WorldWideScience

Sample records for glucan sulfate ps3

  1. Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

    Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

    2017-07-28

    The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

  2. Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation

    Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.

    2015-01-01

    β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the

  3. Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan.

    Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité

    2017-02-01

    Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan

    Yücel, Cigdem; Sotres, Javier; Rascón, Ana

    2017-01-01

    HYPOTHESIS: Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. EXPERIMENT: Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic...... force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured...

  5. Antimicrobial Properties and Cytotoxicity of Sulfated (1,3)-β-D-Glucan from the Mycelium of the Mushroom Ganoderma lucidum.

    Wan-Mohtar, Wan Abd Al Qadr Imad; Young, Louise; Abbott, Gráinne M; Clements, Carol; Harvey, Linda M; McNeil, Brian

    2016-06-28

    Ganoderma lucidum BCCM 31549 has a long established role for its therapeutic activities. In this context, much interest has focused on the possible functions of the (1,3)-β-D-glucan (G) produced by these cultures in a stirred-tank bioreactor and extracted from their underutilized mycelium. In the existing study, we report on the systematic production of G, and its sulfated derivative (GS). The aim of this study was to investigate G and its GS from G. lucidum in terms of their antibacterial properties and cytotoxicity spectrum against human prostate cells (PN2TA) and human caucasian histiocytic lymphoma cells (U937). (1)H NMR for both G and GS compounds showed β-glycosidic linkages and structural similarities when compared with two standards (laminarin and fucoidan). The existence of characteristic absorptions at 1,170 and 867 cm(-1) in the FTIR (Fourier Transform Infrared Spectroscopy) for GS demonstrated the successful sulfation of G. Only GS exhibited antimicrobial activity against a varied range of test bacteria of relevance to foodstuffs and human health. Moreover, both G and GS did not show any cytotoxic effects on PN2TA cells, thus helping demonstrate the safety of these polymers. Moreover, GS showed 40% antiproliferation against cancerous U937 cells at the low concentration (60 μg/ ml) applied in this study compared with G (10%). Together, this demonstrates that sulfation clearly improved the solubility and therapeutic activities of G. The water-soluble GS demonstrates the potential multifunctional effects of these materials in foodstuffs.

  6. Evaluation of the antischistosomal activity of sulfated α-D-glucan from the lichen Ramalina celastri free and encapsulated into liposomes

    R.V.S. Araújo

    2011-04-01

    Full Text Available The antischistosomal activity of the sulfated polysaccharide α-D-glucan (Glu.SO4 extracted from Ramalina celastri was evaluated after encapsulation into liposomes (Glu.SO4-LIPO in Schistosoma mansoni-infected mice. The effect of treatment with Glu.SO4 and Glu.SO4-LIPO (10 mg/kg on egg elimination, worm burden and hepatic granuloma formation was assessed using female albino Swiss mice, 35-40 days of age, weighing 25 ± 2 g, infected with 150 cercariae/animal (Biomphalaria glabrata, BH strain. Four groups (N = 10 were studied, two controls (empty liposomes and NaCl and two treated groups (Glu.SO4-LIPO and Glu.SO4 using a single dose. Parasitological analysis revealed that Glu.SO4-LIPO was as efficient as Glu.SO4 in reducing egg elimination and worm burden. Treatment with free Glu.SO4 and Glu.SO4-LIPO induced a statistically significant reduction in the number of granulomas (62 and 63%, respectively. Lectin histochemistry showed that wheat germ agglutinin intensely stained the egg-granuloma system in all treated groups. On the other hand, peanut agglutinin stained cells in the control groups, but not in the treated groups. The present results suggest a correlation between the decreasing number of hepatic egg-granulomas and the glycosylation profile of the egg-granuloma system in animals treated with free Glu.SO4 or Glu.SO4-LIPO.

  7. The sulfated laminarin triggers a stress transcriptome before priming the SA- and ROS-dependent defenses during grapevine's induced resistance against Plasmopara viticola.

    Adrien Gauthier

    Full Text Available Grapevine (Vitis vinifera is susceptible to many pathogens which cause significant losses to viticulture worldwide. Chemical control is available, but agro-ecological concerns have raised interest in alternative methods, especially in triggering plant immunity by elicitor treatments. The β-glucan laminarin (Lam and its sulfated derivative (PS3 have been previously demonstrated to induce resistance in grapevine against downy mildew (Plasmopara viticola. However, if Lam elicits classical grapevine defenses such as oxidative burst, pathogenesis-related (PR-proteins and phytoalexin production, PS3 triggered grapevine resistance via a poorly understood priming phenomenon. The aim of this study was to identify the molecular mechanisms of the PS3-induced resistance. For this purpose we studied i the signaling events and transcriptome reprogramming triggered by PS3 treatment on uninfected grapevine, ii grapevine immune responses primed by PS3 during P. viticola infection. Our results showed that i PS3 was unable to elicit reactive oxygen species (ROS production, cytosolic Ca(2+ concentration variations, mitogen-activated protein kinase (MAPK activation but triggered a long lasting plasma membrane depolarization in grapevine cells, ii PS3 and Lam shared a common stress-responsive transcriptome profile that partly overlapped the salicylate- (SA and jasmonate-(JA-dependent ones. After P. viticola inoculation, PS3 specifically primed the SA- and ROS-dependent defense pathways leading to grapevine induced resistance against this biotroph. Interestingly pharmacological approaches suggested that the plasma membrane depolarization and the downstream ROS production are key events of the PS3-induced resistance.

  8. PS3 CELL Development for Scientific Computation and Research

    Christiansen, M.; Sevre, E.; Wang, S. M.; Yuen, D. A.; Liu, S.; Lyness, M. D.; Broten, M.

    2007-12-01

    The Cell processor is one of the most powerful processors on the market, and researchers in the earth sciences may find its parallel architecture to be very useful. A cell processor, with 7 cores, can easily be obtained for experimentation by purchasing a PlayStation 3 (PS3) and installing linux and the IBM SDK. Each core of the PS3 is capable of 25 GFLOPS giving a potential limit of 150 GFLOPS when using all 6 SPUs (synergistic processing units) by using vectorized algorithms. We have used the Cell's computational power to create a program which takes simulated tsunami datasets, parses them, and returns a colorized height field image using ray casting techniques. As expected, the time required to create an image is inversely proportional to the number of SPUs used. We believe that this trend will continue when multiple PS3s are chained using OpenMP functionality and are in the process of researching this. By using the Cell to visualize tsunami data, we have found that its greatest feature is its power. This fact entwines well with the needs of the scientific community where the limiting factor is time. Any algorithm, such as the heat equation, that can be subdivided into multiple parts can take advantage of the PS3 Cell's ability to split the computations across the 6 SPUs reducing required run time by one sixth. Further vectorization of the code can allow for 4 simultanious floating point operations by using the SIMD (single instruction multiple data) capabilities of the SPU increasing efficiency 24 times.

  9. Purification and characterization of lipase by Bacillus methylotrophicus PS3 under submerged fermentation and its application in detergent industry

    Pushpinder Sharma

    2017-12-01

    Full Text Available Lipase production bacterial isolate was isolated from soil of service station and identified as Bacillus methylotrophicus PS3 by 16SrRNA with accession number |LN999829.1|. Lipase enzyme was purified by sequential methods of ammonium sulfate precipitation and Sephadex G-100 gel column chromatography. The molecular weight of purified enzyme was 31.40 kDa on SDS-PAGE. This purification procedure resulted in 2.90-fold purification of lipase with a 24.10% final yield. The purified lipase presented maximal hydrolytic activity at a temperature of 55 °C, and pH of 7.0. Lipase activity was stimulated by Triton X-100 and SDS with Mg2+ and Ca2+ metals employ a positive effect and outlast its stable in organic solvent i.e. methanol and ethanol.

  10. Synthesis of NiPS3 and CoPS and its hydrogen storage capacity

    Ismail, N.; Madian, M.; El-Meligi, A.A.

    2014-01-01

    Highlights: • Preparation of NiPS 3 and CoPS using solid state reaction. • Characterization of compounds using XRD, TEM, SEM and IR. • Measuring the compounds thermal stability. • Estimation of the hydrogen storage capacity. -- Abstract: Prepared CoPS and NiPS 3 are studied as new materials for hydrogen energy storage. Single phase of CoPS and NiPS 3 were grown separately in evacuated silicatube via solid state reaction at 650 °C with controlled heating rate 1 °C/min. X-ray diffraction patterns confirm the formation of the desired compounds. Both CoPS and NiPS 3 exhibited high thermal stability up to 700 °C and 630 °C, respectively. The morphology of the prepared samples was investigated using scanning electron microscopy and folded sheets appeared in the transmission electron microscopy. The samples were exposed to 20 bar applied hydrogen pressure at 80 K. Both compounds appear to have feasible hydrogen storage capacity. CoPS was capable to adsorb 1.7 wt% while NiPS 3 storage capacity reached 1.2 wt%

  11. High-Pressure Raman Scattering in the Layered Antiferromagnet NiPS_3

    Rosenblum, S.; Merlin, R.; Francis, A. H.

    1996-03-01

    We report on two-magnon and vibrational Raman scattering from NiPS3 for pressures up to 30 GPa and temperatures between 110 and 300 K. NiPS3 is an S=1, two-dimensional antiferromagnet with TN = 150 K. It is the only known S=1 compound with a relative two-magnon linewidth comparable in magnitude to that of the parent compounds of the high temperature superconductors.(Rosenblum et al., Phys. Rev. B 49), 4352 (1994) In the cuprates, this anomalous linewidth is well described by phonon-magnon coupling.(Knoll et al.), Phys. Rev.B 42, 4842 (1990).^,(Nori et al., Phys. Rev. Lett. 75), 553 (1995). Here, we will look at the measured Grüneisen parameters of the vibrational and magnetic excitations and relate them to the magnetostrictive model.

  12. Package-friendly piezoresistive pressure sensors with on-chip integrated packaging-stress-suppressed suspension (PS3) technology

    Wang, Jiachou; Li, Xinxin

    2013-01-01

    An on-chip integrated packaging-stress-suppressed suspension (PS 3 ) technology for a packaging-stress-free pressure sensor is proposed and developed. With a MIS (microholes interetch and sealing) micromachining process implemented only from the front-side of a single-side polished (1 1 1) silicon wafer, a compact cantilever-shaped PS 3 is on-chip integrated surrounding a piezoresistive pressure-sensing structure to provide a packaging-process/substrate-friendly method for low-cost but high-performance sensor applications. With the MIS process, the chip size of the PS 3 -enclosed pressure sensor is as small as 0.8 mm × 0.8 mm. Compared with a normal pressure sensor without PS 3 (but with an identical pressure-sensing structure), the proposed pressure sensor has the same sensitivity of 0.046 mV kPa −1 (3.3 V) −1 . However, without using the thermal compensation technique, a temperature coefficient of offset of only 0.016% °C −1 FS is noted for the sensor with PS 3 , which is about 15 times better than that for the sensor without PS 3 . Featuring effective isolation and elimination of the influence from packaging stress, the PS 3 technique is promising to be widely used for packaging-friendly mechanical sensors. (paper)

  13. Beta-glucans and cholesterol

    Šíma, Petr; Vannucci, Luca; Větvička, V.

    2017-01-01

    Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016

  14. pH Sensitivity of Novel PANI/PVB/PS3 Composite Films

    Olga Korostynska

    2007-12-01

    Full Text Available This paper reports on the results from the investigation into the pH sensitivity ofnovel PANI/PVB/PS3 composite films. The conductimetric sensing mode was chosen as itis one of the most promising alternatives to the mainstream pH-sensing methods and it is theleast investigated due to the popularity of other approaches. The films were deposited usingboth screen-printing and a drop-coating method. It was found that the best response to pHwas obtained from the screen-printed thick films, which demonstrated a change inconductance by as much as three orders of magnitude over the pH range pH2-pH11. Thedevices exhibited a stable response over 96 hours of operation. Several films were immersedin buffer solutions of different pH values for 96 hours and these were then investigated usingXPS. The resulting N 1s spectra for the various films confirmed that the change inconductance was due to deprotonation of the PANI polymer backbone. SEM andProfilometry were also undertaken and showed that no considerable changes in themorphology of the films took place and that the films did not swell or contract due toexposure to test solutions.

  15. Plants with elevated levels of glucan

    Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

    2018-03-20

    The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

  16. Defining Starch Binding by Glucan Phosphatases

    Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

    2015-01-01

    Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...

  17. A screening method for β-glucan hydrolase employing Trypan Blue-coupled β-glucan agar plate and β-glucan zymography.

    Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick

    2012-06-01

    A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.

  18. Glucan: mechanisms involved in its radioprotective effect

    Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.

    1987-01-01

    It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested

  19. Characterization of the catalytic and noncatalytic ADP binding sites of the F1-ATPase from the thermophilic bacterium, PS3

    Yoshida, M.; Allison, W.S.

    1986-01-01

    Two classes of ADP binding sites at 20 degrees C have been characterized in the F1-ATPase from the thermophilic bacterium, PS3 (TF1). One class is comprised of three sites which saturate with [ 3 H]ADP in less than 10 s with a Kd of 10 microM which, once filled, exchange rapidly with medium ADP. The binding of ADP to these sites is dependent on Mg2+. [ 3 H]ADP bound to these sites is removed by repeated gel filtrations on centrifuge columns equilibrated with ADP free medium. The other class is comprised of a single site which saturates with [ 3 H]ADP in 30 min with a Kd of 30 microM. [ 3 H]ADP bound to this site does not exchange with medium ADP nor does it dissociate on gel filtration through centrifuge columns equilibrated with ADP free medium. Binding of [ 3 H]ADP to this site is weaker in the presence of Mg2+ where the Kd for ADP is about 100 microM. [ 3 H]ADP dissociated from this site when ATP plus Mg2+ was added to the complex while it remained bound in the presence of ATP alone or in the presence of ADP, Pi, or ADP plus Pi with or without added Mg2+. Significant amounts of ADP in the 1:1 TF1.ADP complex were converted to ATP in the presence of Pi, Mg2+, and 50% dimethyl sulfoxide. Enzyme-bound ATP synthesis was abolished by chemical modification of a specific glutamic acid residue by dicyclohexylcarbodiimide, but not by modification of a specific tyrosine residue with 7-chloro-4-nitrobenzofurazan. Difference circular dichroism spectra revealed that the three Mg2+ -dependent, high affinity ADP binding sites that were not stable to gel filtration were on the alpha subunits and that the single ADP binding site that was stable to gel filtration was on one of the three beta subunits

  20. β-1,3-glucan in developing cotton fibers

    Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.

    1979-01-01

    Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis

  1. Barium Sulfate

    ... uses a computer to put together x-ray images to create cross-sectional or three dimensional pictures of the inside of the body). Barium sulfate is in a class of medications called radiopaque contrast media. It works by coating the esophagus, stomach, or ...

  2. Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis

    Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

    2016-01-01

    was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...

  3. Recent insight in α-glucan metabolism in probiotic bacteria

    Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm

    2014-01-01

    α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...

  4. Glucan synthesis in the genus Lactobacillus: Isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

    Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2004-01-01

    Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

  5. Glucan synthesis in the genus Lactobacillus : isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

    Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2004-01-01

    Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

  6. Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.

    Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza

    2008-03-20

    Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).

  7. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  8. Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).

    Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio

    2008-01-01

    Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.

  9. Various roles of beta-glucan in invertebrates

    Větvička, V.; Šíma, Petr

    2017-01-01

    Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016

  10. Effects of Low Molecular Weight Yeast β-Glucan on Antioxidant and Immunological Activities in Mice

    Na Lei

    2015-09-01

    Full Text Available To evaluate the antioxidant and immune effects of low molecular yeast β-glucan on mice, three sulfated glucans from Saccharomyces cerevisiae (sGSCs with different molecular weight (MW and degrees of sulfation (DS were prepared. The structures of the sGSCs were analyzed through high performance liquid chromatography-gel permeation chromatography (HPLC-GPC and Fourier transform infrared spectroscopy (FTIR. sGSC1, sGSC2, and sGSC3 had MW of 12.9, 16.5 and 19.2 kDa, respectively, and DS of 0.16, 0.24 and 0.27, respectively. In vitro and in vivo experiments were conducted to evaluate the antioxidant and immunological activities of the sGSCs. In vitro experiment, the reactive oxygen species (ROS scavenging activities were determined. In vivo experiment, 50 male BALB/c mice were divided into five groups. The sGSC1, sGSC2 and sGSC3 treatment groups received the corresponding sGSCs at 50 mg/kg/day each. The GSC (glucans from Saccharomyces cerevisiae treatment group received 50 mg/kg/day GSC. The normal control group received equal volume of physiological saline solution. All treatments were administered intragastrically for 14 day. Results showed that sGSC1, sGSC2 and sGSC3 can scavenge 1,1-diphenyl-2-picryl-hydrazyl (DPPH, superoxide, and hydroxyl radicals in vitro. The strength of the radical scavenging effects of the sGSCs was in the order of sGSC1 > sGSC2 > sGSC3. Oral administration of sGSC1 significantly improved serum catalase (CAT and glutathione peroxidase (GSH-Px activities and decreased malondialdehyde (MDA level in mice. sGSC1 significantly improved the spleen and thymus indexes and the lymphocyte proliferation, effectively enhanced the percentage of CD4+ T cells, decreased the percentage of CD8+ T cells, and elevated the CD4+/CD8+ ratio. sGSC1 significantly promoted the secretion of IL-2 and IFN-γ. These results indicate that sGSC1 with low MW and DS has better antioxidant and immunological activities than the other sGSCs, and sGSC1 could

  11. Preparation, characterization, and biological properties of β-glucans

    Sandeep Rahar

    2011-01-01

    Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

  12. Desulfotignum phosphitoxidans sp. nov., a new marine sulfate reducer that oxidizes phosphite to phosphate.

    Schink, Bernhard; Thiemann, Volker; Laue, Heike; Friedrich, Michael W

    2002-05-01

    A new sulfate-reducing bacterium was isolated from marine sediment with phosphite as sole electron donor and CO(2) as the only carbon source. Strain FiPS-3 grew slowly, with doubling times of 3-4 days, and oxidized phosphite, hydrogen, formate, acetate, fumarate, pyruvate, glycine, glutamate, and other substrates nearly completely, with concomitant reduction of sulfate to sulfide. Acetate was formed as a side product to a small extent. Glucose, arabinose, and proline were partly oxidized and partly fermented to acetate plus propionate. Growth with phosphite, hydrogen, or formate was autotrophic. Also, in the presence of sulfate, CO dehydrogenase was present, and added acetate did not increase growth rates or growth yields. In the absence of sulfate, phosphite oxidation was coupled to homoacetogenic acetate formation, with growth yields similar to those in the presence of sulfate. Cells were small rods, 0.6 - 0.8 x 2-4 microm in size, and gram-negative, with a G+C content of 53.9 mol%. They contained desulforubidin, but no desulfoviridin. Based on sequence analysis of the 16S rRNA gene and the sulfite reductase genes dsrAB, strain FiPS-3 was found to be closely related to Desulfotignum balticum. However, physiological properties differed in many points from those of D. balticum. These findings justify the establishment of a new species, Desulfotignum phosphitoxidans.

  13. Evaluation on prebiotic properties of β-glucan and oligo-β-glucan from mushrooms by human fecal microbiota in fecal batch culture

    Chiraphon Chaikliang

    2015-11-01

    Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of

  14. Sulfate adsorption on goethite

    Rietra, R P.J.J.; Hiemstra, T; Riemsdijk, W.H. van

    1999-10-15

    Recent spectroscopic work has suggested that only one surface species of sulfate is dominant on hematite. Sulfate is therefore a very suitable anion to test and develop adsorption models for variable charge minerals. The authors have studied sulfate adsorption on goethite covering a large range of sulfate concentrations, surface coverages, pH values, and electrolyte concentrations. Four different techniques were used to cover the entire range of conditions. For characterization at low sulfate concentrations, below the detection limit of sulfate with ICP-AES, the authors used proton-sulfate titrations at constant pH. Adsorption isotherms were studied for the intermediate sulfate concentration range. Acid-base titrations in sodium sulfate and electromobility were used for high sulfate concentrations. All the data can be modeled with one adsorbed species if it is assumed that the charge of adsorbed sulfate is spatially distributed in the interface. The charge distribution of sulfate follows directly from modeling the proton-sulfate adsorption stoichoimemtry sine this stoichiometry is independent of the intrinsic affinity constant of sulfate. The charge distribution can be related to the structure of the surface complex by use of the Pauling bond valence concept and is in accordance with the microscopic structure found by spectroscopy. The intrinsic affinity constant follows from the other measurements. Modeling of the proton-ion stoichoimetry with the commonly used 2-pK models, where adsorbed ions are treated as point charges, is possible only if at least two surface species for sulfate are used.

  15. Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome

    D. El Khoury

    2012-01-01

    Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.

  16. Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae

    Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.

    1999-01-01

    β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are

  17. An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.

    Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.

    2004-01-01

    (1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method

  18. Structure and function of α-glucan debranching enzymes

    Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte

    2016-01-01

    α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....

  19. Suppressing effects of glucan on micronuclei induced by Co60 in mice

    Chorvatovicova, D.

    1991-01-01

    The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de

  20. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

    Sharon Avni

    2017-07-01

    Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

  1. Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan

    JD Biller-Takahashi

    Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.

  2. Analysis of Saprolegnia parasitica Transcriptome following Treatment with Copper Sulfate.

    Kun Hu

    Full Text Available Massive infection caused by oomycete fungus Saprolegnia parasitica is detrimental to freshwater fish. Recently, we showed that copper sulfate demonstrated good efficacy for controlling S. parasitica infection in grass carp. In this study, we investigated the mechanism of inhibition of S. parasitica growth by copper sulfate by analyzing the transcriptome of copper sulfate-treated S. parasitica. To examine the mechanism of copper sulfate inhibiting S. parasitica, we utilized RNA-seq technology to compare differential gene expression in S. parasitica treated with or without copper sulfate.The total mapped rates of the reads with the reference genome were 90.50% in the control group and 73.50% in the experimental group. In the control group, annotated splice junctions, partial novel splice junctions and complete novel splice junctions were about 83%, 3% and 14%, respectively. In the treatment group, the corresponding values were about 75%, 6% and 19%. Following copper sulfate treatment, a total 310 genes were markedly upregulated and 556 genes were markedly downregulated in S. parasitica. Material metabolism related GO terms including cofactor binding (33 genes, 1,3-beta-D-glucan synthase complex (4 genes, carboxylic acid metabolic process (40 genes were the most significantly enriched. KEGG pathway analysis also determined that the metabolism-related biological pathways were significantly enriched, including the metabolic pathways (98 genes, biosynthesis of secondary metabolites pathways (42 genes, fatty acid metabolism (13 genes, phenylalanine metabolism (7 genes, starch and sucrose metabolism pathway (12 genes. The qRT-PCR results were largely consistent with the RNA-Seq results.Our results indicate that copper sulfate inhibits S. parasitica growth by affecting multiple biological functions, including protein synthesis, energy biogenesis, and metabolism.

  3. β-Glucans: Relationships between Modification, Conformation and Functional Activities

    Qiang Wang

    2017-02-01

    Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.

  4. Long-lived effects of administering β-glucans

    Petit, Jules; Wiegertjes, Geert F.

    2016-01-01

    Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a

  5. Immunostimulatory properties and antitumor activities of glucans (Review)

    Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.

    2013-01-01

    Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013

  6. Towards a more versatile alpha-glucan biosynthesis in plants

    Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.

    2003-01-01

    Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated

  7. Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri

    Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...

  8. Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

    Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2010-07-01

    In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.

  9. Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

    Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon

    2010-01-01

    In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity

  10. Small-angle neutron scattering from the reconstituted TF sub 1 of H sup + -ATPase from thermophilic bacterium PS3 with deuterated subunits

    Ito, Yuji [Univ. of Tokyo (Japan) Brookhaven National Lab., Upton, NY (United States); Harada, Mitsuo [Univ. of Tokyo (Japan); Ohta, Shigeo; Kagawa, Yasuo; Aono, Osamu [Jichi Medical School, Tochigi (Japan); Schefer, J; Schoenborn, B P [Brookhaven National Lab., Upton (United States)

    1990-01-01

    Subunits {alpha}, {beta} and {gamma} of adenosine triphosphatase (H{sup +}-ATPase) from the thermophilic bacterium PS3 (TF{sub 1}) have been over-expressed in Escherichia coli. {alpha} and {beta} subunits deuterated to the level of 90% were obtained by culturing E. coli in {sup 2}H{sub 2}O medium. Both the subunits and the reconstituted {alpha}{beta}{gamma} complex, TF{sub 1}, which contain the deuterated components in various combinations, were studied in solution by small-angle neutron scattering. The individual shapes of the subunits and their organization in the {alpha}{beta}{gamma}-TF{sub 1} complex were examined using the techniques of selective deuteration and contrast variation. The {alpha} and {beta} subunits are well approximated as ellipsoids of revolution having minor semi-axes of 20{center dot}4({plus minus}0{center dot}4) and 20{center dot}0({plus minus}0{center dot}2) {angstrom}, and major semi-axes of 53{center dot}0({plus minus}1{center dot}4) and 55{center dot}8({plus minus}0{center dot}9) {angstrom}, respectively. In the TF{sub 1} complex, three {beta} subunits are aligned to form an equilateral triangle, with their major axes tilted by 35{degree} with respect to the 3-fold axis of the complex. The {beta}-{beta} distance is about 53 {angstrom}. Three {alpha} subunits are similarly arranged, positioned between the {beta} subunits, and with their direction of tilt opposite to that of the {beta} subunits. The centers of the {alpha} and {beta} subunits lie in the same plane, forming a hexagon. Adjacent subunits overlap in this model, suggesting that they are not simple ellipsoids of revolution.

  11. Magnetic behavior of MnPS3 phases intercalated by [Zn2L]2+ (LH2: macrocyclic ligand obtained by condensation of 2-hydroxy-5-methyl-1,3-benzenedicarbaldehyde and 1,2-diaminobenzene)

    Spodine, E.; Valencia-Galvez, P.; Fuentealba, P.; Manzur, J.; Ruiz, D.; Venegas-Yazigi, D.; Paredes-Garcia, V.; Cardoso-Gil, R.; Schnelle, W.; Kniep, R.

    2011-01-01

    The intercalation of the cationic binuclear macrocyclic complex [Zn 2 L] 2+ (LH 2 : macrocyclic ligand obtained by the template condensation of 2-hydroxy-5-methyl-1,3-benzenedicarbaldehyde and 1,2-diaminobenzene) was achieved by a cationic exchange process, using K 0.4 Mn 0.8 PS 3 as a precursor. Three intercalated materials were obtained and characterized: (Zn 2 L) 0.05 K 0.3 Mn 0.8 PS 3 (1), (Zn 2 L) 0.1 K 0.2 Mn 0.8 PS 3 (2) and (Zn 2 L) 0.05 K 0.3 Mn 0.8 PS 3 (3), the latter phase being obtained by an assisted microwave radiation process. The magnetic data permit to estimate the Weiss temperature θ of ∼-130 K for (1); ∼-155 K for (2) and ∼-130 K for (3). The spin canting present in the potassium precursor remains unperturbed in composite (3), and spontaneous magnetization is observed under 50 K in both materials. However composites (1) and (2) do not present this spontaneous magnetization at low temperatures. The electronic properties of the intercalates do not appear to be significantly altered. The reflectance spectra of the intercalated phases (1), (2) and (3) show a gap value between 1.90 and 1.80 eV, lower than the value observed for the K 0.4 Mn 0.8 PS 3 precursor of 2.8 eV. -- Graphical Abstract: Microwave assisted synthesis was used to obtain an intercalated MnPS 3 phase with a binuclear Zn(II) macrocyclic complex. A comparative magnetic study of the composites obtained by assisted microwave and traditional synthetic methods is reported. Display Omitted Highlights: → A rapid and efficient preparation of intercalated MnPS 3 composites by assisted microwave synthesis is described. → The exchange of potassium ions of the precursor by the macrocyclic Zn(II) complex is partial. → The composite obtained by assisted microwave synthesis retains the spontaneous magnetization, observed in the low temperature range of the magnetic susceptibility of the potassium precursor. → The materials obtained by the conventional method loose the spontaneous

  12. Rare earth sulfates

    Komissarova, L.N.; Shatskij, V.M.; Pokrovskij, A.N.; Chizhov, S.M.; Bal'kina, T.I.; Suponitskij, Yu.L.

    1986-01-01

    Results of experimental works on the study of synthesis conditions, structure and physico-chemical properties of rare earth, scandium and yttrium sulfates, have been generalized. Phase diagrams of solubility and fusibility, thermodynamic and crystallochemical characteristics, thermal stability of hydrates and anhydrous sulfates of rare earths, including normal, double (with cations of alkali and alkaline-earth metals), ternary and anion-mixed sulfates of rare earths, as well as their adducts, are considered. The state of ions of rare earths, scandium and yttrium in aqueous sulfuric acid solutions is discussed. Data on the use of rare earth sulfates are given

  13. Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice

    Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)

    1991-10-01

    The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).

  14. Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods

    Vesna Zechner-Krpan

    2010-01-01

    Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.

  15. The ceric sulfate dosimeter

    Bjergbakke, Erling

    1970-01-01

    The process employed for the determination of absorbed dose is the reduction of ceric ions to cerous ions in a solution of ceric sulfate and cerous sulfate in 0.8N sulfuric acid: Ce4+→Ce 3+ The absorbed dose is derived from the difference in ceric ion concentration before and after irradiation...

  16. Heparan sulfate biosynthesis

    Multhaupt, Hinke A B; Couchman, John R

    2012-01-01

    Heparan sulfate is perhaps the most complex polysaccharide known from animals. The basic repeating disaccharide is extensively modified by sulfation and uronic acid epimerization. Despite this, the fine structure of heparan sulfate is remarkably consistent with a particular cell type. This suggests...... that the synthesis of heparan sulfate is tightly controlled. Although genomics has identified the enzymes involved in glycosaminoglycan synthesis in a number of vertebrates and invertebrates, the regulation of the process is not understood. Moreover, the localization of the various enzymes in the Golgi apparatus has......-quality resolution of the distribution of enzymes. The EXT2 protein, which when combined as heterodimers with EXT1 comprises the major polymerase in heparan sulfate synthesis, has been studied in depth. All the data are consistent with a cis-Golgi distribution and provide a starting point to establish whether all...

  17. Glucan Particles for Macrophage Targeted Delivery of Nanoparticles

    Ernesto R. Soto

    2012-01-01

    Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.

  18. Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

    Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

    2015-07-20

    Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

    Akira Yoshimi

    2017-11-01

    Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

  20. β-glucan extract from oat bran and its industrial importance

    Ibrahim, M. N. G.; Selezneva, I. S.

    2017-09-01

    The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

  1. 6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

    Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

    2016-02-12

    With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

  2. Ferrous Sulfate (Iron)

    ... are allergic to ferrous sulfate, any other medications tartrazine (a yellow dye in some processed foods and ... in, tightly closed, and out of reach of children. Store it at room temperature and away from ...

  3. Holothurian Fucosylated Chondroitin Sulfate

    Vitor H. Pomin

    2014-01-01

    Full Text Available Fucosylated chondroitin sulfate (FucCS is a structurally distinct glycosaminoglycan found in sea cucumber species. It has the same backbone composition of alternating 4-linked glucuronic acid and 3-linked N-acetyl galactosamine residues within disaccharide repeating units as regularly found in mammalian chondroitin sulfates. However, FucCS has also sulfated fucosyl branching units 3-O-linked to the acid residues. The sulfation patterns of these branches vary accordingly with holothurian species and account for different biological actions and responses. FucCSs may exhibit anticoagulant, antithrombotic, anti-inflammatory, anticancer, antiviral, and pro-angiogenic activities, besides its beneficial effects in hemodialysis, cellular growth modulation, fibrosis and hyperglycemia. Through an historical overview, this document covers most of the science regarding the holothurian FucCS. Both structural and medical properties of this unique GAG, investigated during the last 25 years, are systematically discussed herein.

  4. DHEA-sulfate test

    ... DHEA sulfate may be due to: Adrenal gland disorders that produce lower than normal amounts of adrenal hormones, including adrenal insufficiency and Addison disease The pituitary gland not producing normal amounts of its hormones ( hypopituitarism ) ...

  5. Direct Sulfation of Limestone

    Hu, Guilin; Dam-Johansen, Kim; Wedel, Stig

    2007-01-01

    The direct sulfation of limestone was studied in a laboratory fixed-bed reactor. It is found that the direct sulfation of limestone involves nucleation and crystal grain growth of the solid product (anhydrite). At 823 K and at low-conversions (less than about 0.5 %), the influences of SO2, O-2...... and CO2 on the direct sulfation of limestone corresponds to apparent reaction orders of about 0.2, 0.2 and -0.5, respectively. Water is observed to promote the sulfation reaction and increase the apparent reaction orders of SO2 and O-2. The influence of O-2 at high O-2 concentrations (> about 15...... %) becomes negligible. In the temperature interval from 723 K to 973 K, an apparent activation energy of about 104 kJ/mol is observed for the direct sulfation of limestone. At low temperatures and low conversions, the sulfation process is most likely under mixed control by chemical reaction and solid...

  6. Characterization of cereal β-glucan extracts from oat and barley and quantification of proteinaceous matter.

    Claudia Zielke

    Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.

  7. Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia

    Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu

    2013-01-01

    Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)

  8. Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults

    Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe

    2013-01-01

    for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...

  9. Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

    Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

    2009-07-01

    β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

  10. Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

    Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

    2009-01-01

    β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

  11. The structure of cell wall alpha-glucan from fission yeast

    Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.

    2005-01-01

    Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

  12. The structure of cell wall alpha-glucan from fission yeast.

    Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.

    2005-01-01

    Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

  13. A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.

    Heather T Taff

    Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.

  14. Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.

    Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G

    1992-01-01

    The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.

  15. Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

    Mikkelsen, Mette Skau

    -functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...

  16. Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)

    Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

    β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

  17. Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)

    Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

    β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

  18. Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast

    Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans

    2007-01-01

    The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential

  19. Beta Glucan Production from Two Strains of Agrobacterium sp in Medium Containing of Molases and Uracil Combine

    KUSMIATI

    2007-04-01

    Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both

  20. Molecular size estimation of plasma membrane β-glucan synthase from red beet root

    Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

    1986-01-01

    Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

  1. Study on the immuno stimulation of radiation degraded β-glucan in swiss mice

    Nguyen Thanh Long; Le Quang Luan

    2015-01-01

    The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)

  2. The biological activities of (1,3)-(1,6)-{beta}-d-glucan and porous electrospun PLGA membranes containing {beta}-glucan in human dermal fibroblasts and adipose tissue-derived stem cells

    Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)

    2010-08-01

    In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.

  3. Oral administration of Lentinus edodes β-glucans ameliorates DSS-induced ulcerative colitis in mice via MAPK-Elk-1 and MAPK-PPARγ pathways.

    Shi, Limin; Lin, Qinlu; Yang, Tao; Nie, Ying; Li, Xinhua; Liu, Bo; Shen, Junjun; Liang, Ying; Tang, Yiping; Luo, Feijun

    2016-11-09

    To evaluate the anti-inflammatory effect of β-glucans from Lentinus edodes, and its molecular mechanism, the dextran sulfate sodium salt (DSS) induced colitis model of mice and the LPS-stimulated RAW264.7 cell inflammation model were used in this study. 40 ICR male mice were randomly divided into 4 groups: Control, DSS (DSS treated only), DSS + low-βGs (500 mg kg -1 d -1 ) and DSS + high-βGs (1000 mg kg -1 d -1 ). The body weight of the mice with Lentinus edodes β-glucan supplementation increased significantly compared to the DSS group and the disease activity index (DAI) was improved in both βG-treated groups. Compared with the DSS group, histopathological analysis showed that the infiltration of inflammatory cells of both βG-treated groups decreased significantly in colonic tissues. Furthermore, oral administration of β-glucans decreases the concentration of malondialdehyde (MDA) and myeloperoxidase (MPO) and inhibits the expression of iNOS and several inflammatory factors: TNF-α, IL-1β and IL-6 as well as nitric oxide (NO) of the colonic tissues. The mitogen-activated protein kinase (MAPK) pathway is closely related to the expression of pro-inflammatory factors. In the DSS-induced colitis model and the LPS-stimulated RAW264.7 cell model, βGs inhibited the expression of pro-inflammatory factors and blocked the phosphorylation of JNK/ERK1/2 and p38; βGs also suppress the phosphorylation of Elk-1 at Ser84 and the phosphorylation of PPARγ at Ser112. Altogether, these results suggest that Lentinus edodes βGs could inhibit the DSS-induced ulcerative colitis and decrease inflammatory factor expressions. The molecular mechanism may be involved in suppressing MAPK signaling and inactivation of Elk-1 and activation of PPARγ.

  4. Synthesis of cell wall xylans and glucans by golgi membranes

    Gibeaut, D.M.; Carpita, N.C.

    1989-01-01

    We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus

  5. Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

    Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

    2009-10-14

    To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

  6. Effects of gamma irradiation on the physical and structural properties of β-glucan

    Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon

    2008-01-01

    This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility

  7. Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

    Singh, Mukti; Kim, Sanghoon; Liu, Sean X

    2012-08-01

    Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

  8. Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

    E. Y. Choi

    2016-11-01

    Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.

  9. Sulfate metabolism. I. Sulfate uptake and redistribution of acid rain sulfate by edible plants

    Dallam, R.D.

    1987-01-01

    Sulfur is the major component of polluted air in industrialized societies. Atmospheric sulfur is converted to sulfuric acid through a series of chemical reactions which can eventually reenter many ecosystems. When edible plants are grown in soils containing varying amounts of sulfate, the roots take up and transport inorganic sulfate to the stems and leaves. The sulfate taken up by the roots and the amount transported to the stem and leaves was found to be a function of the concentration of sulfate in the soil. Inorganic sulfate taken up by a corn plant seedling can be rapidly converted to organic sulfate by the root system. Nine days after one of a pair of pea plants was inoculated with artificial acid rain sulfate (dilute H 2 35 SO 4 ) it was found that the sulfate was translocated not only in the inoculated plant, but also to the uninoculated pea plant in the same container. Also, when the leaves of a mature potato plant were inoculated with artificial acid rain sulfate it was found that the sulfate was translocated into the edible potatoes. Fractionation of the potatoes showed that most of the sulfate was water soluble of which 30% was inorganic sulfate and 70% was in the form of organic sulfur. One third of the non-water soluble translocated acid rain sulfate was equally divided between lipid and non-lipid organic sulfur of the potato. 9 references, 2 figures, 5 tables

  10. Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

    Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

    2014-02-07

    The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

  11. Visual effects of β-­glucans on wound healing in fish

    Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær

    2011-01-01

    Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...

  12. Dissolution of sulfate scales

    Hen, J.

    1991-11-26

    This patent describes a composition for the removal of sulfate scale from surfaces. It comprises: an aqueous solution of about 0.1 to 1.0 molar concentration of an aminopolycarboxylic acid (APCA) containing 1 to 4 amino groups or a salt thereof, and about 0.1 to 1.0 molar concentration of a second component which is diethylenetriaminepenta (methylenephosphonic acid) (DTPMP) or a salt thereof, or aminotri (methylenephosphonic acid) (ATMP) or a salt thereof as an internal phase enveloped by a hydrocarbon membrane phase which is itself emulsified in an external aqueous phase, the hydrocarbon membrane phase continuing a complexing agent weaker for the cations of the sulfate scale than the APCA and DTPMP or ATMP, any complexing agent for the cations in the external aqueous phase being weaker than that in the hydrocarbon membrane phase.

  13. Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

    Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

  14. Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

    Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas

    2012-01-01

    Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...

  15. Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.

    Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa

    2014-06-01

    Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.

  16. Radioimmunoassay of dehydroepiandrosterone sulfate

    Vieira, J.G.H.; Furlanetto, R.P.; Russo, E.M.K.; Noguti, K.O.; Chacra, A.R.

    1980-01-01

    The development of a radioimmunological method for the measurement of dehydroepiandrosterone sulfate in serum is described. For the immunization of rabbits, a DHA-3-hemissuccinate-bovine serum albumin conjugate was synthetized and a highly specific anti-serum was produced. The method developed requires only simple dilution prior to assay and the normal values for the different age groups were determined in 146 normal individuals. (Author) [pt

  17. Sulfation of chondroitin. Specificity, degree of sulfation, and detergent effects with 4-sulfating and 6-sulfating microsomal systems

    Sugumaran, G.; Silbert, J.E.

    1988-01-01

    Microsomal preparations from chondroitin 6-sulfate-producing chick embryo epiphyseal cartilage, and from chondroitin 4-sulfate-producing mouse mastocytoma cells, were incubated with UDP-[14C]glucuronic acid and UDP-N-acetylgalactosamine to form non-sulfated proteo[14C]chondroitin. Aliquots of the incubations were then incubated with 3'-phosphoadenylylphosphosulfate (PAPS) in the presence or absence of various detergents. In the absence of detergents, there was good sulfation of this endogenous proteo[14C]chondroitin by the original microsomes from both sources. Detergents, with the exception of Triton X-100, markedly inhibited sulfation in the mast cell system but not in the chick cartilage system. These results indicate that sulfation and polymerization are closely linked on cell membranes and that in some cases this organization can be disrupted by detergents. When aliquots of the original incubation were heat inactivated, and then reincubated with new microsomes from chick cartilage and/or mouse mastocytoma cells plus PAPS, there was no significant sulfation of this exogenous proteo[14C] chondroitin with either system unless Triton X-100 was added. Sulfation of exogenous chondroitin and chondroitin hexasaccharide was compared with sulfation of endogenous and exogenous proteo[14C]chondroitin. Sulfate incorporation into hexasaccharide and chondroitin decreased as their concentrations (based on uronic acid) approached that of the proteo[14C]chondroitin. At the same time, the degree of sulfation in percent of substituted hexosamine increased. However, the degree of sulfation did not reach that of the endogenous proteo[14C]chondroitin. Hexasaccharide and chondroitin sulfation were stimulated by the presence of Triton X-100. However, in contrast to the exogenous proteo[14C]chondroitin, there was some sulfation of hexasaccharide and chondroitin in the absence of this detergent

  18. Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

    Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

    2013-05-01

    The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. β-Glucan as an encapsulating agent: Effect on probiotic survival in simulated gastrointestinal tract.

    Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A

    2016-01-01

    Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.

    Gomaa, K; Kraus, J; Franz, G; Röper, H

    1991-09-18

    Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.

  1. Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice

    Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo

    2008-01-01

    Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...

  2. Enhanced sulfate reduction with acidogenic sulfate-reducing bacteria

    Wang Aijie; Ren Nanqi; Wang Xu; Lee Duujong

    2008-01-01

    Sulfate reduction in a continuous flow, acidogenic reactor using molasses wastewater as the carbon source was studied at varying chemical oxygen demand/sulfate (COD/SO 4 2- ) ratios. At a critical COD/SO 4 2- ratio of 2.7, neither COD nor sulfate were in excess for extra production of ethanol or acetate in the reactor. An acetic-type microbial metabolism was established with sulfate-reducing bacteria (SRB) significantly consuming hydrogen and volatile fatty acids produced by acidogenic bacteria and hydrogen producing acetogens in degrading COD, thereby yielding sulfate removal rate >94.6%. A low critical COD/SO 4 2- ratio of 1.6 was also observed with the enriched ASRB population in reactor which overcomes the barrier to the treatment capability of sulfate-laden wastewater treatment with limited COD supply

  3. Sesquiterpene volatile organic compounds (VOCs are markers of elicitation by sulfated laminarine in grapevine

    Malik eChalal

    2015-05-01

    Full Text Available Inducing resistance in plants by application of elicitors of defense reactions is an attractive plant protection strategy, especially for grapevine (Vitis vinifera which is susceptible to severe fungal diseases. Though induced resistance (IR can be successful in controlled conditions, under outdoor conditions IR is in most cases not effective enough for practical disease control. Progress in the application of IR requires a better understanding of grapevine defense mechanisms and the ability to monitor defense markers in order to identify factors (physiological, environmental… that can impact IR in the vineyard.Volatile organic compounds (VOCs are well-known plant defenses compounds that have only received little or no attention in the case of grape-pathogen interactions to date. This prompted us to investigate whether an elicitor, the sulfated laminarin (PS3, actually induces the production of VOCs in grapevine. Online analysis (PTR-QMS of VOC emissions in dynamic cuvettes and passive sampling in gas tight bags with solid phase micro extraction (SPME-GC-MS under greenhouse conditions showed that PS3 elicited emission of VOCs. Some of them (as (E,E-α-farnesene might be good candidates as biomarkers of elicitor-IR whereas methyl salicylate appears to be rather a biomarker of downy mildew infection. A negative correlation between VOC emission and disease severity suggests a positive role of VOCs in grape defense against diseases.

  4. Distribution and molecular characterization of β-glucans from hull-less barley bran, shorts and flour.

    Zheng, Xueling; Li, Limin; Wang, Qi

    2011-01-01

    Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.

  5. β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

    Matthew J. Elder

    2017-07-01

    Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

  6. Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

    Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

    2013-03-01

    β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.

  7. Syndecan heparan sulfate proteoglycans

    Gomes, Angélica Maciel; Sinkeviciute, Dovile; Multhaupt, Hinke A.B.

    2016-01-01

    discuss how, in partial catabolic processes, new roles for HSPGs emerge that affect cell behavior. Examples from tumor studies are emphasized, since HSPGs may be altered in composition and distribution and may also represent targets for the development of new therapeutics....... signaling can therefore be complex, but it is now known that syndecans are capable of independent signaling. This review is divided in two sections, and will first discuss how the assembly of heparan sulfate, the anabolic process, encodes information related to ligand binding and signaling. Second, we...

  8. Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus

    Ira Widjiastuti

    2017-03-01

    Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of

  9. Dynamic, morphotype-specific Candida albicans beta-glucan exposure during infection and drug treatment.

    Robert T Wheeler

    2008-12-01

    Full Text Available Candida albicans, a clinically important dimorphic fungal pathogen that can evade immune attack by masking its cell wall beta-glucan from immune recognition, mutes protective host responses mediated by the Dectin-1 beta-glucan receptor on innate immune cells. Although the ability of C. albicans to switch between a yeast- or hyphal-form is a key virulence determinant, the role of each morphotype in beta-glucan masking during infection and treatment has not been addressed. Here, we show that during infection of mice, the C. albicans beta-glucan is masked initially but becomes exposed later in several organs. At all measured stages of infection, there is no difference in beta-glucan exposure between yeast-form and hyphal cells. We have previously shown that sub-inhibitory doses of the anti-fungal drug caspofungin can expose beta-glucan in vitro, suggesting that the drug may enhance immune activity during therapy. This report shows that caspofungin also mediates beta-glucan unmasking in vivo. Surprisingly, caspofungin preferentially unmasks filamentous cells, as opposed to yeast form cells, both in vivo and in vitro. The fungicidal activity of caspofungin in vitro is also filament-biased, as corroborated using yeast-locked and hyphal-locked mutants. The uncloaking of filaments is not a general effect of anti-fungal drugs, as another anti-fungal agent does not have this effect. These results highlight the advantage of studying host-pathogen interaction in vivo and suggest new avenues for drug development.

  10. 2-Amino-4-hydroxyethylaminoanisole sulfate

    Madsen, Jakob T; Andersen, Klaus E

    2016-01-01

    positive patch test reactions to the coupler 2-amino-4-hydroxyethylaminoanisole sulfate 2% pet. from 2005 to 2014. METHODS: Patch test results from the Allergen Bank database for eczema patients patch tested with 2-amino-4-hydroxyethylaminoanisole sulfate 2% pet. from 2005 to 2014 were reviewed. RESULTS......: A total of 902 dermatitis patients (154 from the dermatology department and 748 from 65 practices) were patch tested with amino-4-hydroxyethylaminoanisole sulfate 2% pet. from 2005 to 2014. Thirteen (1.4%) patients had a positive patch test reaction. Our results do not indicate irritant reactions....... CONCLUSIONS: 2-Amino-4-hydroxyethylaminoanisole sulfate is a new but rare contact allergen....

  11. High molecular weight glucan of the culinary medicinal mushroom Agaricus bisporus is an a-glucan that forms complexes with low molecular weight galactan

    Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.

    2010-01-01

    An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.

  12. Morpholine-4-carboxamidinium sulfate

    Ioannis Tiritiris

    2016-01-01

    Full Text Available The asymmetric unit of the title salt, 2C5H12N3O+·SO42−, comprises two cations and one sulfate ion. In both cations, the C, N and O atoms of the morpholine rings are disordered over two sets of sites, with refined occupancies of 0.849 (3:0.151 (3 for cation I and 0.684 (4:0.316 (4 for cation II. The C—N bond lengths in both central C3N units of the carboxamidinium ions range between 1.253 (12 and 1.362 (5 Å, indicating a degree of double-bond character. The central C atoms are bonded to the three N atoms in a nearly ideal trigonal–planar geometry and the positive charges are delocalized in both CN3 planes. The crystal structure is stabilized by a three-dimensional network of N—H...O hydrogen bonds between the cations and the sulfate ion. Scheme tiny font, charges and delocalized bonds almost invisible

  13. B-Glucan exacerbates allergic asthma independent of fungal ...

    BackgroundAllergic sensitization to fungi has been associated with asthma severity. As a result, it has been largely assumed that the contribution of fungi to allergic disease is mediated through their potent antigenicity.ObjectiveWe sought to determine the mechanism by which fungi affect asthma development and severity.MethodsWe integrated epidemiologic and experimental asthma models to explore the effect of fungal exposure on asthma development and severity.ResultsWe report that fungal exposure enhances allergen-driven TH2 responses, promoting severe allergic asthma. This effect is independent of fungal sensitization and can be reconstituted with β-glucan and abrogated by neutralization of IL-17A. Furthermore, this severe asthma is resistant to steroids and characterized by mixed TH2 and TH17 responses, including IL-13+IL-17+CD4+ double-producing effector T cells. Steroid resistance is dependent on fungus-induced TH17 responses because steroid sensitivity was restored in IL-17rc−/− mice. Similarly, in children with asthma, fungal exposure was associated with increased serum IL-17A levels and asthma severity.ConclusionOur data demonstrate that fungi are potent immunomodulators and have powerful effects on asthma independent of their potential to act as antigens. Furthermore, our results provide a strong rationale for combination treatment strategies targeting IL-17A for this subgroup of fungus-exposed patients with difficult-to-treat asthma. To describe th

  14. Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

    Theuwissen, Elke; Mensink, Ronald P

    2007-03-01

    Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

  15. Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

    Chang, I.; Cho, G.

    2012-12-01

    Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

  16. Specific binding of a fungal glucan phytoalexin elicitor to membrane fractions from soybean Glycine max

    Schmidt, W.E.; Ebel, J.

    1987-01-01

    Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay

  17. Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats

    Salama, S.F.

    2011-01-01

    1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications

  18. Modulation of the immune response of porcine neutrophils by different β-glucan preparations

    Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard

    2010-01-01

    β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...

  19. INTRACELLULAR SYNTHESIS OF CHONDROITIN SULFATE

    Dziewiatkowski, Dominic D.

    1962-01-01

    In autoradiograms of slices of costal cartilage, incubated for 4 hours in a salt solution containing S35-sulfate and then washed extensively and dehydrated, about 85 per cent of the radioactivity was assignable to the chondrocytes. From alkaline extracts of similarly prepared slices of cartilage, 64 to 83 per cent of the total sulfur-35 in the slices was isolated as chondroitin sulfate by chromatography on an anion-exchange resin. In view of the estimate that only about 15 per cent of the radioactivity was in the matrix, the isolation of 64 to 83 per cent of the total sulfur-35 as chondroitin sulfate is a strong argument that the chondrocytes are the loci in which chondroitin sulfate(s) is synthesized. PMID:13888910

  20. Synthesis of highly anti-HIV active sulfated poly- and oligo-saccharides and analysis of their action mechanisms by NMR [nuclear magnetic resonance] spectroscopy

    Uryu, Toshiyuki

    1998-01-01

    We have been synthesizing sulfated polysaccharides and oligosaccharides with highly anti-HIV (human immunodeficiency virus) activities. It has been known that sulfated polysaccharides such as dextran sulfate and pentosan polysulfate have biological activities such as anticoagulant activity and recently anti-HIV activity. Curdlan sulfate having 1,3-β-linked glucan backbone had high anti-HIV activity but low anticoagulant activity. Phase I/II test for the curdlan sulfate as an AIDS (acquired immunodeficiency syndrome) drug was carried out in the United States. In this study, regioselectivity sulfatec curdlan sulfates were prepared in order to study effects of sulfate groups and conformation of curdlan sulfates. In addition, action mechanisms of curdlan sulfate as anti-AIDS drug and of heparin as an anticoagulant were examined by means of NMR spectroscopy. 1. Structure dependence of anti-HIV and anticoagulant activities of sulfated polysaccharides. Curdlan with M n 9000 was regioselectively sulfated on its hydroxyl groups at 6, 4, and 2 positions. Those were a curdlan sulfate 62S in which 100% of 6-OH, and about 50% of 2-OH was sulfated, a curdlan sulfate 42S in which 4- and 2-OH's were sulfated, and a curdlan sulfate in which 6, 4, and 2-OH's were partially sulfated. All curdlan sulfates had very high anti-HIV activities exhibited by the drug concentration of 50% inhibition of infection, i.e., EC 50 of 0.04 - 0.25 μg/mL. However, there was almost no difference in the activity among the samples. Therefore, it was revealed that the degree of sulfation and putative conformation of the curdlan sulfates but not the position of sulfate groups have large effects on the anti-HIV activity. On the other hand, the anticoagulant activity increased with increasing molecular weight of the curdlan sulfates. As a result, it is assumed that the size of reaction sites of the virus protein reacting with curdlan sulfate is different from that of the proteins related to anticoagulant

  1. Probing the structure of glucan lyases – the lytic members of GH31 - by sequence analysis, circular dichroism and proteolysis

    Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun

    2005-01-01

    Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...

  2. Biotechnological potential of novel glycoside hydrolase family 70 enzymes synthesizing α-glucans from starch and sucrose

    Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

    Transglucosidases belonging to the glycoside hydrolase (GH) family 70 are promising enzymatic tools for the synthesis of α-glucans with defined structures from renewable sucrose and starch substrates. Depending on the GH70 enzyme specificity, α-glucans with different structures and physicochemical

  3. Binding Interactions Between α-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

    Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.

    2012-01-01

    Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...

  4. Binding Interactions Between alpha-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

    Diemer, Silja K.; Svensson, Birte; Babol, Linnea N.; Cockburn, Darrell; Grijpstra, Pieter; Dijkhuizen, Lubbert; Folkenberg, Ditte M.; Garrigues, Christel; Ipsen, Richard H.

    Interactions between milk proteins and alpha-glucans at pH 4.0-5.5 were investigated by use of surface plasmon resonance. The alpha-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the

  5. Dietary (1-->3), (1-->4)-beta-D-glucans from oat activate nuclear factor-kappaB in intestinal leukocytes and enterocytes from mice

    Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum

    2010-01-01

    Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB

  6. Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions

    Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian

    2012-01-01

    Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)

  7. Combined effects of added beta glucan and black tea in breads on starch functionality.

    Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L

    2015-03-01

    Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.

  8. Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

    Ernesto R. Soto

    2016-01-01

    Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.

  9. Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.

    Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui

    2016-12-01

    β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

    Thao, Cao Phuong; Tien, Le Thi Thuy

    2017-09-01

    β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

  11. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  12. Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

    Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

    2017-11-01

    Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs

  13. Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

    Jiménez, Natalia Ivonne Vera

    by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...

  14. Heparan sulfate and cell division

    Porcionatto M.A.

    1999-01-01

    Full Text Available Heparan sulfate is a component of vertebrate and invertebrate tissues which appears during the cytodifferentiation stage of embryonic development. Its structure varies according to the tissue and species of origin and is modified during neoplastic transformation. Several lines of experimental evidence suggest that heparan sulfate plays a role in cellular recognition, cellular adhesion and growth control. Heparan sulfate can participate in the process of cell division in two distinct ways, either as a positive or negative modulator of cellular proliferation, or as a response to a mitogenic stimulus.

  15. Final report on the safety assessment of sodium cetearyl sulfate and related alkyl sulfates as used in cosmetics.

    Fiume, Monice; Bergfeld, Wilma F; Belsito, Donald V; Klaassen, Curtis D; Marks, James G; Shank, Ronald C; Slaga, Thomas J; Snyder, Paul W; Alan Andersen, F

    2010-05-01

    Sodium cetearyl sulfate is the sodium salt of a mixture of cetyl and stearyl sulfate. The other ingredients in this safety assessment are also alkyl salts, including ammonium coco-sulfate, ammonium myristyl sulfate, magnesium coco-sulfate, sodium cetyl sulfate, sodium coco/hydrogenated tallow sulfate, sodium coco-sulfate, sodium decyl sulfate, sodium ethylhexyl sulfate, sodium myristyl sulfate, sodium oleyl sulfate, sodium stearyl sulfate, sodium tallow sulfate, sodium tridecyl sulfate, and zinc coco-sulfate. These ingredients are surfactants used at concentrations from 0.1% to 29%, primarily in soaps and shampoos. Many of these ingredients are not in current use. The Cosmetic Ingredient Review (CIR) Expert Panel previously completed a safety assessment of sodium and ammonium lauryl sulfate. The data available for sodium lauryl sulfate and ammonium lauryl sulfate provide sufficient basis for concluding that sodium cetearyl sulfate and related alkyl sulfates are safe in the practices of use and concentration described in the safety assessment.

  16. Barley genotypic β-glucan variation combined with enzymatic modifications direct its potential as a natural ingredient in a high fiber extract

    Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.

    2017-01-01

    -glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f  and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....

  17. Effect of Immune-Enhancing Enteral Nutrition Enriched with or without Beta-Glucan on Immunomodulation in Critically Ill Patients

    Jae Gil Lee

    2016-06-01

    Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.

  18. Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

    Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

    2018-03-01

    Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

  19. Understanding the role of oat ß-glucan in oat-based dough systems

    Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.

    2015-01-01

    B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat

  20. An enzyme family reunion - similarities, differences and eccentricities in actions on alpha-glucans

    Seo, Eun-Seong; Christiansen, Camilla; Abou Hachem, Maher

    2008-01-01

    alpha-Glucans in general, including starch, glycogen and their derived oligosaccharides are processed by a host of more or less closely related enzymes that represent wide diversity in structure, mechanism, specificity and biological role. Sophisticated three-dimensional structures continue to em...

  1. Effects of β-Glucans and resistant starch on fermentation of recalcitrant fibers in growing pigs

    Vries, de S.; Gerrits, W.J.J.; Kabel, M.A.; Zijlstra, Ruurd; Vasanthan, Thava

    2017-01-01

    Effects of the presence of β-glucans and resistant starch in diets on nutrient and fiber degradability of rapeseed meal [RSM] (Brassica napus) and Distillers Dried Grain with Solubles (DDGS) were tested in a 2 × 3 factorial arrangement. Two basal diets, containing either 500 g/kg RSM or DDGS and

  2. The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.

    Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum

    2014-04-01

    Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.

  3. Novel chitin/chitosan-glucan wound dressing: Isolation, characterization, antibacterial activity and wound healing properties

    Abdel-Mohsen, A. M.; Jancar, J.; Massoud, D.; Fohlerová, Z.; Elhadidy, Hassan; Spotz, Z.; Hebeish, A.

    2016-01-01

    Roč. 510, č. 1 (2016), s. 86-99 ISSN 0378-5173 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Chitin/chitosan-glucan complex * Nonwoven mat * Surgical wound healing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.649, year: 2016

  4. Escherichia coli Phosphoenolpyruvate Dependent Phosphotransferase System. Copurification of HPr and α1-6 Glucan

    Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.

    1979-01-01

    A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of

  5. Beta-glucans in the treatment of diabetes and associated cardiovascular risks

    Jiezhong Chen

    2008-12-01

    Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis

  6. Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.

    Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish

    2012-09-04

    Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.

  7. Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

    Mattia P. Arena

    2014-02-01

    Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.

  8. Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress

    Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...

  9. Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

    We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

  10. Comparison of Chain-Length Preferences and Glucan Specificities of Isoamylase-Type α-Glucan Debranching Enzymes from Rice, Cyanobacteria, and Bacteria.

    Taiki Kobayashi

    Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.

  11. Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

    Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo

    2015-01-01

    β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber

  12. Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

    Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)

    2015-02-27

    β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.

  13. The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus.

    Chad Steele

    2005-12-01

    Full Text Available Alveolar macrophages represent a first-line innate host defense mechanism for clearing inhaled Aspergillus fumigatus from the lungs, yet contradictory data exist as to which alveolar macrophage recognition receptor is critical for innate immunity to A. fumigatus. Acknowledging that the A. fumigatus cell wall contains a high beta-1,3-glucan content, we questioned whether the beta-glucan receptor dectin-1 played a role in this recognition process. Monoclonal antibody, soluble receptor, and competitive carbohydrate blockage indicated that the alveolar macrophage inflammatory response, specifically the production of tumor necrosis factor-alpha (TNF-alpha, interleukin-1alpha (IL-1alpha, IL-1beta, IL-6, CXCL2/macrophage inflammatory protein-2 (MIP-2, CCL3/macrophage inflammatory protein-1alpha (MIP-1alpha, granulocyte-colony stimulating factor (G-CSF, and granulocyte monocyte-CSF (GM-CSF, to live A. fumigatus was dependent on recognition via the beta-glucan receptor dectin-1. The inflammatory response was triggered at the highest level by A. fumigatus swollen conidia and early germlings and correlated to the levels of surface-exposed beta glucans, indicating that dectin-1 preferentially recognizes specific morphological forms of A. fumigatus. Intratracheal administration of A. fumigatus conidia to mice in the presence of a soluble dectin-Fc fusion protein reduced both lung proinflammatory cytokine/chemokine levels and cellular recruitment while modestly increasing the A. fumigatus fungal burden, illustrating the importance of beta-glucan-initiated dectin-1 signaling in defense against this pathogen. Collectively, these data show that dectin-1 is centrally required for the generation of alveolar macrophage proinflammatory responses to A. fumigatus and to our knowledge provides the first in vivo evidence for the role of dectin-1 in fungal innate defense.

  14. Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

    Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

    1989-05-01

    A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

  15. Chondroitin sulfate/dermatan sulfate sulfatases from mammals and bacteria.

    Wang, Shumin; Sugahara, Kazuyuki; Li, Fuchuan

    2016-12-01

    Sulfatases that specifically catalyze the hydrolysis of the sulfate groups on chondroitin sulfate (CS)/dermatan sulfate (DS) poly- and oligosaccharides belong to the formylglycine-dependent family of sulfatases and have been widely found in various mammalian and bacterial organisms. However, only a few types of CS/DS sulfatase have been identified so far. Recently, several novel CS/DS sulfatases have been cloned and characterized. Advanced studies have provided significant insight into the biological function and mechanism of action of CS/DS sulfatases. Moreover, further studies will provide powerful tools for structural and functional studies of CS/DS as well as related applications. This article reviews the recent progress in CS/DS sulfatase research and is expected to initiate further research in this field.

  16. Sequence of the radioactive tryptic peptide obtained after inactivating the F1-ATPase of the thermophilic bacterium PS3 with 5'-p-fluorosulfonylbenzoyl[3H]adenosine at 65 degrees C

    Bullough, D.A.; Yoshida, M.; Allison, W.S.

    1986-01-01

    Following a lag of about 30 min, the F1-ATPase from the thermophilic bacterium, PS3 (TF1), was inactivated slowly by 0.8 mM 5'-p-fluorosulfonylbenzoyladenosine (FSBA) at 23 degrees C and pH 7.0. When the enzyme was treated with 0.2 mM FSBA at pH 7.0 and 23 degrees C for 15 min and gel-filtered, no enzyme activity was lost. However, the lag in inactivation was abolished when the enzyme was subsequently incubated with 2.0 mM FSBA at 23 degrees C in the pH range from 6.8 to 10.0. The pH-inactivation profile obtained under these conditions revealed a pK alpha of about 9.3 which was associated with the inactivation. When pretreated TF1 was inactivated at 23 degrees C with [3H]FSBA by about 90%, greater than 20 mol of [3H]SBA was incorporated per mole of enzyme. TF1 was inactivated rapidly by 0.8 mM FSBA at pH 6.4 and 65 degrees C, and no lag was observed. Following inactivation of TF1 with 0.8 mM [3H]FSBA at 65 degrees C and pH 6.4, about 10 mol of [3H]SBA was incorporated per mole of enzyme. When a tryptic digest of the labeled enzyme was fractionated by reversed-phase high-performance liquid chromatography, a single major radioactive peptide was isolated. When subjected to automatic Edman degradation, this peptide was shown to have the amino acid sequence: A-L-A-P-E-I-V-G-E-E-H-X-Q-V-A-R, where X indicates that a phenylthiohydantoin derivative was not detected in cycle 12. However, from the DNA sequence of the gene encoding the subunit of TF1 (Y. Kagawa, M. Ishizuka, T. Saishu, and S. Nakao (1985)), this position has been shown to be occupied by tyrosine. This tyrosine is homologous with beta-Tyr-368 of the bovine mitochondrial F1-ATPase (MF1) the modification of which is responsible for the inactivation MF1 by FSBA

  17. Semi-synthesis of chondroitin sulfate-E from chondroitin sulfate-A

    Cai, Chao; Solakyildirim, Kemal; Yang, Bo; Beaudet, Julie M.; Weyer, Amanda; Linhardt, Robert J.; Zhang, Fuming

    2012-01-01

    Chondroitin sulfate-E (chondroitin-4, 6-disulfate) was prepared from chondroitin sulfate-A (chondroitin-4 - sulfate) by regioselective sulfonation, performed using trimethylamine sulfur trioxide in formamide under argon. The structure of semi-synthetic chondroitin sulfate-E was analyzed by PAGE, 1H NMR, 13C NMR, 2D NMR and disaccharide analysis and compared with natural chondroitin sulfate-E. Both semi-synthetic and natural chondroitin sulfate-E were each biotinylated and immobilized on BIAco...

  18. Chondroitin Sulfate Perlecan Enhances Collagen Fibril Formation

    Kvist, A. J.; Johnson, A. E.; Mörgelin, M.

    2006-01-01

    in collagen type II fibril assembly by perlecan-null chondrocytes. Cartilage perlecan is a heparin sulfate or a mixed heparan sulfate/chondroitin sulfate proteoglycan. The latter form binds collagen and accelerates fibril formation in vitro, with more defined fibril morphology and increased fibril diameters...... produced in the presence of perlecan. Interestingly, the enhancement of collagen fibril formation is independent on the core protein and is mimicked by chondroitin sulfate E but neither by chondroitin sulfate D nor dextran sulfate. Furthermore, perlecan chondroitin sulfate contains the 4,6-disulfated...... disaccharides typical for chondroitin sulfate E. Indeed, purified glycosaminoglycans from perlecan-enriched fractions of cartilage extracts contain elevated levels of 4,6-disulfated chondroitin sulfate disaccharides and enhance collagen fibril formation. The effect on collagen assembly is proportional...

  19. β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

    Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

    2012-01-01

    ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

  20. Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols

    A. Korpi

    2003-01-01

    Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.

  1. Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy

    Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling

    2010-01-01

    To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...

  2. The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice

    Fengdan Jin

    2014-01-01

    Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.

  3. Concentrated oat β-glucan, a fermentable fiber, lowers serum cholesterol in hypercholesterolemic adults in a randomized controlled trial

    Fulcher R Gary

    2007-03-01

    Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other

  4. Sulfate reduction in freshwater peatlands

    Oequist, M.

    1996-12-31

    This text consist of two parts: Part A is a literature review on microbial sulfate reduction with emphasis on freshwater peatlands, and part B presents the results from a study of the relative importance of sulfate reduction and methane formation for the anaerobic decomposition in a boreal peatland. The relative importance of sulfate reduction and methane production for the anaerobic decomposition was studied in a small raised bog situated in the boreal zone of southern Sweden. Depth distribution of sulfate reduction- and methane production rates were measured in peat sampled from three sites (A, B, and C) forming an minerotrophic-ombrotrophic gradient. SO{sub 4}{sup 2-} concentrations in the three profiles were of equal magnitude and ranged from 50 to 150 {mu}M. In contrast, rates of sulfate reduction were vastly different: Maximum rates in the three profiles were obtained at a depth of ca. 20 cm below the water table. In A it was 8 {mu}M h{sup -1} while in B and C they were 1 and 0.05 {mu}M h{sup -1}, respectively. Methane production rates, however, were more uniform across the three nutrient regimes. Maximum rates in A (ca. 1.5 {mu}g d{sup -1} g{sup -1}) were found 10 cm below the water table, in B (ca. 1.0 {mu}g d{sup -1} g{sup -1}) in the vicinity of the water table, and in C (0.75 {mu}g d{sup -1} g{sup -1}) 20 cm below the water table. In all profiles both sulfate reduction and methane production rates were negligible above the water table. The areal estimates of methane production for the profiles were 22.4, 9.0 and 6.4 mmol m{sup -2} d{sup -1}, while the estimates for sulfate reduction were 26.4, 2.5, and 0.1 mmol m{sup -2} d{sup -1}, respectively. The calculated turnover times at the sites were 1.2, 14.2, and 198.7 days, respectively. The study shows that sulfate reducing bacteria are important for the anaerobic degradation in the studied peatland, especially in the minerotrophic sites, while methanogenic bacteria dominate in ombrotrophic sites Examination

  5. Sulfate reduction in freshwater peatlands

    Oequist, M.

    1996-01-01

    This text consist of two parts: Part A is a literature review on microbial sulfate reduction with emphasis on freshwater peatlands, and part B presents the results from a study of the relative importance of sulfate reduction and methane formation for the anaerobic decomposition in a boreal peatland. The relative importance of sulfate reduction and methane production for the anaerobic decomposition was studied in a small raised bog situated in the boreal zone of southern Sweden. Depth distribution of sulfate reduction- and methane production rates were measured in peat sampled from three sites (A, B, and C) forming an minerotrophic-ombrotrophic gradient. SO 4 2- concentrations in the three profiles were of equal magnitude and ranged from 50 to 150 μM. In contrast, rates of sulfate reduction were vastly different: Maximum rates in the three profiles were obtained at a depth of ca. 20 cm below the water table. In A it was 8 μM h -1 while in B and C they were 1 and 0.05 μM h -1 , respectively. Methane production rates, however, were more uniform across the three nutrient regimes. Maximum rates in A (ca. 1.5 μg d -1 g -1 ) were found 10 cm below the water table, in B (ca. 1.0 μg d -1 g -1 ) in the vicinity of the water table, and in C (0.75 μg d -1 g -1 ) 20 cm below the water table. In all profiles both sulfate reduction and methane production rates were negligible above the water table. The areal estimates of methane production for the profiles were 22.4, 9.0 and 6.4 mmol m -2 d -1 , while the estimates for sulfate reduction were 26.4, 2.5, and 0.1 mmol m -2 d -1 , respectively. The calculated turnover times at the sites were 1.2, 14.2, and 198.7 days, respectively. The study shows that sulfate reducing bacteria are important for the anaerobic degradation in the studied peatland, especially in the minerotrophic sites, while methanogenic bacteria dominate in ombrotrophic sites Examination paper. 67 refs, 6 figs, 3 tabs

  6. Acid Sulfate Alteration on Mars

    Ming, D. W.; Morris, R. V.

    2016-01-01

    A variety of mineralogical and geochemical indicators for aqueous alteration on Mars have been identified by a combination of surface and orbital robotic missions, telescopic observations, characterization of Martian meteorites, and laboratory and terrestrial analog studies. Acid sulfate alteration has been identified at all three landing sites visited by NASA rover missions (Spirit, Opportunity, and Curiosity). Spirit landed in Gusev crater in 2004 and discovered Fe-sulfates and materials that have been extensively leached by acid sulfate solutions. Opportunity landing on the plains of Meridiani Planum also in 2004 where the rover encountered large abundances of jarosite and hematite in sedimentary rocks. Curiosity landed in Gale crater in 2012 and has characterized fluvial, deltaic, and lacustrine sediments. Jarosite and hematite were discovered in some of the lacustrine sediments. The high elemental abundance of sulfur in surface materials is obvious evidence that sulfate has played a major role in aqueous processes at all landing sites on Mars. The sulfate-rich outcrop at Meridiani Planum has an SO3 content of up to 25 wt.%. The interiors of rocks and outcrops on the Columbia Hills within Gusev crater have up to 8 wt.% SO3. Soils at both sites generally have between 5 to 14 wt.% SO3, and several soils in Gusev crater contain around 30 wt.% SO3. After normalization of major element compositions to a SO3-free basis, the bulk compositions of these materials are basaltic, with a few exceptions in Gusev crater and in lacustrine mudstones in Gale crater. These observations suggest that materials encountered by the rovers were derived from basaltic precursors by acid sulfate alteration under nearly isochemical conditions (i.e., minimal leaching). There are several cases, however, where acid sulfate alteration minerals (jarosite and hematite) formed in open hydrologic systems, e.g., in Gale crater lacustrine mudstones. Several hypotheses have been suggested for the

  7. Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

    Rosburg, Valerie; Boylston, Terri; White, Pamela

    2010-06-01

    Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

  8. Influence of chitosan and melanin-glucan complex onto gamma-exposure with low doses and acute stressful reaction

    Senyuk, O.F.; Tarasenko, P.D.; Pazukhin, Eh.M.; Gorovoj, L.F.; Varlamov, V.P.

    2004-01-01

    Possibilities of prevention and reduction of consequences of acute exposure on the background of immobilization stress with the help of chitosan preparations and of melanin - glucan complex of highest bazidiomicetes (fungi) were studied. Tested preparations were capable to protect hematological and immunological homeostasis of line BALB/c mice from stressful reaction provoked by acute exposure and two-hour immobilization. The most expressed normalizing and adapting effect had the mixture composed of chitosan and melanin-glucan complex

  9. beta. -1,4-glucan occurring in homogenate of Phaseolus aureus seedlings. Possible nascent stage of cellulose biosynthesis in vivo

    Satoh, S; Matsuda, K; Tamari, K

    1976-12-01

    A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.

  10. Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis

    Tomoko Jippo

    2015-02-01

    Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases

  11. β-Glucan production of Saccharomyces cerevisiae in medium with different nitrogen sources in air-lift fermentor

    AHMAD THONTOWI

    2007-10-01

    Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.

  12. High Molecular Weight Glucan of the Culinary Medicinal Mushroom Agaricus bisporus is an α-Glucan that Forms Complexes with Low Molecular Weight Galactan

    Harry J. Wichers

    2010-08-01

    Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.

  13. Molecular characterization and genetic diversity analysis β-glucan content variability in grain of oat (Avena sativa L.

    Đukić Nevena H.

    2014-01-01

    Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092

  14. Studies on Trans-Resveratrol/Carboxymethylated (1,3/1,6-β-d-Glucan Association for Aerosol Pharmaceutical Applications

    Antonio Francioso

    2017-05-01

    Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.

  15. Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

    Reshma Davidson

    Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

  16. Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

    Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

    2013-10-01

    Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

  17. Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

    Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

    2017-07-01

    The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Sulfate Transporters in Dissimilatory Sulfate Reducing Microorganisms: A Comparative Genomics Analysis

    Angeliki Marietou

    2018-03-01

    Full Text Available The first step in the sulfate reduction pathway is the transport of sulfate across the cell membrane. This uptake has a major effect on sulfate reduction rates. Much of the information available on sulfate transport was obtained by studies on assimilatory sulfate reduction, where sulfate transporters were identified among several types of protein families. Despite our growing knowledge on the physiology of dissimilatory sulfate-reducing microorganisms (SRM there are no studies identifying the proteins involved in sulfate uptake in members of this ecologically important group of anaerobes. We surveyed the complete genomes of 44 sulfate-reducing bacteria and archaea across six phyla and identified putative sulfate transporter encoding genes from four out of the five surveyed protein families based on homology. We did not find evidence that ABC-type transporters (SulT are involved in the uptake of sulfate in SRM. We speculate that members of the CysP sulfate transporters could play a key role in the uptake of sulfate in thermophilic SRM. Putative CysZ-type sulfate transporters were present in all genomes examined suggesting that this overlooked group of sulfate transporters might play a role in sulfate transport in dissimilatory sulfate reducers alongside SulP. Our in silico analysis highlights several targets for further molecular studies in order to understand this key step in the metabolism of SRMs.

  19. Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

    Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

    2017-04-01

    Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable

  20. Sulfate transport in toad skin

    Larsen, Erik Hviid; Simonsen, K

    1988-01-01

    1. In short-circuited toad skin preparations exposed bilaterally to NaCl-Ringer's containing 1 mM SO2(-4), influx of sulfate was larger than efflux showing that the skin is capable of transporting sulfate actively in an inward direction. 2. This active transport was not abolished by substituting...... apical Na+ for K+. 3. Following voltage activation of the passive Cl- permeability of the mitochondria-rich (m.r.) cells sulfate flux-ratio increased to a value predicted from the Ussing flux-ratio equation for a monovalent anion. 4. In such skins, which were shown to exhibit vanishingly small leakage...... conductances, the variation of the rate coefficient for sulfate influx (y) was positively correlated with the rate coefficient for Cl- influx (x), y = 0.035 x - 0.0077 cm/sec (r = 0.9935, n = 15). 5. Addition of the phosphodiesterase inhibitor, 3-isobutyl-1-methyl-xanthine to the serosal bath of short...

  1. Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.

    Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David

    2014-10-22

    Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.

  2. Methodologies for conformational studies of oligo- and poly-glucans: crystallography and molecular mechanics

    Tran, Huu Vinh

    1983-01-01

    After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans

  3. Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms

    Daniela Fiocco

    2012-05-01

    Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.

  4. Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections

    Andreas F. Haag

    2010-01-01

    Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.

  5. 21 CFR 184.1261 - Copper sulfate.

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Copper sulfate. 184.1261 Section 184.1261 Food and... Substances Affirmed as GRAS § 184.1261 Copper sulfate. (a) Copper sulfate (cupric sulfate, CuSO4·5H2O, CAS... the reaction of sulfuric acid with cupric oxide or with copper metal. (b) The ingredient must be of a...

  6. Periodate Oxidation for Sulfated Glycosaminoglycans, with Special Reference to the Position of Extra Sulfate Groups in Chondroitin Polysulfates, Chondroitin Sulfate D and Chondroitin Sulfate K

    Seno, Nobuko; Murakami, Keiko; Shibusawa, Haru

    1981-01-01

    The optimum conditions for periodate oxidation of sulfated disaccharides were investigated to determine the position of extra sulfate groups on the saturated disulfated disaccharides obtained from chondroitin polysulfates, chondroitin sulfates D and K. Under the conditions: 2mM saturated disulfated disaccharide with 20mM sodium periodate at 37°in the dark, the uronic acid residue in the disulfated disaccharide from chondroitin sulfate D was rapidly and completely destroyed, whereas that in th...

  7. Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters.

    Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen

    2004-10-01

    Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.

  8. Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels

    Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.

    2014-01-01

    Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183

  9. Characterization and biocompatibility of glucan: a safe food additive from probiotic Lactobacillus plantarum DM5.

    Das, Deeplina; Goyal, Arun

    2014-03-15

    Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.

  10. 21 CFR 582.5230 - Calcium sulfate.

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium sulfate. 582.5230 Section 582.5230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5230 Calcium sulfate. (a) Product. Calcium sulfate. (b) Conditions of use. This substance...

  11. 21 CFR 184.1643 - Potassium sulfate.

    2010-04-01

    ... hydroxide or potassium carbonate. (b) The ingredient meets the specifications of the “Food Chemicals Codex... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium sulfate. 184.1643 Section 184.1643 Food... Specific Substances Affirmed as GRAS § 184.1643 Potassium sulfate. (a) Potassium sulfate (K2SO4, CAS Reg...

  12. 21 CFR 184.1443 - Magnesium sulfate.

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Magnesium sulfate. 184.1443 Section 184.1443 Food... Specific Substances Affirmed as GRAS § 184.1443 Magnesium sulfate. (a) Magnesium sulfate (MgSO4·7H2O, CAS... magnesium oxide, hydroxide, or carbonate with sulfuric acid and evaporating the solution to crystallization...

  13. EFFECT OF MAGNESIUM SULFATE (A LAXATIVE) ON ...

    use with little success . Magnesium sulfate also known as Epsom salt or bitter salt is a hydrate salt with a chemical name of magnesium sulfate heptahydrate . Chemical formula is MgSO. 7HO and trade name is. Andrews liver salt. Dried magnesium sulfate is an osmotic laxative or a saline laxative that acts by increasing the.

  14. 21 CFR 582.5443 - Magnesium sulfate.

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Magnesium sulfate. 582.5443 Section 582.5443 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5443 Magnesium sulfate. (a) Product. Magnesium sulfate. (b) Conditions of use. This...

  15. Modeling and minimization of barium sulfate scale

    Alan W. Rudie; Peter W. Hart

    2006-01-01

    The majority of the barium present in the pulping process exits the digester as barium carbonate. Barium carbonate dissolves in the bleach plant when the pH drops below 7 and, if barium and sulfate concentrations are too high, begins to precipitate as barium sulfate. Barium is difficult to control because a mill cannot avoid this carbonate-to-sulfate transition using...

  16. 21 CFR 582.1125 - Aluminum sulfate.

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aluminum sulfate. 582.1125 Section 582.1125 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1125 Aluminum sulfate. (a) Product. Aluminum sulfate. (b) Conditions of use. This substance...

  17. 21 CFR 182.1125 - Aluminum sulfate.

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Aluminum sulfate. 182.1125 Section 182.1125 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Substances § 182.1125 Aluminum sulfate. (a) Product. Aluminum sulfate. (b) Conditions of use. This substance...

  18. Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I

    Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.

    1998-01-01

    The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains

  19. Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

    Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

    2016-01-20

    α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

  20. Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

    Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

    2018-05-14

    Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity

    Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.

    1989-01-01

    A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains

  2. Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

    Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

    2017-03-01

    Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer

    Hirokazu Tokuyasu

    2010-09-01

    Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran

  4. β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.

    Sonja de Vries

    Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.

  5. Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

    Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

    2004-03-26

    The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

  6. The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

    Jenneke Leentjens

    Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.

  7. Enzyme-Linked Immunosorbent Assay Specific for (1→6) Branched, (1→3)-β-d-Glucan Detection in Environmental Samples

    Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael

    2001-01-01

    (1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...

  8. Probing interactions between B-glucan and bile salts at atomic detail by 1H-13C NMR assays

    Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G

    2014-01-01

    Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....

  9. Regeneration of sulfated metal oxides and carbonates

    Hubble, Bill R.; Siegel, Stanley; Cunningham, Paul T.

    1978-03-28

    Alkali metal or alkaline earth metal carbonates such as calcium carbonate and magnesium carbonate found in dolomite or limestone are employed for removal of sulfur dioxide from combustion exhaust gases. The sulfated carbonates are regenerated to oxides through use of a solid-solid reaction, particularly calcium sulfide with calcium sulfate to form calcium oxide and sulfur dioxide gas. The regeneration is performed by contacting the sulfated material with a reductant gas such as hydrogen within an inert diluent to produce calcium sulfide in mixture with the sulfate under process conditions selected to permit the sulfide-sulfate, solid-state reaction to occur.

  10. Reduced sulfation of chondroitin sulfate but not heparan sulfate in kidneys of diabetic db/db mice.

    Reine, Trine M; Grøndahl, Frøy; Jenssen, Trond G; Hadler-Olsen, Elin; Prydz, Kristian; Kolset, Svein O

    2013-08-01

    Heparan sulfate proteoglycans are hypothesized to contribute to the filtration barrier in kidney glomeruli and the glycocalyx of endothelial cells. To investigate potential changes in proteoglycans in diabetic kidney, we isolated glycosaminoglycans from kidney cortex from healthy db/+ and diabetic db/db mice. Disaccharide analysis of chondroitin sulfate revealed a significant decrease in the 4-O-sulfated disaccharides (D0a4) from 65% to 40%, whereas 6-O-sulfated disaccharides (D0a6) were reduced from 11% to 6%, with a corresponding increase in unsulfated disaccharides. In contrast, no structural differences were observed in heparan sulfate. Furthermore, no difference was found in the molar amount of glycosaminoglycans, or in the ratio of hyaluronan/heparan sulfate/chondroitin sulfate. Immunohistochemical staining for the heparan sulfate proteoglycan perlecan was similar in both types of material but reduced staining of 4-O-sulfated chondroitin and dermatan was observed in kidney sections from diabetic mice. In support of this, using qRT-PCR, a 53.5% decrease in the expression level of Chst-11 (chondroitin 4-O sulfotransferase) was demonstrated in diabetic kidney. These results suggest that changes in the sulfation of chondroitin need to be addressed in future studies on proteoglycans and kidney function in diabetes.

  11. Modeling of ferric sulfate decomposition and sulfation of potassium chloride during grate‐firing of biomass

    Wu, Hao; Jespersen, Jacob Boll; Jappe Frandsen, Flemming

    2013-01-01

    Ferric sulfate is used as an additive in biomass combustion to convert the released potassium chloride to the less harmful potassium sulfate. The decomposition of ferric sulfate is studied in a fast heating rate thermogravimetric analyzer and a volumetric reaction model is proposed to describe...... the process. The yields of sulfur oxides from ferric sulfate decomposition under boiler conditions are investigated experimentally, revealing a distribution of approximately 40% SO3 and 60% SO2. The ferric sulfate decomposition model is combined with a detailed kinetic model of gas‐phase KCl sulfation...... and a model of K2SO4 condensation to simulate the sulfation of KCl by ferric sulfate addition. The simulation results show good agreements with experiments conducted in a biomass grate‐firing reactor. The results indicate that the SO3 released from ferric sulfate decomposition is the main contributor to KCl...

  12. Preparation and characteristics of beta-glucan concentrate from brewer's yeast as the additive substance in foods

    Ľubomír Mikuš

    2013-02-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too.  At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258

  13. Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

    Kupetz, M; Sacher, B; Becker, T

    2016-06-05

    Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

    Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

    2015-01-01

    Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

  15. Dietary beta-1,3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L.).

    Kumari, J; Sahoo, P K

    2006-02-01

    This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.

  16. Quantitative assessment of the effects of beta-glucan consumption on serum lipid profile and glucose level in hypercholesterolemic subjects.

    Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S

    2015-08-01

    A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

    Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

    2018-06-19

    The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

  18. Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

    Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

    2013-01-01

    Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

  19. Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

    Kuzmanoff, K. M.

    1984-01-01

    In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

  20. A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

    Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

    2014-08-01

    An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. (1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.

    Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin

    2017-03-01

    A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.

  2. Inhibition of synthesis of heparan sulfate by selenate: Possible dependence on sulfation for chain polymerization

    Dietrich, C.P.; Nader, H.B.; Buonassisi, V.; Colburn, P.

    1988-01-01

    Selenate, a sulfation inhibitor, blocks the synthesis of heparan sulfate and chondroitin sulfate by cultured endothelial cells. In contrast, selenate does not affect the production of hyaluronic acid, a nonsulfated glycosaminoglycan. No differences in molecular weight, [ 3 H]glucosamine/[ 35 S]sulfuric acid ratios, or disaccharide composition were observed when the heparan sulfate synthesized by selenate-treated cells was compared with that of control cells. The absence of undersulfated chains in preparations from cultures exposed to selenate supports the concept that, in the intact cell, the polymerization of heparan sulfate might be dependent on the sulfation of the saccharide units added to the growing glycosaminoglycan chain

  3. Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

    Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

    1999-01-01

    Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique

  4. Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

    Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

    Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique

  5. β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

    2015-01-01

    The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p periodontal disease (p periodontal disease (p periodontal effects in diabetic rats with periodontal disease. PMID:26291983

  6. Analysis of tyrosine-O-sulfation

    Bundgaard, J.R.; Sen, J.W.; Johnsen, A.H.

    2008-01-01

    Tyrosine O-sulfation was first described about 50 years ago as a post-translational modification of fibrinogen. In the following 30 years it was considered to be a rare modification affecting only a few proteins and peptides. However, in the beginning of the 1980s tyrosine (Tyr) sulfation was shown...... to be a common modification and since then an increasing number of proteins have been identified as sulfated. The target proteins belong to the classes of secretory, plasma membrane, and lysosomal proteins, which reflects the intracellular localization of the enzymes catalyzing Tyr sulfation, the tyrosylprotein...... sulfotransferases (TPSTs).Traditionally, Tyr sulfation has been analyzed by incorporation of radiolabeled sulfate into target cells followed by purification of the target protein. Subsequently, the protein is degraded enzymatically or by alkaline hydrolysis followed by thin-layer electrophoresis to demonstrate...

  7. Dimerization of the Glucan Phosphatase Laforin Requires the Participation of Cysteine 329

    Sánchez-Martín, Pablo; Raththagala, Madushi; Bridges, Travis M.; Husodo, Satrio; Gentry, Matthew S.; Sanz, Pascual; Romá-Mateo, Carlos

    2013-01-01

    Laforin, encoded by a gene that is mutated in Lafora Disease (LD, OMIM 254780), is a modular protein composed of a carbohydrate-binding module and a dual-specificity phosphatase domain. Laforin is the founding member of the glucan-phosphatase family and regulates the levels of phosphate present in glycogen. Multiple reports have described the capability of laforin to form dimers, although the function of these dimers and their relationship with LD remains unclear. Recent evidence suggests that laforin dimerization depends on redox conditions, suggesting that disulfide bonds are involved in laforin dimerization. Using site-directed mutagenesis we constructed laforin mutants in which individual cysteine residues were replaced by serine and then tested the ability of each protein to dimerize using recombinant protein as well as a mammalian cell culture assay. Laforin-Cys329Ser was the only Cys/Ser mutant unable to form dimers in both assays. We also generated a laforin truncation lacking the last three amino acids, laforin-Cys329X, and this truncation also failed to dimerize. Interestingly, laforin-Cys329Ser and laforin-Cys329X were able to bind glucans, and maintained wild type phosphatase activity against both exogenous and biologically relevant substrates. Furthermore, laforin-Cys329Ser was fully capable of participating in the ubiquitination process driven by a laforin-malin complex. These results suggest that dimerization is not required for laforin phosphatase activity, glucan binding, or for the formation of a functional laforin-malin complex. Cumulatively, these results suggest that cysteine 329 is specifically involved in the dimerization process of laforin. Therefore, the C329S mutant constitutes a valuable tool to analyze the physiological implications of laforin’s oligomerization. PMID:23922729

  8. Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

    Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

    2016-10-01

    This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Oral microbe-host interactions: influence of β-glucans on gene expression of inflammatory cytokines and metabolome profile.

    Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça

    2017-03-07

    The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.

  10. Hypoglycemic activity of polysaccharide fractions containing ß-glucans from extracts of Rhynchelytrum repens (Willd. C.E. Hubb., Poaceae

    A.C.C.F.F. De Paula

    2005-06-01

    Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

  11. A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

    Semedo, Magda C; Karmali, Amin; Fonseca, Luís

    2015-02-01

    Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Effects of dietary yeastβ-glucan on nutrient digestibility and serum proifles in pre-ruminant Holstein calves

    MA Tao; TU Yan; ZHANG Nai-feng; GUO Jiang-peng; DENG Kai-dong; ZHOU Yi; YUN Qiang; DIAO Qi-yu

    2015-01-01

    This study aimed to investigate the effects of dietary supplementation of yeastβ-glucan on the nutrient digestibility and serum proifles in pre-ruminant Holstein calves. Forty-two neonatal Holstein calves ((39.6±4.2) kg) were randomly al otted to six groups, and each was offered one of the fol owing diets:a basal diet (control) or the basal diet supplemented with 25, 50, 75, 100 or 200 mg of yeastβ-glucan kg–1 feed (dry matter basis). The basal diet consisted of a milk replacer and a starter feed. The trial lasted for 56 d. Two digestibility trials were conducted from d 14 to 20 and from d 42 to 48. Blood samples were col ected on d 0, 14, 28 and 42 for serum proifle analyses. On d 56, three calves from each group were slaughtered, and intestinal samples were col ected to assess the vil ous height, crypt depth and mucosal thickness. Although feed intake was not affected by dietary treatment (P>0.05), the average daily gain (ADG) and gain-to-feed ratios were higher (P0.05). Compared with the control group, supplementation of yeastβ-glucan decreased (P0.05). The supplementation of yeastβ-glucan stimu-lated the enzymatic activity of alkaline phosphatase (ALP) (P<0.05) compared with the control group. The lysozyme (LYZ) concentration increased quadratical y (P<0.05) with increasing yeastβ-glucan levels. The results suggested that dietary supplementation of yeastβ-glucan at 75 mg kg–1 feed improved nutrient digestibility, enhanced immunity by increasing the immunoglobulin concentration and stimulating ALP, and exerted no adverse effects on metabolism in pre-ruminant calves.

  13. Bactericide for sulfate-reducing bacteria

    Shklyar, T F; Anoshina, G M; Blokhin, V Ye; Kisarrev, Ye L; Novikovsa, G M

    1981-01-01

    The aim of the invention is to find a bactericide for sulfate-reducing bacteria of oil fields in Western Siberia in order to suppress the biocorrosive activity on oil industry equipment. This goal is achieved by using M-nitroacetanylide as the bactericide of sulfate-reducing bacteria. This agent suppresses the activity of a stored culture of sulfate-reducing bacteria that comes from industrial waste waters injection wells of the Smotlor oil field.

  14. EFFECTS OF BARLEY FLOUR ADDITION AND BAKING TEMPERATURE ON Β-GLUCANS CONTENT AND BISCUITS PROPERTIES

    Džafić, A; Oručević-Žuljević, Sanja; Spaho, Nermina; Akagić, Asima

    2017-01-01

    The aim of this study was to investigate opportunities to improve the nutritional value of biscuits. Therefore, the content of β-glucans, physical, chemical and sensory properties of biscuits were determined in relation to a share of added barley flour and a baking temperature. Five different blends of barley and wheat were used for biscuit production: barley/wheat flours in combinations: 0/100; 25/75; 50/50; 75/25 and 100/0 according to the procedure described in AACC method 10-52. The temp...

  15. Synthesis of O- and C-glycosides derived from β-(1,3)-D-glucans.

    Marca, Eduardo; Valero-Gonzalez, Jessika; Delso, Ignacio; Tejero, Tomás; Hurtado-Guerrero, Ramon; Merino, Pedro

    2013-12-15

    A series of β-(1,3)-d-glucans have been synthesized incorporating structural variations specifically on the reducing end of the oligomers. Both O- and C-glucosides derived from di- and trisaccharides have been obtained in good overall yields and with complete selectivity. Whereas the O-glycosides were obtained via a classical Koenigs-Knorr glycosylation, the corresponding C-glycosides were obtained through allylation of the anomeric carbon and further cross-metathesis reaction. Finally, the compounds were evaluated against two glycosidases and two endo-glucanases and no inhibitory activity was observed. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Sulfated polysaccharide, curdlan sulfate, efficiently prevents entry/fusion and restricts antibody-dependent enhancement of dengue virus infection in vitro: a possible candidate for clinical application.

    Koji Ichiyama

    Full Text Available Curdlan sulfate (CRDS, a sulfated 1→3-β-D glucan, previously shown to be a potent HIV entry inhibitor, is characterized in this study as a potent inhibitor of the Dengue virus (DENV. CRDS was identified by in silico blind docking studies to exhibit binding potential to the envelope (E protein of the DENV. CRDS was shown to inhibit the DENV replication very efficiently in different cells in vitro. Minimal effective concentration of CRDS was as low as 0.1 µg/mL in LLC-MK2 cells, and toxicity was observed only at concentrations over 10 mg/mL. CRDS can also inhibit DENV-1, 3, and 4 efficiently. CRDS did not inhibit the replication of DENV subgenomic replicon. Time of addition experiments demonstrated that the compound not only inhibited viral infection at the host cell binding step, but also at an early post-attachment step of entry (membrane fusion. The direct binding of CRDS to DENV was suggested by an evident reduction in the viral titers after interaction of the virus with CRDS following an ultrafiltration device separation, as well as after virus adsorption to an alkyl CRDS-coated membrane filter. The electron microscopic features also showed that CRDS interacted directly with the viral envelope, and caused changes to the viral surface. CRDS also potently inhibited DENV infection in DC-SIGN expressing cells as well as the antibody-dependent enhancement of DENV-2 infection. Based on these data, a probable binding model of CRDS to DENV E protein was constructed by a flexible receptor and ligand docking study. The binding site of CRDS was predicted to be at the interface between domains II and III of E protein dimer, which is unique to this compound, and is apparently different from the β-OG binding site. Since CRDS has already been tested in humans without serious side effects, its clinical application can be considered.

  17. Amphiphilic polymeric micelles originating from 1,4-β-D-glucan-g-polyphenylene oxide as the carriers for delivery of docetaxel and the corresponding release behaviors.

    Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang

    2018-07-15

    A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Only small fractions of soluble ß-glucan modulate the mucosal immune system in carp (Cyprinus carpio L.)

    Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht

    For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...

  19. Significant role of organic sulfur in supporting sedimentary sulfate reduction in low-sulfate environments

    Fakhraee, Mojtaba; Li, Jiying; Katsev, Sergei

    2017-09-01

    Dissimilatory sulfate reduction (DSR) is a major carbon mineralization pathway in aquatic sediments, soils, and groundwater, which regulates the production of hydrogen sulfide and the mobilization rates of biologically important elements such as phosphorus and mercury. It has been widely assumed that water-column sulfate is the main sulfur source to fuel this reaction in sediments. While this assumption may be justified in high-sulfate environments such as modern seawater, we argue that in low-sulfate environments mineralization of organic sulfur compounds can be an important source of sulfate. Using a reaction-transport model, we investigate the production of sulfate from sulfur-containing organic matter for a range of environments. The results show that in low sulfate environments (50%) of sulfate reduction. In well-oxygenated systems, porewater sulfate profiles often exhibit sub-interface peaks so that sulfate fluxes are directed out of the sediment. Our measurements in Lake Superior, the world's largest lake, corroborate this conclusion: offshore sediments act as sources rather than sinks of sulfate for the water column, and sediment DSR is supported entirely by the in-sediment production of sulfate. Sulfate reduction rates are correlated to the depth of oxygen penetration and strongly regulated by the supply of reactive organic matter; rate co-regulation by sulfate availability becomes appreciable below 500 μM level. The results indicate the need to consider the mineralization of organic sulfur in the biogeochemical cycling in low-sulfate environments, including several of the world's largest freshwater bodies, deep subsurface, and possibly the sulfate-poor oceans of the Early Earth.

  20. Discovery of a Heparan sulfate 3- o -sulfation specific peeling reaction

    Huang, Yu; Mao, Yang; Zong, Chengli; Lin, Cheng; Boons, Geert Jan|info:eu-repo/dai/nl/088245489; Zaia, Joseph

    2015-01-01

    Heparan sulfate (HS) 3-O-sulfation determines the binding specificity of HS/heparin for antithrombin III and plays a key role in herpes simplex virus (HSV) infection. However, the low natural abundance of HS 3-O-sulfation poses a serious challenge for functional studies other than the two cases

  1. 21 CFR 172.822 - Sodium lauryl sulfate.

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sodium lauryl sulfate. 172.822 Section 172.822 Food... Multipurpose Additives § 172.822 Sodium lauryl sulfate. The food additive sodium lauryl sulfate may be safely... specifications: (1) It is a mixture of sodium alkyl sulfates consisting chiefly of sodium lauryl sulfate [CH2(CH2...

  2. Brittlestars contain highly sulfated chondroitin sulfates/dermatan sulfates that promote fibroblast growth factor 2-induced cell signaling.

    Ramachandra, Rashmi; Namburi, Ramesh B; Ortega-Martinez, Olga; Shi, Xiaofeng; Zaia, Joseph; Dupont, Sam T; Thorndyke, Michael C; Lindahl, Ulf; Spillmann, Dorothe

    2014-02-01

    Glycosaminoglycans (GAGs) isolated from brittlestars, Echinodermata class Ophiuroidea, were characterized, as part of attempts to understand the evolutionary development of these polysaccharides. A population of chondroitin sulfate/dermatan sulfate (CS/DS) chains with a high overall degree of sulfation and hexuronate epimerization was the major GAG found, whereas heparan sulfate (HS) was below detection level. Enzymatic digestion with different chondroitin lyases revealed exceptionally high proportions of di- and trisulfated CS/DS disaccharides. The latter unit appears much more abundant in one of four individual species of brittlestars, Amphiura filiformis, than reported earlier in other marine invertebrates. The brittlestar CS/DS was further shown to bind to growth factors such as fibroblast growth factor 2 and to promote FGF-stimulated cell signaling in GAG-deficient cell lines in a manner similar to that of heparin. These findings point to a potential biological role for the highly sulfated invertebrate GAGs, similar to those ascribed to HS in vertebrates.

  3. Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

    Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

    2014-03-01

    The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

  4. Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.

    Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G

    2017-08-15

    Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.

    Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong

    2014-03-19

    A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.

  6. Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

    Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

  7. Incorporation of UDPglucose into cell wall glucans and lipids by intact cotton fibers

    Dugger, W.M.; Palmer, R.L.

    1986-01-01

    The [ 14 C] moiety from [ 3 H]UDP[ 14 C]glucose was incorporated by intact cotton fibers into hot water soluble, acetic-nitric reagent soluble and insoluble components, and chloroform-methanol soluble lipids; the [ 3 H]UDP moiety was not incorporated. The 3 H-label can be exchanged rapidly with unlabeled substrate in a chase experiment. The cell wall apparent free space of cotton fibers was in the order of 30 picomoles per milligram of dry fibers; 25 picomoles per milligram easily exchanged and about 5 picomoles per milligram more tightly adsorbed. At 50 micromolar UDPglucose, 70% of the [ 14 C]glucose was found in the lipid fraction after both a short labeling period and chase. The percent of [ 14 C]glucose incorporated into total glucan increased within a 30-minute chase period. The data supports the concept that glucan synthesis, including cellulose, as well as the synthesis of steryl glucosides, acetylated steryl glucosides, and glucosyl-phosphoryl-polyprenol from externally supplied UDPglucose occurs at the plasma membrane-cell wall interface. The synthase enzymes for such synthesis must be part of this interfacial membrane system

  8. Post radiation protection and enhancement of DNA repair of beta glucan isolated from Ganoderma lucidum

    Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.

    2013-01-01

    Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)

  9. Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan

    Eduardo Madrigal-Bujaidar

    2015-06-01

    Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.

  10. Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

    Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.

    2013-01-01

    Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

  11. The anaerobic treatment of sulfate containing wastewater

    Visser, A.

    1995-01-01


    In the anaerobic treatment of sulfate containing wastewater sulfate reducing bacteria (SRB) will compete with methanogenic- (MB) and acetogenic bacteria (AB) for the available substrates such as hydrogen, acetate, propionate and butyrate. The outcome of this competition will

  12. Effects of β-Glucans Ingestion on Alveolar Bone Loss, Intestinal Morphology, Systemic Inflammatory Profile, and Pancreatic β-Cell Function in Rats with Periodontitis and Diabetes

    Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.

    2017-01-01

    This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456

  13. Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

    Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

    1990-04-01

    Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

  14. Generic tools to assess genuine carbohydrate specific effects on in vitro immune modulation exemplified by β-glucans

    Rieder, Anne; Grimmer, Stine; Aachmann, Finn L.

    2013-01-01

    Even if carbohydrate preparations from plant/fungal sources have a high degree of purity, observed immune-stimulation may be caused by minute sample contaminations. Using the example of different β-glucans we present a range of analytical tools crucial for validation of possible immune-stimulator...

  15. An extracellular cell-attached pullulanase confers branched α-glucan utilization in human gut Lactobacillus acidophilus

    Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig

    2017-01-01

    binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...

  16. Protective Effects of Surfactant Protein D (SP-D) Treatment in 1,3-β-glucan-modulated Allergic Inflammation

    Fakih, Dalia; Pilecki, Bartosz; Schlosser, Anders

    2015-01-01

    SP-D is a pulmonary collectin important in lung immunity. SP-D-deficient mice (Sftpd(-/-)) are reported to be susceptible to ovalbumin (OVA)- and fungal allergen-induced pulmonary inflammation, while treatment with exogenous SP-D has therapeutic effects in such disease models. β-glucans are a div...

  17. Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus

    Jesus, de Liana Inara; Smiderle, Fhernanda R.; Ruthes, Andrea C.; Vilaplana, Francisco; Lin, Dal' Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Griensven, Van Leo J.L.D.; Iacomini, Marcello

    2017-01-01

    A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle

  18. Respiratory health in children, and indoor exposure to (1,3)-beta-D-glucan, EPS mould components and endotoxin

    Tischer, C.; Gehring, U.; Chen, C-M; Kerkhof, M.; Koppelman, G.; Sausenthaler, S.; Herbarth, O.; Schaaf, B.; Lehmann, I.; Kraemer, U.; Berdel, D.; von Berg, A.; Bauer, C. P.; Koletzko, S.; Wichmann, H-E; Brunekreef, B.; Heinrich, J.

    For a long time, exposure to mould and dampness-derived microbial components was considered a risk factor for the development of respiratory diseases and symptoms. Some recent studies suggested that early childhood exposure to mould components, such as (1,3)-beta-D-glucan and extracellular

  19. Crystal Structure of α-1,4-Glucan Lyase, a Unique Glycoside Hydrolase Family Member with a Novel Catalytic Mechanism

    Rozeboom, Henriëtte J.; Yu, Shukun; Madrid, Susan; Kalk, Kor H.; Zhang, Ran; Dijkstra, Bauke W.

    2013-01-01

    α-1,4-Glucan lyase (EC 4.2.2.13) from the red seaweed Gracilariopsis lemaneiformis cleaves α-1,4-glucosidic linkages in glycogen, starch, and malto-oligosaccharides, yielding the keto-monosaccharide 1,5-anhydro-D-fructose. The enzyme belongs to glycoside hydrolase family 31 (GH31) but degrades

  20. Synthesis of New Hyper-Branched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants

    Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

    2016-01-01

    α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088 and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were

  1. β-glucan enriched bath directly stimulates the wound healing process in common carp (Cyprinus carpio L.)

    Przybylska, Dominika Alicja; Schmidt, Jacob; Jiménez, Natalia Ivonne Vera

    2013-01-01

    of production of radical oxygen species. PAMPs/DAMPs stimulation caused by the wounding and or β-glucans resulted in an inflammatory response by activating IL-1b, IL-6 family member M17 and IL-8 and differences in the expression pattern were seen depending on stimuli. IL-1b, IL-6 family member M17 and IL-8 were...

  2. Plant α-glucan phosphatases SEX4 and LSF2 display different affinity for amylopectin and amylose

    Wilkens, Casper; Auger, Kyle D.; Anderson, Nolan T.

    2016-01-01

    The plant glucan phosphatases Starch EXcess 4 (SEX4) and Like Sex Four2 (LSF2) apply different starch binding mechanisms. SEX4 contains a carbohydrate binding module, and LSF2 has two surface binding sites (SBSs). We determined KDapp for amylopectin and amylose, and KD for β-cyclodextrin and vali...

  3. Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

    Shiota, E; Maekawa, M; Kono, T

    2001-12-01

    Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

  4. Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanase.

    Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi

    2008-06-01

    Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.

  5. Fungi, beta-Glucan, and Bacteria in Nasal Lavage of Greenhouse Workers and Their Relation to Occupational Exposure

    Madsen, A. M.; Tendal, K.; Thilsing, T.

    2013-01-01

    occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...

  6. Determinants of house dust, endotoxin, and β-(1→3)-d-glucan in homes of Danish children

    Holst, Gitte Juel; Høst, Arne; Doekes, G

    2015-01-01

    Little is known about the geographic variation and determinants of bacterial endotoxin and β -(1,3)-d-glucan in Danish house dust. In a population of 317 children, we: (i) described loads and concentrations of floor dust, endotoxin, and β-(1→3)-d-glucan and (ii) their correlations and (iii......) assessed their determinants; (iv) Finally, we compared our findings with previous European studies. Bedroom floor dust was analyzed for endotoxin content by the kinetic limulus amoebocyte lysate assay and for β-(1→3)-d-glucan by the inhibition enzyme immunoassay. The parents answered questions regarding...... potential determinants. We found: geometric means (geometric standard deviations) 186 mg/m(2) (4.3) for dust; 5.46 × 10(3) EU/m(2) (8.0) and 31.1 × 10(3) EU/g (2.6) for endotoxin; and 142 μg/m(2) (14.3) and 0.71 × 10(3) μg/g (7.3) for β-(1→3)-d-glucan. High correlations (r > 0.75) were found between floor...

  7. Characterization and partial purification of beta-1,3-D-glucan (callose) synthase from barley (Hordeum vulgare) leaves

    Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.

    1993-01-01

    The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...

  8. Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

    Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

    2009-01-01

    Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

  9. Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

    Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

    2017-09-05

    Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Metabolic Flexibility of Sulfate Reducing Bacteria

    Caroline M. Plugge

    2011-05-01

    Full Text Available Dissimilatory sulfate-reducing prokaryotes (SRB are a very diverse group of anaerobic bacteria that are omnipresent in nature and play an imperative role in the global cycling of carbon and sulfur. In anoxic marine sediments sulfate reduction accounts for up to 50% of the entire organic mineralization in coastal and shelf ecosystems where sulfate diffuses several meters deep into the sediment. As a consequence, SRB would be expected in the sulfate-containing upper sediment layers, whereas methanogenic Archaea would be expected to succeed in the deeper sulfate-depleted layers of the sediment. Where sediments are high in organic matter, sulfate is depleted at shallow sediment depths, and biogenic methane production will occur. In the absence of sulfate, many SRB ferment organic acids and alcohols, producing hydrogen, acetate, and carbon dioxide, and may even rely on hydrogen- and acetate-scavenging methanogens to convert organic compounds to methane. SRB can establish two different life styles, and these can be termed as sulfidogenic and acetogenic, hydrogenogenic metabolism. The advantage of having different metabolic capabilities is that it raises the chance of survival in environments when electron acceptors become depleted. In marine sediments, SRB and methanogens do not compete but rather complement each other in the degradation of organic matter.Also in freshwater ecosystems with sulfate concentrations of only 10-200 μM, sulfate is consumed efficiently within the top several cm of the sediments. Here, many of the δ-Proteobacteria present have the genetic machinery to perform dissimilatory sulfate reduction, yet they have an acetogenic, hydrogenogenic way of life.In this review we evaluate the physiology and metabolic mode of SRB in relation with their environment.

  11. Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

    Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

    2012-04-01

    Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

  12. NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

    Henky Manoppo

    2010-06-01

    Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

  13. Structural analysis of bioengineered alpha-D-glucan produced by a triple mutant of the glucansucrase GTF180 enzyme from Lactobacillus reuteri strain 180 : Generation of (alpha 1 -> 4) linkages in a native (1 -> 3)(1 -> 6)-alpha-D-glucan

    van Leeuwen, Sander S.; Kralj, Slavko; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

    Site-directed mutagenesis of the glucansucrase gtf180 gene from Lactobacillus reuteri strain 180 was used to transform the active site region. The alpha-D-glucan (mEPS-PNNS) produced by the triple mutant V1027P:S1137N: A1139S differed in structure from that of the wild-type alpha-D-glucan (EPS180).

  14. β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

    Shao, Yujing; Guo, Yuming; Wang, Zhong

    2013-07-01

    This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.

  15. Feeding common carp Cyprinus carpio with b-glucan supplemented \\ud diet stimulates C-reactive protein and complement immune acute\\ud phase responses following PAMPs injection

    Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave

    2014-01-01

    The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...

  16. Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.

    Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong

    2017-02-01

    (1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis

  17. Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.

    Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena

    2015-04-01

    Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

    Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

    2017-11-01

    The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  19. The Dual Activity Responsible for the Elongation and Branching of β-(1,3-Glucan in the Fungal Cell Wall

    Vishukumar Aimanianda

    2017-06-01

    Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.

  20. Characterization of oat beta-glucan and coenzyme Q10-loaded beta-glucan powders generated by the pressurized gas-expanded liquid (PGX) technology.

    Liu, Nian; Couto, Ricardo; Seifried, Bernhard; Moquin, Paul; Delgado, Luis; Temelli, Feral

    2018-04-01

    The physicochemical properties of the oat beta-glucan powder (BG) and coenzyme Q10 (CoQ10)-loaded BG powder (L-BG) produced by the pressurized gas-expanded liquid (PGX) technology were studied. Helium ion microscope, differential scanning calorimeter, X-ray diffractometer, AutoSorb iQ and rheometer were used to determine the particle morphology, thermal properties, crystallinity, surface area and viscosity, respectively. Both BG (7.7μm) and L-BG (6.1μm) were produced as micrometer-scale particles, while CoQ10 nanoparticles (92nm) were adsorbed on the porous structure of L-BG. CoQ10 was successfully loaded onto BG using the PGX process via adsorptive precipitation mainly in its amorphous form. Viscosity of BG and L-BG solutions (0.15%, 0.2%, 0.3% w/v) displayed Newtonian behavior with increasing shear rate but decreased with temperature. Detailed characterization of the physicochemical properties of combination ingredients like L-BG will lead to the development of novel functional food and natural health product applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Extraction of uranyl sulfate with primary amine

    Mrnka, M.; Bizek, V.; Nekovar, P.; Cizevska, S.; Schroetterova, D.

    1984-01-01

    PRIMENE JM-T was used for extraction. Its composition was found to approach the general formula C 21 H 43 NH 2 . It was found that the extraction of uranyl sulfate is lower in case of a higher steady-state concentration of sulfuric acid in the aqueous phase. Extraction is accompanied with coextraction of water. The results obtained showed that uranyl sulfate passes into the organic phase by two mechanisms: extraction with amine sulfate and extraction with free amine. A mathematical description of the process was made based on the obtained results. (E.S.)

  2. Chlorate: a reversible inhibitor of proteoglycan sulfation

    Humphries, D.E.; Silbert, J.E.

    1988-01-01

    Bovine aorta endothelial cells were cultured in medium containing [ 3 H]glucosamine, [ 35 S]sulfate, and various concentrations of chlorate. Cell growth was not affected by 10 mM chlorate, while 30 mM chlorate had a slight inhibitory effect. Chlorate concentrations greater than 10 mM resulted in significant undersulfation of chondroitin. With 30 mM chlorate, sulfation of chondroitin was reduced to 10% and heparan to 35% of controls, but [ 3 H]glucosamine incorporation on a per cell basis did not appear to be inhibited. Removal of chlorate from the culture medium of cells resulted in the rapid resumption of sulfation

  3. Structure elucidation and immunomodulatory activity of a beta glucan from the fruiting bodies of Ganoderma sinense.

    Xiao-Qiang Han

    Full Text Available A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4- and (1→6-Glcp, bearing terminal- and (1→3-Glcp side-chains at O-3 position of (1→6-Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells.

  4. Live imaging of β-1,3-glucan synthase FKS-1 in Neurospora crassa hyphae.

    Sánchez-León, Eddy; Riquelme, Meritxell

    2015-09-01

    The subcellular localization and dynamics of FKS-1, the putative catalytic subunit of the β-1,3-glucan synthase complex, was analyzed in growing hyphae of Neurospora crassa by live confocal microscopy. GFP-tagged FKS-1 accumulated at the outer layer of the Spitzenkörper (Spk), and at the apical plasma membrane (PM). Fluorescence recovery after photobleaching analysis revealed arrival of FKS-1-containing carriers first at the immediate surroundings of the core region of the Spk, and thereafter to the Spk most outer region. The results obtained here and previous data suggest that FKS-1 is transported to the Spk in macrovesicles. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. First principles insight into the α-glucan structures of starch

    Damager, Iben; Engelsen, Søren Balling; Blennow, Andreas

    2010-01-01

    A study was conducted to demonstrate the synthesis, conformation, and hydration of the α-glucan structures of starch. Starch and glycogen were synthesized by sets of specific enzyme activities that directly determined their molecular structures and physical properties. It was demonstrated...... that the extent of crystallinity, aggregation and hydration was of fundamental importance for starch and its human analogue glycogen. Starch was deposited in the plant as a stable form in highly organized and semicrystalline granules having specific crystalline polymorphs as determined by powder X......-ray crystallography. The investigations mainly focused on the bottom-up approach of synthesis, conformation, and hydration of starch. Starch and glycogen were found to be polymers that were built up from a single monomer, D-glucopyranose, or for short D-glucose....

  6. Defects in rhizobial cyclic glucan and lipopolysaccharide synthesis alter legume gene expression during nodule development

    D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene

    2008-01-01

    cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...

  7. Structure Elucidation and Immunomodulatory Activity of A Beta Glucan from the Fruiting Bodies of Ganoderma sinense

    Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin

    2014-01-01

    A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571

  8. Contribution of glucan-binding protein A to firm and stable biofilm formation by Streptococcus mutans.

    Matsumi, Y; Fujita, K; Takashima, Y; Yanagida, K; Morikawa, Y; Matsumoto-Nakano, M

    2015-06-01

    Glucan-binding proteins (Gbps) of Streptococcus mutans, a major pathogen of dental caries, mediate the binding of glucans synthesized from sucrose by the action of glucosyltransferases (GTFs) encoded by gtfB, gtfC, and gtfD. Several stress proteins, including DnaK and GroEL encoded by dnaK and groEL, are related to environmental stress tolerance. The contribution of Gbp expression to biofilm formation was analyzed by focusing on the expression levels of genes encoding GTFs and stress proteins. Biofilm-forming assays were performed using GbpA-, GbpB-, and GbpC-deficient mutant strains and the parental strain MT8148. The expression levels of gtfB, gtfC, gtfD, dnaK, and groEL were evaluated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Furthermore, the structure of biofilms formed by these Gbp-deficient mutant strains was observed using confocal laser scanning microscopy (CLSM). Biofilm-forming assay findings demonstrated that the amount formed by the GbpA-deficient mutant strain (AD1) was nearly the same as that by the parental strain, while the GbpB- and GbpC-deficient mutant strains produced lower amounts than MT8148. Furthermore, RT-qPCR assay results showed that the expressions of gtfB, dnaK, and groEL in AD1 were elevated compared with MT8148. CLSM also revealed that the structure of biofilm formed by AD1 was prominently different compared with that formed by the parental strain. These results suggest that a defect in GbpA influences the expression of genes controlling biofilm formation, indicating its importance as a protein for firm and stable biofilm formation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Antifungal Properties of Cationic Phenylene Ethynylenes and Their Impact on β-Glucan Exposure.

    Pappas, Harry C; Sylejmani, Rina; Graus, Matthew S; Donabedian, Patrick L; Whitten, David G; Neumann, Aaron K

    2016-08-01

    Candida species are the cause of many bloodstream infections through contamination of indwelling medical devices. These infections account for a 40% mortality rate, posing a significant risk to immunocompromised patients. Traditional treatments against Candida infections include amphotericin B and various azole treatments. Unfortunately, these treatments are associated with high toxicity, and resistant strains have become more prevalent. As a new frontier, light-activated phenylene ethynylenes have shown promising biocidal activity against Gram-positive and -negative bacterial pathogens, as well as the environmental yeast Saccharomyces cerevisiae In this study, we monitored the viability of Candida species after treatment with a cationic conjugated polymer [poly(p-phenylene ethynylene); PPE] or oligomer ["end-only" oligo(p-phenylene ethynylene); EO-OPE] by flow cytometry in order to explore the antifungal properties of these compounds. The oligomer was found to disrupt Candida albicans yeast membrane integrity independent of light activation, while PPE is able to do so only in the presence of light, allowing for some control as to the manner in which cytotoxic effects are induced. The contrast in killing efficacy between the two compounds is likely related to their size difference and their intrinsic abilities to penetrate the fungal cell wall. Unlike EO-OPE-DABCO (where DABCO is quaternized diazabicyclo[2,2,2]octane), PPE-DABCO displayed a strong propensity to associate with soluble β-glucan, which is expected to inhibit its ability to access and perturb the inner cell membrane of Candida yeast. Furthermore, treatment with PPE-DABCO unmasked Candida albicans β-glucan and increased phagocytosis by Dectin-1-expressing HEK-293 cells. In summary, cationic phenylene ethynylenes show promising biocidal activity against pathogenic Candida yeast cells while also exhibiting immunostimulatory effects. Copyright © 2016, American Society for Microbiology. All Rights

  10. Prospective Evaluation of Serum β-Glucan Testing in Patients With Probable or Proven Fungal Diseases

    Angebault, Cécile; Lanternier, Fanny; Dalle, Frédéric; Schrimpf, Cécile; Roupie, Anne-Laure; Dupuis, Aurélie; Agathine, Aurélie; Scemla, Anne; Paubelle, Etienne; Caillot, Denis; Neven, Bénédicte; Frange, Pierre; Suarez, Felipe; d'Enfert, Christophe; Lortholary, Olivier; Bougnoux, Marie-Elisabeth

    2016-01-01

    Background. Early diagnosis and treatment are crucial in invasive fungal diseases (IFD). Serum (1-3)-β-d-glucan (BG) is believed to be an early IFD marker, but its diagnostic performance has been ambiguous, with insufficient data regarding sensitivity at the time of IFD diagnosis (TOD) and according to outcome. Whether its clinical utility is equivalent for all types of IFD remains unknown. Methods. We included 143 patients with proven or probable IFD (49 invasive candidiasis, 45 invasive aspergillosis [IA], and 49 rare IFD) and analyzed serum BG (Fungitell) at TOD and during treatment. Results. (1-3)-β-d-glucan was undetectable at TOD in 36% and 48% of patients with candidemia and IA, respectively; there was no correlation between negative BG results at TOD and patients' characteristics, localization of infection, or prior antifungal use. Nevertheless, patients with candidemia due to Candida albicans were more likely to test positive for BG at TOD (odds ratio = 25.4, P = .01) than patients infected with other Candida species. In 70% of the patients with a follow-up, BG negativation occurred in >1 month for candidemia and >3 months for IA. A slower BG decrease in patients with candidemia was associated with deep-seated localizations (P = .04). Thirty-nine percent of patients with rare IFD had undetectable BG at TOD; nonetheless, all patients with chronic subcutaneous IFD tested positive at TOD. Conclusions. Undetectable serum BG does not rule out an early IFD, when the clinical suspicion is high. After IFD diagnostic, kinetics of serum BG are difficult to relate to clinical outcome. PMID:27419189

  11. Polymorphism of nickel sulfate hexahydrate

    Angel, R.J.; Finger, L.W.

    1988-01-01

    NiSO 4 .6H 2 O, M r =262.85; data collections with Mo Kα radiation, λ=0.7093 A, room temperature. Monoclinic polymorph: C2/c, a=9.880(3), b=7.228(2), c=24.130(3) A, β=98.38(2) 0 , V=1704.7(6) A 3 , Z=8, D x =2.05 g cm -3 , μ=25.54 cm -1 , F(000)=1088, R=0.031 (wR=0.038) for 2176 observed reflections. Tetragonal polymorph: P4 1 2 1 2, a=6.780 (1), c=18.285 (2) A, V=840.5 (3) A 3 , Z=4, D x =2.07 g cm -3 , μ=25.81 cm -1 , F(000)=544, R=0.045 (wR=0.050) for 2102 observed reflections. The structure of the tetragonal polymorph originally determined (without H positions) by Beevers and Lipson and refined by O'Connor and Dale and Stadnicka, Glazer and Koralewski, is confirmed by refinement of X-ray diffraction data. The structure of the monoclinic polymorph is confirmed as being isostructural with NiSO 4 .6D 2 O, and a number of other hexahydrate sulfates, e.g. MgSO 4 .6H 2 O. Both structures contain isolated [Ni(H 2 O 6 ] octahedra and [SO 4 ] tetrahedra linked by hydrogen bonding. (orig.)

  12. Sulfate reduction and methanogenesis at a freshwater

    Iversen, Vibeke Margrethe Nyvang; Andersen, Martin Søgaard; Jakobsen, Rasmus

    The freshwater-seawater interface was studied in a ~9-m thick anaerobic aquifer located in marine sand and gravel with thin peat lenses. Very limited amounts of iron-oxides are present. Consequently, the dominating redox processes are sulfate reduction and methanogenesis, and the groundwater...... is enriched in dissolved sulfide, methane and bicarbonate. Under normal conditions the seawater-freshwater interface is found at a depth of 4 m at the coastline and reaches the bottom of the aquifer 40 m inland. However, occasional flooding of the area occurs, introducing sulfate to the aquifer. Groundwater...... chemistry was studied in a 120 m transect perpendicular to the coast. Cores were taken for radiotracer rate measurements of sulfate reduction and methanogenesis. In the saline part of the aquifer 35 m inland, sulfate reduction was the dominant process with rates of 0.1-10 mM/year. In the freshwater part 100...

  13. Lymphocyte mobilization by dextran sulfate in beagles

    Ragan, H.A.; Debban, K.H.

    1978-01-01

    Dogs manifesting 239 Pu-induced lymphopenia responded to the lymphocyte-mobilizing agent, dextran sulfate, to a degree similar to that observed in control dogs. No life-threatening increase in prothrombin times or hemorrhagic tendencies were observed

  14. Sulfated cellulose thin films with antithrombin affinity

    2009-11-01

    Full Text Available Cellulose thin films were chemically modified by in situ sulfation to produce surfaces with anticoagulant characteristics. Two celluloses differing in their degree of polymerization (DP: CEL I (DP 215–240 and CEL II (DP 1300–1400 were tethered to maleic anhydride copolymer (MA layers and subsequently exposed to SO3•NMe3 solutions at elevated temperature. The impact of the resulting sulfation on the physicochemical properties of the cellulose films was investigated with respect to film thickness, atomic composition, wettability and roughness. The sulfation was optimized to gain a maximal surface concentration of sulfate groups. The scavenging of antithrombin (AT by the surfaces was determined to conclude on their potential anticoagulant properties.

  15. COMBINED ALUMINIUM SULFATE/HYDROXIDE PROCESS FOR ...

    sulfate, and used for fluoride removal from water by combining with Nalgonda Technique. ... effects on human health and could result in fluorosis. ... [23], nanoscale aluminium oxide hydroxide (AlOOH) [24] and natural zeolite [25], were among.

  16. ROE Wet Sulfate Deposition 2009-2011

    U.S. Environmental Protection Agency — The raster data represent the amount of wet sulfate deposition in kilograms per hectare from 2009 to 2011. Summary data in this indicator were provided by EPA’s...

  17. Feeding common carp Cyprinus carpio with β-glucan supplemented diet stimulates C-reactive protein and complement immune acute phase responses following PAMPs injection.

    Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J; Shrive, Annette K; Hoole, Dave

    2014-08-01

    The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight or with control food for 25 days and then injected with PBS containing either LPS (4 mg/kg) or poly(I:C) (5 mg/kg) or PBS alone. Fish were sampled during the 25 days of the feeding period and up to 7 days post-PAMPs injections for serum and liver, head kidney and mid-gut tissues. Oral administration of β-glucan for 25 days significantly increased serum CRP levels and alternative complement activity (ACP). In addition, the subsequent LPS and poly(I:C) challenges significantly affected CRP and complement related gene expression profiles (crp1, crp2, c1r/s, bf/c2, c3 and masp2), with the greatest effects observed in the β-glucan fed fish. However, in fish fed β-glucan the PAMPs injections had less effects on CRP levels and complement activity in the serum than in control fed fish, suggesting that the 25 days of β-glucan immunostimulation was sufficient enough to reduce the effects of LPS and poly(I:C) injections. Results suggest that MacroGard® stimulated CRP and complement responses to PAMPs immunological challenges in common carp thus highlighting the beneficial β-glucan immunostimulant properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

    Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

    2017-12-05

    Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  19. Study on preparation and effect of oligoβ-glucan and oligochitosan on immune stimulation white patches in the internal organs disease on Tra catfish (Pangasianodon hypophthalmus)

    Nguyen Ngoc Duy; Dang Van Phu; Nguyen Thi Kim Lan; Nguyen Quoc Hien; Pham Duy Hai

    2015-01-01

    Oligoβ-glucan and oligochitosan were prepared by gamma Co-60 irradiation of β-glucan/H_2O_2 and chitosan/H_2O_2 solution. The efficiency of the degradation process was determined by gel permeation chromatography (GPC) method. Results showed that the Mw decreased with increasing concentration of H_2O_2 and doses. For oligoβ-glucan, Mw reduced from 56.7 kDa to 7.1 kDa when β-glucan 10%/H_2O_2 1% solution was irradiated at 14 kGy. For oligochitosan, Mw reduced from 45.5 kDa to 5.0 kDa when chitosan 5%/H_2O_2 0.5% solution was irradiated at 21 kGy. Tra catfish (Pangasianodon hypophthalmus) was fed with oligoβ-glucan and oligochitosan in various concentrations of 0, 50, 100, and 200 mg/kg feed for 45 days and then was challenged with Edwardsiella ictaluri bacteria to investigate immune stimulation effect against white patches in the internal organs disease. The results indicated that oligoβ-glucan and oligochitosan exhibited good immune stimulation effect with optimum concentration of 100 mg/kg feed. Survival rate of Tra catfishes fed with oligochitosan and oligoβ-glucan is 47.62 ± 1.96% and 46.67 ± 2.58%, respectively. In addition, the mixture of oligochitosan 50 mg/kg + oligo?-glucan 50 mg/kg showed the highest survival rate (62.22 ± 1.96%). (author)

  20. Effect of metakaolin on external sulfate attack

    Ramlochan, T.; Thomas, M. [Toronto Univ., Dept. of Civil Engineering, ON (Canada)

    2000-07-01

    The effect of high reactivity metakaolin (HRM) on the sulfate resistance of mortars was studied. Mortar bars with three cements of varying C{sub 3}A content were used for the experiment. After a six month exposure to a 5 per cent solution of sodium sulfate, mortar bars incorporating any level of HRM as a partial replacement for a high-C{sub 3}A was considered 'moderately sulfate resistant'; mortar bars with HRM and a moderate or low C{sub 3}A content as 'high sulfate resistant'. It was also determined that for long term sulfate resistance 15 per cent HRM or more may be required, depending on the C{sub 3}A content. The performance of HRM was found to be significantly influenced by the water-cementitious material ratio, and in turn, by permeability, suggesting that HRM might increase sulfate resistance more by lowering the permeability of the concrete than by any chemical action. 7 refs., 4 tabs., 7 figs.

  1. Dietary calcium phosphate content and oat β-glucan influence gastrointestinal microbiota, butyrate-producing bacteria and butyrate fermentation in weaned pigs.

    Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G

    2011-03-01

    This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  2. In vivo evaluation of the antimutagenic and antigenotoxic effects of β-glucan extracted from Saccharomyces cerevisiae in acute treatment with multiple doses

    Rodrigo Juliano Oliveira

    2013-01-01

    Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.

  3. Oral beta-glucan adjuvant therapy converts nonprotective Th2 response to protective Th1 cell-mediated immune response in mammary tumor-bearing mice.

    Gordon D Ross

    2007-06-01

    Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.

  4. Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ).

    Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

    2016-12-17

    Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.

  5. Polymorphism of nickel sulfate hexahydrate

    Angel, R.J.; Finger, L.W.

    1988-11-15

    NiSO/sub 4/.6H/sub 2/O, M/sub r/=262.85; data collections with Mo K..cap alpha.. radiation, lambda=0.7093 A, room temperature. Monoclinic polymorph: C2/c, a=9.880(3), b=7.228(2), c=24.130(3) A, ..beta..=98.38(2)/sup 0/, V=1704.7(6) A/sup 3/, Z=8, D/sub x/=2.05 g cm/sup -3/, ..mu..=25.54 cm/sup -1/, F(000)=1088, R=0.031 (wR=0.038) for 2176 observed reflections. Tetragonal polymorph: P4/sub 1/2/sub 1/2, a=6.780 (1), c=18.285 (2) A, V=840.5 (3) A/sup 3/, Z=4, D/sub x/=2.07 g cm/sup -3/, ..mu..=25.81 cm/sup -1/, F(000)=544, R=0.045 (wR=0.050) for 2102 observed reflections. The structure of the tetragonal polymorph originally determined (without H positions) by Beevers and Lipson and refined by O'Connor and Dale and Stadnicka, Glazer and Koralewski, is confirmed by refinement of X-ray diffraction data. The structure of the monoclinic polymorph is confirmed as being isostructural with NiSO/sub 4/.6D/sub 2/O, and a number of other hexahydrate sulfates, e.g. MgSO/sub 4/.6H/sub 2/O. Both structures contain isolated (Ni(H/sub 2/O/sub 6/) octahedra and (SO/sub 4/) tetrahedra linked by hydrogen bonding.

  6. An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

    Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

    2017-06-15

    Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

  7. Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan.

    Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A

    2016-11-01

    At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Oxygen isotopic fractionation during bacterial sulfate reduction

    Balci, N.; Turchyn, A. V.; Lyons, T.; Bruchert, V.; Schrag, D. P.; Wall, J.

    2006-12-01

    Sulfur isotope fractionation during bacterial sulfate reduction (BSR) is understood to depend on a variety of environmental parameters, such as sulfate concentration, temperature, cell specific sulfate reduction rates, and the carbon substrate. What controls oxygen isotope fractionation during BSR is less well understood. Some studies have suggested that carbon substrate is important, whereas others concluded that there is a stoichiometric relationship between the fractionations of sulfur and oxygen during BSR. Studies of oxygen fractionation are complicated by isotopic equilibration between sulfur intermediates, particularly sulfite, and water. This process can modify the isotopic composition of the extracellular sulfate pool (δ18OSO4 ). Given this, the challenge is to distinguish between this isotopic equilibration and fractionations linked to the kinetic effects of the intercellular enzymes and the incorporation of sulfate into the bacterial cell. The δ18OSO4 , in concert with the sulfur isotope composition of sulfate (δ34SSO4), could be a powerful tool for understanding the pathways and environmental controls of BSR in natural systems. We will present δ18OSO4 data measured from batch culture growth of 14 different species of sulfate reducing bacteria for which sulfur isotope data were previously published. A general observation is that δ18OSO4 shows little isotopic change (kinetic effect during BSR and/or equilibration between sulfur intermediates and the isotopically light water (~-5‰) of the growth medium. Our present batch culture data do not allow us to convincingly isolate the magnitude and the controlling parameters of the kinetic isotope effect for oxygen. However, ongoing growth of mutant bacteria missing enzymes critical in the different steps of BSR may assist in this mission.

  9. Evaluation of the Efficiency of Different Disruption Methods on Yeast Cell Wall Preparation for β-Glucan Isolation

    Anna Bzducha-Wróbel

    2014-12-01

    Full Text Available Selected methods for yeast cell disruption were evaluated to establish their suitability for cell wall preparation in the process of β-glucan isolation. The effect of different disruption methods on contents of total saccharides, β-glucans and proteins in the produced cell walls preparations was analyzed. The degree of cell wall purification from intracellular components was established on the basis of the ratio of solubilised material. The investigated methods included: cell exposure to hot water (autoclaving, thermally-induced autolysis, homogenization in a bead mill, sonication and their combinations. Experimental systems were prepared in water (pH 5.0 and pH 7.0 and Tris-HCl buffer (pH 8.0. The Saccharomyces cerevisiae yeast cell wall preparations with the highest degree of cytosol component release and purification of β-glucans were produced by 30 min of cell homogenization with zirconium-glass beads (0.5 mm in diameter. This was confirmed by the highest ratio of solubilised material (approx. 64%–67%. The thus-produced preparations contained ca. 60% of total saccharides, 13%–14% of β(1,3/(1,6-glucans, and approx. 35% of crude proteins. Similar results were obtained after autolysis coupled with bead milling as well as with sonication, but the time required for these processes was more than 24 h. Homogenization in a bead mill could be valuable for general isolation procedures because allows one to eliminate the different autolytic activity of various yeast strains.

  10. Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

    Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

    2017-02-01

    Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.

    Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A

    2018-05-01

    Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.

  12. Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan

    Mekoue Nguela, Julie; Poncet-Legrand, Celine; Sieczkowski, N.; Vernhet, Aude

    2016-01-01

    At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored b...

  13. Rational Design of Adjuvant for Skin Delivery: Conjugation of Synthetic β-Glucan Dectin-1 Agonist to Protein Antigen.

    Donadei, Agnese; Gallorini, Simona; Berti, Francesco; O'Hagan, Derek T; Adamo, Roberto; Baudner, Barbara C

    2015-05-04

    The potential benefits of skin delivery of vaccines derive from the presence of a densely connected network of antigen presenting cells in the skin layer, most significantly represented by Langerhans cells and dermal dendritic cells. Targeting these cells by adjuvant conjugated to an antigen should result in enhanced immunogenicity of a vaccine. Since one of the most widely used adjuvants is an insoluble salt of aluminum (aluminum hydroxide) that cannot be used for skin delivery due to reactogenicity, we focused our attention on agonists of receptors present on skin dendritic cells, including the Dectin-1 receptor. β-(1-3)-glucans, which are the most abundant components of the fungal surface, are known to activate the innate immune response by interaction with the C-type lectin-like Dectin-1 receptor. In this work we identified by rational design a well-defined synthetic β-(1-3)-glucan hexasaccharide as a Dectin-1 agonist and chemically conjugated it to the genetically detoxified diphtheria toxin (CRM197) protein antigen, as a means to increase the binding to Dectin-1 receptor and to target to skin dendritic cells. We demonstrated that the in vitro activation of the receptor was significantly impacted by the presentation of the glucan on the protein carrier. In vivo results in mice showed that the conjugation of the synthetic β-(1-3)-glucan when delivered intradermally resulted in higher antibody titers in comparison to intramuscular (i.m.) immunization and was not different from subcutaneous (s.c.) delivery. These findings suggest that weak receptor binders can be turned into more potent agonists by the multivalent presentation of many ligands covalently conjugated to the protein core. Moreover, this approach is particularly valuable to increase the immunogenicity of antigens administered via skin delivery.

  14. Glucan, Water Dikinase Activity Stimulates Breakdown of Starch Granules by Plastidial β-Amylases1[W][OA

    Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard

    2007-01-01

    Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522

  15. Comparative Analysis of ?-Oryzanol, ?-Glucan, Total Phenolic Content and Antioxidant Activity in Fermented Rice Bran of Different Varieties

    Jung, Tae-Dong; Shin, Gi-Hae; Kim, Jae-Min; Choi, Sun-Il; Lee, Jin-Ha; Lee, Sang Jong; Park, Seon Ju; Woo, Koan Sik; Oh, Sea Kwan; Lee, Ok-Hawn

    2017-01-01

    Rice bran, a by-product derived from processing rice, is a rich source of bioactive compounds. Recent studies have suggested that the fermentation can improve their biological activities. This study aimed to determined the level of γ-oryzanol, β-glucan and total phenol contents of fermented rice bran from 21 Korean varieties, as well as to evaluate their antioxidant activities. We also assessed the validation of the analytical method for determining γ-oryzanol content in fermented rice brans....

  16. Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

    Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

    2012-04-13

    Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

  17. Sulfation of corrosive alkali chlorides by ammonium sulfate in a biomass fired CFB boiler

    Brostroem, Markus; Backman, Rainer; Nordin, Anders [Energy Technology and Thermal Process Chemistry, Umeaa University, SE-901 87 Umeaa (Sweden); Kassman, Haakan [Vattenfall Power Consultant AB, Box 1046, SE-611 29 Nykoeping (Sweden); Helgesson, Anna; Berg, Magnus; Andersson, Christer [Vattenfall Research and Development AB, SE-814 26 Aelvkarleby (Sweden)

    2007-12-15

    Biomass and waste derived fuels contain relatively high amounts of alkali and chlorine, but contain very little sulfur. Combustion of such fuels can result in increased deposit formation and superheater corrosion. These problems can be reduced by using a sulfur containing additive, such as ammonium sulfate, which reacts with the alkali chlorides and forms less corrosive sulfates. Ammonium sulfate injection together with a so-called in situ alkali chloride monitor (IACM) is patented and known as ''ChlorOut''. IACM measures the concentrations of alkali chlorides (mainly KCl in biomass combustion) at superheater temperatures. Tests with and without spraying ammonium sulfate into the flue gases have been performed in a 96MW{sub th}/25MW{sub e} circulating fluidized bed (CFB) boiler. The boiler was fired mainly with bark and a chlorine containing waste. KCl concentration was reduced from more than 15 ppm to approximately 2 ppm during injection of ammonium sulfate. Corrosion probe measurements indicated that both deposit formation and material loss due to corrosion were decreased using the additive. Analysis of the deposits showed significantly higher concentration of sulfur and almost no chlorine in the case with ammonium sulfate. Results from impactor measurements supported that KCl was sulfated to potassium sulfate by the additive. (author)

  18. 21 CFR 524.1484e - Neomycin sulfate and polymyxin B sulfate ophthalmic solution.

    2010-04-01

    ... ophthalmic solution. 524.1484e Section 524.1484e Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.1484e Neomycin sulfate and polymyxin B sulfate ophthalmic solution. (a...

  19. β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake

    Asli Akyol

    2014-09-01

    Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

  20. Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

    Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

    2017-07-18

    Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

  1. Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus.

    de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello

    2017-12-20

    A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5  Da with a random coil conformation for molecular weights below 1 × 10 6  Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.

  2. Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet

    Jie Zheng

    2013-12-01

    Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.

  3. Effect of supplementation of Manno-Oligosaccharide and b-glucans on maize based meal on commercial broilers

    R.C.Shendare

    2008-01-01

    Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15

  4. β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.

    Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju

    2014-09-23

    The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

  5. Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.

    Alwis, K U; Mandryk, J; Hocking, A D

    1999-09-01

    Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.

  6. Modeling of sulfation of potassium chloride by ferric sulfate addition during grate-firing of biomass

    Wu, Hao; Jespersen, Jacob Boll; Aho, Martti

    2013-01-01

    Potassium chloride, KCl, formed from critical ash-forming elements released during combustion may lead to severe ash deposition and corrosion problems in biomass-fired boilers. Ferric sulfate, Fe2(SO4)3 is an effective additive, which produces sulfur oxides (SO2 and SO3) to convert KCl to the less...... harmful K2SO4. In the present study the decomposition of ferric sulfate is studied in a fast-heating rate thermogravimetric analyzer (TGA), and a kinetic model is proposed to describe the decomposition process. The yields of SO2 and SO3 from ferric sulfate decomposition are investigated in a laboratory......-scale tube reactor. It is revealed that approximately 40% of the sulfur is released as SO3, the remaining fraction being released as SO2. The proposed decomposition model of ferric sulfate is combined with a detailed gas phase kinetic model of KCl sulfation, and a simplified model of K2SO4 condensation...

  7. The electrical and thermal properties of sodium sulfate mixed with lithium sulfate, yttrium sulfate, and silicon dioxide

    Imanaka, N.; Yamaguchi, Y.; Adachi, G.; Shiokawa, J.

    1986-01-01

    Sodium sulfate mixed with lithium sulfate, yttrium sulfate, and silicon dioxide was prepared. The thermal and electrical properties of its phases were investigated. The Na 2 SO 4 -Li 2 SO 4 -Y 2 (SO 4 ) 3 SiO 2 samples are similar to the Na 2 SO 4 -I phase (a high temperature phase), which is appreciably effective for Na + ionic conduction. Phase transformation was considerably suppressed by mixing. Electromotive force (EMF) was measured, using Na 2 SO 4 -Li 2 SO 4 -Y 2 (SO 4 ) 3 -SiO 2 as a solid electrolyte, by constructing an SO 2 gas concentration cell. The measured EMF's at 823 and 773 K were in fairly good accordance with the calculated EMF's for inlet SO 2 gas concentration between 30 ppm and 1%, and 500 ppm and 0.5% respectively

  8. Heparan sulfate-chondroitin sulfate hybrid proteoglycan of the cell surface and basement membrane of mouse mammary epithelial cells

    David, G.; Van den Berghe, H.

    1985-01-01

    Chondroitin sulfate represents approximately 15% of the 35 SO 4 -labeled glycosaminoglycans carried by the proteoglycans of the cell surface and of the basolateral secretions of normal mouse mammary epithelial cells in culture. Evidence is provided that these chondroitin sulfate-carrying proteoglycans are hybrid proteoglycans, carrying both chondroitin sulfate and heparan sulfate chains. Complete N-desulfation but limited O-desulfation, by treatment with dimethyl sulfoxide, of the proteoglycans decreased the anionic charge of the chondroitin sulfate-carrying proteoglycans to a greater extent than it decreased the charge of their constituent chondroitin sulfate chains. Partial depolymerization of the heparan sulfate residues of the proteoglycans with nitrous acid or with heparin lyase also reduced the effective molecular radius of the chondroitin sulfate-carrying proteoglycans. The effect of heparin lyase on the chondroitin sulfate-carrying proteoglycans was prevented by treating the proteoglycan fractions with dimethyl sulfoxide, while the effect of nitrous acid on the dimethyl sulfoxide-treated proteoglycans was prevented by acetylation. This occurrence of heparan sulfate-chondroitin sulfate hybrid proteoglycans suggests that the substitution of core proteins by heparan sulfate or chondroitin sulfate chains may not solely be determined by the specific routing of these proteins through distinct chondroitin sulfate and heparan sulfate synthesizing mechanisms. Moreover, regional and temporal changes in pericellular glycosaminoglycan compositions might be due to variable postsynthetic modification of a single gene product

  9. Co-existence of Methanogenesis and Sulfate Reduction with Common Substrates in Sulfate-Rich Estuarine Sediments

    Michal Sela-Adler

    2017-05-01

    Full Text Available The competition between sulfate reducing bacteria and methanogens over common substrates has been proposed as a critical control for methane production. In this study, we examined the co-existence of methanogenesis and sulfate reduction with shared substrates over a large range of sulfate concentrations and rates of sulfate reduction in estuarine systems, where these processes are the key terminal sink for organic carbon. Incubation experiments were carried out with sediment samples from the sulfate-methane transition zone of the Yarqon (Israel estuary with different substrates and inhibitors along a sulfate concentrations gradient from 1 to 10 mM. The results show that methanogenesis and sulfate reduction can co-exist while the microbes share substrates over the tested range of sulfate concentrations and at sulfate reduction rates up to 680 μmol L-1 day-1. Rates of methanogenesis were two orders of magnitude lower than rates of sulfate reduction in incubations with acetate and lactate, suggesting a higher affinity of sulfate reducing bacteria for the available substrates. The co-existence of both processes was also confirmed by the isotopic signatures of δ34S in the residual sulfate and that of δ13C of methane and dissolved inorganic carbon. Copy numbers of dsrA and mcrA genes supported the dominance of sulfate reduction over methanogenesis, while showing also the ability of methanogens to grow under high sulfate concentration and in the presence of active sulfate reduction.

  10. Sulfation in lead-acid batteries

    Catherino, Henry A.; Feres, Fred F.; Trinidad, Francisco

    Virtually, all military land vehicle systems use a lead-acid battery to initiate an engine start. The maintainability of these batteries and as a consequence, system readiness, has suffered from a lack of understanding of the reasons for battery failure. Often, the term most commonly heard for explaining the performance degradation of lead-acid batteries is the word, sulfation. Sulfation is a residual term that came into existence during the early days of lead-acid battery development. The usage is part of the legend that persists as a means for interpreting and justifying the eventual performance deterioration and failure of lead-acid batteries. The usage of this term is confined to the greater user community and, over time, has encouraged a myriad of remedies for solving sulfation problems. One can avoid the connotations associated with the all-inclusive word, sulfation by visualizing the general "sulfation" effect in terms of specific mechanistic models. Also, the mechanistic models are essential for properly understanding the operation and making proper use this battery system. It is evident that the better the model, the better the level of understanding.

  11. Immunohistochemical localization of chondroitin sulfate, chondroitin sulfate proteoglycan, heparan sulfate proteoglycan, entactin, and laminin in basement membranes of postnatal developing and adult rat lungs

    Sannes, P L; Burch, K K; Khosla, J

    1993-01-01

    Histologic preparations of lungs from 1-, 5-, 10-, 18-, and 25-day-old postnatal and adult rats were examined immunohistochemically with antibodies specific against chondroitin sulfate (CS), basement membrane chondroitin sulfate proteoglycan (BM-CSPG), heparan sulfate proteoglycan (HSPG), entactin...

  12. p-Cresyl sulfate and indoxyl sulfate in pediatric patients on chronic dialysis

    Hye Sun Hyun

    2013-04-01

    Full Text Available &lt;b&gt;Purpose:&lt;/b&gt; Indoxyl sulfate and p- cresyl sulfate are important protein-bound uremic retention solutes whose levels can be partially reduced by renal replacement therapy. These solutes originate from intestinal bacterial protein fermentation and are associated with cardiovascular outcomes and chronic kidney disease progression. The aims of this study were to investigate the levels of indoxyl sulfate and p- cresyl sulfate as well as the effect of probiotics on reducing the levels of uremic toxins in pediatric patients on dialysis. &lt;b&gt;Methods:&lt;/b&gt; We enrolled 20 pediatric patients undergoing chronic dialysis; 16 patients completed the study. The patients underwent a 12-week regimen of VSL#3, a high-concentration probiotic preparation, and the serum levels of indoxyl sulfate and p- cresyl sulfate were measured before treatment and at 4, 8, and 12 weeks after the regimen by using fluorescence liquid chromatography. To assess the normal range of indoxyl sulfate and p- cresyl sulfate we enrolled the 16 children with normal glomerular filtration rate who had visited an outpatient clinic for asymptomatic microscopic hematuria that had been detected by a school screening in August 2011. &lt;b&gt;Results:&lt;/b&gt; The baseline serum levels of indoxyl sulfate and p- cresyl sulfate in the patients on chronic dialysis were significantly higher than those in the children with microscopic hematuria. The baseline serum levels of p- cresyl sulfate in the peritoneal dialysis group were significantly higher than those in the hemodialysis group. There were no significant changes in the levels of these uremic solutes after 12-week VSL#3 treatment in the patients on chronic dialysis. &lt;b&gt;Conclusion:&lt;/b&gt; The levels of the uremic toxins p- cresyl sulfate and indoxyl sulfate are highly elevated in pediatric patients on dialysis, but there was no significant effect by

  13. Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

    Boulos, Samy; Nyström, Laura

    2017-11-01

    The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO

  14. Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

    Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

    2018-04-03

    Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which

  15. Immune Enhancing Activity of β-(1,3)-Glucan Isolated from Genus Agrobacterium in Bone-Marrow Derived Macrophages and Mice Splenocytes.

    Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun

    2016-01-01

    An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.

  16. Enhancement of the immunity and body weight gain in broiler by feeding with the brewer yeast β-glucan degraded by gamma Co-60 radiation

    Le Quang Luan; Nguyen Thanh Long

    2015-01-01

    The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)

  17. Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

    Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

    2014-01-01

    Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Sulfated glycopeptide nanostructures for multipotent protein activation

    Lee, Sungsoo S.; Fyrner, Timmy; Chen, Feng; Álvarez, Zaida; Sleep, Eduard; Chun, Danielle S.; Weiner, Joseph A.; Cook, Ralph W.; Freshman, Ryan D.; Schallmo, Michael S.; Katchko, Karina M.; Schneider, Andrew D.; Smith, Justin T.; Yun, Chawon; Singh, Gurmit; Hashmi, Sohaib Z.; McClendon, Mark T.; Yu, Zhilin; Stock, Stuart R.; Hsu, Wellington K.; Hsu, Erin L.; Stupp , Samuel I. (NWU)

    2017-06-19

    Biological systems have evolved to utilize numerous proteins with capacity to bind polysaccharides for the purpose of optimizing their function. A well-known subset of these proteins with binding domains for the highly diverse sulfated polysaccharides are important growth factors involved in biological development and tissue repair. We report here on supramolecular sulfated glycopeptide nanostructures, which display a trisulfated monosaccharide on their surfaces and bind five critical proteins with different polysaccharide-binding domains. Binding does not disrupt the filamentous shape of the nanostructures or their internal β-sheet backbone, but must involve accessible adaptive configurations to interact with such different proteins. The glycopeptide nanostructures amplified signalling of bone morphogenetic protein 2 significantly more than the natural sulfated polysaccharide heparin, and promoted regeneration of bone in the spine with a protein dose that is 100-fold lower than that required in the animal model. These highly bioactive nanostructures may enable many therapies in the future involving proteins.

  19. Formation of the natural sulfate aerosol

    Kerminen, V.M.; Hillamo, R.; Maekinen, M.; Virkkula, A.; Maekelae, T.; Pakkanen, T. [Helsinki Univ. (Finland). Dept. of Physics

    1996-12-31

    Anthropogenic sulfate aerosol, together with particles from biomass burning, may significantly reduce the climatic warming due to man-made greenhouse gases. The radiative forcing of aerosol particles is based on their ability to scatter and absorb solar radiation (direct effect), and on their influences on cloud albedos and lifetimes (indirect effect). The direct aerosol effect depends strongly on the size, number and chemical composition of particles, being greatest for particles of 0.1-1 {mu}m in diameter. The indirect aerosol effect is dictated by the number of particles being able to act as cloud condensation nuclei (CCN). For sulfate particles, the minimum CCN size in tropospheric clouds is of the order of 0.05-0.2 {mu}m. To improve aerosol parameterizations in future climate models, it is required that (1) both primary and secondary sources of various particle types will be characterized at a greater accuracy, and (2) the influences of various atmospheric processes on the spatial and temporal distribution of these particles and their physico-chemical properties are known much better than at the present. In estimating the climatic forcing due to the sulfate particles, one of the major problems is to distinguish between sulfur from anthropogenic sources and that of natural origin. Global emissions of biogenic and anthropogenic sulfate pre-cursors are comparable in magnitude, but over regional scales either of these two source types may dominate. The current presentation is devoted to discussing the natural sulfate aerosol, including the formation of sulfur-derived particles in the marine environment, and the use of particulate methanesulfonic acid (MSA) as a tracer for the natural sulfate

  20. Formation of the natural sulfate aerosol

    Kerminen, V M; Hillamo, R; Maekinen, M; Virkkula, A; Maekelae, T; Pakkanen, T [Helsinki Univ. (Finland). Dept. of Physics

    1997-12-31

    Anthropogenic sulfate aerosol, together with particles from biomass burning, may significantly reduce the climatic warming due to man-made greenhouse gases. The radiative forcing of aerosol particles is based on their ability to scatter and absorb solar radiation (direct effect), and on their influences on cloud albedos and lifetimes (indirect effect). The direct aerosol effect depends strongly on the size, number and chemical composition of particles, being greatest for particles of 0.1-1 {mu}m in diameter. The indirect aerosol effect is dictated by the number of particles being able to act as cloud condensation nuclei (CCN). For sulfate particles, the minimum CCN size in tropospheric clouds is of the order of 0.05-0.2 {mu}m. To improve aerosol parameterizations in future climate models, it is required that (1) both primary and secondary sources of various particle types will be characterized at a greater accuracy, and (2) the influences of various atmospheric processes on the spatial and temporal distribution of these particles and their physico-chemical properties are known much better than at the present. In estimating the climatic forcing due to the sulfate particles, one of the major problems is to distinguish between sulfur from anthropogenic sources and that of natural origin. Global emissions of biogenic and anthropogenic sulfate pre-cursors are comparable in magnitude, but over regional scales either of these two source types may dominate. The current presentation is devoted to discussing the natural sulfate aerosol, including the formation of sulfur-derived particles in the marine environment, and the use of particulate methanesulfonic acid (MSA) as a tracer for the natural sulfate

  1. Inhibition of sulfate reduction in paddy soils

    Vamos, R

    1958-12-13

    The hydrogen sulfide formed in waterlogged soils is a serious problem in rice cultivation. It inhibits the uptake of water and nutrients and may even cause root-rot. Results can best be obtained by preventing the formation of hydrogen sulfide. It is formed mainly by reduction of sulfate for which the cellulose-butyric acid fermentation provides the hydrogen source. Addition of ammonium or potassium nitrate prevents the formation of H/sub 2/S. The hydrogen produced by butyric acid fermentation is used to reduce nitrate and consequently cannot be utilized by the sulfate-reducing bacteria as a source of energy. 6 references.

  2. Measurement of chemical leaching potential of sulfate from landfill disposed sulfate containing wastes.

    Sun, Wenjie; Barlaz, Morton A

    2015-02-01

    A number of sulfate-containing wastes are disposed in municipal solid wastes (MSW) landfills including residues from coal, wood, and MSW combustion, and construction and demolition (C&D) waste. Under anaerobic conditions that dominate landfills, the sulfate can be reduced to hydrogen sulfide which is problematic for several reasons including its low odor threshold, toxicity, and corrosive nature. The overall objective of this study was to evaluate existing protocols for the quantification of total leachable sulfate from solid samples and to compare their effectiveness and efficiency with a new protocol described in this study. Methods compared include two existing acid extraction protocols commonly used in the U.S., a pH neutral protocol that requires multiple changes of the leaching solution, and a new acid extraction method. The new acid extraction method was shown to be simple and effective to measure the leaching potential of sulfate from a range of landfill disposed sulfate-containing wastes. However, the acid extraction methods do not distinguish between sulfate and other forms of sulfur and are thus most useful when sulfate is the only form of sulfur present. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.

    Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung

    2016-04-01

    The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®

  4. A Proinflammatory Effect of the β-Glucan from Pleurotus cornucopiae Mushroom on Macrophage Action

    Ken-ichiro Minato

    2017-01-01

    Full Text Available PCPS from P. citrinopileatus mushroom extract is a β-1,6-glucan possessing a proinflammatory effect on innate immune cells. The PCPS stimulated THP-1 macrophages to secrete significant levels of TNF. Moreover, the mRNA expressions of TNF and IL-1β were significantly enhanced by PCPS treatment. However, the PCPS did not induce to express both IL-12 and IL-10 mRNA in the macrophages. Next, the P. cornucopiae extract (containing mainly PCPS treatment against mice showed significant increases in TNF and IL-1β mRNA expressions in the peritoneal macrophages of them. In this study, the expression levels of IFNγ mRNA in the spleen were almost the same between the extract- (PCPS- treated group and control group. However, the expression of IL-4 mRNA showed a lower level in the extract-treated group than that in the control. Our results suggested that the PCPS could induce proinflammatory action in the immune response. In addition, the proinflammatory effect of the PCPS on THP-1 was enhanced by 5′-GMP-Na, while it was reduced by vitamin D2. These two compounds are majorly contained in the P. citrinopileatus mushroom. Therefore, these results suggested that the P. citrinopileatus mushroom might contain other immune regulative compounds, such as vitamin D2, as well as PCPS.

  5. Incorporation of β-glucans in meat emulsions through an optimal mixture modeling systems.

    Vasquez Mejia, Sandra M; de Francisco, Alicia; Manique Barreto, Pedro L; Damian, César; Zibetti, Andre Wüst; Mahecha, Hector Suárez; Bohrer, Benjamin M

    2018-05-22

    The effects of β-glucans (βG) in beef emulsions with carrageenan and starch were evaluated using an optimal mixture modeling system. The best mathematical models to describe the cooking loss, color, and textural profile analysis (TPA) were selected and optimized. The cubic models were better to describe the cooking loss, color, and TPA parameters, with the exception of springiness. Emulsions with greater levels of βG and starch had less cooking loss (54 and <62), and greater hardness, cohesiveness and springiness values. Subsequently, during the optimization phase, the use of carrageenan was eliminated. The optimized emulsion contained 3.13 ± 0.11% βG, which could cover the intake daily of βG recommendations. However, the hardness of the optimized emulsion was greater (60,224 ± 1025 N) than expected. The optimized emulsion had a homogeneous structure and normal thermal behavior by DSC and allowed for the manufacture of products with high amounts of βG and desired functional attributes. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Development of cosmetic formulations containing glucan polymer of Cassava (Manihot esculenta: stability and sensory analysis

    Luisa M. Manço

    2014-12-01

    Full Text Available The aim of this study was the development, rheological behaviour determination, and sensory analysis of cosmetic formulations containing glucan biopolymer (Manihot esculenta, a tensor agent that was proposed to produce an immediate lifting and smoothing effect. For this purpose, formulations were developed and supplemented or not with 4 % of hydrolysed Manihot esculenta tuber extract and submitted to preliminary stability tests. These formulations were evaluated in terms of rheological behaviour over 90 days. Sensory analysis was carried out through a research with 20 cosmetic consumers who answered a questionnaire regarding their perception to the cosmetic qualities. The formulations presented pseudoplastic behavior and were considered stable in the physical stability studies, with the exception of the gel formulation based on Ammonium Acryloyldimethyltaurate/VP Copolymer. The formulations were well evaluated in the sensory parameters. The gel formulations based on Polyacrylamide, C13- 14 Isoparaffin, and Laureth-7 were stable and presented the best sensory profile in some evaluated parameters, such as spreadability, smoothness and skin moisturizing, and can be considered an appropriate vehicle for formulations containing hydrolysed Manihot esculenta tuber extract.

  7. Fungal beta glucan protects radiation induced DNA damage in human lymphocytes.

    Pillai, Thulasi G; Maurya, Dharmendra K; Salvi, Veena P; Janardhanan, Krishnankutty K; Nair, Cherupally K K

    2014-02-01

    Ganoderma lucidum (Ling Zhi), a basidiomycete white rot macrofungus has been used extensively for therapeutic use in China, Japan, Korea and other Asian countries for 2,000 years. The present study is an attempt to investigate its DNA protecting property in human lymphocytes. Beta glucan (BG) was isolated by standard procedure and the structure and composition were studied by infrared radiation (IR) and nuclear magnetic resonance (NMR) spectroscopy, gel filtration chromatography and paper chromatography. The radioprotective properties of BG isolated from the macro fungi Ganoderma lucidum was assessed by single cell gel electrophoresis (comet assay). Human lymphocytes were exposed to 0, 1, 2 and 4 Gy gamma radiation in the presence and absence of BG. The comet parameters were reduced by BG. The results indicate that the BG of G. lucidum possessed significant radioprotective activity with DNA repairing ability and antioxidant activity as the suggestive mechanism. The findings suggest the potential use of this mushroom for the prevention of radiation induced cellular damages.

  8. Adhesion of glucosyltransferase phase variants to Streptococcus gordonii bacterium-glucan substrata may involve lipoteichoic acid.

    Vickerman, M M; Jones, G W

    1992-10-01

    Growing Streptococcus gordonii Spp+ phase variants, which have normal levels of glucosyltransferase (GTF) activity, use sucrose to promote their accumulation on surfaces by forming a cohesive bacterium-insoluble glucan polymer mass (BPM). Spp- phase variants, which have lower levels of GTF activity, do not form BPMs and do not remain in BPMs formed by Spp+ cells when grown in mixed cultures. To test the hypothesis that segregation of attached Spp+ and unattached Spp- cells was due to differences in adhesiveness, adhesion between washed, [3H]thymidine-labeled cells and preformed BPM substrata was measured. Unexpectedly, the results showed that cells of both phenotypes, as well as GTF-negative cells, attached equally well to preformed BPMs, indicating that attachment to BPMs was independent of cell surface GTF activity. Initial characterization of this binding interaction suggested that a protease-sensitive component on the washed cells may be binding to lipoteichoic acids sequestered in the BPM, since exogenous lipoteichoic acid inhibited adhesion. Surprisingly, the adhesion of both Spp+ and Spp- cells was markedly inhibited in the presence of sucrose, which also released lipoteichoic acid from the BPM. These in vitro findings suggest that, in vivo, sucrose and lipoteichoic acid may modify dental plaque development by enhancing or inhibiting the attachment of additional bacteria.

  9. Sulfates on Mars: A systematic Raman spectroscopic study of hydration states of magnesium sulfates

    Wang, A.; Freeman, J.J.; Jolliff, B.L.; Chou, I.-Ming

    2006-01-01

    The martian orbital and landed surface missions, OMEGA on Mar Express and the two Mars Explorations Rovers, respectively, have yielded evidence pointing to the presence of magnesium sulfates on the martian surface. In situ identification of the hydration states of magnesium sulfates, as well as the hydration states of other Ca- and Fe- sulfates, will be crucial in future landed missions on Mars in order to advance our knowledge of the hydrologic history of Mars as well as the potential for hosting life on Mars. Raman spectroscopy is a technique well-suited for landed missions on the martian surface. In this paper, we report a systematic study of the Raman spectra of the hydrates of magnesium sulfate. Characteristic and distinct Raman spectral patterns were observed for each of the 11 distinct hydrates of magnesium sulfates, crystalline and non-crystalline. The unique Raman spectral features along with the general tendency of the shift of the position of the sulfate ??1 band towards higher wavenumbers with a decrease in the degree of hydration allow in situ identification of these hydrated magnesium sulfates from the raw Raman spectra of mixtures. Using these Raman spectral features, we have started the study of the stability field of hydrated magnesium sulfates and the pathways of their transformations at various temperature and relative humidity conditions. In particular we report on the Raman spectrum of an amorphous hydrate of magnesium sulfate (MgSO4??2H2O) that may have specific relevance for the martian surface. ?? 2006 Elsevier Inc. All rights reserved.

  10. Novel processes for anaerobic sulfate production from elemental sulfur by sulfate-reducing bacteria

    Lovley, D.R.; Phillips, E.J.P.

    1994-01-01

    Sulfate reducers and related organisms which had previously been found to reduce Fe(III) with H2 or organic electron donors oxidized S0 to sulfate when Mn(IV) was provided as an electron acceptor. Organisms catalyzing this reaction in washed cell suspensions included Desulfovibrio desulfuricans, Desulfomicrobium baculatum. Desulfobacterium autotrophicum, Desulfuromonas acetoxidans, and Geobacter metallireducens. These organisms produced little or no sulfate from S0 with Fe(III) as a potential electron acceptor or in the absence of an electron acceptor. In detailed studies with Desulfovibrio desulfuricans, the stoichiometry of sulfate and Mn(II) production was consistent with the reaction S0 + 3 MnO2 + 4H+ ???SO42- + 3Mn(II) + 2H2O. None of the organisms evaluated could be grown with S0 as the sole electron donor and Mn(IV) as the electron acceptor. In contrast to the other sulfate reducers evaluated, Desulfobulbus propionicus produced sulfate from S0 in the absence of an electron acceptor and Fe(III) oxide stimulated sulfate production. Sulfide also accumulated in the absence of Mn(IV) or Fe(III). The stoichiometry of sulfate and sulfide production indicated that Desulfobulbus propionicus disproportionates S0 as follows: 4S0 + 4H2O???SO42- + 3HS- + 5 H+. Growth of Desulfobulbus propionicus with S0 as the electron donor and Fe(III) as a sulfide sink and/or electron acceptor was very slow. The S0 oxidation coupled to Mn(IV) reduction described here provides a potential explanation for the Mn(IV)-dependent sulfate production that previous studies have observed in anoxic marine sediments. Desulfobulbus propionicus is the first example of a pure culture known to disproportionate S0.

  11. Activation and transfer of sulfate in biological systems (1960); Activation biologique du sulfate et son transfert (1960)

    Chapeville, F [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

    1960-07-01

    It examines in this review the successive stages of active sulfate formation and its role in biological synthesis of sulfuric esters. The possible role of active sulfate as intermediary in sulfate reduction is also discussed. (author) [French] On examine dans cette etude les stades successifs de la mise en evidence du sulfate actif, son role dans la formation des esters sulfuriques de natures diverses, ainsi que sa participation eventuelle comme intermediaire au cours de la reduction du sulfate. On decrit aussi un procede de preparation du systeme biologique, generateur du sulfate actif et une methode de synthese chimique. (auteur)

  12. Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia: Preliminary Findings from the Study on Three Patients from India

    Vidyasagar Devaprasad Dedeepiya

    2012-01-01

    Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.

  13. β-Glucan induces reactive oxygen species production in human neutrophils to improve the killing of Candida albicans and Candida glabrata isolates from vulvovaginal candidiasis.

    Patricia de Souza Bonfim-Mendonça

    Full Text Available Vulvovaginal candidiasis (VVC is among the most prevalent vaginal diseases. Candida albicans is still the most prevalent species associated with this pathology, however, the prevalence of other Candida species, such as C. glabrata, is increasing. The pathogenesis of these infections has been intensely studied, nevertheless, no consensus has been reached on the pathogenicity of VVC. In addition, inappropriate treatment or the presence of resistant strains can lead to RVVC (vulvovaginal candidiasis recurrent. Immunomodulation therapy studies have become increasingly promising, including with the β-glucans. Thus, in the present study, we evaluated microbicidal activity, phagocytosis, intracellular oxidant species production, oxygen consumption, myeloperoxidase (MPO activity, and the release of tumor necrosis factor α (TNF-α, interleukin-8 (IL-8, IL-1β, and IL-1Ra in neutrophils previously treated or not with β-glucan. In all of the assays, human neutrophils were challenged with C. albicans and C. glabrata isolated from vulvovaginal candidiasis. β-glucan significantly increased oxidant species production, suggesting that β-glucan may be an efficient immunomodulator that triggers an increase in the microbicidal response of neutrophils for both of the species isolated from vulvovaginal candidiasis. The effects of β-glucan appeared to be mainly related to the activation of reactive oxygen species and modulation of cytokine release.

  14. (1-3)(1-6)-β-glucan-enriched materials from Lentinus edodes mushroom as a high-fibre and low-calorie flour substitute for baked foods.

    Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong

    2011-08-15

    Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.

  15. Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss).

    Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick

    2017-04-01

    Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Lactose in diet influences the degradation of mixed linked β(1-3;1-4)-D-glucan in the small intestine of pigs

    Knudsen, Knud Erik Bach

    The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...

  17. Extraction and chemical characterization of rye arabinoxylan and the effect of β-glucan on the mechanical and barrier properties of cast arabinoxylan films

    Sárossy, Zsuzsa; Tenkanen, Maija; Pitkänen, Leena

    2013-01-01

    .9 and 1.0 cm3 mm/m2 d kPa). However, the water vapor permeability increased with addition of increasing amounts of BG to WE-AX. To our knowledge, this is the first study on the effect of β-glucans on the material and permeability properties of arabinoxylan-based films. © 2012 Elsevier Ltd. All rights......Water-extractable hemicellulose (WEH) fractions, containing approximately 65% arabinoxylans (WE-AX) and 20% mixed-linkage b-glucans were isolated from rye bran. In addition, water-extractable mixedlinkage β-glucans (BG) were isolated from oat bran as a reference material. The β-glucan content....../mol. The material properties of films prepared from the rye hemicellulose isolate and WE-AX as such, or with varying amounts of added BG (20:80; 50:50; 80:20 ratios) were studied. Prior removal of β-glucan from the isolate decreased the tensile strength of the films significantly as well as the elongation at break...

  18. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS ...

    Four strains of eri, Samia cynthia ricini Lepidoptera: Saturniidae that can be identified morphologically and maintained at North East Institute of Science and Technology, Jorhat were characterized based on their protein profile by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and DNA by random ...

  19. Determination of boron spectrophotometry in thorium sulfate

    Federgrun, L.; Abrao, A.

    1976-01-01

    A procedure for the determination of microquantities of boron in nuclear grade thorium sulfate is described. The method is based on the extraction of BF - 4 ion associated to monomethylthionine (MMT) in 1,2 - dichloroethane. The extraction of the colored BF - 4 -MMT complex does not allow the presence of sulfuric and phosphoric acids; other anions interfere seriously. This fact makes the dissolution of the thorium sulfate impracticable, since it is insoluble in both acids. On the other hand, the quantitative separation of thorium is mandatory, to avoid the precipitation of ThF 4 . To overcome this difficulty, the thorium sulfate is dissolved using a strong cationic ion exchanger, Th 4+ being totally retained into the resin. Boron is then analysed in the effluent. The procedure allows the determination of 0.2 to 10.0 microgramas of B, with a maximum error of 10%. Thorium sulfate samples with contents of 0.2 to 2.0μg B/gTh have being analysed [pt

  20. Sulfate reducing potential in an estuarine beach

    LokaBharathi, P.A.; Chandramohan, D.

    Sulfate reducing bacteria (SRB) and their activity (SRA) together with total anaerobic and aerobic bacterial flora were estimated during July 1982-April 1983 and July-August 1984 from 1, 3 and 5 cm depths using core samples. The average number (no...

  1. Sulfate-reducing bacteria in anaerobic bioreactors

    Oude Elferink, S.J.W.H.

    1998-01-01

    The treatment of industrial wastewaters containing high amounts of easily degradable organic compounds in anaerobic bioreactors is a well-established process. Similarly, wastewaters which in addition to organic compounds also contain sulfate can be treated in this way. For a long time, the

  2. Mechanisms and Effectivity of Sulfate Reducing Bioreactors ...

    Mining-influenced water (MIW) is the main environmental challenges associated with the mining industry. Passive MIW remediation can be achieved through microbial activity in sulfate-reducing bioreactors (SRBRs), but their actual removal rates depend on different factors, one of which is the substrate composition. Chitinous materials have demonstrated high metal removal rates, particularly for the two recalcitrant MIW contaminants Zn and Mn, but their removal mechanisms need further study. We studied Cd, Fe, Zn, and Mn removal in bioactive and abiotic SRBRs to elucidate the metal removal mechanisms and the differences in metal and sulfate removal rates using a chitinous material as substrate. We found that sulfate-reducing bacteria are effective in increasing metal and sulfate removal rates and duration of operation in SRBRs, and that the main mechanism involved was metal precipitation as sulfides. The solid residues provided evidence of the presence of sulfides in the bioactive column, more specifically ZnS, according to XPS analysis. The feasibility of passive treatments with a chitinous substrate could be an important option for MIW remediation. Mining influenced water (MIW) remediation is still one of the top priorities for the agency because it addresses the most important environmental problem associated with the mining industry and that affects thousands of communities in the U.S. and worldwide. In this paper, the MIW bioremediation mechanisms are studied

  3. Controlling sulfate attack in Mississippi Department of Transportation structures.

    2010-08-01

    At some construction sites in Mississippi, deterioration of concrete in contact with the surrounding soil could be related to the high sulfate content of the adjacent soils. Studies dating to 1966 have documented sulfate attack associated with specif...

  4. Transmission spectra study of sulfate substituted potassium dihydrogen phosphate

    LI, LIANG; Zhang, Jianqin; Sun, Xun; Zhang, Qiang; Zhao, Xian; Zhang, Xixiang

    2013-01-01

    Potassium dihydrogen phosphate (KDP) crystals with different amounts of sulfate concentration were grown and the transmittance spectrum was studied. A crystal with high sulfate replacement density exhibits heavy absorption property

  5. Controlling sulfate attack in Mississippi Department of Transportation structures

    2010-08-01

    At some construction sites in Mississippi, deterioration of concrete in contact with the surrounding soil could be related to the high sulfate content of the adjacent soils. Studies dating to 1966 have documented sulfate attack associated with sp...

  6. Bone sialoprotein II synthesized by cultured osteoblasts contains tyrosine sulfate

    Ecarot-Charrier, B.; Bouchard, F.; Delloye, C.

    1989-01-01

    Isolated mouse osteoblasts that retain their osteogenic activity in culture were incubated with [35S] sulfate. Two radiolabeled proteins, in addition to proteoglycans, were extracted from the calcified matrix of osteoblast cultures. All the sulfate label in both proteins was in the form of tyrosine sulfate as assessed by amino acid analysis and thin layer chromatography following alkaline hydrolysis. The elution behavior on DEAE-Sephacel of the major sulfated protein and the apparent Mr on sodium dodecyl sulfate gels were characteristic of bone sialoprotein II extracted from rat. This protein was shown to cross-react with an antiserum raised against bovine bone sialoprotein II, indicating that bone sialoprotein II synthesized by cultured mouse osteoblasts is a tyrosine-sulfated protein. The minor sulfated protein was tentatively identified as bone sialoprotein I or osteopontin based on its elution properties on DEAE-Sephacel and anomalous behavior on sodium dodecyl sulfate gels similar to those reported for rat bone sialoprotein I

  7. Galactose 6-sulfate sulfatase activity in Morquio syndrome

    Yutaka, T.; Okada, S.; Kato, T.; Inui, K.; Yabuuhi, H.

    1982-01-01

    The authors have prepared a new substrate, o-β-D-sulfo-galactosyl-(1-4)-β-D-6-sulfo-2-acetamido-2-deoxyglucosyl-(1-4)-D-[1- 3 H]galactitol, from shark cartilage keratan sulfate, for the assay of galactose 6-sulfate sulfatase activity. Using this substrate, they found there was a striking deficiency of galactose 6-sulfate sulfatase activity, in addition to the known deficiency of N-acetylgalactosamine 6-sulfate sulfatase, in the cultured skin fibroblasts of patients with Morquio syndrome. Their results could be explained by the hypothesis that accumulation of keratan sulfate and chondroitin 6-sulfate in Morquio syndrome is due to a deficiency of galactose 6-sulfate sulfatase and N-acetylgalactosamine 6-sulfate sulfatase activity, which are necessary for the degradation of these two mucopolysaccharides. (Auth.)

  8. Galactose 6-sulfate sulfatase activity in Morquio syndrome

    Yutaka, T.; Okada, S.; Kato, T.; Inui, K.; Yabuuhi, H. (Osaka Univ. (Japan). Faculty of Medicine)

    1982-07-01

    The authors have prepared a new substrate, o-..beta..-D-sulfo-galactosyl-(1-4)-..beta..-D-6-sulfo-2-acetamido-2-deoxyglucosyl-(1-4)-D-(1-/sup 3/H)galactitol, from shark cartilage keratan sulfate, for the assay of galactose 6-sulfate sulfatase activity. Using this substrate, they found there was a striking deficiency of galactose 6-sulfate sulfatase activity, in addition to the known deficiency of N-acetylgalactosamine 6-sulfate sulfatase, in the cultured skin fibroblasts of patients with Morquio syndrome. Their results could be explained by the hypothesis that accumulation of keratan sulfate and chondroitin 6-sulfate in Morquio syndrome is due to a deficiency of galactose 6-sulfate sulfatase and N-acetylgalactosamine 6-sulfate sulfatase activity, which are necessary for the degradation of these two mucopolysaccharides.

  9. Isolation of a sulfate reducing bacterium and its application in sulfate ...

    The results show that the effect of C. freundii in removing sulfate was best when the temperature was 32°C, pH was 7.0, COD/SO42- was 5.0 and the initial SO42- concentration was 1500 mg/L. Also, the SRB was inoculated onto an up-flow anaerobic sludge bed (UASB) to remove sulfate in actual tannery wastewater.

  10. Infection Structure–Specific Expression of β-1,3-Glucan Synthase Is Essential for Pathogenicity of Colletotrichum graminicola and Evasion of β-Glucan–Triggered Immunity in Maize[W

    Oliveira-Garcia, Ely; Deising, Holger B.

    2013-01-01

    β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035

  11. Comparison of magnesium sulfate and sodium sulfate for removal of water from pesticide extracts of foods.

    Schenck, Frank J; Callery, Patrick; Gannett, Peter M; Daft, Jonathan R; Lehotay, Steven J

    2002-01-01

    Water-miscible solvents, such as acetone and acetonitrile, effectively extract both polar and nonpolar pesticide residues from nonfatty foods. The addition of sodium chloride to the resulting acetonitrile-water or acetone-water extract (salting out) results in the separation of the water from the organic solvent. However, the organic solvent layer (pesticide extract) still contains some residual water, which can adversely affect separation procedures that follow, such as solid-phase extraction and/or gas chromatography. Drying agents, such as sodium sulfate or magnesium sulfate, are used to remove the water from the organic extracts. In the present study, we used nuclear magnetic resonance spectroscopy to study the composition of the phases resulting from salting out and to compare the effectiveness of sodium sulfate and magnesium sulfate as drying agents. The study showed that considerable amounts of water remained in the organic phase after phase separation. Sodium sulfate was a relatively ineffective drying agent, removing little or no residual water from the organic solvent. Magnesium sulfate proved to be a much more effective drying agent.

  12. Identification of UDPG-binding polypeptides and purified (1,3)-β-glucan synthase by photoaffinity labelling with 5-azido-UDPG

    Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.

    1989-01-01

    The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex

  13. Near infrared spectra indicate specific mutant endosperm genes and reveal a new mechanism for substituting starch with (1-->3,1-->4)-[beta]-glucan in barley

    Munck, L.; Møller, B.; Jacobsen, Susanne

    2004-01-01

    -->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....

  14. Acid Sulfate Alteration in Gusev Crater, Mars

    Morris, R. V.; Ming, D. W.; Catalano, J. G.

    2016-01-01

    The Mars Exploration Rover (MER) Spirit landed on the Gusev Crater plains west of the Columbia Hills in January, 2004, during the Martian summer (sol 0; sol = 1 Martian day = 24 hr 40 min). Spirit explored the Columbia Hills of Gusev Crater in the vicinity of Home Plate at the onset on its second winter (sol approximately 900) until the onset of its fourth winter (sol approximately 2170). At that time, Spirit became mired in a deposit of fined-grained and sulfate-rich soil with dust-covered solar panels and unfavorable pointing of the solar arrays toward the sun. Spirit has not communicated with the Earth since sol 2210 (January, 2011). Like its twin rover Opportunity, which landed on the opposite side of Mars at Meridiani Planum, Spirit has an Alpha Particle X-Ray Spectrometer (APXS) instrument for chemical analyses and a Moessbauer spectrometer (MB) for measurement of iron redox state, mineralogical speciation, and quantitative distribution among oxidation (Fe(3+)/sigma Fe) and coordination (octahedral versus tetrahedral) states and mineralogical speciation (e.g., olivine, pyroxene, ilmenite, carbonate, and sulfate). The concentration of SO3 in Gusev rocks and soils varies from approximately 1 to approximately 34 wt%. Because the APXS instrument does not detect low atomic number elements (e.g., H and C), major-element oxide concentrations are normalized to sum to 100 wt%, i.e., contributions of H2O, CO2, NO2, etc. to the bulk composition care not considered. The majority of Gusev samples have approximately 6 plus or minus 5 wt% SO3, but there is a group of samples with high SO3 concentrations (approximately 30 wt%) and high total iron concentrations (approximately 20 wt%). There is also a group with low total Fe and SO3 concentrations that is also characterized by high SiO2 concentrations (greater than 70 wt%). The trend labeled "Basaltic Soil" is interpreted as mixtures in variable proportions between unaltered igneous material and oxidized and SO3-rich basaltic

  15. Immunohematopoietic modulation by oral β-1,3-glucan in mice infected with Listeria monocytogenes.

    Torello, Cristiane O; de Souza Queiroz, Julia; Oliveira, Sueli C; Queiroz, Mary L S

    2010-12-01

    In this study we demonstrated that the oral administration of β-1,3-glucan (Imunoglucan®) protects mice from a lethal dose of Listeria monocytogenes (LM) when administered prophylactically for 10 days at the doses of 150 and 300 mg/kg, with survival rates up to 40%. These doses also prevented the myelosuppression and the splenomegaly caused by a sublethal infection with LM, due to increased numbers of granulocyte-macrophage progenitors (CFU-GM) in the bone marrow. Investigation of the production of colony-stimulating factors revealed an increased colony-stimulating activity (CSA) in the serum of infected mice pre-treated with Imunoglucan®. The treatment also restored the reduced ability of stromal cells to display myeloid progenitors in long-term bone marrow cultures (LTBMC) and up-regulated IL-6 and IL-1α production by these cells in the infected mice, which was consistent with higher number of non-adherent cells. Additional studies to investigate the levels of interferon-gamma (INF-γ) in the supernatant of splenocyte cultures demonstrated a further increase in the level of this cytokine in infected-treated mice, compared to infected controls. In all cases, no differences were observed between the responses of the two optimal biologically effective doses. In contrast, no significant changes were produced by the treatment with the 50mg/kg dose. In addition, no changes were observed in normal mice treated with the three doses used. All together our results suggest that orally given Imunoglucan® indirectly modulates immune activity and probably disengages Listeria induced suppression of these responses by inducing a higher reserve of myeloid progenitors in the bone marrow in consequence of biologically active cytokine release (CSFs, IL-1α, IL-6, and INF-γ). Copyright © 2010 Elsevier B.V. All rights reserved.

  16. Changes in the composition of intestinal fungi and their role in mice with dextran sulfate sodium-induced colitis.

    Qiu, Xinyun; Zhang, Feng; Yang, Xi; Wu, Na; Jiang, Weiwei; Li, Xia; Li, Xiaoxue; Liu, Yulan

    2015-05-27

    Intestinal fungi are increasingly believed to greatly influence gut health. However, the effects of fungi on intestinal inflammation and on gut bacterial constitution are not clear. Here, based on pyrosequencing method, we reveal that fungal compositions vary in different intestinal segments (ileum, cecum, and colon), prefer different colonization locations (mucosa and feces), and are remarkably changed during intestinal inflammation in dextran sulfate sodium (DSS)-colitis mouse models compare to normal controls: Penicillium, Wickerhamomyces, Alternaria, and Candida are increased while Cryptococcus, Phialemonium, Wallemia and an unidentified Saccharomycetales genus are decreased in the guts of DSS-colitis mice. Fungi-depleted mice exhibited aggravated acute DSS-colitis associated with gain of Hallella, Barnesiella, Bacteroides, Alistipes, and Lactobacillus and loss of butyrate-producing Clostridium XIVa, and Anaerostipes compare with normal control. In contrast, bacteria-depleted mice show attenuated acute DSS-colitis. Mice with severely chronic recurrent DSS-colitis show increased plasma (1,3)-β-D-glucan level and fungal translocation into the colonic mucosa, mesenteric lymph nodes and spleen. This work demonstrate the different roles of fungi in acute and chronic recurrent colitis: They are important counterbalance to bacteria in maintaining intestinal micro-ecological homeostasis and health in acutely inflamed intestines, but can harmfully translocate into abnormal sites and could aggravate disease severity in chronic recurrent colitis.

  17. Modulation of intestinal inflammation by yeasts and cell wall extracts: strain dependence and unexpected anti-inflammatory role of glucan fractions.

    Samir Jawhara

    Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the

  18. Optimization and scale-up of fermentation of glucansucrase and branched glucan by Pediococcus pentosaceus CRAG3 using Taguchi methodology in bioreactor

    RISHIKESH SHUKLA

    2012-01-01

    Full Text Available The present investigation focuses on screening and optimization of media components to enhance glucansucrase and glucan production by Pediococcus pentosaceus CRAG3 at shake-flask and bioreactor level using Taguchi orthogonal array design. A three-level Taguchi orthogonal array layout of L27 (33 was employed, in which six variables were studied for their influence on glucansucrase and glucan production. The results showed that sucrose, K2HPO4 and Tween-80 were the most significant factors to improve glucansucrase production while the glucan production was mostly affected by sucrose, peptone and K2HPO4. The optimized medium composition for maximum glucansucrase and glucan production were: sucrose 3.5% and 5%; yeast extract 0.2% and 2.0%; beef extract 0.5% and 0.5%; peptone 3.0% and 1.0%; K2HPO4 0.2% and 0.2%, and Tween-80 1.0 and 0.1%, respectively. The optimized medium gave 10.1 U/ml and 10.2 U/ml glucansucrase activity while glucan concentrations were 56 mg/ml and 80 mg/ml in shake flask and bioreactor level, respectively which were in good agreement with predicted values (10.1 U/ml and 54.5 mg/ml. The optimized medium gave 2 fold enhancement in enzyme activity and 4 fold increase in glucan concentration as compared to non-optimized medium (4.5 U/ml and 15 mg/ml, respectively at shake flask level.

  19. Children’s residential exposure to selected allergens and microbial indicators: endotoxins and (1→3-β-D-glucans

    Anna Kozajda

    2013-12-01

    Full Text Available Objectives: The study was aimed at assessment of exposure to endotoxins, (1→3-β-D-glucans and mite, cockroach, cat, dog allergens present in settled dust in premises of children as agents which may be significantly correlated with the occurrence of allergic symptoms and diseases in children. Materials and Methods: The study covered 50 homes of one- or two-year-old children in Poland. Samples of settled dust were taken from the floor and the child's bed. The levels of (1→3-β-D-glucans (floor, endotoxins (floor and allergens of mite, cat, dog and cockroach (floor and bed were analyzed. Results: Average geometric concentrations (geometric standard deviation of endotoxins, (1→3-β-D-glucans, Der p1, Fel d1, Can f1 and Bla g1 in children homes were on the floor 42 166.0 EU/g (3.2, 20 478.4 ng/g (2.38, 93.9 ng/g (6.58, 119.8 ng/g (13.0, 288.9 ng/g (3.4, 0.72 U/g (4.4 and in their beds (only allergens 597.8 ng/g (14.2, 54.1 ng/g (4.4, 158.6 ng/g (3.1 0.6 U/g (2.9, respectively. When the floor was covered with the carpet, higher concentrations of endotoxins, (1→3-β-D-glucans and allergens (each type were found in the settled dust (p < 0.05. The trend was opposite in case of allergens (except dog analyzed from bed dust and significantly higher concentrations were found in the rooms with smooth floor (p < 0.05. Conclusions: Among the analyzed factors only the type of floor significantly modified both the level of biological indicators and allergens. The results of this study could be the base for verifying a hypothesis that carpeting may have a protective role against high levels of cockroach, dog and cat allergens.

  20. Thermoresponsive .beta.-glucan-based polymers for bimodal immunoradiotherapy - Are they able to promote the immune system?

    Loukotová, Lenka; Kučka, Jan; Rabyk, Mariia; Höcherl, Anita; Venclíková, Kristýna; Janoušková, Olga; Páral, P.; Kolářová, V.; Heizer, T.; Šefc, L.; Štěpánek, Petr; Hrubý, Martin

    2017-01-01

    Roč. 268, 28 December (2017), s. 78-91 ISSN 0168-3659 R&D Projects: GA ČR(CZ) GA16-02870S; GA ČR(CZ) GA16-03156S; GA MZd(CZ) NV15-25781A; GA MŠk(CZ) 7AMB16FR042 Institutional support: RVO:61389013 Keywords : beta-glucan * polyoxazoline * multimodal cancer therapy Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 7.786, year: 2016

  1. Constraining Δ33S signatures of Archean seawater sulfate with carbonate-associated sulfate

    Peng, Y.; Bao, H.; Bekker, A.; Hofmann, A.

    2017-12-01

    Non-mass dependent sulfur isotope deviation of S-bearing phases in Archean sedimentary strata, and expressed as Δ33S, has a consistent pattern, i.e., sulfide (pyrite) predominantly bear positive Δ33S values, while Paleoarchean sulfate (barite) has negative Δ33S values. This pattern was later corroborated by observations of negative Δ33S values in Archean volcanogenic massive sulfide deposits and negative Δ33S values in early diagenetic nodular pyrite with a wide range of δ34S values, which is thought to be due to microbial sulfate reduction. These signatures have provided a set of initial conditions for a mechanistic interpretation at physical chemistry level. Unlike the younger geological times when large bodies of seawater evaporite deposits are common, to expand seawater sulfate records, carbonate-associated sulfate (CAS) was utilized as a proxy for ancient seawater sulfate. CAS extracted from the Archean carbonates carries positive Δ33S values. However, CAS could be derived from pyrite oxidation following exposure to modern oxidizing conditions and/or during laboratory extraction procedures. It is, therefore, important for us understanding context of the overall early earth atmospheric condition to empirically confirm whether Archean seawater sulfate was generally characterized by negative Δ33S signatures. Combined δ18O, Δ17O, δ34S, and Δ33S analyses of sequentially extracted water-leachable sulfate (WLS) and acid-leachable sulfate (ALS = CAS) and δ34S and Δ33S analyses of pyrite can help to identify the source of extracted sulfate. We studied drill-core samples of Archean carbonates from the 2.55 Ga Malmani and Campell Rand supgroups, South Africa. Our preliminary results show that 1) neither WLS nor ALS were extracted from samples with extremely low pyrite contents (less than 0.05 wt.%); 2) extractable WLS and ALS is present in samples with relatively high pyrite contents (more than 1 wt.%), and that δ34S and Δ33S values of WLS, ALS, and

  2. High rates of sulfate reduction in a low-sulfate hot spring microbial mat are driven by a low level of diversity of sulfate-respiring microorganisms

    Dillon, Jesse G; Fishbain, Susan; Miller, Scott R

    2007-01-01

    The importance of sulfate respiration in the microbial mat found in the low-sulfate thermal outflow of Mushroom Spring in Yellowstone National Park was evaluated using a combination of molecular, microelectrode, and radiotracer studies. Despite very low sulfate concentrations, this mat community...... was shown to sustain a highly active sulfur cycle. The highest rates of sulfate respiration were measured close to the surface of the mat late in the day when photosynthetic oxygen production ceased and were associated with a Thermodesulfovibrio-like population. Reduced activity at greater depths...... was correlated with novel populations of sulfate-reducing microorganisms, unrelated to characterized species, and most likely due to both sulfate and carbon limitation....

  3. In vitro incorporation of 14C-hexose-6-phosphat in mannan, β-glucan and glycogen of Candida spec. H and their mutants

    Roeber, B.; Reuter, G.

    1982-01-01

    Mannose-6-P is an activator of 14 C-mannose incorporation from GDP- 14 C-mannose in mono- and oligosaccharides and in mannopolymers of the cell wall proteophosphomannan produced by the food protein yeast Candida spec. H. Moreover, mannose-6-P is a precursor of proteophosphomannan: 14 C-mannose-6-P has been incorporated in absence of GTP. Corresponding behavior shows glucose-6-P by synthesis of β-glucan and glycogen. Mutants of Candida spec. H with different efficiency in the biosynthesis of mannan, β-glucan and glycogen incorporate hexose-6-P in a different extent. (author)

  4. Effects of sulfate chitosan derivatives on nonalcoholic fatty liver disease

    Yu, Mingming; Wang, Yuanhong; Jiang, Tingfu; Lv, Zhihua

    2014-06-01

    Sulfate chitosan derivatives have good solubility and therapeutic effect on the cell model of NAFLD. The aim of this study was to examine the therapeutic effect of sulfate chitosan derivatives on NAFLD. The male Wistar rats were orally fed high fat emulsion and received sulfate chitosan derivatives for 5 weeks to determine the pre-treatment effect of sulfate chitosan derivatives on NAFLD. To evaluate the therapeutic effect of sulfate chitosan derivatives on NAFLD, the rats were orally fed with high concentration emulsion for 5 weeks, followed by sulfate chitosan derivatives for 3 weeks. Histological analysis and biomedical assays showed that sulfate chitosan derivatives can dramatically prevent the development of hepatic steatosis in hepatocyte cells. In animal studies, pre-treatment and treatment with sulfate chitosan derivatives significantly protected against hepatic steatohepatitis induced by high fat diet according to histological analysis. Furthermore, increased TC, ALT, MDA, and LEP in NAFLD were significantly ameliorated by pre-treatment and treatment with sulfate chitosan derivatives. Furthermore, increased TG, AST, and TNF-α in NAFLD were significantly ameliorated by treatment with sulfate chitosan derivatives. Sulfate chitosan derivatives have good pre-treatment and therapeutic effect on NAFLD.

  5. Chinese hamster ovary cell mutants defective in heparan sulfate biosynthesis

    Bame, K.J.; Kiser, C.S.; Esko, J.D.

    1987-01-01

    The authors have isolated Chinese hamster ovary cell mutants defective in proteoglycan synthesis by radiographic screening for cells unable to incorporate 35 SO 4 into acid-precipitable material. Some mutants did not incorporate 35 SO 4 into acid-precipitable material, whereas others incorporated about 3-fold less radioactivity. HPLC anion exchange chromatographic analysis of radiolabelled glycosaminoglycans isolated from these mutants revealed many are defective in heparan sulfate biosynthesis. Mutants 803 and 677 do not synthesize heparan sulfate, although they produce chondroitin sulfate: strain 803 makes chondroitin sulfate normally, whereas 677 overaccumulates chondroitin sulfate by a factor of three. These mutants fall into the same complementation group, suggesting that the mutations are allelic. A second group of heparan sulfate biosynthetic mutants, consisting of cell lines 625, 668 and 679, produce undersulfated heparan sulfate and normal chondroitin sulfate. Treatment of the chains with nitrous acid should determine the position of the sulfate groups along the chain. These mutants may define a complementation group that is defective in the enzymes which modify the heparan sulfate chain. To increase the authors repertoire of heparan sulfate mutants, they are presently developing an in situ enzyme assay to screen colonies replica plated on filter discs for sulfotransferase defects

  6. Thermophilic Sulfate-Reducing Bacteria in Cold Marine Sediment

    ISAKSEN, MF; BAK, F.; JØRGENSEN, BB

    1994-01-01

    sulfate-reducing bacteria was detected. Time course experiments showed constant sulfate reduction rates at 4 degrees C and 30 degrees C, whereas the activity at 60 degrees C increased exponentially after a lag period of one day. Thermophilic, endospore-forming sulfate-reducing bacteria, designated strain...... C to search for presence of psychrophilic, mesophilic and thermophilic sulfate-reducing bacteria. Detectable activity was initially only in the mesophilic range, but after a lag phase sulfate reduction by thermophilic sulfate-reducing bacteria were observed. No distinct activity of psychrophilic...... P60, were isolated and characterized as Desulfotomaculum kuznetsovii. The temperature response of growth and respiration of strain P60 agreed well with the measured sulfate reduction at 50 degrees-70 degrees C. Bacteria similar to strain P60 could thus be responsible for the measured thermophilic...

  7. DEPENDENCY OF SULFATE SOLUBILITY ON MELT COMPOSITION AND MELT POLYMERIZATION

    JANTZEN, CAROL M.

    2004-01-01

    Sulfate and sulfate salts are not very soluble in borosilicate waste glass. When sulfate is present in excess it can form water soluble secondary phases and/or a molten salt layer (gall) on the melt pool surface which is purported to cause steam explosions in slurry fed melters. Therefore, sulfate can impact glass durability while formation of a molten salt layer on the melt pool can impact processing. Sulfate solubility has been shown to be compositionally dependent in various studies, (e.g. , B2O3, Li2O, CaO, MgO, Na2O, and Fe2O3 were shown to increase sulfate solubility while Al2O3 and SiO2 decreased sulfate solubility). This compositional dependency is shown to be related to the calculated melt viscosity at various temperatures and hence the melt polymerization

  8. Chondroitin-4-sulfation negatively regulates axonal guidance and growth

    Wang, Hang; Katagiri, Yasuhiro; McCann, Thomas E.; Unsworth, Edward; Goldsmith, Paul; Yu, Zu-Xi; Tan, Fei; Santiago, Lizzie; Mills, Edward M.; Wang, Yu; Symes, Aviva J.; Geller, Herbert M.

    2008-01-01

    Summary Glycosaminoglycan (GAG) side chains endow extracellular matrix proteoglycans with diversity and complexity based upon the length, composition, and charge distribution of the polysaccharide chain. Using cultured primary neurons, we show that specific sulfation in the GAG chains of chondroitin sulfate (CS) mediates neuronal guidance cues and axonal growth inhibition. Chondroitin-4-sulfate (CS-A), but not chondroitin-6-sulfate (CS-C), exhibits a strong negative guidance cue to mouse cerebellar granule neurons. Enzymatic and gene-based manipulations of 4-sulfation in the GAG side chains alter their ability to direct growing axons. Furthermore, 4-sulfated CS GAG chains are rapidly and significantly increased in regions that do not support axonal regeneration proximal to spinal cord lesions in mice. Thus, our findings provide the evidence showing that specific sulfation along the carbohydrate backbone carries instructions to regulate neuronal function. PMID:18768934

  9. Thermophilic Sulfate-Reducing Bacteria in Cold Marine Sediment

    ISAKSEN, MF; BAK, F.; JØRGENSEN, BB

    1994-01-01

    C to search for presence of psychrophilic, mesophilic and thermophilic sulfate-reducing bacteria. Detectable activity was initially only in the mesophilic range, but after a lag phase sulfate reduction by thermophilic sulfate-reducing bacteria were observed. No distinct activity of psychrophilic...... sulfate-reducing bacteria was detected. Time course experiments showed constant sulfate reduction rates at 4 degrees C and 30 degrees C, whereas the activity at 60 degrees C increased exponentially after a lag period of one day. Thermophilic, endospore-forming sulfate-reducing bacteria, designated strain...... P60, were isolated and characterized as Desulfotomaculum kuznetsovii. The temperature response of growth and respiration of strain P60 agreed well with the measured sulfate reduction at 50 degrees-70 degrees C. Bacteria similar to strain P60 could thus be responsible for the measured thermophilic...

  10. Sulfate and acid resistant concrete and mortar

    Liskowitz, John W.; Wecharatana, Methi; Jaturapitakkul, Chai; Cerkanowicz, deceased, Anthony E.

    1998-01-01

    The present invention relates to concrete, mortar and other hardenable mixtures comprising cement and fly ash for use in construction and other applications, which hardenable mixtures demonstrate significant levels of acid and sulfate resistance while maintaining acceptable compressive strength properties. The acid and sulfate hardenable mixtures of the invention containing fly ash comprise cementitious materials and a fine aggregate. The cementitous materials may comprise fly ash as well as cement. The fine aggregate may comprise fly ash as well as sand. The total amount of fly ash in the hardenable mixture ranges from about 60% to about 120% of the total amount of cement, by weight, whether the fly ash is included as a cementious material, fine aggregate, or an additive, or any combination of the foregoing. In specific examples, mortar containing 50% fly ash and 50% cement in cementitious materials demonstrated superior properties of corrosion resistance.

  11. Biosynthesis and function of chondroitin sulfate.

    Mikami, Tadahisa; Kitagawa, Hiroshi

    2013-10-01

    Chondroitin sulfate proteoglycans (CSPGs) are principal pericellular and extracellular components that form regulatory milieu involving numerous biological and pathophysiological phenomena. Diverse functions of CSPGs can be mainly attributed to structural variability of their polysaccharide moieties, chondroitin sulfate glycosaminoglycans (CS-GAG). Comprehensive understanding of the regulatory mechanisms for CS biosynthesis and its catabolic processes is required in order to understand those functions. Here, we focus on recent advances in the study of enzymatic regulatory pathways for CS biosynthesis including successive modification/degradation, distinct CS functions, and disease phenotypes that have been revealed by perturbation of the respective enzymes in vitro and in vivo. Fine-tuned machineries for CS production/degradation are crucial for the functional expression of CS chains in developmental and pathophysiological processes. Control of enzymes responsible for CS biosynthesis/catabolism is a potential target for therapeutic intervention for the CS-associated disorders. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Regional transport model of atmospheric sulfates

    Rao, K.S.; Thomson, I.; Egan, B.A.

    1977-01-01

    As part of the Sulfate Regional Experiment (SURE) Design Project, a regional transport model of atmospheric sulfates has been developed. This quasi-Lagrangian three-dimensional grid numerical model uses a detailed SO 2 emission inventory of major anthropogenic sources in the Eastern U.S. region, and observed meteorological data during an episode as inputs. The model accounts for advective transport and turbulent diffusion of the pollutants. The chemical transformation of SO 2 and SO 4 /sup =/ and the deposition of the species at the earth's surface are assumed to be linear processes at specified constant rates. The numerical model can predict the daily average concentrations of SO 2 and SO 4 /sup =/ at all receptor locations in the grid region during the episode. Because of the spatial resolution of the grid, this model is particularly suited to investigate the effect of tall stacks in reducing the ambient concentration levels of sulfur pollutants. This paper presents the formulations and assumptions of the regional sulfate transport model. The model inputs and results are discussed. Isopleths of predicted SO 2 and SO 4 /sup =/ concentrations are compared with the observed ground level values. The bulk of the information in this paper is directed to air pollution meteorologists and environmental engineers interested in the atmospheric transport modeling studies of sulfur oxide pollutants

  13. Sulfation and cation effects on the conformational properties of the glycan backbone of chondroitin sulfate disaccharides.

    Faller, Christina E; Guvench, Olgun

    2015-05-21

    Chondroitin sulfate (CS) is one of several glycosaminoglycans that are major components of proteoglycans. A linear polymer consisting of repeats of the disaccharide -4GlcAβ1-3GalNAcβ1-, CS undergoes differential sulfation resulting in five unique sulfation patterns. Because of the dimer repeat, the CS glycosidic "backbone" has two distinct sets of conformational degrees of freedom defined by pairs of dihedral angles: (ϕ1, ψ1) about the β1-3 glycosidic linkage and (ϕ2, ψ2) about the β1-4 glycosidic linkage. Differential sulfation and the possibility of cation binding, combined with the conformational flexibility and biological diversity of CS, complicate experimental efforts to understand CS three-dimensional structures at atomic resolution. Therefore, all-atom explicit-solvent molecular dynamics simulations with Adaptive Biasing Force sampling of the CS backbone were applied to obtain high-resolution, high-precision free energies of CS disaccharides as a function of all possible backbone geometries. All 10 disaccharides (β1-3 vs β1-4 linkage × five different sulfation patterns) were studied; additionally, ion effects were investigated by considering each disaccharide in the presence of either neutralizing sodium or calcium cations. GlcAβ1-3GalNAc disaccharides have a single, broad, thermodynamically important free-energy minimum, whereas GalNAcβ1-4GlcA disaccharides have two such minima. Calcium cations but not sodium cations bind to the disaccharides, and binding is primarily to the GlcA -COO(-) moiety as opposed to sulfate groups. This binding alters the glycan backbone thermodynamics in instances where a calcium cation bound to -COO(-) can act to bridge and stabilize an interaction with an adjacent sulfate group, whereas, in the absence of this cation, the proximity of a sulfate group to -COO(-) results in two like charges being both desolvated and placed adjacent to each other and is found to be destabilizing. In addition to providing information

  14. Purification and sequence characterization of chondroitin sulfate and dermatan sulfate from fishes.

    Lin, Na; Mo, Xiaoli; Yang, Yang; Zhang, Hong

    2017-04-01

    Chondroitin sulfate (CS) and dermatan sulfate (DS) were extracted and purified from skins or bones of salmon (Salmo salar), snakehead (Channa argus), monkfish (Lophius litulon) and skipjack tuna (Katsuwonus pelamis). Size, structural sequences and sulfate groups of oligosaccharides in the purified CS and DS could be characterized and identified using high performance liquid chromatography (HPLC) combined with Orbitrap mass spectrometry. CS and DS chain structure varies depending on origin, but motif structure appears consistent. Structures of CS and DS oligosaccharides with different size and sulfate groups were compared between fishes and other animals, and results showed that some minor differences of special structures could be identified by hydrophilic interaction chromatography-liquid chromatography-fourier transform-mass/mass spectrometry (HILIC-LC-FT-MS/MS). For example, data showed that salmon and skipjack CS had a higher percentage content of high-level sulfated oligosaccharides than that porcine CS. In addition, structural information of different origins of CS and DS was analyzed by principal component analysis (PCA) and results showed that CS and DS samples could be differentiated according to their molecular conformation and oligosaccharide fragments information. Understanding CS and DS structure derived from different origins may lead to the production of CS or DS with unique disaccharides or oligosaccharides sequence composition and biological functions.

  15. The effect of yeast β-glucan on the amount of albumin, globulin, urea and total protein of broiler chickens

    ali kargarirezapour

    2013-08-01

    Full Text Available Glucans derived from yeast cell wall are promising alternatives to antibiotics, as they have been shown to improve growth performance and stimulate the immune system of immature broilers. In this study we evaluated the effect of different levels of yeast beta-glucan (YBG on some blood parametrs of broiler chickens. In a factorial experiment based on completely randomized design (the first factor: YBG levels: 0, 0.04 and 0.08% of basal diet and sex as a second factor 144 day old chicks (72 male and 72 female were selected and allocated to different treatments (three replicates of each treatment. The overall experimental period was 34 days. At the end of study, two birds from each pen were randomly selected as a sample. The level of albumin, globulin, urea and total protein was measured on blood samples. Statistical analysis of the results showed that the YBG had no significant effect on albumin, globulin, urea and total protein level. But the amount of plasma albumin and total protein in female chicks was significantly higher than male chicks (p

  16. Toxicological Assessment of β-(1à6-Glucan (Lasiodiplodan in Mice during a 28-Day Feeding Study by Gavage

    Janaína A. Túrmina

    2012-12-01

    Full Text Available Studies evaluating the toxicity caused by fungal exopolysaccharides of the β-(1®6-D-glucan type are rare. In this study, the toxicological effects of sub-chronic treatments with lasiodiplodan (β-(1®6-D-glucan from Lasiodiplodia theobromae MMPI were evaluated in mice through the assessment of biochemical, hematological, and histopathological alterations. Thirty-two mice (16 male, 16 female were used in this study divided in two groups; one group received lasiodiplodan (50 mg/kg body weight daily for 28 days via gavage, and another (control group received saline during the same period. Blood samples were collected via cardiac puncture for hematological and biochemical analyses. Liver, heart, kidney, and spleen were collected for histopathological analysis. Statistical analysis was performed through one-way analysis of variance and only p < 0.05 F-values were presented. Significant reduction in blood glucose in the male group (35%; p < 0.01, transaminases activity in both sexes (AST and ALT; ~35%; p < 0.05, and urea (20%; p < 0.01 in the female group was observed with the lasiodiplodan treatment. The results showed that sub-chronic treatments with lasiodiplodan did not generate hematological and histopathological alterations leading to signs of toxicity in healthy mice, independent of gender.

  17. Heritability and clinical determinants of serum indoxyl sulfate and p-cresyl sulfate, candidate biomarkers of the human microbiome enterotype.

    Liesbeth Viaene

    Full Text Available BACKGROUND: Indoxyl sulfate and p-cresyl sulfate are unique microbial co-metabolites. Both co-metabolites have been involved in the pathogenesis of accelerated cardiovascular disease and renal disease progression. Available evidence suggests that indoxyl sulfate and p-cresyl sulfate may be considered candidate biomarkers of the human enterotype and may help to explain the link between diet and cardiovascular disease burden. OBJECTIVE AND DESIGN: Information on clinical determinants and heritability of indoxyl sulfate and p-cresyl sulfate serum is non-existing. To clarify this issue, the authors determined serum levels of indoxyl sulfate and p-cresyl sulfate in 773 individuals, recruited in the frame of the Flemish Study on Environment, Genes and Health Outcomes (FLEMENGHO study. RESULTS: Serum levels of indoxyl sulfate and p-cresyl sulfate amounted to 3.1 (2.4-4.3 and 13.0 (7.4-21.5 μM, respectively. Regression analysis identified renal function, age and sex as independent determinants of both co-metabolites. Both serum indoxyl sulfate (h2 = 0.17 and p-cresyl sulfate (h2 = 0.18 concentrations showed moderate but significant heritability after adjustment for covariables, with significant genetic and environmental correlations for both co-metabolites. LIMITATIONS: Family studies cannot provide conclusive evidence for a genetic contribution, as confounding by shared environmental effects can never be excluded. CONCLUSIONS: The heritability of indoxyl sulfate and p-cresyl sulfate is moderate. Besides genetic host factors and environmental factors, also renal function, sex and age influence the serum levels of these co-metabolites.

  18. Sulfation pattern of fucose branches affects the anti-hyperlipidemic activities of fucosylated chondroitin sulfate.

    Wu, Nian; Zhang, Yu; Ye, Xingqian; Hu, Yaqin; Ding, Tian; Chen, Shiguo

    2016-08-20

    Fucosylated chondroitin sulfates (fCSs) are glycosaminoglycans extracted from sea cucumbers, consisting of chondroitin sulfate E (CSE) backbones and sulfated fucose branches. The biological properties of fCSs could be affected by the sulfation pattern of their fucose branches. In the present study, two fCSs were isolated from sea cucumbers Isostichopus badionotus (fCS-Ib) and Pearsonothuria graeffei (fCS-Pg). Their monosaccharide compositions of glucuronic acid (GlcA), N-acetylgalactosamine (GalNAc), fucose (Fuc) and sulfate were at similar molar ratio with 1.0/0.7/0.9/3.1 for fCS-Ib and 1.0/0.8/1.5/2.6 for fCS-Pg. The two fCSs have different sulfation patterns on their fucose branches, fCS-Pg with 3,4-O-disulfation while fCS-Ib with 2,4-O-disulfation. Their antihyperlipidemic effects were compared using a high-fat high-fructose diet (HFFD)-fed C57BL/6J mice model. Both fCS-Ib and fCS-Pg had significant effects on lipid profile improvement, liver protection, blood glucose diminution and hepatic glycogen synthesis. Specifically, fCS-Pg with 3,4-O-disulfation fucose branches was more effective in reduction of blood cholesterol (TC), low density lipoprotein (LDL) and atherogenic index (AI). Our results indicate that both fCSs, especially fCS-Pg, could be used as a potential anti-hyperlipidemic drug. Copyright © 2016. Published by Elsevier Ltd.

  19. A potential role for chondroitin sulfate/dermatan sulfate in arm regeneration in Amphiura filiformis.

    Ramachandra, Rashmi; Namburi, Ramesh B; Dupont, Sam T; Ortega-Martinez, Olga; van Kuppevelt, Toin H; Lindahl, Ulf; Spillmann, Dorothe

    2017-05-01

    Glycosaminoglycans (GAGs), such as chondroitin sulfate (CS) and dermatan sulfate (DS) from various vertebrate and invertebrate sources are known to be involved in diverse cellular mechanisms during repair and regenerative processes. Recently, we have identified CS/DS as the major GAG in the brittlestar Amphiura filiformis, with high proportions of di- and tri-O-sulfated disaccharide units. As this echinoderm is known for its exceptional regeneration capacity, we aimed to explore the role of these GAG chains during A. filiformis arm regeneration. Analysis of CS/DS chains during the regeneration process revealed an increase in the proportion of the tri-O-sulfated disaccharides. Conversely, treatment of A. filiformis with sodium chlorate, a potent inhibitor of sulfation reactions in GAG biosynthesis, resulted in a significant reduction in arm growth rates with total inhibition at concentrations higher than 5 mM. Differentiation was less impacted by sodium chlorate exposure or even slightly increased at 1-2 mM. Based on the structural changes observed during arm regeneration we identified chondroitin synthase, chondroitin-4-O-sulfotransferase 2 and dermatan-4-O-sulfotransferase as candidate genes and sought to correlate their expression with the expression of the A. filiformis orthologue of bone morphogenetic factors, AfBMP2/4. Quantitative amplification by real-time PCR indicated increased expression of chondroitin synthase and chondroitin-4-O-sulfotransferase 2, with a corresponding increase in AfBMP2/4 during regeneration relative to nonregenerating controls. Our findings suggest that proper sulfation of GAGs is important for A. filiformis arm regeneration and that these molecules may participate in mechanisms controlling cell proliferation. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. On the roles and regulation of chondroitin sulfate and heparan sulfate in zebrafish pharyngeal cartilage morphogenesis

    Holmborn, Katarina; Habicher, Judith; Kasza, Zsolt

    2012-01-01

    The present study addresses the roles of heparan sulfate (HS) proteoglycans and chondroitin sulfate (CS) proteoglycans in the development of zebrafish pharyngeal cartilage structures. uxs1 and b3gat3 mutants, predicted to have impaired biosynthesis of both HS and CS because of defective formation...... levels of CS than control larvae, whereas morpholino-mediated suppression of csgalnact1/csgalnact2 resulted in increased HS biosynthesis. Thus, the balance of the Extl3 and Csgalnact1/Csgalnact2 proteins influences the HS/CS ratio. A characterization of the pharyngeal cartilage element morphologies...

  1. Use of β-glucan from spent brewer's yeast as a thickener in skimmed yogurt: Physicochemical, textural, and structural properties related to sensory perception.

    Raikos, Vassilios; Grant, Shannon B; Hayes, Helen; Ranawana, Viren

    2018-04-25

    Powdered β-glucan extracted from brewer's yeast (Yestimun, Leiber GmbH, Bramsche, Germany) was incorporated into skimmed-milk yogurt at varying concentrations (0.2-0.8% wt/wt) to investigate its potential application as a thickener. The effect of β-glucan fortification on the nutritional profile, microstructure, physicochemical properties, and texture of freshly prepared yogurts was investigated. Sensory evaluation was also conducted and was correlated with instrumental analysis. The addition of Yestimun significantly reduced the fermentation time of the yogurt mix from 4 h to 3 h. Scanning electron microscopy revealed that β-glucan particles formed small spherical clusters within the yogurt matrix. The majority of the physicochemical properties (syneresis, viscosity, color, and titratable acidity) remained unaffected by the incorporation of Yestimun in the recipe. Textural properties showed a gradual increment with increasing β-glucan concentration. Hardness, total work done, adhesive force, and adhesiveness increased by 19.27, 23.3, 21.53, and 20.76%, respectively, when using the highest amount of Yestimun powder. Sensory analysis (n = 40) indicated that fortifying yogurt with Yestimun at 0.8% (wt/wt) concentration may affect overall acceptance ratings, which was attributed to adverse flavor and aftertaste effects. However, the overall liking score of the yogurt (5.0/9.0) shows potential for commercialization of the product. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. The study on application of radiation for preparation of oligo-β-glucan extracted from brewer yeast cell and for gold and silver nano particles

    Le Quang Luan; Nguyen Huynh Phuong Uyen; Nguyen Thanh Vu; Nguyen Quoc Hien; Dang Van Phu; Vo Thi Thu Ha; To Van Loi; Le Dinh Don; Truong Phuoc Thien Hoang; Do Thi Phuong Linh

    2015-01-01

    The process for production of insoluble β-glucan product from brewer’s yeast cell wall collected from the discard waste of beer production was successfully established. Radiation was improved as a useful tool for preparation of low Mw β-glucan. The water soluble oligo-β-glucans with Mw ~ 18 - 25 kDa were found to have novel features for application as plant growth promoter, growth and immune stimulator additive for animals and functional food for prevention and therapy of diabetic, dyslipidemia, cancer, etc. The processes for large scale production of oligo-β-glucan as plant growth promoter. chicken additive and functional food by gamma Co-60 irradiation method have been set up for application. In addition, gold nanoparticles (AuNPs) with size of 10 - 50 nm stabilized in sericin and water soluble chitosan and silver nanoparticles (AgNPs) with size of 5-20 nm stabilized PVA, PVP, sericin and alginate were also successfully synthesized by gamma Co-60 irradiation method. While AuNPs product was found to be not toxic and can be used for bio-medicine and cosmetics, AgNPs exhibited highly antimicrobial activity for potentially use as new and safety antimicrobial agent. The processes for large scale production of AuNPs, AgNPs, cream/AgNPs and hand-wash solution/AgNPs products were also successfully developed within this project. (author)

  3. Effects of β-glucan polysaccharide revealed by the dominant lethal assay and micronucleus assays, and reproductive performance of male mice exposed to cyclophosphamide

    Rodrigo Juliano Oliveira

    2014-01-01

    Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.

  4. Validation of a high-performance size-exclusion chromatography method to determine and characterize β-glucans in beer wort using a triple-detector array.

    Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe

    2017-01-01

    Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Elevated Serum Beta-D-Glucan with Pseudomonas, Aspergillus, and a Partially Acid-Fast Organism in Respiratory Cultures: A Case of Hickam's Dictum Over Occam's Razor.

    Khan, Salman; Hamula, Camille; Rana, Meenakshi; Sullivan, Timothy; Dunn, Dallas; Patel, Pinki; Mishkin, Aaron; Huprikar, Shirish

    2017-10-01

    We describe a case of a man with ectopic Cushing's syndrome, elevated serum beta-D-glucan, and respiratory cultures with Pseudomonas, Aspergillus, and a partially acid-fast organism. Our case highlights challenges in diagnosis and management of coinfection in an immunocompromised host.

  6. Effects of in vitro fermentation of barley β-glucan and sugar beet pectin using human fecal inocula on cytokine expression by dendritic cells

    Rosch, Christiane; Taverne, Nico; Venema, Koen; Gruppen, Harry; Wells, Jerry M.; Schols, Henk A.

    2017-01-01

    Scope: This study simulates the fermentation process of barley β-glucan and sugar beet pectin in the human colon and monitors the degradation products formed. Additionally, immune effects of the degradation products were investigated. Methods and results: Immunostimulatory activity of

  7. Anti-inflammatory properties of the medicinal mushroom Cordyceps militaris might be related to its linear (1→3-β-D-glucan.

    Fhernanda R Smiderle

    Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.

  8. Evaluation of the ability of barley genotypes containing different amounts of ß-glucan to alter growth and disease resistance of rainbow trout Oncorhynchus mykiss.

    A feeding trial was performed to screen three barley genotypes containing different levels of '-glucan for their ability to influence growth, immune function, and disease resistance of rainbow trout. Three experimental diets were prepared by substituting each of three barely genotypes containing dif...

  9. A phase I/II trial of beta-(1,3/(1,6 D-glucan in the treatment of patients with advanced malignancies receiving chemotherapy

    Weitberg Alan B

    2008-09-01

    Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.

  10. Effects of sulfate deprivation on the production of chondroitin/dermatan sulfate by cultures of skin fibroblasts from normal and diabetic individuals

    Silbert, C.K.; Humphries, D.E.; Palmer, M.E.; Silbert, J.E.

    1991-01-01

    Human skin fibroblast monolayer cultures from two normal men, three Type I diabetic men, and one Type I diabetic woman were incubated with [3H]glucosamine in the presence of diminished concentrations of sulfate. Although total synthesis of [3H]chondroitin/dermatan glycosaminoglycans varied somewhat between cell lines, glycosaminoglycan production was not affected within any line when sulfate levels were decreased from 0.3 mM to 0.06 mM to 0.01 mM to 0 added sulfate. Lowering of sulfate concentrations resulted in diminished sulfation of chondroitin/dermatan in a progressive manner, so that overall sulfation dropped to as low as 19% for one of the lines. Sulfation of chondroitin to form chondroitin 4-sulfate and chondroitin 6-sulfate was progressively and equally affected by decreasing the sulfate concentration in the culture medium. However, sulfation to form dermatan sulfate was preserved to a greater degree, so that the relative proportion of dermatan sulfate to chondroitin sulfate increased. Essentially all the nonsulfated residues were susceptible to chondroitin AC lyase, indicating that little epimerization of glucuronic acid residues to iduronic acid had occurred in the absence of sulfation. These results confirm the previously described dependency of glucuronic/iduronic epimerization on sulfation, and indicate that sulfation of the iduronic acid-containing disaccharide residues of dermatan can take place with sulfate concentrations lower than those needed for 6-sulfation and 4-sulfation of the glucuronic acid-containing disaccharide residues of chondroitin. There were considerable differences among the six fibroblast lines in susceptibility to low sulfate medium and in the proportion of chondroitin 6-sulfate, chondroitin 4-sulfate, and dermatan sulfate. However, there was no pattern of differences between normals and diabetics

  11. Measuring (1,3)-β-D-glucan in tracheal aspirate, bronchoalveolar lavage fluid, and serum for detection of suspected Candida pneumonia in immunocompromised and critically ill patients: a prospective observational study.

    Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru

    2017-04-08

    While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.

  12. Dietary β-glucan stimulate complement and C-reactive protein acute phase responses in common carp (Cyprinus carpio) during an Aeromonas salmonicida infection.

    Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave

    2013-03-01

    The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All

  13. Global source attribution of sulfate aerosol and its radiative forcing

    Yang, Y.; Wang, H.; Smith, S.; Easter, R. C.; Ma, P. L.; Qian, Y.; Li, C.; Yu, H.; Rasch, P. J.

    2017-12-01

    Sulfate is an important aerosol that poses health risks and influences climate. Due to long-range atmospheric transport, local sulfate pollution could result from intercontinental influences, making domestic efforts of improving air quality inefficient. Accurate understanding of source attribution of sulfate and its radiative forcing is important for both regional air quality improvement and global climate mitigation. In this study, for the first time, a sulfur source-tagging capability is implemented in the Community Atmosphere Model (CAM5) to quantify the global source-receptor relationships of sulfate and its direct and indirect radiative forcing (DRF and IRF). Near-surface sulfate concentrations are mostly contributed by local emissions in regions with high emissions, while over regions with relatively low SO2 emissions, the near-surface sulfate is primarily attributed to non-local sources from long-range transport. The export of SO2 and sulfate from Europe contributes 20% of sulfate concentrations over North Africa, Russia and Central Asia. Sources from the Middle East account for 20% of sulfate over North Africa, Southern Africa and Central Asia in winter and autumn, and 20% over South Asia in spring. East Asia accounts for about 50% of sulfate over Southeast Asia in winter and autumn, 15% over Russia in summer, and 10% over North America in spring. South Asia contributes to 25% of sulfate over Southeast Asia in spring. Lifetime of aerosols, together with regional export, is found to determine regional air quality. The simulated global total sulfate DRF is -0.42 W m-2, with 75% contributed by anthropogenic sulfate and 25% contributed by natural sulfate. In the Southern Hemisphere tropics, dimethyl sulfide (DMS) contributes the most to the total DRF. East Asia has the largest contribution of 20-30% over the Northern Hemisphere mid- and high-latitudes. A 20% perturbation of sulfate and its precursor emissions gives a sulfate IRF of -0.44 W m-2. DMS has the

  14. Removal of Sulfate Ion From AN-107 by Evaporation

    GJ Lumetta; GS Klinger; DE Kurath; RL Sell; LP Darnell; LR Greenwood; CZ Soderquist; MJ Steele; MW Urie; JJ Wagner

    2000-01-01

    Hanford low-activity waste solutions contain sulfate, which can cause accelerated corrosion of the vitrification melter and unacceptable operating conditions. A method is needed to selectively separate sulfate from the waste. An experiment was conducted to evaluate evaporation for removing sulfate ion from Tank AN-107 low-activity waste. Two evaporation steps were performed. In the first step, the volume was reduced by 55% while in the second step, the liquid volume was reduced another 22%. Analysis of the solids precipitated during these evaporations revealed that large amounts of sodium nitrate and nitrite co-precipitated with sodium sulfate. Many other waste components precipitated as well. It can be concluded that sulfate removal by precipitation is not selective, and thus, evaporation is not a viable option for removing sulfate from the AN-107 liquid

  15. Metabolic interactions in methanogenic and sulfate-reducing bioreactors.

    Stams, A J M; Plugge, C M; de Bok, F A M; van Houten, B H G W; Lens, P; Dijkman, H; Weijma, J

    2005-01-01

    In environments where the amount of electron acceptors is insufficient for complete breakdown of organic matter, methane is formed as the major reduced end product. In such methanogenic environments organic acids are degraded by syntrophic consortia of acetogenic bacteria and methanogenic archaea. Hydrogen consumption by methanogens is essential for acetogenic bacteria to convert organic acids to acetate and hydrogen. Several syntrophic cocultures growing on propionate and butyrate have been described. These syntrophic fatty acid-degrading consortia are affected by the presence of sulfate. When sulfate is present sulfate-reducing bacteria compete with methanogenic archaea for hydrogen and acetate, and with acetogenic bacteria for propionate and butyrate. Sulfate-reducing bacteria easily outcompete methanogens for hydrogen, but the presence of acetate as carbon source may influence the outcome of the competition. By contrast, acetoclastic methanogens can compete reasonably well with acetate-degrading sulfate reducers. Sulfate-reducing bacteria grow much faster on propionate and butyrate than syntrophic consortia.

  16. Process for removing sulfate anions from waste water

    Nilsen, David N.; Galvan, Gloria J.; Hundley, Gary L.; Wright, John B.

    1997-01-01

    A liquid emulsion membrane process for removing sulfate anions from waste water is disclosed. The liquid emulsion membrane process includes the steps of: (a) providing a liquid emulsion formed from an aqueous strip solution and an organic phase that contains an extractant capable of removing sulfate anions from waste water; (b) dispersing the liquid emulsion in globule form into a quantity of waste water containing sulfate anions to allow the organic phase in each globule of the emulsion to extract and absorb sulfate anions from the waste water and (c) separating the emulsion including its organic phase and absorbed sulfate anions from the waste water to provide waste water containing substantially no sulfate anions.

  17. Immobilization of calcium sulfate contained in demolition waste

    Ambroise, J.; Pera, J.

    2008-01-01

    This paper presents the results of a laboratory study undertaken to examine the treatment of demolition waste containing calcium sulfate by means of calcium sulfoaluminate clinker (CSA). The quantity of CSA necessary to entirely consume calcium sulfate was determined. Using infrared spectrometry analysis and X-ray diffraction, it was shown that calcium sulfate was entirely consumed when the ratio between CSA and calcium sulfate was 4. Standard sand was polluted by 4% calcium sulfate. Two solutions were investigated: ·either global treatment of sand by CSA, ·or immobilization of calcium sulfate by CSA, followed by the introduction of this milled mixture in standard sand. Regardless of the type of treatment, swelling was almost stabilized after 28 days of immersion in water

  18. A radioimmunoassay for measurement of thyroxine sulfate

    Chopra, I.J.; Santini, F.; Hurd, R.E.; Chua Teco, G.N.

    1993-01-01

    A highly sensitive, specific, and reproducible RIA has been developed to measure T 4 sulfate (T 4 S) in ethanol extracts of serum. rT 3 sulfate (rT 3 S) cross-reacted 7.1%, and T 3 S cross-reacted 0.59% in the RIA; T 4 , T 3 , rT 3 and 3,3'-diiodothyronine cross-reacted 0.004% or less. The recovery of nonradioactive T 4 S added to serum averaged 95%. The detection threshold of the RIA was 18 pmol/L. The coefficient of variation averaged 6.9% within an assay and 12% between assays. T 4 S was bound by T 4 -binding globulin and albumin in serum. The free fraction of T 4 S in four normal sera averaged 0.06% compared to a value of 0.03% for T 4 (P 4 S was (mean ± SE) 19 ± 1.2 pmol/L in normal subjects, 33 ± 10 in hyperthyroid patients with Graves disease, 42 ± 15 in hypothyroid patients, 34 ± 6.9 in patients with systematic nonthyroidal illnesses, 21 ± 4.3 in pregnant women at 15-40 weeks gestation, and 245 ± 26 in cord blood sera of newborns; the value in the newborn was significantly different from normal (P 4 S. The T 4 S content of the thyroid gland was less than 1/4000th that of T 4 . We conclude that (1) T 4 S is a normal component of human serum, and its levels are markedly increased in newborn serum and amniotic fluid; and (2) the sulfation pathway plays an important role in the metabolism of T 4 in man. 28 refs., 4 figs., 2 tabs

  19. Sequence determination of synthesized chondroitin sulfate dodecasaccharides.

    Shioiri, Tatsumasa; Tsuchimoto, Jun; Watanabe, Hideto; Sugiura, Nobuo

    2016-06-01

    Chondroitin sulfate (CS) is a linear acidic polysaccharide composed of repeating disaccharide units of glucuronic acid and N-acetyl-d-galactosamine. The polysaccharide is modified with sulfate groups at different positions by a variety of sulfotransferases. CS chains exhibit various biological and pathological functions by interacting with cytokines and growth factors and regulating their signal transduction. The fine structure of the CS chain defines its specific biological roles. However, structural analysis of CS has been restricted to disaccharide analysis, hampering the understanding of the structure-function relationship of CS chains. Here, we chemo-enzymatically synthesized CS dodecasaccharides having various sulfate modifications using a bioreactor system of bacterial chondroitin polymerase mutants and various CS sulfotransferases. We developed a sequencing method for CS chains using the CS dodecasaccharides. The method consists of (i) labeling a reducing end with 2-aminopyridine (PA), (ii) partial digestion of CS with testicular hyaluronidase, followed by separation of PA-conjugated oligosaccharides with different chain lengths, (iii) limited digestion of these oligosaccharides with chondroitin lyase AC II into disaccharides, followed by labeling with 2-aminobenzamide, (iv) CS disaccharide analysis using a dual-fluorescence HPLC system (reversed-phase ion-pair and ion-exchange chromatography), and (v) estimation of the composition by calculating individual disaccharide ratios. This CS chain sequencing allows characterization of CS-modifying enzymes and provides a useful tool toward understanding the structure-function relationship of CS chains. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Effects of dietary β-glucan and glycyrrhizin on non-specific immunity and disease resistance of the sea cucumber ( Apostichopus japonicus Selenka) challenged with Vibrio splendidus

    Chang, Jie; Zhang, Wenbing; Mai, Kangsen; Ma, Hongming; Xu, Wei

    2010-12-01

    Sea cucumbers, Apostichopus japonicus Selenka, were fed diets containing non-immunostimulant (basal diet), 0.2% β-glucan and 0.02% glycyrrhizin in a recirculatory water system for 45 days, and subsequently challenged with Vibrio splendidus by injection at 1.0×108 cfu / sea cucumber for 15 days. Phagocytic capacity (PC), intracellular superoxide anion production (ISAP), lysozyme (LSZ) activity and superoxide dismutase (SOD) activity in the coelomic fluid were analyzed on the 0th, 5th, 10th and 15th days after injection. Results showed that after the 45-day feeding period, PC, ISAP, LSZ activity and SOD activity in sea cucumbers fed with dietary β-glucan or glycyrrhizin were significantly higher than in those fed with the basal diet. On the 5th day after infection, all the immune parameters examined in the sea cucumbers injected with V. splendidus decreased in value significantly. On the 15th day, PC, ISAP and LSZ activity returned to levels similar to those on the 0th day. For the sea cucumbers injected with saline, there were no significant differences in all the immune parameters examined and in the cumulative morbidity during the 15-day challenging trial. After injecting with V. splendidus, the cumulative morbidity of sea cucumbers fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin when challenged with V. splendidus challenged sea cucumber fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin. There was no significant difference in cumulative morbidity between the dietary β-glucan and glycyrrhizin treatments over time.

  1. Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

    Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

    2017-07-01

    We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  2. Sulfated oligosaccharide structures, as determined by NMR techniques

    Noseda, M.D.; Duarte, M.E.R.; Tischer, C.A.; Gorin, P.A.J.; Cerezo, A.S.

    1997-01-01

    Carrageenans are sulfated polysaccharides, produced by red seaweeds (Rhodophyta), that have important biological and physico-chemical properties. Using partial autohydrolysis, we obtained sulfated oligosaccharides from a λ-carrageenan (Noseda and Cerezo, 1993). These oligosaccharides are valuable not only for the study of the structures of the parent carrageenans but also for their possible biological activities. In this work we determined the chemical structure of one of the sulfated oligosaccharides using 1D and 2D NMR techniques. (author)

  3. A population of Langerin-positive dendritic cells in murine Peyer's patches involved in sampling β-glucan microparticles.

    Magdia De Jesus

    Full Text Available Glucan particles (GPs are 2-4 μm hollow, porous shells composed of 1,3-β-D-glucan that have been effectively used for oral targeted-delivery of a wide range of payloads, including small molecules, siRNA, DNA, and protein antigens. While it has been demonstrated that the transepithelial transport of GPs is mediated by Peyer's patch M cells, the fate of the GPs once within gut-associated lymphoid tissue (GALT is not known. Here we report that fluorescently labeled GPs administered to mice by gavage accumulate in CD11c+ DCs situated in Peyer's patch sub-epithelial dome (SED regions. GPs appeared in DCs within minutes after gavage and remained within the SED for days afterwards. The co-administration or sequential administration of GPs with differentially labeled GPs or poly(lactic-co-glycolic acid nanoparticles demonstrated that the SED DC subpopulation in question was capable of internalizing particles of different sizes and material compositions. Phenotypic analysis identified the GP-containing DCs as being CD8α- and CD11blo/-, suggesting they are the so-called myeloid and/or double negative (DN subset(s of PP DCs. A survey of C-type lectin receptors (CLRs known to be expressed by leukocytes within the intestinal mucosa revealed that GP-containing SED DCs were positive for Langerin (CD207, a CLR with specificity for β-D-glucan and that has been shown to mediate the internalization of a wide range of microbial pathogens, including bacteria, viruses and fungi. The presence of Langerin+ DCs in the SED as determined by immunofluorescence was confirmed using Langerin E-GFP transgenic mice. In summary, our results demonstrate that following M cell-mediated transepithelial transport, GPs (and other micro/nanoparticles are sampled by a population of SED DCs distinguished from other Peyer's patch DC subsets by their expression of Langerin. Future studies will be aimed at defining the role of Langerin in antigen sampling and antigen presentation within

  4. Hydrometallurgical process for recovering iron sulfate and zinc sulfate from baghouse dust

    Zaromb, Solomon; Lawson, Daniel B.

    1994-01-01

    A process for recovering zinc/rich and iron-rich fractions from the baghouse dust that is generated in various metallurgical operations, especially in steel-making and other iron-making plants, comprises the steps of leaching the dust by hot concentrated sulfuric acid so as to generate dissolved zinc sulfate and a precipitate of iron sulfate, separating the precipitate from the acid by filtration and washing with a volatile liquid, such as methanol or acetone, and collecting the filtered acid and the washings into a filtrate fraction. The volatile liquid may be recovered distillation, and the zinc may be removed from the filtrate by alternative methods, one of which involves addition of a sufficient amount of water to precipitate hydrated zinc sulfate at 10.degree. C., separation of the precipitate from sulfuric acid by filtration, and evaporation of water to regenerate concentrated sulfuric acid. The recovery of iron may also be effected in alternative ways, one of which involves roasting the ferric sulfate to yield ferric oxide and sulfur trioxide, which can be reconverted to concentrated sulfuric acid by hydration. The overall process should not generate any significant waste stream.

  5. Purification, structural characterization and antiproliferative properties of chondroitin sulfate/dermatan sulfate from tunisian fish skins.

    Krichen, Fatma; Volpi, Nicola; Sila, Assaâd; Maccari, Francesca; Mantovani, Veronica; Galeotti, Fabio; Ellouz-Chaabouni, Semia; Bougatef, Ali

    2017-02-01

    Chondroitin sulfate/dermatan sulfate GAGs were extracted and purified from the skins of grey triggerfish (GTSG) and smooth hound (SHSG). The disaccharide composition produced by chondroitinase ABC treatment showed the presence of nonsulfated disaccharide, monosulfated disaccharides ΔDi6S and ΔDi4S, and disulfated disaccharides in different percentages. In particular, the nonsulfated disaccharide ΔDi0S of GTSG and SHSG were 3.5% and 5.5%, respectively, while monosulfated disaccharides ΔDi6S and ΔDi4S were evaluated to be 18.2%, 59% and 14.6%, 47.0%, respectively. Capillary elecrophoresis analysis of GTSG and SHSG contained 99.2% and 95.4% of chondroitin sulfate/dermatan sulfate, respectively. PAGE analysis showed a GTSG and SHSG having molecular masses with average values of 41.72KDa and 23.8KDa, respectively. HCT116 cell proliferation was inhibited (p<0.05) by 70.6% and 72.65% at 200μg/mL of GTSG and SHSG respectively. Both GTSG and SHSG demonstrated promising antiproliferative potential, which may be used as a novel, effective agent. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Inter vs. intraglycosidic acetal linkages control sulfation pattern in semi-synthetic chondroitin sulfate.

    Laezza, Antonio; De Castro, Cristina; Parrilli, Michelangelo; Bedini, Emiliano

    2014-11-04

    Microbial-sourced unsulfated chondroitin could be converted into chondroitin sulfate (CS) polysaccharide by a multi-step strategy relying upon benzylidenation and acetylation reactions as key-steps for its regioselective protection. By conducting the two reactions one- or two-pots, CSs with different sulfation patterns could be obtained at the end of the semi-synthesis. In particular, a CS polysaccharide possessing sulfate groups randomly distributed between positions 4 and 6 of N-acetyl-galactosamine (GalNAc) units could be obtained through the two-pots route, whereas the one-pot pathway allowed an additional sulfation at position 3 of some glucuronic acid (GlcA) units. This difference was ascribed to the stabilization of a labile interglycosidic benzylidene acetal involving positions O-3 and O-6 of some GlcA and GalNAc, respectively, when the benzylidene-acetylation reactions were conducted in a one-pot fashion. Isolation and characterization of a polysaccharide intermediate showing interglycosidic acetal moieties was accomplished. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Sulfate Formation on Mars by Volcanic Aerosols: A New Look

    Blaney, D. L.

    1996-03-01

    Sulfur was measured at both Viking Lander sites in abundances of 5-9 wt % SO3. Because the sulfur was more concentrated in clumps which disintegrated and the general oxidized nature of the Martian soil, these measurements led to the assumption that a sulfate duricrust existed. Two types of models for sulfate formation have been proposed. One is a formation by upwardly migrating ground water. The other is the formation of sulfates by the precipitation of volcanic aerosols. Most investigators have tended to favor the ground water origin of sulfates on Mars. However, evidence assemble since Viking may point to a volcanic aerosol origin.

  8. Bicarbonate sulfate exchange in canalicular rat liver plasma membrane vesicles

    Meier, P.J.; Valantinas, J.; Hugentobler, G.; Rahm, I.

    1987-01-01

    The mechanism(s) and driving forces for biliary excretion of sulfate were investigated in canalicular rat liver plasma membrane vesicles (cLPM). Incubation of cLPM vesicles in the presence of an inside-to-outside (in, out) bicarbonate gradient but not pH or out-to-in sodium gradients, stimulated sulfate uptake 10-fold compared with the absence of bicarbonate and approximately 2-fold above sulfate equilibrium (overshoot). Initial rates of this bicarbonate gradient-driven [ 35 S]-sulfate uptake were saturable with increasing concentrations of sulfate and could be inhibited by probenecid, N-(4-azido-2-nitrophenyl)-2-aminoethylsulfonate, acetazolamide, furosemide, 4-acetamideo-4'-isothiocyanostilbene-2,2'-disulfonic acid, and 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (IC 50 , ∼40 μM). Cisinhibition of initial bicarbonate gradient-stimulated sulfate uptake and transstimulation of sulfate uptake in the absence of bicarbonate were observed with sulfate, thiosulfate, and oxalate but not with chloride, nitrate, phosphate, acetate, lactate, glutamate, aspartate, cholate, taurocholate, dehydrocholate, taurodehydrocholate, and reduced or oxidized glutathione. These findings indicate the presence of a sulfate (oxalate)-bicarbonate anion exchange system in canalicular rat liver plasma membranes. These findings support the concept that bicarbonate-sensitive transport system might play an important role in bile acid-independent canalicular bile formation

  9. Mencegah Pembentukan Kalsium Sulfat pada Desalinasi Air Laut

    Mirna Rahmah Lubis

    2007-06-01

    Full Text Available Resin penukar-anion, Relite MG 1/P, dapat digunakan untuk memisahkan sulfat dalam air laut guna mencegah pembentukan kerak kalsium sulfat pada heat exchanger. Resin tersebut menunjukkan selektivitas sulfat yang tinggi dalam air laut sintetis. Resin yang telah dipakai dapat diregenerasi menggunakan air asin yang dipekatkan dengan asam hingga mencapai pH 4. Untuk waktu pemakaian dan regenerasi yang sama, faktor konsentrasi desalinasi (misalnya 2 hingga 4 menaikkan konsentrasi klorida dalam air asin yang diblowdown. Dengan faktor konsentrasi yang tetap, kenaikan laju alir (pengurangan waktu pemakaian dan regenerasi memperendah efisiensi regenerasi dan menaikkan pemisahan sulfat. Akibat kelarutan kalsium sulfat yang bersifat terbalik tersebut, temperatur air asin yang tinggi memerlukan pemisahan sulfat yang lebih banyak, yang dapat dicapai dengan mengurangi laju alir air laut. Pengurangan laju alir tersebut membutuhkan peralatan yang lebih besar dan resin yang lebih banyak, sehingga biaya modal bertambah. Untuk pabrik desalinasi dengan kapasitas produksi 1 juta gallon per hari dan faktor konsentrasi sebesar 2, biaya pemisahan sulfat meliputi biaya resin dan biaya peralatan. Biaya tersebut bervariasi dari $0.246 hingga $0.356/kgalon (per ribu galon air yang diproduksi karena temperatur maksimum air asin berubah dari 140°C menjadi 180°C. Keywords: desalinasi air laut, ion exchange, kalsium sulfat, kerak; mechanical vapor compression (MVC, pemisahan sulfat, resin penukar-anion basa lemah

  10. Divergent Synthesis of Chondroitin Sulfate Disaccharides and Identification of Sulfate Motifs that Inhibit Triple Negative Breast Cancer

    Wei Poh, Zhong; Heng Gan, Chin; Lee, Eric J.; Guo, Suxian; Yip, George W.; Lam, Yulin

    2015-09-01

    Glycosaminoglycans (GAGs) regulate many important physiological processes. A pertinent issue to address is whether GAGs encode important functional information via introduction of position specific sulfate groups in the GAG structure. However, procurement of pure, homogenous GAG motifs to probe the “sulfation code” is a challenging task due to isolation difficulty and structural complexity. To this end, we devised a versatile synthetic strategy to obtain all the 16 theoretically possible sulfation patterns in the chondroitin sulfate (CS) repeating unit; these include rare but potentially important sulfated motifs which have not been isolated earlier. Biological evaluation indicated that CS sulfation patterns had differing effects for different breast cancer cell types, and the greatest inhibitory effect was observed for the most aggressive, triple negative breast cancer cell line MDA-MB-231.

  11. Acute Exacerbations of COPD Are Associated With Increased Expression of Heparan Sulfate and Chondroitin Sulfate in BAL.

    Papakonstantinou, Eleni; Klagas, Ioannis; Roth, Michael; Tamm, Michael; Stolz, Daiana

    2016-03-01

    Acute exacerbations of COPD (AECOPDs) are associated with accelerated aggravation of clinical symptoms and deterioration of pulmonary function. The mechanisms by which exacerbations may contribute to airway remodeling and declined lung function are poorly understood. We investigated whether AECOPDs are associated with differential expression of glycosaminoglycans in BAL in a cohort of 97 patients with COPD. Patients with COPD with either stable disease (n = 53) or AECOPD (n = 44) and undergoing diagnostic bronchoscopy were matched for demographics and lung function parameters. Levels of heparan sulfate, chondroitin sulfate, dermatan sulfate, and matrix metalloproteinases (MMPs) in BAL were measured by enzyme-linked immunosorbent assay. Heparan sulfate and chondroitin sulfate were significantly increased in BAL of patients during exacerbations. Levels of heparan sulfate were higher in the BAL of patients with microbial infections. Chondroitin sulfate was negatively correlated with FEV1 % predicted but not with diffusing capacity of lung for carbon monoxide % predicted, indicating that chondroitin sulfate is associated with airway remodeling, leading to obstruction rather than to emphysema. Furthermore, heparan sulfate and chondroitin sulfate were significantly correlated with MMP-9, MMP-2, and MMP-12 in BAL, indicating that they were cleaved from their respective proteoglycans by MMPs and subsequently washed out in BAL. During AECOPD, there is increased expression of heparan sulfate and chondroitin sulfate in BAL. These molecules are significantly correlated with MMPs in BAL, indicating that they may be associated with airway remodeling and may lead to lung function decline during exacerbations of COPD. Copyright © 2016 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  12. Medical Gains of Chondroitin Sulfate Upon Fucosylation.

    Pomin, Vitor H

    2015-01-01

    Chondroitin sulfate (CS) is a glycosaminoglycan (GAG) composed of alternating N-acetyl galactosamine and glucuronic acid units within disaccharide building blocks. CS is a key functional component in proteoglycans of cartilaginous tissues. Owing to its numerous biological roles, CS is widely explored in the pharmaceutical market as nutraceutical ingredient commonly utilized against arthritis, osteoarthrosis, and sometimes osteoporosis. Tissues like shark cartilage and bovine trachea are common sources of CS. Nonetheless, a new CS type has been introduced and investigated in the last few decades in what regards its medical potentials. It is named fucosylated chondroitin sulfate (FucCS). This less common CS type is isolated exclusively from the body wall of sea cucumbers. The presence of fucosyl branching units in the holothurian FucCS gives to this unique GAG, therapeutic properties in various pathophysiological systems which are inexistent in the common CS explored in the market. Examples of these systems are coagulation, thrombosis, hemodialysis, atherosclerosis, cellular growth, angiogenesis, fibrosis, tumor growth, inflammation, viral and protozoan infections, hyperglycemia, diabetes-related pathological events and tissue damage. This report aims at describing the medical benefits gained upon fucosylation of CS. Clinical prospects of these medical benefits are also discussed herein.

  13. Optimizing substrate for sulfate-reducing bacteria

    Chang, L.K.; Updegraff, D.M.; Wildeman, T.R.

    1991-01-01

    Microbial sulfate reduction followed by sulfide precipitation effectively removes heavy metals from wastewaters. The substrate in the anaerobic zone in a constructed wetland can be designed to emphasize this removal process. This group of bacteria requires CH 2 O, P, N, and SO 4 =, reducing conditions, and pH range of 5-9 (pH=7 is optimum). The objective of this study was to find an inexpensive source of nutrients that would give the best initial production of sulfide and make a good wetland substrate. All tested materials contain sufficient P and N; mine drainage provides sulfate. Thus, tests focused on finding organic material that provides the proper nutrients and does not cause the culture to fall below pH of 5. Among chemical nutrients, sodium lactate combined with (NH 4 ) 2 HPO 4 were the only compounds that produced sulfide after 11 days. Among complex nutrients, only cow manure produced sulfide after 26 days. Among complex carbohydrates, cracked corn and raw rice produced sulfide after 10 days. Most substrates failed to produce sulfide because anaerobic fermentation reduced the pH below 5. Presently, cracked corn is the best candidate for a substrate. Five grams of cow manure produced 0.14 millimole of sulfide whereas 0.1 g of cracked corn produced 0.22 millimole

  14. Growth and sedimentation of fine particles produced in aqueous solutions of palladium sulfate and palladium sulfate-silver sulfate induced by gamma-ray irradiation

    Hatada, Motoyoshi; Jonah, C.D.

    1994-10-01

    It is known that palladium and palladium-silver fine particles were formed from deaerated aqueous solutions of palladium sulfate and palladium sulfate-silver sulfate induced by gamma-ray irradiation. Changes in particle size and with amount of particles in the solution with time during and after irradiation were studied using dynamic light scattering technique and UV spectrophotometer. The particles formed from palladium sulfate solution are found to be water-filled bulky particles of diameter of 200 nm, which grow by mutual coagulation even after irradiation was terminated. Average density depends on concentration of palladium ion in the solution and dose, and the lowest density was about 2 g/cm 3 for particles of 200 nm obtained from 0.06 mM solution by 2.4 kGy irradiation. The average density of the particles obtained from palladium sulfate-silver sulfate solutions was smaller than those obtained for the corresponding palladium sulfate solutions. Supersonic agitation destroyed coagulated precipitates to form fine particles, but did not form clusters of a few atoms. (author)

  15. Water mobility in the endosperm of high beta-glucan barley mutants as studied by nuclear magnetic resonance imaging

    Seefeldt, Helene Fast; van den Berg, Frans W.J.; Köckenberger, Walter

    2007-01-01

    1H NMR imaging (MRI) was used as a noninvasive technique to study water distribution and mobility in hydrated barley (Hordeum vulgare L.) seeds of accessions with varying content of beta glucan (BG), a highly hygroscopic cell wall component. High contents of BG in barley are unfavorable in malting...... where it leads to clotting of filters and hazing of beer as well as in animal feed where it hinders the rapid uptake of energy. However, a high content of BG has a positive nutritional effect, as it lowers the cholesterol and the glycaemic index. It was studied whether water distribution and mobility...... were related to content and location of BG. Water mobility was investigated by following the rate and mode of desiccation in hydrated single seeds. In order to determine the different water components, a multispin echo experiment was set up to reveal the T2 transverse relaxation rates of water within...

  16. Combination therapy of murine tumors with a degraded D-manno-D-glucan (DMG) from Microellobosporia grisea, and cyclophosphamide.

    Nakajima, H; Hashimoto, S; Kita, Y; Takashi, T; Tsukada, W; Kohno, M; Ogawa, H; Abe, S; Mizuno, D

    1983-12-01

    DMG, a degraded D-manno-D-glucan with a host-mediated antitumor activity did not significantly enhance nor inhibit the development of suppressor cells for either the antibody-forming response or the delayed hypersensitivity reaction to sheep red blood cells. Cyclophosphamide (CY), which inhibited the generation of suppressor cells, was combined with DMG in treatment of murine syngeneic tumors to obtain a higher antitumor activity. The antitumor activity of the combination against MH134 hepatoma was synergistically higher than that of either component alone. A marked antitumor effect of the combination treatment against MM46 mammary carcinoma was also shown. High levels of antitumor delayed hypersensitivity reactions were observed with this combination therapy. The possible roles of DMG and CY in this combination therapy are discussed.

  17. Accessibility and contribution to glucan masking of natural and genetically tagged versions of yeast wall protein 1 of Candida albicans.

    Granger, Bruce L

    2018-01-01

    Yeast wall protein 1 (Ywp1) is an abundant glycoprotein of the cell wall of the yeast form of Candida albicans, the most prevalent fungal pathogen of humans. Antibodies that bind to the polypeptide backbone of isolated Ywp1 show little binding to intact yeast cells, presumably because the Ywp1 epitopes are masked by the polysaccharides of the mannoproteins that form the outer layer of the cell wall. Rare cells do exhibit much greater anti-Ywp1 binding, however, and one of these was isolated and characterized. No differences were seen in its Ywp1, but it exhibited greater adhesiveness, sensitivity to wall perturbing agents, and exposure of its underlying β-1,3-glucan layer to external antibodies. The molecular basis for this greater epitope accessibility has not been determined, but has facilitated exploration of how these properties change as a function of cell growth and morphology. In addition, previously engineered strains with reduced quantities of Ywp1 in their cell walls were also found to have greater β-1,3-glucan exposure, indicating that Ywp1 itself contributes to the masking of wall epitopes, which may be important for understanding the anti-adhesive effect of Ywp1. Ectopic production of Ywp1 by hyphae, which reduces the adhesivity of these filamentous forms of C. albicans, was similarly found to reduce exposure of the β-1,3-glucan in their walls. To monitor Ywp1 in the cell wall irrespective of its accessibility, green fluorescent protein (Gfp) was genetically inserted into wall-anchored Ywp1 using a bifunctional cassette that also allowed production from a single transfection of a soluble, anchor-free version. The wall-anchored Ywp1-Gfp-Ywp1 accumulated in the wall of the yeast forms but not hyphae, and appeared to have properties similar to native Ywp1, including its adhesion-inhibiting effect. Some pseudohyphal walls also detectably accumulated this probe. Strains of C. albicans with tandem hemagglutinin (HA) epitopes inserted into wall

  18. Accessibility and contribution to glucan masking of natural and genetically tagged versions of yeast wall protein 1 of Candida albicans.

    Bruce L Granger

    Full Text Available Yeast wall protein 1 (Ywp1 is an abundant glycoprotein of the cell wall of the yeast form of Candida albicans, the most prevalent fungal pathogen of humans. Antibodies that bind to the polypeptide backbone of isolated Ywp1 show little binding to intact yeast cells, presumably because the Ywp1 epitopes are masked by the polysaccharides of the mannoproteins that form the outer layer of the cell wall. Rare cells do exhibit much greater anti-Ywp1 binding, however, and one of these was isolated and characterized. No differences were seen in its Ywp1, but it exhibited greater adhesiveness, sensitivity to wall perturbing agents, and exposure of its underlying β-1,3-glucan layer to external antibodies. The molecular basis for this greater epitope accessibility has not been determined, but has facilitated exploration of how these properties change as a function of cell growth and morphology. In addition, previously engineered strains with reduced quantities of Ywp1 in their cell walls were also found to have greater β-1,3-glucan exposure, indicating that Ywp1 itself contributes to the masking of wall epitopes, which may be important for understanding the anti-adhesive effect of Ywp1. Ectopic production of Ywp1 by hyphae, which reduces the adhesivity of these filamentous forms of C. albicans, was similarly found to reduce exposure of the β-1,3-glucan in their walls. To monitor Ywp1 in the cell wall irrespective of its accessibility, green fluorescent protein (Gfp was genetically inserted into wall-anchored Ywp1 using a bifunctional cassette that also allowed production from a single transfection of a soluble, anchor-free version. The wall-anchored Ywp1-Gfp-Ywp1 accumulated in the wall of the yeast forms but not hyphae, and appeared to have properties similar to native Ywp1, including its adhesion-inhibiting effect. Some pseudohyphal walls also detectably accumulated this probe. Strains of C. albicans with tandem hemagglutinin (HA epitopes inserted into

  19. The effects of oat β-glucan incorporation on the quality, structure, consumer acceptance and glycaemic response of steamed bread.

    Wang, Lei; Ye, Fayin; Feng, Liyuan; Wei, Fubin; Zhao, Guohua

    2017-12-01

    The objective of this study was to evaluate the effects of the incorporation of oat β-glucan (OβG) on the sensory and nutritional quality of steamed bread. Wheat flour was substituted with OβG at levels varying from 0 g/100 g to 5 g/100 g. The results showed that the products containing 1 g/100 g and 3 g/100 g OβG produced a comparable overall consumer acceptance while a significantly lower score was given to the product with 5 g/100 g. Nutritionally, the presence of OβG impeded in vitro starch hydrolysis by amylolytic enzymes. More importantly, the addition of OβG up to 5 g/100 g did bring about a lower in vitro predicted glycaemic index to steamed bread, but it generated insignificant effects on the in vivo glycaemic response. The current work first demonstrated the feasibility of fabricating OβG-enriched steamed bread and its nutritional superiority compared to the corresponding normal product. Modern methods of food elaboration and processing frequently reduce the content of dietary fiber (DF). Despite the well-known health benefits of DF consumption, average intake levels still fall far below recommended ones. Oat β-glucan (OβG) is a kind of indigestible polysaccharide with diverse bioactivity. This article evaluated the effects of OβG incorporation on quality, structure, consumer acceptance, and glycaemic response of steamed bread. The addition of less than 3 g/100 g of OβG had negligible effects on the consumer acceptance of steamed bread. The enrichment at 5 g/100 g indeed deteriorated the consumer acceptance. Moreover, OβG highly lowered the glycaemic response of steamed bread. The current work first demonstrated the feasibility of fabricating OβG-enriched steamed bread and its nutritional superiority compared to the corresponding normal product. OβG enriched steamed bread may offer an alternative to improve DF intake of residents. © 2017 Wiley Periodicals, Inc.

  20. Glucanos extracelulares bacterianos: estructura, biosíntesis y función Extreacellular bacterial glucans: structure, biosynthesis and function

    Bárbara E. García Triana

    2008-12-01

    Full Text Available La caries dental es una de las enfermedades más frecuentes en el ser humano. En su etiología multifactorial, desempeñan un papel importante determinadas bacterias cariogénicas, que en interacción con la superficie del diente promueven su desmineralización. Dentro de los mecanismos mediadores de la adhesión bacteriana, se encuentra la producción de polisacáridos extracelulares bacterianos. En particular los glucanos sintetizados por las glucosiltransferasas, no solo permiten la adherencia, sino que también constituyen una fuente nutricional para las bacterias, por lo tanto, la actividad de dichas enzimas se considera un factor de virulencia bacteriana en la caries dental. Esta revisión bibliográfica tiene el objetivo de esclarecer los aspectos relacionados con la estructura, biosíntesis y función de los glucanos, y enfatizar en la aplicación de estos conocimientos en la prevención de la caries dental.Dental caries is one of the most common diseases in the human being. Certain cariogenic bacteria play an important role in its multifactorial etiology, since in their interaction with the dental surface they promote its demineralization. The production of extracellular bacterial polyssacharides is among the mechanisms mediating bacterial adhesion. The glucans synthesized by glycosyltransferases not only allow the adherence, but they also are a nutritional source for bacteria and that's why the activity of such enzymes is considered a factor of bacterial virulence in dental caries. This bibliographic review is aimed at making clear the aspects related to the structure, biosynthesis and function of glucans and at giving emphasis to the application of this knowledge in the prevention of dental caries.

  1. The confused world of sulfate attack on concrete

    Neville, Adam

    2004-01-01

    External sulfate attack is not completely understood. Part I identifies the issues involved, pointing out disagreements, and distinguishes between the mere occurrence of chemical reactions of sulfates with hydrated cement paste and the damage or deterioration of concrete; only the latter are taken to represent sulfate attack. Furthermore, sulfate attack is defined as deleterious action involving sulfate ions; if the reaction is physical, then, it is physical sulfate attack that takes place. The discussion of the two forms of sulfate attack leads to a recommendation for distinct nomenclature. Sulfate attack on concrete structures in service is not widespread, and the amount of laboratory-based research seems to be disproportionately large. The mechanisms of attack by different sulfates--sodium, calcium, and magnesium--are discussed, including the issue of topochemical and through-solution reactions. The specific aspects of the action of magnesium sulfate are discussed, and the differences between laboratory conditions and field exposure are pointed out. Part II discusses the progress of sulfate attack and its manifestations. This is followed by a discussion of making sulfate-resisting concrete. One of the measures is to use Type V cement, and this topic is extensively discussed. Likewise, the influence of w/c on sulfate resistance is considered. The two parameters are not independent of one another. Moreover, the cation in the sulfate salt has a strong bearing on the efficiency of the Type V cement. Recent interpretations of the Bureau of Reclamation tests, both long term and accelerated, are evaluated, and it appears that they need reworking. Part III reviews the standards and guides for the classification of the severity of exposure of structures to sulfates and points out the lack of calibration of the various classes of exposure. A particular problem is the classification of soils because much depends on the extraction ratio of sulfate in the soil: there is a

  2. A radioimmunoassay for measurement of thyroxine sulfate

    Chopra, I.J.; Santini, F.; Hurd, R.E.; Chua Teco, G.N. (Univ. of California Center for the Health Sciences, Los Angeles (United States))

    1993-01-01

    A highly sensitive, specific, and reproducible RIA has been developed to measure T[sub 4] sulfate (T[sub 4]S) in ethanol extracts of serum. rT[sub 3] sulfate (rT[sub 3]S) cross-reacted 7.1%, and T[sub 3]S cross-reacted 0.59% in the RIA; T[sub 4], T[sub 3], rT[sub 3] and 3,3[prime]-diiodothyronine cross-reacted 0.004% or less. The recovery of nonradioactive T[sub 4]S added to serum averaged 95%. The detection threshold of the RIA was 18 pmol/L. The coefficient of variation averaged 6.9% within an assay and 12% between assays. T[sub 4]S was bound by T[sub 4]-binding globulin and albumin in serum. The free fraction of T[sub 4]S in four normal sera averaged 0.06% compared to a value of 0.03% for T[sub 4] (P < 0.001). The serum concentration of T[sub 4]S was (mean [+-] SE) 19 [+-] 1.2 pmol/L in normal subjects, 33 [+-] 10 in hyperthyroid patients with Graves disease, 42 [+-] 15 in hypothyroid patients, 34 [+-] 6.9 in patients with systematic nonthyroidal illnesses, 21 [+-] 4.3 in pregnant women at 15-40 weeks gestation, and 245 [+-] 26 in cord blood sera of newborns; the value in the newborn was significantly different from normal (P < 0.001). Administration of sodium ipodate (Oragrafin; 3 g, orally) to hyperthyroid patients was associated with a transient increase in serum T[sub 4]S. The T[sub 4]S content of the thyroid gland was less than 1/4000th that of T[sub 4]. We conclude that (1) T[sub 4]S is a normal component of human serum, and its levels are markedly increased in newborn serum and amniotic fluid; and (2) the sulfation pathway plays an important role in the metabolism of T[sub 4] in man. 28 refs., 4 figs., 2 tabs.

  3. Biological processes for the production of aryl sulfates

    2016-01-01

    The present invention generally relates to the field of biotechnology as it applies to the production of aryl sulfates using polypeptides or recombinant cells comprising said polypeptides. More particularly, the present invention pertains to polypeptides having aryl sulfotransferase activity......, recombinant host cells expressing same and processes for the production of aryl sulfates employing these polypeptides or recombinant host cells....

  4. Dietary reference intakes for water, potassium, sodium, chloride, and sulfate

    Institute of Medicine (U.S.). Panel on Dietary Reference Intakes for Electrolytes and Water

    2005-01-01

    ... intake to the risk of high blood pressure and hypertension as well as other diseases and the amounts of water from beverages and foods needed to maintain hydration. In addition, since requirements for sulfur can be met by inorganic sulfate in the diets of animals, a review of the role in inorganic sulfur in the form of sulfate is included. The gro...

  5. Effects of magnesium sulfate on the acquisition and reinstatement of ...

    In the current study, the effects of magnesium sulfate on the acquisition and reinstatement of morphine-induced conditioned place preference (CPP) in an animal model were investigated. The acquisition and extinction and reinstatement phases induced using morphine 40 and 10mg/kg. Magnesium sulfate 300 and 600 ...

  6. Sulfur accumulation and atmospherically deposited sulfate in the Lake States.

    Mark B. David; George Z. Gernter; David F. Grigal; Lewis F. Ohmann

    1989-01-01

    Characterizes the mass of soil sulfur (adjusted for nitrogen), and atmospherically deposited sulfate along an acid precipitation gradient from Minnesota to Michigan. The relationship of these variables, presented graphically through contour mapping, suggests that patterns of atmospheric wet sulfate deposition are reflected in soil sulfur pools.

  7. Sulfated zirconia modified SBA-15 catalysts for cellobiose hydrolysis

    Degirmenci, V.; Uner, D.; Cinlar, B.; Shanks, B.H.; Yilmaz, A.; Santen, van R.A.; Hensen, E.J.M.

    2011-01-01

    Zirconia modified SBA-15 becomes a very active catalyst for the selective hydrolysis of cellobiose to glucose after sulfation. Spectroscopic investigations indicate the presence of Brønsted acid sites with similar properties to those present in conventional sulfated zirconia. Indications are found

  8. Reductive and sorptive properties of sulfate green rust (GRSO4)

    Nedel, Sorin

    The Fe(II), Fe(III) hydroxide containing sulfate in its structure, called sulfate green rust (GRSO4), can effectively reduce and convert contaminants to less mobile and less toxic forms. However, the ability of GRSO4 to remove positively charged species from solution, via sorption, is very limited...

  9. Sulfate was a trace constituent of Archean seawater

    Crowe, Sean Andrew; Paris, Guillaume; Katsev, Sergei

    2014-01-01

    In the low-oxygen Archean world (>2400 million years ago), seawater sulfate concentrations were much lower than today, yet open questions frustrate the translation of modern measurements of sulfur isotope fractionations into estimates of Archean seawater sulfate concentrations. In the water column...

  10. Extraction and determination of chondroitin sulfate from fish processing byproducts

    Chondroitin sulfate (CS) refers to a group of sulfated glycosaminoglycan containing a chain of alternating N-acetylgalactosamine and glucuronic acid sugars. It is a major component of the extracellular matrix of cartilage and attached to proteins. CS is usually an over the counter dietary supplement...

  11. Annual sulfate budgets for Dutch lowland peat polders

    Vermaat, Jan E.; Harmsen, Joop; Hellmann, Fritz A.; Geest, van der Harm G.; Klein, de Jeroen J.M.; Kosten, Sarian; Smolders, Alfons J.P.; Verhoeven, Jos T.A.; Mes, Ron G.; Ouboter, Maarten

    2016-01-01

    Annual sulfate mass balances have been constructed for four low-lying peat polders in the Netherlands, to resolve the origin of high sulfate concentrations in surface water, which is considered a water quality problem, as indicated amongst others by the absence of sensitive water plant species.

  12. Transmission spectra study of sulfate substituted potassium dihydrogen phosphate

    LI, LIANG

    2013-04-18

    Potassium dihydrogen phosphate (KDP) crystals with different amounts of sulfate concentration were grown and the transmittance spectrum was studied. A crystal with high sulfate replacement density exhibits heavy absorption property in the ultraviolet region which confirms and agrees well with former results. © 2013 Astro Ltd.

  13. Preparation and characterization of a chemically sulfated cashew gum polysaccharide

    Moura Neto, Erico de; Maciel, Jeanny da S.; Cunha, Pablyana L. R.; Paula, Regina Celia M. de; Feitosa, Judith P.A., E-mail: judith@dqoi.ufc.br [Departamento de Quimica Organica e Inorganica, Universidade Federal do Ceara, Fortaleza (Brazil)

    2011-09-15

    Cashew gum (CG) was sulfated in pyridine:formamide using chlorosulfonic acid as the reagent. Confirmation of sulfation was obtained by Fourier transform infrared (FTIR) spectroscopy through the presence of an asymmetrical S=O stretching vibration at 1259 cm{sup -1}. The degrees of substitution were 0.02, 0.24 and 0.88 determined from the sulfur percentage. 1D and 2D nuclear magnetic resonance (NMR) data showed that the sulfation occurred at primary carbons. An increase of at least 4% of the solution viscosity was observed due to sulfation. The thermal gravimetric curves (TGA) indicate that the derivatives are stable up to ca. 200 deg C. The sulfated CG is compared to carboxymethylated CG in order to verify the possibility of the use of the former in the preparation of polyelectrolyte complexes; the latter is already being used for this application. (author)

  14. Sulfate reduction in an entrained-flow black liquor gasifier

    Kymaelaeinen, M.; Janka, K. [Tampella Power, Tampere (Finland); Frederick, W.J.; Littau, M.; Sricharoenchaikul, V.; Jivakanun, N.; Waag, K. [Oregon State Univ., Corvallis, OR (United States). Dept. of Chemical Engineering

    1995-12-31

    Sulfate reduction and carbon conversion during pyrolysis and gasification of black liquor particles were experimentally studied in a laminar entrained-flow reactor. A model was also developed to simulate an entrained-flow black liquor gasifier. Experimental results were then compared to model calculations. Results indicated that carbon must be present to get a high degree of sulfate reduction during gasification. It is therefore important to balance the rates of carbon conversion and sulfate reduction. High local temperatures in the reactor should be avoided so that carbon does not convert too rapidly, but temperatures of nearly 1000 degrees C are required to achieve good sulfate reduction. It was suggested that a new equation was needed to adequately predict sulfate reduction in an entrained-flow black liquor gasifier. 12 refs., 8 figs., 5 tabs.

  15. Extraction of beryllium sulfate by a long chain amine

    Etaix, E.S.

    1968-01-01

    The extraction of sulfuric acid in aqueous solution by a primary amine in benzene solution, 3-9 (diethyl) - 6-amino tri-decane (D.E.T. ) - i.e., with American nomenclature 1-3 (ethyl-pentyl) - 4-ethyl-octyl amine (E.P.O.) - has made it possible to calculate the formation constants of alkyl-ammonium sulfate and acid sulfate. The formula of the beryllium and alkyl-ammonium sulfate complex formed in benzene has next been determined, for various initial acidity of the aqueous solution. Lastly, evidence has been given of negatively charged complexes of beryllium and sulfate in aqueous solution, through the dependence of the aqueous sulfate ions concentration upon beryllium extraction. The formation constant of these anionic complexes has been evaluated. (author) [fr

  16. Dendritic Polyglycerol Sulfate for Therapy and Diagnostics

    Nadine Rades

    2018-05-01

    Full Text Available Dendritic polyglycerol sulfate (dPGS has originally been investigated as an anticoagulant to potentially substitute for the natural glycosaminoglycan heparin. Compared to unfractionated heparin, dPGS possesses lower anticoagulant activity but a much higher anticomplementary effect. Since coagulation, complement activation, and inflammation are often present in the pathophysiology of numerous diseases, dPGS polymers with both anticoagulant and anticomplementary activities represent promising candidates for the development of polymeric drugs of nanosized architecture. In this review, we describe the nanomedical applications of dPGS based on its anti-inflammatory activity. Furthermore, the application of dPGS as a carrier molecule for diagnostic molecules and therapeutic drugs is reviewed, based on the ability to target tumors and localize in tumor cells. Finally, the application of dPGS for inhibition of virus infections is described.

  17. Moessbauer study of hydrated iron sulfates

    Araujo, S.I.; Danon, J.; Iannarella, L.

    1991-01-01

    The hydrated iron sulfates amarantite Fe(SO sub(4))(OH).3H sub(2)O, copiapite (Mg,Al)Fe sup(3+) sub(4)(SO sub(4)) sub(6)(OH) sub(2).20H sub(2)O and ungemachite K sub(3)Na sub(9)Fe(SO sub(4)) sub(6)(OH) sub(3).9H sub(2)O were studied by Moessbauer Spectroscopy (MS) in connection with Differential Scanning Calorimetry (DSC). The effect of the dehydration on the hyperfine parameters at the Fe sites was investigated. For amarantite, the Moessbauer spectrum remained practically unchanged, while the Fe sup(3+) quadrupole splittings for copiapite and ungemachite increased. The Fe sup(2+) quadrupole splitting of ungemachite was also unchanged. We have found out the anisotropy of the recoiless absorption probability for the sup(57)Fe Moessbauer gamma ray in amarantite. The three minerals were found to be highly hygroscopic after the dehydration consequent of the DSC measurements. (author)

  18. Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

    Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

  19. Soluble β-(1,3)-glucans enhance LPS-induced response in the monocyte activation test, but inhibit LPS-mediated febrile response in rabbits: Implications for pyrogenicity tests.

    Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando

    2016-01-01

    In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Biological sulfate removal from gypsum contaminated construction and demolition debris.

    Kijjanapanich, Pimluck; Annachhatre, Ajit P; Esposito, Giovanni; van Hullebusch, Eric D; Lens, Piet N L

    2013-12-15

    Construction and demolition debris (CDD) contains high levels of sulfate that can cause detrimental environmental impacts when disposed without adequate treatment. In landfills, sulfate can be converted to hydrogen sulfide under anaerobic conditions. CDD can thus cause health impacts or odor problems to landfill employees and surrounding residents. Reduction of the sulfate content of CDD is an option to overcome these problems. This study aimed at developing a biological sulfate removal system to reduce the sulfate content of gypsum contaminated CDD in order to decrease the amount of solid waste, to improve the quality of CDD waste for recycling purposes and to recover sulfur from CDD. The treatment leached out the gypsum contained in CDD by water in a leaching column. The sulfate loaded leachate was then treated in a biological sulfate reducing Upflow Anaerobic Sludge Blanket (UASB) reactor to convert the sulfate to sulfide. The UASB reactor was operated at 23 ± 3 °C with a hydraulic retention time and upflow velocity of 15.5 h and 0.1 m h(-1), respectively while ethanol was added as electron donor at a final organic loading rate of 3.46 g COD L(-1) reactor d(-1). The CDD leachate had a pH of 8-9 and sulfate dissolution rates of 526.4 and 609.8 mg L(-1) d(-1) were achieved in CDD gypsum and CDD sand, respectively. Besides, it was observed that the gypsum dissolution was the rate limiting step for the biological treatment of CDD. The sulfate removal efficiency of the system stabilized at around 85%, enabling the reuse of the UASB effluent for the leaching step, proving the versatility of the bioreactor for practical applications. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Chondroitin / dermatan sulfate modification enzymes in zebrafish development.

    Judith Habicher

    Full Text Available Chondroitin/dermatan sulfate (CS/DS proteoglycans consist of unbranched sulfated polysaccharide chains of repeating GalNAc-GlcA/IdoA disaccharide units, attached to serine residues on specific proteins. The CS/DS proteoglycans are abundant in the extracellular matrix where they have essential functions in tissue development and homeostasis. In this report a phylogenetic analysis of vertebrate genes coding for the enzymes that modify CS/DS is presented. We identify single orthologous genes in the zebrafish genome for the sulfotransferases chst7, chst11, chst13, chst14, chst15 and ust and the epimerase dse. In contrast, two copies were found for mammalian sulfotransferases CHST3 and CHST12 and the epimerase DSEL, named chst3a and chst3b, chst12a and chst12b, dsela and dselb, respectively. Expression of CS/DS modification enzymes is spatially and temporally regulated with a large variation between different genes. We found that CS/DS 4-O-sulfotransferases and 6-O-sulfotransferases as well as CS/DS epimerases show a strong and partly overlapping expression, whereas the expression is restricted for enzymes with ability to synthesize di-sulfated disaccharides. A structural analysis further showed that CS/DS sulfation increases during embryonic development mainly due to synthesis of 4-O-sulfated GalNAc while the proportion of 6-O-sulfated GalNAc increases in later developmental stages. Di-sulfated GalNAc synthesized by Chst15 and 2-O-sulfated GlcA/IdoA synthesized by Ust are rare, in accordance with the restricted expression of these enzymes. We also compared CS/DS composition with that of heparan sulfate (HS. Notably, CS/DS biosynthesis in early zebrafish development is more dynamic than HS biosynthesis. Furthermore, HS contains disaccharides with more than one sulfate group, which are virtually absent in CS/DS.

  2. Role of protein sulfation in vasodilation induced by minoxidil sulfate, a K+ channel opener

    Meisheri, K.D.; Oleynek, J.J.; Puddington, L.

    1991-01-01

    Evidence from contractile, radioisotope ion flux and electrophysiological studies suggest that minoxidil sulfate (MNXS) acts as a K+ channel opener in vascular smooth muscle. This study was designed to examine possible biochemical mechanisms by which MNXS exerts such an effect. Experiments performed in the isolated rabbit mesenteric artery (RMA) showed that MNXS, 5 microM, but not the parent compound minoxidil, was a potent vasodilator. Whereas the relaxant effects of an another K+ channel opener vasodilator, BRL-34915 (cromakalim), were removed by washing with physiological saline solution, the effects of MNXS persisted after repeated washout attempts. Furthermore, after an initial exposure of segments of intact RMA to [35S] MNXS, greater than 30% of the radiolabel was retained 2 hr after removal of the drug. In contrast, retention of radiolabel was not detected with either [3H]MNXS (label on the piperidine ring of MNXS) or [3H]minoxidil (each less than 3% after a 2-hr washout). These data suggested that the sulfate moiety from MNXS was closely associated with the vascular tissue. To determine if proteins were the acceptors of sulfate from MNXS, intact RMAs were incubated with [35S]MNXS, and then 35S-labeled proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and analyzed by fluorography. Preferential labeling of a 116 kD protein was detected by 2 and 5 min of treatment. A 43 kD protein (resembling actin) also showed significant labeling. A similar profile of 35S-labeled proteins was observed in [35S] MNXS-treated A7r5 rat aortic smooth muscle cells, suggesting that the majority of proteins labeled by [35S]MNXS in intact RMA were components of smooth muscle cells

  3. Heparan Sulfate and Chondroitin Sulfate Glycosaminoglycans Are Targeted by Bleomycin in Cancer Cells.

    Li, Xiulian; Lan, Ying; He, Yanli; Liu, Yong; Luo, Heng; Yu, Haibo; Song, Ni; Ren, Sumei; Liu, Tianwei; Hao, Cui; Guo, Yunliang; Zhang, Lijuan

    2017-01-01

    Bleomycin is a clinically used anti-cancer drug that produces DNA breaks once inside of cells. However, bleomycin is a positively charged molecule and cannot get inside of cells by free diffusion. We previously reported that the cell surface negatively charged glycosaminoglycans (GAGs) may be involved in the cellular uptake of bleomycin. We also observed that a class of positively charged small molecules has Golgi localization once inside of the cells. We therefore hypothesized that bleomycin might perturb Golgi-operated GAG biosynthesis. We used stable isotope labeling coupled with LC/MS analysis of GAG disaccharides simultaneously from bleomycin-treated and non-treated cancer cells. To further understand the cytotoxicity of bleomycin and its relationship to GAGs, we used sodium chlorate to inhibit GAG sulfation and commercially available GAGs to compete for cell surface GAG/bleomycin interactions in seven cell lines including CHO745 defective in both heparan sulfate and chondroitin sulfate biosynthesis. we discovered that heparan sulfate GAG was significantly undersulfated and the quantity and disaccharide compositions of GAGs were changed in bleomycin-treated cells in a concentration- and time-dependent manner. We revealed that bleomycin-induced cytotoxicity was directly related to cell surface GAGs. GAGs were targeted by bleomycin both at cell surface and at Golgi. Thus, GAGs might be the biological relevant molecules that might be related to the bleomycin-induced fibrosis in certain cancer patients, a severe side effect with largely unknown molecular mechanism. © 2017 The Author(s). Published by S. Karger AG, Basel.

  4. N-sulfation of heparan sulfate is critical for syndecan-4-mediated podocyte cell-matrix interactions

    Sugar, T.; Wassenhove-McCarthy, D.J.; Orr, A.W.; Green, J.; Kuppevelt, T.H. van; McCarthy, K.J.

    2016-01-01

    Previous research has shown that podocytes unable to assemble heparan sulfate on cell surface proteoglycan core proteins have compromised cell-matrix interactions. This report further explores the role of N-sulfation of intact heparan chains in podocyte-matrix interactions. For the purposes of this

  5. Low levels of H2S may replace sulfate as sulfur source in sulfate-deprived onion

    Durenkamp, Mark; De Kok, LJ

    2005-01-01

    Onion (Allium cepa L.) was exposed to low levels of H2S in order to investigate to what extent H2S could be used as a sulfur source for growth under sulfate-deprived conditions. Sulfate deprivation for a two-week period resulted in a decreased biomass production of the shoot, a subsequently

  6. Estrogenicity and androgenicity screening of PCB sulfate monoesters in human breast cancer MCF-7 cells

    Flor, Susanne; He, Xianran; Lehmler, Hans-Joachim; Ludewig, Gabriele

    2015-01-01

    Recent studies identified PCB sulfate esters as a major product of PCB metabolism. Since hydroxy-PCBs (HO-PCBs), the immediate precursors of PCB sulfates and important contributors to PCB toxicity, were shown to have estrogenic activity, we investigated the estrogenicity/androgenicty of a series of PCB sulfate metabolites. We synthesized the five possible structural sulfate monoester metabolites of PCB 3, a congener shown to be biotransformed to sulfates, a sulfate ester of the paint-specific...

  7. Development of affinity-based delivery of NGF from a chondroitin sulfate biomaterial

    Butterfield, Karen Chao; Conovaloff, Aaron W.; Panitch, Alyssa

    2011-01-01

    Chondroitin sulfate is a major component of the extracellular matrix in both the central and peripheral nervous systems. Chondroitin sulfate is upregulated at injury, thus methods to promote neurite extension through chondroitin sulfate-rich matrices and synthetic scaffolds are needed. We describe the use of both chondroitin sulfate and a novel chondroitin sulfate-binding peptide to control the release of nerve growth factor. Interestingly, the novel chondroitin sulfate-binding peptide enhanc...

  8. Potential for beneficial application of sulfate reducing bacteria in sulfate containing domestic wastewater treatment.

    van den Brand, T P H; Roest, K; Chen, G H; Brdjanovic, D; van Loosdrecht, M C M

    2015-11-01

    The activity of sulfate reducing bacteria (SRB) in domestic wastewater treatment plants (WWTP) is often considered as a problem due to H2S formation and potential related odour and corrosion of materials. However, when controlled well, these bacteria can be effectively used in a positive manner for the treatment of wastewater. The main advantages of using SRB in wastewater treatment are: (1) minimal sludge production, (2) reduction of potential pathogens presence, (3) removal of heavy metals and (4) as pre-treatment of anaerobic digestion. These advantages are accessory to efficient and stable COD removal by SRB. Though only a few studies have been conducted on SRB treatment of domestic wastewater, the many studies performed on industrial wastewater provide information on the potential of SRB in domestic wastewater treatment. A key-parameter analyses literature study comprising pH, organic substrates, sulfate, salt, temperature and oxygen revealed that the conditions are well suited for the application of SRB in domestic wastewater treatment. Since the application of SRB in WWTP has environmental benefits its application is worth considering for wastewater treatment, when sulfate is present in the influent.

  9. Acidity-Reactivity Relationships in Catalytic Esterification over Ammonium Sulfate-Derived Sulfated Zirconia

    Abdallah I. M. Rabee

    2017-07-01

    Full Text Available New insight was gained into the acidity-reactivity relationships of sulfated zirconia (SZ catalysts prepared via (NH42SO4 impregnation of Zr(OH4 for propanoic acid esterification with methanol. A family of systematically related SZs was characterized by bulk and surface analyses including XRD, XPS, TGA-MS, N2 porosimetry, temperature-programmed propylamine decomposition, and FTIR of adsorbed pyridine, as well as methylbutynol (MBOH as a reactive probe molecule. Increasing surface sulfation induces a transition from amphoteric character for the parent zirconia and low S loadings <1.7 wt %, evidenced by MBOH conversion to 3-hydroxy-3-methyl-2-butanone, methylbutyne and acetone, with higher S loadings resulting in strong Brønsted-Lewis acid pairs upon completion of the sulfate monolayer, which favored MBOH conversion to prenal. Catalytic activity for propanoic acid esterification directly correlated with acid strength determined from propylamine decomposition, coincident with the formation of Brønsted-Lewis acid pairs identified by MBOH reactive titration. Monodispersed bisulfate species are likely responsible for superacidity at intermediate sulfur loadings.

  10. Opiate-like excitatory effects of steroid sulfates and calcium-complexing agents given cerebroventricularly.

    LaBella, F S; Havlicek, V; Pinsky, C

    1979-01-12

    Intracerebroventricular administration of 10--20 microgram of steroid-O-sulfates induced hypermotility, agitation, salivation, EEG abnormalities, stereotypies, wet dog shakes and seizures. Equivalent effects resulted from 30--200 microgram morphine sulfate (H2SO4 salt), 50 microgram EGTA or 300--400 microgram of sodium sulfate or phosphate, but not chloride, nitrate or acetate. Non-steroid sulfates, steroid glucuronides and steroid phosphates were inactive. Naloxone, previously found to antagonize the excitatory effects of androsterone sulfate, failed to antagonize those of cortisol sulfate, sodium sulfate or EGTA. These findings suggest a role for extracellular calcium ions and for sulfate derived from circulating steroids in central responses to opiates.

  11. Sulfates on Mars: TES Observations and Thermal Inertia Data

    Cooper, C. D.; Mustard, J. F.

    2001-05-01

    The high resolution thermal emission spectra returned by the TES spectrometer on the MGS spacecraft have allowed the mapping of a variety of minerals and rock types by different sets of researchers. Recently, we have used a linear deconvolution approach to compare sulfate-palagonite soil mixtures created in the laboratory with Martian surface spectra. This approach showed that a number of areas on Mars have spectral properties that match those of sulfate-cemented soils (but neither loose powder mixtures of sulfates and soils nor sand-sized grains of disaggregated crusted soils). These features do not appear to be caused by atmospheric or instrumental effects and are thus believed to be related to surface composition and texture. The distribution and physical state of sulfate are important pieces of information for interpreting surface processes on Mars. A number of different mechanisms could have deposited sulfate in surface layers. Some of these include evaporation of standing bodies of water, aerosol deposition of volcanic gases, hydrothermal alteration from groundwater, and in situ interaction between the atmosphere and soil. The areas on Mars with cemented sulfate signatures are spread across a wide range of elevations and are generally large in spatial scale. Some of the areas are associated with volcanic regions, but many are in dark red plains that have previously been interpreted as duricrust deposits. Our current work compares the distribution of sulfate-cemented soils as mapped by the spectral deconvolution approach with thermal inertia maps produced from both Viking and MGS-TES. Duricrust regions, interpreted from intermediate thermal inertia values, are large regions thought to be sulfate-cemented soils similar to coherent, sulfate-rich materials seen at the Viking lander sites. Our observations of apparent regions of cemented sulfate are also large in spatial extent. This scale information is important for evaluating formation mechanisms for the

  12. Ferric sulfates on Mars: Surface Explorations and Laboratory Experiments

    Wang, A.; Ling, Z.; Freeman, J. J.

    2008-12-01

    Recent results from missions to Mars have reinforced the importance of sulfates for Mars science. They are the hosts of water, the sinks of acidity, and maybe the most active species in the past and current surface/near-surface processes on Mars. Fe-sulfate was found frequently by Spirit and Opportunity rovers: jarosite in Meridiani Planum outcrops and a less specific "ferric sulfate" in the salty soils excavated by Spirit at Gusev Crater. Pancam spectral analysis suggests a variety of ferric sulfates in these soils, i.e. ferricopiapite, jarosite, fibroferrite, and rhomboclase. A change in the Pancam spectral features occurred in Tyrone soils after ~ 190 sols of exposure to surface conditions. Dehydration of ferric sulfate is a possible cause. We synthesized eight ferric sulfates and conducted a series of hydration/dehydration experiments. Our goal was to establish the stability fields and phase transition pathways of these ferric sulfates. In our experiments, water activity, temperature, and starting structure are the variables. No redox state change was observed. Acidic, neutral, and basic salts were used. Ferric sulfate sample containers were placed into relative humidity buffer solutions that maintain static relative humidity levels at three temperatures. The five starting phases were ferricopiapite (Fe4.67(SO4)6(OH)2.20H2O), kornelite (Fe2(SO4)3.7H2O), rhomboclase (FeH(SO4)2.4H2O), pentahydrite (Fe2(SO4)3.5H2O), and an amorphous phase (Fe2(SO4)3.5H2O). A total of one hundred fifty experiments have been running for nearly ten months. Thousands of coupled Raman and gravimetric measurements were made at intermediate steps to monitor the phase transitions. The first order discovery from these experiments is the extremely large stability field of ferricopiapite. Ferricopiapite is the major ferric sulfate to precipitate from a Fe3+-S-rich aqueous solution at mid-low temperature, and it has the highest H2O/Fe ratio (~ 4.3). However, unlike the Mg-sulfate with highest

  13. Potent inhibitory effects of D-tagatose on the acid production and water-insoluble glucan synthesis of Streptococcus mutans GS5 in the presence of sucrose.

    Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki

    2015-01-01

    We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10% (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol significantly inhibited the acid production and water-insoluble glucan synthesis of GS5 in the presence of 1% (w/v) sucrose. However, the inhibitory effect of acid production by D-tagatose was significantly stronger than that of xylitol in presence of sucrose.

  14. Fruiting bodies of Hericium erinaceus (Bull. Pers. – a new source of water-insoluble (1→3-α-d-glucan

    Adrian Wiater

    2016-09-01

    Full Text Available A water-insoluble polysaccharide (WIP was isolated from the fruiting bodies of Hericium erinaceus HE01 by an alkaline solution with the yield of 5%. Structural and compositional analyses by total acid hydrolysis, methylation analysis, FT-IR, FT-Raman, and 1H NMR spectroscopy as well as other instrumental techniques showed predominantly glucose linked by α-glycosidic bonds and small amounts of mannose, xylose, rhamnose, galactose, and ribose. The methylation analysis showed that (1→3-linked Glcp is the major constituent (70.8% of the polymer, while the 3,4 substituted d-Glcp represents the main branching residue of the glucan. The presence of (1→3-α-d-glucan in the hyphae of H. erinaceus was additionally confirmed by the use of specific fluorophore-labeled antibodies.

  15. Setting constraints on the nature and origin of the two major hydrous sulfates on Mars: Monohydrated and polyhydrated sulfates

    Wang, Alian; Jolliff, Bradley L.; Liu, Yang; Connor, Kathryn

    2016-04-01

    Monohydrated Mg sulfate (MgSO4·H2O) and polyhydrated sulfate are the most common and abundant hydrous sulfates observed thus far on Mars. They are widely distributed and coexist in many locations. On the basis of results from two new sets of experiments, in combination with past experimental studies and the subsurface salt mineralogy observed at a saline playa (Dalangtan, DLT) in a terrestrial analogue hyperarid region on the Tibet Plateau, we can now set new constraints on the nature and origin of these two major Martian sulfates. Starkeyite (MgSO4·4H2O) is the best candidate for polyhydrated sulfate. MgSO4·H2O in the form of "LH-1w," generated from dehydration of Mg sulfates with high degrees of hydration, is the most likely mineral form for the majority of Martian monohydrated Mg sulfate. Two critical properties of Mg sulfates are responsible for the coexistence of these two phases that have very different degrees of hydration: (1) the metastability of a substructural unit in starkeyite at relatively low temperatures, and (2) catalytic effects attributed to coprecipitated species (sulfates, chlorides, oxides, and hydroxides) from chemically complex brines that help overcome the metastability of starkeyite. The combination of these two properties controls the coexistence of the LH-1w layer and starkeyite layers at many locations on Mars, which sometimes occur in an interbedded stratigraphy. The structural H2O held by these two broadly distributed sulfates represents a large H2O reservoir at the surface and in the shallow subsurface on current Mars.

  16. Aerosolization of fungi, (1→3)-β-D glucan, and endotoxin from flood-affected materials collected in New Orleans homes

    Adhikari, Atin; Jung, Jaehee; Reponen, Tiina; Lewis, Jocelyn Suzanne; DeGrasse, Enjoli C.; Grimsley, L. Faye; Chew, Ginger L.; Grinshpun, Sergey A.

    2015-01-01

    Standing water and sediments remaining on flood-affected materials were the breeding ground for many microorganisms in flooded homes following Hurricane Katrina. The purpose of this laboratory study was to examine the aerosolization of culturable and total fungi, (1→3)-β-D glucan, and endotoxin from eight flood-affected floor and bedding materials collected in New Orleans homes, following Hurricane Katrina. Aerosolization was examined using the Fungal Spore Source Strength Tester (FSSST) connected to a BioSampler. Dust samples were collected by vacuuming. A two-stage cyclone sampler was used for size-selective analysis of aerosolized glucan and endotoxin. On average, levels of culturable fungi ranged from undetectable (lower limit = 8.3×104) to 2.6×105 CFU/m2; total fungi ranged from 2.07×105 to 1.6×106 spores/m2; (1→3)-β-D glucan and endotoxin were 2.0×103 – 2.9×104 ng/m2 and 7.0×102 – 9.3×104 EU/m2, respectively. The results showed that 5–15 min sampling is sufficient for detecting aerosolizable biocontaminants with the FSSST. Smaller particle size fractions (1.8 μm) fractions, which raises additional exposure concerns. Vacuuming was found to overestimate inhalation exposure risks by a factor of approximately 102 for (1→3)-β-D glucan and by 103 to 104 for endotoxin as detected by the FSSST. The information generated from this study is important with respect to restoration and rejuvenation of the flood-affected areas in New Orleans. We believe the findings will be significant during similar disasters in other regions of the world including major coastal floods from tsunamis. PMID:19201399

  17. Dietary β-glucan (MacroGard®) enhances survival of first feeding turbot (Scophthalmus maximus) larvae by altering immunity, metabolism and microbiota.

    Miest, Joanna J; Arndt, Carmen; Adamek, Mikolaj; Steinhagen, Dieter; Reusch, Thorsten B H

    2016-01-01

    Reflecting the natural biology of mass spawning fish aquaculture production of fish larvae is often hampered by high and unpredictable mortality rates. The present study aimed to enhance larval performance and immunity via the oral administration of an immunomodulator, β-glucan (MacroGard(®)) in turbot (Scophthalmus maximus). Rotifers (Brachionus plicatilis) were incubated with or without yeast β-1,3/1,6-glucan in form of MacroGard(®) at a concentration of 0.5 g/L. Rotifers were fed to first feeding turbot larvae once a day. From day 13 dph onwards all tanks were additionally fed untreated Artemia sp. nauplii (1 nauplius ml/L). Daily mortality was monitored and larvae were sampled at 11 and 24 dph for expression of 30 genes, microbiota analysis, trypsin activity and size measurements. Along with the feeding of β-glucan daily mortality was significantly reduced by ca. 15% and an alteration of the larval microbiota was observed. At 11 dph gene expression of trypsin and chymotrypsin was elevated in the MacroGard(®) fed fish, which resulted in heightened tryptic enzyme activity. No effect on genes encoding antioxidative proteins was observed, whilst the immune response was clearly modulated by β-glucan. At 11 dph complement component c3 was elevated whilst cytokines, antimicrobial peptides, toll like receptor 3 and heat shock protein 70 were not affected. At the later time point (24 dph) an anti-inflammatory effect in form of a down-regulation of hsp 70, tnf-α and il-1β was observed. We conclude that the administration of MacroGard(®) induced an immunomodulatory response and could be used as an effective measure to increase survival in rearing of turbot. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Anti-infective properties of the melanin-glucan complex obtained from medicinal tinder bracket mushroom, Fomes fomentarius (L.: Fr.) Fr. (Aphyllophoromycetideae).

    Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I

    2011-01-01

    The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.

  19. Biological functions of iduronic acid in chondroitin/dermatan sulfate.

    Thelin, Martin A; Bartolini, Barbara; Axelsson, Jakob; Gustafsson, Renata; Tykesson, Emil; Pera, Edgar; Oldberg, Åke; Maccarana, Marco; Malmstrom, Anders

    2013-05-01

    The presence of iduronic acid in chondroitin/dermatan sulfate changes the properties of the polysaccharides because it generates a more flexible chain with increased binding potentials. Iduronic acid in chondroitin/dermatan sulfate influences multiple cellular properties, such as migration, proliferation, differentiation, angiogenesis and the regulation of cytokine/growth factor activities. Under pathological conditions such as wound healing, inflammation and cancer, iduronic acid has diverse regulatory functions. Iduronic acid is formed by two epimerases (i.e. dermatan sulfate epimerase 1 and 2) that have different tissue distribution and properties. The role of iduronic acid in chondroitin/dermatan sulfate is highlighted by the vast changes in connective tissue features in patients with a new type of Ehler-Danlos syndrome: adducted thumb-clubfoot syndrome. Future research aims to understand the roles of the two epimerases and their interplay with the sulfotransferases involved in chondroitin sulfate/dermatan sulfate biosynthesis. Furthermore, a better definition of chondroitin/dermatan sulfate functions using different knockout models is needed. In this review, we focus on the two enzymes responsible for iduronic acid formation, as well as the role of iduronic acid in health and disease. © 2013 The Authors Journal compilation © 2013 FEBS.

  20. Interpreting isotopic analyses of microbial sulfate reduction in oil reservoirs

    Hubbard, C. G.; Engelbrektson, A. L.; Druhan, J. L.; Cheng, Y.; Li, L.; Ajo Franklin, J. B.; Coates, J. D.; Conrad, M. E.

    2013-12-01

    Microbial sulfate reduction in oil reservoirs is often associated with secondary production of oil where seawater (28 mM sulfate) is commonly injected to maintain reservoir pressure and displace oil. The hydrogen sulfide produced can cause a suite of operating problems including corrosion of infrastructure, health exposure risks and additional processing costs. We propose that monitoring of the sulfur and oxygen isotopes of sulfate can be used as early indicators that microbial sulfate reduction is occurring, as this process is well known to cause substantial isotopic fractionation. This approach relies on the idea that reactions with reservoir (iron) minerals can remove dissolved sulfide, thereby delaying the transport of the sulfide through the reservoir relative to the sulfate in the injected water. Changes in the sulfate isotopes due to microbial sulfate reduction may therefore be measurable in the produced water before sulfide is detected. However, turning this approach into a predictive tool requires (i) an understanding of appropriate fractionation factors for oil reservoirs, (ii) incorporation of isotopic data into reservoir flow and reactive transport models. We present here the results of preliminary batch experiments aimed at determining fractionation factors using relevant electron donors (e.g. crude oil and volatile fatty acids), reservoir microbial communities and reservoir environmental conditions (pressure, temperature). We further explore modeling options for integrating isotope data and discuss whether single fractionation factors are appropriate to model complex environments with dynamic hydrology, geochemistry, temperature and microbiology gradients.

  1. Sulfate Reduction Remediation of a Metals Plume Through Organic Injection

    Phifer, M.A.

    2003-01-01

    Laboratory testing and a field-scale demonstration for the sulfate reduction remediation of an acidic/metals/sulfate groundwater plume at the Savannah River Site has been conducted. The laboratory testing consisted of the use of anaerobic microcosms to test the viability of three organic substrates to promote microbially mediated sulfate reduction. Based upon the laboratory testing, soybean oil and sodium lactate were selected for injection during the subsequent field-scale demonstration. The field-scale demonstration is currently ongoing. Approximately 825 gallons (3,123 L) of soybean oil and 225 gallons (852 L) of 60 percent sodium lactate have been injected into an existing well system within the plume. Since the injections, sulfate concentrations in the injection zone have significantly decreased, sulfate-reducing bacteria concentrations have significantly increased, the pH has increased, the Eh has decreased, and the concentrations of many metals have decreased. Microbially mediated sulfate reduction has been successfully promoted for the remediation of the acidic/metals/sulfate plume by the injection of soybean oil and sodium lactate within the plume

  2. The effect of aerobic exercise and barley β-glucan on blood glucose, body composition and blood pressure of diabetic women

    Fatemeh Mokhtari

    2018-04-01

    Full Text Available Background: The incidence of type 2 diabetes increases with aging, unhealthy diets, obesity and sedentary lifestyles. The aim of this study was to investigate the combinational effect of a 12-week aerobic exercise and barley β-glucan (BBG on blood glucose, body composition and blood pressure in women with type 2 diabetes. Materials and Methods: In this semi-experimental study, 24 women with the mean age of 49 years and a blood glucose level of 110-280 mg/dl were purposefully selected and randomly divided into three groups: a group of aerobic exercise with diet (n=8, b diet group (n=8 c control group (n=8. The diet group consumed one barley bread, containing 4 g of β glucan, each day for 12 weeks. The group of aerobic exercise, who was on diet, participated in a progressive walking program with the intensity of %60-70% of maximal heart rate in addition to diet program (barley bread. Blood glucose, weight, fat percentage, and systolic and diastolic blood pressure levels were measured in pre-and post-training. Results: Results showed a significant decrease in the blood glucose level in the experimental groups compared to the control group, while no major changes were observed in body composition and blood pressure. Conclusion: It seems that the combined program (aerobic training with diet or consumption of β-glucan alone can decrease blood glucose in patients with diabetes.

  3. Effect of a carbonated HAP/β-glucan composite bone substitute on healing of drilled bone voids in the proximal tibial metaphysis of rabbits

    Borkowski, Leszek; Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek; Polkowska, Izabela; Belcarz, Anna; Karpiński, Mirosław; Słowik, Tymoteusz; Matuszewski, Łukasz; Ślósarczyk, Anna; Ginalska, Grażyna

    2015-01-01

    A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration

  4. Commercial breakfast cereals available in Mexican markets and their contribution in dietary fiber, β-glucans and protein quality by rat bioassays.

    Falcón-Villa, María R; Barrón-Hoyos, Jesús M; Cinco-Moroyoqui, Francisco J

    2014-09-01

    The beneficial effect of dietary fiber (DF) consumption has long been recognized. The global economy and open market trade policies have increased the availability of food products in Mexican markets, resulting in a wide variety of ready-to-eat commercial breakfast cereals classified as 'high fiber'. This research was aimed to evaluate the total dietary fiber contents, its fractions (soluble and insoluble) and β-glucan in 13 commercial 'high-fiber' breakfast cereals, as well as to evaluate their protein quality by rat bioassays. Commercial 'high-fiber' breakfast cereals had 7.42-39.82% insoluble dietary fiber, 2.53-12.85% soluble dietary fiber, and 0.45-4.96% β-glucan. These ready-to-eat commercial 'high-fiber' breakfast cereals differed significantly in their total dietary fiber, their soluble and insoluble DF fractions, and also in their β-glucan contents. When supplied as experimental diets, in 14-day rat feeding trials, the 'high-fiber' breakfast cereals showed an adverse effect on the % N digestibility but protein utilization, as measured as net protein ratio (NPR), was not significantly affected. The consumption of these commercial breakfast cereals, especially those made of oats as the basic ingredient, is highly recommended, since these products, being a concentrated source of dietary fiber, do not affect their protein quality.

  5. Morphology and Structural Properties of Novel Short Linear Glucan/Protein Hybrid Nanoparticles and Their Influence on the Rheological Properties of Starch Gel.

    Li, Xiaojing; Ji, Na; Li, Man; Zhang, Shuangling; Xiong, Liu; Sun, Qingjie

    2017-09-13

    Starch nanoparticles were potential texture modifiers. However, they have strong tendency to aggregate and poor water dispersibility, which limited their application. The interaction between glucan (prepared from starch by enzymatic modification) and protein could significantly improve the dispersity of starch nanoparticles and, thus, enhance the rheological properties of food gels. In this work, glucan/protein hybrid nanoparticles were successfully developed for the first time using short linear glucan (SLG) and edible proteins [soy protein isolate (SPI), rice protein (RP), and whey protein isolate (WPI)]. The results showed that the SLG/SPI hybrid nanoparticles exhibited hollow structures, of which the smallest size was approximately 10-20 nm when the SLG/SPI ratio was 10:5. In contrast, SLG/RP nanoparticles displayed flower-like superstructures, and SLG/WPI nanoparticles presented stacked lamellar nanostructures with a width of 5-10 nm and a length of 50-70 nm. In comparison to bare SLG nanoparticles, SLG/SPI and SLG/WPI hybrid nanoparticles had higher melting temperatures. The addition of all nanoparticles greatly increased the storage modulus of corn starch gels and decreased loss tangent values. Importantly, the G' value of starch gels increased by 567% with the addition of flower-like SLG/RP superstructures.

  6. A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial.

    Tessari, Paolo; Lante, Anna

    2017-03-17

    Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed 'functional' bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods : Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values ( p = 0.028), and by ~0.6% vs. the control group ( p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes.

  7. Effect of a carbonated HAP/β-glucan composite bone substitute on healing of drilled bone voids in the proximal tibial metaphysis of rabbits

    Borkowski, Leszek, E-mail: leszek.borkowski@umlub.pl [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek [Department of Animal Physiology, University of Life Sciences in Lublin, Akademicka 12, 20-033 Lublin (Poland); Polkowska, Izabela [Department and Clinic of Animal Surgery, University of Life Sciences in Lublin, Głęboka 30, 20-612 Lublin (Poland); Belcarz, Anna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Karpiński, Mirosław [Department of Companion and Wildlife Animals, University of Life Sciences in Lublin, Akademicka 13, 20-950 Lublin (Poland); Słowik, Tymoteusz [Independent Radiology Unit at Lublin Small Animals Medical Centre, Stefczyka 11, 20-151 Lublin (Poland); Matuszewski, Łukasz [Children' s Orthopaedic Clinic and Rehabilitation Department, Medical University of Lublin, Chodzki 2, 20-093 Lublin (Poland); Ślósarczyk, Anna [Faculty of Materials Science and Ceramics, AGH-University of Science and Technology, Mickiewicza 30, 30-059 Krakow (Poland); Ginalska, Grażyna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland)

    2015-08-01

    A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration.

  8. Comparative studies on the induction of Trichoderma harzianum mutanase by α-(1→3)-glucan-rich fruiting bodies and mycelia of Laetiporus sulphureus.

    Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz

    2012-01-01

    Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.

  9. A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial

    Tessari, Paolo; Lante, Anna

    2017-01-01

    Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350

  10. Hydroxypropyl cyclic β-(1 → 2)-D-glucans and epichlorohydrin β-cyclodextrin dimers as effective carbohydrate-solubilizers for polycyclic aromatic hydrocarbons.

    Choi, Jae Min; Jeong, Daham; Piao, Jinglan; Kim, Kyoungtea; Nguyen, Andrew Bao Loc; Kwon, Nak-Jung; Lee, Mi-Kyung; Lee, Im Soon; Yu, Jae-Hyuk; Jung, Seunho

    2015-01-12

    The removal of polycyclic aromatic hydrocarbons by soil washing using water is extremely difficult due to their intrinsic hydrophobic nature. In this study, the effective aqueous solubility enhancements of seven polycyclic aromatic hydrocarbons by chemically modified hydroxypropyl rhizobial cyclic β-(1 → 2)-D-glucans and epichlorohydrin β-cyclodextrin dimer have been investigated for the first time. In the presence of hydroxypropyl cyclic β-(1 → 2)-D-glucans, the solubility of benzo[a]pyrene is increased up to 38 fold of its native solubility. The solubility of pyrene and phenanthrene dramatically increased up to 160 and 359. Coronene, chrysene, perylene, and fluoranthene also show an increase of 11, 23, 23, and 97 fold, respectively, of enhanced solubility by complexation with synthetic epichlorohydrin β-cyclodextrin dimer. The physicochemical properties of the complex are characterized by Fourier-transform infrared spectra and differential scanning calorimetry. Utilizing a scanning electron microscopy, the morphological structures of native benzo[a]pyrene, pyrene, phenanthrene, coronene, chrysene, perylene, fluoranthene and their complex with novel carbohydrate-solubilizers are studied. These results elucidate that polycyclic aromatic hydrocarbons are able to form an efficient complex with hydroxypropyl cyclic β-(1 → 2)-D-glucans and β-cyclodextrin dimer, suggesting the potential usage of chemically modified novel carbohydrate-solubilizers. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Transcriptional regulation of fksA, a β-1,3-glucan synthase gene, by the APSES protein StuA during Aspergillus nidulans development.

    Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon

    2014-11-01

    The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.

  12. Structural Characterization and Antioxidative Activity of Low-Molecular-Weights Beta-1,3-Glucan from the Residue of Extracted Ganoderma lucidum Fruiting Bodies

    Pai-Feng Kao

    2012-01-01

    Full Text Available The major cell wall constituent of Ganoderma lucidum (G. lucidum is β-1,3-glucan. This study examined the polysaccharide from the residues of alkaline-extracted fruiting bodies using high-performance anion-exchange chromatography (HPAEC, and it employed nuclear magnetic resonance (NMR and mass spectrometry (MS to confirm the structures. We have successfully isolated low-molecular-weight β-1,3-glucan (LMG, in high yields, from the waste residue of extracted fruiting bodies of G. lucidum. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay evaluated the capability of LMG to suppress H2O2-induced cell death in RAW264.7 cells, identifying that LMG protected cells from H2O2-induced damage. LMG treatment decreased H2O2-induced intracellular reactive oxygen species (ROS production. LMG also influenced sphingomyelinase (SMase activity, stimulated by cell death to induce ceramide formation, and then increase cell ROS production. Estimation of the activities of neutral and acid SMases in vitro showed that LMG suppressed the activities of both neutral and acid SMases in a concentration-dependent manner. These results suggest that LMG, a water-soluble β-1,3-glucan recycled from extracted residue of G. lucidum, possesses antioxidant capability against H2O2-induced cell death by attenuating intracellular ROS and inhibiting SMase activity.

  13. (1,3;1,4)-β-Glucan Biosynthesis by the CSLF6 Enzyme: Position and Flexibility of Catalytic Residues Influence Product Fine Structure.

    Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B

    2016-04-05

    Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.

  14. Sulfate Aerosol in the Arctic: Source Attribution and Radiative Forcing

    Yang, Yang [Atmospheric Science and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA; Wang, Hailong [Atmospheric Science and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA; Smith, Steven J. [Joint Global Change Research Institute, Pacific Northwest National Laboratory, College Park MD USA; Easter, Richard C. [Atmospheric Science and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA; Rasch, Philip J. [Atmospheric Science and Global Change Division, Pacific Northwest National Laboratory, Richland WA USA

    2018-02-08

    Source attributions of Arctic sulfate and its direct radiative effect for 2010–2014 are quantified in this study using the Community Earth System Model (CESM) equipped with an explicit sulfur source-tagging technique. Regions that have high emissions and/or are near/within the Arctic present relatively large contributions to Arctic sulfate burden, with the largest contribution from sources in East Asia (27%). East Asia and South Asia together have the largest contributions to Arctic sulfate concentrations at 9–12 km, whereas sources within or near the Arctic account largely below 2 km. For remote sources with strong emissions, their contributions to Arctic sulfate burden are primarily driven by meteorology, while contributions of sources within or near the Arctic are dominated by their emission strength. The sulfate direct radiative effect (DRE) is –0.080 W m-2 at the Arctic surface, offsetting the net warming effect from the combination of in-snow heating and DRE cooling from black carbon. East Asia, Arctic local and Russia/Belarus/Ukraine sources contribute –0.017, –0.016 and –0.014 W m-2, respectively, to Arctic sulfate DRE. A 20% reduction in anthropogenic SO2 emissions leads to a net increase of +0.013 W m-2 forcing at the Arctic surface. These results indicate that a joint reduction in BC emissions could prevent possible Arctic warming from future reductions in SO2 emissions. Sulfate DRE efficiency calculations suggest that short transport pathways together with meteorology favoring long sulfate lifetimes make certain sources more efficient in influencing the Arctic sulfate DRE.

  15. Localized sulfate-reducing zones in a coastal plain aquifer

    Brown, C.J.; Coates, J.D.; Schoonen, M.A.A.

    1999-01-01

    High concentrations of dissolved iron in ground water of coastal plain or alluvial aquifers contribute to the biofouling of public supply wells for which treatment and remediation is costly. Many of these aquifers, however, contain zones in which microbial sulfate reduction and the associated precipitation of iron-sulfide minerals decreases iron mobility. The principal water-bearing aquifer (Magothy Aquifer of Cretaceous age) in Suffolk County, New York, contains localized sulfate-reducing zones in and near lignite deposits, which generally are associated with clay lenses. Microbial analyses of core samples amended with [14C]-acetate indicate that microbial sulfate reduction is the predominant terminal-electron-accepting process (TEAP) in poorly permeable, lignite-rich sediments at shallow depths and near the ground water divide. The sulfate-reducing zones are characterized by abundant lignite and iron-sulfide minerals, low concentrations of Fe(III) oxyhydroxides, and by proximity to clay lenses that contain pore water with relatively high concentrations of sulfate and dissolved organic carbon. The low permeability of these zones and, hence, the long residence time of ground water within them, permit the preservation and (or) allow the formation of iron-sulfide minerals, including pyrite and marcasite. Both sulfate-reducing bacteria (SRB) and iron-reducing bacteria (IRB) are present beneath and beyond the shallow sulfate-reducing zones. A unique Fe(III)-reducing organism, MD-612, was found in core sediments from a depth of 187 m near the southern shore of Long Island. The distribution of poorly permeable, lignite-rich, sulfate-reducing zones with decreased iron concentration is varied within the principal aquifer and accounts for the observed distribution of dissolved sulfate, iron, and iron sulfides in the aquifer. Locating such zones for the placement of production wells would be difficult, however, because these zones are of limited aerial extent.

  16. Evolutionary relationships and functional diversity of plant sulfate transporters

    Hideki eTakahashi

    2012-01-01

    Full Text Available Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal sulfate transporters (SUL and animal anion exchangers (SLC26. The lineage of plant SULTR family is expanded into four subfamilies (SULTR1 to SULTR4 in land plant species. By contrast, the putative SULTR homologues from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4, and the other diverged before the appearance of lineages for SUL, SULTR and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13 and plant tonoplast-localized dicarboxylate transporters (TDT. The putative sulfur-sensing protein (SAC1 and SAC1-like transporters (SLT of Chlorophyte green algae, bryophyte and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is completely absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.

  17. Development of affinity-based delivery of NGF from a chondroitin sulfate biomaterial.

    Butterfield, Karen Chao; Conovaloff, Aaron W; Panitch, Alyssa

    2011-01-01

    Chondroitin sulfate is a major component of the extracellular matrix in both the central and peripheral nervous systems. Chondroitin sulfate is upregulated at injury, thus methods to promote neurite extension through chondroitin sulfate-rich matrices and synthetic scaffolds are needed. We describe the use of both chondroitin sulfate and a novel chondroitin sulfate-binding peptide to control the release of nerve growth factor. Interestingly, the novel chondroitin sulfate-binding peptide enhances the controlled release properties of the chondroitin sulfate gels. While introduction of chondroitin sulfate into a scaffold inhibits primary cortical outgrowth, the combination of chondroitin sulfate, chondroitin sulfate-binding peptide and nerve growth factor promotes primary cortical neurite outgrowth in chondroitin sulfate gels.

  18. Incorporation of Monovalent Cations in Sulfate Green Rust

    Christiansen, B. C.; Dideriksen, K.; Katz, A.

    2014-01-01

    Green rust is a naturally occurring layered mixed-valent ferrous-ferric hydroxide, which can react with a range of redox-active compounds. Sulfate-bearing green rust is generally thought to have interlayers composed of sulfate and water. Here, we provide evidence that the interlayers also contain...... with water showed that Na+ and K+ were structurally fixed in the interlayer, whereas Rb+ and Cs+ could be removed, resulting in a decrease in the basal layer spacing. The incorporation of cations in the interlayer opens up new possibilities for the use of sulfate green rust for exchange reactions with both...

  19. Improved biological processes for the production of aryl sulfates

    2017-01-01

    The present invention generally relates to the field of biotechnology as it applies to the production of aryl sulfates using recombinant host cells. More particularly, the present invention pertains to recombinant host cells comprising (e.g., expressing) a polypeptide having aryl sulfotransferase...... activity, wherein said recombinant host cells have been modified to have an increased uptake of sulfate compared to identical host cells that does not carry said modification. Further provided are processes for the production of aryl sulfates, such as zosteric acid, employing such recombinant host cells....

  20. Studies on sulfate attack: Mechanisms, test methods, and modeling

    Santhanam, Manu

    The objective of this research study was to investigate various issues pertaining to the mechanism, testing methods, and modeling of sulfate attack in concrete. The study was divided into the following segments: (1) effect of gypsum formation on the expansion of mortars, (2) attack by the magnesium ion, (3) sulfate attack in the presence of chloride ions---differentiating seawater and groundwater attack, (4) use of admixtures to mitigate sulfate attack---entrained air, sodium citrate, silica fume, and metakaolin, (5) effects of temperature and concentration of the attack solution, (6) development of new test methods using concrete specimens, and (7) modeling of the sulfate attack phenomenon. Mortar specimens using portland cement (PC) and tricalcium silicate (C 3S), with or without mineral admixtures, were prepared and immersed in different sulfate solutions. In addition to this, portland cement concrete specimens were also prepared and subjected to complete and partial immersion in sulfate solutions. Physical measurements, chemical analyses and microstructural studies were performed periodically on the specimens. Gypsum formation was seen to cause expansion of the C3S mortar specimens. Statistical analyses of the data also indicated that the quantity of gypsum was the most significant factor controlling the expansion of mortar bars. The attack by magnesium ion was found to drive the reaction towards the formation of brucite. Decalcification of the C-S-H and its subsequent conversion to the non-cementitious M-S-H was identified as the mechanism of destruction in magnesium sulfate attack. Mineral admixtures were beneficial in combating sodium sulfate attack, while reducing the resistance to magnesium sulfate attack. Air entrainment did not change the measured physical properties, but reduced the visible distress of the mortars. Sodium citrate caused a substantial reduction in the rate of damage of the mortars due to its retarding effect. Temperature and