WorldWideScience

Sample records for germ 5s ribosomal

  1. 5S rRNA and ribosome.

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  2. 5S ribosomal RNA database Y2K.

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  3. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  5. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  6. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  7. Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs

    Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.

    1986-01-01

    5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)

  8. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  10. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  11. Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA

    Barciszewska, M.Z.

    1994-01-01

    In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab

  12. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  13. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  14. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  15. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  16. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  17. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  18. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  19. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  20. Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells

    Cohen Sarit

    2010-03-01

    Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.

  1. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  2. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  3. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  4. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  6. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  7. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  8. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  9. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  10. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  11. Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

    Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

    2017-01-01

    Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

  12. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  13. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  15. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  16. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  17. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  18. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  19. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae from the upper Paraná river basin, Brazil

    Carlos Alexandre Fernandes

    2006-01-01

    Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

  1. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  2. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  3. An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

    Timmins, P.A.; Langowski, J.; Brown, R.S.

    1988-01-01

    The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

  4. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  5. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  6. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  7. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  9. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  10. Fluorescent in situ hybridization of the ribosomal RNA genes (5S and 35S in the genus Lolium: Lolium canariense, the missing link with Festuca?

    Inda, Luis A.

    2013-06-01

    Full Text Available Two groups of taxa can be distinguished within the genus Lolium L. based on the pollination system, chromosome size, chromosomal location of nrDNA (5S and 35S (18S-5.8S-26S] and nrDNA phylogeny. The first group includes self-pollinated taxa (L. temulentum, L. persicum and L. remotum, whereas the second group comprises cross-pollinated species (L. perenne, L. multiflorum and L. rigidum. Here we describe that the autogamous species have two 5S sites and four 35S sites in their genome. Two of the 35S sites are present in the chromosomes containing the 5S regions. The allogamous taxa possess two 5S rDNA sites and 6-10 35S sites per genome, depending on the species. Two of these regions (35S may also be present in the chromosomes bearing 5S sites. Our study also demonstrates that Lolium canariense shows a distinctive pattern. It has two 5S and four 35S sites. In this case, the 35S loci are located in different chromosomes than the 5S. This cytogenetic pattern is consistent with that of Festuca pratensis. Thus, despite being allogamous, Lolium canariense does not entirely fit in either of the groups defined for the genus Lolium. The physical mapping of the nrDNA regions in L. canariense is different, and resembles that of F. pratensis, suggesting that this Macaronesian Lolium could be intermediate between Festuca and Lolium.En trabajos previos se ha descrito que el género Lolium L. está formado por dos grupos de taxones basados en el tipo de polinización, tamaño de los cromosomas, localización cromosómica de los loci del ADN ribosómico [5S y 35S (18S-5.8S-26S] y filogenia molecular basada en secuencias de ADN ribosómico. Los dos grupos son: especies autógamas (L. temulentum, L. persicum y L. remotum y especies alógamas (L. perenne, L. multiflorum y L. rigidum. Aquí describimos que según la localización cromosómica de los loci ribosómicos, las especies autógamas tienen dos sitios 5S y cuatro sitios 35S; dos de las cuales coinciden en

  11. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. © 2013 Elsevier Inc. All rights reserved.

  12. Chaperoning 5S RNA assembly.

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  13. Eukaryotic 5S rRNA biogenesis

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  14. Increased 5S rRNA oxidation in Alzheimer's disease.

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  15. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  16. Germ Cells are Made Semiotically Competent During Evolution

    Giorgi, Franco; Bruni, Luis Emilio

    2016-01-01

    Germ cells are cross-roads of development and evolution. They define the origin of every new generation and, at the same time, represent the biological end-product of any mature organism. Germ cells are endowed with the following capacities: (1) to store a self-descriptive program, (2......) to accumulate a protein-synthesizing machinery (ribosomes), and (3) to incorporate enough nourishment to sustain embryonic development (yolk). To accomplish this goal, germ cells do not simply unfold a pre-determined program or realize a sole instructive role. On the contrary, due to the complexity...... milieu and experience the compatibility of selected developmental sequences. The question of which signaling pathways are activated at each developmental stage does not result from a strictly predetermined program instructing germ cell stemness. Rather, each developmental sequence is an open...

  17. 5S IN QUALITY MANAGEMENT

    BOCA GRATIELA DANA

    2015-07-01

    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  18. Time of action of 4.5 S RNA in Escherichia coli translation

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  19. Extragonadal Germ Cell Cancer (EGC)

    The Testicular Cancer Resource Center Extragonadal Germ Cell Cancer (EGC) 95% of all testicular tumors are germ cell tumors. That is, the tumors originate in the sperm forming cells in the testicles ( ...

  20. AiGERM: A logic programming front end for GERM

    Hashim, Safaa H.

    1990-01-01

    AiGerm (Artificially Intelligent Graphical Entity Relation Modeler) is a relational data base query and programming language front end for MCC (Mission Control Center)/STP's (Space Test Program) Germ (Graphical Entity Relational Modeling) system. It is intended as an add-on component of the Germ system to be used for navigating very large networks of information. It can also function as an expert system shell for prototyping knowledge-based systems. AiGerm provides an interface between the programming language and Germ.

  1. Guns, Germs and Steel

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 1. Guns, Germs and Steel - A Short History of Everybody for the Last 13,000 years. Suri Venkatachalam. Book Review Volume 6 Issue 1 January 2001 pp 84-88. Fulltext. Click here to view fulltext PDF. Permanent link:

  2. Foodborne Germs and Illnesses

    ... Español (Spanish) Recommend on Facebook Tweet Share Compartir What Causes Food Poisoning? Many different disease-causing germs can contaminate ... email address: Enter Email Address What’s this? Submit What's this? Submit Button ... of Foodborne Illness in the U.S. Food Safety is a CDC Winnable Battle Foodborne Illness ...

  3. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  4. A ribosome without RNA

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  5. Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.

    Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen

    2017-01-01

    Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of

  6. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  7. Identification of genes expressed in the hermaphrodite germ line of C. elegans using SAGE

    Wang, Xin; Zhao, Yongjun; Wong, Kim; Ehlers, Peter; Kohara, Yuji; Jones, Steven J; Marra, Marco A; Holt, Robert A; Moerman, Donald G; Hansen, Dave

    2009-01-01

    Background Germ cells must progress through elaborate developmental stages from an undifferentiated germ cell to a fully differentiated gamete. Some of these stages include exiting mitosis and entering meiosis, progressing through the various stages of meiotic prophase, adopting either a male (sperm) or female (oocyte) fate, and completing meiosis. Additionally, many of the factors needed to drive embryogenesis are synthesized in the germ line. To increase our understanding of the genes that might be necessary for the formation and function of the germ line, we have constructed a SAGE library from hand dissected C. elegans hermaphrodite gonads. Results We found that 4699 genes, roughly 21% of all known C. elegans genes, are expressed in the adult hermaphrodite germ line. Ribosomal genes are highly expressed in the germ line; roughly four fold above their expression levels in the soma. We further found that 1063 of the germline-expressed genes have enriched expression in the germ line as compared to the soma. A comparison of these 1063 germline-enriched genes with a similar list of genes prepared using microarrays revealed an overlap of 460 genes, mutually reinforcing the two lists. Additionally, we identified 603 germline-enriched genes, supported by in situ expression data, which were not previously identified. We also found >4 fold enrichment for RNA binding proteins in the germ line as compared to the soma. Conclusion Using multiple technological platforms provides a more complete picture of global gene expression patterns. Genes involved in RNA metabolism are expressed at a significantly higher level in the germ line than the soma, suggesting a stronger reliance on RNA metabolism for control of the expression of genes in the germ line. Additionally, the number and expression level of germ line expressed genes on the X chromosome is lower than expected based on a random distribution. PMID:19426519

  8. Identification of genes expressed in the hermaphrodite germ line of C. elegans using SAGE

    Holt Robert A

    2009-05-01

    Full Text Available Abstract Background Germ cells must progress through elaborate developmental stages from an undifferentiated germ cell to a fully differentiated gamete. Some of these stages include exiting mitosis and entering meiosis, progressing through the various stages of meiotic prophase, adopting either a male (sperm or female (oocyte fate, and completing meiosis. Additionally, many of the factors needed to drive embryogenesis are synthesized in the germ line. To increase our understanding of the genes that might be necessary for the formation and function of the germ line, we have constructed a SAGE library from hand dissected C. elegans hermaphrodite gonads. Results We found that 4699 genes, roughly 21% of all known C. elegans genes, are expressed in the adult hermaphrodite germ line. Ribosomal genes are highly expressed in the germ line; roughly four fold above their expression levels in the soma. We further found that 1063 of the germline-expressed genes have enriched expression in the germ line as compared to the soma. A comparison of these 1063 germline-enriched genes with a similar list of genes prepared using microarrays revealed an overlap of 460 genes, mutually reinforcing the two lists. Additionally, we identified 603 germline-enriched genes, supported by in situ expression data, which were not previously identified. We also found >4 fold enrichment for RNA binding proteins in the germ line as compared to the soma. Conclusion Using multiple technological platforms provides a more complete picture of global gene expression patterns. Genes involved in RNA metabolism are expressed at a significantly higher level in the germ line than the soma, suggesting a stronger reliance on RNA metabolism for control of the expression of genes in the germ line. Additionally, the number and expression level of germ line expressed genes on the X chromosome is lower than expected based on a random distribution.

  9. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  10. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  11. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  12. Ribosomal Antibiotics: Contemporary Challenges

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  13. Expanding the ribosomal universe.

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  14. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of post...

  15. A Study of the 5S Ribosomal RNAs of the Vibrionaceae

    1984-01-01

    codon (UAA, UAG, or UGA) TBE Tris-borate-EDTA buffer ug microgram, i.e., 10-’ gram 6 ul microliter. iJe., 10- 6 liter UPG unweighted pair-group UPGMA ...Psy~ww~w .......................... .. 4.------------------ 0 IC 5b. The UPGMA , or UPS average linkage, dendrogram resulting from the...cluster, and the V. damsela - Q. anguillarus doublet are identical to that predicted by UPGMA analysis. C. CONSERVED AND HYPERVARIABLE REGIONS As

  16. Germ killing by ultraviolet radiation

    Wawrik, O.

    1975-01-01

    Short-wave UV radiation, in particular the range about 250 nm, has a high germ reducing effect. Corresponding UV burners which above all emit radiation at the line of 254 nm can therefore be used effectively in all cases where the least possible content of germs in the air is aimed at. Apart from this it is also possible to reduce by this process the germs on surfaces and liquids. Especially in the most various ranges of pharmaceutical production one is steadily striving for efficient and last not least economic procedures by which it is possible to reduce the germs present in the air of a room. Numerous scientific investigations have sufficiently proved that short-wave UV radiation is extremely well appropriate for such purposes. Absolutely germ-free air in a room can only be obtained under laboratory conditions. In practice, however, the aim is not to achieve a 100 per cent killing of the germs present in a room but to make sure that the germ rate in certain rooms is constantly reduced to the lowest possible level. If in this connection it is referred to a germ reduction of 100 or 99 per cent this is but theory. (orig.) [de

  17. In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

    Schubert, I.; Baeumlein, H.; Wobus, U.

    1978-01-01

    In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)

  18. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  19. In vitro degradation of ribosomes.

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  20. Role of Axumin PET Scan in Germ Cell Tumor

    2018-05-01

    Testis Cancer; Germ Cell Tumor; Testicular Cancer; Germ Cell Tumor of Testis; Germ Cell Tumor, Testicular, Childhood; Testicular Neoplasms; Testicular Germ Cell Tumor; Testicular Yolk Sac Tumor; Testicular Choriocarcinoma; Testicular Diseases; Germ Cell Cancer Metastatic; Germ Cell Neoplasm of Retroperitoneum; Germ Cell Cancer, Nos

  1. Carbon magnetic resonance spectroscopy on carbon-13-labeled uracil in 5S ribonucleic acid

    Hamill, W.D.; Grant, D.M.; Cooper, R.B.; Harmon, S.A.

    1978-01-01

    The carbon-13 nuclear magnetic resonance spectra of the 13 C-enriched C-4 uridine carbons in 5S ribosomal ribonucleic acid of Salmonella typhimurium, strain JL-1055, was obtained. The most striking feature of the 5S RNA spectrum was the large number of well-resolved lines in the uridine band covering a chemical shift range of approximately 3.6 ppM. This data was used to obtain information on the secondary structure. The number of uridines involved in secondary interactions is estimated to be at least 75% and may be as high as 95%

  2. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  3. 5S-menetelmän implementointi

    Kaikula, Kari-Marko

    2017-01-01

    Tässä opinnäytetyössä tavoiteltiin siisteyden ja järjestyksen tuomista 5S-menetelmän avulla Helen Oy:n kunnossapidon varaosavarastoon Salmisaaren voimalaitoksella. Helen Oy on Helsingin kaupungin omistama energia-alan yritys. Kehittämistehtävänä työssä oli 5S-menetelmän implementointi. Tutkimuksen tarkoituksena oli tutkia niitä seikkoja, jotka vaikuttavat 5S-menetelmän käyttöönottoon. 5S on menetelmä, jolla tuodaan siisteyttä ja järjestystä työympäristöön. Tutkimusmenetelmänä oli toiminta...

  4. Yeast ribosomal proteins

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  5. 5S-menetelmän pilotointi

    Lampela, Saara

    2017-01-01

    Tämän opinnäytetyön tavoitteena oli siisteys- ja järjestystason parantaminen 5S-menetelmän avulla UPM Kaukaan paperitehtaalla. 5S on tuottavuuden parantamiseen keskittyvä lean-työkalu, jonka päätehtäväksi paperitehtaalla määritettiin erityisesti seisokkitilanteissa työvälineiden ja tavaroiden etsimiseen käytetyn ajan vähentäminen sekä työn yleinen jouhevoituminen. 5S-menetelmän nimi tulee japanin kielen sanoista Seiri, Seiton, Seiso, Seiketsu ja Shitsuke. Suomeksi vaiheet ovat lajittelu, järj...

  6. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  9. The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

    Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

    1989-01-01

    The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig

  10. Generalized oscillator strengths for 5s, 5s', and 5p excitations of krypton

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-01-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s ' , 5p [5/2] 3,2 , 5p [3/2] 1,2 , and 5p [1/2] 0 transitions of krypton have been determined in a large K 2 region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s ' transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s ' transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)

  11. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  12. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  13. Implementacija metode 5S v proces proizvodnje

    Alojz Gorše

    2016-03-01

    Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction

  14. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  15. Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

    Terao, K.; Uchiumi, T.; Ogata, K.

    1980-01-01

    After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)

  16. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  17. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  18. Don Germán

    Juan Luis Mejía

    1991-01-01

    El veranillo de San Juan hace soportable el mediodía. Los "chorros d'oro" inundan de amarillo los antejardines del Prado. Las golondrinas veraneras invaden, al atardecer, los alrededores de la Biblioteca Departamental. Los voceadores de la suerte del paseo Bolívar claman a los cuatro vientos el número que cambiará su destino . Pero algo falta definitivamente en esta Barranquilla. De alguna manera la ciudad ya no es la misma. Falta Don Germán.

  19. Don Germán

    Juan Luis Mejía

    1991-01-01

    Full Text Available El veranillo de San Juan hace soportable el mediodía. Los "chorros d'oro" inundan de amarillo los antejardines del Prado. Las golondrinas veraneras invaden, al atardecer, los alrededores de la Biblioteca Departamental. Los voceadores de la suerte del paseo Bolívar claman a los cuatro vientos el número que cambiará su destino . Pero algo falta definitivamente en esta Barranquilla. De alguna manera la ciudad ya no es la misma. Falta Don Germán.

  20. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  1. Stopping the Spread of Germs at Home, Work and School

    ... Pandemic Other Stopping the Spread of Germs at Home, Work & School Language: English (US) Español Recommend on Facebook ... everyone from getting germs or spreading germs at home, work, or school. Clean and disinfect surfaces or objects. ...

  2. Multiphoton microscopy imaging of developing tooth germs

    Pei-Yu Pan

    2014-01-01

    Conclusion: In this study, a novel multiphoton microscopy database of images from developing tooth germs in mice was set up. We confirmed that multiphoton laser microscopy is a powerful tool for investigating the development of tooth germ and is worthy for further application in the study of tooth regeneration.

  3. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  4. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Intracranial germ-cell tumors

    Baker, L.L.; Kollias, S.S.; Cogen, P.H.; Barkovich, A.J.

    1991-01-01

    This paper reports on the MR characteristics together with the clinical and histologic features of cerebral germ-cell tumors were investigated to augment data regarding this rare, diverse class of neoplasms. Germinomas were homogeneous or heterogeneous masses, predominantly isointense to normal brain on T1-weighted images, and hyperintense and heterogeneous on T2-weighted images; three showed adjacent brain edema. Enhancement was prominent, either homogeneous or heterogeneous. One had spinal drop metastases. Teratomas, more common in young patients, were more heterogeneous than germinomas on T1-weighted and T2-weighted images. Five showed hyper- and hypointense foci on T1-weighted images that corresponded to fat and calcium, respectively, at CT. Teratomas did not enhance or enhanced heterogeneously. Two had intratumoral hemorrhage; there were no metastases. Both patients with choriocarcinoma had hemorrhagic masses

  6. Radiosensitivity of mouse germ cells

    Matsuda, Yoichi; Takeuchi, Toyoko; Maemori, Mamiko; Seki, Naohiko; Tobari, Izuo

    1991-01-01

    To estimate radiosensitivity of mouse germ cells the analysis of chromosome aberrations was performed at diakinesis-metaphase I of spermatocytes and first-cleavage metaphase of one-cell embryos after exposure to radiations at various stages of primary spermatocytes and spermatids. The result provided evidence that there are two major types of DNA damage in X-irradiated sperm : (1) short-lived DNA lesions ; the lesions are subject to repair inhibition by agents added in G 1 , and are converted into chromosome-type aberrations during G 1 , and (2) long-lived DNA lesions ; the lesions persist until S phase and repair of the lesions is inhibited by caffeine, hydroxyurea and arabinofuranosyl cytosine in G 2 . The characteristic of X-ray damage induced in spermiogenic stage and repair mechanism for the damage in the fertilized egg were discussed comparing with the results with two chemicals, methyl methanesulfonate (MMS) and mitomycin C (MMC). (J.P.N.)

  7. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  8. Germ Cell-less Promotes Centrosome Segregation to Induce Germ Cell Formation

    Dorothy A. Lerit

    2017-01-01

    Full Text Available The primordial germ cells (PGCs specified during embryogenesis serve as progenitors to the adult germline stem cells. In Drosophila, the proper specification and formation of PGCs require both centrosomes and germ plasm, which contains the germline determinants. Centrosomes are microtubule (MT-organizing centers that ensure the faithful segregation of germ plasm into PGCs. To date, mechanisms that modulate centrosome behavior to engineer PGC development have remained elusive. Only one germ plasm component, Germ cell-less (Gcl, is known to play a role in PGC formation. Here, we show that Gcl engineers PGC formation by regulating centrosome dynamics. Loss of gcl leads to aberrant centrosome separation and elaboration of the astral MT network, resulting in inefficient germ plasm segregation and aborted PGC cellularization. Importantly, compromising centrosome separation alone is sufficient to mimic the gcl loss-of-function phenotypes. We conclude Gcl functions as a key regulator of centrosome separation required for proper PGC development.

  9. Epigenetic features of testicular germ cell tumours in relation to epigenetic characteristics of foetal germ cells

    Kristensen, Dina Graae; Skakkebæk, Niels E; Rajpert-De Meyts, Ewa

    2013-01-01

    in humans. However, the common precursor of testicular cancers- the carcinoma in situ (CIS) cell- is thought to be an arrested foetal germ cell. Therefore studies of CIS cells may leverage information on human foetal germ cell development and, in particular, when neoplastic transformation is initiated....... In this review, we will focus on current knowledge of the epigenetics of CIS cells and relate it to the epigenetic changes occurring in early developing germ cells of mice during specification, migration and colonization. We will focus on DNA methylation and some of the best studied histone modifications like H3...... event in the initiation of testicular germ cell cancer. Even though only sparse information is available on epigenetic cues in human foetal germ cells, these indicate that the developmental patterns differ from the findings in mice and emphasize the need for further studies of foetal germ cell...

  10. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  11. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  12. Control of ribosome formation in rat heart

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  13. Treatment Option Overview (Ovarian Germ Cell Tumors)

    ... Germ Cell Tumors Treatment (PDQ®)–Patient Version Treatment Option Overview Go to Health Professional Version Key Points ... and restore) the body’s blood cells. New treatment options Combination chemotherapy (the use of more than one ...

  14. Treatment Option Overview (Extragonadal Germ Cell Tumors)

    ... Cell Tumors Treatment Testicular Cancer Treatment Age and gender can affect the risk of extragonadal germ cell ... Headache. Change in bowel habits. Feeling very tired. Trouble walking. Trouble in seeing or moving the eyes. ...

  15. General Information about Extragonadal Germ Cell Tumors

    ... Cell Tumors Treatment Testicular Cancer Treatment Age and gender can affect the risk of extragonadal germ cell ... Headache. Change in bowel habits. Feeling very tired. Trouble walking. Trouble in seeing or moving the eyes. ...

  16. Epigenetic reprogramming in the porcine germ line

    Matzen, Sara Maj Hyldig; Croxall, Nicola; Contreras, David A.

    2011-01-01

    BACKGROUND: Epigenetic reprogramming is critical for genome regulation during germ line development. Genome-wide demethylation in mouse primordial germ cells (PGC) is a unique reprogramming event essential for erasing epigenetic memory and preventing the transmission of epimutations to the next...... an increased proportion of cells in G2. CONCLUSIONS: Our study demonstrates that epigenetic reprogramming occurs in pig migratory and gonadal PGC, and establishes the window of time for the occurrence of these events. Reprogramming of histone H3K9me2 and H3K27me3 detected between E15-E21 precedes the dynamic...... DNA demethylation at imprinted loci and DNA repeats between E22-E42. Our findings demonstrate that major epigenetic reprogramming in the pig germ line follows the overall dynamics shown in mice, suggesting that epigenetic reprogramming of germ cells is conserved in mammals. A better understanding...

  17. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

  18. Making safety an integral part of 5S in healthcare.

    Ikuma, Laura H; Nahmens, Isabelina

    2014-01-01

    Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.

  19. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Developmental regulation of Xenopus 5S RNA genes

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  1. Trapping the ribosome to control gene expression.

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  2. New evidence for the origin of intracranial germ cell tumours from primordial germ cells

    Hoei-Hansen, C E; Sehested, A; Juhler, M

    2006-01-01

    that it is not required for the initiation of malignant germ cell transformation. The expression of genes associated with embryonic stem cell pluripotency in CNS germ cell tumours strongly suggests that these tumours are derived from cells that retain, at least partially, an embryonic stem cell-like phenotype, which...... germ cell tumours and analysed expression of a wide panel of stem cell-related proteins (C-KIT, OCT-3/4 (POU5F1), AP-2gamma (TFAP2C), and NANOG) and developmentally regulated germ cell-specific proteins (including MAGE-A4, NY-ESO-1, and TSPY). Expression at the protein level was analysed in 21 children...... and young adults with intracranial germinomas and non-germinomas, contributing to a careful description of these unusual tumours and adding to the understanding of pathogenesis. Stem cell related proteins were highly expressed in intracranial germ cell tumours, and many similarities were detected...

  3. Differential Stoichiometry among Core Ribosomal Proteins

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  4. Establishment of the Vertebrate Germ Layers.

    Tseng, Wei-Chia; Munisha, Mumingjiang; Gutierrez, Juan B; Dougan, Scott T

    2017-01-01

    The process of germ layer formation is a universal feature of animal development. The germ layers separate the cells that produce the internal organs and tissues from those that produce the nervous system and outer tissues. Their discovery in the early nineteenth century transformed embryology from a purely descriptive field into a rigorous scientific discipline, in which hypotheses could be tested by observation and experimentation. By systematically addressing the questions of how the germ layers are formed and how they generate overall body plan, scientists have made fundamental contributions to the fields of evolution, cell signaling, morphogenesis, and stem cell biology. At each step, this work was advanced by the development of innovative methods of observing cell behavior in vivo and in culture. Here, we take an historical approach to describe our current understanding of vertebrate germ layer formation as it relates to the long-standing questions of developmental biology. By comparing how germ layers form in distantly related vertebrate species, we find that highly conserved molecular pathways can be adapted to perform the same function in dramatically different embryonic environments.

  5. Review on Implementation of 5S in Various Organization

    Vipulkumar C. Patel; Dr. Hemant Thakkar

    2014-01-01

    This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ effic...

  6. PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY

    Beata GALA

    2013-10-01

    Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.

  7. Radiotherapy of patients with germ cell tumor

    Inomata, Taisuke; Maeda, Tomoho; Yoshida, Shoji; Ogawa, Yasuhiro; Hamada, Fumio; Imajo, Yoshinari; Gose, Kyuhei; Fujiwara, Kiyoshi.

    1986-01-01

    Twenty-one patients with germ cell tumor who received radiotherapy were discussed. There were eight patients with germinoma, two patients with malignant teratoma, three patients with pineocytoma (out of category of germ cell tumor today) and eight unverified patients. Irradiated dose was mostly from 50 Gy to 60 Gy and local irradiation was performed after whole brain irradiation in many cases. The effect of radiotherapy was not so good in patients with malignant teratoma. On the contrary, it was relatively good in patients with germinoma and five out of eight patients are alive with no symptoms of recurrence. Six out of eight unverified patients are also alive. Among them, several patients with germinoma are considered to be included. Germinoma occupies many cases of germ cell tumor and has a good response to radiotherapy. Against spinal cord metastasis and late recurrence, additional therapy, such as chemotherapy, seems to be useful to improve cure ratio. (author)

  8. [Germ cell membrane lipids in spermatogenesis].

    Wang, Ting; Shi, Xiao; Quan, Song

    2016-05-01

    Spermatogenesis is a complex developmental process in which a diploid progenitor germ cell transforms into highly specialized spermatozoa. During spermatogenesis, membrane remodeling takes place, and cell membrane permeability and liquidity undergo phase-specific changes, which are all associated with the alteration of membrane lipids. Lipids are important components of the germ cell membrane, whose volume and ratio fluctuate in different phases of spermatogenesis. Abnormal lipid metabolism can cause spermatogenic dysfunction and consequently male infertility. Germ cell membrane lipids are mainly composed of cholesterol, phospholipids and glycolipids, which play critical roles in cell adhesion and signal transduction during spermatogenesis. An insight into the correlation of membrane lipids with spermatogenesis helps us to better understand the mechanisms of spermatogenesis and provide new approaches to the diagnosis and treatment of male infertility.

  9. Tooth-germ damage by ionizing radiation

    Sobkowiak, E.M.; Beetke, E.; Bienengraeber, V.; Held, M.; Kittner, K.H.

    1977-01-01

    Experiments on animals (four-week-old dogs) were conducted in an investigation made to study the possibility of dose-dependent tooth-germ damage produced by ionizing radiation. The individual doses were 50 R and 200 R, respectively, and they were administered once to three times at weekly intervals. Hyperemia and edemata could be observed on tooth-germ pulps from 150 R onward. Both of these conditions became more acute as the radiation dose increased (from 150 R to 600 R). Possible damage to both the dentin and enamel is pointed out. (author)

  10. Germ line mechanics – and unfinished business

    Wessel, Gary M.

    2016-01-01

    Primordial germ cells are usually made early in the development of an organism. These are the mother of all stem cells that are necessary for propagation of the species, yet use highly diverse mechanisms between organisms. How they are specified, and when and where they form, are central to developmental biology. Using diverse organisms to study this development is illuminating for understanding the mechanics these cells use in this essential function, and for identifying the breadth of evolutionary changes that have occurred between species. This essay emphasizes how echinoderms may contribute to the patch-work quilt of our understanding of germ line formation during embryogenesis. PMID:26970000

  11. Stability of wheat germ oil obtained by supercritical carbon dioxide ...

    심정은

    accumulated gas volume passing through the apparatus were measured using a gas flow meter. Wheat germ oil was ..... of rancidity in wheat germ analyzed by headspace gas chromatography and sensory analysis. J. Agric. Food Chem.

  12. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  13. Stages of Childhood Extracranial Germ Cell Tumors

    ... tumors: Yolk sac tumors make a hormone called alpha-fetoprotein (AFP). They can form in the ovary, testicle, ... are used to detect extracranial germ cell tumors: Alpha-fetoprotein (AFP). Beta-human chorionic gonadotropin (β-hCG). For ...

  14. Linearization of germs of hyperbolic vector fields

    Bonckaert, P; Naudot, [No Value; Yang, JZ

    2003-01-01

    We develop a normal form to express asymptotically a conjugacy between a germ of resonant vector field and its linear part. We show that such an asymptotic expression can be written in terms of functions of the Logarithmic Mourtada type. To cite this article: P Bonckaert et al., C. R. Acad. Sci.

  15. Molecular dynamics simulation of ribosome jam

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  16. Ribosome evolution: Emergence of peptide synthesis machinery

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  17. Is The Ribosome Targeted By Adaptive Mutations

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  18. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  19. A germ cell determinant reveals parallel pathways for germ line development in Caenorhabditis elegans.

    Mainpal, Rana; Nance, Jeremy; Yanowitz, Judith L

    2015-10-15

    Despite the central importance of germ cells for transmission of genetic material, our understanding of the molecular programs that control primordial germ cell (PGC) specification and differentiation are limited. Here, we present findings that X chromosome NonDisjunction factor-1 (XND-1), known for its role in regulating meiotic crossover formation, is an early determinant of germ cell fates in Caenorhabditis elegans. xnd-1 mutant embryos display a novel 'one PGC' phenotype as a result of G2 cell cycle arrest of the P4 blastomere. Larvae and adults display smaller germ lines and reduced brood size consistent with a role for XND-1 in germ cell proliferation. Maternal XND-1 proteins are found in the P4 lineage and are exclusively localized to the nucleus in PGCs, Z2 and Z3. Zygotic XND-1 turns on shortly thereafter, at the ∼300-cell stage, making XND-1 the earliest zygotically expressed gene in worm PGCs. Strikingly, a subset of xnd-1 mutants lack germ cells, a phenotype shared with nos-2, a member of the conserved Nanos family of germline determinants. We generated a nos-2 null allele and show that nos-2; xnd-1 double mutants display synthetic sterility. Further removal of nos-1 leads to almost complete sterility, with the vast majority of animals without germ cells. Sterility in xnd-1 mutants is correlated with an increase in transcriptional activation-associated histone modification and aberrant expression of somatic transgenes. Together, these data strongly suggest that xnd-1 defines a new branch for PGC development that functions redundantly with nos-2 and nos-1 to promote germline fates by maintaining transcriptional quiescence and regulating germ cell proliferation. © 2015. Published by The Company of Biologists Ltd.

  20. Crystallization of ribosomes from Thermus thermophilus

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  1. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. Environmentally induced transgenerational epigenetic reprogramming of primordial germ cells and the subsequent germ line.

    Michael K Skinner

    Full Text Available A number of environmental factors (e.g. toxicants have been shown to promote the epigenetic transgenerational inheritance of disease and phenotypic variation. Transgenerational inheritance requires the germline transmission of altered epigenetic information between generations in the absence of direct environmental exposures. The primary periods for epigenetic programming of the germ line are those associated with primordial germ cell development and subsequent fetal germline development. The current study examined the actions of an agricultural fungicide vinclozolin on gestating female (F0 generation progeny in regards to the primordial germ cell (PGC epigenetic reprogramming of the F3 generation (i.e. great-grandchildren. The F3 generation germline transcriptome and epigenome (DNA methylation were altered transgenerationally. Interestingly, disruptions in DNA methylation patterns and altered transcriptomes were distinct between germ cells at the onset of gonadal sex determination at embryonic day 13 (E13 and after cord formation in the testis at embryonic day 16 (E16. A larger number of DNA methylation abnormalities (epimutations and transcriptional alterations were observed in the E13 germ cells than in the E16 germ cells. These observations indicate that altered transgenerational epigenetic reprogramming and function of the male germline is a component of vinclozolin induced epigenetic transgenerational inheritance of disease. Insights into the molecular control of germline transmitted epigenetic inheritance are provided.

  3. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. © 2014 S. Karger AG, Basel.

  4. Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli

    Brown, S

    1987-01-01

    A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way...... that the strain becomes dependent upon inducers of lac for growth. Mutants mapping to fus, the structural gene for protein synthesis elongation factor G, appear as spontaneous, inducer-independent revertants. These mutants alter the intracellular distribution of 4.5S RNA such that it sediments at 70S or greater....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....

  5. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  6. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  7. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  8. Large Scale Construction Project Innovative Management Through 5-S

    Hashim Hj. Abdul Ghani Mohd.

    2014-11-01

    Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.

  9. Implementation of 5S Method for Ergonomic Laboratory

    Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

    2017-06-01

    This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

  10. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  11. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  12. Molecular biology of testicular germ cell tumors.

    Gonzalez-Exposito, R; Merino, M; Aguayo, C

    2016-06-01

    Testicular germ cell tumors (TGCTs) are the most common solid tumors in young adult men. They constitute a unique pathology because of their embryonic and germ origin and their special behavior. Genetic predisposition, environmental factors involved in their development and genetic aberrations have been under study in many works throughout the last years trying to explain the susceptibility and the transformation mechanism of TGCTs. Despite the high rate of cure in this type of tumors because its particular sensitivity to cisplatin, there are tumors resistant to chemotherapy for which it is needed to find new therapies. In the present work, it has been carried out a literature review on the most important molecular aspects involved in the onset and development of such tumors, as well as a review of the major developments regarding prognostic factors, new prognostic biomarkers and the possibility of new targeted therapies.

  13. Strong decays and dipion transitions of Y(5S)

    Simonov, Yu.A.; Veselov, A.I.

    2009-01-01

    Dipion transitions of Y(nS) with n=5, n ' =1,2,3 are studied using the Field Correlator Method, applied previously to dipion transitions with n=2,3,4. The only two parameters of effective Lagrangian were fixed in that earlier study, and total widths Γ ππ (5,n ' ) as well as pionless decay widths Γ BB (5S), Γ BB* (5S), Γ B*B* (5S) and Γ KK (5,n ' ) were calculated and are in a reasonable agreement with experiment. The experimental ππ spectra for (5,1) and (5,2) transitions are well reproduced taking into account FSI in the ππ

  14. Assessment of application of 5S practices in ceramic industry

    Danel Kleszcz

    2017-10-01

    Full Text Available Results of research connected with determining the degree of implementation of 5S practices in ceramics industry are discussed in this paper. Direct survey with employees of companies plus ex-pert interview was used in the research. A 21 point scale was used to assess the degree of implemen-tation the 5S practices at individual stages of the manufacturing process. The specificity of produc-tion in ceramics industry enforces maintaining the regime of cleanliness during production. The research revealed that the level of conscious implementation of the 5S practices in companies de-pends on the culture of organization and the degree of involvement of employees in the improvement actions in their company. The presented results are a part of the research aimed at determining refer-ence requirements for companies in terms of implementation and making use of the Lean Manage-ment (LM instruments.

  15. DNA repair studies in mammalian germ cells

    Sega, G.A.; Owens, J.G.

    1984-01-01

    In submammalian test systems, nitrosocarbamates (NEC) are 100-fold more mutagenic than are their corresponding nitrosourea homologues. To learn more about its interaction with germ-cell DNA in the mouse testis, male mice were given i.p. injections of NEC. Testicular injections of [ 3 H]dThd were given along with the NEC. Sixteen days after treatment, sperm were recovered from the caudal epididymides and assayed for an unscheduled-DNA-synthesis

  16. Diagnostic markers for germ cell neoplasms

    Rajpert-De Meyts, Ewa; Nielsen, John E; Skakkebaek, Niels E

    2015-01-01

    This concise review summarises tissue and serum markers useful for differential diagnosis of germ cell tumours (GCTs), with focus on the most common testicular GCTs (TGCTs). GCTs are characterised by phenotypic heterogeneity due to largely retained embryonic pluripotency and aberrant somatic diff...... of molecular markers, which allow specific diagnosis of various subtypes of GCT and are very useful for early detection at the precursor stage and for monitoring of patients during the follow-up....

  17. A role for Lin28 in primordial germ cell development and germ cell malignancy

    West, Jason A.; Viswanathan, Srinivas R.; Yabuuchi, Akiko; Cunniff, Kerianne; Takeuchi, Ayumu; Park, In-Hyun; Sero, Julia E.; Zhu, Hao; Perez-Atayde, Antonio; Frazier, A. Lindsay; Surani, M. Azim; Daley, George Q.

    2009-01-01

    The rarity and inaccessibility of the earliest primordial germ cells (PGCs) in the mouse embryo thwarts efforts to investigate molecular mechanisms of germ cell specification. Stella marks the minute founder population of the germ lineage1,2. Here we differentiate mouse embryonic stem cells (ESCs) carrying a Stella transgenic reporter into putative PGCs in vitro. The Stella+ cells possess a transcriptional profile similar to embryo-derived PGCs, and like their counterparts in vivo, lose imprints in a time-dependent manner. Using inhibitory RNAs to screen candidate genes for effects on the development of Stella+ cells in vitro, we discovered that Lin28, a negative regulator of let-7 microRNA processing3-6, is essential for proper PGC development. We further show that Blimp1, a let-7 target and a master regulator of PGC specification7-9, can rescue the effect of Lin28-deficiency during PGC development, thereby establishing a mechanism of action for Lin28 during PGC specification. Over-expression of Lin28 promotes formation of Stella+ cells in vitro and PGCs in chimeric embryos, and is associated with human germ cell tumours. The differentiation of putative PGCs from ESCs in vitro recapitulates the early stages of gamete development in vivo, and provides an accessible system for discovering novel genes involved in germ cell development and malignancy. PMID:19578360

  18. Radiation Therapy of Suprasellar Germ Cell Tumors

    Park, Woo Yoon; Choi, Doo Ho; Choi, Eun Kyung; Kim, Il Han; Ha, Sung Whan; Park, Charn Il

    1988-01-01

    A retrospective study was performed on 15 patients with suprasellar germ cell tumors treated by megavoltage external beam irradiation between Feb. 1979 and Dec. 1985. Follow-up period of survivors was 30 to 91 months. Histologic diagnosis was obtained before radiation therapy in 10 patients (9 germinomas and 1 mixed). Five patients were treated without histologic verification. In 9 patients with biopsy-proven germinomas radiation therapy was delivered to the craniospinal axis in 6, to the whole brain in 3. In 5 patients with mixed germ cell tumor or elevated tumor marker, irradiation was delivered to the craniospinal axis in 2, to the whole brain in 2, and to the primary site only in 1. Total doses ranged from 5,000 to 5,500 cGy to the primary site, 3,000 to 4,400 cGy to the whole brain, and 1,300 to 3,000 cGy to the spine. In these 14, local tumor was controlled and primary or spinal failure was not observed. One patient without elevated tumor marker was treated to the whole brain, The tumor was not controlled and he had spinal recurrence. It is proven that radiation therapy is an effective treatment for suprasellar germ cell tumors. The neuroendocrinologic presentation, tumor marker status, early response to radiation measured on CT seem to be useful means for selecting patients for radiation therapy when tissue diagnosis is not available

  19. 5S-toimintamallin kehittäminen nostintuotannossa

    Laine, Atte

    2017-01-01

    TIIVISTELMÄ Opinnäytetyön aiheena oli kehittää 5S-toimintamallia Konecranes Finland Oy:n nostintuotannossa Hämeenlinnan nostintehtaalla. Konecranesilla käytetään Lean Six Sigma -menetelmiä prosessien ja liiketoiminnan kehittämiseen ja 5S-toimintamalli on yksi näistä Lean Six Sigmaan kuuluvista menetelmistä. Se on jo osittain käytössä Hämeenlinnan nostintehtaalla ja nyt tehtaan nostinkokoonpanoon oli saatava sama toimintamalli kuin muillakin tehtaan osastoilla. Opinnäytetyössä perehdyttiin...

  20. Radiative transitions from Υ(5S) to molecular bottomonium

    Voloshin, M. B.

    2011-01-01

    The heavy quark spin symmetry implies that in addition to the recently observed Z(10610) and Z(10650) molecular resonances with I G =1 + , there should exist two or four molecular bottomonium-like states with I G =1 - . Properties of these G-odd states are considered, including their production in the radiative transitions from Υ(5S), by applying the same symmetry to the Υ(5S) resonance and the transition amplitudes. The considered radiative processes can provide a realistic option for observing the yet hypothetical states.

  1. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  2. Understanding Mammalian Germ Line Development with In Vitro Models.

    Martínez-Arroyo, Ana M; Míguez-Forján, Jose M; Remohí, Jose; Pellicer, Antonio; Medrano, Jose V

    2015-09-15

    Germ line development is crucial in organisms with sexual reproduction to complete their life cycle. In mammals, knowledge about germ line development is based mainly on the mouse model, in which genetic and epigenetic events are well described. However, little is known about how germ line development is orchestrated in humans, especially in the earliest stages. New findings derived from human in vitro models to obtain germ cells can shed light on these questions. This comprehensive review summarizes the current knowledge about mammalian germ line development, emphasizing the state of the art obtained from in vitro models for germ cell-like cell derivation. Current knowledge of the pluripotency cycle and germ cell specification has allowed different in vitro strategies to obtain germ cells with proven functionality in mouse models. Several reports during the last 10 years show that in vitro germ cell derivation with proven functionality to generate a healthy offspring is possible in mice. However, differences in the embryo development and pluripotency potential between human and mouse make it difficult to extrapolate these results. Further efforts on both human and mouse in vitro models to obtain germ cells from pluripotent stem cells may help to elucidate how human physiological events take place; therefore, therapeutic strategies can also be considered.

  3. Convergent evolution of germ granule nucleators: A hypothesis.

    Kulkarni, Arpita; Extavour, Cassandra G

    2017-10-01

    Germ cells have been considered "the ultimate stem cell" because they alone, during normal development of sexually reproducing organisms, are able to give rise to all organismal cell types. Morphological descriptions of a specialized cytoplasm termed 'germ plasm' and associated electron dense ribonucleoprotein (RNP) structures called 'germ granules' within germ cells date back as early as the 1800s. Both germ plasm and germ granules are implicated in germ line specification across metazoans. However, at a molecular level, little is currently understood about the molecular mechanisms that assemble these entities in germ cells. The discovery that in some animals, the gene products of a small number of lineage-specific genes initiate the assembly (also termed nucleation) of germ granules and/or germ plasm is the first step towards facilitating a better understanding of these complex biological processes. Here, we draw on research spanning over 100years that supports the hypothesis that these nucleator genes may have evolved convergently, allowing them to perform analogous roles across animal lineages. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  4. On the development of extragonadal and gonadal human germ cells

    A. Marijne Heeren

    2016-02-01

    Full Text Available Human germ cells originate in an extragonadal location and have to migrate to colonize the gonadal primordia at around seven weeks of gestation (W7, or five weeks post conception. Many germ cells are lost along the way and should enter apoptosis, but some escape and can give rise to extragonadal germ cell tumors. Due to the common somatic origin of gonads and adrenal cortex, we investigated whether ectopic germ cells were present in the human adrenals. Germ cells expressing DDX4 and/or POU5F1 were present in male and female human adrenals in the first and second trimester. However, in contrast to what has been described in mice, where ‘adrenal’ and ‘ovarian’ germ cells seem to enter meiosis in synchrony, we were unable to observe meiotic entry in human ‘adrenal’ germ cells until W22. By contrast, ‘ovarian’ germ cells at W22 showed a pronounced asynchronous meiotic entry. Interestingly, we observed that immature POU5F1+ germ cells in both first and second trimester ovaries still expressed the neural crest marker TUBB3, reminiscent of their migratory phase. Our findings highlight species-specific differences in early gametogenesis between mice and humans. We report the presence of a population of ectopic germ cells in the human adrenals during development.

  5. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  6. TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD

    Raluca BRAD

    2015-05-01

    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  7. Analyzing Digital Library Initiatives: 5S Theory Perspective

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  8. Lipase inactivation in wheat germ by gamma irradiation

    Jha, Pankaj Kumar; Kudachikar, V.B.; Kumar, Sourav

    2013-01-01

    An attempt was made to improve the shelf life of wheat germ by optimizing processing conditions involving γ-irradiation. Studies were carried out to investigate the effect of γ-irradiation (0–30 kGy doses) on the chemical composition of wheat germ with respect to variation in moisture, total ash, crude fat, free fatty acid, protein and lipase activity. The results demonstrate that shelf stability of wheat germ was achieved by inactivation of lipase at doses of γ-irradiation greater than 12 kGy. - Highlights: Ø γ-irradiation was found to inactivate Lipase present in Wheat Germ. Ø The treatment did not result in significant changes in Total Ash, Moisture and Protein Content of Wheat Germ. Ø The irradiation at 30 kGy resulted in 31.2 % inactivation of Lipase in Wheat Germ

  9. Lin28a regulates germ cell pool size and fertility

    Shinoda, Gen; de Soysa, T. Yvanka; Seligson, Marc T.; Yabuuchi, Akiko; Fujiwara, Yuko; Huang, Pei Yi; Hagan, John P.; Gregory, Richard I.; Moss, Eric G.; Daley, George Q.

    2013-01-01

    Overexpression of LIN28A is associated with human germ cell tumors and promotes primordial germ cell (PGC) development from embryonic stem cells in vitro and in chimeric mice. Knockdown of Lin28a inhibits PGC development in vitro, but how constitutional Lin28a deficiency affects the mammalian reproductive system in vivo remains unknown. Here, we generated Lin28a knockout (KO) mice and found that Lin28a deficiency compromises the size of the germ cell pool in both males and females by affecting PGC proliferation during embryogenesis. Interestingly however, in Lin28a KO males the germ cell pool partially recovers during postnatal expansion, while fertility remains impaired in both males and females mated to wild type mice. Embryonic overexpression of let-7, a microRNA negatively regulated by Lin28a, reduces the germ cell pool, corroborating the role of the Lin28a/let-7 axis in regulating the germ lineage. PMID:23378032

  10. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  11. Germ Plasm Biogenesis--An Oskar-Centric Perspective.

    Lehmann, Ruth

    2016-01-01

    Germ granules are the hallmark of all germ cells. These membrane-less, electron-dense structures were first observed over 100 years ago. Today, their role in regulating and processing transcripts critical for the establishment, maintenance, and protection of germ cells is well established, and pathways outlining the biochemical mechanisms and physical properties associated with their biogenesis are emerging. © 2016 Elsevier Inc. All rights reserved.

  12. Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

    Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

    2004-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

  13. Cytokeratin expression in mouse lacrimal gland germ epithelium.

    Hirayama, Masatoshi; Liu, Ying; Kawakita, Tetsuya; Shimmura, Shigeto; Tsubota, Kazuo

    2016-05-01

    The lacrimal gland secretes tear fluids that protect the ocular surface epithelium, and its dysfunction leads to dry eye disease (DED). The functional restoration of the lacrimal gland by engraftment of a bioengineered lacrimal gland using lacrimal gland germ epithelial cells has been proposed to cure DED in mice. Here, we investigate the expression profile of cytokeratins in the lacrimal gland germ epithelium to clarify their unique characteristics. We performed quantitative polymerase chain reaction (Q-PCR) and immunohistochemistry (IHC) analysis to clarify the expression profile of cytokeratin in the lacrimal gland germ epithelium. The mRNA expression of keratin (KRT) 5, KRT8, KRT14, KRT15, and KRT18 in the lacrimal gland germ epithelium was increased compared with that in mouse embryonic stem cells and the lacrimal gland germ mesenchyme, as analyzed by Q-PCR. The expression level of KRT15 increased in the transition from stem cells to lacrimal gland germ epithelium, then decreased as the lacrimal gland matured. IHC revealed that the expression set of these cytokeratins in the lacrimal gland germ epithelium was different from that in the adult lacrimal gland. The expression of KRT15 was observed in the lacrimal gland germ epithelium, and it segmentalized into some of the basal cells in the intercanulated duct in mature gland. We determined the expression profile of cytokeratins in the lacrimal gland epithelium, and identified KRT15 as a candidate unique cellular marker for the lacrimal gland germ epithelium. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Molecular biological features of male germ cell differentiation

    HIROSE, MIKA; TOKUHIRO, KEIZO; TAINAKA, HITOSHI; MIYAGAWA, YASUSHI; TSUJIMURA, AKIRA; OKUYAMA, AKIHIKO; NISHIMUNE, YOSHITAKE

    2007-01-01

    Somatic cell differentiation is required throughout the life of a multicellular organism to maintain homeostasis. In contrast, germ cells have only one specific function; to preserve the species by conveying the parental genes to the next generation. Recent studies of the development and molecular biology of the male germ cell have identified many genes, or isoforms, that are specifically expressed in the male germ cell. In the present review, we consider the unique features of male germ cell differentiation. (Reprod Med Biol 2007; 6: 1–9) PMID:29699260

  15. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  16. Gene manipulation: churches against germ changes.

    Budiansky, S

    An immediate ban on human genetic engineering that alters germ cells is called for in a resolution, written by activist Jeremy Rifkin, that was released last week over the signatures of 21 Catholic bishops, a broad spectrum of Protestant and Jewish religious leaders, and three scientists. The resolution takes a much harder line than was espoused by religious leaders in a letter to the now-defunct President's Commission for the Study of Ethical Problems in Medicine and Biomedical and Behavioral Research. Several of the signers indicated that they did not fully agree with the resolution, but saw it as a good vehicle to encourage public discussion.

  17. Radiation- induced aneuploidy in mammalian germ cells

    Tease, C.

    1989-01-01

    The ability of ionizing radiation to induce aneuploidy in mammalian germ cells has been investigated experimentally in the laboratory mouse using a variety of cytogenetic and genetic methods. These studies have provided unambiguous evidence of induced nondisjunction in both male and female germ cells when the effect of irradiation is screened in meiotic cells or preimplantation embryos. In contrast, however, cytogenetic analyses of post-implantation embryos and genetic assays for induced chromosome gains have not found a significant radiation effect. These apparently contradictory findings may be reconciled if (a) radiation induces tertiary rather than primary trisomy, or (b) induces embryo-lethal genetic damage, such as deletions, in addition to numerical anomalies. Either or both of these explanations may account for the apparent loss during gestation of radiation-induced trisomic embryos. Extrapolating from the information so far available, it seems unlikely that environmental exposure to low doses if low dose rate radiation will result in a detectable increase in the rate of aneuploidy in the human population. (author)

  18. Intestinal obstruction in germ-free dogs.

    Heneghan, J B; Robinson, J W; Menge, H; Winistörfer, B

    1981-08-01

    Mechanical occlusions were created in the intestines of four germ-free dogs. At the time of the operation, a control loop of mid-intestine was perfused in vivo and then excised for examinations in vitro, which included the determination of the equilibrium uptake of phenylalanine and of beta-methyl-glucoside, the influx kinetics of phenylalanine and morphometric analysis of the mucosa by microdissection and stereological techniques. Seven days after establishment of the occlusion the abdomen was reopened, and loops above and below the occlusion were perfused, and then excised for the same tests in vitro. Unlike occluded loops of conventional dogs, the intestine of the germ-free animal above the occlusion does not secrete water and electrolytes into the lumen. Its transport properties in vitro do not differ from those of the control loop, and the morphometric analyses reveal only slight changes in villus structure. The loop below the obstruction undergoes marked atrophy, as has been observed in conventional dogs. The results suggest that the copious secretion that occurs above an intestinal obstruction in normal animals is due to the presence of an abundant bacterial population in the obstruction fluid.

  19. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  20. GTPases and the origin of the ribosome

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  1. Primordial germ cells and amnion development in the avian embryo

    De Melo Bernardo, Ana

    2016-01-01

    Primordial germ cells (PGCs) are the progenitors of the gametes, responsible for transmitting genetic information from generation to generation. Although there is a long history of gamete biology research, there is still a lot to be learned about many of the mechanisms underlying germ cell

  2. Childhood Central Nervous System Germ Cell Tumors Treatment

    ... make hormones. Yolk sac tumors make the hormone alpha-fetoprotein (AFP). Mixed germ cell tumors are made of ... used to diagnose some CNS germ cell tumors: Alpha-fetoprotein (AFP). Beta-human chorionic gonadotropin (β-hCG). Blood ...

  3. Is Tobacco Smoke a Germ-Cell Mutagen?

    Although no international organization exists to declare whether an agent is a germ-cell mutagen, tobacco smoke may be a human germ-cell mutagen. In the mouse, tobacco smoke induces a significant increase in the mutation frequency at an expanded simple tandem repeat (ESTR) locus....

  4. Germ cell transplantation in an azoospermic Klinefelter bull.

    Joerg, Hannes; Janett, Fredi; Schlatt, Stefan; Mueller, Simone; Graphodatskaya, Daria; Suwattana, Duangsmorn; Asai, Mika; Stranzinger, Gerald

    2003-12-01

    Germ cell transplantation is a technique that transfers donor testicular cells into recipient testes. A population of germ cells can colonize the recipient testis, initiate spermatogenesis, and produce sperm capable of fertilization. In the present study, a nonmosaic Klinefelter bull was used as a germ cell recipient. The donor cell suspension was introduced into the rete testis using ultrasound-guided puncture. A pulsatile administration of GnRH was performed to stimulate spermatogenesis. The molecular approach to detect donor cells was done by a quantitative polymerase chain reaction with allele discrimination based on a genetic mutation between donor and recipient. Therefore, a known genetic mutation, associated with coat-color phenotype, was used to calculate the ratio of donor to recipient cells in the biopsy specimens and ejaculates for 10 mo. After slaughtering, meiotic preparations were performed. The injected germ cells did not undergo spermatogenesis. Six months after germ cell transplantation, the donor cells were rejected, which indicates that the donor cells could not incorporate in the testis. The hormone stimulation showed that the testosterone-producing Leydig cells were functionally intact. Despite subfertility therapy, neither the recipient nor the donor cells underwent spermatogenesis. Therefore, nonmosaic Klinefelter bulls are not suitable as germ cell recipients. Future germ cell recipients in cattle could be mosaic Klinefelters, interspecies hybrids, bulls with Sertoli cell-only syndrome, or bulls with disrupted germ cell migration caused by RNA interference.

  5. Editorial Introduction [to Female Germ Cells: Biology and Genetic Risk

    This is an editorial introduction to the special issue of utation Research, titled, emale Germ Cells: Biology and Genetic isk, which is an attempt to present a collection of papers that emphasize the distinct properties of female germ cells and their characteristic response to mu...

  6. A poly (U) polymerase in ribosome preparations from Ehrlich ascites tumor cells

    Guimaraes, R.C.; Bloch, D.P.

    1981-01-01

    A ribosome-bound poly (U) polymerase from Ehrlich ascites tumor cells is partially characterized. It adds UMPs to RNAs terminating in U-(3')-OH. The UMP-rich segments added reach average sizes of up to 18 nucleotides. CTP is strongly inhibitory to the enzyme. The main endogenous primers are low molecular weight RNAs which are found, after the addition of UMPs, mostly in the 6-8 S range. Some evidence suggests that a 5 S rRNA or polysome-associated 7 S RNA could be the main endogenous primers. (Author) [pt

  7. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...

  8. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  9. Developmental arrest of germ cells in the pathogenesis of germ cell neoplasia

    Rajpert-De Meyts, E; Jørgensen, N; Brøndum-Nielsen, K

    1998-01-01

    Clinical observations and epidemiological evidence suggest that important aetiopathological events that cause neoplastic transformation of the male germ cell may occur in fetal life or early infancy. The incidence of germ cell neoplasia is high in individuals with various disorders of gonadal...... development and sexual differentiation, such as gonadal dysgenesis or androgen insensitivity syndrome. Increased risk has also been noted in individuals with trisomy 21, idiopathic infertility and low birth weight. Infertility is sometimes associated with small aberrations of sex chromosomes (e.g. low...... frequency mosaicism XY/XO) which can also be found in patients with testicular cancer. The variety of conditions that predispose to testicular neoplasia and the rise in its incidence in many countries speaks for the influence of environmental factors which may affect genetically predisposed individuals. We...

  10. Dynamic distribution patterns of ribosomal DNA and chromosomal evolution in Paphiopedilum, a lady's slipper orchid

    Albert Victor A

    2011-09-01

    Full Text Available Abstract Background Paphiopedilum is a horticulturally and ecologically important genus of ca. 80 species of lady's slipper orchids native to Southeast Asia. These plants have long been of interest regarding their chromosomal evolution, which involves a progressive aneuploid series based on either fission or fusion of centromeres. Chromosome number is positively correlated with genome size, so rearrangement processes must include either insertion or deletion of DNA segments. We have conducted Fluorescence In Situ Hybridization (FISH studies using 5S and 25S ribosomal DNA (rDNA probes to survey for rearrangements, duplications, and phylogenetically-correlated variation within Paphiopedilum. We further studied sequence variation of the non-transcribed spacers of 5S rDNA (5S-NTS to examine their complex duplication history, including the possibility that concerted evolutionary forces may homogenize diversity. Results 5S and 25S rDNA loci among Paphiopedilum species, representing all key phylogenetic lineages, exhibit a considerable diversity that correlates well with recognized evolutionary groups. 25S rDNA signals range from 2 (representing 1 locus to 9, the latter representing hemizygosity. 5S loci display extensive structural variation, and show from 2 specific signals to many, both major and minor and highly dispersed. The dispersed signals mainly occur at centromeric and subtelomeric positions, which are hotspots for chromosomal breakpoints. Phylogenetic analysis of cloned 5S rDNA non-transcribed spacer (5S-NTS sequences showed evidence for both ancient and recent post-speciation duplication events, as well as interlocus and intralocus diversity. Conclusions Paphiopedilum species display many chromosomal rearrangements - for example, duplications, translocations, and inversions - but only weak concerted evolutionary forces among highly duplicated 5S arrays, which suggests that double-strand break repair processes are dynamic and ongoing. These

  11. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  12. Characterization of germ cell-specific expression of the orphan nuclear receptor, germ cell nuclear factor.

    Katz, D; Niederberger, C; Slaughter, G R; Cooney, A J

    1997-10-01

    Nuclear receptors, such as those for androgens, estrogens, and progesterones, control many reproductive processes. Proteins with structures similar to these receptors, but for which ligands have not yet been identified, have been termed orphan nuclear receptors. One of these orphans, germ cell nuclear factor (GCNF), has been shown to be germ cell specific in the adult and, therefore, may also participate in the regulation of reproductive functions. In this paper, we examine more closely the expression patterns of GCNF in germ cells to begin to define spatio-temporal domains of its activity. In situ hybridization showed that GCNF messenger RNA (mRNA) is lacking in the testis of hypogonadal mutant mice, which lack developed spermatids, but is present in the wild-type testis. Thus, GCNF is, indeed, germ cell specific in the adult male. Quantitation of the specific in situ hybridization signal in wild-type testis reveals that GCNF mRNA is most abundant in stage VII round spermatids. Similarly, Northern analysis and specific in situ hybridization show that GCNF expression first occurs in testis of 20-day-old mice, when round spermatids first emerge. Therefore, in the male, GCNF expression occurs postmeiotically and may participate in the morphological changes of the maturing spermatids. In contrast, female expression of GCNF is shown in growing oocytes that have not completed the first meiotic division. Thus, GCNF in the female is expressed before the completion of meiosis. Finally, the nature of the two different mRNAs that hybridize to the GCNF complementary DNA was studied. Although both messages contain the DNA binding domain, only the larger message is recognized by a probe from the extreme 3' untranslated region. In situ hybridization with these differential probes demonstrates that both messages are present in growing oocytes. In addition, the coding region and portions of the 3' untranslated region of the GCNF complementary DNA are conserved in the rat.

  13. MRI of intracranial germ cell tumours

    Sumida, M.; Uozumi, T.; Kiya, K.; Mukada, K.; Arita, K.; Kurisu, K.; Sugiyama, K.; Onda, J.; Satoh, H.; Ikawa, F.; Migita, K.

    1995-01-01

    We reviewed MRI findings in proven intracranial germ cell tumours in 22 cases, 12 of whom received Gd-DTPA. On T1-weighted images, the signal intensity of the tumour parenchyma was moderately low in 19 cases and isointense in 3; on T2-weighted images, it was high in all cases. Regions of different intensity thought to be cysts were found in 17 (77 %): 7 of 12 patients with germinoma (58 %) and in all other cases. Of the 13 patients with pineal lesions T1-weighted sagittal images showed the aqueduct to be obstructed in 5, stenotic in 7 and normal in 1. Strong contrast enhancement was observed in all 12 cases. Of the 14 patients with suprasellar lesions, 5 were found to have an intrasellar extension, and in 3 of these, the normal pituitary gland, which could be distinguished from the tumour, was displaced anteriorly. Ten patients (45 %) had multiple lesions. (orig.)

  14. Tritium effects on germ cells and fertility

    Dobson, R.L.; Kwan, T.C.; Straume, T.

    1982-01-01

    Primordial oocytes in juvenile mice show acute gamma-ray LD 50 as low as 6 rad. This provides opportunities for determining dose-response relations at low doses and chronic exposure in the intact animal - conditions of particular interest for hazard evaluation. Examined in this way, 3 HOH in body water is found to kill murine oocytes exponentially with dose, the LD 50 level for chronic exposure being only 2μCi/ml (delivering 0.4 rad/day). At very low doses and dose rates, where comparisons between tritium and other radiations are of special significance for radiological protection, the RBE of tritium compared with 60 Co gamma radiation reaches approximately 3. Effects on murine fertility from tritium-induced oocyte loss have been quantified by reproductive capacity measurements. Chronic low-level exposure has been examined also in three primate species - squirrel, rhesus, and bonnet monkeys. In squirrel monkeys the ovarian germ-cell supply is 99% destroyed by the time of birth from prenatal exposure to body-water levels of 3 HOH (administered in maternal drinking water) of only 3 μCi/ml, the LD 50 level being 0.5 μCi/ml (giving 0.1 rad/day), one fourth that in mice. Though not completely ruled out, similar high sensitivity of female germ cells has not been found in macaques; and it probably does not occur in man. The exquisite radiosensitivity of primordial oocytes in mice is apparently due to vulnerability of the plasma membrane (or something of similar geometry and location), not DNA. Evidence for this comes from tritium data as well as neutron studies. Tritium administered as 3 HOH, and therefore generally distributed, is much more effective in killing murine oocytes than is tritium administered as 3 H-TdR, localized in the nucleus. This situation in the mouse may have implications for estimating radiation genetic risk in the human female

  15. Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

    Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

  16. Ribosomal history reveals origins of modern protein synthesis.

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  17. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  18. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  19. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  20. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  1. DEPLOYMENT OF 5S SYSTEM IN ARCHIVES MANAGEMENT

    Marcelo Cavaglieri

    2017-06-01

    Full Text Available An efficient document management brings various benefits, not only for professionals of the area but, mainly, for business managers who can use this information in their decisionmaking to enjoy competitive advantages on competitors. Having in mind that effectiveness is a constant pursuit for any company in order to achieve their strategic goals and improve the techniques which enable more productivity using fewer financial resources. In this sense, it was sought to apply the 5S philosophy in the document file management of Santa Fé Company, once it is necessary to improve the current processes with less waste and more efficiency, with a view to the need to suit the client more efficiently before their information necessities. Regarding to the method used, it is characterized as a researchaction in a quali-quantitative approach, classified as exploratory and descriptive. Among the obtained research results, it stands out in a quantitative way the reduction of waste, with significant gains of Lead Time, diminishing the time to process the activities. Financial gains were also obtained with a better use of resources and a redesigning of the way to keeping the documents. In a qualitative way, a better working environment is highlighted and increase of the service efficiency in bringing more customer satisfaction.

  2. Placeholder factors in ribosome biogenesis: please, pave my way

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  3. The architecture of mammalian ribosomal protein promoters

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  4. Molecular dynamics simulation of ribosome jam

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  5. Ribosomal RNA: a key to phylogeny

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  6. Eukaryotic ribosome display with in situ DNA recovery.

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  7. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  8. Lipid phosphate phosphatase activity regulates dispersal and bilateral sorting of embryonic germ cells in Drosophila

    Renault, Andrew D.; Kunwar, Prabhat S.; Lehmann, Ruth

    2010-01-01

    In Drosophila, germ cell survival and directionality of migration are controlled by two lipid phosphate phosphatases (LPP), wunen (wun) and wunen-2 (wun2). wun wun2 double mutant analysis reveals that the two genes, hereafter collectively called wunens, act redundantly in primordial germ cells. We find that wunens mediate germ cell-germ cell repulsion and that this repulsion is necessary for germ cell dispersal and proper transepithelial migration at the onset of migration and for the equal sorting of the germ cells between the two embryonic gonads during their migration. We propose that this dispersal function optimizes adult fecundity by assuring maximal germ cell occupancy of both gonads. Furthermore, we find that the requirement for wunens in germ cell survival can be eliminated by blocking germ cell migration. We suggest that this essential function of Wunen is needed to maintain cell integrity in actively migrating germ cells. PMID:20431117

  9. Treatment Options By Stage (Ovarian Germ Cell Tumors)

    ... Germ Cell Tumors Treatment (PDQ®)–Patient Version Treatment Option Overview Go to Health Professional Version Key Points ... and restore) the body’s blood cells. New treatment options Combination chemotherapy (the use of more than one ...

  10. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    Garcia, S.; Panero, J.L.; Široký, Jiří; Kovařík, Aleš

    2010-01-01

    Roč. 10, č. 176 (2010), s. 1-18 ISSN 1471-2229 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : organization of rDNA unit * intergenic spacer * Asteraceae Subject RIV: BO - Biophysics Impact factor: 4.085, year: 2010

  11. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  12. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  13. Primary pleuro-pulmonary malignant germ cell tumours.

    Vaideeswar P

    2002-01-01

    Full Text Available Lungs and pleura are rare sites for malignant germ-cell tumours. Two cases, pure yolk-sac tumour and yolk sac-sac tumour/embryonal carcinoma are described in young males who presented with rapid progression of respiratory symptoms. The malignant mixed germ cell tumour occurred in the right lung, while the yolk-sac tumour had a pseudomesotheliomatous growth pattern suggesting a pleural origin. Alpha-foetoprotein was immunohistochemically demonstrated in both.

  14. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  15. Preconception exposures to potential germ-cell mutagens

    Draper, G.

    2008-01-01

    Radiation and other agents can cause germ-cell mutations in animal systems. No human germ-cell mutagen has been identified, but this does not mean that human germ-cells are not vulnerable to mutagenesis. There has been particular concern about the possible health effects on offspring following parental preconception exposure to ionizing radiation - both occupational and therapeutic. A strong association with preconception radiation exposure in the fathers of the cases was found in a case-control study of young people with leukaemia living near the Sellafield nuclear plant in the UK. Subsequent studies of workers occupationally exposed to ionizing radiation have failed to confirm these findings. No statistically significant effects have been reported from studies of possible indicators of germ-cell mutagenesis in the A-bomb survivors. Studies of offspring of cancer survivors who receive radiotherapy and mutagenic chemotherapy have found no evidence of germ-cell mutagenesis. Failure to detect human germ-cell mutagenic agents may be a consequence of inadequate study sizes or insufficiently sensitive laboratory techniques. (authors)

  16. Baldness, acne and testicular germ cell tumors

    Trabert, Britton; Sigurdson, Alice J.; Sweeney, Anne M.; Amato, Robert J.; Strom, Sara S.; McGlynn, Katherine A.

    2013-01-01

    Androgen levels during critical periods of testicular development may be involved in the etiology of testicular germ cell tumors (TGCT). We evaluated the roles of adolescent and early adult life correlates of androgen exposure and TGCT in a hospital-based case control study. TGCT cases (n=187) and controls (n=148), matched on age, race and state of residence, participated in the study. Unconditional logistic regression was used to estimate associations between TGCT and male pattern baldness, severe acne, markers of puberty onset and body size. Cases were significantly less likely to report hair loss than controls (OR, 0.6; 95% CI, 0.4, 1.0). Amount of hair loss, increasing age at onset and increasing rate of loss were all inversely associated with TGCT (rate of hair loss: p-trend=0.03; age at onset: p-trend=0.03; amount of hair loss: p-trend=0.01). History of severe acne was inversely associated with TGCT (OR, 0.5; 95% CI, 0.3, 0.9) and height was positively associated with TGCT (p-trend=0.02). Increased endogenous androgen levels during puberty and early adulthood may be associated with decreased risk of TGCT. Additional studies of endogenous hormone levels during puberty and early adult life are warranted, especially studies evaluating the role of androgen synthesis, metabolism and uptake. PMID:21128977

  17. MRI of intracranial germ-cell tumours

    Liang, L.; Korogi, Y.; Sugahara, T.; Ikushima, I.; Shigematsu, Y.; Okuda, T.; Takahashi, M.; Kochi, M.; Ushio, Y.

    2002-01-01

    Abstract. Our aim was to review the MRI appearances of primary intracranial germ-cell tumours (GCT). We reviewed the MRI studies of 32 patients: 19 with germinomas, five with teratomas, one with an embryonal carcinoma, five with mixed and two with malignant nongerminomatous GCT. Eleven were in the pineal region, 12 suprasellar, five in the both sites, two in the basal ganglia and two in the corpus callosum. Contrast-enhanced images were available for 27 patients. The solid parts of GCT were nearly isointense with grey matter on both T1- and T2-weighted images. In seven patients with nongerminomatous GCT high-signal components were found on T1-weighted images, representing haemorrhage, high-protein fluid or fat. Cystic components were detected in 17 of 27 patients; eight germinomas and all nine nongerminomatous GCT had cysts. The solid components of germinomas enhanced homogeneously in eight cases and heterogeneously in 10, while all nongerminomatous GCT showed heterogeneous enhancement. MRI features tumours can facilitate correct diagnosis of GCT, including histological subtypes. (orig.)

  18. Defining the bacteroides ribosomal binding site.

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  19. Observation of the strongest 5s2 5p6 5d-(5s2 5p5 5d6s+5s25p6 7p) transitions in Au XI to Bi XV ions

    Churilov, S.S.; Joshi, Y.N.

    2001-01-01

    The spectra of gold till bismuth were studied in the 90-135 A region. Nine most intense lines belonging to the 5s 2 5p 6 5d-5s 2 5p 5 5d6s array were identified in Au XI to Bi XV ions. The 5s 2 5p 6 7p 2 P 3/2,1/2 levels in Au XI and the 5s 2 5p 6 7p 2 P 3/2 level in Hg XII were also identified. The observed wavelengths and intensities agree quite well with the Hartree-Fock calculations. (orig.)

  20. Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

    da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

    2016-01-01

    Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

  1. Mechanism of recycling of post-termination ribosomal complexes in ...

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  2. Expression of protein-coding genes embedded in ribosomal DNA

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  3. Proto-ribosome: a theoretical approach based on RNA relics

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  4. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  5. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  6. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  7. Maternal smoking and testicular germ cell tumors.

    McGlynn, Katherine A; Zhang, Yawei; Sakoda, Lori C; Rubertone, Mark V; Erickson, Ralph L; Graubard, Barry I

    2006-10-01

    Testicular germ cell tumors (TGCT) are the most common cancer among men ages 15 to 35 years in the United States. The well-established TGCT risk factors cryptorchism, prior diagnosis of TGCT, and family history of testicular cancer indicate that exposures in early life and/or in the familial setting may be critical to determining risk. Previous reports of familial clustering of lung cancer in mothers and testicular cancers in sons suggest that passive smoking in childhood may be such an exposure. To clarify the relationship of passive smoking exposure to TGCT risk, data from 754 cases and 928 controls enrolled in the Servicemen's Testicular Tumor Environmental and Endocrine Determinants study were analyzed. Data from 1,086 mothers of the cases and controls were also examined. Overall, there was no relationship between maternal [odds ratio (OR), 1.1; 95% confidence interval (95% CI), 0.9-1.3] or paternal smoking (OR, 1.0; 95% CI, 0.8-1.3) and TGCT risk. Although living with a non-parent smoker was marginally related to risk (OR, 1.4; 95% CI, 1.0-2.1), there was no relationship with number of smokers, amount smoked, or duration of smoking. Responses from both case-control participants and mothers also revealed no relationship between either maternal smoking while pregnant or while breast-feeding. Results did not differ by TGCT histology (seminoma, non-seminoma). These results do not support the hypothesis that passive smoking, either in utero or in childhood, is related to risk of TGCT. Other early life exposures, however, may explain the familial clustering of lung cancer in mothers and TGCT in sons.

  8. Specification of primordial germ cells in medaka (Oryzias latipes

    Raz Erez

    2007-01-01

    Full Text Available Abstract Background Primordial germ cells (PGCs give rise to gametes that are responsible for the development of a new organism in the next generation. Two modes of germ line specification have been described: the inheritance of asymmetrically-localized maternally provided cytoplasmic determinants and the induction of the PGC fate by other cell types. PGCs specification in zebrafish appears to depend on inheritance of germ plasm in which several RNA molecules such as vasa and nanos reside. Whether the specification mode of PGCs found in zebrafish is general for other fish species was brought into question upon analysis of olvas expression – the vasa homologue in another teleost, medaka (Oryzias latipes. Here, in contrast to the findings in zebrafish, the PGCs are found in a predictable position relative to a somatic structure, the embryonic shield. This finding, coupled with the fact that vasa mRNA, which is localized to the germ plasm of zebrafish but does not label a similar structure in medaka opened the possibility of fundamentally different mechanisms governing PGC specification in these two fish species. Results In this study we addressed the question concerning the mode of PGC specification in medaka using embryological experiments, analysis of RNA stability in the PGCs and electron microscopy observations. Dramatic alterations in the somatic environment, i.e. induction of a secondary axis or mesoderm formation alteration, did not affect the PGC number. Furthermore, the PGCs of medaka are capable of protecting specific RNA molecules from degradation and could therefore exhibit a specific mRNA expression pattern controlled by posttrancriptional mechanisms. Subsequent analysis of 4-cell stage medaka embryos using electron microscopy revealed germ plasm-like structures located at a region corresponding to that of zebrafish germ plasm. Conclusion Taken together, these results are consistent with the idea that in medaka the inheritance of

  9. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Stern David B

    2010-09-01

    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  10. Preferences of AAA/AAG codon recognition by modified nucleosides, τm5s2U34 and t6A37 present in tRNALys.

    Sonawane, Kailas D; Kamble, Asmita S; Fandilolu, Prayagraj M

    2017-12-27

    Deficiency of 5-taurinomethyl-2-thiouridine, τm 5 s 2 U at the 34th 'wobble' position in tRNA Lys causes MERRF (Myoclonic Epilepsy with Ragged Red Fibers), a neuromuscular disease. This modified nucleoside of mt tRNA Lys , recognizes AAA/AAG codons during protein biosynthesis process. Its preference to identify cognate codons has not been studied at the atomic level. Hence, multiple MD simulations of various molecular models of anticodon stem loop (ASL) of mt tRNA Lys in presence and absence of τm 5 s 2 U 34 and N 6 -threonylcarbamoyl adenosine (t 6 A 37 ) along with AAA and AAG codons have been accomplished. Additional four MD simulations of multiple ASL mt tRNA Lys models in the context of ribosomal A-site residues have also been performed to investigate the role of A-site in recognition of AAA/AAG codons. MD simulation results show that, ASL models in presence of τm 5 s 2 U 34 and t 6 A 37 with codons AAA/AAG are more stable than the ASL lacking these modified bases. MD trajectories suggest that τm 5 s 2 U recognizes the codons initially by 'wobble' hydrogen bonding interactions, and then tRNA Lys might leave the explicit codon by a novel 'single' hydrogen bonding interaction in order to run the protein biosynthesis process smoothly. We propose this model as the 'Foot-Step Model' for codon recognition, in which the single hydrogen bond plays a crucial role. MD simulation results suggest that, tRNA Lys with τm 5 s 2 U and t 6 A recognizes AAA codon more preferably than AAG. Thus, these results reveal the consequences of τm 5 s 2 U and t 6 A in recognition of AAA/AAG codons in mitochondrial disease, MERRF.

  11. Control of Ribosome Synthesis in Escherichia coli

    Molin, Søren; Meyenburg, K. von; Måløe, O.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  12. The calculation of oscillator strengths for the 5s21S0→5s5p1,3P1 transitions in Cd-like ions

    Li Guangyuan

    1998-01-01

    The screened hydrogenic model is employed to calculate the oscillator strength of the 5s 2 1 S 0 -5s5p 1 P 1 resonance transition in Cd-like ions (Z = 48 -74). The expression for the oscillator strength of the 5s 2 1 S 0 -5s5p 3 P1 is given, with the introduction of the correctional coefficient K and the mixing angle in jj-coupling. The results are compared with that of other authors, and some discussions are also given

  13. Immunofluorescence Analysis of Testicular Biopsies With Germ Cell and Sertoli Cell Markers Shows Significant MVH Negative Germ Cell Depletion With Older Age of Orchidopexy

    Li, Ruili; Thorup, Jørgen Mogens; Sun, Cong

    2014-01-01

    Undescended testis is the most common defect in newborn boys. It is associated with increased risks of infertility and testicular malignancy due to abnormal germ cell development in these testes. Early surgery may limit such risks. The aim of our study was to analyse germ cell development verses ...... age of orchidopexy using a germ cell marker and a Sertoli cell marker on testicular biopsies.......Undescended testis is the most common defect in newborn boys. It is associated with increased risks of infertility and testicular malignancy due to abnormal germ cell development in these testes. Early surgery may limit such risks. The aim of our study was to analyse germ cell development verses...

  14. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  15. Nuclear Reprogramming in Mouse Primordial Germ Cells: Epigenetic Contribution

    Massimo De Felici

    2011-01-01

    Full Text Available The unique capability of germ cells to give rise to a new organism, allowing the transmission of primary genetic information from generation to generation, depends on their epigenetic reprogramming ability and underlying genomic totipotency. Recent studies have shown that genome-wide epigenetic modifications, referred to as “epigenetic reprogramming”, occur during the development of the gamete precursors termed primordial germ cells (PGCs in the embryo. This reprogramming is likely to be critical for the germ line development itself and necessary to erase the parental imprinting and setting the base for totipotency intrinsic to this cell lineage. The status of genome acquired during reprogramming and the associated expression of key pluripotency genes render PGCs susceptible to transform into pluripotent stem cells. This may occur in vivo under still undefined condition, and it is likely at the origin of the formation of germ cell tumors. The phenomenon appears to be reproduced under partly defined in vitro culture conditions, when PGCs are transformed into embryonic germ (EG cells. In the present paper, I will try to summarize the contribution that epigenetic modifications give to nuclear reprogramming in mouse PGCs.

  16. ATTEMPT TO APPLY STABILIZED WHEAT GERM FOR BREAD SUPPLEMENTATION

    Halina Gambuś

    2015-02-01

    Full Text Available The increased interest in rational nutrition causes, that from many years is observed a growing consumption of bread, and novel food supplemented with health promoting components. For the bread production in Poland mainly wheat and rye cake flours are used, depleted of a many valuable nutrients such as protein, dietary fibre, minerals and vitamins. Because of their unique chemical composition wheat germs are a particularly valuable resource, both for direct consumption and to enhance the nutritional value of food products. The aim of the study was to prepare wheat bread with a 10% addition of commercial stabilized wheat germs. Based on the obtained results, it was found that wheat germs, due to their unique chemical composition, were a particularly valuable resource to supplement the nutritional value of bread. However, germs had detrimental effect on mechanical properties of dough, and on bread quality. Texture of bread crumb and its chemical composition were analysed. It was shown, that germs subjected to fermentation process could be used in wheat bread production as dietary fibre and mineral compound supplement.

  17. Hyperfine structure in 5s4d 3D-5snf transitions of 87Sr

    Bushaw, B.A.; Kluge, H.J.; Lantzsch, J.; Schwalbach, R.; Stenner, J.; Stevens, H.; Wendt, K.; Zimmer, K.

    1993-01-01

    The hyperfine spectra of the 5s4d 3 D 1 -5s20f, 5s4d 3 D 2 -5s23f, and 5s4d 3 D 3 -5s32f transitions of 87 Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a 5s and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d 3 D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  18. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  19. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  20. Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.

    Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U

    2018-01-01

    The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.

  1. On the control of ribosomal protein biosynthesis in Escherichia coli

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  2. Post-transcriptional regulation of ribosome biogenesis in yeast

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  3. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  4. "Mixed germ cell testicular tumor" in an adult female

    Udasimath Shivakumarswamy

    2012-01-01

    Full Text Available The androgen insensitivity (testicular feminization syndrome was described by Morris in phenotypic females with 46XY karyotype, presenting with primary amenorrhea, adequate breast development, and absent or scanty pubic or axillary hair. Gonads consist usually of seminiferous tubules without spermatogenesis. These patients have a 5-10% risk of developing germ cell tumors, usually after the complete development of secondary female sexual characteristics. We hereby report a case considered as a female with married life of 15 years, who was operated for severe abdominal pain. Phenotype characters were that of female. Microscopic examination of the tumor from the abdomen revealed germinoma and yolk sac tumor with adjacent seminiferous tubules. Karyotyping showed 46XY. Final diagnosis of malignant mixed germ cell tumor in androgen insensitivity syndrome was made. Surveillance may be the most appropriate option when these conditions are initially diagnosed in adulthood to prevent development of germ cell tumors.

  5. Germ cell neoplasia in situ (GCNIS)

    Berney, Daniel M; Looijenga, Leendert H J; Idrees, Muhammad

    2016-01-01

    The pre-invasive lesion associated with post-pubertal malignant germ cell tumours of the testis was first recognized in the early 1970s and confirmed by a number of observational and follow-up studies. Until this year, this scientific story has been confused by resistance to the entity and disagr......The pre-invasive lesion associated with post-pubertal malignant germ cell tumours of the testis was first recognized in the early 1970s and confirmed by a number of observational and follow-up studies. Until this year, this scientific story has been confused by resistance to the entity...... and disagreement on its name. Initially termed 'carcinoma in situ' (CIS), it has also been known as 'intratubular germ cell neoplasia, unclassified' (IGCNU) and 'testicular intraepithelial neoplasia' (TIN). In this paper, we review the history of discovery and controversy concerning these names and introduce...

  6. Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe

    Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.

    2007-01-01

    The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well

  7. Germ-line gene therapy and the medical imperative.

    Munson, Ronald; Davis, Lawrence H

    1992-06-01

    Somatic cell gene therapy has yielded promising results. If germ cell gene therapy can be developed, the promise is even greater: hundreds of genetic diseases might be virtually eliminated. But some claim the procedure is morally unacceptable. We thoroughly and sympathetically examine several possible reasons for this claim but find them inadequate. There is no moral reason, then, not to develop and employ germ-line gene therapy. Taking the offensive, we argue next that medicine has a prima facie moral obligation to do so.

  8. Reduction of the number of germs in spices by radappertization

    Beczner, Laszlone; Kiss, Istvan

    1983-01-01

    The sterilization by fumigation with ethylene oxide and propylene oxide of ground paprika and spice mixtures used in preserves and meat industry was compared with the radappertization of the same spices. The number of germs including that of spores and moulds was determined. It can be established that irradiation with ionizing radiation (5 kGy) has the same effect on the reduction of the number of germs as sterilization by ethylene oxide. In addition, the side effects of sterilization can be avoided. (V.N.)

  9. Radiation-induced genetic effects in germ cells of mammals

    Van der Schans, G.P.

    1993-01-01

    The objectives of the project are a better understanding of the fundamental principles that determine the radiation sensitivity in humans, with specific attention for the role of DNA repair in germ cells. The induction and repair of damage in DNA of germ cells of the Syrian golden hamster exposed to ionizing radiation is studied at biologically relevant doses. It has also been investigated which aspects of DNA sequence or chromosomal organisation are important with respect to their influence on the repairability of DNA damage. (R.P.) 10 refs

  10. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  11. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  12. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  13. File list: Oth.Gon.20.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Full Text Available Oth.Gon.20.AllAg.Testicular_germ_cells mm9 TFs and others Gonad Testicular germ cel...ls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Gon.20.AllAg.Testicular_germ_cells.bed ...

  14. File list: Oth.Gon.10.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Full Text Available Oth.Gon.10.AllAg.Testicular_germ_cells mm9 TFs and others Gonad Testicular germ cel...ls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Gon.10.AllAg.Testicular_germ_cells.bed ...

  15. File list: Pol.Gon.05.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Full Text Available Pol.Gon.05.AllAg.Testicular_germ_cells mm9 RNA polymerase Gonad Testicular germ cel...ls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Gon.05.AllAg.Testicular_germ_cells.bed ...

  16. File list: DNS.Gon.05.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Full Text Available DNS.Gon.05.AllAg.Testicular_germ_cells mm9 DNase-seq Gonad Testicular germ cells ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Gon.05.AllAg.Testicular_germ_cells.bed ...

  17. Evidence against a germ plasm in the milkweed bug Oncopeltus fasciatus, a hemimetabolous insect

    Ben Ewen-Campen

    2013-04-01

    Primordial germ cell (PGC formation in holometabolous insects like Drosophila melanogaster relies on maternally synthesised germ cell determinants that are asymmetrically localised to the oocyte posterior cortex. Embryonic nuclei that inherit this “germ plasm” acquire PGC fate. In contrast, historical studies of basally branching insects (Hemimetabola suggest that a maternal requirement for germ line genes in PGC specification may be a derived character confined principally to Holometabola. However, there have been remarkably few investigations of germ line gene expression and function in hemimetabolous insects. Here we characterise PGC formation in the milkweed bug Oncopeltus fasciatus, a member of the sister group to Holometabola, thus providing an important evolutionary comparison to members of this clade. We examine the transcript distribution of orthologues of 19 Drosophila germ cell and/or germ plasm marker genes, and show that none of them localise asymmetrically within Oncopeltus oocytes or early embryos. Using multiple molecular and cytological criteria, we provide evidence that PGCs form after cellularisation at the site of gastrulation. Functional studies of vasa and tudor reveal that these genes are not required for germ cell formation, but that vasa is required in adult males for spermatogenesis. Taken together, our results provide evidence that Oncopeltus germ cells may form in the absence of germ plasm, consistent with the hypothesis that germ plasm is a derived strategy of germ cell specification in insects.

  18. Evidence against a germ plasm in the milkweed bug Oncopeltus fasciatus, a hemimetabolous insect.

    Ewen-Campen, Ben; Jones, Tamsin E M; Extavour, Cassandra G

    2013-06-15

    Primordial germ cell (PGC) formation in holometabolous insects like Drosophila melanogaster relies on maternally synthesised germ cell determinants that are asymmetrically localised to the oocyte posterior cortex. Embryonic nuclei that inherit this "germ plasm" acquire PGC fate. In contrast, historical studies of basally branching insects (Hemimetabola) suggest that a maternal requirement for germ line genes in PGC specification may be a derived character confined principally to Holometabola. However, there have been remarkably few investigations of germ line gene expression and function in hemimetabolous insects. Here we characterise PGC formation in the milkweed bug Oncopeltus fasciatus, a member of the sister group to Holometabola, thus providing an important evolutionary comparison to members of this clade. We examine the transcript distribution of orthologues of 19 Drosophila germ cell and/or germ plasm marker genes, and show that none of them localise asymmetrically within Oncopeltus oocytes or early embryos. Using multiple molecular and cytological criteria, we provide evidence that PGCs form after cellularisation at the site of gastrulation. Functional studies of vasa and tudor reveal that these genes are not required for germ cell formation, but that vasa is required in adult males for spermatogenesis. Taken together, our results provide evidence that Oncopeltus germ cells may form in the absence of germ plasm, consistent with the hypothesis that germ plasm is a derived strategy of germ cell specification in insects.

  19. Adult Immunohistochemical Markers Fail to Detect Intratubular Germ Cell Neoplasia in Prepubertal Boys with Cryptorchidism

    Kvist, Kolja; Clasen-Linde, Erik; Cortes, Dina

    2013-01-01

    Intratubular germ cell neoplasia (ITGCN) is a precursor to testicular germ cell cancer. It is characterized by large germ cells with large nuclei with a hyperchromatic, coarse chromatin pattern, large prominent nucleoli and abundant pale cytoplasm. In prepubertal boys these cells are located both...

  20. Great migration: epigenetic reprogramming and germ cell-oocyte metamorphosis determine individual ovarian reserve.

    Celik, Onder; Aygun, Banu Kumbak; Celik, Nilufer; Aydin, Suleyman; Haberal, Esra Tustas; Sahin, Levent; Yavuz, Yasemin; Celik, Sudenaz

    2016-01-01

    Emigration is defined as a synchronized movement of germ cells between the yolk sack and genital ridges. The miraculous migration of germ cells resembles the remigration of salmon traveling from one habitat to other. This migration of germ cells is indispensible for the development of new generations. It is not, however, clear why germ cells differentiate during migration but not at the place of origin. In order to escape harmful somatic signals which might disturb the proper establishment of germ cells forced germ cell migration may be necessary. Another reason may be to benefit from the opportunities of new habitats. Therefore, emigration may have powerful effects on the population dynamics of the immigrant germ cells. While some of these cells do reach their target, some others die or reach to wrong targets. Only germ cell precursors with genetically, and structurally powerful can reach their target. Likewise, epigenetic reprogramming in both migratory and post-migratory germ cells is essential for the establishment of totipotency. During this journey some germ cells may sacrifice themselves for the goodness of the others. The number and quality of germ cells reaching the genital ridge may vary depending on the problems encountered during migration. If the aim in germ cell specification is to provide an optimal ovarian reserve for the continuity of the generation, then this cascade of events cannot be only accomplished at the same level for every one but also are manifested by several outcomes. This is significant evidence supporting the possibility of unique individual ovarian reserve.

  1. Carcinoma in situ testis displays permissive chromatin modifications similar to immature foetal germ cells

    Almstrup, K; Nielsen, J E; Mlynarska, O

    2010-01-01

    The majority of testicular germ cell cancers develop through a pre-invasive carcinoma in situ (CIS) stage. The CIS cell is a neoplastic counterpart of foetal germ cells. During their development, foetal germ cells undergo extensive and essential epigenetic modifications, but little is known about...

  2. Childhood Central Nervous System Germ Cell Tumors Treatment (PDQ®)—Patient Version

    Childhood central nervous system (CNS) germ cell tumors form from germ cells (a type of cell that forms as a fetus develops and later becomes sperm in the testicles or eggs in the ovaries). Learn about the signs, tests to diagnose, and treatment of pediatric germ cell tumors in the brain in this expert-reviewed summary.

  3. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  4. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  5. Molecular mechanisms governing primordial germ cell migration in zebrafish

    Doitsidou, M.

    2005-01-01

    In most sexually reproducing organisms primordial germ cells (pGCs) are specified early in development in places that are distinct from the region where the somatic part of the gonad develops. From their places of specification they have to migrate towards the site where they associate with somatic

  6. Stability of wheat germ oil obtained by supercritical carbon dioxide ...

    심정은

    For determination of stability, wheat germ oil obtained by ethanolysis reactants was characterized by ... extract non polar lipids with lipid soluble bioactive com- pounds from different sources (Esquivel et al., 1997; ... thin layer of cotton was placed at the bottom of the extraction vessel. Before plugging with cap another layer of ...

  7. Genetic analysis of neonatal and infantile germ cell tumours.

    Veltman, I.M.

    2006-01-01

    Human germ cell tumours (GCTs) can be classified into five distinct types, based on differences in anatomical location, histology, clinical outcome, age and genotype. The first type, the type I GCTs primarily occur in neonates and infants under the age of five years and include teratomas and yolk

  8. Germ cell tumours in neonates and infants: a distinct subgroup?

    Veltman, I.M.; Schepens, M.T.M.; Looijenga, L.H.J.; Strong, L.C.; Geurts van Kessel, A.H.M.

    2003-01-01

    Human germ cell tumours (GCTs) constitute a heterogeneous group of tumours that can be classified into four major subgroups. One of these subgroups encompasses (immature) teratomas and yolk sac tumours of patients under the age of 5 years. In this paper we review the various clinical, histological

  9. Mutability of germ cells of descedants of irradiated drosophila males

    Fokina, T.L.; Vorobtsova, I.E.

    1987-01-01

    The increased frequency of random and radiation-induced mutation was registered in germ cells of drosophila irradiated male descendants of the first generation. The effect observed depended on of radiation dose delivered to parent males, test dose to posterity, type of mutation registered, and sex of the descendants under study

  10. Treatment Options for Childhood Extracranial Germ Cell Tumors

    ... tumors: Yolk sac tumors make a hormone called alpha-fetoprotein (AFP). They can form in the ovary, testicle, ... are used to detect extracranial germ cell tumors: Alpha-fetoprotein (AFP). Beta-human chorionic gonadotropin (β-hCG). For ...

  11. General Information about Childhood Extracranial Germ Cell Tumors

    ... tumors: Yolk sac tumors make a hormone called alpha-fetoprotein (AFP). They can form in the ovary, testicle, ... are used to detect extracranial germ cell tumors: Alpha-fetoprotein (AFP). Beta-human chorionic gonadotropin (β-hCG). For ...

  12. Dynamics of germs responsible for acute bacterial meningitis in ...

    The aim of this study was to analyze ten (10) years of epidemiological surveillance data of meningitis in Burkina Faso for high risk germs patterns identification in order to contribute to the strengthening of prevention strategies. A retrospective study of the past decade (2005- 2014) of cases of acute bacterial meningitis ...

  13. 10 original article dynamics of germs responsible for acute bacterial ...

    boaz

    The aim of this study was to analyze ten (10) years of epidemiological surveillance data of meningitis in Burkina Faso for high risk germs patterns identification in order to contribute to the strengthening of prevention strategies. A retrospective study of the past decade (2005- 2014) of cases of acute bacterial meningitis ...

  14. Wheat Germ Oil Attenuates Gamma Radiation-Induced Skeletal ...

    Muscular strength is important in sport as well as in daily activities. Exposure to ionizing radiation is thought to increase oxidative stress and damage muscle tissue. Wheat germ oil is a natural unrefined vegetable oil. It is an excellent source of vitamin E, octacosanol, linoleic and linolenic essential fatty acids, which may be ...

  15. Towards Optimal Diagnosis of Type II Germ Cell Tumors

    J.A. Stoop (Hans)

    2011-01-01

    textabstractThe aim of the work described in this thesis is to improve the understanding of the pathobiology of testicular cancer (type II Germ Cell Tumors) to create possibilities for optimalization of diagnosis for this type of malignancy in routine pathology laboratories. The different studies

  16. Clinical and genetic aspects of testicular germ cell tumours

    Holzik, Martijn F. Lutke; Sijmons, Rolf H.; Hoekstra-Weebers, Josette E. H. M.; Sleijfer, Dirk Th.; Hoekstra, Harald J.

    2008-01-01

    In this paper we review clinical and genetic aspects of testicular germ cell tumours (TGCTs). TGCT is the most common type of malignant disorder in men aged 15-40 years. Its incidence has increased sharply in recent years. Fortunately, survival of patients with TGCT has improved enormously, which

  17. A comparison between hominy chop and defatted maize germ meal ...

    Defatted maize germ meal (DMG) is arbitrarily rated at a lower economic value than maize meal or hominy chop (HC). Five treatments with 15 steers each were fed different inclusion levels of DMG (0%, 25%, 50%, 75% and 100%), replacing hominy chop during the fattening period. Slaughter data were collected for carcass ...

  18. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  19. International germ cell consensus classification : A prognostic factor-erased staging system for metastatic germ cell cancers

    Mead, GM; Stenning, SP; Cook, P; Fossa, SD; Horwich, A; Kaye, SB; Oliver, RTD; deMulder, PHM; deWit, R; Stoter, G; Sylvester, RJ; Bajorin, DF; Bosl, GJ; Mazumdar, M; Nichols, CR; Amato, R; Pizzocaro, G; Droz, JP; Kramar, A; Daugaard, G; CortesFunes, H; PazAres, L; Levi, JA; Colls, BM; Harvey, VJ; Coppin, C

    Purpose: Cisplatin-containing chemotherapy has dramatically improved the outlook for patients with metastatic germ cell tumors (GCT), and overall cure rates now exceed 80%. To make appropriate risk-based decisions about therapy and to facilitate collaborative trials, a simple prognostic factor-based

  20. A landscape of germ line mutations in a cohort of inherited bone marrow failure patients.

    Bluteau, Olivier; Sebert, Marie; Leblanc, Thierry; Peffault de Latour, Régis; Quentin, Samuel; Lainey, Elodie; Hernandez, Lucie; Dalle, Jean-Hugues; Sicre de Fontbrune, Flore; Lengline, Etienne; Itzykson, Raphael; Clappier, Emmanuelle; Boissel, Nicolas; Vasquez, Nadia; Da Costa, Mélanie; Masliah-Planchon, Julien; Cuccuini, Wendy; Raimbault, Anna; De Jaegere, Louis; Adès, Lionel; Fenaux, Pierre; Maury, Sébastien; Schmitt, Claudine; Muller, Marc; Domenech, Carine; Blin, Nicolas; Bruno, Bénédicte; Pellier, Isabelle; Hunault, Mathilde; Blanche, Stéphane; Petit, Arnaud; Leverger, Guy; Michel, Gérard; Bertrand, Yves; Baruchel, André; Socié, Gérard; Soulier, Jean

    2018-02-15

    Bone marrow (BM) failure (BMF) in children and young adults is often suspected to be inherited, but in many cases diagnosis remains uncertain. We studied a cohort of 179 patients (from 173 families) with BMF of suspected inherited origin but unresolved diagnosis after medical evaluation and Fanconi anemia exclusion. All patients had cytopenias, and 12.0% presented ≥5% BM blast cells. Median age at genetic evaluation was 11 years; 20.7% of patients were aged ≤2 years and 36.9% were ≥18 years. We analyzed genomic DNA from skin fibroblasts using whole-exome sequencing, and were able to assign a causal or likely causal germ line mutation in 86 patients (48.0%), involving a total of 28 genes. These included genes in familial hematopoietic disorders ( GATA2 , RUNX1 ), telomeropathies ( TERC , TERT , RTEL1 ), ribosome disorders ( SBDS , DNAJC21 , RPL5 ), and DNA repair deficiency ( LIG4 ). Many patients had an atypical presentation, and the mutated gene was often not clinically suspected. We also found mutations in genes seldom reported in inherited BMF (IBMF), such as SAMD9 and SAMD9L (N = 16 of the 86 patients, 18.6%), MECOM/EVI1 (N = 6, 7.0%), and ERCC6L2 (N = 7, 8.1%), each of which was associated with a distinct natural history; SAMD9 and SAMD9L patients often experienced transient aplasia and monosomy 7, whereas MECOM patients presented early-onset severe aplastic anemia, and ERCC6L2 patients, mild pancytopenia with myelodysplasia. This study broadens the molecular and clinical portrait of IBMF syndromes and sheds light on newly recognized disease entities. Using a high-throughput sequencing screen to implement precision medicine at diagnosis can improve patient management and family counseling. © 2018 by The American Society of Hematology.

  1. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  2. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  3. A study on effective extraction of isoflavones from soy germ using the electron beam

    Park, Jeong Hoon [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of); Choi, Tae Beom [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of); Department of Chemistry, Dongguk University, 3 Pildong, Chunggu, Seoul 100-715 (Korea, Republic of); Kim, Sang Wook [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of)], E-mail: swkim@kaeri.re.kr; Hur, Min Goo; Yang, Seung Dae [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of); Yu, Kook Hyun [Department of Chemistry, Dongguk University, 3 Pildong, Chunggu, Seoul 100-715 (Korea, Republic of)], E-mail: yukook@dongguk.edu

    2009-07-15

    Soy germ was irradiated with 2 MeV electron beam with different doses ranging from 1 to 20 kGy. The amount of isoflavones from irradiated soy germ was compared with those from natural soy germ by extracting with ethanol and methanol. The changed amounts of isoflavones were measured by high-performance liquid chromatography with standard calibration curve. Each extract of soy germ was quantified for antioxidant activity with 1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical scavenging method. The amount of isoflavones was found to be increased after electron-beam irradiation. Particularly ethanol extract with 15 kGy irradiated soy germ contained the maximum amount of isoflavones. Antioxidant activity of irradiated soy germ was higher than that of natural soy germ.

  4. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  5. Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong

    Tsoi Vincent F. K.

    2014-11-01

    Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.

  6. The 5S methodology as a tool for improving the organisation

    J. Michalska; D. Szewieczek

    2007-01-01

    Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectivene...

  7. Manifestation of Strongly Delocalized Atomic States in the 5s Photoionization of Xenon

    Schmoranzer, H.; Lauer, S.; Vollweiler, F.; Reichardt, G.; Schartner, K.; Mentzel, G.; Wilhelmi, O.; Sukhorukov, V.L.; Lagutin, B.M.; Petrov, I.D.

    1997-01-01

    The photoionization (PI) of the Xe atom was investigated in the vicinity of the 5s -shell threshold by photon-induced fluorescence spectroscopy. The highest resolution so far attained of 2meV enabled us to observe a new series of resonance structures in the 5s -PI cross section closely above threshold. Calculations of the partial 5s - and 5p -PI cross sections were performed taking into account many-electron correlations. These structures were related with strongly delocalized f -resonances which affect the 5s -PI cross section due to their mixing with p -resonances. copyright 1997 The American Physical Society

  8. 4p-5s transitions in In XIII, In XIV and In XV

    Carroll, P.K.; Costello, J.T.; O'Sullivan, G.

    1986-01-01

    The spectrum of an indium plasma produced by a 1.5 J, 25 ns ruby laser was recorded in the XUV. At wavelengths below 100 A, the spectrum is dominated by 4p-5s transitions in a number of ion stages. Many lines arising from 4p 6 4d-4p 5 4d5s, 4p 6 -4p 5 5s and 4p 5 -4p 4 5s transitions in In XIII, In XIV and In XV have been identified by isoelectronic extrapolation and Dirac-Fock calculations. (orig.)

  9. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    R. S. Agrahari

    2015-04-01

    Full Text Available Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a stronger work ethic within the management and workers who would be expected to continue the good practices.

  10. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Vibhor Kakkar

    2015-02-01

    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  11. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  12. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  13. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  14. The Phosphorylation of Ribosomal Protein in Lemna minor

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  15. MRI Findings of Suprasellar Germ Cell Tumors in Two Dogs.

    Cook, Laurie; Tensley, Michelle; Drost, Wm Tod; Koivisto, Christopher; Oglesbee, Michael

    A 4 yr old border collie presenting for mydriasis and decreased mentation and a 7 yr old Boston terrier presenting for obtundation, head tilt, and paraparesis were both evaluated using MRI. Findings in both included mass lesions of the thalamus and brainstem that were hypo- to isointense on T1-weighted images and hyperintense on T2-weighted images with regions of hypointensity, and robust contrast enhancement and displacement of adjacent structures. Postmortem histopathology findings, tumor location, and a mixed pattern of epithelial cell differentiation were consistent with germ cell tumor in both cases. Germ cell tumor of the suprasellar region is an infrequently reported neoplasm of dogs and imaging findings in this species have not been well described in the prior literature.

  16. Video-assisted thoracic surgery mediastinal germ cell metastasis resection.

    Nardini, Marco; Jayakumar, Shruti; Migliore, Marcello; Dunning, Joel

    2017-07-01

    Thoracoscopy can be safely used for dissection of masses in the visceral mediastinum. We report the case of a 31-year-old man affected by metastatic germ cell tumour and successfully treated with a 3-port posterior approach video-assisted thoracic surgery. © The Author 2017. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

  17. Radiation-induced genetic effects in germ cells of mammals

    Van Buul, P.P.W.

    1993-01-01

    The aim of the project is to gain information on the effects of ionizing radiation on germ cells of rodents and primates as measured by induced chromosomal translocations. Different aspects of the very significant interspecies differences between the mouse and the rhesus monkey (Macaca mulatta) for translocation induction in spermatogonial stem cells were studied. In addition, possible mechanisms for the well established reduced transmission of induced mouse translocations were investigated. (R.P.) 6 refs

  18. On the number of founding germ cells in humans

    Byers Breck

    2005-08-01

    Full Text Available Abstract Background The number of founding germ cells (FGCs in mammals is of fundamental significance to the fidelity of gene transmission between generations, but estimates from various methods vary widely. In this paper we obtain a new estimate for the value in humans by using a mathematical model of germ cell development that depends on available oocyte counts for adult women. Results The germline-development model derives from the assumption that oogonial proliferation in the embryonic stage starts with a founding cells at t = 0 and that the subsequent proliferation can be defined as a simple stochastic birth process. It follows that the population size X(t at the end of germline expansion (around the 5th month of pregnancy in humans; t = 0.42 years is a random variable with a negative binomial distribution. A formula based on the expectation and variance of this random variable yields a moment-based estimate of a that is insensitive to the progressive reduction in oocyte numbers due to their utilization and apoptosis at later stages of life. In addition, we describe an algorithm for computing the maximum likelihood estimation of the FGC population size (a, as well as the rates of oogonial division and loss to apoptosis. Utilizing both of these approaches to evaluate available oocyte-counting data, we have obtained an estimate of a = 2 – 3 for Homo sapiens. Conclusion The estimated number of founding germ cells in humans corresponds well with values previously derived from chimerical or mosaic mouse data. These findings suggest that the large variation in oocyte numbers between individual women is consistent with a smaller founding germ cell population size than has been estimated by cytological analyses.

  19. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  20. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  1. Interaction of tRNA with Eukaryotic Ribosome

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  2. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  3. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  4. European consensus on diagnosis and treatment of germ cell cancer: a report of the European Germ Cell Cancer Consensus Group (EGCCCG)

    Schmoll, H. J.; Souchon, R.; Krege, S.; Albers, P.; Beyer, J.; Kollmannsberger, C.; Fossa, S. D.; Skakkebaek, N. E.; de Wit, R.; Fizazi, K.; Droz, J. P.; Pizzocaro, G.; Daugaard, G.; de Mulder, P. H. M.; Horwich, A.; Oliver, T.; Huddart, R.; Rosti, G.; Paz Ares, L.; Pont, O.; Hartmann, J. T.; Aass, N.; Algaba, F.; Bamberg, M.; Bodrogi, I.; Bokemeyer, C.; Classen, J.; Clemm, S.; Culine, S.; de Wit, M.; Derigs, H. G.; Dieckmann, K. P.; Flasshove, M.; Garcia del Muro, X.; Gerl, A.; Germa-Lluch, J. R.; Hartmann, M.; Heidenreich, A.; Hoeltl, W.; Joffe, J.; Jones, W.; Kaiser, G.; Klepp, O.; Kliesch, S.; Kisbenedek, L.; Koehrmann, K. U.; Kuczyk, M.; Laguna, M. P.; Leiva, O.; Loy, V.; Mason, M. D.; Mead, G. M.; Mueller, R. P.; Nicolai, N.; Oosterhof, G. O. N.; Pottek, T.; Rick, O.; Schmidberger, H.; Sedlmayer, F.; Siegert, W.; Studer, U.; Tjulandin, S.; von der Maase, H.; Walz, P.; Weinknecht, S.; Weissbach, L.; Winter, E.; Wittekind, C.

    2004-01-01

    Germ cell tumour is the most frequent malignant tumour type in young men with a 100% rise in the incidence every 20 years. Despite this, the high sensitivity of germ cell tumours to platinum-based chemotherapy, together with radiation and surgical measures, leads to the high cure rate of > or = 99%

  5. Biochemical Intestinal Parameters in Germ-free Minipigs and Rats and in Ex-germ-free Minipigs and Rats Monoassociated with Escherichia coli

    Cardona, M.,E.; Kozáková, Hana; Collinder, E.; Persson, A.-K.; Midtvedt, T.; Norin, E.

    2005-01-01

    Roč. 52, - (2005), s. 109-113 ISSN 1548-9213 R&D Projects: GA AV ČR IAA5020101 Institutional research plan: CEZ:AV0Z5020903 Keywords : germ-free * minipigs * ex-germ-free Subject RIV: EE - Microbiology, Virology Impact factor: 2.111, year: 2005

  6. DAZ Family Proteins, Key Players for Germ Cell Development

    Fu, Xia-Fei; Cheng, Shun-Feng; Wang, Lin-Qing; Yin, Shen; De Felici, Massimo; Shen, Wei

    2015-01-01

    DAZ family proteins are found almost exclusively in germ cells in distant animal species. Deletion or mutations of their encoding genes usually severely impair either oogenesis or spermatogenesis or both. The family includes Boule (or Boll), Dazl (or Dazla) and DAZ genes. Boule and Dazl are situated on autosomes while DAZ, exclusive of higher primates, is located on the Y chromosome. Deletion of DAZ gene is the most common causes of infertility in humans. These genes, encoding for RNA binding proteins, contain a highly conserved RNA recognition motif and at least one DAZ repeat encoding for a 24 amino acids sequence able to bind other mRNA binding proteins. Basically, Daz family proteins function as adaptors for target mRNA transport and activators of their translation. In some invertebrate species, BOULE protein play a pivotal role in germline specification and a conserved regulatory role in meiosis. Depending on the species, DAZL is expressed in primordial germ cells (PGCs) and/or pre-meiotic and meiotic germ cells of both sexes. Daz is found in fetal gonocytes, spermatogonia and spermatocytes of adult testes. Here we discuss DAZ family genes in a phylogenic perspective, focusing on the common and distinct features of these genes, and their pivotal roles during gametogenesis evolved during evolution. PMID:26327816

  7. Malignant primary germ-cell tumor of the brain

    Yamamoto, Toyoshiro; Sato, Shinichi; Nakao, Satoshi; Ban, Sadahiko; Namba, Koh

    1983-01-01

    The unusual case of a 15 year old boy with three discrete paraventricular germ-cell tumors is reported.FThe first tumor was located just lateral to the left thalamus and included a massive cystic part around it, the second tumor in the paraventricular region above the head of the left caudate nucleus and the third tumor in the medial part of the left parietal lobe.FTotal removal of all tumors was successfully accomplished in stages at four separate operations, namely, the first tumor was removed through the left transsylvian approach, the second tumor via left superior frontal gyrus and the third tumor via left superior frontal gyrus and left superior parietal lobule.FHistological examination revealed that the first tumor was teratoma, the second was choriocarcinoma and the third was germinoma.FPrimary germ-cell tumors of the brain can be divided into 5 groups: 1) germinoma; 2) embryonal carcinoma; 3) choriocarcinoma; 4) yolk-sac tumor; or 5) teratoma.FIn this case, a combination of three different histological patterns was seen. If malignant germ-cell tumor is supected on CT, aggressive extirpation should be done, not only to determine the exact diagnosis, but also to provide the basis for subsequent adjunctive therapy. (author)

  8. Origins and molecular biology of testicular germ cell tumors.

    Reuter, Victor E

    2005-02-01

    Testicular germ cell tumors can be divided into three groups (infantile/prepubertal, adolescent/young adult and spermatocytic seminoma), each with its own constellation of clinical histology, molecular and clinical features. They originate from germ cells at different stages of development. The most common testicular cancers arise in postpubertal men and are characterized genetically by having one or more copies of an isochromosome of the short arm of chromosome 12 [i(12p)] or other forms of 12p amplification and by aneuploidy. The consistent gain of genetic material from chromosome 12 seen in these tumors suggests that it has a crucial role in their development. Intratubular germ cell neoplasia, unclassified type (IGCNU) is the precursor to these invasive tumors. Several factors have been associated with their pathogenesis, including cryptorchidism, elevated estrogens in utero and gonadal dysgenesis. Tumors arising in prepubertal gonads are either teratomas or yolk sac tumors, tend to be diploid and are not associated with i(12p) or with IGCNU. Spermatocytic seminoma (SS) arises in older patients. These benign tumors may be either diploid or aneuploid and have losses of chromosome 9 rather than i(12p). Intratubular SS is commonly encountered but IGCNU is not. The pathogenesis of prepubertal GCT and SS is poorly understood.

  9. POMB/ACE chemotherapy for mediastinal germ cell tumours.

    Bower, M; Brock, C; Holden, L; Nelstrop, A; Makey, A R; Rustin, G J; Newlands, E S

    1997-05-01

    Mediastinal germ cell tumours (MGCT) are rare and most published series reflect the experiences of individual institutions over many years. Since 1979, we have treated 16 men (12 non-seminomatous germ cell tumours and 4 seminomas) with newly diagnosed primary MGCT with POMB/ACE chemotherapy and elective surgical resection of residual masses. This approach yielded complete remissions in 15/16 (94%) patients. The median follow-up was 6.0 years and no relapses occurred more than 2 years after treatment. The 5 year overall survival in the non-seminomatous germ cell tumours (NSGCT) is 73% (95% confidence interval 43-90%). One patient with NSGCT developed drug-resistant disease and died without achieving remission and 2 patients died of relapsed disease. In addition, 4 patients with bulky and/or metastatic seminoma were treated with POMB/ACE. One died of treatment-related neutropenic sepsis in complete remission and one died of relapsed disease. Finally, 4 patients (2 NSGCT and 2 seminomas) referred at relapse were treated with POMB/ACE and one was successfully salvaged. The combination of POMB/ACE chemotherapy and surgery is effective management for MGCT producing high long-term survival rates.

  10. Genetic selection and DNA sequences of 4.5S RNA homologs

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  11. Protein-protein interactions within late pre-40S ribosomes.

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  12. Human DAZL, DAZ and BOULE genes modulate primordial germ cell and haploid gamete formation

    Kee, Kehkooi; Angeles, Vanessa T; Flores, Martha; Nguyen, Ha Nam; Pera, Renee A Reijo

    2009-01-01

    The leading cause of infertility in men and women is quantitative and qualitative defects in human germ cell (oocyte and sperm) development. Yet, it has not been possible to examine the unique developmental genetics of human germ cell formation and differentiation due to inaccessibility of germ cells during fetal development. Although several studies have shown that germ cells can be differentiated from mouse and human embryonic stem cells, human germ cells differentiated in these studies generally did not develop beyond the earliest stages1-8. Here we used a germ cell reporter to quantitate and isolate primordial germ cells derived from both male and female hESCs. Then, by silencing and overexpressing genes that encode germ cell-specific cytoplasmic RNA-binding proteins (not transcription factors), we modulated human germ cell formation and developmental progression. We observed that human DAZL (Deleted in AZoospermia-Like) functions in primordial germ cell formation, whereas closely-related genes, DAZ and BOULE, promote later stages of meiosis and development of haploid gametes. These results are significant to the generation of gametes for future basic science and potential clinical applications. PMID:19865085

  13. Tre1, a G protein-coupled receptor, directs transepithelial migration of Drosophila germ cells.

    Prabhat S Kunwar

    2003-12-01

    Full Text Available In most organisms, germ cells are formed distant from the somatic part of the gonad and thus have to migrate along and through a variety of tissues to reach the gonad. Transepithelial migration through the posterior midgut (PMG is the first active step during Drosophila germ cell migration. Here we report the identification of a novel G protein-coupled receptor (GPCR, Tre1, that is essential for this migration step. Maternal tre1 RNA is localized to germ cells, and tre1 is required cell autonomously in germ cells. In tre1 mutant embryos, most germ cells do not exit the PMG. The few germ cells that do leave the midgut early migrate normally to the gonad, suggesting that this gene is specifically required for transepithelial migration and that mutant germ cells are still able to recognize other guidance cues. Additionally, inhibiting small Rho GTPases in germ cells affects transepithelial migration, suggesting that Tre1 signals through Rho1. We propose that Tre1 acts in a manner similar to chemokine receptors required during transepithelial migration of leukocytes, implying an evolutionarily conserved mechanism of transepithelial migration. Recently, the chemokine receptor CXCR4 was shown to direct migration in vertebrate germ cells. Thus, germ cells may more generally use GPCR signaling to navigate the embryo toward their target.

  14. Germ cell development in the Honeybee (Apis mellifera; Vasa and Nanos expression

    Dearden Peter K

    2006-02-01

    Full Text Available Abstract Background Studies of specification of germ-cells in insect embryos has indicated that in many taxa the germ cells form early in development, and their formation is associated with pole plasm, germ plasm or an organelle called the oosome. None of these morphological features associated with germ cell formation have been identified in the Honeybee Apis mellifera. In this study I report the cloning and expression analysis of Honeybee homologues of vasa and nanos, germ cell markers in insects and other animals. Results Apis vasa and nanos RNAs are present in early honeybee embryos, but the RNAs clear rapidly, without any cells expressing these germ cell markers past stage 2. These genes are then only expressed in a line of cells in the abdomen from stage 9 onwards. These cells are the developing germ cells that are moved dorsally by dorsal closure and are placed in the genital ridge. Conclusion This study of the expression of germ cell markers in the honeybee implies that in this species either germ cells are formed by an inductive event, late in embryogenesis, or they are formed early in development in the absence of vasa and nanos expression. This contrasts with germ cell development in other members of the Hymenoptera, Diptera and Lepidoptera.

  15. The diversity of nanos expression in echinoderm embryos supports different mechanisms in germ cell specification.

    Fresques, Tara; Swartz, Steven Zachary; Juliano, Celina; Morino, Yoshiaki; Kikuchi, Mani; Akasaka, Koji; Wada, Hiroshi; Yajima, Mamiko; Wessel, Gary M

    2016-07-01

    Specification of the germ cell lineage is required for sexual reproduction in all animals. However, the timing and mechanisms of germ cell specification is remarkably diverse in animal development. Echinoderms, such as sea urchins and sea stars, are excellent model systems to study the molecular and cellular mechanisms that contribute to germ cell specification. In several echinoderm embryos tested, the germ cell factor Vasa accumulates broadly during early development and is restricted after gastrulation to cells that contribute to the germ cell lineage. In the sea urchin, however, the germ cell factor Vasa is restricted to a specific lineage by the 32-cell stage. We therefore hypothesized that the germ cell specification program in the sea urchin/Euechinoid lineage has evolved to an earlier developmental time point. To test this hypothesis we determined the expression pattern of a second germ cell factor, Nanos, in four out of five extant echinoderm clades. Here we find that Nanos mRNA does not accumulate until the blastula stage or later during the development of all other echinoderm embryos except those that belong to the Echinoid lineage. Instead, Nanos is expressed in a restricted domain at the 32-128 cell stage in Echinoid embryos. Our results support the model that the germ cell specification program underwent a heterochronic shift in the Echinoid lineage. A comparison of Echinoid and non-Echinoid germ cell specification mechanisms will contribute to our understanding of how these mechanisms have changed during animal evolution. © 2016 Wiley Periodicals, Inc.

  16. FLI-1 Flightless-1 and LET-60 Ras control germ line morphogenesis in C. elegans

    Dentler William L

    2008-05-01

    Full Text Available Abstract Background In the C. elegans germ line, syncytial germ line nuclei are arranged at the cortex of the germ line as they exit mitosis and enter meiosis, forming a nucleus-free core of germ line cytoplasm called the rachis. Molecular mechanisms of rachis formation and germ line organization are not well understood. Results Mutations in the fli-1 gene disrupt rachis organization without affecting meiotic differentiation, a phenotype in C. elegans referred to here as the germ line morphogenesis (Glm phenotype. In fli-1 mutants, chains of meiotic germ nuclei spanned the rachis and were partially enveloped by invaginations of germ line plasma membrane, similar to nuclei at the cortex. Extensions of the somatic sheath cells that surround the germ line protruded deep inside the rachis and were associated with displaced nuclei in fli-1 mutants. fli-1 encodes a molecule with leucine-rich repeats and gelsolin repeats similar to Drosophila flightless 1 and human Fliih, which have been shown to act as cytoplasmic actin regulators as well as nuclear transcriptional regulators. Mutations in let-60 Ras, previously implicated in germ line development, were found to cause the Glm phenotype. Constitutively-active LET-60 partially rescued the fli-1 Glm phenotype, suggesting that LET-60 Ras and FLI-1 might act together to control germ line morphogenesis. Conclusion FLI-1 controls germ line morphogenesis and rachis organization, a process about which little is known at the molecular level. The LET-60 Ras GTPase might act with FLI-1 to control germ line morphogenesis.

  17. The prohibition order according to paragraph 5 S. 4 EnWG; Die Untersagungsverfuegung nach paragraph 5 S. 4 EnWG

    Rauch, Karsten [WSW Netz GmbH, Wuppertal (Germany)

    2011-02-10

    The introduction of prosecutorial investigation on suspicion of delaying the insolvency proceedings published in the autumn 2010 results to a general question of whether and to what extent a concomitant intervention of the regulatory authorities is indicated. Central to this are the basis for authorization given in paragraph 5 S. 4 Energy Economy Law and the related prohibition authority.

  18. Decay rate ratios of Υ(5S)→B anti B reactions

    Hwang, Dae Sung; Son, Hyungsuk

    2010-01-01

    We calculate the decay rate ratios for OZI allowed decays of Υ(5S) to two B mesons by using the decay amplitudes which incorporate the wave function of the Υ(5S) state. We obtain the result that the branching ratio of the Υ(5S) decay to B s * anti B s * is much larger than the branching ratio to B s anti B s * or anti B s B s * , in good agreement with the recent experimental results of CLEO and BELLE. This agreement with the experimental results is made possible since the nodes of the Υ(5S) radial wave function induce the nodes of the decay amplitude. We find that the results for the Υ(5S) decays to B u (*) anti B u (*) or B d (*) anti B d (*) pairs are sensitive to the parameter values used for the potential between heavy quarks. (orig.)

  19. How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

    Pelczar, P.; Fiett, J.; Bartnik, E.

    1994-01-01

    We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig

  20. The 5S lean method as a tool of industrial management performances

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  1. The transitions 4p-5s in Y VI, Zr VII, Nb VIII and Mo IX

    Chaghtai, M.S.Z.; Rahimullah, K.; Khatoon, S.

    1976-01-01

    With the help of the spectra recorded in the Physics Department of Lund University, Y VI, Zr VII, Nb VIII and Mo IX are freshly analysed. The five 4s 2 4p 4 ground levels and the ten 4s 2 4p 3 5s levels of previous analyses are confirmed in the first three spectra, except for revising in Y VI the 4p 4 1 S 0 and 4p 3 5s( 4 Ssub(3/2)) 2 levels and interchanging 5s( 2 Dsub(3/2)) 1 with 5s( 2 Dsub(3/2)) 2 . All level values are improved due to the new measurements. A new analysis of Mo IX establishing all the 4p 4 and 4p 3 5s levels is being reported. (Auth.)

  2. A streamlined ribosome profiling protocol for the characterization of microorganisms

    Latif, Haythem; Szubin, Richard; Tan, Justin

    2015-01-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  3. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  4. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  5. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus

  6. Forskolin and the meiosis inducing substance synergistically initiate meiosis in fetal male germ cells

    Byskov, A G; Fenger, M; Westergaard, L

    1993-01-01

    We have shown that Meiosis Inducing Substance (MIS) and forskolin synergistically and dose dependently induce meiosis in germ cells of cultured fetal mouse testes. We used a bioassay which consists of fetal mouse testes and ovaries cultured for 6 days. In this study MIS media are spent culture...... are fixed, squashed, and DNA-stained. In these preparations germ cells and somatic cells can be distinguished, and the number of germ cells in the different stages of meiosis is counted as is the number of somatic cells in mitosis. MIS activity is defined to be present in a medium when meiosis is induced...... in male germ cells during culture. We found that MIS media as well as forskolin induced meiosis in fetal male germ cells in a dose-dependent manner. In addition, MIS media and forskolin acted synergistically by inducing meiosis. Female germ cells seem to be unaffected by the various culture media...

  7. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  8. ADN ribosomique 5S chez Arabidopsis thaliana : dynamique chromatinienne et ARN polymérase IV

    Douet , Julien

    2008-01-01

    In Arabidopsis thaliana, 5S rRNA genes are found clustered at pericentromeric heterochromatin of chromosomes 3, 4 and 5. 5S rRNA genes transcription is epigenetically regulated through the formation of specific chromatin structure. In order to determine the events that lead to the establishment of such structures, a study during the first steps of post-germinative plant development was done. Unexpectedly, we observed a decondensation followed by a rapid "re"condensation of 5S rDNA chromatin. ...

  9. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  10. The ribosome-associated complex antagonizes prion formation in yeast.

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  11. Ribosomal DNA internal transcribed spacer 1 and internal ...

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  12. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  13. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  14. Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...

    Unknown

    mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.

  15. Protein folding on the ribosome studied using NMR spectroscopy

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  16. Architecture of the E.coli 70S ribosome

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  17. Immature germ cells in semen - correlation with total sperm count and sperm motility

    Priya S Patil

    2013-01-01

    Conclusions: Round cells in semen can be differentiated into immature germ cells and leucocytes using simple staining methods. The differential counts mentioned in a semen report give valuable and clinically relevant information. In this study, we observed a negative correlation between total count and immature germ cells, as well as sperm motility and shedding of immature germ cells. The latter was statistically significant with a P value 0.000.

  18. Fatty acid composition of maize germ oil from high-oil hybrids wet-milling processing

    Jovanović Petar Lj.

    2005-01-01

    Full Text Available Maize germ was obtained by wet-milling laboratory processing of domestic high-oil maize hybrids. After separation, the germ was subjected to extraction of maize oil. Fatty acid composition of maize germ oil was determined by gas chromatography. The results showed very high levels of unsaturated fatty acids and a constant sum of oleic and linoleic acids in oils of different maize hybrids.

  19. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  20. Origin of pluripotent germ cell tumours: the role of microenvironment during embryonic development

    Kristensen, David Møbjerg; Sonne, Si Brask; Ottesen, Anne Marie

    2008-01-01

    into virtually any type of tissue and form teratomas (non-seminomas). CIS cells display a close phenotypic similarity to fetal germ cells (primordial germ cells or gonocytes) suggesting an origin due to a developmental delay or arrest of differentiation of early germ cells. The pluripotency of these neoplasms...... in several tissue specific stem cells, such as TFAP2C (AP-2gamma) or KIT. CIS and seminomas highly express a number of pre-meiotic germ cell specific genes, which are down-regulated during development to non-seminomas, while the expression of other embryonic markers, such as SOX2, is up...

  1. Sex-specific differences in fetal germ cell apoptosis induced by ionizing radiation

    Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [CEA, DSV/DRR/SEGG/LDRG, Laboratory of Differentiation and Radiobiology of the Gonads, Unit of Gametogenesis and Genotoxicity, F-92265 Fontenay aux Roses (France); Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [Univ. Paris 7-Denis Diderot, UFR of Biology, UMR-S 566, F-92265 Fontenay aux Roses (France); Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [INSERM, U566, F-92265 Fontenay aux Roses (France); Bakalska, M. [Institute of Experimental Morphology and Anthropology, Bulgarian Academy of Sciences, Sofia (Bulgaria); Frydman, R. [Univ Paris-Sud, Clamart F-92140 (France); Frydman, R. [AP-HP, Service de Gynecologie-Obstetrique et Medecine de la Reproduction, Hopital Antoine Beclere, Clamart F-92141 (France); Frydman, R. [INSERM, U782, Clamart F-92140 (France)

    2009-07-01

    Background: We have previously shown that male human fetal germ cells are highly radiosensitive and that their death depends on p53 activation. Male germ cell apoptosis was initiated with doses as low as 0.1 Gy and was prevented by pifithrin {alpha}, a p53 inhibitor. In this study, we investigated the radiosensitivity of early female and male fetal proliferating germ cells. Methods and results: Both male and female fetal germ cells displayed a similar number of {gamma}H2AX foci in response to ionizing radiation (IR). In organ culture of human fetal ovaries, the germ cells underwent apoptosis only when exposed to high doses of IR (1.5 Gy and above). Accumulation of p53 was detected in irradiated male human fetal germ cells but not in female ones. Inhibition of p53 with pifithrin {alpha} did not affect oogonia apoptosis following irradiation. IR induced apoptosis similarly in mouse fetal ovaries in organ culture and in vivo during oogonial proliferation. Germ cell survival in testes from p53 knockout or p63 knockout mice exposed to IR was better than wild-type, whereas female germ cell survival was unaffected by p53 or p63 knockout. Conclusions: These findings show that pre-meiotic male and female fetal germ cells behave differently in response to a genotoxic stress-irradiation with oogonia being less sensitive and undergoing p53-independent apoptosis. (authors)

  2. Pathogenesis of germ cell neoplasia in testicular dysgenesis and disorders of sex development

    Jørgensen, Anne; Lindhardt Johansen, Marie; Juul, Anders

    2015-01-01

    in individuals with 46,XY DSD. We summarise knowledge concerning development and sex differentiation of human gonads, with focus on sex-dimorphic steps of germ cell maturation, including meiosis. We also briefly outline the histopathology of germ cell neoplasia in situ (GCNIS) and gonadoblastoma (GDB), which......Development of human gonads is a sex-dimorphic process which evolved to produce sex-specific types of germ cells. The process of gonadal sex differentiation is directed by the action of the somatic cells and ultimately results in germ cells differentiating to become functional gametes through...

  3. Isolation and purification of wheat germ agglutinin and analysis of its properties

    Wang, Han

    2017-12-01

    In this paper, the wheat germ agglutinin was isolated and purified by affinity chromatography of chicken ovomucoid as ligand. The physicochemical properties were analyzed. The chicken ovomucoid was isolated from egg white and conjugated to affinity chromatography column agarose gel to prepare affinity adsorbent. The crude extract of wheat germ was freezedried by affinity chromatography. The physicochemical properties were analyzed by SDSpolyacrylamide gel electrophoresis and isoelectric focusing electrophoresis. And the relative molecular mass and isoelectric point of wheat germ agglutinin were obtained, and the high efficiency of purification of wheat germ agglutinin was proved by affinity chromatography.

  4. Peculiarities in the CT findings of germ cell tumors in various tumor localizations

    Tazoe, Makoto; Miyagami, Mitsusuke; Tsubokawa, Takashi

    1991-01-01

    The CT findings of 17 germ cell tumors were studied in relation to the locations of the tumor, the pathological diagnoses, and the tumor markers (AFP and HCG). Generally, the CT findings of germ cell tumors depended on the pathological diagnoses more strongly than on the location of the tumors. On plain CT of 7 germ cell tumors in the pineal region, all of them demonstrated heterogeneous findings. Hydrocephalus was seen in 6 cases (86%) and calcification in 6 cases (86%) of the germ cell tumors in the pineal region. Calcification and hydrocephalus that appeared more often than in other regions were characteristic of germ cell tumors of the pineal region. The germ cell tumors in the basal ganglia had a slightly homogenous high density, with small cysts and calcification in most of them on plain CT. On enhanced CT, the tumors were moderately enhanced in all cases located in the basal ganglia. Four cases of germ cell tumors located in the basal ganglia revealed the dilatation of lateral ventricle due to hemispheric atrophy in the tumor side. The germ cell tumors showing an increase in the tumor markers such as AFP and HCG, which were usually malignant germ cell tumors, were strongly enhanced on enhanced CT. (author)

  5. Insights into female germ cell biology: from in vivo development to in vitro derivations.

    Jung, Dajung; Kee, Kehkooi

    2015-01-01

    Understanding the mechanisms of human germ cell biology is important for developing infertility treatments. However, little is known about the mechanisms that regulate human gametogenesis due to the difficulties in collecting samples, especially germ cells during fetal development. In contrast to the mitotic arrest of spermatogonia stem cells in the fetal testis, female germ cells proceed into meiosis and began folliculogenesis in fetal ovaries. Regulations of these developmental events, including the initiation of meiosis and the endowment of primordial follicles, remain an enigma. Studying the molecular mechanisms of female germ cell biology in the human ovary has been mostly limited to spatiotemporal characterizations of genes or proteins. Recent efforts in utilizing in vitro differentiation system of stem cells to derive germ cells have allowed researchers to begin studying molecular mechanisms during human germ cell development. Meanwhile, the possibility of isolating female germline stem cells in adult ovaries also excites researchers and generates many debates. This review will mainly focus on presenting and discussing recent in vivo and in vitro studies on female germ cell biology in human. The topics will highlight the progress made in understanding the three main stages of germ cell developments: namely, primordial germ cell formation, meiotic initiation, and folliculogenesis.

  6. Sex-specific differences in fetal germ cell apoptosis induced by ionizing radiation

    Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Bakalska, M.; Frydman, R.; Frydman, R.; Frydman, R.

    2009-01-01

    Background: We have previously shown that male human fetal germ cells are highly radiosensitive and that their death depends on p53 activation. Male germ cell apoptosis was initiated with doses as low as 0.1 Gy and was prevented by pifithrin α, a p53 inhibitor. In this study, we investigated the radiosensitivity of early female and male fetal proliferating germ cells. Methods and results: Both male and female fetal germ cells displayed a similar number of γH2AX foci in response to ionizing radiation (IR). In organ culture of human fetal ovaries, the germ cells underwent apoptosis only when exposed to high doses of IR (1.5 Gy and above). Accumulation of p53 was detected in irradiated male human fetal germ cells but not in female ones. Inhibition of p53 with pifithrin α did not affect oogonia apoptosis following irradiation. IR induced apoptosis similarly in mouse fetal ovaries in organ culture and in vivo during oogonial proliferation. Germ cell survival in testes from p53 knockout or p63 knockout mice exposed to IR was better than wild-type, whereas female germ cell survival was unaffected by p53 or p63 knockout. Conclusions: These findings show that pre-meiotic male and female fetal germ cells behave differently in response to a genotoxic stress-irradiation with oogonia being less sensitive and undergoing p53-independent apoptosis. (authors)

  7. The impact of atmospheric cold plasma treatment on inactivation of lipase and lipoxygenase of wheat germs

    Tolouie, Haniye; Mohammadifar, Mohammad Amin; Ghomi, Hamid

    2018-01-01

    Wheat germ is a by-product of milling process which contains large amount of nutrients. The shelf life of wheat germ could improve by inactivation of destructive endogenous enzymes especially lipase and lipoxygenase. In this work, the impact of atmospheric cold plasma treatment on the inactivation...... of lipase and lipoxygenase enzymes of wheat germ was studied. Dielectric barrier discharge plasma was utilized to treat wheat germs. The impact of treatment time and voltage of plasma on the inactivation of lipase and lipoxygenase were investigated as well. The higher voltage and treatment time led...

  8. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

    Ruggero, D; Londei, P

    1996-01-01

    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  9. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  10. DNA replication stress restricts ribosomal DNA copy number

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  11. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  12. DNA replication stress restricts ribosomal DNA copy number.

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  13. DNA replication stress restricts ribosomal DNA copy number.

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  14. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  15. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Czifra, György

    2017-09-01

    Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: "YES", because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  16. Hyperfine splitting of B mesons and Bs production at the Υ(5S)

    Lee-Franzini, J.; Heintz, U.; Lovelock, D.M.J.; Narain, M.; Schamberger, R.D.; Willins, J.; Yanagisawa, C.; Franzini, P.; Tuts, P.M.

    1990-01-01

    Using the Columbia University--Stony Brook (CUSB-II) detector we have studied the inclusive photon spectrum from 2.9x10 4 Υ(5S) decays. We observe a strong signal due to B * →Bγ decays. From this we obtain (i) the average B * -B mass difference, 46.7±0.4 MeV, (ii) the photon yield per Υ(5S) decay, left-angle γ/Υ(5S)right-angle=1.09±0.06, and (iii) the average velocity of the B * 's, left-angle β right-angle=0.156±0.010, for a mix of nonstrange (B) and strange (B s ) B * mesons from Υ(5S) decays. From the shape of the photon line, we find that both B and B s mesons are produced with nearly equal values for the hyperfine splitting of the B and B s meson systems

  17. Peak shifts due to B(*)-B(*) rescattering in Υ(5S) dipion transitions

    Meng Ce; Chao Kuangta

    2008-01-01

    We study the energy distributions of dipion transitions Υ(5S) to Υ(1S,2S,3S)π + π - in the final-state rescattering model. Since the Υ(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes Υ(5S)→B ( * ) B ( * ) and B ( * ) B ( * ) →Υ(1S,2S,3S)π + π - . We find that the energy distributions of Υ(1S,2S,3S)π + π - markedly differ from that of Υ(5S)→B ( * ) B ( * ) . In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  18. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  19. Y(5S): What has been learned and what can be learned

    Blusk, S.R.

    2007-01-01

    We present recent measurements of B and B s 0 production using data collected on the Y(5S) resonance at CLEO and Belle. We also briefly discuss what can be learned using sufficiently larger data samples in the future

  20. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Czifra György

    2017-09-01

    Full Text Available Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: “YES”, because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  1. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p5S it was observed and determined that facilitating the job and setting up a safe environment created a statistically significant effect on

  2. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Kolb, V A; Kammer, A A; Spirin, A S

    1987-01-01

    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  3. O5S, Calibration of Organic Scintillation Detector by Monte-Carlo

    1985-01-01

    1 - Nature of physical problem solved: O5S is designed to directly simulate the experimental techniques used to obtain the pulse height distribution for a parallel beam of mono-energetic neutrons incident on organic scintillator systems. Developed to accurately calibrate the nominally 2 in. by 2 in. liquid organic scintillator NE-213 (composition CH-1.2), the programme should be readily adaptable to many similar problems. 2 - Method of solution: O5S is a Monte Carlo programme patterned after the general-purpose Monte Carlo neutron transport programme system, O5R. The O5S Monte Carlo experiment follows the course of each neutron through the scintillator and obtains the energy-deposits of the ions produced by elastic scatterings and reactions. The light pulse produced by the neutron is obtained by summing up the contributions of the various ions with the use of appropriate light vs. ion-energy tables. Because of the specialized geometry and simpler cross section needs O5S is able to by-pass many features included in O5R. For instance, neutrons may be followed individually, their histories analyzed as they occur, and upon completion of the experiment, the results analyzed to obtain the pulse-height distribution during one pass on the computer. O5S does allow the absorption of neutrons, but does not allow splitting or Russian roulette (biased weighting schemes). SMOOTHIE is designed to smooth O5S histogram data using Gaussian functions with parameters specified by the user

  4. Gods, Germs, and Petri Dishes: Toward a Nonsecular Medical Anthropology.

    Roberts, Elizabeth F S

    2016-01-01

    This commentary calls on medical anthropology to become programmatically non-secular. Despite recent anthropological critiques of secularity, within and outside of anthropology, most contemporary medical anthropologists continue to leave deities and religiosity out of their examinations of healing practices, especially in their accounts of biomedicine. Through a critical, relational constructionist lens, which traces how all entities are both constructed and real, a non-secular medical anthropology would insist that when deities are part of medical practice, they are integral to analysis. Importantly then, within the symmetrical nature of this same constructionist lens, biomedical entities like germs and petri dishes need to be accounted for just as much as deities.

  5. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S r

  6. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  7. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  8. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  10. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  11. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  12. Non-germ cell tumours arising in germ cell tumours (teratoma with malignant transformation) in men: CT and MR findings

    Athanasiou, A. [Department of Radiology, Institut Gustave-Roussy, Villejuif (France); Department of Radiology, Institut Curie, Paris (France)], E-mail: alexandra.athanasiou@curie.net; Vanel, D. [Department of Radiology, Institut Gustave-Roussy, Villejuif (France); Department of Radiology, Istituti Ortopedici Rizzoli, Bologna (Italy); El Mesbahi, O. [Department of Medicine, Institut Gustave-Roussy, Villejuif (France); Theodore, C. [Department of Medicine, Institut Gustave-Roussy, Villejuif (France); Department of Oncology, Hopital Foch, Suresnes (France); Fizazi, K. [Department of Medicine, Institut Gustave-Roussy, Villejuif (France)

    2009-02-15

    Purpose: To describe the imaging findings of germ cell tumours (GCT) containing non-germ cell malignant components (also designated teratoma with malignant transformation or TMT). Patients and methods: The records of 14 male patients with GCT and a non-germ cell histological component TMT were retrospectively reviewed. All patients had computed tomography (CT) and/or magnetic resonance (MR) studies before and after initial surgery and chemotherapy, as well as during follow-up. Imaging findings were correlated with the response to treatment and with overall survival. Pathological evaluation, immunohistochemistry, serum alpha-fetoprotein (AFP) and human chorionic gonadotropin (HCG) were also taken into consideration. Sarcoma was identified in 10 out of 14 patients, with rhabdomyosarcoma ranking first (n = 4), followed by osteosarcoma (n = 2), fusiform cell sarcoma (n = 1), undifferentiated sarcoma (n = 1), neurosarcoma (n = 1) and myxoid sarcoma (n = 1). Other histological types of malignant transformation included adenocarcinoma (n = 3) and bronchoalveolar carcinoma (n = 1). Overall, 9 patients relapsed at a median time of 84 months (range 60-168). Results: Non-GCT malignant transformation was identified in the retroperitoneum (5), testis (3), mediastinum (3), peritoneum (2) and lungs (1). The CT and MR imaging findings before treatment and after relapse were evaluated with emphasis on imaging features that could possibly imply the presence of malignant transformation (heterogeneously enhancing soft-tissue masses, ossified masses with calcified lymph nodes, diffuse epiploic thickening associated with ascites and peritoneal nodules, pulmonary alveolar infiltration with septal thickening). All but 1 patient with TMT presented with nodal and distant metastases. The prognosis was poor: within a median follow-up of 59 months (range 3-180), 4 out of 14 patients were alive. Conclusion: TMT is rare and associated with poorer survival compared to GCT. Imaging can be useful

  13. Measurement of B(Υ(5S)→Bs(*)Bs(*)) using φ mesons

    Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Coan, T. E.; Gao, Y. S.; Liu, F.

    2007-01-01

    Knowledge of the B s decay fraction of the Υ(5S) resonance, f S , is important for B s meson studies at the Υ(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423 fb -1 on the Υ(5S) resonance, 6.34 fb -1 on the Υ(4S) and 2.32 fb -1 in the continuum below the Υ(4S), we measure B(Υ(5S)→φX)=(13.8±0.7 -1.5 +2.3 )% and B(Υ(4S)→φX)=(7.1±0.1±0.6)%; the ratio of the two rates is (1.9±0.1 -0.2 +0.3 ). This is the first measurement of the φ meson yield from the Υ(5S). Using these rates, and a model dependent estimate of B(B s →φX), we determine f S =(24.6±2.9 -5.3 +11.0 )%. We also update our previous independent measurement of f S made using the inclusive D s yields to now be (16.8±2.6 -3.4 +6.7 )%, due to a better estimate of the number of hadronic events. We also report the total Υ(5S) hadronic cross section above continuum to be σ(e + e - →Υ(5S))=(0.301±0.002±0.039) nb. This allows us to extract the fraction of B mesons as (58.9±10.0±9.2)%, equal to 1-f S . Averaging the three methods gives a model dependent result of f S =(21 -3 +6 )%

  14. Issues in identifying germ tube positive yeasts by conventional methods.

    Yazdanpanah, Atta; Khaithir, Tzar Mohd Nizam

    2014-01-01

    Candida speciation is vital for epidemiology and management of candidiasis. Nonmolecular conventional methods often fail to identify closely related germ tube positive yeasts from clinical specimens. The present study was conducted to identify these yeasts and to highlight issues in conventional versus molecular methods of identification. A total of 98 germ tube positive yeasts from high vaginal swabs were studied over a 12-month period. Isolates were examined with various methods including growth at 42 °C and 45 °C on Sabouraud dextrose agar (SDA), color development on CHROMagar Candida medium, chlamydospore production on corn meal agar at 25 °C, carbohydrate assimilation using ID 32C system, and polymerase chain reaction using a single pair of primers targeting the hyphal wall protein 1 (Hwp1) gene. Of all the isolates studied, 97 were molecularly confirmed as C. albicans and one isolate was identified as C. dubliniensis. No C. africana was detected in this study. The molecular method used in our study was an accurate and useful tool for discriminating C. albicans, C. dubliniensis, and C. africana. The conventional methods, however, were less accurate and riddled with many issues that will be discussed in further details. © 2013 Wiley Periodicals, Inc.

  15. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  17. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  18. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  19. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  20. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Implementation of 5S in Manufacturing Industry: A Case of Foreign Workers in Melaka

    Chee Houa San

    2018-01-01

    Full Text Available Lean manufacturing system has been infiltrated in manufacturing sectors across the world. In fact, Lean manufacturing system is a practice which regards the use of the resources, creation of value for the end customers, and as the ways to eliminate the waste. There are several tools that can be used to eliminate the waste within the industry. This research is a study of the implementation of 5S in manufacturing industry. Despite this, the research study focused on manufacturing industry, which has been implemented 5S system in Melaka State. Although there are number of tools and technique available to help in improving the manufacturing process, however, there is only few industries could implement the tools successfully. In this research, foreign workers play a main role in implement the 5S systems as the manufacturing industry in Malaysia adopt large amount of foreign workers to work as employees. Therefore, it is important to ensure the foreign workers truly understand the concept of 5S system and adopt the best ways to implement it in order to have better performance. This research study has been proposed by the research model of the barriers to implementation of 5S in manufacturing industry among foreign workers. A several research method has been adopted to do the research, such as descriptive research design with quantitative methods, survey questionnaire and cross-sectional studies.

  2. Immature germ cells in semen - correlation with total sperm count and sperm motility.

    Patil, Priya S; Humbarwadi, Rajendra S; Patil, Ashalata D; Gune, Anita R

    2013-07-01

    Current data regarding infertility suggests that male factor contributes up to 30% of the total cases of infertility. Semen analysis reveals the presence of spermatozoa as well as a number of non-sperm cells, presently being mentioned in routine semen report as "round cells" without further differentiating them into leucocytes or immature germ cells. The aim of this work was to study a simple, cost-effective, and convenient method for differentiating the round cells in semen into immature germ cells and leucocytes and correlating them with total sperm counts and motility. Semen samples from 120 males, who had come for investigation for infertility, were collected, semen parameters recorded, and stained smears studied for different round cells. Statistical analysis of the data was done to correlate total sperm counts and sperm motility with the occurrence of immature germ cells and leucocytes. The average shedding of immature germ cells in different groups with normal and low sperm counts was compared. The clinical significance of "round cells" in semen and their differentiation into leucocytes and immature germ cells are discussed. Round cells in semen can be differentiated into immature germ cells and leucocytes using simple staining methods. The differential counts mentioned in a semen report give valuable and clinically relevant information. In this study, we observed a negative correlation between total count and immature germ cells, as well as sperm motility and shedding of immature germ cells. The latter was statistically significant with a P value 0.000.

  3. Erythropoietin may reduce the risk of germ cell loss in boys with cryptorchidism

    Cortes, Dina; Visfeldt, J; Thorup, J M

    2001-01-01

    In boys with cryptorchidism older than 2 years a testicular biopsy at time of orchiopexy shows lack of germ cells in 10-40% of the cases. The number of spermatogonia per tubule is prognostic for subsequent fertility potential. A biopsy without germ cells is associated with 33-100% risk of inferti...

  4. Orientation of Germ Tubes of Puccinia hordei on the Hordeum chilense Leaf Surface

    Vaz Patto, M.C.; Niks, R.E.

    2000-01-01

    The directional growth of urediospores germ tubes along the transverse axis of a cereal's leaf is considered to be a response to stimuli from the plant surface. In order to find out if the germ tube growth is directed towards stomata, and if the cuticular wax layer plays a role in this orientated

  5. Influence of different dose irradiation on genetic effect in mice somatic and germ cells

    Kostrova, L.N.; Molofej, V.P.; Mosseh, I.B.

    2007-01-01

    Comparison of clastogenic effects of different radiation doses in somatic and germ cells of one the same animals has been studied. Correlation analysis allows to extrapolate genetic effects from somatic cells to germ ones. This can be useful for human model elaboration. (authors)

  6. Prevention of airborne contamination and cross-contamination in germ-free mice by laminar flow

    Waaij, D. van der; Andres, A.H.

    1971-01-01

    The efficacy of horizontal and vertical laminar flow units (equipped with high-efficiency air filters) in the prevention of cross-contamination between cages and of contamination from outside has been demonstrated. With germ-free mice and using germ-free standard techniques for sterilization and for

  7. Weierstrass preparation and division theorems for the ring of germs of superanalytic functions

    Yankov, C.L.

    1989-11-01

    The aim of this paper is to show that Weierstrass preparation and division theorems hold for the ring of germs of superanalytic functions at a given point. This ring is the tensor product of the ring of germs of analytic functions at that point and a finite-dimensional complex Grassmann algebra. 7 refs

  8. Risk and prognostic significance of metachronous contralateral testicular germ cell tumours

    Schaapveld, M.; van den Belt-Dusebout, A. W.; Gietema, J. A.; de Wit, R.; Horenblas, S.; Witjes, J. A.; Hoekstra, H. J.; Kiemeney, L. A. L. M.; Louwman, W. J.; Ouwens, G. M.; Aleman, B. M. P.; van Leeuwen, F. E.

    2012-01-01

    BACKGROUND: Testicular germ cell tumour (TGCT) patients are at increased risk of developing a contralateral testicular germ cell tumour (CTGCT). It is unclear whether TGCT treatment affects CTGCT risk. METHODS: The risk of developing a metachronous CTGCT (a CTGCT diagnosed >= 6 months after a

  9. Primary Germ Cell Tumors of the Mediastinum: 10 Years of Experience in a Tertiary Teaching Hospital

    Chih-Jen Yang

    2005-09-01

    Full Text Available Germ cell tumors occur mostly in the gonad. Extragonadal germ cell tumors are rare, and most occur in the retroperitoneum and mediastinum. Primary mediastinal germ cell tumors are often found in the anterior portion of the mediastinum and include teratomas and non-teratomatous tumors. Non-teratomatous tumors include seminomas and malignant non-seminomatous germ cell tumors (MNSGCTs. MNSGCTs include yolk sac tumors, choriocarcinomas, embryonal carcinomas, and mixed type germ cell tumors. Teratomas are the most common germ cell tumors of the mediastinum, and seminomas are the most common non-teratomatous germ cell tumors of the mediastinum. Cases of primary mediastinal MNSGCT reported in the literature are rare. In this report, we review all primary mediastinal germ cell tumors from a 10-year period at the Chung-Ho Memorial Hospital of Kaohsiung Medical University. A total of 14 cases were reviewed, including 11 patients with mature teratomas, two with yolk sac tumors, and one with seminoma. We discuss the differences in clinical presentation, histopathologic characteristics, treatment, and prognosis.

  10. Childhood Central Nervous System Germ Cell Tumors Treatment (PDQ®)—Health Professional Version

    CNS germ cell tumors can be diagnosed and classified based on histology, tumor markers, or a combination of both. Get detailed information about newly diagnosed and recurrent childhood CNS germ cell tumors including molecular features and clinical features, diagnostic and staging evaluation, and treatment in this summary for clinicians.

  11. Germ cells are not required to establish the female pathway in mouse fetal gonads.

    Danielle M Maatouk

    Full Text Available The fetal gonad is composed of a mixture of somatic cell lineages and germ cells. The fate of the gonad, male or female, is determined by a population of somatic cells that differentiate into Sertoli or granulosa cells and direct testis or ovary development. It is well established that germ cells are not required for the establishment or maintenance of Sertoli cells or testis cords in the male gonad. However, in the agametic ovary, follicles do not form suggesting that germ cells may influence granulosa cell development. Prior investigations of ovaries in which pre-meiotic germ cells were ablated during fetal life reported no histological changes during stages prior to birth. However, whether granulosa cells underwent normal molecular differentiation was not investigated. In cases where germ cell loss occurred secondary to other mutations, transdifferentiation of granulosa cells towards a Sertoli cell fate was observed, raising questions about whether germ cells play an active role in establishing or maintaining the fate of granulosa cells. We developed a group of molecular markers associated with ovarian development, and show here that the loss of pre-meiotic germ cells does not disrupt the somatic ovarian differentiation program during fetal life, or cause transdifferentiation as defined by expression of Sertoli markers. Since we do not find defects in the ovarian somatic program, the subsequent failure to form follicles at perinatal stages is likely attributable to the absence of germ cells rather than to defects in the somatic cells.

  12. Germ Cells Are Not Required to Establish the Female Pathway in Mouse Fetal Gonads

    Maatouk, Danielle M.; Mork, Lindsey; Hinson, Ashley; Kobayashi, Akio; McMahon, Andrew P.; Capel, Blanche

    2012-01-01

    The fetal gonad is composed of a mixture of somatic cell lineages and germ cells. The fate of the gonad, male or female, is determined by a population of somatic cells that differentiate into Sertoli or granulosa cells and direct testis or ovary development. It is well established that germ cells are not required for the establishment or maintenance of Sertoli cells or testis cords in the male gonad. However, in the agametic ovary, follicles do not form suggesting that germ cells may influence granulosa cell development. Prior investigations of ovaries in which pre-meiotic germ cells were ablated during fetal life reported no histological changes during stages prior to birth. However, whether granulosa cells underwent normal molecular differentiation was not investigated. In cases where germ cell loss occurred secondary to other mutations, transdifferentiation of granulosa cells towards a Sertoli cell fate was observed, raising questions about whether germ cells play an active role in establishing or maintaining the fate of granulosa cells. We developed a group of molecular markers associated with ovarian development, and show here that the loss of pre-meiotic germ cells does not disrupt the somatic ovarian differentiation program during fetal life, or cause transdifferentiation as defined by expression of Sertoli markers. Since we do not find defects in the ovarian somatic program, the subsequent failure to form follicles at perinatal stages is likely attributable to the absence of germ cells rather than to defects in the somatic cells. PMID:23091613

  13. Dafachronic acid inhibits C. elegans germ cell proliferation in a DAF-12-dependent manner.

    Mukherjee, Madhumati; Chaudhari, Snehal N; Balachandran, Riju S; Vagasi, Alexandra S; Kipreos, Edward T

    2017-12-15

    Dafachronic acid (DA) is a bile acid-like steroid hormone that regulates dauer formation, heterochrony, and lifespan in C. elegans. Here, we describe that DA is an inhibitor of C. elegans germ stem cell proliferation in adult hermaphrodites. Using a C. elegans germ cell primary culture system, we show that DA inhibits the proliferation of germ cells in vitro. Exogenous DA reduces the frequency of large tumors in adult tumorous germline mutants and decreases the proliferation of wild-type germ stem cells in adult hermaphrodites. In contrast, DA has no appreciable effect on the proliferation of larval-stage germ cells in wild type. The inhibition of adult germ cell proliferation by DA requires its canonical receptor DAF-12. Blocking DA production by inactivating the cytochrome P450 DAF-9 increases germ cell proliferation in wild-type adult hermaphrodites and the frequency of large tumors in germline tumorous mutants, suggesting that DA inhibits the rate of germ cell proliferation under normal growth conditions. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Germ Cell Tumor Located in the Midline of the Anterior Neck

    Tatyana PIRDOPSKA; Ivan TERZIEV; Sv. HRISTOVA; W. MLADENOVSKY; R. PETKOV

    2011-01-01

    Primary germ cell tumors involving midline of the anterior neck are extremely rare. Here we report a 68-year-old male who was operated due to a mass lesion in the anterior neck with infiltration of the isthmus of the thyroid gland. Histopathological examination revealed a germ cell tumor with extragonadal localization in the anterior neck infiltrating the isthmus of the thyroid gland.

  15. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  16. Ribosome-catalyzed formation of an abnormal peptide analogue

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  17. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  18. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  19. In vitro germ cell differentiation from cynomolgus monkey embryonic stem cells.

    Kaori Yamauchi

    Full Text Available BACKGROUND: Mouse embryonic stem (ES cells can differentiate into female and male germ cells in vitro. Primate ES cells can also differentiate into immature germ cells in vitro. However, little is known about the differentiation markers and culture conditions for in vitro germ cell differentiation from ES cells in primates. Monkey ES cells are thus considered to be a useful model to study primate gametogenesis in vitro. Therefore, in order to obtain further information on germ cell differentiation from primate ES cells, this study examined the ability of cynomolgus monkey ES cells to differentiate into germ cells in vitro. METHODS AND FINDINGS: To explore the differentiation markers for detecting germ cells differentiated from ES cells, the expression of various germ cell marker genes was examined in tissues and ES cells of the cynomolgus monkey (Macaca fascicularis. VASA is a valuable gene for the detection of germ cells differentiated from ES cells. An increase of VASA expression was observed when differentiation was induced in ES cells via embryoid body (EB formation. In addition, the expression of other germ cell markers, such as NANOS and PIWIL1 genes, was also up-regulated as the EB differentiation progressed. Immunocytochemistry identified the cells expressing stage-specific embryonic antigen (SSEA 1, OCT-4, and VASA proteins in the EBs. These cells were detected in the peripheral region of the EBs as specific cell populations, such as SSEA1-positive, OCT-4-positive cells, OCT-4-positive, VASA-positive cells, and OCT-4-negative, VASA-positive cells. Thereafter, the effect of mouse gonadal cell-conditioned medium and growth factors on germ cell differentiation from monkey ES cells was examined, and this revealed that the addition of BMP4 to differentiating ES cells increased the expression of SCP1, a meiotic marker gene. CONCLUSION: VASA is a valuable gene for the detection of germ cells differentiated from ES cells in monkeys, and the

  20. The role of sex chromosomes in mammalian germ cell differentiation: can the germ cells carrying X and Y chromosomes differentiate into fertile oocytes?

    Teruko Taketo

    2015-06-01

    Full Text Available The sexual differentiation of germ cells into spermatozoa or oocytes is strictly regulated by their gonadal environment, testis or ovary, which is determined by the presence or absence of the Y chromosome, respectively. Hence, in normal mammalian development, male germ cells differentiate in the presence of X and Y chromosomes, and female germ cells do so in the presence of two X chromosomes. However, gonadal sex reversal occurs in humans as well as in other mammalian species, and the resultant XX males and XY females can lead healthy lives, except for a complete or partial loss of fertility. Germ cells carrying an abnormal set of sex chromosomes are efficiently eliminated by multilayered surveillance mechanisms in the testis, and also, though more variably, in the ovary. Studying the molecular basis for sex-specific responses to a set of sex chromosomes during gametogenesis will promote our understanding of meiotic processes contributing to the evolution of sex determining mechanisms. This review discusses the fate of germ cells carrying various sex chromosomal compositions in mouse models, the limitation of which may be overcome by recent successes in the differentiation of functional germ cells from embryonic stem cells under experimental conditions.

  1. Germ cell regeneration-mediated, enhanced mutagenesis in the ascidian Ciona intestinalis reveals flexible germ cell formation from different somatic cells.

    Yoshida, Keita; Hozumi, Akiko; Treen, Nicholas; Sakuma, Tetsushi; Yamamoto, Takashi; Shirae-Kurabayashi, Maki; Sasakura, Yasunori

    2017-03-15

    The ascidian Ciona intestinalis has a high regeneration capacity that enables the regeneration of artificially removed primordial germ cells (PGCs) from somatic cells. We utilized PGC regeneration to establish efficient methods of germ line mutagenesis with transcription activator-like effector nucleases (TALENs). When PGCs were artificially removed from animals in which a TALEN pair was expressed, somatic cells harboring mutations in the target gene were converted into germ cells, this germ cell population exhibited higher mutation rates than animals not subjected to PGC removal. PGC regeneration enables us to use TALEN expression vectors of specific somatic tissues for germ cell mutagenesis. Unexpectedly, cis elements for epidermis, neural tissue and muscle could be used for germ cell mutagenesis, indicating there are multiple sources of regenerated PGCs, suggesting a flexibility of differentiated Ciona somatic cells to regain totipotency. Sperm and eggs of a single hermaphroditic, PGC regenerated animal typically have different mutations, suggesting they arise from different cells. PGCs can be generated from somatic cells even though the maternal PGCs are not removed, suggesting that the PGC regeneration is not solely an artificial event but could have an endogenous function in Ciona. This study provides a technical innovation in the genome-editing methods, including easy establishment of mutant lines. Moreover, this study suggests cellular mechanisms and the potential evolutionary significance of PGC regeneration in Ciona. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Studies of inelastic cross-section in Rb(7S) + Rb(5S) collisions

    Caiyan, L.; Ekers, A.; Latvia Univ., Riga; Klavins, J.; Jansons, M.

    1996-01-01

    The cross section σ = (8 ± 4) x 10 -15 cm 2 was determined for the Rb(7S) + Rb(5S) → Rb(5D) + Rb(5S) excitation energy transfer process, and the quenching cross section σ q = (2 ± 1) x 10 -14 cm 2 for the Rb(5D) state in collisions with ground state Rb atoms. Applying rubidium quasimolecular asymptotic potential curves at relatively large internuclear distances, a qualitative interpretation of the experimental results is presented. It is shown that the quenching of the Rb(5D) atoms in collisions may be explained by a reversed energy pooling process Rb(5D) + Rb(5S) → Rb(5P) + Rb(5P). (orig.)

  3. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  4. IMPLEMENTING THE 5S METHOD IN THE PRODUCTION SYSTEM OF DACIA & RENAULT

    Marin CIOBANU

    2014-11-01

    Full Text Available The aim of this paper is to demonstrate the usefulness of the 5S method in addressing the issues of continuous improvement of productivity and quality of work. There are presented the 5 steps, techniques and the adjacent tools. Solutions implemented in the production system Dacia & Renault are indicated. This article provides a practical framework. The 5S method follows the Deming PDCA cycle which constitutes the starting point of the SDCA cycle of continuous improvement of the company's activities in order to obtain excellence. The implementing time of the method depends on the resources and materials allocated. Deployment of 5S is achieved by a scheme of "3+2": the first 3S are tangible and immediate actions, the last 2S appeal to specific management actions. The efficacy of their own workplace in total autonomy creates comfort in the work environment and gives personal benefits to workers.

  5. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  6. Ethical and psychological factors in 5S and total productive maintenance

    Jamal Ahmed Hama Kareem

    2017-08-01

    Full Text Available Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results.  Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b Panneerselvam (2012 Singh et al. (2013 and Poduval & Pramod (2015 in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM that are used to bring out the best productivity.

  7. Ethical and psychological factors in 5S and total productive maintenance

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-01-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  8. Ethical and psychological factors in 5S and total productive maintenance

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-07-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  9. Assembly constraints drive co-evolution among ribosomal constituents.

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  11. Further characterization of ribosome binding to thylakoid membranes

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  12. Structure of Vibrio cholerae ribosome hibernation promoting factor

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  13. A new version of the RDP (Ribosomal Database Project)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  14. Simulation and analysis of single-ribosome translation

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  15. Multiplicity of Buc copies in Atlantic salmon contrasts with loss of the germ cell determinant in primates, rodents and axolotl

    Skugor, Adrijana; Tveiten, Helge; Johnsen, Hanne; Andersen, Øivind

    2016-01-01

    Background The primordial germ cells (PGCs) giving rise to gametes are determined by two different mechanisms in vertebrates. While the germ cell fate in mammals and salamanders is induced by zygotic signals, maternally delivered germ cell determinants specify the PGCs in birds, frogs and teleost fish. Assembly of the germ plasm in the oocyte is organized by the single Buc in zebrafish, named Velo1 in Xenopus, and by Oskar in Drosophila. Secondary loss of oskar in several insect lineages coin...

  16. 5S-MENETELMÄN KÄYTTÖÖNOTTO SERVICEPOINTILLA

    Ovaskainen, Tatu-Pekka

    2014-01-01

    Opinnäytetyö on tehty Servicepoint Kuopio Oy:n toimeksiannosta. Servicepoint Kuopio on teollisuuden kunnossapitoon automaatio- ja sähköistysprojekteihin sekä robottisovelluksiin erikoistunut yritys. Yrityksen kahden toimipisteen yhdistyminen lisäsi toimipisteellä henkilöstön ja työkalujen määrää. Yrityksessä toteutetaan sovelletusti Lean-ajattelumallia. Yksi Leanin työkaluista on 5S, joka haluttiin ottaa käyttöön yrityksessä. Opinnäytetyön tavoitteena oli ottaa käyttöön 5S-menetelmä Servi...

  17. 5S-menetelmän käyttöönotto Case: Planmeca Oy

    Velic, Adel

    2014-01-01

    Opinnäytetyön tavoitteena on tutkia Planmeca Oy:n panoraamaröntgentuotannossa syksyllä 2012 toteutetun 5S-projektin onnistuneisuutta. Työ kattaa sekä 5S-periaatteiden mukaisesti suunniteltujen ja toteutettujen panoraamaröntgentuotannon Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiimin työpisteiden että projektin toteutustavan onnistuneisuuden mittaamisen. Tutkimusmenetelmänä käytetään Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiim...

  18. From Young Children's Ideas about Germs to Ideas Shaping a Learning Environment

    Ergazaki, Marida; Saltapida, Konstantina; Zogza, Vassiliki

    2010-11-01

    This paper is concerned with highlighting young children’s ideas about the nature, location and appearance of germs, as well as their reasoning strands about germs’ ontological category and biological functions. Moreover, it is concerned with exploring how all these could be taken into account for shaping a potentially fruitful learning environment. Conducting individual, semi-structured interviews with 35 preschoolers (age 4.5-5.5) of public kindergartens in the broader area of Patras, we attempted to trace their ideas about what germs are, where they may be found, whether they are good or bad and living or non-living and how they might look like in a drawing. Moreover, children were required to attribute a series of biological functions to dogs, chairs and germs, and finally to create a story with germs holding a key-role. The analysis of our qualitative data within the “NVivo” software showed that the informants make a strong association of germs with health and hygiene issues, locate germs mostly in our body and the external environment, are not familiar with the ‘good germs’-idea, and draw germs as ‘human-like’, ‘animal-like’ or ‘abstract’ entities. Moreover, they have significant difficulties not only in employing biological functions as criteria for classifying germs in the category of ‘living’, but also in just attributing such functions to germs using a warrant. Finally, the shift from our findings to a 3-part learning environment aiming at supporting preschoolers in refining their initial conceptualization of germs is thoroughly discussed in the paper.

  19. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  20. Clinical use of serum TRA-1-60 as tumor marker in patients with germ cell cancer

    Lajer, Henrik; Daugaard, Gedske; Andersson, Anna-Maria

    2002-01-01

    TRA-1-60 antigen has been related to the presence of embryonal germ cell carcinoma (EC) and carcinoma in situ. Our study further investigated the clinical efficacy of TRA-1-60 as a serum tumor marker for germ cell cancer in the testis. Three groups of patients with germ cell tumors were included:...

  1. File list: InP.Gon.10.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Full Text Available InP.Gon.10.AllAg.Testicular_germ_cells mm9 Input control Gonad Testicular germ cell.../dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Gon.10.AllAg.Testicular_germ_cells.bed ...

  2. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

    Anne Kathrin Hett

    Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.

  4. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study.

    Hanf, Matthieu; Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-11-08

    To assess at country level the association of mortality in under 5s with a large set of determinants. Longitudinal study. 193 United Nations member countries, 2000-09. Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. National rate of deaths in under 5s per 1000 live births The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015.

  5. Ba 5s photoionization in the region of the second Cooper minimum

    Whitfield, S B; Wehlitz, R; Dolmatov, V K

    2011-01-01

    We investigate the 5s angular distribution parameter and partial photoionization cross section of atomic Ba in the region of the second Cooper minimum covering a photon energy region from 120 to 260 eV. We observe a strong drop in the Ba 5s β value from 2.0, reaching a minimum of 1.57 ± 0.07 at a photon energy of 150 eV. The β value then slowly rises back towards its nominal value of 2.0 at photon energies beyond the minimum. Our measured 5s partial cross section also shows a pronounced dip around 170 eV due to interchannel coupling with the Ba 4d photoelectrons. After combining our measurements with previous experimental values at lower photon energies, we obtain a consistent data set spanning the photon energy range prior to the onset of the partial cross section maximum and through the cross section minimum. We also calculate the 5s partial cross section under several different levels of approximation. We find that the generalized random-phase approximation with exchange calculation models the shape and position of the combined experimental cross section data set rather well after incorporating experimental ionization energies and a shift in the photon energy scale.

  6. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  7. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA

    Kumke, K.; Macas, Jiří; Fuchs, J.; Altschmied, L.; Kour, J.; Dhar, M.K.; Houben, A.

    2016-01-01

    Roč. 148, č. 1 (2016), s. 68-73 ISSN 1424-8581 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Polymorhpic A chromosome segment * Satellite repeat * Supernumerary chromosome * 5S rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  8. Dramatic nondipole effects in low-energy photoionization: Experimental and theoretical study of Xe 5s

    Hemmers, O.; Lindle, D.W.; Baker, J.; Hudson, A.; Lotrakul, M.; Tran, I.C.; Guillemin, R.; Stolte, W.C.; Wolska, A.; Yu, S.W.; Kanter, E.P.; Kraessig, B.; Southworth, S.H.; Wehlitz, R.; Rolles, D.; Amusia, M.Ya.; Cheng, K.T.; Chernysheva, L.V.; Johnson, W.R.; Manson, S.T.

    2003-01-01

    The Xe 5s nondipole photoelectron parameter γ is obtained experimentally and theoretically from threshold to ∼200 eV photon energy. Significant nondipole effects are seen even in the threshold region of this valence shell photoionization. In addition, contrary to previous understanding, clear evidence of interchannel coupling among quadrupole photoionization channels is found

  9. Evaluation of corn germ from ethanol production as an alternative fat source in dairy cow diets.

    Abdelqader, M M; Hippen, A R; Kalscheur, K F; Schingoethe, D J; Karges, K; Gibson, M L

    2009-03-01

    Sixteen multiparous cows (12 Holstein and 4 Brown Swiss, 132 +/- 20 d in milk) were used in a replicated 4 x 4 Latin square design with 4-wk periods to determine the effects of feeding corn germ on dairy cow performance. Diets were formulated with increasing concentrations of corn germ (Dakota Germ, Poet Nutrition, Sioux Falls, SD) at 0, 7, 14, and 21% of the diet dry matter (DM). All diets had a 55:45 forage to concentrate ratio, where forage was 55% corn silage and 45% alfalfa hay. Dietary fat increased from 4.8% in the control diet to 8.2% at the greatest inclusion level of corn germ. The addition of corn germ resulted in a quadratic response in DM intake with numerically greater intake at 14% of diet DM. Feeding corn germ at 7 and 14% of diet DM increased milk yield and energy-corrected milk as well as fat percentage and yield. Milk protein yield tended to decrease as the concentration of corn germ increased in the diet. Dietary treatments had no effect on feed efficiency, which averaged 1.40 kg of energy-corrected milk/kg of DMI. Increasing the dietary concentration of corn germ resulted in a linear increase in milk fat concentrations of monounsaturated and polyunsaturated fatty acids at the expense of saturated fatty acids. Milk fat concentration and yield of cis-9, trans-11 and trans-10, cis-12 conjugated linoleic acid were increased with increased dietary concentrations of corn germ. Although milk fat concentrations of both total trans-18:1 and cis-18:1 fatty acids increased linearly, a marked numeric increase in the concentration of trans-10 C18:1 was observed in milk from cows fed the 21% corn germ diet. A similar response was observed in plasma concentration of trans-10 C18:1. Feeding increasing concentrations of corn germ had no effect on plasma concentrations of glucose, triglyceride, or beta-hydroxybutyrate; however, the concentration of nonesterified fatty acids increased linearly, with plasma cholesterol concentration demonstrating a similar trend

  10. Pathobiology of germ cell tumors - applying the gossip test!

    Looijenga, Leendert H J; Oosterhuis, J Wolter

    2013-01-01

    Residual mature teratoma, a frequent finding in clinical pathology since the introduction of cisplatin-based chemotherapy, put Wolter Oosterhuis on the track of germ cell tumors (GCTs). These neoplasms in the borderland between developmental biology and oncology have fascinated him ever since. He tells the story on how GCTs brought him in contact with leading investigators in the field like Ivan Damjanov, Peter Andrews, and Niels Skakkebaek. His fruitful line of research was made possible through a longstanding collaboration with Bauke de Jong and, to this day, Leendert Looijenga who joined his group as a student in 1988. Probably their most important contribution to the field of GCTs is an integrated approach to GCTs, combining epidemiology, pathology, (cyto)genetics and molecular biology, that has resulted in a pathobiology-based classification of GCTs in five types. It has clinical relevance and stimulates further research on these intriguing neoplasms and their corresponding animal models.

  11. Functional fixation of autotransplanted tooth germs by using bioresorbable membranes.

    Gérard, Eric; Membre, Hervé; Gaudy, Jean-François; Mahler, Patrick; Bravetti, Pierre

    2002-12-01

    The purpose of this study was to evaluate the contribution of a bioresorbable membrane placement to the healing of immature teeth after autotransplantation of tooth buds. Six cases were selected: 2 transplantations of wisdom teeth, 2 for premolar agenesis, 1 for ectopia, and 1 premolar in an incisor position. The crown of each tooth germ and the marginal alveolar bone were covered with a resorbable membrane. The radicular edification was nearly complete, neither ankylosis nor inflammatory resorption was observable, the pulp vitality was preserved, and the periodontal integration was identical to that of other teeth. The membrane ensured contention and stabilization of the transplant, allowed functional stimulation, permitted protection of the coagulum and periodontal cells, and kept the epithelium at a distance. The transplantations of immature teeth were improved by the use of a resorbable membrane, which caused an optimal functional fixation of the transplanted tooth.

  12. Testicular germ cell tumours and parental occupational exposure to pesticides

    Le Cornet, Charlotte; Fervers, Béatrice; Oksbjerg Dalton, Susanne

    2015-01-01

    OBJECTIVES: A potential impact of exposure to endocrine disruptors, including pesticides, during intrauterine life, has been hypothesised in testicular germ cell tumour (TGCT) aetiology, but exposure assessment is challenging. This large-scale registry-based case-control study aimed to investigate...... controls per case were randomly selected from the general national populations, matched on year of birth. Information on parental occupation was collected through censuses or Pension Fund information and converted into a pesticide exposure index based on the Finnish National Job-Exposure Matrix. RESULTS......: A total of 9569 cases and 32 028 controls were included. No overall associations were found for either maternal or paternal exposures and TGCT risk in their sons, with ORs of 0.83 (95% CI 0.56 to 1.23) and of 1.03 (0.92 to 1.14), respectively. Country-specific estimates and stratification by birth cohorts...

  13. Testicular germ cell tumors: Molecular genetic and clinicomorphological aspects

    M. V. Nemtsova

    2015-03-01

    Full Text Available Testicular tumors are the most common form of solid cancer in young men. According to the 2004 WHO classification, testicular germ cell tumors (TGCT may present with different histological types. Embryonic cells of varying grade may be a source of TGCT and the occurrence of this type of tumors is directly related to the formation of a pool of male sex cells and gametogenesis. The paper gives information on mo- lecular stages for the process of formation of male sex cells in health, as well as ways of their impairments leading to TGCT. An investigation of the profiles of gene expression and the spectrum of molecular damages revealed genes responsible for a predisposition to the sporadic and hereditary forms of TGCT. The paper presents the current molecular genetic and clinicomorphological characteristics of TGCT. 

  14. Extraforaminal Lumbar Interbody Fusion at the L5-S1 Level: Technical Considerations and Feasibility.

    Kurzbuch, Arthur Robert; Kaech, Denis; Baranowski, Pawel; Baranowska, Alicja; Recoules-Arche, Didier

    2017-09-01

    Background  Extraforaminal lumbar interbody fusion (ELIF) surgery is a muscle-sparing approach that allows the treatment of various degenerative spinal diseases. It is technical challenging to perform the ELIF approach at the L5-S1 level because the sacral ala obstructs the view of the intervertebral disk space. Methods  We reported earlier on the ELIF technique in which the intervertebral disk is targeted at an angle of 45 degrees relative to the midline. In this article we describe the technical process we developed to overcome the anatomic relation between the sacral ala and the intervertebral disk space L5-S1 that hinders the ELIF approach at this level. We then report in a retrospective analysis on the short-term clinical and radiologic outcome of 100 consecutive patients with degenerative L5-S1 pathologies who underwent ELIF surgery. Results  The L5-S1 ELIF approach could be realized in all patients. The short-term clinical outcome was evaluated 5 months after surgery: 92% of the patients were satisfied with their postoperative result; 8% had a poor result. Overall, 17% of the patients presented light radicular or low back pain not influencing their daily activity, and 82% of the patients working before surgery returned to work 3 to 7 months after surgery. The radiologic outcome was documented by computed tomography at 5 months after surgery and showed fusion in 99% of the patients. Lumbar magnetic resonance imaging performed in 5 patients at 6 months after surgery revealed the integrity of the paraspinal muscles. Conclusions  ELIF surgery at the L5-S1 level is technically feasible for various degenerative spinal diseases. Analysis of the clinical and radiologic data in a consecutive retrospective cohort of patients who underwent this surgical procedure showed a good short-term clinical outcome and fusion rate. Georg Thieme Verlag KG Stuttgart · New York.

  15. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  16. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  17. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  18. Germ Cell Proteins in Melanoma: Prognosis, Diagnosis, Treatment, and Theories on Expression

    Rosa, A. M.; Dabas, N.; Byrnes, D. M.; Eller, M. S.; Grichnik, J. M.; Grichnik, J M.; Grichnik, J M.

    2012-01-01

    Germ cell protein expression in melanoma has been shown to correlate with malignancy, severity of disease and to serve as an immunologic target for therapy. However, very little is known about the role that germ cell proteins play in cancer development. Unique germ cell pathways include those involved in immortalization, genetic evolution, and energy metabolism. There is an ever increasing recognition that within tumors there is a subpopulation of cells with stem-cell-like characteristics that play a role in driving tumor genesis. Stem cell and germ cell biology is intertwined. Given the enormous potential and known expression of germ cell proteins in melanoma, it is possible that they represent a largely untapped resource that may play a fundamental role in tumor development and progression. The purpose of this paper is to provide an update on the current value of germ cell protein expression in melanoma diagnosis, prognosis, and therapy, as well as to review critical germ cell pathways and discuss the potential roles these pathways may play in malignant transformation

  19. Generation of organized germ layers from a single mouse embryonic stem cell.

    Poh, Yeh-Chuin; Chen, Junwei; Hong, Ying; Yi, Haiying; Zhang, Shuang; Chen, Junjian; Wu, Douglas C; Wang, Lili; Jia, Qiong; Singh, Rishi; Yao, Wenting; Tan, Youhua; Tajik, Arash; Tanaka, Tetsuya S; Wang, Ning

    2014-05-30

    Mammalian inner cell mass cells undergo lineage-specific differentiation into germ layers of endoderm, mesoderm and ectoderm during gastrulation. It has been a long-standing challenge in developmental biology to replicate these organized germ layer patterns in culture. Here we present a method of generating organized germ layers from a single mouse embryonic stem cell cultured in a soft fibrin matrix. Spatial organization of germ layers is regulated by cortical tension of the colony, matrix dimensionality and softness, and cell-cell adhesion. Remarkably, anchorage of the embryoid colony from the 3D matrix to collagen-1-coated 2D substrates of ~1 kPa results in self-organization of all three germ layers: ectoderm on the outside layer, mesoderm in the middle and endoderm at the centre of the colony, reminiscent of generalized gastrulating chordate embryos. These results suggest that mechanical forces via cell-matrix and cell-cell interactions are crucial in spatial organization of germ layers during mammalian gastrulation. This new in vitro method could be used to gain insights on the mechanisms responsible for the regulation of germ layer formation.

  20. Control over the morphology and segregation of Zebrafish germ cell granules during embryonic development

    Nakkrasae La-Iad

    2008-05-01

    Full Text Available Abstract Background Zebrafish germ cells contain granular-like structures, organized around the cell nucleus. These structures share common features with polar granules in Drosophila, germinal granules in Xenopus and chromatoid bodies in mice germ cells, such as the localization of the zebrafish Vasa, Piwi and Nanos proteins, among others. Little is known about the structure of these granules as well as their segregation in mitosis during early germ-cell development. Results Using transgenic fish expressing a fluorescently labeled novel component of Zebrafish germ cell granules termed Granulito, we followed the morphology and distribution of the granules. We show that whereas these granules initially exhibit a wide size variation, by the end of the first day of development they become a homogeneous population of medium size granules. We investigated this resizing event and demonstrated the role of microtubules and the minus-end microtubule dependent motor protein Dynein in the process. Last, we show that the function of the germ cell granule resident protein the Tudor domain containing protein-7 (Tdrd7 is required for determination of granule morphology and number. Conclusion Our results suggest that Zebrafish germ cell granules undergo a transformation process, which involves germ cell specific proteins as well as the microtubular network.

  1. Generation of male differentiated germ cells from various types of stem cells.

    Hou, Jingmei; Yang, Shi; Yang, Hao; Liu, Yang; Liu, Yun; Hai, Yanan; Chen, Zheng; Guo, Ying; Gong, Yuehua; Gao, Wei-Qiang; Li, Zheng; He, Zuping

    2014-06-01

    Infertility is a major and largely incurable disease caused by disruption and loss of germ cells. It affects 10-15% of couples, and male factor accounts for half of the cases. To obtain human male germ cells 'especially functional spermatids' is essential for treating male infertility. Currently, much progress has been made on generating male germ cells, including spermatogonia, spermatocytes, and spermatids, from various types of stem cells. These germ cells can also be used in investigation of the pathology of male infertility. In this review, we focused on advances on obtaining male differentiated germ cells from different kinds of stem cells, with an emphasis on the embryonic stem (ES) cells, the induced pluripotent stem (iPS) cells, and spermatogonial stem cells (SSCs). We illustrated the generation of male differentiated germ cells from ES cells, iPS cells and SSCs, and we summarized the phenotype for these stem cells, spermatocytes and spermatids. Moreover, we address the differentiation potentials of ES cells, iPS cells and SSCs. We also highlight the advantages, disadvantages and concerns on derivation of the differentiated male germ cells from several types of stem cells. The ability of generating mature and functional male gametes from stem cells could enable us to understand the precise etiology of male infertility and offer an invaluable source of autologous male gametes for treating male infertility of azoospermia patients. © 2014 Society for Reproduction and Fertility.

  2. Light and electron microscopic analyses of Vasa expression in adult germ cells of the fish medaka.

    Yuan, Yongming; Li, Mingyou; Hong, Yunhan

    2014-07-15

    Germ cells of diverse animal species have a unique membrane-less organelle called germ plasm (GP). GP is usually associated with mitochondria and contains RNA binding proteins and mRNAs of germ genes such as vasa. GP has been described as the mitochondrial cloud (MC), intermitochondrial cement (IC) and chromatoid body (CB). The mechanism underlying varying GP structures has remained incompletely understood. Here we report the analysis of GP through light and electron microscopy by using Vasa as a marker in adult male germ cells of the fish medaka (Oryzias latipes). Immunofluorescence light microscopy revealed germ cell-specific Vasa expression. Vasa is the most abundant in mitotic germ cells (oogonia and spermatogonia) and reduced in meiotic germ cells. Vasa in round spermatids exist as a spherical structure reminiscent of CB. Nanogold immunoelectron microscopy revealed subcellular Vasa redistribution in male germ cells. Vasa in spermatogonia concentrates in small areas of the cytoplasm and is surrounded by mitochondria, which is reminiscent of MC. Vasa is intermixed with mitochondria to form IC in primary spermatocytes, appears as the free cement (FC) via separation from mitochondria in secondary spermatocyte and becomes condensed in CB at the caudal pole of round spermatids. During spermatid morphogenesis, Vasa redistributes and forms a second CB that is a ring-like structure surrounding the dense fiber of the flagellum in the midpiece. These structures resemble those described for GP in various species. Thus, Vasa identifies GP and adopts varying structures via dynamic reorganization at different stages of germ cell development. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. gamma. radiation effect on the functional properties of the cotton ribosomes

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  4. Computational resources for ribosome profiling: from database to Web server and software.

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  6. Control of ribosome traffic by position-dependent choice of synonymous codons

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  7. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.

  8. EKSTRAKSI DAN ANALISIS FITOSTEROL LEMBAGA GANDUM [Extraction and analysis of Phytosterol from wheat germ (Triticum sp.

    Latifah K Darusman3

    2005-04-01

    Full Text Available Phytosterol may reduce the absorption of cholesterol, and used for preventing atherosclerosis. It is limited in soybean, but potentially abundant in wheat germ. Research on the utilization of wheat germ sterol had not been reported so far. Many aspects of germ sterol extraction from wheat germ and its characteristics were still unknown. In this research, the best extraction method, kinds and content of phytosterol from wheat germ were investigated.This research consisted of two steps: (1 extraction of phytosterol directly form whole germ and ground germ using hexane, and indirect extraction through germ oil using hexane and mixed solvent of hexane and ethanol, and direct extraction from ground germ using ethanol; (2 analysis of the type and content of phytosterol in the crude extract through the following steps: preparation of crude extract, fractionation, and analysis.Results showed that indirect extraction through germ oil was considered as the best method which yielded 1.37% of phytosterol. The highest yield was obtained when extracted using a mixed solvent of hexane – ethanol 82:18. However, the odor of ethanol and hexane (gasoline like odor was still detected. The solvent’s ratio of hexane to ethanol at 1:2 resulted better odor of the extract. Extraction of sterol using ethanol yielded 18.39% of sterol when the ratio of germ to ethanol at 1:10 (w/v was applied.Results of quantitative analysis on the main component of crude extract of wheat germ sterol showed that the total content of sterol extracted with mixed solvent was higher than those extracted with ethanol. The ratio of hexane to ethanol at 1:1 (v/v gave higher content of total sterol, stigmasterol and campesterol, whereas higher content of -sitosterol was produced at the solvent’s ratio of hexane to ethanol at 1:2 (v/v.

  9. Fat absorption in germ-free and conventional rats artificially deprived of bile secretion

    Demarne, Y.; Corring, T.; Pihet, A.; Sacquet, E.

    1982-01-01

    Bile duct ligation was performed in germ-free and conventional rats in order to study the effects of bile deprivation on the absorption of dietary lipids and the excretion of faecal lipids in the presence or the absence of gastrointestinal flora. The main consequence of bile duct ligation in conventional rats was decrease of about 50% in the apparent absorption of dietary lipids (peanut oil). In germ-free rats, absorption decreased by only about 25%.In conventional as well as in germ-free con...

  10. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  11. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  12. Defatted wheat germ application: Influence on cookies' properties with regard to its particle size and dough moisture content.

    Petrović, Jovana; Rakić, Dušan; Fišteš, Aleksandar; Pajin, Biljana; Lončarević, Ivana; Tomović, Vladimir; Zarić, Danica

    2017-10-01

    The introduction of agro-food industry by-products rich in bioactive compounds represents major challenge in food industry sector. The influence of wheat germ particle size (Box-Behnken experimental design. The substitution of wheat flour with wheat germ increased the protein, fat, mineral, and fiber content of the cookies. The particle size of wheat germ affected the textural properties of cookies. As the particle size of wheat germ increased, the hardness of cookies decreased. The color of the cookie was most influenced by the interaction of dough moisture content and wheat germ particle size. Wheat germ level up to 15% had no significant effect on the sensory characteristics of cookies. A suitable combination of defatted wheat germ level, its particle size, and dough moisture content can improve the nutritional value of cookies, without causing a negative effect on the cookies' sensory characteristics.

  13. Ellipsometry study of optical parameters of AgIn5S8 crystals

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  14. Ellipsometry study of optical parameters of AgIn{sub 5}S{sub 8} crystals

    Isik, Mehmet, E-mail: mehmet.isik@atilim.edu.tr [Department of Electrical and Electronics Engineering, Atilim University, 06836 Ankara (Turkey); Gasanly, Nizami [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Virtual International Scientific Research Centre, Baku State University, 1148 Baku (Azerbaijan)

    2015-12-01

    AgIn{sub 5}S{sub 8} crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2–6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn{sub 5}S{sub 8} crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  15. Perception and analysis of the 5S program at a business service provider

    André Luiz Emmel Silva

    2016-09-01

    Full Text Available Given the importance that the service sector represents in our economy, the application of concepts and techniques for its administration and models aimed at improving its quality is growing. This article aims to analyze the main aspects of the 5S program in the implementation phase and in the course of its evolution at a service company. The methodology used is qualitative, implemented through a case study structured in 6 steps. The company under study performs strongly on the national market and therefore has a large amount of documents circulating daily through different sectors, which generated the need to implement a methodology capable of streamlining document flow management and reducing the time spent on bureaucracy by its employees. The 5S program was shown to have brought the company greater administrative efficiency and a more pleasant, safe and organized working environment, motivating employees, reducing costs and providing competitive advantages.

  16. Implementation of 5S tools as a starting point in business process reengineering

    Vorkapić Miloš 0000-0002-3463-8665

    2017-01-01

    Full Text Available The paper deals with the analysis of elements which represent a starting point in implementation of a business process reengineering. We have used Lean tools through the analysis of 5S model in our research. On the example of finalization of the finished transmitter in IHMT-CMT production, 5S tools were implemented with a focus on Quality elements although the theory shows that BPR and TQM are two opposite activities in an enterprise. We wanted to distinguish the significance of employees’ self-discipline which helps the process of product finalization to develop in time and without waste and losses. In addition, the employees keep their work place clean, tidy and functional.

  17. The blue light indicator in rubidium 5S-5P-5D cascade excitation

    Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

    2017-07-01

    The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

  18. Attosecond relative delay among xenon 5p, 5s, and 4d photoionization

    Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri

    2017-04-01

    Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.

  19. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  20. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  1. Potential roles for ubiquitin and the proteasome during ribosome biogenesis

    Stavreva, D. A.; Kawasaki, M.; Dundr, M.; Koberna, Karel; Müller, W. G.; Tsujimura-Takahashi, T.; Komatsu, W.; Hayano, T.; Isobe, T.; Raška, Ivan; Misteli, T.; Takahashi, N.; McNally, J. G.

    2006-01-01

    Roč. 26, č. 13 (2006), s. 5131-5145 ISSN 0270-7306 R&D Projects: GA MŠk(CZ) LC535; GA ČR(CZ) GA304/05/0374; GA ČR(CZ) GA304/04/0692 Grant - others:NIH(US) Intramural Research Program; Ministry of Education(JP) Pioneer Research grant Institutional research plan: CEZ:AV0Z50110509 Keywords : the role of the ubikvitin * proteasome system in ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.773, year: 2006

  2. New antiferromagnetic semiconductor CuCr1.5Sb0.5S4

    Kesler, Ya.A.; Koroleva, L.I.; Mikheev, M.G.; Odintsov, A.G.; Filimonov, D.S.

    1993-01-01

    New halcogenide compound with spinel-antiferromagnetic semiconductor CuCr 1.5 Sb 0.5 S 4 are obtained and studied for the first time. Magnetic properties of this compound, namely, magnetization linear dependence, maximum on PHI(T) curve in the low-temperature area and realization of the Curie-Weis law for paramagnetic susceptibility with negative paramagnetic temperature testiby to the fact that this compound is antiferromagnetic

  3. Uudised : Eesti muusikalistaarid Euroopas. Tüüri 5.sümfoonia Tallinnas

    2005-01-01

    Koit Toome, Ele Millistver ja Lauri Liiv alustavad 1. detsembril Brnos rahvusvahelises muusikalitrupis "Hairi" proovidega. Esietendus on 26. dets. Iserlohni linnas Saksamaal ning etendusi antakse järgmise aasta 16. aprillini Saksa linnades, Austrias, Šveitsis ja Taanis. Erkki-Sven Tüüri 5. sümfoonia tuleb Eestis esiettekandele 10. dets. Estonia Kontserdisaalis, teose esiettekannet selle aasta veebruaris Stuttgardis dirigeeris Olari Elts

  4. Fuel and coolant motions following pin failure: EPIC models and the PBE-5S experiment

    Garner, P.L.; Abramson, P.B.

    1979-01-01

    The EPIC computer code has been used to analyze the post-fuel-pin-failure behavior in the PBE-5S experiment performed at Sandia Laboratories. The effects of modeling uncertainties on the calculation are examined. The calculations indicate that the majority of the piston motion observed in the test is due to the initial pressurization of the coolant channel by fuel vapor at cladding failure. A more definitive analysis requires improvements in calculational capabilities and experiment diagnostics

  5. The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

    Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

    2017-10-27

    The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

  6. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  7. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  8. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  9. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  10. Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite

    Yu, Wen; Fang, Pengfei; Wang, Shaojie

    2014-12-01

    Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.

  11. Evidence-based management of otitis media: a 5S model approach.

    Wasson, J D; Yung, M W

    2015-02-01

    The 5S model proposes five hierarchical levels (systems, summaries, synopses, syntheses and studies) of pre-appraised evidence to guide evidence-based practice. This review aimed to identify and summarise pre-appraised evidence at the highest available 5S level for the management of different subsets of otitis media: acute otitis media, otitis media with effusion, chronic suppurative otitis media and cholesteatoma in both adults and children. Data sources were pre-appraised evidence resources. Evidence freely available from sources at the highest available level of the 5S model were summarised for this review. System level evidence exists for acute otitis media and otitis media with effusion. Summary level evidence exists for recurrent acute otitis media and medical management of chronic suppurative otitis media. There is an absence of randomised controlled trials to prove the efficacy of surgical management of chronic suppurative otitis media and cholesteatoma. Until randomised controlled trial data are generated, consensus publications on the surgical management of chronic suppurative otitis media and cholesteatoma should be used to guide best practice.

  12. Why are our children wasting: Determinants of wasting among under 5s in Ghana.

    Darteh, Eugene Kofuor Maafo; Acquah, Evelyn; Darteh, Florie

    2017-09-01

    Wasting is one of the indicators of malnutrition known to contribute to the deaths occurring from childhood malnutrition. It is the measure of body mass in relation to body length used to explain recent nutritional status. This paper examines the determinants of wasting among under 5s in Ghana. Data were drawn from the 2014 Ghana Demographic and Health Survey children's records file to examine the determinants of wasting among children. A total of 2720 children under 5 years with valid anthropometric data were used. Data on wasting were collected by measuring the weight and height of all children under 5 years of age. Bi-variate and multi-variate statistics are used to examine the determinants of wasting. The bi-variate analysis showed significant differences ( p 5s according to age of the child, region, and wealth status. On the other hand, the multi-variate analysis revealed that the odds of wasting were lower among children aged 24-35 months (Odds ratio (OR) = 0.37; p 5s. Also, efforts should be made by the relevant government agencies and other stakeholders to strengthen the socio-economic status of mothers to enable them to provide adequate nutrition and improve access to health insurance for their children in order to reduce the incidence of wasting among these children.

  13. Distraction manipulation reduction of an L5-S1 disk herniation.

    Cox, J M; Hazen, L J; Mungovan, M

    1993-06-01

    A computed tomography (CT)-confirmed L5-S1 disk protrusion is reported to be reduced following chiropractic adjustment, as seen on repeat CT scanning. Correlation of the CT reports with the patient's symptoms before and after manipulation is reported. A 38-yr-old female was treated for low back pain and right lower extremity first sacral dermatome sciatica. CT confirmed disk herniations at both the L4-L5 and L5-S1 levels were found. Motor weakness of the right gluteus maximus muscle was found and extremely tight hamstring muscles accompanying positive straight leg signs were elicited. A clinical and imaging diagnosis of an L5-S1 disk herniation was made. Distraction type chiropractic manipulation, electrical stimulation, exercises, nutrition advice and low back wellness class were administered with complete relief of sciatic pain and nearly complete relief of low back pain. Chiropractic distraction manipulation is an effective treatment of lumbar disk herniation, if the chiropractor is observant during its administration for patient tolerance to manipulation under distraction and any signs of neurological deficit demanding other types of care.

  14. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  15. Gonadal germ cell tumors in children and adolescents

    Giovanni Cecchetto

    2014-01-01

    Full Text Available Pediatric germ cell tumors (GCT are rare tumors: 80% are benign, 20% malignant (2-3% of all malignant pediatric tumors. The gonadal sites (ovary and testis account for 40% of cases. Ovarian GCTs: Represent 30% of GCTs and 70% of neoplastic ovarian masses, being the most common ovarian neoplasms in children and teenagers. Benign and immature forms (teratomas constitute about 80% of all ovarian GCTs, malignant forms represent 20% increasing during adolescence. The most common malignant entity in children is the yolk sac tumors (YST; dysgerminoma is frequent during adolescence and being bilateral in 10% of cases. Presentation is similar in malignant and benign lesions; abdominal pain (70-80% and lower abdominal mass are common symptoms. Evaluation of alpha-fetoprotein (αFP or beta subunit of human chorionic gonadotropin (βHCG is essential to address the nature of the tumors: Their elevation means presence of malignancy. Surgery includes intraoperative staging procedures and requires ovariectomy or ovarosalpingectomy for malignant lesions, but may be conservative in selected benign tumors. Since malignant GCTs are very chemosensitive, primary chemotherapy is recommended in metastatic or locally advanced tumors. Testicular GCT: Represent 10% of pediatric GCT, and about 30% of malignant GCT with two age peaks: Children <3 years may experience mature teratoma and malignant GCTs, represented almost exclusively by YST, while adolescents may also show seminomas or other mixed tumors. The main clinical feature is a painless scrotal mass. Surgery represents the cornerstone of the management of testicular GCTs, with an inguinal approach and a primary high orchidectomy for malignant tumors, while a testis-sparing surgery can be considered for benign lesions. A retroperitoneal lymph node (LN biopsy may be necessary to define the staging when the involvement of retroperitoneal LN is uncertain at imaging investigations. Conclusion: Patients with gonadal

  16. Stereotactic radiotherapy for pediatric intracranial germ cell tumors

    Zissiadis, Yvonne; Dutton, Sharon; Kieran, Mark; Goumnerova, Liliana; Scott, R. Michael; Kooy, Hanne M.; Tarbell, Nancy J.

    2001-01-01

    Purpose: Intracranial germ cell tumors are rare, radiosensitive tumors seen most commonly in the second and third decades of life. Radiotherapy alone has been the primary treatment modality for germinomas, and is used with chemotherapy for nongerminomatous tumors. Stereotactic radiotherapy techniques minimize the volume of surrounding normal tissue irradiated and, hence, the late radiation morbidity. This study reports our experience with stereotactic radiotherapy in this group of tumors. Methods and Materials: Between December 1992 and December 1998, 18 patients with intracranial germ cell tumors were treated with stereotactic radiotherapy. A total of 23 histologically proven tumors were treated. Thirteen patients had a histologic diagnosis of germinoma, and 5 patients had germinoma with nongerminomatous elements. Of those patients with a histologic diagnosis of germinoma, 5 had multiple midline tumors. The median age of the patients was 12.9 years (range, 5.6-17.5 years). Results: A boost using stereotactic radiotherapy was delivered to 19 tumors following whole-brain radiation in 8 cases and craniospinal radiation in 11 cases. Three tumors were treated with stereotactic radiotherapy to the tumor volume alone following chemotherapy, and 1 tumor received a boost using stereotactic radiosurgery following craniospinal radiation. A median dose of 2520 cGy (range, 1500-3600) cGy was given to the whole brain, and a median dose of 2160 (range, 2100-2600) cGy was given to the spinal field. The median boost dose to the tumor was 2600 (range, 2160-3600) cGy, given by stereotactic radiotherapy delivered to the 95% isodose line. At a median follow-up time of 40 (range, 12-73) months, no local or marginal recurrences were reported in patients with germinoma. Two patients with nongerminomatous tumors have relapsed. One had elevation of tumor markers only at 37 months following treatment, and the other had persistent disease following chemotherapy and radiation therapy. Eight

  17. Pathogenesis of Testicular Germ Cell Tumors from a Developmental Point of View

    K. Biermann (Katharina)

    2010-01-01

    textabstractCurrent classification systems of human germ cell tumors (GCTs) are based on histological composition. In the group of nonseminomas, different variants of teratoma (somatic differentiation), yolk sac tumor and choriocarcinoma (extra-embryonic differentiation), are recognized, as well

  18. Expression of immunohistochemical markers for testicular carcinoma in situ by normal human fetal germ cells

    Jørgensen, N; Rajpert-De Meyts, E; Graem, N

    1995-01-01

    study. EXPERIMENTAL DESIGN: Normal human germ cells from 10 first-trimester fetuses and 76 second- and third-trimester testes were investigated for the immunohistochemical expression of the markers of testicular carcinoma in situ. The panel of markers included in the study consisted of placental......-like alkaline phosphatase, the protooncogene c-kit protein product, and the antigens for the monoclonal antibodies TRA-1-60 and M2A. The relative numbers of fetal germ cells that demonstrated positive reaction with the markers were calculated. RESULTS: The vast majority of the germ cells (75-100%) in the first......-trimester gonads were positive for placental-like alkaline phosphatase, TRA-1-60, and M2A. The c-kit protein was detected in three out of the ten first-trimester gonads. The relative number of germ cells positive for all the markers studied declined rapidly during the first part of the second trimester...

  19. In vivo cytogenetic effects of 2-trans hexenal on somatic and germ ...

    Francis

    meiotic cells. Wyrobek et al. (1983) emphasized that chemicals which are mutagenic to somatic cells, could also affect germ cells. The dose-dependent increase in the frequency of abnormal sperm observed in the present study suggests that ...

  20. Repair and mutation induction in mouse germ cells: a summary and some thoughts

    Russell, L.B.

    1979-01-01

    The various lines of evidence for repair of premutational damage in mouse germ cells are reviewed with the implications for future experiment planning. Relation between mutagenicity and carcinogenicity are discussed

  1. In Vitro Effect of Local Anesthetics on Candida albicans Germ Tube Formation

    Acácio Rodrigues

    1994-01-01

    Full Text Available Objective: This study was planned to clarify the in vitro effect of lidocaine and bupivacaine on germ tube formation by Candida albicans isolates from cases of clinical vaginal candidiasis.

  2. The ethics of germ line gene manipulation--a five dimensional debate.

    Carter, Lucy

    2002-10-01

    Contributors to the debate surrounding the ethics of germ line gene manipulation have by and large concentrated their efforts on discussions of the potential risks that are associated with the use of this technology. Many international advisory committees have ruled out the acceptability of germ line gene manipulation at least for the time being. The purpose of this work is to generate much needed discussion on the many other ethical issues concerning the implementation of not only germ line gene manipulation but also other related biotechnologies. In this paper I systematically investigate and analyse the most salient issues put forward by proponents and opponents alike. I argue that if germ line manipulation proves to be a safe and effective procedure, then the principle of beneficence imposes on the medical profession a moral duty to pursue the technology.

  3. Involvement of epigenetic modifiers in the pathogenesis of testicular dysgenesis and germ cell cancer

    Lawaetz, Andreas C.; Almstrup, Kristian

    2015-01-01

    Testicular germ cell cancer manifests mainly in young adults as a seminoma or non-seminoma. The solid tumors are preceded by the presence of a non-invasive precursor cell, the carcinoma in situ cell (CIS), which shows great similarity to fetal germ cells. It is therefore hypothesized that the CIS...... of epigenetic modifiers with a focus on jumonji C enzymes in the development of testicular dysgenesis and germ cell cancer in men....... cell is a fetal germ cell that has been arrested during development due to testicular dysgenesis. CIS cells retain a fetal and open chromatin structure, and recently several epigenetic modifiers have been suggested to be involved in testicular dysgenesis in mice. We here review the possible involvement...

  4. Analysis of Maize Seed Germs by Photoacoustic Microscopy and Photopyroelectric Technique

    Pacheco, A. Domínguez; Aguilar, C. Hernández; Cruz-Orea, A.

    2013-05-01

    A knowledge about thermal parameters of structural components of maize seed is of great relevance in the seed technology practice. The objective of the present study was to determine the thermal effusivity of germs of maize ( Zea mays L.) of different genotypes by means of the photopyroelectric technique (PPE) in the inverse configuration and obtaining the thermal imaging of these samples by photoacoustic microscopy (PAM). Germs from crystalline maize (white pigment), semi-crystalline maize (yellow pigment), and floury maize (blue pigment) were used in this investigation. The results show differences between germs of maize seeds mainly in the values of their thermal effusivities. The thermal images showed minimum inhomogeneity of these seed germs. Characterizations of thermal parameters in seeds are important in agriculture and food production and could be particularly useful to define their quality and determine their utility. PPE and PAM can be considered as potential diagnostic tools for the characterization of agriculture seeds.

  5. The uranyl influence on a mutation process in germ and somatic cells of mice

    Kostrova, L.N.; Mosseh, I.B.; Molofej, V.P.

    2008-01-01

    The mutagenic effect of uranyl was revealed by the chromosome rearrangement test in germ and somatic cells of mice. The effect value depended on duration of substance administration into organism. (authors)

  6. Histological evidence of testicular dysgenesis in contralateral biopsies from 218 patients with testicular germ cell cancer

    Hoei-Hansen, Christina E; Holm, Mette; Rajpert-De Meyts, Ewa

    2003-01-01

    This study was prompted by a hypothesis that testicular germ cell cancer may be aetiologically linked to other male reproductive abnormalities as a part of the so-called 'testicular dysgenesis syndrome' (TDS). To corroborate the hypothesis of a common association of germ cell cancer with testicular...... dysgenesis, microscopic dysgenetic features were quantified in contralateral testicular biopsies in patients with a testicular germ cell tumour. Two hundred and eighty consecutive contralateral testicular biopsies from Danish patients with testicular cancer diagnosed in 1998-2001 were evaluated...... presenting with testicular germ cell neoplasms of the adolescent and young type. The findings therefore support the hypothesis that this cancer is part of a testicular dysgenesis syndrome. The presence of contralateral carcinoma in situ was higher in the present study than previously reported....

  7. Ribosome-Inactivating Proteins from Plants: A Historical Overview

    Andrea Bolognesi

    2016-11-01

    Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.

  8. Analysis of ribosomal protein gene structures: implications for intron evolution.

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  9. [Family of ribosomal proteins S1 contains unique conservative domain].

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  10. Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center

    Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865

  11. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  12. Multidimensional representations: The knowledge domain of germs held by students, teachers and medical professionals

    Rua, Melissa Jo

    The present study examined the understandings held by 5th, 8th, and 11th-grade students, their teachers and medical professionals about germs. Specifically, this study describes the content and structure of students' and adults' conceptions in the areas of germ contraction, transmission, and treatment of infectious and non-infectious diseases caused by microorganisms. Naturalistic and empirical research methods were used to investigate participants' conceptions. Between and within group similarities were found using data from concept maps on the topic "flu," drawings of germs, a 20 word card sort related to germs and illness, and a semi-structured interview. Concept maps were coded according to techniques by Novak and Gowan (1984). Drawings of germs were coded into four main categories (bacteria, viruses, animal cell, other) and five subcategories (disease, caricature, insect, protozoa, unclassified). Cluster patterns for the card sorts of each group were found using multidimensional scaling techniques. Six coding categories emerged from the interview transcripts: (a) transmission, (b) treatment, (c) effect of weather on illness, (d) immune response, (e) location of germs, and (f) similarities and differences between bacteria and viruses. The findings showed students, teachers and medical professionals have different understandings about bacteria and viruses and the structures of those understandings vary. Gaps or holes in the participants knowledge were found in areas such as: (a) how germs are transmitted, (b) where germs are found, (c) how the body transports and uses medicine, (d) how the immune system functions, (e) the difference between vaccines and non-prescription medicines, (f) differences that exist between bacteria and viruses, and (g) bacterial resistance to medication. The youngest students relied heavily upon personal experiences with germs rather than formal instruction when explaining their conceptions. As a result, the influence of media was

  13. Modeling cell elongation during germ band retraction: cell autonomy versus applied anisotropic stress

    Lynch, Holley E; Shane Hutson, M; Veldhuis, Jim; Wayne Brodland, G

    2014-01-01

    The morphogenetic process of germ band retraction in Drosophila embryos involves coordinated movements of two epithelial tissues—germ band and amnioserosa. The germ band shortens along its rostral–caudal or head-to-tail axis, widens along its perpendicular dorsal-ventral axis, and uncurls from an initial ‘U’ shape. The amnioserosa mechanically assists this process by pulling on the crook of the U-shaped germ band. The amnioserosa may also provide biochemical signals that drive germ band cells to change shape in a mechanically autonomous fashion. Here, we use a finite-element model to investigate how these two contributions reshape the germ band. We do so by modeling the response to laser-induced wounds in each of the germ band’s spatially distinct segments (T1–T3, A1–A9) during the middle of retraction when segments T1–A3 form the ventral arm of the ‘U’, A4–A7 form its crook, and A8–A9 complete the dorsal arm. We explore these responses under a range of externally applied stresses and internal anisotropy of cell edge tensions—akin to a planar cell polarity that can drive elongation of cells in a direction parallel to the minimum edge tension—and identify regions of parameter space (edge-tension anisotropy versus stress anisotropy) that best match previous experiments for each germ band segment. All but three germ band segments are best fit when the applied stress anisotropy and the edge-tension anisotropy work against one another—i.e., when the isolated effects would elongate cells in perpendicular directions. Segments in the crook of the germ band (A4–A7) have cells that elongate in the direction of maximum external stress, i.e., external stress anisotropy is dominant. In most other segments, the dominant factor is internal edge-tension anisotropy. These results are consistent with models in which the amnioserosa pulls on the crook of the germ band to mechanically assist retraction. In addition, they suggest a mechanical cue for

  14. Molecular dosimetry of chemical mutagens: measurement of molecular dose and DNA repair germ cells

    Sega, G.A.

    1975-01-01

    Molecular dosimetry in the germ cells of male mice is reviewed with regard to in vivo alkylation of sperm heads, in vivo alkylation of sperm DNA, and possible alkylation of sperm protamine. DNA repair in male germ cells is reviewed with regard to basic design of experiments, DNA repair in various stages of spermatogenesis, effect of protamine on DNA repair following treatment with EMS or x radiation, and induction of DNA repair by methyl methanesulfonate, propyl methanesulfonate, and isopropyl methanesulfonate

  15. Dearth and Delayed Maturation of Testicular Germ Cells in Fanconi Anemia E Mutant Male Mice.

    Chun Fu

    Full Text Available After using a self-inactivating lentivirus for non-targeted insertional mutagenesis in mice, we identified a transgenic family with a recessive mutation that resulted in reduced fertility in homozygous transgenic mice. The lentiviral integration site was amplified by inverse PCR. Sequencing revealed that integration had occurred in intron 8 of the mouse Fance gene, which encodes the Fanconi anemia E (Fance protein. Fanconi anemia (FA proteins play pivotal roles in cellular responses to DNA damage and Fance acts as a molecular bridge between the FA core complex and Fancd2. To investigate the reduced fertility in the mutant males, we analyzed postnatal development of testicular germ cells. At one week after birth, most tubules in the mutant testes contained few or no germ cells. Over the next 2-3 weeks, germ cells accumulated in a limited number of tubules, so that some tubules contained germ cells around the full periphery of the tubule. Once sufficient numbers of germ cells had accumulated, they began to undergo the later stages of spermatogenesis. Immunoassays revealed that the Fancd2 protein accumulated around the periphery of the nucleus in normal developing spermatocytes, but we did not detect a similar localization of Fancd2 in the Fance mutant testes. Our assays indicate that although Fance mutant males are germ cell deficient at birth, the extant germ cells can proliferate and, if they reach a threshold density, can differentiate into mature sperm. Analogous to previous studies of FA genes in mice, our results show that the Fance protein plays an important, but not absolutely essential, role in the initial developmental expansion of the male germ line.

  16. Pluripotency Factors in Embryonic Stem Cells Regulate Differentiation into Germ Layers

    Thomson, Matt; Liu, Siyuan John; Zou, Ling-Nan; Smith, Zack; Meissner, Alexander; Ramanathan, Sharad

    2011-01-01

    Cell fate decisions are fundamental for development, but we do not know how transcriptional networks reorganize during the transition from a pluripotent to a differentiated cell state. Here, we asked how mouse embryonic stem cells (ESCs) leave the pluripotent state and choose between germ layer fates. By analyzing the dynamics of the transcriptional circuit that maintains pluripotency, we found that Oct4 and Sox2, proteins that maintain ESC identity, also orchestrate germ layer fate selection...

  17. Localisation of RNAs into the germ plasm of vitellogenic Xenopus oocytes.

    Sarbjit Nijjar

    Full Text Available We have studied the localisation of mRNAs in full-grown Xenopus laevis oocytes by injecting fluorescent RNAs, followed by confocal microscopy of the oocyte cortex. Concentrating on RNA encoding the Xenopus Nanos homologue, nanos1 (formerly Xcat2, we find that it consistently localised into aggregated germ plasm ribonucleoprotein (RNP particles, independently of cytoskeletal integrity. This implies that a diffusion/entrapment-mediated mechanism is active, as previously reported for previtellogenic oocytes. Sometimes this was accompanied by localisation into scattered particles of the "late", Vg1/VegT pathway; occasionally only late pathway localisation was seen. The Xpat RNA behaved in an identical fashion and for neither RNA was the localisation changed by any culture conditions tested. The identity of the labelled RNP aggregates as definitive germ plasm was confirmed by their inclusion of abundant mitochondria and co-localisation with the germ plasm protein Hermes. Further, the nanos1/Hermes RNP particles are interspersed with those containing the germ plasm protein Xpat. These aggregates may be followed into the germ plasm of unfertilized eggs, but with a notable reduction in its quantity, both in terms of injected molecules and endogenous structures. Our results conflict with previous reports that there is no RNA localisation in large oocytes, and that during mid-oogenesis even germ plasm RNAs localise exclusively by the late pathway. We find that in mid oogenesis nanos1 RNA also localises to germ plasm but also by the late pathway. Late pathway RNAs, Vg1 and VegT, also may localise into germ plasm. Our results support the view that mechanistically the two modes of localisation are extremely similar, and that in an injection experiment RNAs might utilise either pathway, the distinction in fates being very subtle and subject to variation. We discuss these results in relation to their biological significance and the results of others.

  18. Generation of germ cells in vitro in the era of induced pluripotent stem cells.

    Imamura, Masanori; Hikabe, Orie; Lin, Zachary Yu-Ching; Okano, Hideyuki

    2014-01-01

    Induced pluripotent stem cells (iPSCs) are stem cells that can be artificially generated via "cellular reprogramming" using gene transduction in somatic cells. iPSCs have enormous potential in stem-cell biology as they can give rise to numerous cell lineages, including the three germ layers. An evaluation of germ-line competency by blastocyst injection or tetraploid complementation, however, is critical for determining the developmental potential of mouse iPSCs towards germ cells. Recent studies have demonstrated that primordial germ cells obtained by the in vitro differentiation of iPSCs produce functional gametes as well as healthy offspring. These findings illustrate not only that iPSCs are developmentally similar to embryonic stem cells (ESCs), but also that somatic cells from adult tissues can produce gametes in vitro, that is, if they are reprogrammed into iPSCs. In this review, we discuss past and recent advances in the in vitro differentiation of germ cells using pluripotent stem cells, with an emphasis on ESCs and iPSCs. While this field of research is still at a stage of infancy, it holds great promises for investigating the mechanisms of germ-cell development, especially in humans, and for advancing reproductive and developmental engineering technologies in the future. © 2013 Wiley Periodicals, Inc.

  19. DNA methylation profiling of embryonic stem cell differentiation into the three germ layers.

    Isagawa, Takayuki; Nagae, Genta; Shiraki, Nobuaki; Fujita, Takanori; Sato, Noriko; Ishikawa, Shumpei; Kume, Shoen; Aburatani, Hiroyuki

    2011-01-01

    Embryogenesis is tightly regulated by multiple levels of epigenetic regulation such as DNA methylation, histone modification, and chromatin remodeling. DNA methylation patterns are erased in primordial germ cells and in the interval immediately following fertilization. Subsequent developmental reprogramming occurs by de novo methylation and demethylation. Variance in DNA methylation patterns between different cell types is not well understood. Here, using methylated DNA immunoprecipitation and tiling array technology, we have comprehensively analyzed DNA methylation patterns at proximal promoter regions in mouse embryonic stem (ES) cells, ES cell-derived early germ layers (ectoderm, endoderm and mesoderm) and four adult tissues (brain, liver, skeletal muscle and sperm). Most of the methylated regions are methylated across all three germ layers and in the three adult somatic tissues. This commonly methylated gene set is enriched in germ cell-associated genes that are generally transcriptionally inactive in somatic cells. We also compared DNA methylation patterns by global mapping of histone H3 lysine 4/27 trimethylation, and found that gain of DNA methylation correlates with loss of histone H3 lysine 4 trimethylation. Our combined findings indicate that differentiation of ES cells into the three germ layers is accompanied by an increased number of commonly methylated DNA regions and that these tissue-specific alterations in methylation occur for only a small number of genes. DNA methylation at the proximal promoter regions of commonly methylated genes thus appears to be an irreversible mark which functions to fix somatic lineage by repressing the transcription of germ cell-specific genes.

  20. NANOG priming before full reprogramming may generate germ cell tumours

    I Grad

    2011-11-01

    Full Text Available Reprogramming somatic cells into a pluripotent state brings patient-tailored, ethical controversy-free cellular therapy closer to reality. However, stem cells and cancer cells share many common characteristics; therefore, it is crucial to be able to discriminate between them. We generated two induced pluripotent stem cell (iPSC lines, with NANOG pre-transduction followed by OCT3/4, SOX2, and LIN28 overexpression. One of the cell lines, CHiPS W, showed normal pluripotent stem cell characteristics, while the other, CHiPS A, though expressing pluripotency markers, failed to differentiate and gave rise to germ cell-like tumours in vivo. Comparative genomic hybridisation analysis of the generated iPS lines revealed that they were genetically more stable than human embryonic stem cell counterparts. This analysis proved to be predictive for the differentiation potential of analysed cells. Moreover, the CHiPS A line expressed a lower ratio of p53/p21 when compared to CHiPS W. NANOG pre-induction followed by OCT3/4, SOX2, MYC, and KLF4 induction resulted in the same tumour-inducing phenotype. These results underline the importance of a re-examination of the role of NANOG during reprogramming. Moreover, this reprogramming method may provide insights into primordial cell tumour formation and cancer stem cell transformation.