WorldWideScience

Sample records for glucan synthase ii

  1. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  2. Molecular size estimation of plasma membrane β-glucan synthase from red beet root

    International Nuclear Information System (INIS)

    Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

    1986-01-01

    Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

  3. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  4. Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

    Science.gov (United States)

    Kuzmanoff, K. M.

    1984-01-01

    In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

  5. Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

    Directory of Open Access Journals (Sweden)

    Reshma Davidson

    Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

  6. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  7. UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity

    International Nuclear Information System (INIS)

    Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.

    1989-01-01

    A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains

  8. Characterization and partial purification of beta-1,3-D-glucan (callose) synthase from barley (Hordeum vulgare) leaves

    DEFF Research Database (Denmark)

    Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.

    1993-01-01

    The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...

  9. Live imaging of β-1,3-glucan synthase FKS-1 in Neurospora crassa hyphae.

    Science.gov (United States)

    Sánchez-León, Eddy; Riquelme, Meritxell

    2015-09-01

    The subcellular localization and dynamics of FKS-1, the putative catalytic subunit of the β-1,3-glucan synthase complex, was analyzed in growing hyphae of Neurospora crassa by live confocal microscopy. GFP-tagged FKS-1 accumulated at the outer layer of the Spitzenkörper (Spk), and at the apical plasma membrane (PM). Fluorescence recovery after photobleaching analysis revealed arrival of FKS-1-containing carriers first at the immediate surroundings of the core region of the Spk, and thereafter to the Spk most outer region. The results obtained here and previous data suggest that FKS-1 is transported to the Spk in macrovesicles. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Identification of UDPG-binding polypeptides and purified (1,3)-β-glucan synthase by photoaffinity labelling with 5-azido-UDPG

    International Nuclear Information System (INIS)

    Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.

    1989-01-01

    The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex

  11. Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast

    NARCIS (Netherlands)

    Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans

    2007-01-01

    The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential

  12. Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Blanton, R.L.

    1992-01-15

    Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.

  13. Transcriptional regulation of fksA, a β-1,3-glucan synthase gene, by the APSES protein StuA during Aspergillus nidulans development.

    Science.gov (United States)

    Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon

    2014-11-01

    The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.

  14. Infection Structure–Specific Expression of β-1,3-Glucan Synthase Is Essential for Pathogenicity of Colletotrichum graminicola and Evasion of β-Glucan–Triggered Immunity in Maize[W

    Science.gov (United States)

    Oliveira-Garcia, Ely; Deising, Holger B.

    2013-01-01

    β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035

  15. Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

    Science.gov (United States)

    Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

  16. β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

    Science.gov (United States)

    Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

    2012-01-01

    ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

  17. Differential Activity of the Oral Glucan Synthase Inhibitor SCY-078 against Wild-Type and Echinocandin-Resistant Strains of Candida Species.

    Science.gov (United States)

    Pfaller, Michael A; Messer, Shawn A; Rhomberg, Paul R; Borroto-Esoda, Katyna; Castanheira, Mariana

    2017-08-01

    SCY-078 (formerly MK-3118) is a novel orally active inhibitor of fungal β-(1,3)-glucan synthase (GS). SCY-078 is a derivative of enfumafungin and is structurally distinct from the echinocandin class of antifungal agents. We evaluated the in vitro activity of this compound against wild-type (WT) and echinocandin-resistant isolates containing mutations in the FKS genes of Candida spp. Against 36 Candida spp. FKS mutants tested, 30 (83.3%) were non-WT to 1 or more echinocandins, and only 9 (25.0%) were non-WT (MIC, >WT-upper limit) to SCY-078. Among C. glabrata isolates carrying FKS alterations, 84.0% were non-WT to the echinocandins versus only 24.0% for SCY-078. In contrast to the echinocandin comparators, the activity of SCY-078 was minimally affected by the presence of FKS mutations, suggesting that this agent is useful in the treatment of Candida infections due to echinocandin-resistant strains. Copyright © 2017 American Society for Microbiology.

  18. The novel oral glucan synthase inhibitor SCY-078 shows in vitro activity against sessile and planktonic Candida spp.

    Science.gov (United States)

    Marcos-Zambrano, Laura Judith; Gómez-Perosanz, Marta; Escribano, Pilar; Bouza, Emilio; Guinea, Jesús

    2017-07-01

    We studied the antifungal activity of SCY-078 (an orally bioavailable 1,3-β -d- glucan synthesis inhibitor), micafungin and fluconazole against the planktonic and sessile forms of 178 Candida and non- Candida isolates causing fungaemia in patients recently admitted to a large European hospital. The in vitro activity of SCY-078, micafungin and fluconazole against the planktonic form of the isolates was assessed using EUCAST EDef 7.3 and CLSI M27-A3. Antibiofilm activity was assessed using the XTT reduction assay. SCY-078 and micafungin showed potent in vitro activity against Candida and non- Candida isolates. The in vitro activity of both drugs was similar, but SYC-078 displayed significantly lower MIC values than micafungin against Candida parapsilosis and non- Candida isolates, whereas micafungin displayed significantly lower MIC values for the remaining species ( P  Candida glabrata , in which the micafungin sessile MIC values were significantly lower ( P  Candida isolates in both sessile and planktonic forms is comparable to that of micafungin. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Characterization of a 1,4-{beta}-D-glucan synthase from Dictyostelium discoideum. Progress report, May 1990--January 1992

    Energy Technology Data Exchange (ETDEWEB)

    Blanton, R.L.

    1992-01-15

    Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.

  20. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  1. Chemical modification as an approach for the identification of UDPG-binding polypeptides of UDPG-glucose: (1,3)-Beta-glucan synthase

    International Nuclear Information System (INIS)

    Mason, T.L.

    1989-01-01

    The lysine-reactive chemical modification reagents uridine diphosphate pyridoxal (UDP-pyridoxal) and formaldehyde (HCHO) were used to identify UDPG-binding polypeptides of UDP-glucose: (1,3)-β-D-glucan synthase (GS) from red beet storage tissue. Complete enzyme inactivation occurred after exposure to micromolar levels of UDP-pyridoxal and millimolar levels of HCHO. Divalent cations (Mg 2+ and Ca 2+ , particularly Ca 2+ ) were required by both for inactivation. Substrate (UDPG) and chelators (EDTA and EGTA) protected plasma membrane GS (PMGS) against UDP-pyridoxal and HCHO inhibition. UDPG protected CHAPS solubilized GS (CSGS) against UDP-pyridoxal inactivation, but not against HCHO. It was concluded that beet GS contains a lysine residue at the UDPG-binding site. When PMGS was directly labeled with UDP[ 3 H]-pyridoxal or [ 14 C]HCHO, random labeling occurred. Therefore, a multi-step labeling procedure was developed. Nonessential lysine residues were first blocked with HCHO while 5 mM UDPG protected the active site lysine. Background labeling was reduced 4-fold. Membranes were recovered by centrifugation and the active site lysine exposed to [ 14 C] HCHO. Major labeled polypeptides were at 200, 76, and 54 kD. Minor polypeptides were seen at 94, 82, 68, 60, and 20-25 kD. CSGS was labeled by a modified multi-step procedure. CSGS was blocked by reaction with UDP-pyridoxal in the presence of UDPG. CSGS was then recovered by product entrapment and labeled with [ 14 C]HCHO. Background labeling was reduced by 8-fold and potential UDPG-binding polypeptides narrowed to 68, 54, 25 and 22 kD

  2. Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

    DEFF Research Database (Denmark)

    Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny

    2007-01-01

    Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

  3. Class II recombinant phosphoribosyl diphosphate synthase from spinach

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B

    2001-01-01

    to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....

  4. Synthesis of cell wall xylans and glucans by golgi membranes

    International Nuclear Information System (INIS)

    Gibeaut, D.M.; Carpita, N.C.

    1989-01-01

    We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus

  5. Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.

  6. Angiotensin II stimulates superoxide production by nitric oxide synthase in thick ascending limbs.

    Science.gov (United States)

    Gonzalez-Vicente, Agustin; Saikumar, Jagannath H; Massey, Katherine J; Hong, Nancy J; Dominici, Fernando P; Carretero, Oscar A; Garvin, Jeffrey L

    2016-02-01

    Angiotensin II (Ang II) causes nitric oxide synthase (NOS) to become a source of superoxide (O2 (-)) via a protein kinase C (PKC)-dependent process in endothelial cells. Ang II stimulates both NO and O2 (-) production in thick ascending limbs. We hypothesized that Ang II causes O2 (-) production by NOS in thick ascending limbs via a PKC-dependent mechanism. NO production was measured in isolated rat thick ascending limbs using DAF-FM, whereas O2 (-) was measured in thick ascending limb suspensions using the lucigenin assay. Consistent stimulation of NO was observed with 1 nmol/L Ang II (P thick ascending limbs via a PKC- and NADPH oxidase-dependent process; and (2) the effect of Ang II is not due to limited substrate. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  7. Structure of the ent-Copalyl Diphosphate Synthase PtmT2 from Streptomyces platensis CB00739, a Bacterial Type II Diterpene Synthase.

    Science.gov (United States)

    Rudolf, Jeffrey D; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben

    2016-08-31

    Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three α-helical domains (αβγ), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (α) and type II TSs (βγ). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtmT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 Å, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg(2+)-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.

  8. Policing starter unit selection of the enterocin type II polyketide synthase by the type II thioesterase EncL.

    Science.gov (United States)

    Kalaitzis, John A; Cheng, Qian; Meluzzi, Dario; Xiang, Longkuan; Izumikawa, Miho; Dorrestein, Pieter C; Moore, Bradley S

    2011-11-15

    Enterocin is an atypical type II polyketide synthase (PKS) product from the marine actinomycete 'Streptomyces maritimus'. The enterocin biosynthesis gene cluster (enc) codes for proteins involved in the assembly and attachment of the rare benzoate primer that initiates polyketide assembly with the addition of seven malonate molecules and culminates in a Favorskii-like rearrangement of the linear poly-β-ketone to give its distinctive non-aromatic, caged core structure. Fundamental to enterocin biosynthesis, which utilizes a single acyl carrier protein (ACP), EncC, for both priming with benzoate and elongating with malonate, involves maintaining the correct balance of acyl-EncC substrates for efficient polyketide assembly. Here, we report the characterization of EncL as a type II thioesterase that functions to edit starter unit (mis)priming of EncC. We performed a series of in vivo mutational studies, heterologous expression experiments, in vitro reconstitution studies, and Fourier-transform mass spectrometry-monitored competitive enzyme assays that together support the proposed selective hydrolase activity of EncL toward misprimed acetyl-ACP over benzoyl-ACP to facilitate benzoyl priming of the enterocin PKS complex. While this system resembles the R1128 PKS that also utilizes an editing thioesterase (ZhuC) to purge acetate molecules from its initiation module ACP in favor of alkylacyl groups, the enterocin system is distinct in its usage of a single ACP for both priming and elongating reactions with different substrates. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Creation of a high-amylose durum wheat through mutagenesis of starch synthase II (SSIIa)

    Science.gov (United States)

    In cereal seeds mutations in one or more starch synthases lead to decreased amylopectin and increased amylose content. Here, the impact of starch synthase IIa (SSIIa or SGP-1) mutations upon durum starch was investigated. A screen of durum accessions identified two lines lacking SGP-A1, the A geno...

  10. A phase I/II trial of beta-(1,3/(1,6 D-glucan in the treatment of patients with advanced malignancies receiving chemotherapy

    Directory of Open Access Journals (Sweden)

    Weitberg Alan B

    2008-09-01

    Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.

  11. Wild-type phosphoribosylpyrophosphate synthase (PRS from Mycobacterium tuberculosis: a bacterial class II PRS?

    Directory of Open Access Journals (Sweden)

    Ardala Breda

    Full Text Available The 5-phospho-α-D-ribose 1-diphosphate (PRPP metabolite plays essential roles in several biosynthetic pathways, including histidine, tryptophan, nucleotides, and, in mycobacteria, cell wall precursors. PRPP is synthesized from α-D-ribose 5-phosphate (R5P and ATP by the Mycobacterium tuberculosis prsA gene product, phosphoribosylpyrophosphate synthase (MtPRS. Here, we report amplification, cloning, expression and purification of wild-type MtPRS. Glutaraldehyde cross-linking results suggest that MtPRS predominates as a hexamer, presenting varied oligomeric states due to distinct ligand binding. MtPRS activity measurements were carried out by a novel coupled continuous spectrophotometric assay. MtPRS enzyme activity could be detected in the absence of P(i. ADP, GDP and UMP inhibit MtPRS activity. Steady-state kinetics results indicate that MtPRS has broad substrate specificity, being able to accept ATP, GTP, CTP, and UTP as diphosphoryl group donors. Fluorescence spectroscopy data suggest that the enzyme mechanism for purine diphosphoryl donors follows a random order of substrate addition, and for pyrimidine diphosphoryl donors follows an ordered mechanism of substrate addition in which R5P binds first to free enzyme. An ordered mechanism for product dissociation is followed by MtPRS, in which PRPP is the first product to be released followed by the nucleoside monophosphate products to yield free enzyme for the next round of catalysis. The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of P(i would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure and allosteric ADP inhibition would place MtPRS in Class I PRSs. Further data are needed to classify MtPRS as belonging to a particular family of PRS proteins. The data here presented should help augment our understanding of MtPRS mode of action. Current efforts are toward experimental structure

  12. Wild-Type Phosphoribosylpyrophosphate Synthase (PRS) from Mycobacterium tuberculosis: A Bacterial Class II PRS?

    Science.gov (United States)

    Breda, Ardala; Martinelli, Leonardo K. B.; Bizarro, Cristiano V.; Rosado, Leonardo A.; Borges, Caroline B.; Santos, Diógenes S.; Basso, Luiz A.

    2012-01-01

    The 5-phospho-α-D-ribose 1-diphosphate (PRPP) metabolite plays essential roles in several biosynthetic pathways, including histidine, tryptophan, nucleotides, and, in mycobacteria, cell wall precursors. PRPP is synthesized from α-D-ribose 5-phosphate (R5P) and ATP by the Mycobacterium tuberculosis prsA gene product, phosphoribosylpyrophosphate synthase (MtPRS). Here, we report amplification, cloning, expression and purification of wild-type MtPRS. Glutaraldehyde cross-linking results suggest that MtPRS predominates as a hexamer, presenting varied oligomeric states due to distinct ligand binding. MtPRS activity measurements were carried out by a novel coupled continuous spectrophotometric assay. MtPRS enzyme activity could be detected in the absence of Pi. ADP, GDP and UMP inhibit MtPRS activity. Steady-state kinetics results indicate that MtPRS has broad substrate specificity, being able to accept ATP, GTP, CTP, and UTP as diphosphoryl group donors. Fluorescence spectroscopy data suggest that the enzyme mechanism for purine diphosphoryl donors follows a random order of substrate addition, and for pyrimidine diphosphoryl donors follows an ordered mechanism of substrate addition in which R5P binds first to free enzyme. An ordered mechanism for product dissociation is followed by MtPRS, in which PRPP is the first product to be released followed by the nucleoside monophosphate products to yield free enzyme for the next round of catalysis. The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of Pi would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure and allosteric ADP inhibition would place MtPRS in Class I PRSs. Further data are needed to classify MtPRS as belonging to a particular family of PRS proteins. The data here presented should help augment our understanding of MtPRS mode of action. Current efforts are toward experimental structure determination of Mt

  13. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

    2002-01-01

    in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

  14. A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.

    Directory of Open Access Journals (Sweden)

    Heather T Taff

    Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.

  15. Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

    Directory of Open Access Journals (Sweden)

    T. Angeline

    2011-01-01

    Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

  16. Two residues determine the product profile of the class II diterpene synthases TPS14 and TPS21 of Tripterygium wilfordii

    DEFF Research Database (Denmark)

    Hansen, Nikolaj Lervad; Nissen, Jakob N.; Hamberger, Björn Robert

    2017-01-01

    residue gave mixed product profiles. Two mutants, TwTPS14:Y265H and TwTPS21:A325V, also produced ent-copalyl diphosphate, highlighting the evolutionary potential of enzymes of this family to drive rapid diversification of plant diterpene biosynthesis through neo-functionalization. Our study contributes......The medicinal plant Tripterygium wilfordii (Celastraceae) contains a pair of class II diterpene synthases (diTPS) of specialized labdane-type metabolism that, despite remarkably close homology, form strikingly different products. TwTPS21 catalyzes bicyclization of the linear C20 precursor......-directed mutagenesis, we generated a panel of six variants, where one, or both positions were exchanged between the enzymes. In coupled heterologous assays with a corresponding class I diTPS, TwTPS2, complete product interchange was observed in variants with both reciprocal mutations, while substitutions of either...

  17. Exploring Protein Interactions on a Minimal Type II Polyketide Synthase Using a Yeast Two-Hybrid System

    Directory of Open Access Journals (Sweden)

    Gaetano Castaldo

    2005-01-01

    Full Text Available Interactions between proteins that form the ’minimal’ type II polyketide synthase in the doxorubicin producing biosynthetic pathway from Streptomyces peucetius were investigated using a yeast two-hybrid system (Y2H. Proteins that function as the so called ’chain length factor’ (DpsB and putative transacylase (DpsD were found to interact with the ketosynthase subunit (DpsA, which can also interact with itself. On the basis of these results we propose a head-to-tail homodimeric structure, which is consistent with previously published in vivo mutagenesis studies. No interactions were found between the acyl-carrier protein (DpsG and any of the other constituents of the complex, however, transient interactions, not detectable using the Y2H system, cannot be discounted and warrant further investigation.

  18. Structure of the ent -Copalyl Diphosphate Synthase PtmT2 from Streptomyces platensis CB00739, a Bacterial Type II Diterpene Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Rudolf, Jeffrey D.; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, Ben

    2016-08-31

    Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three alpha-helical domains (alpha beta gamma), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (alpha) and type II TSs (beta gamma). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtnaT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 angstrom, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg2+-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.

  19. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza

    2016-11-01

    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  20. Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

    Directory of Open Access Journals (Sweden)

    E. Y. Choi

    2016-11-01

    Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.

  1. Beta-glucans and cholesterol

    Czech Academy of Sciences Publication Activity Database

    Šíma, Petr; Vannucci, Luca; Větvička, V.

    2017-01-01

    Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016

  2. Structure and function of α-glucan debranching enzymes

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte

    2016-01-01

    α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....

  3. Angiotensin II-induced hypertension blunts thick ascending limb NO production by reducing NO synthase 3 expression and enhancing threonine 495 phosphorylation.

    Science.gov (United States)

    Ramseyer, Vanesa D; Gonzalez-Vicente, Agustin; Carretero, Oscar A; Garvin, Jeffrey L

    2015-01-15

    Thick ascending limbs reabsorb 30% of the filtered NaCl load. Nitric oxide (NO) produced by NO synthase 3 (NOS3) inhibits NaCl transport by this segment. In contrast, chronic angiotensin II (ANG II) infusion increases net thick ascending limb transport. NOS3 activity is regulated by changes in expression and phosphorylation at threonine 495 (T495) and serine 1177 (S1177), inhibitory and stimulatory sites, respectively. We hypothesized that NO production by thick ascending limbs is impaired by chronic ANG II infusion, due to reduced NOS3 expression, increased phosphorylation of T495, and decreased phosphorylation of S1177. Rats were infused with 200 ng·kg(-1)·min(-1) ANG II or vehicle for 1 and 5 days. ANG II infusion for 5 days decreased NOS3 expression by 40 ± 12% (P thick ascending limbs from ANG II-infused animals [ANG II -0.01 ± 0.06 arbitrary fluorescence units (AFU)/min vs. 0.17 ± 0.02 AFU/min in controls; P thick ascending limbs is impaired due to decreased NOS3 expression and altered phosphorylation. Copyright © 2015 the American Physiological Society.

  4. Plants with elevated levels of glucan

    Energy Technology Data Exchange (ETDEWEB)

    Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

    2018-03-20

    The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

  5. Defining Starch Binding by Glucan Phosphatases

    DEFF Research Database (Denmark)

    Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

    2015-01-01

    Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...

  6. A screening method for β-glucan hydrolase employing Trypan Blue-coupled β-glucan agar plate and β-glucan zymography.

    Science.gov (United States)

    Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick

    2012-06-01

    A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.

  7. Negative regulation by Ser/Thr phosphorylation of HadAB and HadBC dehydratases from Mycobacterium tuberculosis type II fatty acid synthase system.

    Science.gov (United States)

    Slama, Nawel; Leiba, Jade; Eynard, Nathalie; Daffé, Mamadou; Kremer, Laurent; Quémard, Annaïk; Molle, Virginie

    2011-09-02

    The type II fatty acid synthase system of mycobacteria is involved in the biosynthesis of major and essential lipids, mycolic acids, key-factors of Mycobacterium tuberculosis pathogenicity. One reason of the remarkable survival ability of M. tuberculosis in infected hosts is partly related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate synthesis of these lipids in response to environmental changes are unknown. We demonstrate here that HadAB and HadBC dehydratases of this system are phosphorylated by Ser/Thr protein kinases, which negatively affects their enzymatic activity. The phosphorylation of HadAB/BC is growth phase-dependent, suggesting that it represents a mechanism by which mycobacteria might tightly control mycolic acid biosynthesis under non-replicating condition. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Delineating the structural, functional and evolutionary relationships of sucrose phosphate synthase gene family II in wheat and related grasses

    Directory of Open Access Journals (Sweden)

    Khalil Zaynali

    2010-06-01

    Full Text Available Abstract Background Sucrose phosphate synthase (SPS is an important component of the plant sucrose biosynthesis pathway. In the monocotyledonous Poaceae, five SPS genes have been identified. Here we present a detailed analysis of the wheat SPSII family in wheat. A set of homoeologue-specific primers was developed in order to permit both the detection of sequence variation, and the dissection of the individual contribution of each homoeologue to the global expression of SPSII. Results The expression in bread wheat over the course of development of various sucrose biosynthesis genes monitored on an Affymetrix array showed that the SPS genes were regulated over time and space. SPSII homoeologue-specific assays were used to show that the three homoeologues contributed differentially to the global expression of SPSII. Genetic mapping placed the set of homoeoloci on the short arms of the homoeologous group 3 chromosomes. A resequencing of the A and B genome copies allowed the detection of four haplotypes at each locus. The 3B copy includes an unspliced intron. A comparison of the sequences of the wheat SPSII orthologues present in the diploid progenitors einkorn, goatgrass and Triticum speltoides, as well as in the more distantly related species barley, rice, sorghum and purple false brome demonstrated that intronic sequence was less well conserved than exonic. Comparative sequence and phylogenetic analysis of SPSII gene showed that false purple brome was more similar to Triticeae than to rice. Wheat - rice synteny was found to be perturbed at the SPS region. Conclusion The homoeologue-specific assays will be suitable to derive associations between SPS functionality and key phenotypic traits. The amplicon sequences derived from the homoeologue-specific primers are informative regarding the evolution of SPSII in a polyploid context.

  9. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  10. Glucan: mechanisms involved in its radioprotective effect

    International Nuclear Information System (INIS)

    Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.

    1987-01-01

    It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested

  11. Implications of secondary structure prediction and amino acid sequence comparison of class I and class II phosphoribosyl diphosphate synthases on catalysis, regulation, and quaternary structure

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B

    2001-01-01

    Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...... is consistent with a homotrimer. Secondary structure prediction shows that spinach PRPP synthase isozyme 4 has a general folding similar to that of Bacillus subtilis class I PRPP synthase, for which the three-dimensional structure has been solved, as the position and extent of helices and beta-sheets of the two...... in the spinach enzyme. In contrast, residues of the active site of B. subtilis PRPP synthase show extensive conservation in spinach PRPP synthase isozyme 4....

  12. Sequence analysis and structure prediction of type II Pseudomonas sp. USM 4–55 PHA synthase and an insight into its catalytic mechanism

    Directory of Open Access Journals (Sweden)

    Ahmad Khairudin Nurul

    2006-11-01

    Full Text Available Abstract Background Polyhydroxyalkanoates (PHA, are biodegradable polyesters derived from many microorganisms such as the pseudomonads. These polyesters are in great demand especially in the packaging industries, the medical line as well as the paint industries. The enzyme responsible in catalyzing the formation of PHA is PHA synthase. Due to the limited structural information, its functional properties including catalysis are lacking. Therefore, this study seeks to investigate the structural properties as well as its catalytic mechanism by predicting the three-dimensional (3D model of the Type II Pseudomonas sp. USM 4–55 PHA synthase 1 (PhaC1P.sp USM 4–55. Results Sequence analysis demonstrated that PhaC1P.sp USM 4–55 lacked similarity with all known structures in databases. PSI-BLAST and HMM Superfamily analyses demonstrated that this enzyme belongs to the alpha/beta hydrolase fold family. Threading approach revealed that the most suitable template to use was the human gastric lipase (PDB ID: 1HLG. The superimposition of the predicted PhaC1P.sp USM 4–55 model with 1HLG covering 86.2% of the backbone atoms showed an RMSD of 1.15 Å. The catalytic residues comprising of Cys296, Asp451 and His479 were found to be conserved and located adjacent to each other. In addition to this, an extension to the catalytic mechanism was also proposed whereby two tetrahedral intermediates were believed to form during the PHA biosynthesis. These transition state intermediates were further postulated to be stabilized by the formation of oxyanion holes. Based on the sequence analysis and the deduced model, Ser297 was postulated to contribute to the formation of the oxyanion hole. Conclusion The 3D model of the core region of PhaC1P.sp USM 4–55 from residue 267 to residue 484 was developed using computational techniques and the locations of the catalytic residues were identified. Results from this study for the first time highlighted Ser297 potentially

  13. Threonine phosphorylation of rat liver glycogen synthase

    International Nuclear Information System (INIS)

    Arino, J.; Arro, M.; Guinovart, J.J.

    1985-01-01

    32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase

  14. Calcium/calmodulin-dependent kinase II and nitric oxide synthase 1-dependent modulation of ryanodine receptors during β-adrenergic stimulation is restricted to the dyadic cleft.

    Science.gov (United States)

    Dries, Eef; Santiago, Demetrio J; Johnson, Daniel M; Gilbert, Guillaume; Holemans, Patricia; Korte, Sanne M; Roderick, H Llewelyn; Sipido, Karin R

    2016-10-15

    The dyadic cleft, where coupled ryanodine receptors (RyRs) reside, is thought to serve as a microdomain for local signalling, as supported by distinct modulation of coupled RyRs dependent on Ca 2+ /calmodulin-dependent kinase II (CaMKII) activation during high-frequency stimulation. Sympathetic stimulation through β-adrenergic receptors activates an integrated signalling cascade, enhancing Ca 2+ cycling and is at least partially mediated through CaMKII. Here we report that CaMKII activation during β-adrenergic signalling is restricted to the dyadic cleft, where it enhances activity of coupled RyRs thereby contributing to the increase in diastolic events. Nitric oxide synthase 1 equally participates in the local modulation of coupled RyRs. In contrast, the increase in the Ca 2+ content of the sarcoplasmic reticulum and related increase in the amplitude of the Ca 2+ transient are primarily protein kinase A-dependent. The present data extend the concept of microdomain signalling in the dyadic cleft and give perspectives for selective modulation of RyR subpopulations and diastolic events. In cardiac myocytes, β-adrenergic stimulation enhances Ca 2+ cycling through an integrated signalling cascade modulating L-type Ca 2+ channels (LTCCs), phospholamban and ryanodine receptors (RyRs). Ca 2+ /calmodulin-dependent kinase II (CaMKII) and nitric oxide synthase 1 (NOS1) are proposed as prime mediators for increasing RyR open probability. We investigate whether this pathway is confined to the high Ca 2+ microdomain of the dyadic cleft and thus to coupled RyRs. Pig ventricular myocytes are studied under whole-cell voltage-clamp and confocal line-scan imaging with Fluo-4 as a [Ca 2+ ] i indicator. Following conditioning depolarizing pulses, spontaneous RyR activity is recorded as Ca 2+ sparks, which are assigned to coupled and non-coupled RyR clusters. Isoproterenol (ISO) (10 nm) increases Ca 2+ spark frequency in both populations of RyRs. However, CaMKII inhibition reduces

  15. Valsartan regulates the interaction of angiotensin II type 1 receptor and endothelial nitric oxide synthase via Src/PI3K/Akt signalling.

    Science.gov (United States)

    Su, Kuo-Hui; Tsai, Jin-Yi; Kou, Yu Ru; Chiang, An-Na; Hsiao, Sheng-Huang; Wu, Yuh-Lin; Hou, Hsin-Han; Pan, Ching-Chian; Shyue, Song-Kun; Lee, Tzong-Shyuan

    2009-06-01

    Valsartan, a selective angiotensin II type 1 receptor (AT1R) blocker, has beneficial effects in the cardiovascular system in part by its increase of nitric oxide (NO) bioavailability, yet the mechanisms are unclear. We investigated the molecular mechanisms underlying this effect in endothelial cells (ECs). NO production was examined by Griess reagent assay, DAF-2 DA fluorescence staining and cGMP ELISA kits. Protein interaction was determined by western blotting and immunoprecipitation. Treating bovine or human aortic ECs with valsartan increased NO production, as evidenced by elevated level of stable NO metabolites and intracellular cGMP. Valsartan increased the phosphorylation but not the protein level of endothelial NO synthase (eNOS). Inhibition of phosphoinositide-3 kinase (PI3K)/Akt and Src pathways by specific inhibitors suppressed valsartan-induced NO release. In addition, valsartan increased the tyrosine residue phosphorylation of AT1R, which was attenuated by inhibition of Src but not PI3K activities. Valsartan also suppressed the interaction of eNOS and AT1R, which was blocked by Src or PI3K inhibition. Valsartan-induced NO production in ECs is mediated through Src/PI3K/Akt-dependent phosphorylation of eNOS. Valsartan-induced AT1R phosphorylation depends on Src but not PI3K, whereas valsartan-induced suppression of AT1R-eNOS interaction depends on Src/PI3K/Akt signalling. These results indicate a novel vasoprotective mechanism of valsartan in upregulating NO production in ECs.

  16. Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

    Science.gov (United States)

    Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

    1990-04-01

    Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

  17. β-1,3-glucan in developing cotton fibers

    International Nuclear Information System (INIS)

    Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.

    1979-01-01

    Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis

  18. (1,3;1,4)-β-Glucan Biosynthesis by the CSLF6 Enzyme: Position and Flexibility of Catalytic Residues Influence Product Fine Structure.

    Science.gov (United States)

    Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B

    2016-04-05

    Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.

  19. (1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.

    Science.gov (United States)

    Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin

    2017-03-01

    A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.

  20. Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

    Science.gov (United States)

    Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

  1. Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis

    DEFF Research Database (Denmark)

    Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

    2016-01-01

    was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...

  2. Recent insight in α-glucan metabolism in probiotic bacteria

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm

    2014-01-01

    α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...

  3. Incorporation of UDPglucose into cell wall glucans and lipids by intact cotton fibers

    International Nuclear Information System (INIS)

    Dugger, W.M.; Palmer, R.L.

    1986-01-01

    The [ 14 C] moiety from [ 3 H]UDP[ 14 C]glucose was incorporated by intact cotton fibers into hot water soluble, acetic-nitric reagent soluble and insoluble components, and chloroform-methanol soluble lipids; the [ 3 H]UDP moiety was not incorporated. The 3 H-label can be exchanged rapidly with unlabeled substrate in a chase experiment. The cell wall apparent free space of cotton fibers was in the order of 30 picomoles per milligram of dry fibers; 25 picomoles per milligram easily exchanged and about 5 picomoles per milligram more tightly adsorbed. At 50 micromolar UDPglucose, 70% of the [ 14 C]glucose was found in the lipid fraction after both a short labeling period and chase. The percent of [ 14 C]glucose incorporated into total glucan increased within a 30-minute chase period. The data supports the concept that glucan synthesis, including cellulose, as well as the synthesis of steryl glucosides, acetylated steryl glucosides, and glucosyl-phosphoryl-polyprenol from externally supplied UDPglucose occurs at the plasma membrane-cell wall interface. The synthase enzymes for such synthesis must be part of this interfacial membrane system

  4. Glucan synthesis in the genus Lactobacillus: Isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

    NARCIS (Netherlands)

    Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2004-01-01

    Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

  5. Glucan synthesis in the genus Lactobacillus : isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

    NARCIS (Netherlands)

    Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2004-01-01

    Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

  6. Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.

    Science.gov (United States)

    Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A

    2018-05-01

    Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.

  7. Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.

    Science.gov (United States)

    Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza

    2008-03-20

    Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).

  8. Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).

    Science.gov (United States)

    Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio

    2008-01-01

    Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.

  9. Disruption of ATCSLD5 results in reduced growth, reduced xylan and homogalacturonan synthase activity and altered xylan occurrence in Arabidopsis

    DEFF Research Database (Denmark)

    Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper

    2007-01-01

    Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...

  10. Determinants of house dust, endotoxin, and β-(1→3)-d-glucan in homes of Danish children

    DEFF Research Database (Denmark)

    Holst, Gitte Juel; Høst, Arne; Doekes, G

    2015-01-01

    Little is known about the geographic variation and determinants of bacterial endotoxin and β -(1,3)-d-glucan in Danish house dust. In a population of 317 children, we: (i) described loads and concentrations of floor dust, endotoxin, and β-(1→3)-d-glucan and (ii) their correlations and (iii......) assessed their determinants; (iv) Finally, we compared our findings with previous European studies. Bedroom floor dust was analyzed for endotoxin content by the kinetic limulus amoebocyte lysate assay and for β-(1→3)-d-glucan by the inhibition enzyme immunoassay. The parents answered questions regarding...... potential determinants. We found: geometric means (geometric standard deviations) 186 mg/m(2) (4.3) for dust; 5.46 × 10(3) EU/m(2) (8.0) and 31.1 × 10(3) EU/g (2.6) for endotoxin; and 142 μg/m(2) (14.3) and 0.71 × 10(3) μg/g (7.3) for β-(1→3)-d-glucan. High correlations (r > 0.75) were found between floor...

  11. Proteomic profiling of cellulase-aid-extracted membrane proteins for functional identification of cellulose synthase complexes and their potential associated- components in cotton fibers.

    Science.gov (United States)

    Li, Ao; Wang, Ruyi; Li, Xianliang; Liu, Mingyong; Fan, Jian; Guo, Kai; Luo, Bing; Chen, Tingting; Feng, Shengqiu; Wang, Yanting; Wang, Bingrui; Peng, Liangcai; Xia, Tao

    2016-05-19

    Cotton fibers are an excellent model for understanding of cellulose biosynthesis in higher plants. In this study, we determined a high cellulose biosynthesis activity in vitro by optimizing biochemical reaction conditions in cotton fibers. By adding a commercial cellulase enzyme into fibers extraction process, we extracted markedly higher levels of GhCESA1 and GhCESA8 proteins and observed an increase in β-1,4-glucan and β-1,3-glucan products in vitro. LC-MS/MS analysis of anti-GhCESA8-immunoprecipitated proteins showed that 19 proteins could be found in three independent experiments including four CESAs (GhCESA1,2,7,8), five well-known non-CESA proteins, one callose synthase (CALS) and nine novel proteins. Notably, upon the cellulase treatment, four CESAs, one CALS and four novel proteins were measured at relatively higher levels by calculating total peptide counts and distinct peptide numbers, indicating that the cellulase-aid-extracted proteins most likely contribute to the increase in β-glucan products in vitro. These results suggest that the cellulase treatment may aid to release active cellulose synthases complexes from growing glucan chains and make them more amenable to extraction. To our knowledge, it is the first time report about the functional identification of the potential proteins that were associated with plant cellulose and callose synthases complexes by using the cellulase-aided protein extraction.

  12. Various roles of beta-glucan in invertebrates

    Czech Academy of Sciences Publication Activity Database

    Větvička, V.; Šíma, Petr

    2017-01-01

    Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016

  13. Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

    Science.gov (United States)

    Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

    2017-07-01

    We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  14. Preparation, characterization, and biological properties of β-glucans

    Directory of Open Access Journals (Sweden)

    Sandeep Rahar

    2011-01-01

    Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

  15. Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia: Preliminary Findings from the Study on Three Patients from India

    Directory of Open Access Journals (Sweden)

    Vidyasagar Devaprasad Dedeepiya

    2012-01-01

    Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.

  16. Evaluation on prebiotic properties of β-glucan and oligo-β-glucan from mushrooms by human fecal microbiota in fecal batch culture

    Directory of Open Access Journals (Sweden)

    Chiraphon Chaikliang

    2015-11-01

    Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of

  17. Cellulose synthases: new insights from crystallography and modeling.

    Science.gov (United States)

    Slabaugh, Erin; Davis, Jonathan K; Haigler, Candace H; Yingling, Yaroslava G; Zimmer, Jochen

    2014-02-01

    Detailed information about the structure and biochemical mechanisms of cellulose synthase (CelS) proteins remained elusive until a complex containing the catalytic subunit (BcsA) of CelS from Rhodobacter sphaeroides was crystalized. Additionally, a 3D structure of most of the cytosolic domain of a plant CelS (GhCESA1 from cotton, Gossypium hirsutum) was produced by computational modeling. This predicted structure contributes to our understanding of how plant CelS proteins may be similar and different as compared with BcsA. In this review, we highlight how these structures impact our understanding of the synthesis of cellulose and other extracellular polysaccharides. We show how the structures can be used to generate hypotheses for experiments testing mechanisms of glucan synthesis and translocation in plant CelS. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome

    Directory of Open Access Journals (Sweden)

    D. El Khoury

    2012-01-01

    Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.

  19. Contribution of granule bound starch synthase in kernel modification ...

    African Journals Online (AJOL)

    The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...

  20. Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.

    1999-01-01

    β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are

  1. Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation

    NARCIS (Netherlands)

    Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.

    2015-01-01

    β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the

  2. An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.

    NARCIS (Netherlands)

    Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.

    2004-01-01

    (1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method

  3. Extracellular Protein Kinase A Modulates Intracellular Calcium/Calmodulin-Dependent Protein Kinase II, Nitric Oxide Synthase, and the Glutamate-Nitric Oxide-cGMP Pathway in Cerebellum. Differential Effects in Hyperammonemia.

    Science.gov (United States)

    Cabrera-Pastor, Andrea; Llansola, Marta; Felipo, Vicente

    2016-12-21

    Extracellular protein kinases, including cAMP-dependent protein kinase (PKA), modulate neuronal functions including N-methyl-d-aspartate (NMDA) receptor-dependent long-term potentiation. NMDA receptor activation increases calcium, which binds to calmodulin and activates nitric oxide synthase (NOS), increasing nitric oxide (NO), which activates guanylate cyclase, increasing cGMP, which is released to the extracellular fluid, allowing analysis of this glutamate-NO-cGMP pathway in vivo by microdialysis. The function of this pathway is impaired in hyperammonemic rats. The aims of this work were to assess (1) whether the glutamate-NO-cGMP pathway is modulated in cerebellum in vivo by an extracellular PKA, (2) the role of phosphorylation and activity of calcium/calmodulin-dependent protein kinase II (CaMKII) and NOS in the pathway modulation by extracellular PKA, and (3) whether the effects are different in hyperammonemic and control rats. The pathway was analyzed by in vivo microdialysis. The role of extracellular PKA was analyzed by inhibiting it with a membrane-impermeable inhibitor. The mechanisms involved were analyzed in freshly isolated cerebellar slices from control and hyperammonemic rats. In control rats, inhibiting extracellular PKA reduces the glutamate-NO-cGMP pathway function in vivo. This is due to reduction of CaMKII phosphorylation and activity, which reduces NOS phosphorylation at Ser1417 and NOS activity, resulting in reduced guanylate cyclase activation and cGMP formation. In hyperammonemic rats, under basal conditions, CaMKII phosphorylation and activity are increased, increasing NOS phosphorylation at Ser847, which reduces NOS activity, guanylate cyclase activation, and cGMP. Inhibiting extracellular PKA in hyperammonemic rats normalizes CaMKII phosphorylation and activity, NOS phosphorylation, NOS activity, and cGMP, restoring normal function of the pathway.

  4. Far-infrared radiation acutely increases nitric oxide production by increasing Ca(2+) mobilization and Ca(2+)/calmodulin-dependent protein kinase II-mediated phosphorylation of endothelial nitric oxide synthase at serine 1179.

    Science.gov (United States)

    Park, Jung-Hyun; Lee, Sangmi; Cho, Du-Hyong; Park, Young Mi; Kang, Duk-Hee; Jo, Inho

    2013-07-12

    Repeated thermal therapy manifested by far-infrared (FIR) radiation improves vascular function in both patients and mouse model with coronary heart disease, but its underlying mechanism is not fully understood. Using FIR as a thermal therapy agent, we investigate the molecular mechanism of its effect on endothelial nitric oxide synthase (eNOS) activity and NO production. FIR increased the phosphorylation of eNOS at serine 1179 (eNOS-Ser(1179)) in a time-dependent manner (up to 40min of FIR radiation) in bovine aortic endothelial cells (BAEC) without alterations in eNOS expression. This increase was accompanied by increases in NO production and intracellular Ca(2+) levels. Treatment with KN-93, a selective inhibitor of Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) and H-89, a protein kinase A inhibitor, inhibited FIR radiation-stimulated eNOS-Ser(1179) phosphorylation. FIR radiation itself also increased the temperature of culture medium. As transient receptors potential vanilloid (TRPV) ion channels are known to be temperature-sensitive calcium channels, we explore whether TRPV channels mediate these observed effects. Reverse transcription-PCR assay revealed two TRPV isoforms in BAEC, TRPV2 and TRPV4. Although ruthenium red, a pan-TRPV inhibitor, completely reversed the observed effect of FIR radiation, a partial attenuation (∼20%) was found in cells treated with Tranilast, TRPV2 inhibitor. However, ectopic expression of siRNA of TRPV2 showed no significant alteration in FIR radiation-stimulated eNOS-Ser(1179) phosphorylation. This study suggests that FIR radiation increases NO production via increasing CaMKII-mediated eNOS-Ser(1179) phosphorylation but TRPV channels may not be involved in this pathway. Our results may provide the molecular mechanism by which FIR radiation improves endothelial function. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Suppressing effects of glucan on micronuclei induced by Co60 in mice

    International Nuclear Information System (INIS)

    Chorvatovicova, D.

    1991-01-01

    The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de

  6. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Sharon Avni

    2017-07-01

    Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

  7. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey

    2016-05-10

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  8. Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan

    Directory of Open Access Journals (Sweden)

    JD Biller-Takahashi

    Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.

  9. β-Glucans: Relationships between Modification, Conformation and Functional Activities

    Directory of Open Access Journals (Sweden)

    Qiang Wang

    2017-02-01

    Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.

  10. Long-lived effects of administering β-glucans

    NARCIS (Netherlands)

    Petit, Jules; Wiegertjes, Geert F.

    2016-01-01

    Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a

  11. Immunostimulatory properties and antitumor activities of glucans (Review)

    Czech Academy of Sciences Publication Activity Database

    Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.

    2013-01-01

    Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013

  12. Towards a more versatile alpha-glucan biosynthesis in plants

    NARCIS (Netherlands)

    Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.

    2003-01-01

    Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated

  13. Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri

    Science.gov (United States)

    Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...

  14. Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2010-07-01

    In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.

  15. Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

    International Nuclear Information System (INIS)

    Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon

    2010-01-01

    In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity

  16. Glycogen synthase activation by sugars in isolated hepatocytes.

    Science.gov (United States)

    Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J

    1988-07-01

    We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.

  17. Enzymology and Molecular Biology of Cell Wall Biosynthesis. Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Dr. Peter M. Ray

    2000-04-01

    The following aspects of enzymology of cell wall synthesis were pursued under this cited grant: (1) Isolation of plasma membrane-localized glucan synthase II (GS-II) of pea; (2) Cloning of genes for possible plant GS-II components; (3) Golgi glucan synthase-I (GS-I); and (4) Golgi reversibly glycosylated protein 1 (RGP1).

  18. Far-infrared radiation acutely increases nitric oxide production by increasing Ca2+ mobilization and Ca2+/calmodulin-dependent protein kinase II-mediated phosphorylation of endothelial nitric oxide synthase at serine 1179

    International Nuclear Information System (INIS)

    Park, Jung-Hyun; Lee, Sangmi; Cho, Du-Hyong; Park, Young Mi; Kang, Duk-Hee; Jo, Inho

    2013-01-01

    Highlights: •Far-infrared (FIR) radiation increases eNOS-Ser 1179 phosphorylation and NO production in BAEC. •CaMKII and PKA mediate FIR-stimulated increases in eNOS-Ser 1179 phosphorylation. •FIR increases intracellular Ca 2+ levels. •Thermo-sensitive TRPV Ca 2+ channels are unlikely to be involved in the FIR-mediated eNOS-Ser 1179 phosphorylation pathway. -- Abstract: Repeated thermal therapy manifested by far-infrared (FIR) radiation improves vascular function in both patients and mouse model with coronary heart disease, but its underlying mechanism is not fully understood. Using FIR as a thermal therapy agent, we investigate the molecular mechanism of its effect on endothelial nitric oxide synthase (eNOS) activity and NO production. FIR increased the phosphorylation of eNOS at serine 1179 (eNOS-Ser 1179 ) in a time-dependent manner (up to 40 min of FIR radiation) in bovine aortic endothelial cells (BAEC) without alterations in eNOS expression. This increase was accompanied by increases in NO production and intracellular Ca 2+ levels. Treatment with KN-93, a selective inhibitor of Ca 2+ /calmodulin-dependent protein kinase II (CaMKII) and H-89, a protein kinase A inhibitor, inhibited FIR radiation-stimulated eNOS-Ser 1179 phosphorylation. FIR radiation itself also increased the temperature of culture medium. As transient receptors potential vanilloid (TRPV) ion channels are known to be temperature-sensitive calcium channels, we explore whether TRPV channels mediate these observed effects. Reverse transcription-PCR assay revealed two TRPV isoforms in BAEC, TRPV2 and TRPV4. Although ruthenium red, a pan-TRPV inhibitor, completely reversed the observed effect of FIR radiation, a partial attenuation (∼20%) was found in cells treated with Tranilast, TRPV2 inhibitor. However, ectopic expression of siRNA of TRPV2 showed no significant alteration in FIR radiation-stimulated eNOS-Ser 1179 phosphorylation. This study suggests that FIR radiation increases NO

  19. Far-infrared radiation acutely increases nitric oxide production by increasing Ca{sup 2+} mobilization and Ca{sup 2+}/calmodulin-dependent protein kinase II-mediated phosphorylation of endothelial nitric oxide synthase at serine 1179

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jung-Hyun; Lee, Sangmi [Department of Molecular Medicine and Ewha Medical Research Institute, Ewha Womans University Medical School, Seoul 158-710 (Korea, Republic of); Cho, Du-Hyong [Department of Neuroscience, School of Medicine, Konkuk University, Seoul 143-701 (Korea, Republic of); Park, Young Mi [Department of Molecular Medicine and Ewha Medical Research Institute, Ewha Womans University Medical School, Seoul 158-710 (Korea, Republic of); Kang, Duk-Hee [Division of Nephrology, Department of Internal Medicine, Ewha Womans University Medical School, Seoul 158-710 (Korea, Republic of); Jo, Inho, E-mail: inhojo@ewha.ac.kr [Department of Molecular Medicine and Ewha Medical Research Institute, Ewha Womans University Medical School, Seoul 158-710 (Korea, Republic of)

    2013-07-12

    Highlights: •Far-infrared (FIR) radiation increases eNOS-Ser{sup 1179} phosphorylation and NO production in BAEC. •CaMKII and PKA mediate FIR-stimulated increases in eNOS-Ser{sup 1179} phosphorylation. •FIR increases intracellular Ca{sup 2+} levels. •Thermo-sensitive TRPV Ca{sup 2+} channels are unlikely to be involved in the FIR-mediated eNOS-Ser{sup 1179} phosphorylation pathway. -- Abstract: Repeated thermal therapy manifested by far-infrared (FIR) radiation improves vascular function in both patients and mouse model with coronary heart disease, but its underlying mechanism is not fully understood. Using FIR as a thermal therapy agent, we investigate the molecular mechanism of its effect on endothelial nitric oxide synthase (eNOS) activity and NO production. FIR increased the phosphorylation of eNOS at serine 1179 (eNOS-Ser{sup 1179}) in a time-dependent manner (up to 40 min of FIR radiation) in bovine aortic endothelial cells (BAEC) without alterations in eNOS expression. This increase was accompanied by increases in NO production and intracellular Ca{sup 2+} levels. Treatment with KN-93, a selective inhibitor of Ca{sup 2+}/calmodulin-dependent protein kinase II (CaMKII) and H-89, a protein kinase A inhibitor, inhibited FIR radiation-stimulated eNOS-Ser{sup 1179} phosphorylation. FIR radiation itself also increased the temperature of culture medium. As transient receptors potential vanilloid (TRPV) ion channels are known to be temperature-sensitive calcium channels, we explore whether TRPV channels mediate these observed effects. Reverse transcription-PCR assay revealed two TRPV isoforms in BAEC, TRPV2 and TRPV4. Although ruthenium red, a pan-TRPV inhibitor, completely reversed the observed effect of FIR radiation, a partial attenuation (∼20%) was found in cells treated with Tranilast, TRPV2 inhibitor. However, ectopic expression of siRNA of TRPV2 showed no significant alteration in FIR radiation-stimulated eNOS-Ser{sup 1179} phosphorylation. This

  20. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  1. Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice

    Energy Technology Data Exchange (ETDEWEB)

    Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)

    1991-10-01

    The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).

  2. Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods

    Directory of Open Access Journals (Sweden)

    Vesna Zechner-Krpan

    2010-01-01

    Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.

  3. Studies on the Active Site of Deacetoxycephalosporin C Synthase

    NARCIS (Netherlands)

    Lloyd, Matthew D.; Lee, Hwei-Jen; Harlos, Karl; Zhang, Zhi-Hong; Baldwin, Jack E.; Schofield, Christopher J.; Charnock, John M.; Garner, C. David; Hara, Takane; Terwisscha van Scheltinga, Anke C.; Valegård, Karin; Viklund, Jenny A.C.; Hajdu, Janos; Andersson, Inger; Danielsson, Åke; Bhikhabhai, Rama

    1999-01-01

    The Fe(II) and 2-oxoglutarate-dependent dioxygenase deacetoxycephalosporin C synthase (DAOCS) from Streptomyces clavuligerus was expressed at ca 25% of total soluble protein in Escherichia coli and purified by an efficient large-scale procedure. Purified protein catalysed the conversions of

  4. Glucan Particles for Macrophage Targeted Delivery of Nanoparticles

    Directory of Open Access Journals (Sweden)

    Ernesto R. Soto

    2012-01-01

    Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.

  5. Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

    Science.gov (United States)

    Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

    2015-07-20

    Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

    Directory of Open Access Journals (Sweden)

    Akira Yoshimi

    2017-11-01

    Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

  7. Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

    Science.gov (United States)

    Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

    2017-07-28

    The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

  8. β-glucan extract from oat bran and its industrial importance

    Science.gov (United States)

    Ibrahim, M. N. G.; Selezneva, I. S.

    2017-09-01

    The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

  9. 6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

    Science.gov (United States)

    Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

    2016-02-12

    With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

  10. Characterization of cereal β-glucan extracts from oat and barley and quantification of proteinaceous matter.

    Directory of Open Access Journals (Sweden)

    Claudia Zielke

    Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.

  11. Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia

    International Nuclear Information System (INIS)

    Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu

    2013-01-01

    Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)

  12. Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults

    DEFF Research Database (Denmark)

    Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe

    2013-01-01

    for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...

  13. Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

    Science.gov (United States)

    Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

    2009-07-01

    β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

  14. Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

    International Nuclear Information System (INIS)

    Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

    2009-01-01

    β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

  15. The structure of cell wall alpha-glucan from fission yeast

    NARCIS (Netherlands)

    Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.

    2005-01-01

    Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

  16. The structure of cell wall alpha-glucan from fission yeast.

    NARCIS (Netherlands)

    Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.

    2005-01-01

    Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

  17. Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.

    Science.gov (United States)

    Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G

    1992-01-01

    The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.

  18. Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

    DEFF Research Database (Denmark)

    Mikkelsen, Mette Skau

    -functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...

  19. Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)

    DEFF Research Database (Denmark)

    Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

    β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

  20. Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)

    DEFF Research Database (Denmark)

    Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

    β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

  1. Beta Glucan Production from Two Strains of Agrobacterium sp in Medium Containing of Molases and Uracil Combine

    Directory of Open Access Journals (Sweden)

    KUSMIATI

    2007-04-01

    Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both

  2. Study on the immuno stimulation of radiation degraded β-glucan in swiss mice

    International Nuclear Information System (INIS)

    Nguyen Thanh Long; Le Quang Luan

    2015-01-01

    The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)

  3. The biological activities of (1,3)-(1,6)-{beta}-d-glucan and porous electrospun PLGA membranes containing {beta}-glucan in human dermal fibroblasts and adipose tissue-derived stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)

    2010-08-01

    In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.

  4. Phytochelatin synthase activity as a marker of metal pollution

    Energy Technology Data Exchange (ETDEWEB)

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Adam, Vojtech [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic); Zehnalek, Josef; Beklova, Miroslava [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Kizek, Rene, E-mail: kizek@sci.muni.cz [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic)

    2011-08-30

    Highlights: {yields} New tool for determination of phytochelatin synthase activity. {yields} The optimization of experimental condition for determination of the enzyme activity. {yields} First evaluation of K{sub m} for the enzyme. {yields} The effects of cadmium (II) not only on the activity of the enzyme but also on K{sub m}. -- Abstract: The synthesis of phytochelatins is catalyzed by {gamma}-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO{sub 3}){sub 2} for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 {sup o}C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K{sub m} for PCS was estimated as 2.3 mM.

  5. Phytochelatin synthase activity as a marker of metal pollution

    International Nuclear Information System (INIS)

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina; Adam, Vojtech; Zehnalek, Josef; Beklova, Miroslava; Kizek, Rene

    2011-01-01

    Highlights: → New tool for determination of phytochelatin synthase activity. → The optimization of experimental condition for determination of the enzyme activity. → First evaluation of K m for the enzyme. → The effects of cadmium (II) not only on the activity of the enzyme but also on K m . -- Abstract: The synthesis of phytochelatins is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO 3 ) 2 for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 o C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K m for PCS was estimated as 2.3 mM.

  6. Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

    Science.gov (United States)

    Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

    2009-10-14

    To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

  7. Effects of gamma irradiation on the physical and structural properties of β-glucan

    International Nuclear Information System (INIS)

    Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon

    2008-01-01

    This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility

  8. Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

    Science.gov (United States)

    Singh, Mukti; Kim, Sanghoon; Liu, Sean X

    2012-08-01

    Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

  9. Brucella cyclic β-1,2-glucan plays a critical role in the induction of splenomegaly in mice.

    Directory of Open Access Journals (Sweden)

    Mara S Roset

    Full Text Available Brucella, the etiological agent of animal and human brucellosis, is a bacterium with the capacity to modulate the inflammatory response. Cyclic β-1,2-glucan (CβG is a virulence factor key for the pathogenesis of Brucella as it is involved in the intracellular life cycle of the bacteria. Using comparative studies with different CβG mutants of Brucella, cgs (CβG synthase, cgt (CβG transporter and cgm (CβG modifier, we have identified different roles for this polysaccharide in Brucella. While anionic CβG is required for bacterial growth in low osmolarity conditions, the sole requirement for a successful Brucella interaction with mammalian host is its transport to periplasmic space. Our results uncover a new role for CβG in promoting splenomegaly in mice. We showed that CβG-dependent spleen inflammation is the consequence of massive cell recruitment (monocytes, dendritics cells and neutrophils due to the induction of pro-inflammatory cytokines such as IL-12 and TNF-α and also that the reduced splenomegaly response observed with the cgs mutant is not the consequence of changes in expression levels of the characterized Brucella PAMPs LPS, flagellin or OMP16/19. Complementation of cgs mutant with purified CβG increased significantly spleen inflammation response suggesting a direct role for this polysaccharide.

  10. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2017-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  11. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  12. Overlapping functions of the starch synthases SSII and SSIII in amylopectin biosynthesis in Arabidopsis

    Directory of Open Access Journals (Sweden)

    D'Hulst Christophe

    2008-09-01

    Full Text Available Abstract Background The biochemical mechanisms that determine the molecular architecture of amylopectin are central in plant biology because they allow long-term storage of reduced carbon. Amylopectin structure imparts the ability to form semi-crystalline starch granules, which in turn provides its glucose storage function. The enzymatic steps of amylopectin biosynthesis resemble those of the soluble polymer glycogen, however, the reasons for amylopectin's architectural distinctions are not clearly understood. The multiplicity of starch biosynthetic enzymes conserved in plants likely is involved. For example, amylopectin chain elongation in plants involves five conserved classes of starch synthase (SS, whereas glycogen biosynthesis typically requires only one class of glycogen synthase. Results Null mutations were characterized in AtSS2, which codes for SSII, and mutant lines were compared to lines lacking SSIII and to an Atss2, Atss3 double mutant. Loss of SSII did not affect growth rate or starch quantity, but caused increased amylose/amylopectin ratio, increased total amylose, and deficiency in amylopectin chains with degree of polymerization (DP 12 to DP28. In contrast, loss of both SSII and SSIII caused slower plant growth and dramatically reduced starch content. Extreme deficiency in DP12 to DP28 chains occurred in the double mutant, far more severe than the summed changes in SSII- or SSIII-deficient plants lacking only one of the two enzymes. Conclusion SSII and SSIII have partially redundant functions in determination of amylopectin structure, and these roles cannot be substituted by any other conserved SS, specifically SSI, GBSSI, or SSIV. Even though SSIII is not required for the normal abundance of glucan chains of DP12 to DP18, the enzyme clearly is capable of functioning in production such chains. The role of SSIII in producing these chains cannot be detected simply by analysis of an individual mutation. Competition between

  13. Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

    Science.gov (United States)

    Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

    2014-02-07

    The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

  14. Visual effects of β-­glucans on wound healing in fish

    DEFF Research Database (Denmark)

    Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær

    2011-01-01

    Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...

  15. Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

    Science.gov (United States)

    Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

  16. Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

    OpenAIRE

    Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas

    2012-01-01

    Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...

  17. Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.

    Science.gov (United States)

    Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa

    2014-06-01

    Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.

  18. Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

    Science.gov (United States)

    Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

    2013-05-01

    The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. β-Glucan as an encapsulating agent: Effect on probiotic survival in simulated gastrointestinal tract.

    Science.gov (United States)

    Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A

    2016-01-01

    Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.

    Science.gov (United States)

    Gomaa, K; Kraus, J; Franz, G; Röper, H

    1991-09-18

    Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.

  1. Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice

    DEFF Research Database (Denmark)

    Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo

    2008-01-01

    Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...

  2. Distribution and molecular characterization of β-glucans from hull-less barley bran, shorts and flour.

    Science.gov (United States)

    Zheng, Xueling; Li, Limin; Wang, Qi

    2011-01-01

    Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.

  3. β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

    Directory of Open Access Journals (Sweden)

    Matthew J. Elder

    2017-07-01

    Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

  4. Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

    Science.gov (United States)

    Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

    2013-03-01

    β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.

  5. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    OpenAIRE

    Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

  6. Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus

    Directory of Open Access Journals (Sweden)

    Ira Widjiastuti

    2017-03-01

    Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of

  7. Dynamic, morphotype-specific Candida albicans beta-glucan exposure during infection and drug treatment.

    Directory of Open Access Journals (Sweden)

    Robert T Wheeler

    2008-12-01

    Full Text Available Candida albicans, a clinically important dimorphic fungal pathogen that can evade immune attack by masking its cell wall beta-glucan from immune recognition, mutes protective host responses mediated by the Dectin-1 beta-glucan receptor on innate immune cells. Although the ability of C. albicans to switch between a yeast- or hyphal-form is a key virulence determinant, the role of each morphotype in beta-glucan masking during infection and treatment has not been addressed. Here, we show that during infection of mice, the C. albicans beta-glucan is masked initially but becomes exposed later in several organs. At all measured stages of infection, there is no difference in beta-glucan exposure between yeast-form and hyphal cells. We have previously shown that sub-inhibitory doses of the anti-fungal drug caspofungin can expose beta-glucan in vitro, suggesting that the drug may enhance immune activity during therapy. This report shows that caspofungin also mediates beta-glucan unmasking in vivo. Surprisingly, caspofungin preferentially unmasks filamentous cells, as opposed to yeast form cells, both in vivo and in vitro. The fungicidal activity of caspofungin in vitro is also filament-biased, as corroborated using yeast-locked and hyphal-locked mutants. The uncloaking of filaments is not a general effect of anti-fungal drugs, as another anti-fungal agent does not have this effect. These results highlight the advantage of studying host-pathogen interaction in vivo and suggest new avenues for drug development.

  8. High molecular weight glucan of the culinary medicinal mushroom Agaricus bisporus is an a-glucan that forms complexes with low molecular weight galactan

    NARCIS (Netherlands)

    Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.

    2010-01-01

    An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.

  9. B-Glucan exacerbates allergic asthma independent of fungal ...

    Science.gov (United States)

    BackgroundAllergic sensitization to fungi has been associated with asthma severity. As a result, it has been largely assumed that the contribution of fungi to allergic disease is mediated through their potent antigenicity.ObjectiveWe sought to determine the mechanism by which fungi affect asthma development and severity.MethodsWe integrated epidemiologic and experimental asthma models to explore the effect of fungal exposure on asthma development and severity.ResultsWe report that fungal exposure enhances allergen-driven TH2 responses, promoting severe allergic asthma. This effect is independent of fungal sensitization and can be reconstituted with β-glucan and abrogated by neutralization of IL-17A. Furthermore, this severe asthma is resistant to steroids and characterized by mixed TH2 and TH17 responses, including IL-13+IL-17+CD4+ double-producing effector T cells. Steroid resistance is dependent on fungus-induced TH17 responses because steroid sensitivity was restored in IL-17rc−/− mice. Similarly, in children with asthma, fungal exposure was associated with increased serum IL-17A levels and asthma severity.ConclusionOur data demonstrate that fungi are potent immunomodulators and have powerful effects on asthma independent of their potential to act as antigens. Furthermore, our results provide a strong rationale for combination treatment strategies targeting IL-17A for this subgroup of fungus-exposed patients with difficult-to-treat asthma. To describe th

  10. Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

    Science.gov (United States)

    Theuwissen, Elke; Mensink, Ronald P

    2007-03-01

    Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

  11. Bifunctional cis-Abienol Synthase from Abies balsamea Discovered by Transcriptome Sequencing and Its Implications for Diterpenoid Fragrance Production*

    Science.gov (United States)

    Zerbe, Philipp; Chiang, Angela; Yuen, Macaire; Hamberger, Björn; Hamberger, Britta; Draper, Jason A.; Britton, Robert; Bohlmann, Jörg

    2012-01-01

    The labdanoid diterpene alcohol cis-abienol is a major component of the aromatic oleoresin of balsam fir (Abies balsamea) and serves as a valuable bioproduct material for the fragrance industry. Using high-throughput 454 transcriptome sequencing and metabolite profiling of balsam fir bark tissue, we identified candidate diterpene synthase sequences for full-length cDNA cloning and functional characterization. We discovered a bifunctional class I/II cis-abienol synthase (AbCAS), along with the paralogous levopimaradiene/abietadiene synthase and isopimaradiene synthase, all of which are members of the gymnosperm-specific TPS-d subfamily. The AbCAS-catalyzed formation of cis-abienol proceeds via cyclization and hydroxylation at carbon C-8 of a postulated carbocation intermediate in the class II active site, followed by cleavage of the diphosphate group and termination of the reaction sequence without further cyclization in the class I active site. This reaction mechanism is distinct from that of synthases of the isopimaradiene- or levopimaradiene/abietadiene synthase type, which employ deprotonation reactions in the class II active site and secondary cyclizations in the class I active site, leading to tricyclic diterpenes. Comparative homology modeling suggested the active site residues Asp-348, Leu-617, Phe-696, and Gly-723 as potentially important for the specificity of AbCAS. As a class I/II bifunctional enzyme, AbCAS is a promising target for metabolic engineering of cis-abienol production. PMID:22337889

  12. Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

    Science.gov (United States)

    Chang, I.; Cho, G.

    2012-12-01

    Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

  13. Specific binding of a fungal glucan phytoalexin elicitor to membrane fractions from soybean Glycine max

    International Nuclear Information System (INIS)

    Schmidt, W.E.; Ebel, J.

    1987-01-01

    Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay

  14. Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats

    International Nuclear Information System (INIS)

    Salama, S.F.

    2011-01-01

    1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications

  15. Modulation of the immune response of porcine neutrophils by different β-glucan preparations

    DEFF Research Database (Denmark)

    Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard

    2010-01-01

    β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...

  16. Producing biofuels using polyketide synthases

    Science.gov (United States)

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-04-16

    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  17. Probing the structure of glucan lyases – the lytic members of GH31 - by sequence analysis, circular dichroism and proteolysis

    DEFF Research Database (Denmark)

    Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun

    2005-01-01

    Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...

  18. Biotechnological potential of novel glycoside hydrolase family 70 enzymes synthesizing α-glucans from starch and sucrose

    NARCIS (Netherlands)

    Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

    Transglucosidases belonging to the glycoside hydrolase (GH) family 70 are promising enzymatic tools for the synthesis of α-glucans with defined structures from renewable sucrose and starch substrates. Depending on the GH70 enzyme specificity, α-glucans with different structures and physicochemical

  19. Binding Interactions Between α-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

    DEFF Research Database (Denmark)

    Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.

    2012-01-01

    Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...

  20. Binding Interactions Between alpha-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

    NARCIS (Netherlands)

    Diemer, Silja K.; Svensson, Birte; Babol, Linnea N.; Cockburn, Darrell; Grijpstra, Pieter; Dijkhuizen, Lubbert; Folkenberg, Ditte M.; Garrigues, Christel; Ipsen, Richard H.

    Interactions between milk proteins and alpha-glucans at pH 4.0-5.5 were investigated by use of surface plasmon resonance. The alpha-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the

  1. Dietary (1-->3), (1-->4)-beta-D-glucans from oat activate nuclear factor-kappaB in intestinal leukocytes and enterocytes from mice

    NARCIS (Netherlands)

    Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum

    2010-01-01

    Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB

  2. Optimization of ATP synthase function in mitochondria and chloroplasts via the adenylate kinase equilibrium

    Directory of Open Access Journals (Sweden)

    Abir U Igamberdiev

    2015-01-01

    Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.

  3. Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions

    International Nuclear Information System (INIS)

    Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian

    2012-01-01

    Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)

  4. Combined effects of added beta glucan and black tea in breads on starch functionality.

    Science.gov (United States)

    Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L

    2015-03-01

    Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.

  5. Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

    Directory of Open Access Journals (Sweden)

    Ernesto R. Soto

    2016-01-01

    Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.

  6. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  7. Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.

    Science.gov (United States)

    Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui

    2016-12-01

    β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

    Science.gov (United States)

    Thao, Cao Phuong; Tien, Le Thi Thuy

    2017-09-01

    β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

  9. Synthesis and Self-Assembly of Cellulose Microfibrils from Reconstituted Cellulose Synthase1[OPEN

    Science.gov (United States)

    Purushotham, Pallinti; Fang, Chao; Maranas, Cassandra; Bulone, Vincent

    2017-01-01

    Cellulose, the major component of plant cell walls, can be converted to bioethanol and is thus highly studied. In plants, cellulose is produced by cellulose synthase, a processive family-2 glycosyltransferase. In plant cell walls, individual β-1,4-glucan chains polymerized by CesA are assembled into microfibrils that are frequently bundled into macrofibrils. An in vitro system in which cellulose is synthesized and assembled into fibrils would facilitate detailed study of this process. Here, we report the heterologous expression and partial purification of His-tagged CesA5 from Physcomitrella patens. Immunoblot analysis and mass spectrometry confirmed enrichment of PpCesA5. The recombinant protein was functional when reconstituted into liposomes made from yeast total lipid extract. The functional studies included incorporation of radiolabeled Glc, linkage analysis, and imaging of cellulose microfibril formation using transmission electron microscopy. Several microfibrils were observed either inside or on the outer surface of proteoliposomes, and strikingly, several thinner fibrils formed ordered bundles that either covered the surfaces of proteoliposomes or were spawned from liposome surfaces. We also report this arrangement of fibrils made by proteoliposomes bearing CesA8 from hybrid aspen. These observations describe minimal systems of membrane-reconstituted CesAs that polymerize β-1,4-glucan chains that coalesce to form microfibrils and higher-ordered macrofibrils. How these micro- and macrofibrils relate to those found in primary and secondary plant cell walls is uncertain, but their presence enables further study of the mechanisms that govern the formation and assembly of fibrillar cellulosic structures and cell wall composites during or after the polymerization process controlled by CesA proteins. PMID:28768815

  10. Synthesis and Self-Assembly of Cellulose Microfibrils from Reconstituted Cellulose Synthase.

    Science.gov (United States)

    Cho, Sung Hyun; Purushotham, Pallinti; Fang, Chao; Maranas, Cassandra; Díaz-Moreno, Sara M; Bulone, Vincent; Zimmer, Jochen; Kumar, Manish; Nixon, B Tracy

    2017-09-01

    Cellulose, the major component of plant cell walls, can be converted to bioethanol and is thus highly studied. In plants, cellulose is produced by cellulose synthase, a processive family-2 glycosyltransferase. In plant cell walls, individual β-1,4-glucan chains polymerized by CesA are assembled into microfibrils that are frequently bundled into macrofibrils. An in vitro system in which cellulose is synthesized and assembled into fibrils would facilitate detailed study of this process. Here, we report the heterologous expression and partial purification of His-tagged CesA5 from Physcomitrella patens Immunoblot analysis and mass spectrometry confirmed enrichment of PpCesA5. The recombinant protein was functional when reconstituted into liposomes made from yeast total lipid extract. The functional studies included incorporation of radiolabeled Glc, linkage analysis, and imaging of cellulose microfibril formation using transmission electron microscopy. Several microfibrils were observed either inside or on the outer surface of proteoliposomes, and strikingly, several thinner fibrils formed ordered bundles that either covered the surfaces of proteoliposomes or were spawned from liposome surfaces. We also report this arrangement of fibrils made by proteoliposomes bearing CesA8 from hybrid aspen. These observations describe minimal systems of membrane-reconstituted CesAs that polymerize β-1,4-glucan chains that coalesce to form microfibrils and higher-ordered macrofibrils. How these micro- and macrofibrils relate to those found in primary and secondary plant cell walls is uncertain, but their presence enables further study of the mechanisms that govern the formation and assembly of fibrillar cellulosic structures and cell wall composites during or after the polymerization process controlled by CesA proteins. © 2017 American Society of Plant Biologists. All Rights Reserved.

  11. Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

    Science.gov (United States)

    Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

    2017-11-01

    Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs

  12. Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

    DEFF Research Database (Denmark)

    Jiménez, Natalia Ivonne Vera

    by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...

  13. Glycogen Synthase Kinase-3β

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie

    2016-01-01

    cells were quantitated using enzyme immunometric assays. The activity of GSK-3β (serine-9-phosphorylated GSK-3β/total GSK-3β) was lower at baseline compared with follow-up. No significant mean change over time was observed in levels of total GSK-3β and serine-9-phosphorylated GSK-3β. Exploratory......Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...... with emotional lability, subjective mood fluctuations and cognitive function in healthy individuals. Thirty-seven healthy subjects were evaluated with neuropsychological tests and blood samples at baseline and 12-week follow-up. Total GSK-3β and serine-9-phosphorylated GSK-3β in peripheral blood mononuclear...

  14. Barley genotypic β-glucan variation combined with enzymatic modifications direct its potential as a natural ingredient in a high fiber extract

    DEFF Research Database (Denmark)

    Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.

    2017-01-01

    -glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f  and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....

  15. Crystal structure of riboflavin synthase

    Energy Technology Data Exchange (ETDEWEB)

    Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)

    2010-03-05

    Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.

  16. Mutational, Phylogeny and Evolution Analyses of Salvia Copalyl Diphosphate Synthase

    International Nuclear Information System (INIS)

    Hao, D. C.; Thimmappa, R. B.; Xiao, P. G.

    2016-01-01

    The cyclization of geranylgeranyl diphosphate (GGPP) is catalyzed by copalyl diphosphate synthase (CPS), a class II diterpene synthase (diTPS), to form copalyl diphosphate (CPP), which is an essential substrate of a variety of diterpenes in secondary metabolism of angiosperm including Salvia medicinal plants. The protein environment of the N-terminal class II active site stabilizes the carbocation intermediates and maintains the catalytic activity of angiosperm class II diTPS. The virtual modeling and mutagenesis of the class II diTPS of Salvia miltiorrhiza (SmCPS) were accomplished to illuminate the catalytic activity of SmCPS. Terminal truncations and point mutations established the role of the Beta-Gamma domain and Alpha domain, i.e., they facilitate the flexible conformational change of the class II active site after substrate binding. E203 and K238 in the N-ter Gamma domain of SmCPS1 are functional in the substrate binding and conformational transition and might be essential in catalysis. Similar to other CPSs, the ensuing protonation of the GGPP substrate and coordination of the diphosphate group are governed by highly conserved residues in the DxDD motif of SmCPS, e.g., D372 of CPS1. Moreover, F256 and Y505 stabilize the carbocation and control the enzymatic activity during CPP formation. The amino acids of the predicted active sites, despite under purifying selection, vary greatly, corresponding to the functional flexibility of angiosperm CPSs. Molecular phylogeny and evolution analyses suggest early and ongoing evolution of labdane-related diterpenoid metabolism in angiosperm. (author)

  17. Effect of Immune-Enhancing Enteral Nutrition Enriched with or without Beta-Glucan on Immunomodulation in Critically Ill Patients

    Directory of Open Access Journals (Sweden)

    Jae Gil Lee

    2016-06-01

    Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.

  18. Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

    Science.gov (United States)

    Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

    2018-03-01

    Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

  19. Structures of Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) and a C164Q mutant provide templates for antibacterial drug discovery and identify a buried potassium ion and a ligand-binding site that is an artefact of the crystal form

    Energy Technology Data Exchange (ETDEWEB)

    Baum, Bernhard [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany); Lecker, Laura S. M.; Zoltner, Martin [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Jaenicke, Elmar [Johannes Gutenberg-Universität, Jakob Welder Weg 26, 55128 Mainz (Germany); Schnell, Robert [Karolinska Institutet, 17 177 Stockholm (Sweden); Hunter, William N., E-mail: w.n.hunter@dundee.ac.uk [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Brenk, Ruth, E-mail: w.n.hunter@dundee.ac.uk [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany)

    2015-07-28

    Three crystal structures of recombinant P. aeruginosa FabF are reported: the apoenzyme, an active-site mutant and a complex with a fragment of a natural product inhibitor. The characterization provides reagents and new information to support antibacterial drug discovery. Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials.

  20. Structures of Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) and a C164Q mutant provide templates for antibacterial drug discovery and identify a buried potassium ion and a ligand-binding site that is an artefact of the crystal form

    International Nuclear Information System (INIS)

    Baum, Bernhard; Lecker, Laura S. M.; Zoltner, Martin; Jaenicke, Elmar; Schnell, Robert; Hunter, William N.; Brenk, Ruth

    2015-01-01

    Three crystal structures of recombinant P. aeruginosa FabF are reported: the apoenzyme, an active-site mutant and a complex with a fragment of a natural product inhibitor. The characterization provides reagents and new information to support antibacterial drug discovery. Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials

  1. Understanding the role of oat ß-glucan in oat-based dough systems

    NARCIS (Netherlands)

    Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.

    2015-01-01

    B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat

  2. An enzyme family reunion - similarities, differences and eccentricities in actions on alpha-glucans

    DEFF Research Database (Denmark)

    Seo, Eun-Seong; Christiansen, Camilla; Abou Hachem, Maher

    2008-01-01

    alpha-Glucans in general, including starch, glycogen and their derived oligosaccharides are processed by a host of more or less closely related enzymes that represent wide diversity in structure, mechanism, specificity and biological role. Sophisticated three-dimensional structures continue to em...

  3. Effects of β-Glucans and resistant starch on fermentation of recalcitrant fibers in growing pigs

    NARCIS (Netherlands)

    Vries, de S.; Gerrits, W.J.J.; Kabel, M.A.; Zijlstra, Ruurd; Vasanthan, Thava

    2017-01-01

    Effects of the presence of β-glucans and resistant starch in diets on nutrient and fiber degradability of rapeseed meal [RSM] (Brassica napus) and Distillers Dried Grain with Solubles (DDGS) were tested in a 2 × 3 factorial arrangement. Two basal diets, containing either 500 g/kg RSM or DDGS and

  4. The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.

    Science.gov (United States)

    Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum

    2014-04-01

    Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.

  5. Novel chitin/chitosan-glucan wound dressing: Isolation, characterization, antibacterial activity and wound healing properties

    Czech Academy of Sciences Publication Activity Database

    Abdel-Mohsen, A. M.; Jancar, J.; Massoud, D.; Fohlerová, Z.; Elhadidy, Hassan; Spotz, Z.; Hebeish, A.

    2016-01-01

    Roč. 510, č. 1 (2016), s. 86-99 ISSN 0378-5173 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Chitin/chitosan-glucan complex * Nonwoven mat * Surgical wound healing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.649, year: 2016

  6. Escherichia coli Phosphoenolpyruvate Dependent Phosphotransferase System. Copurification of HPr and α1-6 Glucan

    NARCIS (Netherlands)

    Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.

    1979-01-01

    A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of

  7. Beta-glucans in the treatment of diabetes and associated cardiovascular risks

    Directory of Open Access Journals (Sweden)

    Jiezhong Chen

    2008-12-01

    Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis

  8. Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.

    Science.gov (United States)

    Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish

    2012-09-04

    Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.

  9. Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

    Directory of Open Access Journals (Sweden)

    Mattia P. Arena

    2014-02-01

    Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.

  10. Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress

    Science.gov (United States)

    Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...

  11. Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

    Science.gov (United States)

    We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

  12. The cellulose synthase companion proteins act non-redundantly with CELLULOSE SYNTHASE INTERACTING1/POM2 and CELLULOSE SYNTHASE 6

    OpenAIRE

    Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan

    2016-01-01

    Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...

  13. Comparison of Chain-Length Preferences and Glucan Specificities of Isoamylase-Type α-Glucan Debranching Enzymes from Rice, Cyanobacteria, and Bacteria.

    Directory of Open Access Journals (Sweden)

    Taiki Kobayashi

    Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.

  14. Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

    International Nuclear Information System (INIS)

    Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo

    2015-01-01

    β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber

  15. Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)

    2015-02-27

    β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.

  16. The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Chad Steele

    2005-12-01

    Full Text Available Alveolar macrophages represent a first-line innate host defense mechanism for clearing inhaled Aspergillus fumigatus from the lungs, yet contradictory data exist as to which alveolar macrophage recognition receptor is critical for innate immunity to A. fumigatus. Acknowledging that the A. fumigatus cell wall contains a high beta-1,3-glucan content, we questioned whether the beta-glucan receptor dectin-1 played a role in this recognition process. Monoclonal antibody, soluble receptor, and competitive carbohydrate blockage indicated that the alveolar macrophage inflammatory response, specifically the production of tumor necrosis factor-alpha (TNF-alpha, interleukin-1alpha (IL-1alpha, IL-1beta, IL-6, CXCL2/macrophage inflammatory protein-2 (MIP-2, CCL3/macrophage inflammatory protein-1alpha (MIP-1alpha, granulocyte-colony stimulating factor (G-CSF, and granulocyte monocyte-CSF (GM-CSF, to live A. fumigatus was dependent on recognition via the beta-glucan receptor dectin-1. The inflammatory response was triggered at the highest level by A. fumigatus swollen conidia and early germlings and correlated to the levels of surface-exposed beta glucans, indicating that dectin-1 preferentially recognizes specific morphological forms of A. fumigatus. Intratracheal administration of A. fumigatus conidia to mice in the presence of a soluble dectin-Fc fusion protein reduced both lung proinflammatory cytokine/chemokine levels and cellular recruitment while modestly increasing the A. fumigatus fungal burden, illustrating the importance of beta-glucan-initiated dectin-1 signaling in defense against this pathogen. Collectively, these data show that dectin-1 is centrally required for the generation of alveolar macrophage proinflammatory responses to A. fumigatus and to our knowledge provides the first in vivo evidence for the role of dectin-1 in fungal innate defense.

  17. Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

    Science.gov (United States)

    Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

    1989-05-01

    A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

  18. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  19. Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases.

    Science.gov (United States)

    Cheng, Jiujun; Charles, Trevor C

    2016-09-01

    Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

  20. Terpene synthases from Cannabis sativa.

    Directory of Open Access Journals (Sweden)

    Judith K Booth

    Full Text Available Cannabis (Cannabis sativa plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E-β-ocimene, (--limonene, (+-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  1. Terpene synthases from Cannabis sativa.

    Science.gov (United States)

    Booth, Judith K; Page, Jonathan E; Bohlmann, Jörg

    2017-01-01

    Cannabis (Cannabis sativa) plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS) were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E)-β-ocimene, (-)-limonene, (+)-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  2. Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols

    Directory of Open Access Journals (Sweden)

    A. Korpi

    2003-01-01

    Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.

  3. Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy

    DEFF Research Database (Denmark)

    Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling

    2010-01-01

    To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...

  4. The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice

    Directory of Open Access Journals (Sweden)

    Fengdan Jin

    2014-01-01

    Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.

  5. Concentrated oat β-glucan, a fermentable fiber, lowers serum cholesterol in hypercholesterolemic adults in a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Fulcher R Gary

    2007-03-01

    Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other

  6. Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

    Science.gov (United States)

    Rosburg, Valerie; Boylston, Terri; White, Pamela

    2010-06-01

    Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

  7. Influence of chitosan and melanin-glucan complex onto gamma-exposure with low doses and acute stressful reaction

    International Nuclear Information System (INIS)

    Senyuk, O.F.; Tarasenko, P.D.; Pazukhin, Eh.M.; Gorovoj, L.F.; Varlamov, V.P.

    2004-01-01

    Possibilities of prevention and reduction of consequences of acute exposure on the background of immobilization stress with the help of chitosan preparations and of melanin - glucan complex of highest bazidiomicetes (fungi) were studied. Tested preparations were capable to protect hematological and immunological homeostasis of line BALB/c mice from stressful reaction provoked by acute exposure and two-hour immobilization. The most expressed normalizing and adapting effect had the mixture composed of chitosan and melanin-glucan complex

  8. beta. -1,4-glucan occurring in homogenate of Phaseolus aureus seedlings. Possible nascent stage of cellulose biosynthesis in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Satoh, S; Matsuda, K; Tamari, K

    1976-12-01

    A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.

  9. Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis

    Directory of Open Access Journals (Sweden)

    Tomoko Jippo

    2015-02-01

    Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases

  10. β-Glucan production of Saccharomyces cerevisiae in medium with different nitrogen sources in air-lift fermentor

    Directory of Open Access Journals (Sweden)

    AHMAD THONTOWI

    2007-10-01

    Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.

  11. High Molecular Weight Glucan of the Culinary Medicinal Mushroom Agaricus bisporus is an α-Glucan that Forms Complexes with Low Molecular Weight Galactan

    Directory of Open Access Journals (Sweden)

    Harry J. Wichers

    2010-08-01

    Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.

  12. Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    2014-12-26

    Dec 26, 2014 ... other causes of secondary hypertension), diabetes or under any kind of .... used for the analysis of CYP11B2 C-344T and ATR1 A1166C ...... Staessen J. A., Li Y. and Thijs L. 2007 Meta-analysis of blood pres- sure and the ...

  13. Molecular characterization and genetic diversity analysis β-glucan content variability in grain of oat (Avena sativa L.

    Directory of Open Access Journals (Sweden)

    Đukić Nevena H.

    2014-01-01

    Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092

  14. Studies on Trans-Resveratrol/Carboxymethylated (1,3/1,6-β-d-Glucan Association for Aerosol Pharmaceutical Applications

    Directory of Open Access Journals (Sweden)

    Antonio Francioso

    2017-05-01

    Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.

  15. Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

    Science.gov (United States)

    Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

    2013-10-01

    Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

  16. Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

    Science.gov (United States)

    Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

    2017-07-01

    The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Flux through trehalose synthase flows from trehalose to the alpha anomer of maltose in mycobacteria.

    Science.gov (United States)

    Miah, Farzana; Koliwer-Brandl, Hendrik; Rejzek, Martin; Field, Robert A; Kalscheuer, Rainer; Bornemann, Stephen

    2013-04-18

    Trehalose synthase (TreS) was thought to catalyze flux from maltose to trehalose, a precursor of essential trehalose mycolates in mycobacterial cell walls. However, we now show, using a genetic approach, that TreS is not required for trehalose biosynthesis in Mycobacterium smegmatis, whereas two alternative trehalose-biosynthetic pathways (OtsAB and TreYZ) are crucial. Consistent with this direction of flux, trehalose levels in Mycobacterium tuberculosis decreased when TreS was overexpressed. In addition, TreS was shown to interconvert the α anomer of maltose and trehalose using (1)H and (19)F-nuclear magnetic resonance spectroscopies using its normal substrates and deoxyfluoromaltose analogs, with the nonenzymatic mutarotation of α/β-maltose being slow. Therefore, flux through TreS in mycobacteria flows from trehalose to α-maltose, which is the appropriate anomer for maltose kinase of the GlgE α-glucan pathway, which in turn contributes to intracellular and/or capsular polysaccharide biosynthesis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Development and characterization of an oat TILLING-population and identification of mutations in lignin and β-glucan biosynthesis genes

    Directory of Open Access Journals (Sweden)

    Vivekanand Vivekanand

    2010-05-01

    Full Text Available Abstract Background Oat, Avena sativa is the sixth most important cereal in the world. Presently oat is mostly used as feed for animals. However, oat also has special properties that make it beneficial for human consumption and has seen a growing importance as a food crop in recent decades. Increased demand for novel oat products has also put pressure on oat breeders to produce new oat varieties with specific properties such as increased or improved β-glucan-, antioxidant- and omega-3 fatty acid levels, as well as modified starch and protein content. To facilitate this development we have produced a TILLING (Targeting Induced Local Lesions IN Genomes population of the spring oat cultivar SW Belinda. Results Here a population of 2600 mutagenised M2 lines, producing 2550 M3 seed lots were obtained. The M2 population was initially evaluated by visual inspection and a number of different phenotypes were seen ranging from dwarfs to giants, early flowering to late flowering, leaf morphology and chlorosis. Phloroglucinol/HCl staining of M3 seeds, obtained from 1824 different M2 lines, revealed a number of potential lignin mutants. These were later confirmed by quantitative analysis. Genomic DNA was prepared from the M2 population and the mutation frequency was determined. The estimated mutation frequency was one mutation per 20 kb by RAPD-PCR fingerprinting, one mutation per 38 kb by MALDI-TOF analysis and one mutation per 22.4 kb by DNA sequencing. Thus, the overall mutation frequency in the population is estimated to be one mutation per 20-40 kb, depending on if the method used addressed the whole genome or specific genes. During the investigation, 6 different mutations in the phenylalanine ammonia-lyase (AsPAL1 gene and 10 different mutations in the cellulose synthase-like (AsCslF6 β-glucan biosynthesis gene were identified. Conclusion The oat TILLING population produced in this work carries, on average, hundreds of mutations in every individual

  19. Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

    Science.gov (United States)

    Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

    2017-04-01

    Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable

  20. Glycogen synthase kinase 3: more than a namesake.

    Science.gov (United States)

    Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit

    2009-03-01

    Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.

  1. Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.

    Science.gov (United States)

    Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David

    2014-10-22

    Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.

  2. Methodologies for conformational studies of oligo- and poly-glucans: crystallography and molecular mechanics

    International Nuclear Information System (INIS)

    Tran, Huu Vinh

    1983-01-01

    After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans

  3. Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms

    Directory of Open Access Journals (Sweden)

    Daniela Fiocco

    2012-05-01

    Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.

  4. Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections

    Directory of Open Access Journals (Sweden)

    Andreas F. Haag

    2010-01-01

    Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.

  5. Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters.

    Science.gov (United States)

    Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen

    2004-10-01

    Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.

  6. Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels

    Science.gov (United States)

    Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.

    2014-01-01

    Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183

  7. Characterization and biocompatibility of glucan: a safe food additive from probiotic Lactobacillus plantarum DM5.

    Science.gov (United States)

    Das, Deeplina; Goyal, Arun

    2014-03-15

    Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.

  8. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  9. Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I

    International Nuclear Information System (INIS)

    Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.

    1998-01-01

    The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains

  10. Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

    Science.gov (United States)

    Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

    2016-01-20

    α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

  11. Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

    2018-05-14

    Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

    Science.gov (United States)

    Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

    2017-03-01

    Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer

    Directory of Open Access Journals (Sweden)

    Hirokazu Tokuyasu

    2010-09-01

    Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran

  14. β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.

    Directory of Open Access Journals (Sweden)

    Sonja de Vries

    Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.

  15. Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

    Science.gov (United States)

    Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

    2004-03-26

    The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

  16. The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

    Directory of Open Access Journals (Sweden)

    Jenneke Leentjens

    Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.

  17. Enzyme-Linked Immunosorbent Assay Specific for (1→6) Branched, (1→3)-β-d-Glucan Detection in Environmental Samples

    OpenAIRE

    Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael

    2001-01-01

    (1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...

  18. Probing interactions between B-glucan and bile salts at atomic detail by 1H-13C NMR assays

    DEFF Research Database (Denmark)

    Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G

    2014-01-01

    Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....

  19. Inhibition of mammalian nitric oxide synthases by agmatine, an endogenous polyamine formed by decarboxylation of arginine.

    OpenAIRE

    Galea, E; Regunathan, S; Eliopoulos, V; Feinstein, D L; Reis, D J

    1996-01-01

    Agmatine, decarboxylated arginine, is a metabolic product of mammalian cells. Considering the close structural similarity between L-arginine and agmatine, we investigated the interaction of agmatine and nitric oxide synthases (NOSs), which use L-arginine to generate nitric oxide (NO) and citrulline. Brain, macrophages and endothelial cells were respectively used as sources for NOS isoforms I, II and III. Enzyme activity was measured by the production of nitrites or L-citrulline. Agmatine was ...

  20. Identification of potential leads against 4-hydroxytetrahydrodipicolinate synthase from Mycobacterium tuberculosis

    OpenAIRE

    Rehman, Ajijur; Akhtar, Salman; Siddiqui, Mohd Haris; Sayeed, Usman; Ahmad, Syed Sayeed; Arif, Jamal M.; Khan, M. Kalim A.

    2016-01-01

    4-hydroxy-tetrahydrodipicolinate synthase (DHDPS) is an important enzyme needed for the biosynthesis of lysine and many more key metabolites in Mycobacterium tuberculosis (Mtb). Inhibition of DHDPS is supposed to a promising therapeutic target due to its specific role in sporulation, cross-linking of the peptidiglycan polymers and biosynthesis of amino acids. In this work, a known inhibitor-based similarity search was carried out against a natural products database (Super Natural II) towards ...

  1. Phosphorylation and 14-3-3 binding of Arabidopsis trehalose-phosphate synthase 5 in response to 2-deoxyglucose

    DEFF Research Database (Denmark)

    Harthill, Jean E; Meek, Sarah E M; Morrice, Nick

    2006-01-01

    Trehalose-6-phosphate is a 'sugar signal' that regulates plant metabolism and development. The Arabidopsis genome encodes trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphatase (TPP) enzymes. It also encodes class II proteins (TPS isoforms 5-11) that contain both TPS-like and TPP...

  2. Cloning and expression of pineapple sucrosephosphate synthase ...

    African Journals Online (AJOL)

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  3. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  4. HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.

    Science.gov (United States)

    PORRA, R J; ROSS, B D

    1965-03-01

    1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.

  5. Heme A synthase in bacteria depends on one pair of cysteinyls for activity.

    Science.gov (United States)

    Lewin, Anna; Hederstedt, Lars

    2016-02-01

    Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Preparation and characteristics of beta-glucan concentrate from brewer's yeast as the additive substance in foods

    Directory of Open Access Journals (Sweden)

    Ľubomír Mikuš

    2013-02-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too.  At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258

  7. Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

    Science.gov (United States)

    Kupetz, M; Sacher, B; Becker, T

    2016-06-05

    Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

    Science.gov (United States)

    Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

    2015-01-01

    Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

  9. Dietary beta-1,3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L.).

    Science.gov (United States)

    Kumari, J; Sahoo, P K

    2006-02-01

    This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.

  10. Quantitative assessment of the effects of beta-glucan consumption on serum lipid profile and glucose level in hypercholesterolemic subjects.

    Science.gov (United States)

    Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S

    2015-08-01

    A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

    Science.gov (United States)

    Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

    2018-06-19

    The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

  12. Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

    Science.gov (United States)

    Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

    2013-01-01

    Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

  13. A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

    Science.gov (United States)

    Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

    2014-08-01

    An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Structural characterization of a mixed-linkage glucan deficient mutant reveals alteration in cellulose microfibril orientation in rice coleoptile mesophyll cell walls

    Directory of Open Access Journals (Sweden)

    Andreia Michelle Smith-Moritz

    2015-08-01

    Full Text Available The CELLULOSE SYNTHASE-LIKE F6 (CslF6 gene was previously shown to mediate the biosynthesis of mixed-linkage glucan (MLG, a cell wall polysaccharide that is hypothesized to be a tightly associated with cellulose and also have a role in cell expansion in the primary cell wall of young seedlings in grass species. We have recently shown that loss-of-function cslf6 rice mutants do not accumulate MLG in most vegetative tissues. Despite the absence of a structurally important polymer, MLG, these mutants are unexpectedly viable and only show a moderate growth compromise compared to wild type. Therefore these mutants are ideal biological systems to test the current grass cell wall model. In order to gain a better understanding of the role of MLG in the primary wall, we performed in-depth compositional and structural analyses of the cell walls of three day-old rice seedlings using various biochemical and novel microspectroscopic approaches. We found that cellulose content as well as matrix polysaccharide composition was not significantly altered in the MLG deficient mutant. However, we observed a significant change in cellulose microfibril bundle organization in mesophyll cell walls of the cslf6 mutant. Using synchrotron source Fourier Transform Mid-Infrared Spectromicroscopy for high-resolution imaging, we determined that the bonds associated with cellulose and arabinoxylan, another major component of the primary cell was of grasses, were in a lower energy configuration compared to wild type, suggesting a slightly weaker primary wall in MLG deficient mesophyll cells. Taken together, these results suggest that MLG may influence cellulose deposition in mesophyll cell walls without significantly affecting anisotropic growth thus challenging MLG importance in cell wall expansion.

  15. Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

    NARCIS (Netherlands)

    Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

    1999-01-01

    Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique

  16. Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

    NARCIS (Netherlands)

    Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

    Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique

  17. β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

    Science.gov (United States)

    2015-01-01

    The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p periodontal disease (p periodontal disease (p periodontal effects in diabetic rats with periodontal disease. PMID:26291983

  18. Dimerization of the Glucan Phosphatase Laforin Requires the Participation of Cysteine 329

    Science.gov (United States)

    Sánchez-Martín, Pablo; Raththagala, Madushi; Bridges, Travis M.; Husodo, Satrio; Gentry, Matthew S.; Sanz, Pascual; Romá-Mateo, Carlos

    2013-01-01

    Laforin, encoded by a gene that is mutated in Lafora Disease (LD, OMIM 254780), is a modular protein composed of a carbohydrate-binding module and a dual-specificity phosphatase domain. Laforin is the founding member of the glucan-phosphatase family and regulates the levels of phosphate present in glycogen. Multiple reports have described the capability of laforin to form dimers, although the function of these dimers and their relationship with LD remains unclear. Recent evidence suggests that laforin dimerization depends on redox conditions, suggesting that disulfide bonds are involved in laforin dimerization. Using site-directed mutagenesis we constructed laforin mutants in which individual cysteine residues were replaced by serine and then tested the ability of each protein to dimerize using recombinant protein as well as a mammalian cell culture assay. Laforin-Cys329Ser was the only Cys/Ser mutant unable to form dimers in both assays. We also generated a laforin truncation lacking the last three amino acids, laforin-Cys329X, and this truncation also failed to dimerize. Interestingly, laforin-Cys329Ser and laforin-Cys329X were able to bind glucans, and maintained wild type phosphatase activity against both exogenous and biologically relevant substrates. Furthermore, laforin-Cys329Ser was fully capable of participating in the ubiquitination process driven by a laforin-malin complex. These results suggest that dimerization is not required for laforin phosphatase activity, glucan binding, or for the formation of a functional laforin-malin complex. Cumulatively, these results suggest that cysteine 329 is specifically involved in the dimerization process of laforin. Therefore, the C329S mutant constitutes a valuable tool to analyze the physiological implications of laforin’s oligomerization. PMID:23922729

  19. Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

    Science.gov (United States)

    Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

    2016-10-01

    This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Oral microbe-host interactions: influence of β-glucans on gene expression of inflammatory cytokines and metabolome profile.

    Science.gov (United States)

    Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça

    2017-03-07

    The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.

  1. Hypoglycemic activity of polysaccharide fractions containing ß-glucans from extracts of Rhynchelytrum repens (Willd. C.E. Hubb., Poaceae

    Directory of Open Access Journals (Sweden)

    A.C.C.F.F. De Paula

    2005-06-01

    Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

  2. A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

    Science.gov (United States)

    Semedo, Magda C; Karmali, Amin; Fonseca, Luís

    2015-02-01

    Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Effects of dietary yeastβ-glucan on nutrient digestibility and serum proifles in pre-ruminant Holstein calves

    Institute of Scientific and Technical Information of China (English)

    MA Tao; TU Yan; ZHANG Nai-feng; GUO Jiang-peng; DENG Kai-dong; ZHOU Yi; YUN Qiang; DIAO Qi-yu

    2015-01-01

    This study aimed to investigate the effects of dietary supplementation of yeastβ-glucan on the nutrient digestibility and serum proifles in pre-ruminant Holstein calves. Forty-two neonatal Holstein calves ((39.6±4.2) kg) were randomly al otted to six groups, and each was offered one of the fol owing diets:a basal diet (control) or the basal diet supplemented with 25, 50, 75, 100 or 200 mg of yeastβ-glucan kg–1 feed (dry matter basis). The basal diet consisted of a milk replacer and a starter feed. The trial lasted for 56 d. Two digestibility trials were conducted from d 14 to 20 and from d 42 to 48. Blood samples were col ected on d 0, 14, 28 and 42 for serum proifle analyses. On d 56, three calves from each group were slaughtered, and intestinal samples were col ected to assess the vil ous height, crypt depth and mucosal thickness. Although feed intake was not affected by dietary treatment (P>0.05), the average daily gain (ADG) and gain-to-feed ratios were higher (P0.05). Compared with the control group, supplementation of yeastβ-glucan decreased (P0.05). The supplementation of yeastβ-glucan stimu-lated the enzymatic activity of alkaline phosphatase (ALP) (P<0.05) compared with the control group. The lysozyme (LYZ) concentration increased quadratical y (P<0.05) with increasing yeastβ-glucan levels. The results suggested that dietary supplementation of yeastβ-glucan at 75 mg kg–1 feed improved nutrient digestibility, enhanced immunity by increasing the immunoglobulin concentration and stimulating ALP, and exerted no adverse effects on metabolism in pre-ruminant calves.

  4. EFFECTS OF BARLEY FLOUR ADDITION AND BAKING TEMPERATURE ON Β-GLUCANS CONTENT AND BISCUITS PROPERTIES

    OpenAIRE

    Džafić, A; Oručević-Žuljević, Sanja; Spaho, Nermina; Akagić, Asima

    2017-01-01

    The aim of this study was to investigate opportunities to improve the nutritional value of biscuits. Therefore, the content of β-glucans, physical, chemical and sensory properties of biscuits were determined in relation to a share of added barley flour and a baking temperature. Five different blends of barley and wheat were used for biscuit production: barley/wheat flours in combinations: 0/100; 25/75; 50/50; 75/25 and 100/0 according to the procedure described in AACC method 10-52. The temp...

  5. Synthesis of O- and C-glycosides derived from β-(1,3)-D-glucans.

    Science.gov (United States)

    Marca, Eduardo; Valero-Gonzalez, Jessika; Delso, Ignacio; Tejero, Tomás; Hurtado-Guerrero, Ramon; Merino, Pedro

    2013-12-15

    A series of β-(1,3)-d-glucans have been synthesized incorporating structural variations specifically on the reducing end of the oligomers. Both O- and C-glucosides derived from di- and trisaccharides have been obtained in good overall yields and with complete selectivity. Whereas the O-glycosides were obtained via a classical Koenigs-Knorr glycosylation, the corresponding C-glycosides were obtained through allylation of the anomeric carbon and further cross-metathesis reaction. Finally, the compounds were evaluated against two glycosidases and two endo-glucanases and no inhibitory activity was observed. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Amphiphilic polymeric micelles originating from 1,4-β-D-glucan-g-polyphenylene oxide as the carriers for delivery of docetaxel and the corresponding release behaviors.

    Science.gov (United States)

    Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang

    2018-07-15

    A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Only small fractions of soluble ß-glucan modulate the mucosal immune system in carp (Cyprinus carpio L.)

    DEFF Research Database (Denmark)

    Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht

    For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...

  8. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    International Nuclear Information System (INIS)

    Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long

    2014-01-01

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus

  9. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)

    2014-04-15

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.

  10. Xyloglucan biosynthesis by Golgi membranes from suspension-cultured sycamore (Acer pseudoplatanus) cells

    International Nuclear Information System (INIS)

    White, A.R.; Xin, Yi

    1990-01-01

    Xyloglucan is a major hemicellulose polysaccharide in plant cell walls. Biosynthesis of such cell wall polysaccharides is closely linked to the process of plant cell growth and development. Xyloglucan polysaccharides consist of a β-1,4 glucan backbone synthesized by xyloglucan synthase and sidechains of xylose, galactose, and fucose added by other transferase enzymes. Most plant Golgi and plasma membranes also contain glucan synthases I ampersand II, which make β-1,4 and β-1,3 glucans, respectively. All of these enzymes have very similar activities. Cell walls on suspension-cultured cells from Acer pseudoplatanus (sycamore maple) were enzymatically softened prior to cell disruption by passing through a 30 μm nylon screen. Cell membranes from homogenates were separated by ultracentrifugation on top-loaded or flotation sucrose density gradients. Samples were collected by gradient fractionation and assayed for membrane markers and xyloglucan and glucan synthase activities. Standard marker assays (cyt. c reductase for eR, IDPase ampersand UDPase for Golgi, and eosin 5'-malelmide binding for plasma membrane) showed partial separation of these three membrane types. Golgi and plasma membrane markers overlapped in most gradients. Incorporation of 14 C-labeled sugars from UDP-glucose and UDP-xylose was used to detect xyloglucan synthase, glucan synthases I ampersand II, and xylosyl transferase in Golgi membrane fractions. These activities overlapped, although distinct peaks of xyloglucan synthase and xylosyl transferase were found. Ca ++ had a stimulatory effect on glucan synthases I ampersand II, while Mn ++ had an inhibitory effect on glucan synthase I in the presence of Ca ++ . The similarity of these various synthase activities demonstrates the need for careful structural characterization of newly synthesized polysaccharides

  11. Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

    Science.gov (United States)

    Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

    2014-03-01

    The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

  12. Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.

    Science.gov (United States)

    Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G

    2017-08-15

    Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.

    Science.gov (United States)

    Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong

    2014-03-19

    A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.

  14. Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

    Energy Technology Data Exchange (ETDEWEB)

    Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

  15. Post radiation protection and enhancement of DNA repair of beta glucan isolated from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.

    2013-01-01

    Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)

  16. Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan

    Directory of Open Access Journals (Sweden)

    Eduardo Madrigal-Bujaidar

    2015-06-01

    Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.

  17. Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

    International Nuclear Information System (INIS)

    Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.

    2013-01-01

    Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

  18. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  19. Effects of β-Glucans Ingestion on Alveolar Bone Loss, Intestinal Morphology, Systemic Inflammatory Profile, and Pancreatic β-Cell Function in Rats with Periodontitis and Diabetes

    Science.gov (United States)

    Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.

    2017-01-01

    This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456

  20. Generic tools to assess genuine carbohydrate specific effects on in vitro immune modulation exemplified by β-glucans

    DEFF Research Database (Denmark)

    Rieder, Anne; Grimmer, Stine; Aachmann, Finn L.

    2013-01-01

    Even if carbohydrate preparations from plant/fungal sources have a high degree of purity, observed immune-stimulation may be caused by minute sample contaminations. Using the example of different β-glucans we present a range of analytical tools crucial for validation of possible immune-stimulator...

  1. An extracellular cell-attached pullulanase confers branched α-glucan utilization in human gut Lactobacillus acidophilus

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig

    2017-01-01

    binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...

  2. Protective Effects of Surfactant Protein D (SP-D) Treatment in 1,3-β-glucan-modulated Allergic Inflammation

    DEFF Research Database (Denmark)

    Fakih, Dalia; Pilecki, Bartosz; Schlosser, Anders

    2015-01-01

    SP-D is a pulmonary collectin important in lung immunity. SP-D-deficient mice (Sftpd(-/-)) are reported to be susceptible to ovalbumin (OVA)- and fungal allergen-induced pulmonary inflammation, while treatment with exogenous SP-D has therapeutic effects in such disease models. β-glucans are a div...

  3. Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus

    NARCIS (Netherlands)

    Jesus, de Liana Inara; Smiderle, Fhernanda R.; Ruthes, Andrea C.; Vilaplana, Francisco; Lin, Dal' Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Griensven, Van Leo J.L.D.; Iacomini, Marcello

    2017-01-01

    A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle

  4. Respiratory health in children, and indoor exposure to (1,3)-beta-D-glucan, EPS mould components and endotoxin

    NARCIS (Netherlands)

    Tischer, C.; Gehring, U.; Chen, C-M; Kerkhof, M.; Koppelman, G.; Sausenthaler, S.; Herbarth, O.; Schaaf, B.; Lehmann, I.; Kraemer, U.; Berdel, D.; von Berg, A.; Bauer, C. P.; Koletzko, S.; Wichmann, H-E; Brunekreef, B.; Heinrich, J.

    For a long time, exposure to mould and dampness-derived microbial components was considered a risk factor for the development of respiratory diseases and symptoms. Some recent studies suggested that early childhood exposure to mould components, such as (1,3)-beta-D-glucan and extracellular

  5. Crystal Structure of α-1,4-Glucan Lyase, a Unique Glycoside Hydrolase Family Member with a Novel Catalytic Mechanism

    NARCIS (Netherlands)

    Rozeboom, Henriëtte J.; Yu, Shukun; Madrid, Susan; Kalk, Kor H.; Zhang, Ran; Dijkstra, Bauke W.

    2013-01-01

    α-1,4-Glucan lyase (EC 4.2.2.13) from the red seaweed Gracilariopsis lemaneiformis cleaves α-1,4-glucosidic linkages in glycogen, starch, and malto-oligosaccharides, yielding the keto-monosaccharide 1,5-anhydro-D-fructose. The enzyme belongs to glycoside hydrolase family 31 (GH31) but degrades

  6. Synthesis of New Hyper-Branched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants

    NARCIS (Netherlands)

    Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

    2016-01-01

    α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088 and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were

  7. β-glucan enriched bath directly stimulates the wound healing process in common carp (Cyprinus carpio L.)

    DEFF Research Database (Denmark)

    Przybylska, Dominika Alicja; Schmidt, Jacob; Jiménez, Natalia Ivonne Vera

    2013-01-01

    of production of radical oxygen species. PAMPs/DAMPs stimulation caused by the wounding and or β-glucans resulted in an inflammatory response by activating IL-1b, IL-6 family member M17 and IL-8 and differences in the expression pattern were seen depending on stimuli. IL-1b, IL-6 family member M17 and IL-8 were...

  8. Plant α-glucan phosphatases SEX4 and LSF2 display different affinity for amylopectin and amylose

    DEFF Research Database (Denmark)

    Wilkens, Casper; Auger, Kyle D.; Anderson, Nolan T.

    2016-01-01

    The plant glucan phosphatases Starch EXcess 4 (SEX4) and Like Sex Four2 (LSF2) apply different starch binding mechanisms. SEX4 contains a carbohydrate binding module, and LSF2 has two surface binding sites (SBSs). We determined KDapp for amylopectin and amylose, and KD for β-cyclodextrin and vali...

  9. Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

    Science.gov (United States)

    Shiota, E; Maekawa, M; Kono, T

    2001-12-01

    Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

  10. Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanase.

    Science.gov (United States)

    Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi

    2008-06-01

    Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.

  11. Fungi, beta-Glucan, and Bacteria in Nasal Lavage of Greenhouse Workers and Their Relation to Occupational Exposure

    DEFF Research Database (Denmark)

    Madsen, A. M.; Tendal, K.; Thilsing, T.

    2013-01-01

    occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...

  12. Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

    Czech Academy of Sciences Publication Activity Database

    Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

    2009-01-01

    Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

  13. Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

    Science.gov (United States)

    Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

    2017-09-05

    Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer

    International Nuclear Information System (INIS)

    Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju

    2010-01-01

    We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco

  15. Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

    Science.gov (United States)

    Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

    2012-04-01

    Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

  16. NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

    Directory of Open Access Journals (Sweden)

    Henky Manoppo

    2010-06-01

    Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

  17. Structural analysis of bioengineered alpha-D-glucan produced by a triple mutant of the glucansucrase GTF180 enzyme from Lactobacillus reuteri strain 180 : Generation of (alpha 1 -> 4) linkages in a native (1 -> 3)(1 -> 6)-alpha-D-glucan

    NARCIS (Netherlands)

    van Leeuwen, Sander S.; Kralj, Slavko; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

    Site-directed mutagenesis of the glucansucrase gtf180 gene from Lactobacillus reuteri strain 180 was used to transform the active site region. The alpha-D-glucan (mEPS-PNNS) produced by the triple mutant V1027P:S1137N: A1139S differed in structure from that of the wild-type alpha-D-glucan (EPS180).

  18. Genomic Analysis of Terpene Synthase Family and Functional Characterization of Seven Sesquiterpene Synthases from Citrus sinensis

    Directory of Open Access Journals (Sweden)

    Berta Alquézar

    2017-08-01

    Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.

  19. Chrysanthemyl diphosphate synthase operates in planta as a bifunctional enzyme with chrysanthemol synthase activity

    DEFF Research Database (Denmark)

    Yang, Ting; Gao, Liping; Hu, Hao

    2014-01-01

    Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...

  20. β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

    Science.gov (United States)

    Shao, Yujing; Guo, Yuming; Wang, Zhong

    2013-07-01

    This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.

  1. Feeding common carp Cyprinus carpio with b-glucan supplemented \\ud diet stimulates C-reactive protein and complement immune acute\\ud phase responses following PAMPs injection

    OpenAIRE

    Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave

    2014-01-01

    The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...

  2. Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.

    Science.gov (United States)

    Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong

    2017-02-01

    (1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis

  3. Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.

    Science.gov (United States)

    Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena

    2015-04-01

    Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

    2017-11-01

    The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  5. The Dual Activity Responsible for the Elongation and Branching of β-(1,3-Glucan in the Fungal Cell Wall

    Directory of Open Access Journals (Sweden)

    Vishukumar Aimanianda

    2017-06-01

    Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.

  6. Characterization of oat beta-glucan and coenzyme Q10-loaded beta-glucan powders generated by the pressurized gas-expanded liquid (PGX) technology.

    Science.gov (United States)

    Liu, Nian; Couto, Ricardo; Seifried, Bernhard; Moquin, Paul; Delgado, Luis; Temelli, Feral

    2018-04-01

    The physicochemical properties of the oat beta-glucan powder (BG) and coenzyme Q10 (CoQ10)-loaded BG powder (L-BG) produced by the pressurized gas-expanded liquid (PGX) technology were studied. Helium ion microscope, differential scanning calorimeter, X-ray diffractometer, AutoSorb iQ and rheometer were used to determine the particle morphology, thermal properties, crystallinity, surface area and viscosity, respectively. Both BG (7.7μm) and L-BG (6.1μm) were produced as micrometer-scale particles, while CoQ10 nanoparticles (92nm) were adsorbed on the porous structure of L-BG. CoQ10 was successfully loaded onto BG using the PGX process via adsorptive precipitation mainly in its amorphous form. Viscosity of BG and L-BG solutions (0.15%, 0.2%, 0.3% w/v) displayed Newtonian behavior with increasing shear rate but decreased with temperature. Detailed characterization of the physicochemical properties of combination ingredients like L-BG will lead to the development of novel functional food and natural health product applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Effects of Low Molecular Weight Yeast β-Glucan on Antioxidant and Immunological Activities in Mice

    Directory of Open Access Journals (Sweden)

    Na Lei

    2015-09-01

    Full Text Available To evaluate the antioxidant and immune effects of low molecular yeast β-glucan on mice, three sulfated glucans from Saccharomyces cerevisiae (sGSCs with different molecular weight (MW and degrees of sulfation (DS were prepared. The structures of the sGSCs were analyzed through high performance liquid chromatography-gel permeation chromatography (HPLC-GPC and Fourier transform infrared spectroscopy (FTIR. sGSC1, sGSC2, and sGSC3 had MW of 12.9, 16.5 and 19.2 kDa, respectively, and DS of 0.16, 0.24 and 0.27, respectively. In vitro and in vivo experiments were conducted to evaluate the antioxidant and immunological activities of the sGSCs. In vitro experiment, the reactive oxygen species (ROS scavenging activities were determined. In vivo experiment, 50 male BALB/c mice were divided into five groups. The sGSC1, sGSC2 and sGSC3 treatment groups received the corresponding sGSCs at 50 mg/kg/day each. The GSC (glucans from Saccharomyces cerevisiae treatment group received 50 mg/kg/day GSC. The normal control group received equal volume of physiological saline solution. All treatments were administered intragastrically for 14 day. Results showed that sGSC1, sGSC2 and sGSC3 can scavenge 1,1-diphenyl-2-picryl-hydrazyl (DPPH, superoxide, and hydroxyl radicals in vitro. The strength of the radical scavenging effects of the sGSCs was in the order of sGSC1 > sGSC2 > sGSC3. Oral administration of sGSC1 significantly improved serum catalase (CAT and glutathione peroxidase (GSH-Px activities and decreased malondialdehyde (MDA level in mice. sGSC1 significantly improved the spleen and thymus indexes and the lymphocyte proliferation, effectively enhanced the percentage of CD4+ T cells, decreased the percentage of CD8+ T cells, and elevated the CD4+/CD8+ ratio. sGSC1 significantly promoted the secretion of IL-2 and IFN-γ. These results indicate that sGSC1 with low MW and DS has better antioxidant and immunological activities than the other sGSCs, and sGSC1 could

  8. Structure elucidation and immunomodulatory activity of a beta glucan from the fruiting bodies of Ganoderma sinense.

    Directory of Open Access Journals (Sweden)

    Xiao-Qiang Han

    Full Text Available A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4- and (1→6-Glcp, bearing terminal- and (1→3-Glcp side-chains at O-3 position of (1→6-Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells.

  9. First principles insight into the α-glucan structures of starch

    DEFF Research Database (Denmark)

    Damager, Iben; Engelsen, Søren Balling; Blennow, Andreas

    2010-01-01

    A study was conducted to demonstrate the synthesis, conformation, and hydration of the α-glucan structures of starch. Starch and glycogen were synthesized by sets of specific enzyme activities that directly determined their molecular structures and physical properties. It was demonstrated...... that the extent of crystallinity, aggregation and hydration was of fundamental importance for starch and its human analogue glycogen. Starch was deposited in the plant as a stable form in highly organized and semicrystalline granules having specific crystalline polymorphs as determined by powder X......-ray crystallography. The investigations mainly focused on the bottom-up approach of synthesis, conformation, and hydration of starch. Starch and glycogen were found to be polymers that were built up from a single monomer, D-glucopyranose, or for short D-glucose....

  10. Defects in rhizobial cyclic glucan and lipopolysaccharide synthesis alter legume gene expression during nodule development

    DEFF Research Database (Denmark)

    D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene

    2008-01-01

    cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...

  11. Structure Elucidation and Immunomodulatory Activity of A Beta Glucan from the Fruiting Bodies of Ganoderma sinense

    Science.gov (United States)

    Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin

    2014-01-01

    A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571

  12. Circulation of Pneumocystis dihydropteroate synthase mutants in France.

    Science.gov (United States)

    Le Gal, Solène; Damiani, Céline; Perrot, Maëla; Rouillé, Amélie; Virmaux, Michèle; Quinio, Dorothée; Moalic, Elodie; Saliou, Philippe; Berthou, Christian; Le Meur, Yann; Totet, Anne; Nevez, Gilles

    2012-10-01

    Data on the prevalence of Pneumocystis jirovecii (P. jirovecii) dihydropteroate synthase (DHPS) mutants in France are still limited. In this study, mutant prevalence in the Brest region (western France) was determined. Archival pulmonary specimens from 85 patients infected with P. jirovecii and admitted to our institution (University Hospital, Brest) from October 2007 to February 2010 were retrospectively typed at the DHPS locus using a polymerase chain reaction-restriction fragment length polymorphism assay. Type identification was successful in 66 of 85 patients. Sixty-four patients were infected with a wild type, whereas mutants were found in 2 patients (2/66, 3%). Medical chart analysis revealed that these 2 patients usually lived in Paris. Another patient usually lived on the French Riviera, whereas 63 patients were from the city of Brest. Thus, the corrected prevalence of mutants in patients who effectively lived in our geographic area was 0% (0/63). Taking into account that i) Paris is characterized by a high prevalence of mutants from 18.5% to 40%, ii) infection diagnoses were performed in the 2 Parisians during their vacation Paris to Brest through infected vacationers. The study shows that the usual city of patient residence, rather than the city of infection diagnosis, is a predictor of mutants and that P. jirovecii infections involving mutants do not represent a public health issue in western France. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  14. Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study

    DEFF Research Database (Denmark)

    Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus

    1991-01-01

    Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...

  15. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...

  16. Contribution of glucan-binding protein A to firm and stable biofilm formation by Streptococcus mutans.

    Science.gov (United States)

    Matsumi, Y; Fujita, K; Takashima, Y; Yanagida, K; Morikawa, Y; Matsumoto-Nakano, M

    2015-06-01

    Glucan-binding proteins (Gbps) of Streptococcus mutans, a major pathogen of dental caries, mediate the binding of glucans synthesized from sucrose by the action of glucosyltransferases (GTFs) encoded by gtfB, gtfC, and gtfD. Several stress proteins, including DnaK and GroEL encoded by dnaK and groEL, are related to environmental stress tolerance. The contribution of Gbp expression to biofilm formation was analyzed by focusing on the expression levels of genes encoding GTFs and stress proteins. Biofilm-forming assays were performed using GbpA-, GbpB-, and GbpC-deficient mutant strains and the parental strain MT8148. The expression levels of gtfB, gtfC, gtfD, dnaK, and groEL were evaluated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Furthermore, the structure of biofilms formed by these Gbp-deficient mutant strains was observed using confocal laser scanning microscopy (CLSM). Biofilm-forming assay findings demonstrated that the amount formed by the GbpA-deficient mutant strain (AD1) was nearly the same as that by the parental strain, while the GbpB- and GbpC-deficient mutant strains produced lower amounts than MT8148. Furthermore, RT-qPCR assay results showed that the expressions of gtfB, dnaK, and groEL in AD1 were elevated compared with MT8148. CLSM also revealed that the structure of biofilm formed by AD1 was prominently different compared with that formed by the parental strain. These results suggest that a defect in GbpA influences the expression of genes controlling biofilm formation, indicating its importance as a protein for firm and stable biofilm formation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Antifungal Properties of Cationic Phenylene Ethynylenes and Their Impact on β-Glucan Exposure.

    Science.gov (United States)

    Pappas, Harry C; Sylejmani, Rina; Graus, Matthew S; Donabedian, Patrick L; Whitten, David G; Neumann, Aaron K

    2016-08-01

    Candida species are the cause of many bloodstream infections through contamination of indwelling medical devices. These infections account for a 40% mortality rate, posing a significant risk to immunocompromised patients. Traditional treatments against Candida infections include amphotericin B and various azole treatments. Unfortunately, these treatments are associated with high toxicity, and resistant strains have become more prevalent. As a new frontier, light-activated phenylene ethynylenes have shown promising biocidal activity against Gram-positive and -negative bacterial pathogens, as well as the environmental yeast Saccharomyces cerevisiae In this study, we monitored the viability of Candida species after treatment with a cationic conjugated polymer [poly(p-phenylene ethynylene); PPE] or oligomer ["end-only" oligo(p-phenylene ethynylene); EO-OPE] by flow cytometry in order to explore the antifungal properties of these compounds. The oligomer was found to disrupt Candida albicans yeast membrane integrity independent of light activation, while PPE is able to do so only in the presence of light, allowing for some control as to the manner in which cytotoxic effects are induced. The contrast in killing efficacy between the two compounds is likely related to their size difference and their intrinsic abilities to penetrate the fungal cell wall. Unlike EO-OPE-DABCO (where DABCO is quaternized diazabicyclo[2,2,2]octane), PPE-DABCO displayed a strong propensity to associate with soluble β-glucan, which is expected to inhibit its ability to access and perturb the inner cell membrane of Candida yeast. Furthermore, treatment with PPE-DABCO unmasked Candida albicans β-glucan and increased phagocytosis by Dectin-1-expressing HEK-293 cells. In summary, cationic phenylene ethynylenes show promising biocidal activity against pathogenic Candida yeast cells while also exhibiting immunostimulatory effects. Copyright © 2016, American Society for Microbiology. All Rights

  18. Prospective Evaluation of Serum β-Glucan Testing in Patients With Probable or Proven Fungal Diseases

    Science.gov (United States)

    Angebault, Cécile; Lanternier, Fanny; Dalle, Frédéric; Schrimpf, Cécile; Roupie, Anne-Laure; Dupuis, Aurélie; Agathine, Aurélie; Scemla, Anne; Paubelle, Etienne; Caillot, Denis; Neven, Bénédicte; Frange, Pierre; Suarez, Felipe; d'Enfert, Christophe; Lortholary, Olivier; Bougnoux, Marie-Elisabeth

    2016-01-01

    Background. Early diagnosis and treatment are crucial in invasive fungal diseases (IFD). Serum (1-3)-β-d-glucan (BG) is believed to be an early IFD marker, but its diagnostic performance has been ambiguous, with insufficient data regarding sensitivity at the time of IFD diagnosis (TOD) and according to outcome. Whether its clinical utility is equivalent for all types of IFD remains unknown. Methods. We included 143 patients with proven or probable IFD (49 invasive candidiasis, 45 invasive aspergillosis [IA], and 49 rare IFD) and analyzed serum BG (Fungitell) at TOD and during treatment. Results. (1-3)-β-d-glucan was undetectable at TOD in 36% and 48% of patients with candidemia and IA, respectively; there was no correlation between negative BG results at TOD and patients' characteristics, localization of infection, or prior antifungal use. Nevertheless, patients with candidemia due to Candida albicans were more likely to test positive for BG at TOD (odds ratio = 25.4, P = .01) than patients infected with other Candida species. In 70% of the patients with a follow-up, BG negativation occurred in >1 month for candidemia and >3 months for IA. A slower BG decrease in patients with candidemia was associated with deep-seated localizations (P = .04). Thirty-nine percent of patients with rare IFD had undetectable BG at TOD; nonetheless, all patients with chronic subcutaneous IFD tested positive at TOD. Conclusions. Undetectable serum BG does not rule out an early IFD, when the clinical suspicion is high. After IFD diagnostic, kinetics of serum BG are difficult to relate to clinical outcome. PMID:27419189

  19. Recent Advances in the Development of Mammalian Geranylgeranyl Diphosphate Synthase Inhibitors

    Directory of Open Access Journals (Sweden)

    Staci L. Haney

    2017-05-01

    Full Text Available The enzyme geranylgeranyl diphosphate synthase (GGDPS catalyzes the synthesis of the 20-carbon isoprenoid geranylgeranyl diphosphate (GGPP. GGPP is the isoprenoid donor for protein geranylgeranylation reactions catalyzed by the enzymes geranylgeranyl transferase (GGTase I and II. Inhibitors of GGDPS result in diminution of protein geranylgeranylation through depletion of cellular GGPP levels, and there has been interest in GGDPS inhibitors as potential anti-cancer agents. Here we discuss recent advances in the development of GGDPS inhibitors, including insights gained by structure-function relationships, and review the preclinical data that support the continued development of this novel class of drugs.

  20. Evolutionary history of callose synthases in terrestrial plants with emphasis on proteins involved in male gametophyte development.

    Directory of Open Access Journals (Sweden)

    Lenka Záveská Drábková

    Full Text Available Callose is a plant-specific polysaccharide (β-1,3-glucan playing an important role in angiosperms in many developmental processes and responses to biotic and abiotic stresses. Callose is synthesised at the plasma membrane of plant cells by callose synthase (CalS and, among others, represents the main polysaccharide in the callose wall surrounding the tetrads of developing microspores and in the growing pollen tube wall. CalS proteins involvement in spore development is a plesiomorphic feature of terrestrial plants, but very little is known about their evolutionary origin and relationships amongst the members of this protein family. We performed thorough comparative analyses of callose synthase family proteins from major plant lineages to determine their evolutionary history across the plant kingdom. A total of 1211 candidate CalS sequences were identified and compared amongst diverse taxonomic groups of plants, from bryophytes to angiosperms. Phylogenetic analyses identified six main clades of CalS proteins and suggested duplications during the evolution of specialised functions. Twelve family members had previously been identified in Arabidopsis thaliana. We focused on five CalS subfamilies directly linked to pollen function and found that proteins expressed in pollen evolved twice. CalS9/10 and CalS11/12 formed well-defined clades, whereas pollen-specific CalS5 was found within subfamilies that mostly did not express in mature pollen vegetative cell, although were found in sperm cells. Expression of five out of seven mature pollen-expressed CalS genes was affected by mutations in bzip transcription factors. Only three subfamilies, CalS5, CalS10, and CalS11, however, formed monophyletic, mostly conserved clades. The pairs CalS9/CalS10, CalS11/CalS12 and CalS3 may have diverged after angiosperms diversified from lycophytes and bryophytes. Our analysis of fully sequenced plant proteins identified new evolutionary lineages of callose synthase

  1. Insights into the reactivation of cobalamin-dependent methionine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Koutmos, Markos; Datta, Supratim; Pattridge, Katherine A.; Smith, Janet L.; Matthews, Rowena G.; (Michigan)

    2009-12-10

    Cobalamin-dependent methionine synthase (MetH) is a modular protein that catalyzes the transfer of a methyl group from methyltetrahydrofolate to homocysteine to produce methionine and tetrahydrofolate. The cobalamin cofactor, which serves as both acceptor and donor of the methyl group, is oxidized once every {approx}2,000 catalytic cycles and must be reactivated by the uptake of an electron from reduced flavodoxin and a methyl group from S-adenosyl-L-methionine (AdoMet). Previous structures of a C-terminal fragment of MetH (MetH{sup CT}) revealed a reactivation conformation that juxtaposes the cobalamin- and AdoMet-binding domains. Here we describe 2 structures of a disulfide stabilized MetH{sup CT} ({sub s-s}MetH{sup CT}) that offer further insight into the reactivation of MetH. The structure of {sub s-s}MetH{sup CT} with cob(II)alamin and S-adenosyl-L-homocysteine represents the enzyme in the reactivation step preceding electron transfer from flavodoxin. The structure supports earlier suggestions that the enzyme acts to lower the reduction potential of the Co(II)/Co(I) couple by elongating the bond between the cobalt and its upper axial water ligand, effectively making the cobalt 4-coordinate, and illuminates the role of Tyr-1139 in the stabilization of this 4-coordinate state. The structure of {sub s-s}MetH{sub CT} with aquocobalamin may represent a transient state at the end of reactivation as the newly remethylated 5-coordinate methylcobalamin returns to the 6-coordinate state, triggering the rearrangement to a catalytic conformation.

  2. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage

    Directory of Open Access Journals (Sweden)

    Nevzat Selim Gokay

    2016-01-01

    Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.

  3. Feeding common carp Cyprinus carpio with β-glucan supplemented diet stimulates C-reactive protein and complement immune acute phase responses following PAMPs injection.

    Science.gov (United States)

    Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J; Shrive, Annette K; Hoole, Dave

    2014-08-01

    The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight or with control food for 25 days and then injected with PBS containing either LPS (4 mg/kg) or poly(I:C) (5 mg/kg) or PBS alone. Fish were sampled during the 25 days of the feeding period and up to 7 days post-PAMPs injections for serum and liver, head kidney and mid-gut tissues. Oral administration of β-glucan for 25 days significantly increased serum CRP levels and alternative complement activity (ACP). In addition, the subsequent LPS and poly(I:C) challenges significantly affected CRP and complement related gene expression profiles (crp1, crp2, c1r/s, bf/c2, c3 and masp2), with the greatest effects observed in the β-glucan fed fish. However, in fish fed β-glucan the PAMPs injections had less effects on CRP levels and complement activity in the serum than in control fed fish, suggesting that the 25 days of β-glucan immunostimulation was sufficient enough to reduce the effects of LPS and poly(I:C) injections. Results suggest that MacroGard® stimulated CRP and complement responses to PAMPs immunological challenges in common carp thus highlighting the beneficial β-glucan immunostimulant properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

    Science.gov (United States)

    Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

    2017-12-05

    Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  5. Study on preparation and effect of oligoβ-glucan and oligochitosan on immune stimulation white patches in the internal organs disease on Tra catfish (Pangasianodon hypophthalmus)

    International Nuclear Information System (INIS)

    Nguyen Ngoc Duy; Dang Van Phu; Nguyen Thi Kim Lan; Nguyen Quoc Hien; Pham Duy Hai

    2015-01-01

    Oligoβ-glucan and oligochitosan were prepared by gamma Co-60 irradiation of β-glucan/H_2O_2 and chitosan/H_2O_2 solution. The efficiency of the degradation process was determined by gel permeation chromatography (GPC) method. Results showed that the Mw decreased with increasing concentration of H_2O_2 and doses. For oligoβ-glucan, Mw reduced from 56.7 kDa to 7.1 kDa when β-glucan 10%/H_2O_2 1% solution was irradiated at 14 kGy. For oligochitosan, Mw reduced from 45.5 kDa to 5.0 kDa when chitosan 5%/H_2O_2 0.5% solution was irradiated at 21 kGy. Tra catfish (Pangasianodon hypophthalmus) was fed with oligoβ-glucan and oligochitosan in various concentrations of 0, 50, 100, and 200 mg/kg feed for 45 days and then was challenged with Edwardsiella ictaluri bacteria to investigate immune stimulation effect against white patches in the internal organs disease. The results indicated that oligoβ-glucan and oligochitosan exhibited good immune stimulation effect with optimum concentration of 100 mg/kg feed. Survival rate of Tra catfishes fed with oligochitosan and oligoβ-glucan is 47.62 ± 1.96% and 46.67 ± 2.58%, respectively. In addition, the mixture of oligochitosan 50 mg/kg + oligo?-glucan 50 mg/kg showed the highest survival rate (62.22 ± 1.96%). (author)

  6. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

    Science.gov (United States)

    Ober, Dietrich; Hartmann, Thomas

    1999-01-01

    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  7. Dietary calcium phosphate content and oat β-glucan influence gastrointestinal microbiota, butyrate-producing bacteria and butyrate fermentation in weaned pigs.

    Science.gov (United States)

    Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G

    2011-03-01

    This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  8. In vivo evaluation of the antimutagenic and antigenotoxic effects of β-glucan extracted from Saccharomyces cerevisiae in acute treatment with multiple doses

    Directory of Open Access Journals (Sweden)

    Rodrigo Juliano Oliveira

    2013-01-01

    Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.

  9. Oral beta-glucan adjuvant therapy converts nonprotective Th2 response to protective Th1 cell-mediated immune response in mammary tumor-bearing mice.

    Directory of Open Access Journals (Sweden)

    Gordon D Ross

    2007-06-01

    Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.

  10. Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ).

    Science.gov (United States)

    Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

    2016-12-17

    Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.

  11. Nitric oxide synthase gene G298 allele

    International Nuclear Information System (INIS)

    Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

    2004-01-01

    Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

  12. cobalt (ii), nickel (ii)

    African Journals Online (AJOL)

    DR. AMINU

    Department of Chemistry Bayero University, P. M. B. 3011, Kano, Nigeria. E-mail: hnuhu2000@yahoo.com. ABSTRACT. The manganese (II), cobalt (II), nickel (II) and .... water and common organic solvents, but are readily soluble in acetone. The molar conductance measurement [Table 3] of the complex compounds in.

  13. Evolution of Conifer Diterpene Synthases: Diterpene Resin Acid Biosynthesis in Lodgepole Pine and Jack Pine Involves Monofunctional and Bifunctional Diterpene Synthases1[W][OA

    Science.gov (United States)

    Hall, Dawn E.; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L.; Yuen, Macaire; Bohlmann, Jörg

    2013-01-01

    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714

  14. Evolution of conifer diterpene synthases: diterpene resin acid biosynthesis in lodgepole pine and jack pine involves monofunctional and bifunctional diterpene synthases.

    Science.gov (United States)

    Hall, Dawn E; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L; Yuen, Macaire; Bohlmann, Jörg

    2013-02-01

    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs.

  15. An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

    Science.gov (United States)

    Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

    2017-06-15

    Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

  16. Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan.

    Science.gov (United States)

    Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A

    2016-11-01

    At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Evaluation of the Efficiency of Different Disruption Methods on Yeast Cell Wall Preparation for β-Glucan Isolation

    Directory of Open Access Journals (Sweden)

    Anna Bzducha-Wróbel

    2014-12-01

    Full Text Available Selected methods for yeast cell disruption were evaluated to establish their suitability for cell wall preparation in the process of β-glucan isolation. The effect of different disruption methods on contents of total saccharides, β-glucans and proteins in the produced cell walls preparations was analyzed. The degree of cell wall purification from intracellular components was established on the basis of the ratio of solubilised material. The investigated methods included: cell exposure to hot water (autoclaving, thermally-induced autolysis, homogenization in a bead mill, sonication and their combinations. Experimental systems were prepared in water (pH 5.0 and pH 7.0 and Tris-HCl buffer (pH 8.0. The Saccharomyces cerevisiae yeast cell wall preparations with the highest degree of cytosol component release and purification of β-glucans were produced by 30 min of cell homogenization with zirconium-glass beads (0.5 mm in diameter. This was confirmed by the highest ratio of solubilised material (approx. 64%–67%. The thus-produced preparations contained ca. 60% of total saccharides, 13%–14% of β(1,3/(1,6-glucans, and approx. 35% of crude proteins. Similar results were obtained after autolysis coupled with bead milling as well as with sonication, but the time required for these processes was more than 24 h. Homogenization in a bead mill could be valuable for general isolation procedures because allows one to eliminate the different autolytic activity of various yeast strains.

  18. Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

    Science.gov (United States)

    Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

    2017-02-01

    Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan

    OpenAIRE

    Mekoue Nguela, Julie; Poncet-Legrand, Celine; Sieczkowski, N.; Vernhet, Aude

    2016-01-01

    At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored b...

  20. Rational Design of Adjuvant for Skin Delivery: Conjugation of Synthetic β-Glucan Dectin-1 Agonist to Protein Antigen.

    Science.gov (United States)

    Donadei, Agnese; Gallorini, Simona; Berti, Francesco; O'Hagan, Derek T; Adamo, Roberto; Baudner, Barbara C

    2015-05-04

    The potential benefits of skin delivery of vaccines derive from the presence of a densely connected network of antigen presenting cells in the skin layer, most significantly represented by Langerhans cells and dermal dendritic cells. Targeting these cells by adjuvant conjugated to an antigen should result in enhanced immunogenicity of a vaccine. Since one of the most widely used adjuvants is an insoluble salt of aluminum (aluminum hydroxide) that cannot be used for skin delivery due to reactogenicity, we focused our attention on agonists of receptors present on skin dendritic cells, including the Dectin-1 receptor. β-(1-3)-glucans, which are the most abundant components of the fungal surface, are known to activate the innate immune response by interaction with the C-type lectin-like Dectin-1 receptor. In this work we identified by rational design a well-defined synthetic β-(1-3)-glucan hexasaccharide as a Dectin-1 agonist and chemically conjugated it to the genetically detoxified diphtheria toxin (CRM197) protein antigen, as a means to increase the binding to Dectin-1 receptor and to target to skin dendritic cells. We demonstrated that the in vitro activation of the receptor was significantly impacted by the presentation of the glucan on the protein carrier. In vivo results in mice showed that the conjugation of the synthetic β-(1-3)-glucan when delivered intradermally resulted in higher antibody titers in comparison to intramuscular (i.m.) immunization and was not different from subcutaneous (s.c.) delivery. These findings suggest that weak receptor binders can be turned into more potent agonists by the multivalent presentation of many ligands covalently conjugated to the protein core. Moreover, this approach is particularly valuable to increase the immunogenicity of antigens administered via skin delivery.

  1. Glucan, Water Dikinase Activity Stimulates Breakdown of Starch Granules by Plastidial β-Amylases1[W][OA

    Science.gov (United States)

    Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard

    2007-01-01

    Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522

  2. Comparative Analysis of ?-Oryzanol, ?-Glucan, Total Phenolic Content and Antioxidant Activity in Fermented Rice Bran of Different Varieties

    OpenAIRE

    Jung, Tae-Dong; Shin, Gi-Hae; Kim, Jae-Min; Choi, Sun-Il; Lee, Jin-Ha; Lee, Sang Jong; Park, Seon Ju; Woo, Koan Sik; Oh, Sea Kwan; Lee, Ok-Hawn

    2017-01-01

    Rice bran, a by-product derived from processing rice, is a rich source of bioactive compounds. Recent studies have suggested that the fermentation can improve their biological activities. This study aimed to determined the level of γ-oryzanol, β-glucan and total phenol contents of fermented rice bran from 21 Korean varieties, as well as to evaluate their antioxidant activities. We also assessed the validation of the analytical method for determining γ-oryzanol content in fermented rice brans....

  3. Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

    Science.gov (United States)

    Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

    2012-04-13

    Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

  4. Generation and Functional Evaluation of Designer Monoterpene Synthases.

    Science.gov (United States)

    Srividya, N; Lange, I; Lange, B M

    2016-01-01

    Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.

  5. Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

    International Nuclear Information System (INIS)

    Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi

    2010-01-01

    The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

  6. Phosphorylation of inhibitor-2 and activation of MgATP-dependent protein phosphatase by rat skeletal muscle glycogen synthase kinase

    International Nuclear Information System (INIS)

    Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.

    1986-01-01

    Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca 2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32 P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32 P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor

  7. β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake

    Directory of Open Access Journals (Sweden)

    Asli Akyol

    2014-09-01

    Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

  8. Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

    Science.gov (United States)

    Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

    2017-07-18

    Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

  9. Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus.

    Science.gov (United States)

    de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello

    2017-12-20

    A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5  Da with a random coil conformation for molecular weights below 1 × 10 6  Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.

  10. Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan.

    Science.gov (United States)

    Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité

    2017-02-01

    Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet

    Directory of Open Access Journals (Sweden)

    Jie Zheng

    2013-12-01

    Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.

  12. Effect of supplementation of Manno-Oligosaccharide and b-glucans on maize based meal on commercial broilers

    Directory of Open Access Journals (Sweden)

    R.C.Shendare

    2008-01-01

    Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15

  13. β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.

    Science.gov (United States)

    Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju

    2014-09-23

    The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

  14. Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.

    Science.gov (United States)

    Alwis, K U; Mandryk, J; Hocking, A D

    1999-09-01

    Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.

  15. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Nitrite reductase activity and inhibition of H₂S biogenesis by human cystathionine ß-synthase.

    Directory of Open Access Journals (Sweden)

    Carmen Gherasim

    Full Text Available Nitrite was recognized as a potent vasodilator >130 years and has more recently emerged as an endogenous signaling molecule and modulator of gene expression. Understanding the molecular mechanisms that regulate nitrite metabolism is essential for its use as a potential diagnostic marker as well as therapeutic agent for cardiovascular diseases. In this study, we have identified human cystathionine ß-synthase (CBS as a new player in nitrite reduction with implications for the nitrite-dependent control of H₂S production. This novel activity of CBS exploits the catalytic property of its unusual heme cofactor to reduce nitrite and generate NO. Evidence for the possible physiological relevance of this reaction is provided by the formation of ferrous-nitrosyl (Fe(II-NO CBS in the presence of NADPH, the human diflavin methionine synthase reductase (MSR and nitrite. Formation of Fe(II-NO CBS via its nitrite reductase activity inhibits CBS, providing an avenue for regulating biogenesis of H₂S and cysteine, the limiting reagent for synthesis of glutathione, a major antioxidant. Our results also suggest a possible role for CBS in intracellular NO biogenesis particularly under hypoxic conditions. The participation of a regulatory heme cofactor in CBS in nitrite reduction is unexpected and expands the repertoire of proteins that can liberate NO from the intracellular nitrite pool. Our results reveal a potential molecular mechanism for cross-talk between nitrite, NO and H₂S biology.

  17. HOMOLOGY MODELING AND FUNCTIONAL CHARACTERIZATION OF THREE-DIMENSIONAL STRUCTURE OF DAHP SYNTHASE FROM BRACHYPODIUM DISTACHYON

    Directory of Open Access Journals (Sweden)

    Aditya Dev

    2013-06-01

    Full Text Available The Shikimate pathway is an attractive target for herbicides and antimicrobial agents because it is essential in microbes and plants but absent in animals. The 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase (DAHPS is the first enzyme of this pathway, which is involved in the condensation of phosphoenolpyruvate (PEP and D-erythrose 4-phosphate (E4P to produce 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP. DAHPS enzymes have been divided into two types, class I and class II, based on their primary amino acid sequence and three dimensional structures. The plant DAHPS belongs to class II and is regulated differently than DAHPS from microorganisms. To understand the structural basis of such differences in DAHPS from plants and its catalytic mechanism, we have used sequence analysis, homology modeling and docking approach to generate the three dimensional models of DAHP synthase from Brachypodium distachyon (Bd-DAHPS complexed with substrate PEP for the first time. The three dimensional models of Bd-DAHPS provides a detailed knowledge of the active site and the important secondary structural regions that play significant roles in the regulatory mechanism and further may be helpful for design of specific inhibitors towards herbicide development.

  18. Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

    Science.gov (United States)

    Boulos, Samy; Nyström, Laura

    2017-11-01

    The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO

  19. Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

    Science.gov (United States)

    Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

    2018-04-03

    Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which

  20. Isolation of developing secondary xylem specific cellulose synthase ...

    Indian Academy of Sciences (India)

    The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.

  1. Cloning and expression of pineapple sucrose- phosphate synthase ...

    African Journals Online (AJOL)

    hope&shola

    2010-12-06

    Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

  2. Immune Enhancing Activity of β-(1,3)-Glucan Isolated from Genus Agrobacterium in Bone-Marrow Derived Macrophages and Mice Splenocytes.

    Science.gov (United States)

    Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun

    2016-01-01

    An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.

  3. Enhancement of the immunity and body weight gain in broiler by feeding with the brewer yeast β-glucan degraded by gamma Co-60 radiation

    International Nuclear Information System (INIS)

    Le Quang Luan; Nguyen Thanh Long

    2015-01-01

    The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)

  4. Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

    Science.gov (United States)

    Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

    2014-01-01

    Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Prostaglandin endoperoxide H synthases: peroxidase hydroperoxide specificity and cyclooxygenase activation.

    Science.gov (United States)

    Liu, Jiayan; Seibold, Steve A; Rieke, Caroline J; Song, Inseok; Cukier, Robert I; Smith, William L

    2007-06-22

    The cyclooxygenase (COX) activity of prostaglandin endoperoxide H synthases (PGHSs) converts arachidonic acid and O2 to prostaglandin G2 (PGG2). PGHS peroxidase (POX) activity reduces PGG2 to PGH2. The first step in POX catalysis is formation of an oxyferryl heme radical cation (Compound I), which undergoes intramolecular electron transfer forming Intermediate II having an oxyferryl heme and a Tyr-385 radical required for COX catalysis. PGHS POX catalyzes heterolytic cleavage of primary and secondary hydroperoxides much more readily than H2O2, but the basis for this specificity has been unresolved. Several large amino acids form a hydrophobic "dome" over part of the heme, but when these residues were mutated to alanines there was little effect on Compound I formation from H2O2 or 15-hydroperoxyeicosatetraenoic acid, a surrogate substrate for PGG2. Ab initio calculations of heterolytic bond dissociation energies of the peroxyl groups of small peroxides indicated that they are almost the same. Molecular Dynamics simulations suggest that PGG2 binds the POX site through a peroxyl-iron bond, a hydrogen bond with His-207 and van der Waals interactions involving methylene groups adjoining the carbon bearing the peroxyl group and the protoporphyrin IX. We speculate that these latter interactions, which are not possible with H2O2, are major contributors to PGHS POX specificity. The distal Gln-203 four residues removed from His-207 have been thought to be essential for Compound I formation. However, Q203V PGHS-1 and PGHS-2 mutants catalyzed heterolytic cleavage of peroxides and exhibited native COX activity. PGHSs are homodimers with each monomer having a POX site and COX site. Cross-talk occurs between the COX sites of adjoining monomers. However, no cross-talk between the POX and COX sites of monomers was detected in a PGHS-2 heterodimer comprised of a Q203R monomer having an inactive POX site and a G533A monomer with an inactive COX site.

  6. Modulation of hyaluronan synthase activity in cellular membrane fractions

    OpenAIRE

    Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto

    2009-01-01

    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...

  7. Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision

    Science.gov (United States)

    2013-05-01

    acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for

  8. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    Science.gov (United States)

    2012-05-01

    compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR

  9. Homocystinuria due to cystathionine beta synthase deficiency

    Directory of Open Access Journals (Sweden)

    Rao T

    2008-01-01

    Full Text Available A two year-old male child presented with cutis marmorata congenita universalis, brittle hair, mild mental retardation, and finger spasms. Biochemical findings include increased levels of homocysteine in the blood-106.62 µmol/L (normal levels: 5.90-16µmol/L. Biochemical tests such as the silver nitroprusside and nitroprusside tests were positive suggesting homocystinuria. The patient was treated with oral pyridoxine therapy for three months. The child responded well to this therapy and the muscle spasms as well as skin manifestations such as cutis marmorata subsided. The treatment is being continued; the case is reported here because of its rarity. Homocysteinuria arising due to cystathionine beta-synthase (CBS deficiency is an autosomal recessive disorder of methionine metabolism that produces increased levels of urinary homocysteine and methionine It manifests itself in vascular, central nervous system, cutaneous, and connective tissue disturbances and phenotypically resembles Marfan′s syndrome. Skin manifestations include malar flush, thin hair, and cutis reticulata / marmorata.

  10. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  11. Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.

    Science.gov (United States)

    Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung

    2016-04-01

    The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®

  12. A Proinflammatory Effect of the β-Glucan from Pleurotus cornucopiae Mushroom on Macrophage Action

    Directory of Open Access Journals (Sweden)

    Ken-ichiro Minato

    2017-01-01

    Full Text Available PCPS from P. citrinopileatus mushroom extract is a β-1,6-glucan possessing a proinflammatory effect on innate immune cells. The PCPS stimulated THP-1 macrophages to secrete significant levels of TNF. Moreover, the mRNA expressions of TNF and IL-1β were significantly enhanced by PCPS treatment. However, the PCPS did not induce to express both IL-12 and IL-10 mRNA in the macrophages. Next, the P. cornucopiae extract (containing mainly PCPS treatment against mice showed significant increases in TNF and IL-1β mRNA expressions in the peritoneal macrophages of them. In this study, the expression levels of IFNγ mRNA in the spleen were almost the same between the extract- (PCPS- treated group and control group. However, the expression of IL-4 mRNA showed a lower level in the extract-treated group than that in the control. Our results suggested that the PCPS could induce proinflammatory action in the immune response. In addition, the proinflammatory effect of the PCPS on THP-1 was enhanced by 5′-GMP-Na, while it was reduced by vitamin D2. These two compounds are majorly contained in the P. citrinopileatus mushroom. Therefore, these results suggested that the P. citrinopileatus mushroom might contain other immune regulative compounds, such as vitamin D2, as well as PCPS.

  13. Incorporation of β-glucans in meat emulsions through an optimal mixture modeling systems.

    Science.gov (United States)

    Vasquez Mejia, Sandra M; de Francisco, Alicia; Manique Barreto, Pedro L; Damian, César; Zibetti, Andre Wüst; Mahecha, Hector Suárez; Bohrer, Benjamin M

    2018-05-22

    The effects of β-glucans (βG) in beef emulsions with carrageenan and starch were evaluated using an optimal mixture modeling system. The best mathematical models to describe the cooking loss, color, and textural profile analysis (TPA) were selected and optimized. The cubic models were better to describe the cooking loss, color, and TPA parameters, with the exception of springiness. Emulsions with greater levels of βG and starch had less cooking loss (54 and <62), and greater hardness, cohesiveness and springiness values. Subsequently, during the optimization phase, the use of carrageenan was eliminated. The optimized emulsion contained 3.13 ± 0.11% βG, which could cover the intake daily of βG recommendations. However, the hardness of the optimized emulsion was greater (60,224 ± 1025 N) than expected. The optimized emulsion had a homogeneous structure and normal thermal behavior by DSC and allowed for the manufacture of products with high amounts of βG and desired functional attributes. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Development of cosmetic formulations containing glucan polymer of Cassava (Manihot esculenta: stability and sensory analysis

    Directory of Open Access Journals (Sweden)

    Luisa M. Manço

    2014-12-01

    Full Text Available The aim of this study was the development, rheological behaviour determination, and sensory analysis of cosmetic formulations containing glucan biopolymer (Manihot esculenta, a tensor agent that was proposed to produce an immediate lifting and smoothing effect. For this purpose, formulations were developed and supplemented or not with 4 % of hydrolysed Manihot esculenta tuber extract and submitted to preliminary stability tests. These formulations were evaluated in terms of rheological behaviour over 90 days. Sensory analysis was carried out through a research with 20 cosmetic consumers who answered a questionnaire regarding their perception to the cosmetic qualities. The formulations presented pseudoplastic behavior and were considered stable in the physical stability studies, with the exception of the gel formulation based on Ammonium Acryloyldimethyltaurate/VP Copolymer. The formulations were well evaluated in the sensory parameters. The gel formulations based on Polyacrylamide, C13- 14 Isoparaffin, and Laureth-7 were stable and presented the best sensory profile in some evaluated parameters, such as spreadability, smoothness and skin moisturizing, and can be considered an appropriate vehicle for formulations containing hydrolysed Manihot esculenta tuber extract.

  15. Fungal beta glucan protects radiation induced DNA damage in human lymphocytes.

    Science.gov (United States)

    Pillai, Thulasi G; Maurya, Dharmendra K; Salvi, Veena P; Janardhanan, Krishnankutty K; Nair, Cherupally K K

    2014-02-01

    Ganoderma lucidum (Ling Zhi), a basidiomycete white rot macrofungus has been used extensively for therapeutic use in China, Japan, Korea and other Asian countries for 2,000 years. The present study is an attempt to investigate its DNA protecting property in human lymphocytes. Beta glucan (BG) was isolated by standard procedure and the structure and composition were studied by infrared radiation (IR) and nuclear magnetic resonance (NMR) spectroscopy, gel filtration chromatography and paper chromatography. The radioprotective properties of BG isolated from the macro fungi Ganoderma lucidum was assessed by single cell gel electrophoresis (comet assay). Human lymphocytes were exposed to 0, 1, 2 and 4 Gy gamma radiation in the presence and absence of BG. The comet parameters were reduced by BG. The results indicate that the BG of G. lucidum possessed significant radioprotective activity with DNA repairing ability and antioxidant activity as the suggestive mechanism. The findings suggest the potential use of this mushroom for the prevention of radiation induced cellular damages.

  16. Adhesion of glucosyltransferase phase variants to Streptococcus gordonii bacterium-glucan substrata may involve lipoteichoic acid.

    Science.gov (United States)

    Vickerman, M M; Jones, G W

    1992-10-01

    Growing Streptococcus gordonii Spp+ phase variants, which have normal levels of glucosyltransferase (GTF) activity, use sucrose to promote their accumulation on surfaces by forming a cohesive bacterium-insoluble glucan polymer mass (BPM). Spp- phase variants, which have lower levels of GTF activity, do not form BPMs and do not remain in BPMs formed by Spp+ cells when grown in mixed cultures. To test the hypothesis that segregation of attached Spp+ and unattached Spp- cells was due to differences in adhesiveness, adhesion between washed, [3H]thymidine-labeled cells and preformed BPM substrata was measured. Unexpectedly, the results showed that cells of both phenotypes, as well as GTF-negative cells, attached equally well to preformed BPMs, indicating that attachment to BPMs was independent of cell surface GTF activity. Initial characterization of this binding interaction suggested that a protease-sensitive component on the washed cells may be binding to lipoteichoic acids sequestered in the BPM, since exogenous lipoteichoic acid inhibited adhesion. Surprisingly, the adhesion of both Spp+ and Spp- cells was markedly inhibited in the presence of sucrose, which also released lipoteichoic acid from the BPM. These in vitro findings suggest that, in vivo, sucrose and lipoteichoic acid may modify dental plaque development by enhancing or inhibiting the attachment of additional bacteria.

  17. Converting S-limonene synthase to pinene or phellandrene synthases reveals the plasticity of the active site.

    Science.gov (United States)

    Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong

    2017-05-01

    S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. β-Glucan induces reactive oxygen species production in human neutrophils to improve the killing of Candida albicans and Candida glabrata isolates from vulvovaginal candidiasis.

    Directory of Open Access Journals (Sweden)

    Patricia de Souza Bonfim-Mendonça

    Full Text Available Vulvovaginal candidiasis (VVC is among the most prevalent vaginal diseases. Candida albicans is still the most prevalent species associated with this pathology, however, the prevalence of other Candida species, such as C. glabrata, is increasing. The pathogenesis of these infections has been intensely studied, nevertheless, no consensus has been reached on the pathogenicity of VVC. In addition, inappropriate treatment or the presence of resistant strains can lead to RVVC (vulvovaginal candidiasis recurrent. Immunomodulation therapy studies have become increasingly promising, including with the β-glucans. Thus, in the present study, we evaluated microbicidal activity, phagocytosis, intracellular oxidant species production, oxygen consumption, myeloperoxidase (MPO activity, and the release of tumor necrosis factor α (TNF-α, interleukin-8 (IL-8, IL-1β, and IL-1Ra in neutrophils previously treated or not with β-glucan. In all of the assays, human neutrophils were challenged with C. albicans and C. glabrata isolated from vulvovaginal candidiasis. β-glucan significantly increased oxidant species production, suggesting that β-glucan may be an efficient immunomodulator that triggers an increase in the microbicidal response of neutrophils for both of the species isolated from vulvovaginal candidiasis. The effects of β-glucan appeared to be mainly related to the activation of reactive oxygen species and modulation of cytokine release.

  19. (1-3)(1-6)-β-glucan-enriched materials from Lentinus edodes mushroom as a high-fibre and low-calorie flour substitute for baked foods.

    Science.gov (United States)

    Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong

    2011-08-15

    Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.

  20. Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick

    2017-04-01

    Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Lactose in diet influences the degradation of mixed linked β(1-3;1-4)-D-glucan in the small intestine of pigs

    DEFF Research Database (Denmark)

    Knudsen, Knud Erik Bach

    The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...

  2. Extraction and chemical characterization of rye arabinoxylan and the effect of β-glucan on the mechanical and barrier properties of cast arabinoxylan films

    DEFF Research Database (Denmark)

    Sárossy, Zsuzsa; Tenkanen, Maija; Pitkänen, Leena

    2013-01-01

    .9 and 1.0 cm3 mm/m2 d kPa). However, the water vapor permeability increased with addition of increasing amounts of BG to WE-AX. To our knowledge, this is the first study on the effect of β-glucans on the material and permeability properties of arabinoxylan-based films. © 2012 Elsevier Ltd. All rights......Water-extractable hemicellulose (WEH) fractions, containing approximately 65% arabinoxylans (WE-AX) and 20% mixed-linkage b-glucans were isolated from rye bran. In addition, water-extractable mixedlinkage β-glucans (BG) were isolated from oat bran as a reference material. The β-glucan content....../mol. The material properties of films prepared from the rye hemicellulose isolate and WE-AX as such, or with varying amounts of added BG (20:80; 50:50; 80:20 ratios) were studied. Prior removal of β-glucan from the isolate decreased the tensile strength of the films significantly as well as the elongation at break...

  3. Sphingomyelin synthases regulate protein trafficking and secretion.

    Directory of Open Access Journals (Sweden)

    Marimuthu Subathra

    Full Text Available Sphingomyelin synthases (SMS1 and 2 represent a class of enzymes that transfer a phosphocholine moiety from phosphatidylcholine onto ceramide thus producing sphingomyelin and diacylglycerol (DAG. SMS1 localizes at the Golgi while SMS2 localizes both at the Golgi and the plasma membrane. Previous studies from our laboratory showed that modulation of SMS1 and, to a lesser extent, of SMS2 affected the formation of DAG at the Golgi apparatus. As a consequence, down-regulation of SMS1 and SMS2 reduced the localization of the DAG-binding protein, protein kinase D (PKD, to the Golgi. Since PKD recruitment to the Golgi has been implicated in cellular secretion through the trans golgi network (TGN, the effect of down-regulation of SMSs on TGN-to-plasma membrane trafficking was studied. Down regulation of either SMS1 or SMS2 significantly retarded trafficking of the reporter protein vesicular stomatitis virus G protein tagged with GFP (VSVG-GFP from the TGN to the cell surface. Inhibition of SMSs also induced tubular protrusions from the trans Golgi network reminiscent of inhibited TGN membrane fission. Since a recent study demonstrated the requirement of PKD activity for insulin secretion in beta cells, we tested the function of SMS in this model. Inhibition of SMS significantly reduced insulin secretion in rat INS-1 cells. Taken together these results provide the first direct evidence that both enzymes (SMS1 and 2 are capable of regulating TGN-mediated protein trafficking and secretion, functions that are compatible with PKD being a down-stream target for SMSs in the Golgi.

  4. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  5. A recruiting protein of geranylgeranyl diphosphate synthase controls metabolic flux toward chlorophyll biosynthesis in rice.

    Science.gov (United States)

    Zhou, Fei; Wang, Cheng-Yuan; Gutensohn, Michael; Jiang, Ling; Zhang, Peng; Zhang, Dabing; Dudareva, Natalia; Lu, Shan

    2017-06-27

    In plants, geranylgeranyl diphosphate (GGPP) is produced by plastidic GGPP synthase (GGPPS) and serves as a precursor for vital metabolic branches, including chlorophyll, carotenoid, and gibberellin biosynthesis. However, molecular mechanisms regulating GGPP allocation among these biosynthetic pathways localized in the same subcellular compartment are largely unknown. We found that rice contains only one functionally active GGPPS, OsGGPPS1, in chloroplasts. A functionally active homodimeric enzyme composed of two OsGGPPS1 subunits is located in the stroma. In thylakoid membranes, however, the GGPPS activity resides in a heterodimeric enzyme composed of one OsGGPPS1 subunit and GGPPS recruiting protein (OsGRP). OsGRP is structurally most similar to members of the geranyl diphosphate synthase small subunit type II subfamily. In contrast to members of this subfamily, OsGRP enhances OsGGPPS1 catalytic efficiency and specificity of GGPP production on interaction with OsGGPPS1. Structural biology and protein interaction analyses demonstrate that affinity between OsGRP and OsGGPPS1 is stronger than between two OsGGPPS1 molecules in homodimers. OsGRP determines OsGGPPS1 suborganellar localization and directs it to a large protein complex in thylakoid membranes, consisting of geranylgeranyl reductase (OsGGR), light-harvesting-like protein 3 (OsLIL3), protochlorophyllide oxidoreductase (OsPORB), and chlorophyll synthase (OsCHLG). Taken together, genetic and biochemical analyses suggest OsGRP functions in recruiting OsGGPPS1 from the stroma toward thylakoid membranes, thus providing a mechanism to control GGPP flux toward chlorophyll biosynthesis.

  6. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  7. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  8. Near infrared spectra indicate specific mutant endosperm genes and reveal a new mechanism for substituting starch with (1-->3,1-->4)-[beta]-glucan in barley

    DEFF Research Database (Denmark)

    Munck, L.; Møller, B.; Jacobsen, Susanne

    2004-01-01

    -->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....

  9. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Praveen Balabaskaran Nina

    2010-07-01

    Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

  10. Immunohematopoietic modulation by oral β-1,3-glucan in mice infected with Listeria monocytogenes.

    Science.gov (United States)

    Torello, Cristiane O; de Souza Queiroz, Julia; Oliveira, Sueli C; Queiroz, Mary L S

    2010-12-01

    In this study we demonstrated that the oral administration of β-1,3-glucan (Imunoglucan®) protects mice from a lethal dose of Listeria monocytogenes (LM) when administered prophylactically for 10 days at the doses of 150 and 300 mg/kg, with survival rates up to 40%. These doses also prevented the myelosuppression and the splenomegaly caused by a sublethal infection with LM, due to increased numbers of granulocyte-macrophage progenitors (CFU-GM) in the bone marrow. Investigation of the production of colony-stimulating factors revealed an increased colony-stimulating activity (CSA) in the serum of infected mice pre-treated with Imunoglucan®. The treatment also restored the reduced ability of stromal cells to display myeloid progenitors in long-term bone marrow cultures (LTBMC) and up-regulated IL-6 and IL-1α production by these cells in the infected mice, which was consistent with higher number of non-adherent cells. Additional studies to investigate the levels of interferon-gamma (INF-γ) in the supernatant of splenocyte cultures demonstrated a further increase in the level of this cytokine in infected-treated mice, compared to infected controls. In all cases, no differences were observed between the responses of the two optimal biologically effective doses. In contrast, no significant changes were produced by the treatment with the 50mg/kg dose. In addition, no changes were observed in normal mice treated with the three doses used. All together our results suggest that orally given Imunoglucan® indirectly modulates immune activity and probably disengages Listeria induced suppression of these responses by inducing a higher reserve of myeloid progenitors in the bone marrow in consequence of biologically active cytokine release (CSFs, IL-1α, IL-6, and INF-γ). Copyright © 2010 Elsevier B.V. All rights reserved.

  11. Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1

    Science.gov (United States)

    Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.

    1992-01-01

    The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

  12. Modulation of intestinal inflammation by yeasts and cell wall extracts: strain dependence and unexpected anti-inflammatory role of glucan fractions.

    Directory of Open Access Journals (Sweden)

    Samir Jawhara

    Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the

  13. Optimization and scale-up of fermentation of glucansucrase and branched glucan by Pediococcus pentosaceus CRAG3 using Taguchi methodology in bioreactor

    Directory of Open Access Journals (Sweden)

    RISHIKESH SHUKLA

    2012-01-01

    Full Text Available The present investigation focuses on screening and optimization of media components to enhance glucansucrase and glucan production by Pediococcus pentosaceus CRAG3 at shake-flask and bioreactor level using Taguchi orthogonal array design. A three-level Taguchi orthogonal array layout of L27 (33 was employed, in which six variables were studied for their influence on glucansucrase and glucan production. The results showed that sucrose, K2HPO4 and Tween-80 were the most significant factors to improve glucansucrase production while the glucan production was mostly affected by sucrose, peptone and K2HPO4. The optimized medium composition for maximum glucansucrase and glucan production were: sucrose 3.5% and 5%; yeast extract 0.2% and 2.0%; beef extract 0.5% and 0.5%; peptone 3.0% and 1.0%; K2HPO4 0.2% and 0.2%, and Tween-80 1.0 and 0.1%, respectively. The optimized medium gave 10.1 U/ml and 10.2 U/ml glucansucrase activity while glucan concentrations were 56 mg/ml and 80 mg/ml in shake flask and bioreactor level, respectively which were in good agreement with predicted values (10.1 U/ml and 54.5 mg/ml. The optimized medium gave 2 fold enhancement in enzyme activity and 4 fold increase in glucan concentration as compared to non-optimized medium (4.5 U/ml and 15 mg/ml, respectively at shake flask level.

  14. Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan

    DEFF Research Database (Denmark)

    Yücel, Cigdem; Sotres, Javier; Rascón, Ana

    2017-01-01

    HYPOTHESIS: Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. EXPERIMENT: Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic...... force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured...

  15. Children’s residential exposure to selected allergens and microbial indicators: endotoxins and (1→3-β-D-glucans

    Directory of Open Access Journals (Sweden)

    Anna Kozajda

    2013-12-01

    Full Text Available Objectives: The study was aimed at assessment of exposure to endotoxins, (1→3-β-D-glucans and mite, cockroach, cat, dog allergens present in settled dust in premises of children as agents which may be significantly correlated with the occurrence of allergic symptoms and diseases in children. Materials and Methods: The study covered 50 homes of one- or two-year-old children in Poland. Samples of settled dust were taken from the floor and the child's bed. The levels of (1→3-β-D-glucans (floor, endotoxins (floor and allergens of mite, cat, dog and cockroach (floor and bed were analyzed. Results: Average geometric concentrations (geometric standard deviation of endotoxins, (1→3-β-D-glucans, Der p1, Fel d1, Can f1 and Bla g1 in children homes were on the floor 42 166.0 EU/g (3.2, 20 478.4 ng/g (2.38, 93.9 ng/g (6.58, 119.8 ng/g (13.0, 288.9 ng/g (3.4, 0.72 U/g (4.4 and in their beds (only allergens 597.8 ng/g (14.2, 54.1 ng/g (4.4, 158.6 ng/g (3.1 0.6 U/g (2.9, respectively. When the floor was covered with the carpet, higher concentrations of endotoxins, (1→3-β-D-glucans and allergens (each type were found in the settled dust (p < 0.05. The trend was opposite in case of allergens (except dog analyzed from bed dust and significantly higher concentrations were found in the rooms with smooth floor (p < 0.05. Conclusions: Among the analyzed factors only the type of floor significantly modified both the level of biological indicators and allergens. The results of this study could be the base for verifying a hypothesis that carpeting may have a protective role against high levels of cockroach, dog and cat allergens.

  16. Thermoresponsive .beta.-glucan-based polymers for bimodal immunoradiotherapy - Are they able to promote the immune system?

    Czech Academy of Sciences Publication Activity Database

    Loukotová, Lenka; Kučka, Jan; Rabyk, Mariia; Höcherl, Anita; Venclíková, Kristýna; Janoušková, Olga; Páral, P.; Kolářová, V.; Heizer, T.; Šefc, L.; Štěpánek, Petr; Hrubý, Martin

    2017-01-01

    Roč. 268, 28 December (2017), s. 78-91 ISSN 0168-3659 R&D Projects: GA ČR(CZ) GA16-02870S; GA ČR(CZ) GA16-03156S; GA MZd(CZ) NV15-25781A; GA MŠk(CZ) 7AMB16FR042 Institutional support: RVO:61389013 Keywords : beta-glucan * polyoxazoline * multimodal cancer therapy Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 7.786, year: 2016

  17. The c-Ring of the F1FO-ATP Synthase: Facts and Perspectives.

    Science.gov (United States)

    Nesci, Salvatore; Trombetti, Fabiana; Ventrella, Vittoria; Pagliarani, Alessandra

    2016-04-01

    The F1FO-ATP synthase is the only enzyme in nature endowed with bi-functional catalytic mechanism of synthesis and hydrolysis of ATP. The enzyme functions, not only confined to energy transduction, are tied to three intrinsic features of the annular arrangement of c subunits which constitutes the so-called c-ring, the core of the membrane-embedded FO domain: (i) the c-ring constitution is linked to the number of ions (H(+) or Na(+)) channeled across the membrane during the dissipation of the transmembrane electrochemical gradient, which in turn determines the species-specific bioenergetic cost of ATP, the "molecular currency unit" of energy transfer in all living beings; (ii) the c-ring is increasingly involved in the mitochondrial permeability transition, an event linked to cell death and to most mitochondrial dysfunctions; (iii) the c subunit species-specific amino acid sequence and susceptibility to post-translational modifications can address antibacterial drug design according to the model of enzyme inhibitors which target the c subunits. Therefore, the simple c-ring structure not only allows the F1FO-ATP synthase to perform the two opposite tasks of molecular machine of cell life and death, but it also amplifies the enzyme's potential role as a drug target.

  18. Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.

    Science.gov (United States)

    Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin

    2017-10-01

    Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. In vitro incorporation of 14C-hexose-6-phosphat in mannan, β-glucan and glycogen of Candida spec. H and their mutants

    International Nuclear Information System (INIS)

    Roeber, B.; Reuter, G.

    1982-01-01

    Mannose-6-P is an activator of 14 C-mannose incorporation from GDP- 14 C-mannose in mono- and oligosaccharides and in mannopolymers of the cell wall proteophosphomannan produced by the food protein yeast Candida spec. H. Moreover, mannose-6-P is a precursor of proteophosphomannan: 14 C-mannose-6-P has been incorporated in absence of GTP. Corresponding behavior shows glucose-6-P by synthesis of β-glucan and glycogen. Mutants of Candida spec. H with different efficiency in the biosynthesis of mannan, β-glucan and glycogen incorporate hexose-6-P in a different extent. (author)

  20. Bornyl-diphosphate synthase from Lavandula angustifolia: A major monoterpene synthase involved in essential oil quality.

    Science.gov (United States)

    Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric

    2017-05-01

    Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.

  1. ORF Alignment: NC_004463 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_004463 gi|27377726 >1k4iA 2 216 3 205 5e-67 ... ref|NP_769255.1| 3,4-dihydroxy-2-butanone-4-phosha...0.1| ... 3,4-dihydroxy-2-butanone-4-phoshate synthase/GTP ... cyclohydrolase II [Bradyrhizobiu

  2. Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

    Science.gov (United States)

    Flynn, Christopher M; Schmidt-Dannert, Claudia

    2018-06-01

    The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

  3. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  4. The priming of storage glucan synthesis from bacteria to plants: current knowledge and new developments.

    Science.gov (United States)

    D'Hulst, Christophe; Mérida, Angel

    2010-10-01

    Starch is the main polymer in which carbon and energy are stored in land plants, algae and some cyanobacteria. It plays a crucial role in the physiology of these organisms and also represents an important polymer for humans, in terms of both diet and nonfood industry uses. Recent efforts have elucidated most of the steps involved in the synthesis of starch. However, the process that initiates the synthesis of the starch granule remains unclear. Here, we outline the similarities between the synthesis of starch and the synthesis of glycogen, the other widespread and abundant glucose-based polymer in living cells. We place special emphasis on the mechanisms of initiation of the glycogen granule and current knowledge concerning the initiation of the starch granule. We also discuss recent discoveries regarding the function of starch synthases in the priming of the starch granule and possible interactions with other elements of the starch synthesis machinery.

  5. The effect of yeast β-glucan on the amount of albumin, globulin, urea and total protein of broiler chickens

    Directory of Open Access Journals (Sweden)

    ali kargarirezapour

    2013-08-01

    Full Text Available Glucans derived from yeast cell wall are promising alternatives to antibiotics, as they have been shown to improve growth performance and stimulate the immune system of immature broilers. In this study we evaluated the effect of different levels of yeast beta-glucan (YBG on some blood parametrs of broiler chickens. In a factorial experiment based on completely randomized design (the first factor: YBG levels: 0, 0.04 and 0.08% of basal diet and sex as a second factor 144 day old chicks (72 male and 72 female were selected and allocated to different treatments (three replicates of each treatment. The overall experimental period was 34 days. At the end of study, two birds from each pen were randomly selected as a sample. The level of albumin, globulin, urea and total protein was measured on blood samples. Statistical analysis of the results showed that the YBG had no significant effect on albumin, globulin, urea and total protein level. But the amount of plasma albumin and total protein in female chicks was significantly higher than male chicks (p

  6. Toxicological Assessment of β-(1à6-Glucan (Lasiodiplodan in Mice during a 28-Day Feeding Study by Gavage

    Directory of Open Access Journals (Sweden)

    Janaína A. Túrmina

    2012-12-01

    Full Text Available Studies evaluating the toxicity caused by fungal exopolysaccharides of the β-(1®6-D-glucan type are rare. In this study, the toxicological effects of sub-chronic treatments with lasiodiplodan (β-(1®6-D-glucan from Lasiodiplodia theobromae MMPI were evaluated in mice through the assessment of biochemical, hematological, and histopathological alterations. Thirty-two mice (16 male, 16 female were used in this study divided in two groups; one group received lasiodiplodan (50 mg/kg body weight daily for 28 days via gavage, and another (control group received saline during the same period. Blood samples were collected via cardiac puncture for hematological and biochemical analyses. Liver, heart, kidney, and spleen were collected for histopathological analysis. Statistical analysis was performed through one-way analysis of variance and only p < 0.05 F-values were presented. Significant reduction in blood glucose in the male group (35%; p < 0.01, transaminases activity in both sexes (AST and ALT; ~35%; p < 0.05, and urea (20%; p < 0.01 in the female group was observed with the lasiodiplodan treatment. The results showed that sub-chronic treatments with lasiodiplodan did not generate hematological and histopathological alterations leading to signs of toxicity in healthy mice, independent of gender.

  7. The Post-polyketide Synthase Steps in iso-Migrastatin Biosynthesis Featuring Tailoring Enzymes with Broad Substrate Specificity

    Science.gov (United States)

    Ma, Ming; Kwong, Thomas; Lim, Si-Kyu; Ju, Jianhua; Lohman, Jeremy R.; Shen, Ben

    2013-01-01

    The iso-migrastatin (iso-MGS) biosynthetic gene cluster from Streptomyces platensis NRRL 18993 consists of 11 genes, featuring an acyltransferase (AT)-less type I polyketide synthase (PKS) and three tailoring enzymes MgsIJK. Systematic inactivation of mgsIJK in S. platensis enabled us to (i) identify two nascent products (10 and 13) of the iso-MGS AT-less type I PKS, establishing an unprecedented novel feature for AT-less type I PKSs, and (ii) account for the formation of all known post-PKS biosynthetic intermediates (10-17) generated by the three tailoring enzymes MgsIJK, which possessed significant substrate promiscuities. PMID:23394593

  8. Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.

    Science.gov (United States)

    Lather, Amit; Sharma, Sunil; Khatkar, Anurag

    2018-01-01

    Infections caused by microorganisms are the major cause of death today. The tremendous and improper use of antimicrobial agents leads to antimicrobial resistance. Various currently available antimicrobial drugs are inadequate to control the infections and lead to various adverse drug reactions. Efforts based on computer-aided drug design (CADD) can excavate a large number of databases to generate new, potent hits and minimize the requirement of time as well as money for the discovery of newer antimicrobials. Pharmaceutical sciences also have made development with advances in drug designing concepts. The current research article focuses on the study of various G-6-P synthase inhibitors from literature cited molecular database. Docking analysis was conducted and ADMET data of various molecules was evaluated by Schrodinger Glide and PreADMET software, respectively. Here, the results presented efficacy of various inhibitors towards enzyme G-6-P synthase. Docking scores, binding energy and ADMET data of various molecules showed good inhibitory potential toward G-6-P synthase as compared to standard antibiotics. This novel antimicrobial drug target G-6-P synthase has not so extensively been explored for its application in antimicrobial therapy, so the work done so far proved highly essential. This article has helped the drug researchers and scientists to intensively explore about this wonderful antimicrobial drug target. The Schrodinger, Inc. (New York, USA) software was utilized to carry out the computational calculations and docking studies. The hardware configuration was Intel® core (TM) i5-4210U CPU @ 2.40GHz, RAM memory 4.0 GB under 64-bit window operating system. The ADMET data was calculated by using the PreADMET tool (PreADMET ver. 2.0). All the computational work was completed in the Laboratory for Enzyme Inhibition Studies, Department of Pharmaceutical Sciences, M.D. University, Rohtak, INDIA. Molecular docking studies were carried out to identify the binding

  9. PhaM is the physiological activator of poly(3-hydroxybutyrate) (PHB) synthase (PhaC1) in Ralstonia eutropha.

    Science.gov (United States)

    Pfeiffer, Daniel; Jendrossek, Dieter

    2014-01-01

    Poly(3-hydroxybutyrate) (PHB) synthase (PhaC1) is the key enzyme of PHB synthesis in Ralstonia eutropha and other PHB-accumulating bacteria and catalyzes the polymerization of 3-hydroxybutyryl-CoA to PHB. Activity assays of R. eutropha PHB synthase are characterized by the presence of lag phases and by low specific activity. It is assumed that the lag phase is caused by the time necessary to convert the inactive PhaC1 monomer into the active dimeric form by an unknown priming process. The lag phase can be reduced by addition of nonionic detergents such as hecameg [6-O-(N-heptyl-carbamoyl)-methyl-α-D-glucopyranoside], which apparently accelerates the formation of PhaC1 dimers. We identified the PHB granule-associated protein (PGAP) PhaM as the natural primer (activator) of PHB synthase activity. PhaM was recently discovered as a novel type of PGAP with multiple functions in PHB metabolism. Addition of PhaM to PHB synthase assays resulted in immediate polymerization of 3HB coenzyme A with high specific activity and without a significant lag phase. The effect of PhaM on (i) PhaC1 activity, (ii) oligomerization of PhaC1, (iii) complex formation with PhaC1, and (iv) PHB granule formation in vitro and in vivo was shown by cross-linking experiments of purified proteins (PhaM, PhaC1) with glutardialdehyde, by size exclusion chromatography, and by fluorescence microscopic detection of de novo-synthesized PHB granules.

  10. Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)

    2011-09-20

    The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.

  11. Cellulose microfibril crystallinity is reduced by mutating C-terminal transmembrane region residues CESA1{sup A903V} and CESA3{sup T942I} of cellulose synthase

    Energy Technology Data Exchange (ETDEWEB)

    Harris, Darby; Corbin, Kendall; Wang, Tuo; Gutierrez, Ryan; Bertolo, Ana; Petti, Caroalberto; Smilgies, Detlef-M; Estevez, Jose Manuel; Bonetta, Dario; Urbanowicz, Breeanna; Ehrhardt, David; Somerville, Chris; Rose, Jocelyn; Hong, Mei; DeBolt, Seth

    2012-01-08

    The mechanisms underlying the biosynthesis of cellulose in plants are complex and still poorly understood. A central question concerns the mechanism of microfibril structure and how this is linked to the catalytic polymerization action of cellulose synthase (CESA). Furthermore, it remains unclear whether modification of cellulose microfibril structure can be achieved genetically, which could be transformative in a bio-based economy. To explore these processes in planta, we developed a chemical genetic toolbox of pharmacological inhibitors and corresponding resistance-conferring point mutations in the C-terminal transmembrane domain region of CESA1{sup A903V} and CESA3{sup T942I} in Arabidopsis thaliana. Using {sup 13}C solid-state nuclear magnetic resonance spectroscopy and X-ray diffraction, we show that the cellulose microfibrils displayed reduced width and an additional cellulose C4 peak indicative of a degree of crystallinity that is intermediate between the surface and interior glucans of wild type, suggesting a difference in glucan chain association during microfibril formation. Consistent with measurements of lower microfibril crystallinity, cellulose extracts from mutated CESA1{sup A903V} and CESA3{sup T942I} displayed greater saccharification efficiency than wild type. Using live-cell imaging to track fluorescently labeled CESA, we found that these mutants show increased CESA velocities in the plasma membrane, an indication of increased polymerization rate. Collectively, these data suggest that CESA1{sup A903V} and CESA3{sup T942I} have modified microfibril structure in terms of crystallinity and suggest that in plants, as in bacteria, crystallization biophysically limits polymerization.

  12. Highly Divergent Mitochondrial ATP Synthase Complexes in Tetrahymena thermophila

    NARCIS (Netherlands)

    Nina, Praveen Balabaskaran; Dudkina, Natalya V.; Kane, Lesley A.; van Eyk, Jennifer E.; Boekema, Egbert J.; Mather, Michael W.; Vaidya, Akhil B.; Eisen, Jonathan A.

    The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1) sector catalyzes ATP synthesis, whereas the F(o) sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1) and F(o) sectors are

  13. Predicting the catalytic sites of isopenicillin N synthase (IPNS ...

    African Journals Online (AJOL)

    Isopenicillin N synthase (IPNS) related Non-haem iron-dependent oxygenases and oxidases (NHIDOX) demonstrated a striking structural conservativeness, even with low protein sequence homology. It is evident that these enzymes have an architecturally similar catalytic centre with active ligands lining the reactive pocket.

  14. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  15. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    DEFF Research Database (Denmark)

    Manczak, Tom; Simonsen, Henrik Toft

    2016-01-01

    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....

  16. Endothelial nitric oxide synthase polymorphism G298T in ...

    Indian Academy of Sciences (India)

    Supplementary data: Endothelial nitric oxide synthase polymorphism G298T in association with oxidative DNA damage in coronary atherosclerosis. Rajesh G. Kumar, Mrudula K. Spurthi, Kishore G. Kumar, Sanjib K. Sahu and Surekha H. Rani. J. Genet. 91, 349–352. Table 1. The demographic and clinical data of the CHD ...

  17. ATP synthase--a marvellous rotary engine of the cell.

    Science.gov (United States)

    Yoshida, M; Muneyuki, E; Hisabori, T

    2001-09-01

    ATP synthase can be thought of as a complex of two motors--the ATP-driven F1 motor and the proton-driven Fo motor--that rotate in opposite directions. The mechanisms by which rotation and catalysis are coupled in the working enzyme are now being unravelled on a molecular scale.

  18. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  19. Analysis of genetic variation of inducible nitric oxide synthase and ...

    African Journals Online (AJOL)

    The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

  20. Characterising the cellulose synthase complexes of cell walls

    NARCIS (Netherlands)

    Mansoori Zangir, N.

    2012-01-01

    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as

  1. Molecular cloning and characterization of strictosidine synthase, a ...

    African Journals Online (AJOL)

    Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...

  2. Functional Characterization of Sesquiterpene Synthase from Polygonum minus

    Directory of Open Access Journals (Sweden)

    Su-Fang Ee

    2014-01-01

    Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

  3. Use of β-glucan from spent brewer's yeast as a thickener in skimmed yogurt: Physicochemical, textural, and structural properties related to sensory perception.

    Science.gov (United States)

    Raikos, Vassilios; Grant, Shannon B; Hayes, Helen; Ranawana, Viren

    2018-04-25

    Powdered β-glucan extracted from brewer's yeast (Yestimun, Leiber GmbH, Bramsche, Germany) was incorporated into skimmed-milk yogurt at varying concentrations (0.2-0.8% wt/wt) to investigate its potential application as a thickener. The effect of β-glucan fortification on the nutritional profile, microstructure, physicochemical properties, and texture of freshly prepared yogurts was investigated. Sensory evaluation was also conducted and was correlated with instrumental analysis. The addition of Yestimun significantly reduced the fermentation time of the yogurt mix from 4 h to 3 h. Scanning electron microscopy revealed that β-glucan particles formed small spherical clusters within the yogurt matrix. The majority of the physicochemical properties (syneresis, viscosity, color, and titratable acidity) remained unaffected by the incorporation of Yestimun in the recipe. Textural properties showed a gradual increment with increasing β-glucan concentration. Hardness, total work done, adhesive force, and adhesiveness increased by 19.27, 23.3, 21.53, and 20.76%, respectively, when using the highest amount of Yestimun powder. Sensory analysis (n = 40) indicated that fortifying yogurt with Yestimun at 0.8% (wt/wt) concentration may affect overall acceptance ratings, which was attributed to adverse flavor and aftertaste effects. However, the overall liking score of the yogurt (5.0/9.0) shows potential for commercialization of the product. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. The study on application of radiation for preparation of oligo-β-glucan extracted from brewer yeast cell and for gold and silver nano particles

    International Nuclear Information System (INIS)

    Le Quang Luan; Nguyen Huynh Phuong Uyen; Nguyen Thanh Vu; Nguyen Quoc Hien; Dang Van Phu; Vo Thi Thu Ha; To Van Loi; Le Dinh Don; Truong Phuoc Thien Hoang; Do Thi Phuong Linh

    2015-01-01

    The process for production of insoluble β-glucan product from brewer’s yeast cell wall collected from the discard waste of beer production was successfully established. Radiation was improved as a useful tool for preparation of low Mw β-glucan. The water soluble oligo-β-glucans with Mw ~ 18 - 25 kDa were found to have novel features for application as plant growth promoter, growth and immune stimulator additive for animals and functional food for prevention and therapy of diabetic, dyslipidemia, cancer, etc. The processes for large scale production of oligo-β-glucan as plant growth promoter. chicken additive and functional food by gamma Co-60 irradiation method have been set up for application. In addition, gold nanoparticles (AuNPs) with size of 10 - 50 nm stabilized in sericin and water soluble chitosan and silver nanoparticles (AgNPs) with size of 5-20 nm stabilized PVA, PVP, sericin and alginate were also successfully synthesized by gamma Co-60 irradiation method. While AuNPs product was found to be not toxic and can be used for bio-medicine and cosmetics, AgNPs exhibited highly antimicrobial activity for potentially use as new and safety antimicrobial agent. The processes for large scale production of AuNPs, AgNPs, cream/AgNPs and hand-wash solution/AgNPs products were also successfully developed within this project. (author)

  5. Effects of β-glucan polysaccharide revealed by the dominant lethal assay and micronucleus assays, and reproductive performance of male mice exposed to cyclophosphamide

    Directory of Open Access Journals (Sweden)

    Rodrigo Juliano Oliveira

    2014-01-01

    Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.

  6. Validation of a high-performance size-exclusion chromatography method to determine and characterize β-glucans in beer wort using a triple-detector array.

    Science.gov (United States)

    Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe

    2017-01-01

    Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Elevated Serum Beta-D-Glucan with Pseudomonas, Aspergillus, and a Partially Acid-Fast Organism in Respiratory Cultures: A Case of Hickam's Dictum Over Occam's Razor.

    Science.gov (United States)

    Khan, Salman; Hamula, Camille; Rana, Meenakshi; Sullivan, Timothy; Dunn, Dallas; Patel, Pinki; Mishkin, Aaron; Huprikar, Shirish

    2017-10-01

    We describe a case of a man with ectopic Cushing's syndrome, elevated serum beta-D-glucan, and respiratory cultures with Pseudomonas, Aspergillus, and a partially acid-fast organism. Our case highlights challenges in diagnosis and management of coinfection in an immunocompromised host.

  8. Effects of in vitro fermentation of barley β-glucan and sugar beet pectin using human fecal inocula on cytokine expression by dendritic cells

    NARCIS (Netherlands)

    Rosch, Christiane; Taverne, Nico; Venema, Koen; Gruppen, Harry; Wells, Jerry M.; Schols, Henk A.

    2017-01-01

    Scope: This study simulates the fermentation process of barley β-glucan and sugar beet pectin in the human colon and monitors the degradation products formed. Additionally, immune effects of the degradation products were investigated. Methods and results: Immunostimulatory activity of

  9. Anti-inflammatory properties of the medicinal mushroom Cordyceps militaris might be related to its linear (1→3-β-D-glucan.

    Directory of Open Access Journals (Sweden)

    Fhernanda R Smiderle

    Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.

  10. Evaluation of the ability of barley genotypes containing different amounts of ß-glucan to alter growth and disease resistance of rainbow trout Oncorhynchus mykiss.

    Science.gov (United States)

    A feeding trial was performed to screen three barley genotypes containing different levels of '-glucan for their ability to influence growth, immune function, and disease resistance of rainbow trout. Three experimental diets were prepared by substituting each of three barely genotypes containing dif...

  11. Measuring (1,3)-β-D-glucan in tracheal aspirate, bronchoalveolar lavage fluid, and serum for detection of suspected Candida pneumonia in immunocompromised and critically ill patients: a prospective observational study.

    Science.gov (United States)

    Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru

    2017-04-08

    While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.

  12. Dietary β-glucan stimulate complement and C-reactive protein acute phase responses in common carp (Cyprinus carpio) during an Aeromonas salmonicida infection.

    Science.gov (United States)

    Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave

    2013-03-01

    The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All

  13. Effects of dietary β-glucan and glycyrrhizin on non-specific immunity and disease resistance of the sea cucumber ( Apostichopus japonicus Selenka) challenged with Vibrio splendidus

    Science.gov (United States)

    Chang, Jie; Zhang, Wenbing; Mai, Kangsen; Ma, Hongming; Xu, Wei

    2010-12-01

    Sea cucumbers, Apostichopus japonicus Selenka, were fed diets containing non-immunostimulant (basal diet), 0.2% β-glucan and 0.02% glycyrrhizin in a recirculatory water system for 45 days, and subsequently challenged with Vibrio splendidus by injection at 1.0×108 cfu / sea cucumber for 15 days. Phagocytic capacity (PC), intracellular superoxide anion production (ISAP), lysozyme (LSZ) activity and superoxide dismutase (SOD) activity in the coelomic fluid were analyzed on the 0th, 5th, 10th and 15th days after injection. Results showed that after the 45-day feeding period, PC, ISAP, LSZ activity and SOD activity in sea cucumbers fed with dietary β-glucan or glycyrrhizin were significantly higher than in those fed with the basal diet. On the 5th day after infection, all the immune parameters examined in the sea cucumbers injected with V. splendidus decreased in value significantly. On the 15th day, PC, ISAP and LSZ activity returned to levels similar to those on the 0th day. For the sea cucumbers injected with saline, there were no significant differences in all the immune parameters examined and in the cumulative morbidity during the 15-day challenging trial. After injecting with V. splendidus, the cumulative morbidity of sea cucumbers fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin when challenged with V. splendidus challenged sea cucumber fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin. There was no significant difference in cumulative morbidity between the dietary β-glucan and glycyrrhizin treatments over time.

  14. Structural characterization and comparison of three acyl-carrier-protein synthases from pathogenic bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Halavaty, Andrei S. [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States); Kim, Youngchang [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Minasov, George; Shuvalova, Ludmilla; Dubrovska, Ievgeniia; Winsor, James [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States); Zhou, Min [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Onopriyenko, Olena; Skarina, Tatiana [Center for Structural Genomics of Infectious Diseases, (United States); University of Toronto, Toronto, Ontario M5G 1L6 (Canada); Papazisi, Leka; Kwon, Keehwan; Peterson, Scott N. [Center for Structural Genomics of Infectious Diseases, (United States); J. Craig Venter Institute, Rockville, MD 20850 (United States); Joachimiak, Andrzej [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Savchenko, Alexei [Center for Structural Genomics of Infectious Diseases, (United States); University of Toronto, Toronto, Ontario M5G 1L6 (Canada); Anderson, Wayne F., E-mail: wf-anderson@northwestern.edu [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States)

    2012-10-01

    The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holo form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS{sub SA}), Vibrio cholerae (AcpS{sub VC}) and Bacillus anthracis (AcpS{sub BA}) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS{sub BA} is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS{sub BA} may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP.

  15. Structural characterization and comparison of three acyl-carrier-protein synthases from pathogenic bacteria

    International Nuclear Information System (INIS)

    Halavaty, Andrei S.; Kim, Youngchang; Minasov, George; Shuvalova, Ludmilla; Dubrovska, Ievgeniia; Winsor, James; Zhou, Min; Onopriyenko, Olena; Skarina, Tatiana; Papazisi, Leka; Kwon, Keehwan; Peterson, Scott N.; Joachimiak, Andrzej; Savchenko, Alexei; Anderson, Wayne F.

    2012-01-01

    The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holo form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS SA ), Vibrio cholerae (AcpS VC ) and Bacillus anthracis (AcpS BA ) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS BA is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS BA may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP

  16. Isolation and functional characterization of a τ-cadinol synthase, a new sesquiterpene synthase from Lavandula angustifolia.

    Science.gov (United States)

    Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis

    2014-01-01

    In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.

  17. Copper (II)

    African Journals Online (AJOL)

    CLEMENT O BEWAJI

    Valine (2 - amino - 3 – methylbutanoic acid), is a chemical compound containing .... Stability constant (Kf). Gibb's free energy. ) (. 1. −. ∆. Mol. JG. [CuL2(H2O)2] ... synthesis and characterization of Co(ii), Ni(ii), Cu (II), and Zn(ii) complexes with ...

  18. A population of Langerin-positive dendritic cells in murine Peyer's patches involved in sampling β-glucan microparticles.

    Directory of Open Access Journals (Sweden)

    Magdia De Jesus

    Full Text Available Glucan particles (GPs are 2-4 μm hollow, porous shells composed of 1,3-β-D-glucan that have been effectively used for oral targeted-delivery of a wide range of payloads, including small molecules, siRNA, DNA, and protein antigens. While it has been demonstrated that the transepithelial transport of GPs is mediated by Peyer's patch M cells, the fate of the GPs once within gut-associated lymphoid tissue (GALT is not known. Here we report that fluorescently labeled GPs administered to mice by gavage accumulate in CD11c+ DCs situated in Peyer's patch sub-epithelial dome (SED regions. GPs appeared in DCs within minutes after gavage and remained within the SED for days afterwards. The co-administration or sequential administration of GPs with differentially labeled GPs or poly(lactic-co-glycolic acid nanoparticles demonstrated that the SED DC subpopulation in question was capable of internalizing particles of different sizes and material compositions. Phenotypic analysis identified the GP-containing DCs as being CD8α- and CD11blo/-, suggesting they are the so-called myeloid and/or double negative (DN subset(s of PP DCs. A survey of C-type lectin receptors (CLRs known to be expressed by leukocytes within the intestinal mucosa revealed that GP-containing SED DCs were positive for Langerin (CD207, a CLR with specificity for β-D-glucan and that has been shown to mediate the internalization of a wide range of microbial pathogens, including bacteria, viruses and fungi. The presence of Langerin+ DCs in the SED as determined by immunofluorescence was confirmed using Langerin E-GFP transgenic mice. In summary, our results demonstrate that following M cell-mediated transepithelial transport, GPs (and other micro/nanoparticles are sampled by a population of SED DCs distinguished from other Peyer's patch DC subsets by their expression of Langerin. Future studies will be aimed at defining the role of Langerin in antigen sampling and antigen presentation within

  19. Evolutionary and mechanistic insights from the reconstruction of α-humulene synthases from a modern (+)-germacrene A synthase.

    Science.gov (United States)

    Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K

    2014-10-15

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.

  20. Systematic replacement of lysine with glutamine and alanine in Escherichia coli malate synthase G: effect on crystallization

    International Nuclear Information System (INIS)

    Anstrom, David M.; Colip, Leslie; Moshofsky, Brian; Hatcher, Eric; Remington, S. James

    2005-01-01

    Alanine and glutamine mutations were made to the same 15 lysine positions on the surface of E. coli malate synthase G and the impact on crystallization observed. The results support lysine replacement for improvement of crystallization and provide insight into site selection and type of amino-acid replacement. Two proposals recommend substitution of surface lysine residues as a means to improve the quality of protein crystals. In proposal I, substitution of lysine by alanine has been suggested to improve crystallization by reducing the entropic cost of ordering flexible side chains at crystal contacts. In proposal II, substitution of lysine by residues more commonly found in crystal contacts, such as glutamine, has been proposed to improve crystallization. 15 lysine residues on the surface of Escherichia coli malate synthase G, distributed over a variety of secondary structures, were individually mutated to both alanine and glutamine. For 28 variants, detailed studies of the effect on enzymatic activity and crystallization were conducted. This has permitted direct comparison of the relative effects of the two types of mutations. While none of the variants produced crystals suitable for X-ray structural determination, small crystals were obtained in a wide variety of conditions, in support of the general approach. Glutamine substitutions were found to be more effective than alanine in producing crystals, in support of proposal II. Secondary structure at the site of mutation does not appear to play a major role in determining the rate of success

  1. Water mobility in the endosperm of high beta-glucan barley mutants as studied by nuclear magnetic resonance imaging

    DEFF Research Database (Denmark)

    Seefeldt, Helene Fast; van den Berg, Frans W.J.; Köckenberger, Walter

    2007-01-01

    1H NMR imaging (MRI) was used as a noninvasive technique to study water distribution and mobility in hydrated barley (Hordeum vulgare L.) seeds of accessions with varying content of beta glucan (BG), a highly hygroscopic cell wall component. High contents of BG in barley are unfavorable in malting...... where it leads to clotting of filters and hazing of beer as well as in animal feed where it hinders the rapid uptake of energy. However, a high content of BG has a positive nutritional effect, as it lowers the cholesterol and the glycaemic index. It was studied whether water distribution and mobility...... were related to content and location of BG. Water mobility was investigated by following the rate and mode of desiccation in hydrated single seeds. In order to determine the different water components, a multispin echo experiment was set up to reveal the T2 transverse relaxation rates of water within...

  2. Combination therapy of murine tumors with a degraded D-manno-D-glucan (DMG) from Microellobosporia grisea, and cyclophosphamide.

    Science.gov (United States)

    Nakajima, H; Hashimoto, S; Kita, Y; Takashi, T; Tsukada, W; Kohno, M; Ogawa, H; Abe, S; Mizuno, D

    1983-12-01

    DMG, a degraded D-manno-D-glucan with a host-mediated antitumor activity did not significantly enhance nor inhibit the development of suppressor cells for either the antibody-forming response or the delayed hypersensitivity reaction to sheep red blood cells. Cyclophosphamide (CY), which inhibited the generation of suppressor cells, was combined with DMG in treatment of murine syngeneic tumors to obtain a higher antitumor activity. The antitumor activity of the combination against MH134 hepatoma was synergistically higher than that of either component alone. A marked antitumor effect of the combination treatment against MM46 mammary carcinoma was also shown. High levels of antitumor delayed hypersensitivity reactions were observed with this combination therapy. The possible roles of DMG and CY in this combination therapy are discussed.

  3. Accessibility and contribution to glucan masking of natural and genetically tagged versions of yeast wall protein 1 of Candida albicans.

    Science.gov (United States)

    Granger, Bruce L

    2018-01-01

    Yeast wall protein 1 (Ywp1) is an abundant glycoprotein of the cell wall of the yeast form of Candida albicans, the most prevalent fungal pathogen of humans. Antibodies that bind to the polypeptide backbone of isolated Ywp1 show little binding to intact yeast cells, presumably because the Ywp1 epitopes are masked by the polysaccharides of the mannoproteins that form the outer layer of the cell wall. Rare cells do exhibit much greater anti-Ywp1 binding, however, and one of these was isolated and characterized. No differences were seen in its Ywp1, but it exhibited greater adhesiveness, sensitivity to wall perturbing agents, and exposure of its underlying β-1,3-glucan layer to external antibodies. The molecular basis for this greater epitope accessibility has not been determined, but has facilitated exploration of how these properties change as a function of cell growth and morphology. In addition, previously engineered strains with reduced quantities of Ywp1 in their cell walls were also found to have greater β-1,3-glucan exposure, indicating that Ywp1 itself contributes to the masking of wall epitopes, which may be important for understanding the anti-adhesive effect of Ywp1. Ectopic production of Ywp1 by hyphae, which reduces the adhesivity of these filamentous forms of C. albicans, was similarly found to reduce exposure of the β-1,3-glucan in their walls. To monitor Ywp1 in the cell wall irrespective of its accessibility, green fluorescent protein (Gfp) was genetically inserted into wall-anchored Ywp1 using a bifunctional cassette that also allowed production from a single transfection of a soluble, anchor-free version. The wall-anchored Ywp1-Gfp-Ywp1 accumulated in the wall of the yeast forms but not hyphae, and appeared to have properties similar to native Ywp1, including its adhesion-inhibiting effect. Some pseudohyphal walls also detectably accumulated this probe. Strains of C. albicans with tandem hemagglutinin (HA) epitopes inserted into wall

  4. Accessibility and contribution to glucan masking of natural and genetically tagged versions of yeast wall protein 1 of Candida albicans.

    Directory of Open Access Journals (Sweden)

    Bruce L Granger

    Full Text Available Yeast wall protein 1 (Ywp1 is an abundant glycoprotein of the cell wall of the yeast form of Candida albicans, the most prevalent fungal pathogen of humans. Antibodies that bind to the polypeptide backbone of isolated Ywp1 show little binding to intact yeast cells, presumably because the Ywp1 epitopes are masked by the polysaccharides of the mannoproteins that form the outer layer of the cell wall. Rare cells do exhibit much greater anti-Ywp1 binding, however, and one of these was isolated and characterized. No differences were seen in its Ywp1, but it exhibited greater adhesiveness, sensitivity to wall perturbing agents, and exposure of its underlying β-1,3-glucan layer to external antibodies. The molecular basis for this greater epitope accessibility has not been determined, but has facilitated exploration of how these properties change as a function of cell growth and morphology. In addition, previously engineered strains with reduced quantities of Ywp1 in their cell walls were also found to have greater β-1,3-glucan exposure, indicating that Ywp1 itself contributes to the masking of wall epitopes, which may be important for understanding the anti-adhesive effect of Ywp1. Ectopic production of Ywp1 by hyphae, which reduces the adhesivity of these filamentous forms of C. albicans, was similarly found to reduce exposure of the β-1,3-glucan in their walls. To monitor Ywp1 in the cell wall irrespective of its accessibility, green fluorescent protein (Gfp was genetically inserted into wall-anchored Ywp1 using a bifunctional cassette that also allowed production from a single transfection of a soluble, anchor-free version. The wall-anchored Ywp1-Gfp-Ywp1 accumulated in the wall of the yeast forms but not hyphae, and appeared to have properties similar to native Ywp1, including its adhesion-inhibiting effect. Some pseudohyphal walls also detectably accumulated this probe. Strains of C. albicans with tandem hemagglutinin (HA epitopes inserted into

  5. The effects of oat β-glucan incorporation on the quality, structure, consumer acceptance and glycaemic response of steamed bread.

    Science.gov (United States)

    Wang, Lei; Ye, Fayin; Feng, Liyuan; Wei, Fubin; Zhao, Guohua

    2017-12-01

    The objective of this study was to evaluate the effects of the incorporation of oat β-glucan (OβG) on the sensory and nutritional quality of steamed bread. Wheat flour was substituted with OβG at levels varying from 0 g/100 g to 5 g/100 g. The results showed that the products containing 1 g/100 g and 3 g/100 g OβG produced a comparable overall consumer acceptance while a significantly lower score was given to the product with 5 g/100 g. Nutritionally, the presence of OβG impeded in vitro starch hydrolysis by amylolytic enzymes. More importantly, the addition of OβG up to 5 g/100 g did bring about a lower in vitro predicted glycaemic index to steamed bread, but it generated insignificant effects on the in vivo glycaemic response. The current work first demonstrated the feasibility of fabricating OβG-enriched steamed bread and its nutritional superiority compared to the corresponding normal product. Modern methods of food elaboration and processing frequently reduce the content of dietary fiber (DF). Despite the well-known health benefits of DF consumption, average intake levels still fall far below recommended ones. Oat β-glucan (OβG) is a kind of indigestible polysaccharide with diverse bioactivity. This article evaluated the effects of OβG incorporation on quality, structure, consumer acceptance, and glycaemic response of steamed bread. The addition of less than 3 g/100 g of OβG had negligible effects on the consumer acceptance of steamed bread. The enrichment at 5 g/100 g indeed deteriorated the consumer acceptance. Moreover, OβG highly lowered the glycaemic response of steamed bread. The current work first demonstrated the feasibility of fabricating OβG-enriched steamed bread and its nutritional superiority compared to the corresponding normal product. OβG enriched steamed bread may offer an alternative to improve DF intake of residents. © 2017 Wiley Periodicals, Inc.

  6. Glucanos extracelulares bacterianos: estructura, biosíntesis y función Extreacellular bacterial glucans: structure, biosynthesis and function

    Directory of Open Access Journals (Sweden)

    Bárbara E. García Triana

    2008-12-01

    Full Text Available La caries dental es una de las enfermedades más frecuentes en el ser humano. En su etiología multifactorial, desempeñan un papel importante determinadas bacterias cariogénicas, que en interacción con la superficie del diente promueven su desmineralización. Dentro de los mecanismos mediadores de la adhesión bacteriana, se encuentra la producción de polisacáridos extracelulares bacterianos. En particular los glucanos sintetizados por las glucosiltransferasas, no solo permiten la adherencia, sino que también constituyen una fuente nutricional para las bacterias, por lo tanto, la actividad de dichas enzimas se considera un factor de virulencia bacteriana en la caries dental. Esta revisión bibliográfica tiene el objetivo de esclarecer los aspectos relacionados con la estructura, biosíntesis y función de los glucanos, y enfatizar en la aplicación de estos conocimientos en la prevención de la caries dental.Dental caries is one of the most common diseases in the human being. Certain cariogenic bacteria play an important role in its multifactorial etiology, since in their interaction with the dental surface they promote its demineralization. The production of extracellular bacterial polyssacharides is among the mechanisms mediating bacterial adhesion. The glucans synthesized by glycosyltransferases not only allow the adherence, but they also are a nutritional source for bacteria and that's why the activity of such enzymes is considered a factor of bacterial virulence in dental caries. This bibliographic review is aimed at making clear the aspects related to the structure, biosynthesis and function of glucans and at giving emphasis to the application of this knowledge in the prevention of dental caries.

  7. In vitro biochemical characterization of all barley endosperm starch synthases

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian

    2016-01-01

    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS....... Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...

  8. ATP Synthase, a Target for Dementia and Aging?

    Science.gov (United States)

    Larrick, James W; Larrick, Jasmine W; Mendelsohn, Andrew R

    2018-02-01

    Advancing age is the biggest risk factor for development for the major life-threatening diseases in industrialized nations accounting for >90% of deaths. Alzheimer's dementia (AD) is among the most devastating. Currently approved therapies fail to slow progression of the disease, providing only modest improvements in memory. Recently reported work describes mechanistic studies of J147, a promising therapeutic molecule previously shown to rescue the severe cognitive deficits exhibited by aged, transgenic AD mice. Apparently, J147 targets the mitochondrial alpha-F1-ATP synthase (ATP5A). Modest inhibition of the ATP synthase modulates intracellular calcium to activate AMP-activated protein kinase to inhibit mammalian target of rapamycin, a known mechanism of lifespan extension from worms to mammals.

  9. Activation of cyclic GMP-AMP synthase by self-DNA causes autoimmune diseases.

    Science.gov (United States)

    Gao, Daxing; Li, Tuo; Li, Xiao-Dong; Chen, Xiang; Li, Quan-Zhen; Wight-Carter, Mary; Chen, Zhijian J

    2015-10-20

    TREX1 is an exonuclease that digests DNA in the cytoplasm. Loss-of-function mutations of TREX1 are linked to Aicardi-Goutieres Syndrome (AGS) and systemic lupus erythematosus (SLE) in humans. Trex1(-/-) mice exhibit autoimmune and inflammatory phenotypes that are associated with elevated expression of interferon (IFN)-induced genes (ISGs). Cyclic GMP-AMP (cGAMP) synthase (cGAS) is a cytosolic DNA sensor that activates the IFN pathway. Upon binding to DNA, cGAS is activated to catalyze the synthesis of cGAMP, which functions as a second messenger that binds and activates the adaptor protein STING to induce IFNs and other cytokines. Here we show that genetic ablation of cGas in Trex1(-/-) mice eliminated all detectable pathological and molecular phenotypes, including ISG induction, autoantibody production, aberrant T-cell activation, and lethality. Even deletion of just one allele of cGas largely rescued the phenotypes of Trex1(-/-) mice. Similarly, deletion of cGas in mice lacking DNaseII, a lysosomal enzyme that digests DNA, rescued the lethal autoimmune phenotypes of the DNaseII(-/-) mice. Through quantitative mass spectrometry, we found that cGAMP accumulated in mouse tissues deficient in Trex1 or DNaseII and that this accumulation was dependent on cGAS. These results demonstrate that cGAS activation causes the autoimmune diseases in Trex1(-/-) and DNaseII(-/-) mice and suggest that inhibition of cGAS may lead to prevention and treatment of some human autoimmune diseases caused by self-DNA.

  10. Microsatellite instability in colorectal cancer and association with thymidylate synthase and dihydropyrimidine dehydrogenase expression

    International Nuclear Information System (INIS)

    Jensen, Søren A; Vainer, Ben; Kruhøffer, Mogens; Sørensen, Jens B

    2009-01-01

    Microsatellite instability (MSI) refers to mutations in short motifs of tandemly repeated nucleotides resulting from replication errors and deficient mismatch repair (MMR). Colorectal cancer with MSI has characteristic biology and chemosensitivity, however the molecular basis remains unclarified. The association of MSI and MMR status with outcome and with thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression in colorectal cancer were evaluated. MSI in five reference loci, MMR enzymes (hMSH2, hMSH6, hMLH1 and hPMS2), thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression were assessed in paraffin embedded tumor specimens, and associated with outcome in 340 consecutive patients completely resected for colorectal cancer stages II-IV and subsequently receiving adjuvant 5-fluorouracil therapy. MSI was found in 43 (13.8%) tumors. Absence of repair protein expression was assessed in 52 (17.0%) tumors, which had primarily lost hMLH1 in 39 (12.7%), hMSH2 in 5 (1.6%), and hMSH6 in 8 (2.6%) tumors. In multivariate analysis MSI (instable) compared to MSS (stable) tumors were significantly associated with lower risk of recurrence (hazard ratio (HR) = 0.3; 95% CI: 0.2–0.7; P = 0.0007) and death (HR = 0.4; 95% CI: 0.2–0.9; P = 0.02) independently of the TS and DPD expressions. A direct relationship between MSI and TS intensity (P = 0.001) was found, while there was no significant association with DPD intensity (P = 0.1). The favourable outcome of MSI colorectal carcinomas is ascribed mainly to the tumor biology and to a lesser extent to antitumor response to 5-fluorouracil therapy. There is no evidence that differential TS or DPD expression may account for these outcome characteristics

  11. Perspective of microsomal prostaglandin E2 synthase-1 as drug target in inflammation-related disorders.

    Science.gov (United States)

    Koeberle, Andreas; Werz, Oliver

    2015-11-01

    Prostaglandin (PG)E2 encompasses crucial roles in pain, fever, inflammation and diseases with inflammatory component, such as cancer, but is also essential for gastric, renal, cardiovascular and immune homeostasis. Cyclooxygenases (COX) convert arachidonic acid to the intermediate PGH2 which is isomerized to PGE2 by at least three different PGE2 synthases. Inhibitors of COX - non-steroidal anti-inflammatory drugs (NSAIDs) - are currently the only available therapeutics that target PGE2 biosynthesis. Due to adverse effects of COX inhibitors on the cardiovascular system (COX-2-selective), stomach and kidney (COX-1/2-unselective), novel pharmacological strategies are in demand. The inducible microsomal PGE2 synthase (mPGES)-1 is considered mainly responsible for the excessive PGE2 synthesis during inflammation and was suggested as promising drug target for suppressing PGE2 biosynthesis. However, 15 years after intensive research on the biology and pharmacology of mPGES-1, the therapeutic value of mPGES-1 as drug target is still vague and mPGES-1 inhibitors did not enter the market so far. This commentary will first shed light on the structure, mechanism and regulation of mPGES-1 and will then discuss its biological function and the consequence of its inhibition for the dynamic network of eicosanoids. Moreover, we (i) present current strategies for interfering with mPGES-1-mediated PGE2 synthesis, (ii) summarize bioanalytical approaches for mPGES-1 drug discovery and (iii) describe preclinical test systems for the characterization of mPGES-1 inhibitors. The pharmacological potential of selective mPGES-1 inhibitor classes as well as dual mPGES-1/5-lipoxygenase inhibitors is reviewed and pitfalls in their development, including species discrepancies and loss of in vivo activity, are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  13. Role of Modular Polyketide Synthases in the Production of Polyether Ladder Compounds in Ciguatoxin-Producing Gambierdiscus polynesiensis and G. excentricus (Dinophyceae).

    Science.gov (United States)

    Kohli, Gurjeet S; Campbell, Katrina; John, Uwe; Smith, Kirsty F; Fraga, Santiago; Rhodes, Lesley L; Murray, Shauna A

    2017-09-01

    Gambierdiscus, a benthic dinoflagellate, produces ciguatoxins that cause the human illness Ciguatera. Ciguatoxins are polyether ladder compounds that have a polyketide origin, indicating that polyketide synthases (PKS) are involved in their production. We sequenced transcriptomes of Gambierdiscus excentricus and Gambierdiscus polynesiensis and found 264 contigs encoding single domain ketoacyl synthases (KS; G. excentricus: 106, G. polynesiensis: 143) and ketoreductases (KR; G. excentricus: 7, G. polynesiensis: 8) with sequence similarity to type I PKSs, as reported in other dinoflagellates. In addition, 24 contigs (G. excentricus: 3, G. polynesiensis: 21) encoding multiple PKS domains (forming typical type I PKSs modules) were found. The proposed structure produced by one of these megasynthases resembles a partial carbon backbone of a polyether ladder compound. Seventeen contigs encoding single domain KS, KR, s-malonyltransacylase, dehydratase and enoyl reductase with sequence similarity to type II fatty acid synthases (FAS) in plants were found. Type I PKS and type II FAS genes were distinguished based on the arrangement of domains on the contigs and their sequence similarity and phylogenetic clustering with known PKS/FAS genes in other organisms. This differentiation of PKS and FAS pathways in Gambierdiscus is important, as it will facilitate approaches to investigating toxin biosynthesis pathways in dinoflagellates. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.

  14. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

    2013-12-01

    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Nitric oxide synthase isoforms in spontaneous and salt hypertension

    Czech Academy of Sciences Publication Activity Database

    Hojná, Silvie; Kuneš, Jaroslav; Zicha, Josef

    2007-01-01

    Roč. 25, Suppl. 2 (2007), S 338-S 338 ISSN 0263-6352. [European Meeting on Hypertension /17./. 15.06.2007-19.06.2007, Milan] R&D Projects: GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : nitric oxide synthase isoforms * spontaneous and salt hypertension Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  16. Use of linalool synthase in genetic engineering of scent production

    Science.gov (United States)

    Pichersky, Eran

    1998-01-01

    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.

  17. Trypanosoma brucei solanesyl-diphosphate synthase localizes to the mitochondrion

    Czech Academy of Sciences Publication Activity Database

    Lai, D.-H.; Bontempi, E. J.; Lukeš, Julius

    2012-01-01

    Roč. 183, č. 2 (2012), s. 189-192 ISSN 0166-6851 R&D Projects: GA ČR(CZ) GAP305/11/2179 Institutional support: RVO:60077344 Keywords : Trypanosoma brucei * Sleeping sickness * Ubiquinone * Solanesyl-diphosphate synthase * Digitonin permeabilization * In situ tagging Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.734, year: 2012 http://www.sciencedirect.com/science/article/pii/S0166685112000539

  18. Multi-substrate terpene synthases: their occurrence and physiological significance

    Directory of Open Access Journals (Sweden)

    Leila Pazouki

    2016-07-01

    Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.

  19. From bacterial to human dihydrouridine synthase: automated structure determination

    Energy Technology Data Exchange (ETDEWEB)

    Whelan, Fiona, E-mail: fiona.whelan@york.ac.uk; Jenkins, Huw T., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom); Griffiths, Samuel C. [University of Oxford, Headington, Oxford OX3 7BN (United Kingdom); Byrne, Robert T. [Ludwig-Maximilians-University Munich, Feodor-Lynen-Strasse 25, 81377 Munich (Germany); Dodson, Eleanor J.; Antson, Alfred A., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom)

    2015-06-30

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer.

  20. From bacterial to human dihydrouridine synthase: automated structure determination

    International Nuclear Information System (INIS)

    Whelan, Fiona; Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.

    2015-01-01

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer

  1. Dynamics of meso and thermo citrate synthases with implicit solvation

    Science.gov (United States)

    Cordeiro, J. M. M.

    The dynamics of hydration of meso and thermo citrate synthases has been investigated using the EEF1 methodology implemented with the CHARMM program. The native enzymes are composed of two identical subunits, each divided into a small and large domain. The dynamics behavior of both enzymes at 30°C and 60°C has been compared. The results of simulations show that during the hydration process, each subunit follows a different pathway of hydration, in spite of the identical sequence. The hydrated structures were compared with the crystalline structure, and the root mean square deviation (RMSD) of each residue along the trajectory was calculated. The regions with larger and smaller mobility were identified. In particular, helices belonging to the small domain are more mobile than those of the large domain. In contrast, the residues that constitute the active site show a much lower displacement compared with the crystalline structure. Hydration free energy calculations point out that Thermoplasma acidophilum citrate synthase (TCS) is more stable than chicken citrate synthase (CCS), at high temperatures. Such result has been ascribed to the higher number of superficial charges in the thermophilic homologue, which stabilizes the enzyme, while the mesophilic homologue denatures. These results are in accord with the experimental found that TCS keeps activity at temperatures farther apart from the catalysis regular temperature than the CCS.

  2. Mechanism of Action and Inhibition of dehydrosqualene Synthase

    Energy Technology Data Exchange (ETDEWEB)

    F Lin; C Liu; Y Liu; Y Zhang; K Wang; W Jeng; T Ko; R Cao; A Wang; E Oldfield

    2011-12-31

    'Head-to-head' terpene synthases catalyze the first committed steps in sterol and carotenoid biosynthesis: the condensation of two isoprenoid diphosphates to form cyclopropylcarbinyl diphosphates, followed by ring opening. Here, we report the structures of Staphylococcus aureus dehydrosqualene synthase (CrtM) complexed with its reaction intermediate, presqualene diphosphate (PSPP), the dehydrosqualene (DHS) product, as well as a series of inhibitors. The results indicate that, on initial diphosphate loss, the primary carbocation so formed bends down into the interior of the protein to react with C2,3 double bond in the prenyl acceptor to form PSPP, with the lower two-thirds of both PSPP chains occupying essentially the same positions as found in the two farnesyl chains in the substrates. The second-half reaction is then initiated by the PSPP diphosphate returning back to the Mg{sup 2+} cluster for ionization, with the resultant DHS so formed being trapped in a surface pocket. This mechanism is supported by the observation that cationic inhibitors (of interest as antiinfectives) bind with their positive charge located in the same region as the cyclopropyl carbinyl group; that S-thiolo-diphosphates only inhibit when in the allylic site; activity results on 11 mutants show that both DXXXD conserved domains are essential for PSPP ionization; and the observation that head-to-tail isoprenoid synthases as well as terpene cyclases have ionization and alkene-donor sites which spatially overlap those found in CrtM.

  3. Longevity in vivo of primary cell wall cellulose synthases.

    Science.gov (United States)

    Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming

    2018-02-01

    Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.

  4. The primary defect in glycogen synthase activity is not based on increased glycogen synthase kinase-3a activity in diabetic myotubes

    DEFF Research Database (Denmark)

    Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.

    2004-01-01

    The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...

  5. Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues

    Science.gov (United States)

    Koo, Hyun Jo; Gang, David R.

    2012-01-01

    The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

  6. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    Science.gov (United States)

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  7. Suites of terpene synthases explain differential terpenoid production in ginger and turmeric tissues.

    Directory of Open Access Journals (Sweden)

    Hyun Jo Koo

    Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.

  8. (II) complexes

    African Journals Online (AJOL)

    activities of Schiff base tin (II) complexes. Neelofar1 ... Conclusion: All synthesized Schiff bases and their Tin (II) complexes showed high antimicrobial and ...... Singh HL. Synthesis and characterization of tin (II) complexes of fluorinated Schiff bases derived from amino acids. Spectrochim Acta Part A: Molec Biomolec.

  9. Soluble β-(1,3)-glucans enhance LPS-induced response in the monocyte activation test, but inhibit LPS-mediated febrile response in rabbits: Implications for pyrogenicity tests.

    Science.gov (United States)

    Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando

    2016-01-01

    In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Science.gov (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  11. Potent inhibitory effects of D-tagatose on the acid production and water-insoluble glucan synthesis of Streptococcus mutans GS5 in the presence of sucrose.

    Science.gov (United States)

    Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki

    2015-01-01

    We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10% (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol significantly inhibited the acid production and water-insoluble glucan synthesis of GS5 in the presence of 1% (w/v) sucrose. However, the inhibitory effect of acid production by D-tagatose was significantly stronger than that of xylitol in presence of sucrose.

  12. Fruiting bodies of Hericium erinaceus (Bull. Pers. – a new source of water-insoluble (1→3-α-d-glucan

    Directory of Open Access Journals (Sweden)

    Adrian Wiater

    2016-09-01

    Full Text Available A water-insoluble polysaccharide (WIP was isolated from the fruiting bodies of Hericium erinaceus HE01 by an alkaline solution with the yield of 5%. Structural and compositional analyses by total acid hydrolysis, methylation analysis, FT-IR, FT-Raman, and 1H NMR spectroscopy as well as other instrumental techniques showed predominantly glucose linked by α-glycosidic bonds and small amounts of mannose, xylose, rhamnose, galactose, and ribose. The methylation analysis showed that (1→3-linked Glcp is the major constituent (70.8% of the polymer, while the 3,4 substituted d-Glcp represents the main branching residue of the glucan. The presence of (1→3-α-d-glucan in the hyphae of H. erinaceus was additionally confirmed by the use of specific fluorophore-labeled antibodies.

  13. The valine and lysine residues in the conserved FxVTxK motif are important for the function of phylogenetically distant plant cellulose synthases

    Energy Technology Data Exchange (ETDEWEB)

    Slabaugh, Erin; Scavuzzo-Duggan, Tess; Chaves, Arielle; Wilson, Liza; Wilson, Carmen; Davis, Jonathan K.; Cosgrove, Daniel J.; Anderson, Charles T.; Roberts, Alison W.; Haigler, Candace H.

    2015-12-08

    Cellulose synthases (CESAs) synthesize the β-1,4-glucan chains that coalesce to form cellulose microfibrils in plant cell walls. In addition to a large cytosolic (catalytic) domain, CESAs have eight predicted transmembrane helices (TMHs). However, analogous to the structure of BcsA, a bacterial CESA, predicted TMH5 in CESA may instead be an interfacial helix. This would place the conserved FxVTxK motif in the plant cell cytosol where it could function as a substrate-gating loop as occurs in BcsA. To define the functional importance of the CESA region containing FxVTxK, we tested five parallel mutations in Arabidopsis thaliana CESA1 and Physcomitrella patens CESA5 in complementation assays of the relevant cesa mutants. In both organisms, the substitution of the valine or lysine residues in FxVTxK severely affected CESA function. In Arabidopsis roots, both changes were correlated with lower cellulose anisotropy, as revealed by Pontamine Fast Scarlet. Analysis of hypocotyl inner cell wall layers by atomic force microscopy showed that two altered versions of Atcesa1 could rescue cell wall phenotypes observed in the mutant background line. Overall, the data show that the FxVTxK motif is functionally important in two phylogenetically distant plant CESAs. The results show that Physcomitrella provides an efficient model for assessing the effects of engineered CESA mutations affecting primary cell wall synthesis and that diverse testing systems can lead to nuanced insights into CESA structure–function relationships. Although CESA membrane topology needs to be experimentally determined, the results support the possibility that the FxVTxK region functions similarly in CESA and BcsA.

  14. Sex differences in angiotensin II- induced hypertension

    Directory of Open Access Journals (Sweden)

    B. Xue

    2007-05-01

    Full Text Available Sex differences in the development of hypertension and cardiovascular disease have been described in humans and in animal models. In this paper we will review some of our studies which have as their emphasis the examination of the role of sex differences and sex steroids in modulating the central actions of angiotensin II (ANG II via interactions with free radicals and nitric oxide, generating pathways within brain circumventricular organs and in central sympathomodulatory systems. Our studies indicate that low-dose infusions of ANG II result in hypertension in wild-type male mice but not in intact wild-type females. Furthermore, we have demonstrated that ANG II-induced hypertension in males is blocked by central infusions of the androgen receptor antagonist, flutamide, and by central infusions of the superoxide dismutase mimetic, tempol. We have also found that, in comparison to females, males show greater levels of intracellular reactive oxygen species in circumventricular organ neurons following long-term ANG II infusions. In female mice, ovariectomy, central blockade of estrogen receptors or total knockout of estrogen a receptors augments the pressor effects of ANG II. Finally, in females but not in males, central blockade of nitric oxide synthase increases the pressor effects of ANG II. Taken together, these results suggest that sex differences and estrogen and testosterone play important roles in the development of ANG II-induced hypertension.

  15. Aerosolization of fungi, (1→3)-β-D glucan, and endotoxin from flood-affected materials collected in New Orleans homes

    Science.gov (United States)

    Adhikari, Atin; Jung, Jaehee; Reponen, Tiina; Lewis, Jocelyn Suzanne; DeGrasse, Enjoli C.; Grimsley, L. Faye; Chew, Ginger L.; Grinshpun, Sergey A.

    2015-01-01

    Standing water and sediments remaining on flood-affected materials were the breeding ground for many microorganisms in flooded homes following Hurricane Katrina. The purpose of this laboratory study was to examine the aerosolization of culturable and total fungi, (1→3)-β-D glucan, and endotoxin from eight flood-affected floor and bedding materials collected in New Orleans homes, following Hurricane Katrina. Aerosolization was examined using the Fungal Spore Source Strength Tester (FSSST) connected to a BioSampler. Dust samples were collected by vacuuming. A two-stage cyclone sampler was used for size-selective analysis of aerosolized glucan and endotoxin. On average, levels of culturable fungi ranged from undetectable (lower limit = 8.3×104) to 2.6×105 CFU/m2; total fungi ranged from 2.07×105 to 1.6×106 spores/m2; (1→3)-β-D glucan and endotoxin were 2.0×103 – 2.9×104 ng/m2 and 7.0×102 – 9.3×104 EU/m2, respectively. The results showed that 5–15 min sampling is sufficient for detecting aerosolizable biocontaminants with the FSSST. Smaller particle size fractions (1.8 μm) fractions, which raises additional exposure concerns. Vacuuming was found to overestimate inhalation exposure risks by a factor of approximately 102 for (1→3)-β-D glucan and by 103 to 104 for endotoxin as detected by the FSSST. The information generated from this study is important with respect to restoration and rejuvenation of the flood-affected areas in New Orleans. We believe the findings will be significant during similar disasters in other regions of the world including major coastal floods from tsunamis. PMID:19201399

  16. Dietary β-glucan (MacroGard®) enhances survival of first feeding turbot (Scophthalmus maximus) larvae by altering immunity, metabolism and microbiota.

    Science.gov (United States)

    Miest, Joanna J; Arndt, Carmen; Adamek, Mikolaj; Steinhagen, Dieter; Reusch, Thorsten B H

    2016-01-01

    Reflecting the natural biology of mass spawning fish aquaculture production of fish larvae is often hampered by high and unpredictable mortality rates. The present study aimed to enhance larval performance and immunity via the oral administration of an immunomodulator, β-glucan (MacroGard(®)) in turbot (Scophthalmus maximus). Rotifers (Brachionus plicatilis) were incubated with or without yeast β-1,3/1,6-glucan in form of MacroGard(®) at a concentration of 0.5 g/L. Rotifers were fed to first feeding turbot larvae once a day. From day 13 dph onwards all tanks were additionally fed untreated Artemia sp. nauplii (1 nauplius ml/L). Daily mortality was monitored and larvae were sampled at 11 and 24 dph for expression of 30 genes, microbiota analysis, trypsin activity and size measurements. Along with the feeding of β-glucan daily mortality was significantly reduced by ca. 15% and an alteration of the larval microbiota was observed. At 11 dph gene expression of trypsin and chymotrypsin was elevated in the MacroGard(®) fed fish, which resulted in heightened tryptic enzyme activity. No effect on genes encoding antioxidative proteins was observed, whilst the immune response was clearly modulated by β-glucan. At 11 dph complement component c3 was elevated whilst cytokines, antimicrobial peptides, toll like receptor 3 and heat shock protein 70 were not affected. At the later time point (24 dph) an anti-inflammatory effect in form of a down-regulation of hsp 70, tnf-α and il-1β was observed. We conclude that the administration of MacroGard(®) induced an immunomodulatory response and could be used as an effective measure to increase survival in rearing of turbot. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Anti-infective properties of the melanin-glucan complex obtained from medicinal tinder bracket mushroom, Fomes fomentarius (L.: Fr.) Fr. (Aphyllophoromycetideae).

    Science.gov (United States)

    Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I

    2011-01-01

    The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.

  18. The effect of aerobic exercise and barley β-glucan on blood glucose, body composition and blood pressure of diabetic women

    Directory of Open Access Journals (Sweden)

    Fatemeh Mokhtari

    2018-04-01

    Full Text Available Background: The incidence of type 2 diabetes increases with aging, unhealthy diets, obesity and sedentary lifestyles. The aim of this study was to investigate the combinational effect of a 12-week aerobic exercise and barley β-glucan (BBG on blood glucose, body composition and blood pressure in women with type 2 diabetes. Materials and Methods: In this semi-experimental study, 24 women with the mean age of 49 years and a blood glucose level of 110-280 mg/dl were purposefully selected and randomly divided into three groups: a group of aerobic exercise with diet (n=8, b diet group (n=8 c control group (n=8. The diet group consumed one barley bread, containing 4 g of β glucan, each day for 12 weeks. The group of aerobic exercise, who was on diet, participated in a progressive walking program with the intensity of %60-70% of maximal heart rate in addition to diet program (barley bread. Blood glucose, weight, fat percentage, and systolic and diastolic blood pressure levels were measured in pre-and post-training. Results: Results showed a significant decrease in the blood glucose level in the experimental groups compared to the control group, while no major changes were observed in body composition and blood pressure. Conclusion: It seems that the combined program (aerobic training with diet or consumption of β-glucan alone can decrease blood glucose in patients with diabetes.

  19. Effect of a carbonated HAP/β-glucan composite bone substitute on healing of drilled bone voids in the proximal tibial metaphysis of rabbits

    International Nuclear Information System (INIS)

    Borkowski, Leszek; Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek; Polkowska, Izabela; Belcarz, Anna; Karpiński, Mirosław; Słowik, Tymoteusz; Matuszewski, Łukasz; Ślósarczyk, Anna; Ginalska, Grażyna

    2015-01-01

    A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration

  20. Commercial breakfast cereals available in Mexican markets and their contribution in dietary fiber, β-glucans and protein quality by rat bioassays.

    Science.gov (United States)

    Falcón-Villa, María R; Barrón-Hoyos, Jesús M; Cinco-Moroyoqui, Francisco J

    2014-09-01

    The beneficial effect of dietary fiber (DF) consumption has long been recognized. The global economy and open market trade policies have increased the availability of food products in Mexican markets, resulting in a wide variety of ready-to-eat commercial breakfast cereals classified as 'high fiber'. This research was aimed to evaluate the total dietary fiber contents, its fractions (soluble and insoluble) and β-glucan in 13 commercial 'high-fiber' breakfast cereals, as well as to evaluate their protein quality by rat bioassays. Commercial 'high-fiber' breakfast cereals had 7.42-39.82% insoluble dietary fiber, 2.53-12.85% soluble dietary fiber, and 0.45-4.96% β-glucan. These ready-to-eat commercial 'high-fiber' breakfast cereals differed significantly in their total dietary fiber, their soluble and insoluble DF fractions, and also in their β-glucan contents. When supplied as experimental diets, in 14-day rat feeding trials, the 'high-fiber' breakfast cereals showed an adverse effect on the % N digestibility but protein utilization, as measured as net protein ratio (NPR), was not significantly affected. The consumption of these commercial breakfast cereals, especially those made of oats as the basic ingredient, is highly recommended, since these products, being a concentrated source of dietary fiber, do not affect their protein quality.

  1. Morphology and Structural Properties of Novel Short Linear Glucan/Protein Hybrid Nanoparticles and Their Influence on the Rheological Properties of Starch Gel.

    Science.gov (United States)

    Li, Xiaojing; Ji, Na; Li, Man; Zhang, Shuangling; Xiong, Liu; Sun, Qingjie

    2017-09-13

    Starch nanoparticles were potential texture modifiers. However, they have strong tendency to aggregate and poor water dispersibility, which limited their application. The interaction between glucan (prepared from starch by enzymatic modification) and protein could significantly improve the dispersity of starch nanoparticles and, thus, enhance the rheological properties of food gels. In this work, glucan/protein hybrid nanoparticles were successfully developed for the first time using short linear glucan (SLG) and edible proteins [soy protein isolate (SPI), rice protein (RP), and whey protein isolate (WPI)]. The results showed that the SLG/SPI hybrid nanoparticles exhibited hollow structures, of which the smallest size was approximately 10-20 nm when the SLG/SPI ratio was 10:5. In contrast, SLG/RP nanoparticles displayed flower-like superstructures, and SLG/WPI nanoparticles presented stacked lamellar nanostructures with a width of 5-10 nm and a length of 50-70 nm. In comparison to bare SLG nanoparticles, SLG/SPI and SLG/WPI hybrid nanoparticles had higher melting temperatures. The addition of all nanoparticles greatly increased the storage modulus of corn starch gels and decreased loss tangent values. Importantly, the G' value of starch gels increased by 567% with the addition of flower-like SLG/RP superstructures.

  2. A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial.

    Science.gov (United States)

    Tessari, Paolo; Lante, Anna

    2017-03-17

    Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed 'functional' bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods : Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values ( p = 0.028), and by ~0.6% vs. the control group ( p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes.

  3. Effect of a carbonated HAP/β-glucan composite bone substitute on healing of drilled bone voids in the proximal tibial metaphysis of rabbits

    Energy Technology Data Exchange (ETDEWEB)

    Borkowski, Leszek, E-mail: leszek.borkowski@umlub.pl [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek [Department of Animal Physiology, University of Life Sciences in Lublin, Akademicka 12, 20-033 Lublin (Poland); Polkowska, Izabela [Department and Clinic of Animal Surgery, University of Life Sciences in Lublin, Głęboka 30, 20-612 Lublin (Poland); Belcarz, Anna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Karpiński, Mirosław [Department of Companion and Wildlife Animals, University of Life Sciences in Lublin, Akademicka 13, 20-950 Lublin (Poland); Słowik, Tymoteusz [Independent Radiology Unit at Lublin Small Animals Medical Centre, Stefczyka 11, 20-151 Lublin (Poland); Matuszewski, Łukasz [Children' s Orthopaedic Clinic and Rehabilitation Department, Medical University of Lublin, Chodzki 2, 20-093 Lublin (Poland); Ślósarczyk, Anna [Faculty of Materials Science and Ceramics, AGH-University of Science and Technology, Mickiewicza 30, 30-059 Krakow (Poland); Ginalska, Grażyna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland)

    2015-08-01

    A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration.

  4. Comparative studies on the induction of Trichoderma harzianum mutanase by α-(1→3)-glucan-rich fruiting bodies and mycelia of Laetiporus sulphureus.

    Science.gov (United States)

    Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz

    2012-01-01

    Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.

  5. A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial

    Science.gov (United States)

    Tessari, Paolo; Lante, Anna

    2017-01-01

    Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350

  6. Hydroxypropyl cyclic β-(1 → 2)-D-glucans and epichlorohydrin β-cyclodextrin dimers as effective carbohydrate-solubilizers for polycyclic aromatic hydrocarbons.

    Science.gov (United States)

    Choi, Jae Min; Jeong, Daham; Piao, Jinglan; Kim, Kyoungtea; Nguyen, Andrew Bao Loc; Kwon, Nak-Jung; Lee, Mi-Kyung; Lee, Im Soon; Yu, Jae-Hyuk; Jung, Seunho

    2015-01-12

    The removal of polycyclic aromatic hydrocarbons by soil washing using water is extremely difficult due to their intrinsic hydrophobic nature. In this study, the effective aqueous solubility enhancements of seven polycyclic aromatic hydrocarbons by chemically modified hydroxypropyl rhizobial cyclic β-(1 → 2)-D-glucans and epichlorohydrin β-cyclodextrin dimer have been investigated for the first time. In the presence of hydroxypropyl cyclic β-(1 → 2)-D-glucans, the solubility of benzo[a]pyrene is increased up to 38 fold of its native solubility. The solubility of pyrene and phenanthrene dramatically increased up to 160 and 359. Coronene, chrysene, perylene, and fluoranthene also show an increase of 11, 23, 23, and 97 fold, respectively, of enhanced solubility by complexation with synthetic epichlorohydrin β-cyclodextrin dimer. The physicochemical properties of the complex are characterized by Fourier-transform infrared spectra and differential scanning calorimetry. Utilizing a scanning electron microscopy, the morphological structures of native benzo[a]pyrene, pyrene, phenanthrene, coronene, chrysene, perylene, fluoranthene and their complex with novel carbohydrate-solubilizers are studied. These results elucidate that polycyclic aromatic hydrocarbons are able to form an efficient complex with hydroxypropyl cyclic β-(1 → 2)-D-glucans and β-cyclodextrin dimer, suggesting the potential usage of chemically modified novel carbohydrate-solubilizers. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Structural Characterization and Antioxidative Activity of Low-Molecular-Weights Beta-1,3-Glucan from the Residue of Extracted Ganoderma lucidum Fruiting Bodies

    Directory of Open Access Journals (Sweden)

    Pai-Feng Kao

    2012-01-01

    Full Text Available The major cell wall constituent of Ganoderma lucidum (G. lucidum is β-1,3-glucan. This study examined the polysaccharide from the residues of alkaline-extracted fruiting bodies using high-performance anion-exchange chromatography (HPAEC, and it employed nuclear magnetic resonance (NMR and mass spectrometry (MS to confirm the structures. We have successfully isolated low-molecular-weight β-1,3-glucan (LMG, in high yields, from the waste residue of extracted fruiting bodies of G. lucidum. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay evaluated the capability of LMG to suppress H2O2-induced cell death in RAW264.7 cells, identifying that LMG protected cells from H2O2-induced damage. LMG treatment decreased H2O2-induced intracellular reactive oxygen species (ROS production. LMG also influenced sphingomyelinase (SMase activity, stimulated by cell death to induce ceramide formation, and then increase cell ROS production. Estimation of the activities of neutral and acid SMases in vitro showed that LMG suppressed the activities of both neutral and acid SMases in a concentration-dependent manner. These results suggest that LMG, a water-soluble β-1,3-glucan recycled from extracted residue of G. lucidum, possesses antioxidant capability against H2O2-induced cell death by attenuating intracellular ROS and inhibiting SMase activity.

  8. Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.

    Science.gov (United States)

    Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan

    2009-01-01

    The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.

  9. Baker's yeast beta glucan supplementation increases salivary IgA and decreases cold/flu symptomatic days after intense exercise.

    Science.gov (United States)

    McFarlin, Brian K; Carpenter, Katie C; Davidson, Tiffany; McFarlin, Meredith A

    2013-09-01

    Strenuous exercise, such as running a marathon, is known to suppress mucosal immunity for up to 24 hr, which can increase the risk of developing an upper respiratory tract infection (URTI) and reduced performance capacity (Allgrove JE, Geneen L, Latif S, Gleeson M. Influence of a fed or fasted state on the s-IgA response to prolonged cycling in active men and women. Int J Sport Nutr Exerc Metab. 2009;19(3):209-221; Barrett B, Locken K, Maberry R, Schwamman J, Brown R, Bobula J, Stauffacher EA. The Wisconsin Upper Respiratory Symptom Survey (WURSS): a new research instrument for assessing the common cold. J Fam Pract. 2002;51(3):265; Carpenter KC, Breslin WL, Davidson T, Adams A, McFarlin BK. Baker's yeast beta glucan supplementation increases monocytes and cytokines post-exercise: implications for infection risk? Br J Nutr. 2012;1-9). While many dietary interventions have been used to combat postexercise immune suppression, most have been ineffective. The key purpose of this study was to determine if baker's yeast β-glucan (BG) could positively affect the immune system of individuals undergoing intense exercise stress using two experiments. In the first (E1; N = 182 men and women), BG was compared to placebo supplementation for the incidence of URTI symptoms for 28 days postmarathon. In the second (E2; N = 60 men and women) changes in salivary immunoglobulin A (IgA) were evaluated after 50-min of strenuous cycling when participants had been supplemented for 10 days with either BG (250 mg/day) or placebo (rice flour). For E1, subjects reported URTI symptoms using a daily health log. For E2, saliva was collected prior to, immediately, and 2-hr postexercise using a salivette. Data for E1 and E2 were analyzed using separate analyses of variance (ANOVAs) with repeated measures (p flu symptom days postmarathon compared to placebo (p = .026). In E2, BG was associated with a 32% increase in salivary IgA (p = .048) at 2 hr after exercise compared to placebo. In summary

  10. Exposures to thoracic particulate matter, endotoxin, and glucan during post-Hurricane Katrina restoration work, New Orleans 2005-2012.

    Science.gov (United States)

    Rando, Roy J; Kwon, Cheol-Woong; Lefante, John J

    2014-01-01

    In the aftermath of Hurricane Katrina, which devastated the city of New Orleans in August 2005, restoration workers were at risk for respiratory illness from exposure to airborne particles and microbial agents. In support of an epidemiologic investigation of this risk, an exposure assessment for restoration work activities (demolition, trash & debris management, landscape restoration, sewer/waterline repair, and mold remediation) was performed from 2005 to 2012. For 2005 and 2006, Occupational Safety and Health Administration (OSHA) data (n = 730) for personal and area monitoring of total and respirable dust exposures of restoration workers were accessed and analyzed. The most significant exposures were for demolition work, with average respirable dust exposures in 2005 above the action level of 2.5 mg/m(3) and 17.6% of exposures exceeding the permissible exposure limit (PEL) (5 mg/m(3)). Additional personal and area monitoring for thoracic particulate matter was performed from 2007 to 2012 (n = 774) and samples were assayed for endotoxin and (1→3, 1→6)-β-D-glucan (n = 202). In order to integrate the OSHA data with the later monitoring data, three independent predictive models were developed to convert total and respirable dust measures into the equivalent thoracic dust. The three models were not statistically different and the modeling results were in good agreement with an overall coefficient of variation of 16% for the thoracic dust means across work activities estimated by each of the three models. Overall, thoracic dust exposure levels decreased by about an order of magnitude within the first year after Katrina and then more gradually declined and stabilized through 2012. Estimated average exposures to endotoxin and microbial glucan in 2005 were as high as 256 EU/m(3) and 118 μg/m(3), respectively, and likewise were seen to decrease dramatically and stabilize after 2005. The results of this exposure assessment support previously published reports of

  11. A pH-responsive carboxylic β-1,3-glucan polysaccharide for complexation with polymeric guests.

    Science.gov (United States)

    Lien, Le Thi Ngoc; Shiraki, Tomohiro; Dawn, Arnab; Tsuchiya, Youichi; Tokunaga, Daisuke; Tamaru, Shun-ichi; Enomoto, Naoya; Hojo, Junichi; Shinkai, Seiji

    2011-06-07

    The helix-forming nature of β-1,3-glucan polysaccharides is a characteristic that has potential for producing gene carriers, bio-nanomaterials and other chiral nanowires. Herein, carboxylic curdlan (CurCOOH) bearing the β-1,3-polyglucuronic acid structure was successfully prepared from β-1,3-glucan polysaccharide curdlan (Cur) by one-step oxidation using a 4-acetamido-TEMPO/NaClO/NaClO(2) system as the oxidant. The resulting high-molecular-weight CurCOOH was proved to bear the 6-COOH group in 100% purity. The optical rotatory dispersion (ORD) spectra indicated that the obtained CurCOOH behaves as a water-soluble single-strand in various pH aqueous media. This advantage has allowed us to use CurCOOH as a polymeric host to form various macromolecular complexes. For example, complexation of CurCOOH with single-walled carbon nanotubes (SWNTs) resulted in a water-soluble one-dimensional architecture, which formed a dispersion in aqueous solution that was stable for several months, and much more stable than SWNTs complexes of the similar negatively-charged polyacrylic acid (PAA) and polymethacrylic acid (PMAA). It was shown that in the complex, SWNTs are effectively wrapped by a small amount of CurCOOH, enabling them to avoid electrostatic repulsion. This pH-responsive CurCOOH formed a very stable complex with cationic water-soluble polythiophenes (PT-1), which was stabilized not only by the hydrophobic interaction but also by the electrostatic attraction between trimethylammonium cations in PT-1 and dissociated anionic COO(-) groups in CurCOOH. The included PT-1 became CD-active only in the neutral to basic pH region, and the positive Cotton effect suggested that the conjugated main chain is twisted in the right-handed direction. We also found that CurCOOH can interact with polycytidylic acid (poly(C)) only under high NaCl concentrations, the binding and release of which could be controlled by a change in the salt concentration. We believe, therefore, that Cur

  12. Enhancement of vascular targeting by inhibitors of nitric oxide synthase

    International Nuclear Information System (INIS)

    Davis, Peter D.; Tozer, Gillian M.; Naylor, Matthew A.; Thomson, Peter; Lewis, Gemma; Hill, Sally A.

    2002-01-01

    Purpose: This study investigates the enhancement of the vascular targeting activity of the tubulin-binding agent combretastatin A4 phosphate (CA4P) by various inhibitors of nitric oxide synthases. Methods and Materials: The syngeneic tumors CaNT and SaS growing in CBA mice were used for this study. Reduction in perfused vascular volume was measured by injection of Hoechst 33342 24 h after drug administration. Necrosis (hematoxylin and eosin stain) was assessed also at 24 h after treatment. Combretastatin A4 phosphate was synthesized by a modification of the published procedure and the nitric oxide synthase inhibitors L-NNA, L-NMMA, L-NIO, L-NIL, S-MTC, S-EIT, AMP, AMT, and L-TC, obtained from commercial sources. Results: A statistically significant augmentation of the reduction in perfused vascular volume by CA4P in the CaNT tumor was observed with L-NNA, AMP, and AMT. An increase in CA4P-induced necrosis in the same tumor achieved significance with L-NNA, L-NMMA, L-NIL, and AMT. CA4P induced little necrosis in the SaS tumor, but combination with the inhibitors L-NNA, L-NMMA, L-NIO, S-EIT, and L-TC was effective. Conclusions: Augmentation of CA4P activity by nitric oxide synthase inhibitors of different structural classes supports a nitric oxide-related mechanism for this effect. L-NNA was the most effective inhibitor studied

  13. Incorporation of phosphate into glycogen by glycogen synthase.

    Science.gov (United States)

    Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

    2016-05-01

    The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Microsomal prostaglandin E synthase-1 in rheumatic diseases

    Directory of Open Access Journals (Sweden)

    Marina eKorotkova

    2011-01-01

    Full Text Available Microsomal prostaglandin E synthase-1 (mPGES-1 is a well recognized target for the development of novel anti-inflammatory drugs that can reduce symptoms of inflammation in rheumatic diseases and other inflammatory conditions. In this review, we focus on mPGES-1 in rheumatic diseases with the aim to cover the most recent advances in the understanding of mPGES-1 in rheumatoid arthritis, osteoarthritis and inflammatory myopathies. Novel findings regarding regulation of mPGES1 cell expression as well as enzyme inhibitors are also summarized.

  15. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    We used post-mortem magnetic resonance imaging (MRI) guidance to obtain paired biopsies from the brains of four patients with clinical definite multiple sclerosis (MS). Samples were analyzed for the immunoreactivity (IR) of the three nitric oxide (NO) synthase isoforms [inducible, neuronal......NOS expressing cells in active lesions. NOS IR expressing cells were widely distributed in plaques, in white and gray matter that appeared normal macroscopically, and on MR. Endothelial NOS (eNOS) was highly expressed in intraparenchymal vascular endothelial cells of MS patients. A control group matched for age...

  16. Fatty acid synthase inhibitors isolated from Punica granatum L

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)

    2012-05-15

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)

  17. Fatty acid synthase inhibitors isolated from Punica granatum L

    International Nuclear Information System (INIS)

    Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng

    2012-01-01

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)

  18. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    International Nuclear Information System (INIS)

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-01-01

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution

  19. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    Energy Technology Data Exchange (ETDEWEB)

    Enderle, Mathias [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany); McCarthy, Andrew [EMBL Grenoble, 71 Avenue des Martyrs, 38042 Grenoble CEDEX 9 (France); Paithankar, Karthik Shivaji, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Grininger, Martin, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany)

    2015-10-23

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  20. Characterization of Polysaccharides from the Fruiting Bodies of Two Species of Genus Ganoderma (Agaricomycetes) and Determination of Water-Soluble β-D-Glucan Using High-Performance Liquid Chromatography.

    Science.gov (United States)

    Liu, Yanfang; Tang, Qingjiu; Yang, Yan; Zhou, Shuai; Wu, Di; Tang, Chuanhong; Zhang, Zhong; Yan, Mengqiu; Feng, Jie; Zhang, Jing-Song

    2017-01-01

    Molecular weight (Mw) distributions of polysaccharides from the fruiting bodies of different Ganoderma lucidum strains and G. sinense were investigated and compared using high-pressure size exclusion chromatography/multiangle laser light scattering/refractive index analysis. Results showed that there were big differences in the Mw distributions and characteristics of polysaccharides from 2 species of Ganoderma. All tested G. lucidum materials exhibited similar polysaccharide distributions and similar characteristics for each fraction. The fraction with highest Mw (peak 1) was identified as β-(1→3)-linked D-glucan with (1→6)-β-D-glucopyranosyl side branches. G. sinense fruiting bodies did not include the β-D-glucan when compared with G. lucidum. A high-pressure size exclusion chromatography method was developed and applied to determine the amount of high-Mw β-D-glucan in G. lucidum fruiting bodies. Results indicated that there was no obvious relationship between β-D-glucan content and the genetic similarity of G. lucidum. The strain labeled "Longzhi no. 2" was determined to possess the largest amount of β-D-glucan: 8.2 mg/mL based on the dry weight of fruiting bodies. The β-D-glucan content in the hot water extract of Longzhi no. 2 reached 17.05%. For the "Hunong no. 1" strain, the β-D-glucan content in log-cultivated fruiting bodies was much higher than that in bag-cultivated ones. This method could be used to improve quality control of polysaccharides in G. lucidum.