WorldWideScience

Sample records for germ 5s ribosomal

  1. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  2. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    Science.gov (United States)

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  3. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  5. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  6. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  7. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  8. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  9. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  10. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  11. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  12. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  14. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  15. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  16. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  17. Mutation in ribosomal protein S5 leads to spectinomycin resistance in Neisseria gonorrhoeae.

    Directory of Open Access Journals (Sweden)

    Elena eIlina

    2013-07-01

    Full Text Available Spectinomycin remains a useful reserve option for therapy of gonorrhea. The emergence of multidrug-resistant Neisseria gonorrhoeae strains with decreased susceptibility to cefixime and to ceftriaxone makes it the only medicine still effective for treatment of gonorrhea infection in analogous cases. However, adoption of spectinomycin as a routinely used drug of choice was soon followed by reports of spectinomycin resistance. The main molecular mechanism of spectinomycin resistance in N. gonorrhoeae was C1192T substitution in 16S rRNA genes. Here we reported a Thr-24→Pro mutation in ribosomal protein S5 found in spectinomycin resistant clinical N. gonorrhoeae strain, which carried no changes in 16S rRNA. In a series of experiments, the transfer of rpsE gene allele encoding the mutant ribosomal protein S5 to the recipient N. gonorrhoeae strains was analyzed. The relatively high rate of transformation (ca. 10-5 CFUs indicates the possibility of spread of spectinonycin resistance within gonococcal population due to the horizontal gene transfer.

  18. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  19. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  20. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  1. Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA

    International Nuclear Information System (INIS)

    Barciszewska, M.Z.

    1994-01-01

    In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab

  2. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  3. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  4. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    OpenAIRE

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  5. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Science.gov (United States)

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  6. Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

    Science.gov (United States)

    Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

    2017-01-01

    Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

  7. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  9. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  11. Development of Soft Tissue Sarcomas in Ribosomal Proteins L5 and S24 Heterozygous Mice

    Czech Academy of Sciences Publication Activity Database

    Kazerounian, S.; Ciarlini, P.D.S.C.; Yuan, D.; Ghazvinian, R.; Alberich-Jorda, Meritxell; Joshi, M.; Zhang, H.; Beggs, A.H.; Gazda, H.T.

    2016-01-01

    Roč. 7, č. 1 (2016), s. 32-36 ISSN 1837-9664 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Ribosomal proteins RPL5 and RPS24 * Diamond-Blackfan anemia * Soft tissue sarcoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.916, year: 2016

  12. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  13. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  14. The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

    Science.gov (United States)

    Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

    2008-07-01

    Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

  15. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  16. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  17. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  18. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  19. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  20. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  1. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  2. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  3. Germ Cells are Made Semiotically Competent During Evolution

    DEFF Research Database (Denmark)

    Giorgi, Franco; Bruni, Luis Emilio

    2016-01-01

    Germ cells are cross-roads of development and evolution. They define the origin of every new generation and, at the same time, represent the biological end-product of any mature organism. Germ cells are endowed with the following capacities: (1) to store a self-descriptive program, (2......) to accumulate a protein-synthesizing machinery (ribosomes), and (3) to incorporate enough nourishment to sustain embryonic development (yolk). To accomplish this goal, germ cells do not simply unfold a pre-determined program or realize a sole instructive role. On the contrary, due to the complexity...... milieu and experience the compatibility of selected developmental sequences. The question of which signaling pathways are activated at each developmental stage does not result from a strictly predetermined program instructing germ cell stemness. Rather, each developmental sequence is an open...

  4. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  5. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  6. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  8. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  9. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    Science.gov (United States)

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  10. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    International Nuclear Information System (INIS)

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  11. Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

    1976-01-01

    An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

  12. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  13. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  14. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  15. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  16. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  17. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  18. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    OpenAIRE

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

  19. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  2. Subcellular localization of Bombyx mori ribosomal protein S3a and ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... In the present study, using a BV/PH-Bms3a-EGFP, we found that Bombyx mori ribosomal protein S3a. (BmS3a) with EGFP fused to its C-terminal, was predominantly localized in the cytoplasm of B. mori cells. Subsequently, to investigate the effect of BmS3a over-expression on BmNPV infection both at the.

  3. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  4. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  5. Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae from the upper Paraná river basin, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Alexandre Fernandes

    2006-01-01

    Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

  6. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  7. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  8. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  9. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  10. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  11. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  12. Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells

    Directory of Open Access Journals (Sweden)

    Cohen Sarit

    2010-03-01

    Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.

  13. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  14. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  15. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  16. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  17. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  18. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  19. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    Science.gov (United States)

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  20. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  1. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Terao, K.; Uchiumi, T.; Ogata, K.

    1980-01-01

    After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)

  3. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  4. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  5. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  6. Neutron scattering and the 30 S ribosomal subunit of E. coli

    International Nuclear Information System (INIS)

    Moore, P.B.; Engelman, D.M.; Langer, J.A.; Ramakrishnan, V.R.; Schindler, D.G.; Schoenborn, B.P.; Sillers, I.Y.; Yabuki, S.

    1982-01-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures

  7. An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

    International Nuclear Information System (INIS)

    Timmins, P.A.; Langowski, J.; Brown, R.S.

    1988-01-01

    The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

  8. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  9. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  10. Mutation of the key residue for extraribosomal function of ribosomal protein S19 cause increased grooming behaviors in mice.

    Science.gov (United States)

    Chen, Jun; Kaitsuka, Taku; Fujino, Rika; Araki, Kimi; Tomizawa, Kazuhito; Yamamoto, Tetsuro

    2016-08-26

    Ribosomal protein S19 (RP S19) possesses ribosomal function as RP S19 monomer and extraribosomal function as cross-linked RP S19 oligomers which function as a ligand of the complement 5a (C5a) receptor (CD88). We have generated a Gln137Glu-RP S19 knock-in (KI) mouse, which is shown to possess the weakened extraribosomal function of RP S19. Because whether the extraribosomal function of RP S19 has a role in brain function had been unclear, we performed behavioral analysis on these mice and demonstrated that KI mice displayed an increased grooming behavior during open-field test and elevated plus maze test and an enhanced freezing behavior in contextual fear conditioning test. These results suggest an involvement of RP S19 oligomers in some anxiety-like behavior, especially grooming behavior. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  11. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Identification of genes expressed in the hermaphrodite germ line of C. elegans using SAGE

    Science.gov (United States)

    Wang, Xin; Zhao, Yongjun; Wong, Kim; Ehlers, Peter; Kohara, Yuji; Jones, Steven J; Marra, Marco A; Holt, Robert A; Moerman, Donald G; Hansen, Dave

    2009-01-01

    Background Germ cells must progress through elaborate developmental stages from an undifferentiated germ cell to a fully differentiated gamete. Some of these stages include exiting mitosis and entering meiosis, progressing through the various stages of meiotic prophase, adopting either a male (sperm) or female (oocyte) fate, and completing meiosis. Additionally, many of the factors needed to drive embryogenesis are synthesized in the germ line. To increase our understanding of the genes that might be necessary for the formation and function of the germ line, we have constructed a SAGE library from hand dissected C. elegans hermaphrodite gonads. Results We found that 4699 genes, roughly 21% of all known C. elegans genes, are expressed in the adult hermaphrodite germ line. Ribosomal genes are highly expressed in the germ line; roughly four fold above their expression levels in the soma. We further found that 1063 of the germline-expressed genes have enriched expression in the germ line as compared to the soma. A comparison of these 1063 germline-enriched genes with a similar list of genes prepared using microarrays revealed an overlap of 460 genes, mutually reinforcing the two lists. Additionally, we identified 603 germline-enriched genes, supported by in situ expression data, which were not previously identified. We also found >4 fold enrichment for RNA binding proteins in the germ line as compared to the soma. Conclusion Using multiple technological platforms provides a more complete picture of global gene expression patterns. Genes involved in RNA metabolism are expressed at a significantly higher level in the germ line than the soma, suggesting a stronger reliance on RNA metabolism for control of the expression of genes in the germ line. Additionally, the number and expression level of germ line expressed genes on the X chromosome is lower than expected based on a random distribution. PMID:19426519

  13. Identification of genes expressed in the hermaphrodite germ line of C. elegans using SAGE

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2009-05-01

    Full Text Available Abstract Background Germ cells must progress through elaborate developmental stages from an undifferentiated germ cell to a fully differentiated gamete. Some of these stages include exiting mitosis and entering meiosis, progressing through the various stages of meiotic prophase, adopting either a male (sperm or female (oocyte fate, and completing meiosis. Additionally, many of the factors needed to drive embryogenesis are synthesized in the germ line. To increase our understanding of the genes that might be necessary for the formation and function of the germ line, we have constructed a SAGE library from hand dissected C. elegans hermaphrodite gonads. Results We found that 4699 genes, roughly 21% of all known C. elegans genes, are expressed in the adult hermaphrodite germ line. Ribosomal genes are highly expressed in the germ line; roughly four fold above their expression levels in the soma. We further found that 1063 of the germline-expressed genes have enriched expression in the germ line as compared to the soma. A comparison of these 1063 germline-enriched genes with a similar list of genes prepared using microarrays revealed an overlap of 460 genes, mutually reinforcing the two lists. Additionally, we identified 603 germline-enriched genes, supported by in situ expression data, which were not previously identified. We also found >4 fold enrichment for RNA binding proteins in the germ line as compared to the soma. Conclusion Using multiple technological platforms provides a more complete picture of global gene expression patterns. Genes involved in RNA metabolism are expressed at a significantly higher level in the germ line than the soma, suggesting a stronger reliance on RNA metabolism for control of the expression of genes in the germ line. Additionally, the number and expression level of germ line expressed genes on the X chromosome is lower than expected based on a random distribution.

  14. Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.

    Science.gov (United States)

    Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen

    2017-01-01

    Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of

  15. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  17. Cross-talk between miR-471-5p and autophagy component proteins regulates LC3-associated phagocytosis (LAP) of apoptotic germ cells.

    Science.gov (United States)

    Panneerdoss, Subbarayalu; Viswanadhapalli, Suryavathi; Abdelfattah, Nourhan; Onyeagucha, Benjamin C; Timilsina, Santosh; Mohammad, Tabrez A; Chen, Yidong; Drake, Michael; Vuori, Kristiina; Kumar, T Rajendra; Rao, Manjeet K

    2017-09-19

    Phagocytic clearance of apoptotic germ cells by Sertoli cells is vital for germ cell development and differentiation. Here, using a tissue-specific miRNA transgenic mouse model, we show that interaction between miR-471-5p and autophagy member proteins regulates clearance of apoptotic germ cells via LC3-associated phagocytosis (LAP). Transgenic mice expressing miR-471-5p in Sertoli cells show increased germ cell apoptosis and compromised male fertility. Those effects are due to defective engulfment and impaired LAP-mediated clearance of apoptotic germ cells as miR-471-5p transgenic mice show lower levels of Dock180, LC3, Atg12, Becn1, Rab5 and Rubicon in Sertoli cells. Our results reveal that Dock180 interacts with autophagy member proteins to constitute a functional LC3-dependent phagocytic complex. We find that androgen regulates Sertoli cell phagocytosis by controlling expression of miR-471-5p and its target proteins. These findings suggest that recruitment of autophagy machinery is essential for efficient clearance of apoptotic germ cells by Sertoli cells using LAP.Although phagocytic clearance of apoptotic germ cells by Sertoli cells is essential for spermatogenesis, little of the mechanism is known. Here the authors show that Sertoli cells employ LC3-associated phagocytosis (LAP) by recruiting autophagy member proteins to clear apoptotic germ cells.

  18. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  19. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    Science.gov (United States)

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  20. In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

    International Nuclear Information System (INIS)

    Schubert, I.; Baeumlein, H.; Wobus, U.

    1978-01-01

    In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)

  1. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  2. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    Science.gov (United States)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  3. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  4. From Young Children's Ideas about Germs to Ideas Shaping a Learning Environment

    Science.gov (United States)

    Ergazaki, Marida; Saltapida, Konstantina; Zogza, Vassiliki

    2010-11-01

    This paper is concerned with highlighting young children’s ideas about the nature, location and appearance of germs, as well as their reasoning strands about germs’ ontological category and biological functions. Moreover, it is concerned with exploring how all these could be taken into account for shaping a potentially fruitful learning environment. Conducting individual, semi-structured interviews with 35 preschoolers (age 4.5-5.5) of public kindergartens in the broader area of Patras, we attempted to trace their ideas about what germs are, where they may be found, whether they are good or bad and living or non-living and how they might look like in a drawing. Moreover, children were required to attribute a series of biological functions to dogs, chairs and germs, and finally to create a story with germs holding a key-role. The analysis of our qualitative data within the “NVivo” software showed that the informants make a strong association of germs with health and hygiene issues, locate germs mostly in our body and the external environment, are not familiar with the ‘good germs’-idea, and draw germs as ‘human-like’, ‘animal-like’ or ‘abstract’ entities. Moreover, they have significant difficulties not only in employing biological functions as criteria for classifying germs in the category of ‘living’, but also in just attributing such functions to germs using a warrant. Finally, the shift from our findings to a 3-part learning environment aiming at supporting preschoolers in refining their initial conceptualization of germs is thoroughly discussed in the paper.

  5. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  6. Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

    1977-01-01

    The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes

  7. Wheat germ agglutinin-functionalised crosslinked polyelectrolyte microparticles for local colon delivery of 5-FU

    DEFF Research Database (Denmark)

    Glavas-Dodov,, Marija; Steffansen, Bente; Srcarevska, Maja

    2013-01-01

    We have previously reported the development and characterisation of wheat germ agglutinin (WGA)-functionalised chitosan-Ca-alginate (CTS-Ca-ALG) microparticles (MPs) loaded with acid-resistant particles of 5-fluorouracil (5-FU). In the present work, our goal was to evaluate the potential of these......We have previously reported the development and characterisation of wheat germ agglutinin (WGA)-functionalised chitosan-Ca-alginate (CTS-Ca-ALG) microparticles (MPs) loaded with acid-resistant particles of 5-fluorouracil (5-FU). In the present work, our goal was to evaluate the potential......-Ca-ALG MPs and WGA conjugates. The concentration of 5-FU associated with Caco-2 cells was significantly greater when delivered from MPs. By incorporation of 5-FU into MPs and further decoration with WGA, an increased [methyl-³H]thymidine uptake was observed few hours after continuous drug treatment followed...... by significantly reduced uptake after 6 h. Gastrointestinal distribution was in favour of increased localisation and concentration of the particles in colon region....

  8. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  9. Sequence analysis of the 5.8S ribosomal DNA and internal transcribed spacers (ITS1 and ITS2) from five species of the Oxalis tuberosa alliance.

    Science.gov (United States)

    Tosto, D S; Hopp, H E

    1996-01-01

    The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.

  10. Profil des germes impliqués dans les infections cervicovaginales ...

    African Journals Online (AJOL)

    La prévalence des infections était de 70,59%. Les germes rencontrés étaient Candida albicans 32,35%, Gardnerella vaginalis 30,39%, Staphylococcus aureus 8,82%, Streptococcus spp 1,96%, les entérobactéries 11,78% et le trichomonas vaginalis 1%. C.albicans a montré une résistance à l'Amphotéricime B 41 ,94 % et ...

  11. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  12. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  13. New evidence for the origin of intracranial germ cell tumours from primordial germ cells

    DEFF Research Database (Denmark)

    Hoei-Hansen, C E; Sehested, A; Juhler, M

    2006-01-01

    that it is not required for the initiation of malignant germ cell transformation. The expression of genes associated with embryonic stem cell pluripotency in CNS germ cell tumours strongly suggests that these tumours are derived from cells that retain, at least partially, an embryonic stem cell-like phenotype, which...... germ cell tumours and analysed expression of a wide panel of stem cell-related proteins (C-KIT, OCT-3/4 (POU5F1), AP-2gamma (TFAP2C), and NANOG) and developmentally regulated germ cell-specific proteins (including MAGE-A4, NY-ESO-1, and TSPY). Expression at the protein level was analysed in 21 children...... and young adults with intracranial germinomas and non-germinomas, contributing to a careful description of these unusual tumours and adding to the understanding of pathogenesis. Stem cell related proteins were highly expressed in intracranial germ cell tumours, and many similarities were detected...

  14. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Science.gov (United States)

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  15. AiGERM: A logic programming front end for GERM

    Science.gov (United States)

    Hashim, Safaa H.

    1990-01-01

    AiGerm (Artificially Intelligent Graphical Entity Relation Modeler) is a relational data base query and programming language front end for MCC (Mission Control Center)/STP's (Space Test Program) Germ (Graphical Entity Relational Modeling) system. It is intended as an add-on component of the Germ system to be used for navigating very large networks of information. It can also function as an expert system shell for prototyping knowledge-based systems. AiGerm provides an interface between the programming language and Germ.

  16. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  17. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  18. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  19. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Science.gov (United States)

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  20. Role of blood ribosomal protein S19 in coagulum resorption: a study using Gln137Glu-ribosomal protein S19 gene knock-in mouse.

    Science.gov (United States)

    Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro

    2014-11-01

    Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

  1. Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

    Science.gov (United States)

    Cukras, Anthony R; Green, Rachel

    2005-05-27

    The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

  2. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  3. Distribution of protein and RNA in the 30S ribosomal subunit

    International Nuclear Information System (INIS)

    Ramakrishnan, V.

    1986-01-01

    In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

  4. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  5. Convergent evolution of germ granule nucleators: A hypothesis.

    Science.gov (United States)

    Kulkarni, Arpita; Extavour, Cassandra G

    2017-10-01

    Germ cells have been considered "the ultimate stem cell" because they alone, during normal development of sexually reproducing organisms, are able to give rise to all organismal cell types. Morphological descriptions of a specialized cytoplasm termed 'germ plasm' and associated electron dense ribonucleoprotein (RNP) structures called 'germ granules' within germ cells date back as early as the 1800s. Both germ plasm and germ granules are implicated in germ line specification across metazoans. However, at a molecular level, little is currently understood about the molecular mechanisms that assemble these entities in germ cells. The discovery that in some animals, the gene products of a small number of lineage-specific genes initiate the assembly (also termed nucleation) of germ granules and/or germ plasm is the first step towards facilitating a better understanding of these complex biological processes. Here, we draw on research spanning over 100years that supports the hypothesis that these nucleator genes may have evolved convergently, allowing them to perform analogous roles across animal lineages. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    International Nuclear Information System (INIS)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-01-01

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

  7. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  8. Assembly of the 30S subunit from Escherichia coli ribosomes occurs via two assembly domains which are initiated by S4 and S7

    International Nuclear Information System (INIS)

    Nowotny, V.; Nierhaus, K.H.

    1988-01-01

    A protein which initiates assembly of ribosomes is defined as a protein which binds to the respective rRNA without cooperativity (i.e., without the help of other proteins) during the onset of assembly and is essential for the formation of active ribosomal subunits. The number of proteins binding without cooperativity was determined by monitoring the reconstitution output of active particles at various inputs of 16S rRNA, in the present of constant amounts of 30S-derived proteins (TP30): This showed that only two of the proteins of the 30S subunit are assembly-initiator proteins. These two proteins are still present on a LiCl core particle comprising 16S rRNA and 12 proteins (including minor proteins). The 12 proteins were isolated, and a series of reconstitution experiments at various levels of rRNA excess demonstrated that S4 and S7 are the initiator proteins. Pulse-chase experiments performed during the early assembly with 14 C- and 3 H-labeled TP30 and the determination of the 14 C/ 3 H ratio of the individual proteins within the assembled particles revealed a bilobal structure of the 30S assembly: A group of six proteins headed by S4 (namely, S4, S20, S16, S15, S6, and S18) resisted the chasing most efficiently (S4 assembly domain). None of the proteins depending on S7 during assembly were found in this group but rather in a second group with intermediate chasing stability [S7 assembly domain; consisting of S7, S9, (S8), S19, and S3]. A number of proteins could be fully chased during the early assembly and therefore represent late assembly proteins (S10, S5, S13, S2, S21, S1). These findings fit well with the 30S assembly map. These data, together with the assembly map, imply that S8 and S5 play an important role in the interconnection of the two assembly domains

  9. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  10. The Difference in Effectiveness of 70% and 0.5% Chlorine to ReduceThe Germ Number on Stethoscope’s Membrane Experimental research at stethoscope in Baitul Izah Ward of Sultan Agung Islamic Hospital Semarang

    Directory of Open Access Journals (Sweden)

    Heny Pramita

    2011-06-01

    Design and Methods: This was an experimental research with the Post Test Only Control Group Design using 18 stethoscopes divided into 3 groups randomly. Group A was the control group (aquabidest, group B were treated with 70% alcohol treatment, and group C was treated with 0.5% chlorine. The research samples were the stethoscopes used to treat patient in Baitul Izah ward of Islamic Hospital of Sultan Agung Semarang. The data on the germ amount was analyzed using Kruskal-Wallis test. Results: There was a significant difference between aquabidest group and 70% alcohol group (p0.05, nevertheless, there was no significant difference between the 70% alcohol group and 0.5% chlorine group ( 0.652. Conclusion: There was no difference in the effectiveness between 70% alcohol and 0.5% chlorine to reduce the number of germ on the stethoscope’s membrane (Sains Medika, 3(1:63-68.

  11. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  12. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  13. Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

    Science.gov (United States)

    Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

    2017-12-01

    In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  14. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  15. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  16. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  17. Inhibition of peptide bond formation by pleuromutilins: the structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin.

    Science.gov (United States)

    Schlünzen, Frank; Pyetan, Erez; Fucini, Paola; Yonath, Ada; Harms, Jörg M

    2004-12-01

    Tiamulin, a prominent member of the pleuromutilin class of antibiotics, is a potent inhibitor of protein synthesis in bacteria. Up to now the effect of pleuromutilins on the ribosome has not been determined on a molecular level. The 3.5 A structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin provides for the first time a detailed picture of its interactions with the 23S rRNA, thus explaining the molecular mechanism of the antimicrobial activity of the pleuromutilin class of antibiotics. Our results show that tiamulin is located within the peptidyl transferase center (PTC) of the 50S ribosomal subunit with its tricyclic mutilin core positioned in a tight pocket at the A-tRNA binding site. Also, the extension, which protrudes from its mutilin core, partially overlaps with the P-tRNA binding site. Thereby, tiamulin directly inhibits peptide bond formation. Comparison of the tiamulin binding site with other PTC targeting drugs, like chloramphenicol, clindamycin and streptogramins, may facilitate the design of modified or hybridized drugs that extend the applicability of this class of antibiotics.

  18. A bifunctional archaeal protein that is a component of 30S ribosomal subunits and interacts with C/D box small RNAs

    Directory of Open Access Journals (Sweden)

    Andrea Ciammaruconi

    2008-01-01

    Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.

  19. Amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Hatakeyama, T

    1990-07-06

    The complete amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui were determined. Protein HL30 was found to be acetylated at its N-terminal amino acid and shows homology to the eukaryotic ribosomal proteins YL34 from yeast and RL31 from rat. Protein HmaL5 was homologous to the protein L5 from Escherichia coli and Bacillus stearothermophilus as well as to YL16 from yeast. HmaL5 shows more similarities to its eukaryotic counterpart than to eubacterial ones.

  20. 35S induced dominant lethals in male germ cells of mouse

    International Nuclear Information System (INIS)

    Satyanarayana Reddy, K.; Reddy, P.D.; Reddi, O.S.

    1977-01-01

    (CBA female x C 3 H/He male) F 1 males born to 35 S (20 μCi) treated animals during major organogenesis period were tested for dominant lethal mutations at maturity. The pre-implantation loss showed an increase from 6.88% in the control to 10.92% in 35 S treated animals. Similarly the post-implantation loss has increased from 3.96% (control) to 7.40%. As a result of the increased pre- and post-losses the total loss showed a significant increase (17.51%) in F 1 males born to 35 S treated animals when compared to controls (10.57%). Thus the results clearly show that 35 S is mutagenic in male germ cells of mouse. (author)

  1. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  2. When does germ cell loss and fibrosis occur in patients with Klinefelter syndrome?

    Science.gov (United States)

    Van Saen, D; Vloeberghs, V; Gies, I; Mateizel, I; Sermon, K; De Schepper, Jean; Tournaye, H; Goossens, E

    2018-06-01

    .0%). Germ cells were detectable in testicular biopsies from 21% of adult men for whom no spermatozoa could be retrieved by TESE and in 31.5% of peripubertal KS boys. Very small numbers of spermatogonia (0.03-0.06 spermatogonia/tubule) were detected in three out of four (75%) prepubertal patients. At a foetal age, the number of germ cells was similar for KS and control samples. Increased signs of fibrosis were not present at foetal and prepubertal ages, but peripubertal and adult KS patients showed high levels of fibrosis. N/A. Only four prepubertal biopsies were included in this study, but they all showed a very low germ cell number. A high variability in the number of spermatogonia per mm2 was observed in the limited (n = 5) number of foetal biopsies. However, testicular biopsies from prepubertal and foetal Klinefelter patients are difficult to obtain. Testicular tissue banking at a prepubertal age has been suggested as a potential method for fertility preservation in early diagnosed KS boys. However, our results show that a reduction in germ cell number has already taken place in childhood. Therefore, offering testicular tissue banking in young KS boys to prevent subsequent sterility might be a questionable strategy. However, this should be confirmed in a larger study population. This project was funded by the scientific Fund Willy Gepts from the UZ Brussel (D.V.S., J.D.S.), grants from the Vrije Universiteit Brussel (E.G.) and a Methusalem grant (K.S.). D.V.S is a post-doctoral fellow of the Fonds Wetenschappelijk Onderzoek (FWO; 12M2815N). No conflict of interest is declared.

  3. Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs

    International Nuclear Information System (INIS)

    Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.

    1986-01-01

    5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)

  4. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  5. Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

    Science.gov (United States)

    Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

    2018-04-21

    Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

  6. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  7. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  8. On the development of extragonadal and gonadal human germ cells

    Directory of Open Access Journals (Sweden)

    A. Marijne Heeren

    2016-02-01

    Full Text Available Human germ cells originate in an extragonadal location and have to migrate to colonize the gonadal primordia at around seven weeks of gestation (W7, or five weeks post conception. Many germ cells are lost along the way and should enter apoptosis, but some escape and can give rise to extragonadal germ cell tumors. Due to the common somatic origin of gonads and adrenal cortex, we investigated whether ectopic germ cells were present in the human adrenals. Germ cells expressing DDX4 and/or POU5F1 were present in male and female human adrenals in the first and second trimester. However, in contrast to what has been described in mice, where ‘adrenal’ and ‘ovarian’ germ cells seem to enter meiosis in synchrony, we were unable to observe meiotic entry in human ‘adrenal’ germ cells until W22. By contrast, ‘ovarian’ germ cells at W22 showed a pronounced asynchronous meiotic entry. Interestingly, we observed that immature POU5F1+ germ cells in both first and second trimester ovaries still expressed the neural crest marker TUBB3, reminiscent of their migratory phase. Our findings highlight species-specific differences in early gametogenesis between mice and humans. We report the presence of a population of ectopic germ cells in the human adrenals during development.

  9. Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

    Science.gov (United States)

    Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

    2017-06-20

    The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. The Interaction Pattern between a Homology Model of 40S Ribosomal S9 Protein of Rhizoctonia solani and 1-Hydroxyphenaize by Docking Study

    Directory of Open Access Journals (Sweden)

    Seema Dharni

    2014-01-01

    Full Text Available 1-Hydroxyphenazine (1-OH-PHZ, a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases.

  11. Germ Cell-less Promotes Centrosome Segregation to Induce Germ Cell Formation

    Directory of Open Access Journals (Sweden)

    Dorothy A. Lerit

    2017-01-01

    Full Text Available The primordial germ cells (PGCs specified during embryogenesis serve as progenitors to the adult germline stem cells. In Drosophila, the proper specification and formation of PGCs require both centrosomes and germ plasm, which contains the germline determinants. Centrosomes are microtubule (MT-organizing centers that ensure the faithful segregation of germ plasm into PGCs. To date, mechanisms that modulate centrosome behavior to engineer PGC development have remained elusive. Only one germ plasm component, Germ cell-less (Gcl, is known to play a role in PGC formation. Here, we show that Gcl engineers PGC formation by regulating centrosome dynamics. Loss of gcl leads to aberrant centrosome separation and elaboration of the astral MT network, resulting in inefficient germ plasm segregation and aborted PGC cellularization. Importantly, compromising centrosome separation alone is sufficient to mimic the gcl loss-of-function phenotypes. We conclude Gcl functions as a key regulator of centrosome separation required for proper PGC development.

  12. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  13. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  14. The first determination of Trichuris sp. from roe deer by amplification and sequenation of the ITS1-5.8S-ITS2 segment of ribosomal DNA.

    Science.gov (United States)

    Salaba, O; Rylková, K; Vadlejch, J; Petrtýl, M; Scháňková, S; Brožová, A; Jankovská, I; Jebavý, L; Langrová, I

    2013-03-01

    Trichuris nematodes were isolated from roe deer (Capreolus capreolus). At first, nematodes were determined using morphological and biometrical methods. Subsequently genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from ribosomal DNA (RNA) was amplified and sequenced using PCR techniques. With u sing morphological and biometrical methods, female nematodes were identified as Trichuris globulosa, and the only male was identified as Trichuris ovis. The females were classified into four morphotypes. However, analysis of the internal transcribed spacers (ITS1-5.8S-ITS2) of specimens did not confirm this classification. Moreover, the female individuals morphologically determined as T. globulosa were molecularly identified as Trichuris discolor. In the case of the only male molecular analysis match the result of the molecular identification. Furthermore, a comparative phylogenetic study was carried out with the ITS1 and ITS2 sequences of the Trichuris species from various hosts. A comparison of biometric information from T. discolor individuals from this study was also conducted.

  15. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  16. Foodborne Germs and Illnesses

    Science.gov (United States)

    ... Español (Spanish) Recommend on Facebook Tweet Share Compartir What Causes Food Poisoning? Many different disease-causing germs can contaminate ... email address: Enter Email Address What’s this? Submit What's this? Submit Button ... of Foodborne Illness in the U.S. Food Safety is a CDC Winnable Battle Foodborne Illness ...

  17. Insulin receptors mediate growth effects in cultured fetal neurons. II. Activation of a protein kinase that phosphorylates ribosomal protein S6

    International Nuclear Information System (INIS)

    Heidenreich, K.A.; Toledo, S.P.

    1989-01-01

    As an initial attempt to identify early steps in insulin action that may be involved in the growth responses of neurons to insulin, we investigated whether insulin receptor activation increases the phosphorylation of ribosomal protein S6 in cultured fetal neurons and whether activation of a protein kinase is involved in this process. When neurons were incubated for 2 h with 32Pi, the addition of insulin (100 ng/ml) for the final 30 min increased the incorporation of 32Pi into a 32K microsomal protein. The incorporation of 32Pi into the majority of other neuronal proteins was unaltered by the 30-min exposure to insulin. Cytosolic extracts from insulin-treated neurons incubated in the presence of exogenous rat liver 40S ribosomes and [gamma-32P]ATP displayed a 3- to 8-fold increase in the phosphorylation of ribosomal protein S6 compared to extracts from untreated cells. Inclusion of cycloheximide during exposure of the neurons to insulin did not inhibit the increased cytosolic kinase activity. Activation of S6 kinase activity by insulin was dose dependent (seen at insulin concentration as low as 0.1 ng/ml) and reached a maximum after 20 min of incubation. Addition of phosphatidylserine, diolein, and Ca2+ to the in vitro kinase reaction had no effect on the phosphorylation of ribosomal protein S6. Likewise, treatment of neurons with (Bu)2cAMP did not alter the phosphorylation of ribosomal protein S6 by neuronal cytosolic extracts. We conclude that insulin activates a cytosolic protein kinase that phosphorylates ribosomal S6 in neurons and is distinct from protein kinase-C and cAMP-dependent protein kinase. Stimulation of this kinase may play a role in insulin signal transduction in neurons

  18. Rrp12 and the Exportin Crm1 participate in late assembly events in the nucleolus during 40S ribosomal subunit biogenesis.

    Science.gov (United States)

    Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

    2014-12-01

    During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.

  19. Biochemical Intestinal Parameters in Germ-free Minipigs and Rats and in Ex-germ-free Minipigs and Rats Monoassociated with Escherichia coli

    Czech Academy of Sciences Publication Activity Database

    Cardona, M.,E.; Kozáková, Hana; Collinder, E.; Persson, A.-K.; Midtvedt, T.; Norin, E.

    2005-01-01

    Roč. 52, - (2005), s. 109-113 ISSN 1548-9213 R&D Projects: GA AV ČR IAA5020101 Institutional research plan: CEZ:AV0Z5020903 Keywords : germ-free * minipigs * ex-germ-free Subject RIV: EE - Microbiology, Virology Impact factor: 2.111, year: 2005

  20. Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

    Science.gov (United States)

    Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

    2017-05-27

    Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Science.gov (United States)

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  2. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  3. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  4. Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

    Science.gov (United States)

    Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

    1982-06-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

  5. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  6. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  7. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  8. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  9. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  10. Cytokeratin expression in mouse lacrimal gland germ epithelium.

    Science.gov (United States)

    Hirayama, Masatoshi; Liu, Ying; Kawakita, Tetsuya; Shimmura, Shigeto; Tsubota, Kazuo

    2016-05-01

    The lacrimal gland secretes tear fluids that protect the ocular surface epithelium, and its dysfunction leads to dry eye disease (DED). The functional restoration of the lacrimal gland by engraftment of a bioengineered lacrimal gland using lacrimal gland germ epithelial cells has been proposed to cure DED in mice. Here, we investigate the expression profile of cytokeratins in the lacrimal gland germ epithelium to clarify their unique characteristics. We performed quantitative polymerase chain reaction (Q-PCR) and immunohistochemistry (IHC) analysis to clarify the expression profile of cytokeratin in the lacrimal gland germ epithelium. The mRNA expression of keratin (KRT) 5, KRT8, KRT14, KRT15, and KRT18 in the lacrimal gland germ epithelium was increased compared with that in mouse embryonic stem cells and the lacrimal gland germ mesenchyme, as analyzed by Q-PCR. The expression level of KRT15 increased in the transition from stem cells to lacrimal gland germ epithelium, then decreased as the lacrimal gland matured. IHC revealed that the expression set of these cytokeratins in the lacrimal gland germ epithelium was different from that in the adult lacrimal gland. The expression of KRT15 was observed in the lacrimal gland germ epithelium, and it segmentalized into some of the basal cells in the intercanulated duct in mature gland. We determined the expression profile of cytokeratins in the lacrimal gland epithelium, and identified KRT15 as a candidate unique cellular marker for the lacrimal gland germ epithelium. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.

    2015-01-01

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

  12. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  13. A rotational diffusion coefficient of the 70s ribosome determined by depolarized laser light scattering

    NARCIS (Netherlands)

    Bruining, J.; Fijnaut, H.M.

    We have obtained a rotational diffusion coefficient of the 70S ribosome isolated from Escherichia-coli (MRE-600), from the depolarized light scattering spectrum measured by photon correlation spectroscopy. The intensity correlation function of depolarized scattered light contains contributions due

  14. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-05-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  15. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  16. Crystal Structure of the Oxazolidinone Antibiotic Linezolid Bound to the 50S Ribosomal Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Ippolito,J.; Kanyo, Z.; Wang, D.; Franceschi, F.; Moore, P.; Steitz, T.; Duffy, E.

    2008-01-01

    The oxazolidinone antibacterials target the 50S subunit of prokaryotic ribosomes. To gain insight into their mechanism of action, the crystal structure of the canonical oxazolidinone, linezolid, has been determined bound to the Haloarcula marismortui 50S subunit. Linezolid binds the 50S A-site, near the catalytic center, which suggests that inhibition involves competition with incoming A-site substrates. These results provide a structural basis for the discovery of improved oxazolidinones active against emerging drug-resistant clinical strains.

  17. Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

    Science.gov (United States)

    Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

    2004-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

  18. Germ cell neoplasia in situ (GCNIS)

    DEFF Research Database (Denmark)

    Berney, Daniel M; Looijenga, Leendert H J; Idrees, Muhammad

    2016-01-01

    The pre-invasive lesion associated with post-pubertal malignant germ cell tumours of the testis was first recognized in the early 1970s and confirmed by a number of observational and follow-up studies. Until this year, this scientific story has been confused by resistance to the entity and disagr......The pre-invasive lesion associated with post-pubertal malignant germ cell tumours of the testis was first recognized in the early 1970s and confirmed by a number of observational and follow-up studies. Until this year, this scientific story has been confused by resistance to the entity...... and disagreement on its name. Initially termed 'carcinoma in situ' (CIS), it has also been known as 'intratubular germ cell neoplasia, unclassified' (IGCNU) and 'testicular intraepithelial neoplasia' (TIN). In this paper, we review the history of discovery and controversy concerning these names and introduce...

  19. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  20. Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

    Science.gov (United States)

    Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

    1979-01-01

    The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

  1. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  2. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  3. Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

    Directory of Open Access Journals (Sweden)

    Mikael S Lindström

    Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

  4. Evolutionary conservation of nuclear and nucleolar targeting sequences in yeast ribosomal protein S6A

    International Nuclear Information System (INIS)

    Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim

    2005-01-01

    Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs

  5. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Science.gov (United States)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  6. Germ killing by ultraviolet radiation

    International Nuclear Information System (INIS)

    Wawrik, O.

    1975-01-01

    Short-wave UV radiation, in particular the range about 250 nm, has a high germ reducing effect. Corresponding UV burners which above all emit radiation at the line of 254 nm can therefore be used effectively in all cases where the least possible content of germs in the air is aimed at. Apart from this it is also possible to reduce by this process the germs on surfaces and liquids. Especially in the most various ranges of pharmaceutical production one is steadily striving for efficient and last not least economic procedures by which it is possible to reduce the germs present in the air of a room. Numerous scientific investigations have sufficiently proved that short-wave UV radiation is extremely well appropriate for such purposes. Absolutely germ-free air in a room can only be obtained under laboratory conditions. In practice, however, the aim is not to achieve a 100 per cent killing of the germs present in a room but to make sure that the germ rate in certain rooms is constantly reduced to the lowest possible level. If in this connection it is referred to a germ reduction of 100 or 99 per cent this is but theory. (orig.) [de

  7. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  8. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Plastid ribosomal protein S5 plays a critical role in photosynthesis, plant development, and cold stress tolerance in arabidopsis

    Science.gov (United States)

    Plastid ribosomal proteins (RPs) are essential components for protein synthesis machinery and exert diverse roles in plant growth and development. Mutations in plastid RPs lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood and th...

  10. Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 5: intercellular junctions and contacts between germs cells and Sertoli cells and their regulatory interactions, testicular cholesterol, and genes/proteins associated with more than one germ cell generation.

    Science.gov (United States)

    Hermo, Louis; Pelletier, R-Marc; Cyr, Daniel G; Smith, Charles E

    2010-04-01

    In the testis, cell adhesion and junctional molecules permit specific interactions and intracellular communication between germ and Sertoli cells and apposed Sertoli cells. Among the many adhesion family of proteins, NCAM, nectin and nectin-like, catenins, and cadherens will be discussed, along with gap junctions between germ and Sertoli cells and the many members of the connexin family. The blood-testis barrier separates the haploid spermatids from blood borne elements. In the barrier, the intercellular junctions consist of many proteins such as occludin, tricellulin, and claudins. Changes in the expression of cell adhesion molecules are also an essential part of the mechanism that allows germ cells to move from the basal compartment of the seminiferous tubule to the adluminal compartment thus crossing the blood-testis barrier and well-defined proteins have been shown to assist in this process. Several structural components show interactions between germ cells to Sertoli cells such as the ectoplasmic specialization which are more closely related to Sertoli cells and tubulobulbar complexes that are processes of elongating spermatids embedded into Sertoli cells. Germ cells also modify several Sertoli functions and this also appears to be the case for residual bodies. Cholesterol plays a significant role during spermatogenesis and is essential for germ cell development. Lastly, we list genes/proteins that are expressed not only in any one specific generation of germ cells but across more than one generation. Copyright 2009 Wiley-Liss, Inc.

  11. Monocistronic mRNAs containing defective hepatitis C virus-like picornavirus internal ribosome entry site elements in their 5 ' untranslated regions are efficiently translated in cells by a cap-dependent mechanism

    DEFF Research Database (Denmark)

    Belsham, Graham; Nielsen, Inge; Normann, Preben

    2008-01-01

    The initiation of protein synthesis on mRNAs within eukaryotic cells is achieved either by a 5' cap-dependent mechanism or through internal initiation directed by an internal ribosome entry site (IRES). Picornavirus IRES elements, located in the 59 untranslated region (5'UTR), contain extensive s...

  12. [Study of enzymes of xenobiotic metabolism in the evaluation of quality of protein-containing wheat germ flakes and wallpaper flour].

    Science.gov (United States)

    Martinchuk, A N; E En Gyn; Safronova, A M; Peskova, E V

    1991-01-01

    Intake of wheat upholstery meal by growing rats was attended by a sharp decrease in the content and activity of xenobiotic metabolism enzymes in the hepatic microsomes, that was caused by the low biological value of the meal proteins. Hepatic microsomes of the rats that were fed with wheat germ flakes showed increased specific content of cytochromes P-450 and b5, but the total blood protein content per 100 g of body mass was lower than during casein consumption. No significant changes were detected in hydroxylation rate of benz(a)pyrene, aniline and ethylmorphine. During consumption of wheat germ flakes induction of UDP-glucuronide-transferase was detected in hepatic microsomes. Wheat germ flakes induced a 5-fold increase of Se-dependent glutathione peroxidase activity. Wheat germ flakes produced no significant effect on glutathione-S-aryltransferase and glutathione reductase activity.

  13. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  14. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  15. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  16. An update on sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Van Criekinge, Wim; Menschaert, Gerben

    2018-01-04

    sORFs.org (http://www.sorfs.org) is a public repository of small open reading frames (sORFs) identified by ribosome profiling (RIBO-seq). This update elaborates on the major improvements implemented since its initial release. sORFs.org now additionally supports three more species (zebrafish, rat and Caenorhabditis elegans) and currently includes 78 RIBO-seq datasets, a vast increase compared to the three that were processed in the initial release. Therefore, a novel pipeline was constructed that also enables sORF detection in RIBO-seq datasets comprising solely elongating RIBO-seq data while previously, matching initiating RIBO-seq data was necessary to delineate the sORFs. Furthermore, a novel noise filtering algorithm was designed, able to distinguish sORFs with true ribosomal activity from simulated noise, consequently reducing the false positive identification rate. The inclusion of other species also led to the development of an inner BLAST pipeline, assessing sequence similarity between sORFs in the repository. Building on the proof of concept model in the initial release of sORFs.org, a full PRIDE-ReSpin pipeline was now released, reprocessing publicly available MS-based proteomics PRIDE datasets, reporting on true translation events. Next to reporting those identified peptides, sORFs.org allows visual inspection of the annotated spectra within the Lorikeet MS/MS viewer, thus enabling detailed manual inspection and interpretation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  18. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  19. Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

    Science.gov (United States)

    Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

    2018-04-06

    The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

  20. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Science.gov (United States)

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Epigenetic features of testicular germ cell tumours in relation to epigenetic characteristics of foetal germ cells

    DEFF Research Database (Denmark)

    Kristensen, Dina Graae; Skakkebæk, Niels E; Rajpert-De Meyts, Ewa

    2013-01-01

    in humans. However, the common precursor of testicular cancers- the carcinoma in situ (CIS) cell- is thought to be an arrested foetal germ cell. Therefore studies of CIS cells may leverage information on human foetal germ cell development and, in particular, when neoplastic transformation is initiated....... In this review, we will focus on current knowledge of the epigenetics of CIS cells and relate it to the epigenetic changes occurring in early developing germ cells of mice during specification, migration and colonization. We will focus on DNA methylation and some of the best studied histone modifications like H3...... event in the initiation of testicular germ cell cancer. Even though only sparse information is available on epigenetic cues in human foetal germ cells, these indicate that the developmental patterns differ from the findings in mice and emphasize the need for further studies of foetal germ cell...

  2. Evidence that the primary effect of phosphorylation of eukaryotic initiation factor 2(alpha) in rabbit reticulocyte lysate is inhibition of the release of eukaryotic initiation factor-2.GDP from 60 S ribosomal subunits

    International Nuclear Information System (INIS)

    Gross, M.; Redman, R.; Kaplansky, D.A.

    1985-01-01

    The phosphorylation of eukaryotic initiation factor (eIF) 2 alpha that occurs when rabbit reticulocyte lysate is incubated in the absence of hemin or with poly(I.C) causes inhibition of polypeptide chain initiation by preventing a separate factor (termed RF) from promoting the exchange of GTP for GDP on eIF-2. When lysate was incubated in the presence of hemin and [ 14 C] eIF-2 or [alpha- 32 P]GTP, the authors observed binding of eIF-2 and GDP or GTP to 60 S ribosomal subunits that was slightly greater than that bound to 40 S subunits and little binding to 80 S ribosomes. When incubation was in the absence of hemin or in the presence of hemin plus 0.1 microgram/ml poly(I.C), eIF-2 and GDP binding to 60 S subunits was increased 1.5- to 2-fold, that bound to 80 S ribosomes was almost as great as that bound to 60 S subunits, and that bound to 40 S subunits was unchanged. The data indicate that about 40% of the eIF-2 that becomes bound to 60 S subunits and 80 S ribosomes in the absence of hemin or with poly(I.C) is eIF-2(alpha-P) and suggest that the eIF-2 and GDP bound is probably in the form of a binary complex. The rate of turnover of GDP (presumably eIF-2.GDP) on 60 S subunits and 80 S ribosomes in the absence of hemin is reduced to less than 10% the control rate, because the dissociation of eIF-2.GDP is inhibited. Our findings suggest that eIF-2.GTP binding to and eIF-2.GDP release from 60 S subunits may normally occur and serve to promote subunit joining

  3. A germ cell determinant reveals parallel pathways for germ line development in Caenorhabditis elegans.

    Science.gov (United States)

    Mainpal, Rana; Nance, Jeremy; Yanowitz, Judith L

    2015-10-15

    Despite the central importance of germ cells for transmission of genetic material, our understanding of the molecular programs that control primordial germ cell (PGC) specification and differentiation are limited. Here, we present findings that X chromosome NonDisjunction factor-1 (XND-1), known for its role in regulating meiotic crossover formation, is an early determinant of germ cell fates in Caenorhabditis elegans. xnd-1 mutant embryos display a novel 'one PGC' phenotype as a result of G2 cell cycle arrest of the P4 blastomere. Larvae and adults display smaller germ lines and reduced brood size consistent with a role for XND-1 in germ cell proliferation. Maternal XND-1 proteins are found in the P4 lineage and are exclusively localized to the nucleus in PGCs, Z2 and Z3. Zygotic XND-1 turns on shortly thereafter, at the ∼300-cell stage, making XND-1 the earliest zygotically expressed gene in worm PGCs. Strikingly, a subset of xnd-1 mutants lack germ cells, a phenotype shared with nos-2, a member of the conserved Nanos family of germline determinants. We generated a nos-2 null allele and show that nos-2; xnd-1 double mutants display synthetic sterility. Further removal of nos-1 leads to almost complete sterility, with the vast majority of animals without germ cells. Sterility in xnd-1 mutants is correlated with an increase in transcriptional activation-associated histone modification and aberrant expression of somatic transgenes. Together, these data strongly suggest that xnd-1 defines a new branch for PGC development that functions redundantly with nos-2 and nos-1 to promote germline fates by maintaining transcriptional quiescence and regulating germ cell proliferation. © 2015. Published by The Company of Biologists Ltd.

  4. Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel

    Energy Technology Data Exchange (ETDEWEB)

    Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.

    2017-08-28

    Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.

  5. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  6. Characterization of migratory primordial germ cells in the aorta-gonad-mesonephros of a 4.5 week-old human embryo: a toolbox to evaluate in-vitro early gametogenesis.

    Science.gov (United States)

    Gomes Fernandes, Maria; Bialecka, Monika; Salvatori, Daniela C F; Chuva de Sousa Lopes, Susana M

    2018-03-08

    ; whereas other markers, such as ALPL, SOX17, KIT, TUBB3, ITGA6 marked both POU5F1+ hPGCs and other cells in the AGM. We used a combination of multiple markers, immunostaining different cellular compartments when feasible, to decrease the chance of misidentifying hPGCs. non-applicable. Material to study early human development is unique and very rare thus restricting the sample size. We have used a combination of antibodies limited by the number of paraffin sections available. Most of our knowledge on early gametogenesis has been obtained from model organisms such as mice and is extrapolated to humans. However, since there is a dedicated effort to produce human artificial gametes in vitro, it is of great importance to determine the expression and specificity of human-specific germ cell markers. We provide a systematic analysis of the expression of 31 different markers in paraffin sections of a CS 12-13 embryo. Our results will help to set up a toolbox of markers to evaluate protocols to induce hPGCLCs in vitro. M.G.F. was funded by Fundação para a Ciência e Tecnologia (FCT) [SFRH/BD/78689/2011] and S.M.C.S.L. was funded by the Interuniversity Attraction Poles (IAP, P7/07) and the European Research Council Consolidator (ERC-CoG-725722-OVOGROWTH). The authors declare no conflict of interest.

  7. Role of Axumin PET Scan in Germ Cell Tumor

    Science.gov (United States)

    2018-05-01

    Testis Cancer; Germ Cell Tumor; Testicular Cancer; Germ Cell Tumor of Testis; Germ Cell Tumor, Testicular, Childhood; Testicular Neoplasms; Testicular Germ Cell Tumor; Testicular Yolk Sac Tumor; Testicular Choriocarcinoma; Testicular Diseases; Germ Cell Cancer Metastatic; Germ Cell Neoplasm of Retroperitoneum; Germ Cell Cancer, Nos

  8. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  9. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  10. Ribosomal protein mutations induce autophagy through S6 kinase inhibition of the insulin pathway.

    Directory of Open Access Journals (Sweden)

    Harry F Heijnen

    Full Text Available Mutations affecting the ribosome lead to several diseases known as ribosomopathies, with phenotypes that include growth defects, cytopenia, and bone marrow failure. Diamond-Blackfan anemia (DBA, for example, is a pure red cell aplasia linked to the mutation of ribosomal protein (RP genes. Here we show the knock-down of the DBA-linked RPS19 gene induces the cellular self-digestion process of autophagy, a pathway critical for proper hematopoiesis. We also observe an increase of autophagy in cells derived from DBA patients, in CD34+ erythrocyte progenitor cells with RPS19 knock down, in the red blood cells of zebrafish embryos with RP-deficiency, and in cells from patients with Shwachman-Diamond syndrome (SDS. The loss of RPs in all these models results in a marked increase in S6 kinase phosphorylation that we find is triggered by an increase in reactive oxygen species (ROS. We show that this increase in S6 kinase phosphorylation inhibits the insulin pathway and AKT phosphorylation activity through a mechanism reminiscent of insulin resistance. While stimulating RP-deficient cells with insulin reduces autophagy, antioxidant treatment reduces S6 kinase phosphorylation, autophagy, and stabilization of the p53 tumor suppressor. Our data suggest that RP loss promotes the aberrant activation of both S6 kinase and p53 by increasing intracellular ROS levels. The deregulation of these signaling pathways is likely playing a major role in the pathophysiology of ribosomopathies.

  11. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  12. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  13. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

    Science.gov (United States)

    Crossland, Hannah; Timmons, James A; Atherton, Philip J

    2017-12-01

    Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

  14. Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.

    1981-01-01

    The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)

  15. Environmentally induced transgenerational epigenetic reprogramming of primordial germ cells and the subsequent germ line.

    Directory of Open Access Journals (Sweden)

    Michael K Skinner

    Full Text Available A number of environmental factors (e.g. toxicants have been shown to promote the epigenetic transgenerational inheritance of disease and phenotypic variation. Transgenerational inheritance requires the germline transmission of altered epigenetic information between generations in the absence of direct environmental exposures. The primary periods for epigenetic programming of the germ line are those associated with primordial germ cell development and subsequent fetal germline development. The current study examined the actions of an agricultural fungicide vinclozolin on gestating female (F0 generation progeny in regards to the primordial germ cell (PGC epigenetic reprogramming of the F3 generation (i.e. great-grandchildren. The F3 generation germline transcriptome and epigenome (DNA methylation were altered transgenerationally. Interestingly, disruptions in DNA methylation patterns and altered transcriptomes were distinct between germ cells at the onset of gonadal sex determination at embryonic day 13 (E13 and after cord formation in the testis at embryonic day 16 (E16. A larger number of DNA methylation abnormalities (epimutations and transcriptional alterations were observed in the E13 germ cells than in the E16 germ cells. These observations indicate that altered transgenerational epigenetic reprogramming and function of the male germline is a component of vinclozolin induced epigenetic transgenerational inheritance of disease. Insights into the molecular control of germline transmitted epigenetic inheritance are provided.

  16. Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

    Institute of Scientific and Technical Information of China (English)

    Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

    2017-01-01

    As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

  17. Wheat germ agglutinin-conjugated liposomes incorporated with cardiolipin to improve neuronal survival in Alzheimer’s disease treatment

    Directory of Open Access Journals (Sweden)

    Kuo YC

    2017-03-01

    Full Text Available Yung-Chih Kuo,1 Che-Yu Lin,1 Jay-Shake Li,2 Yung-I Lou3 1Department of Chemical Engineering, 2Department of Psychology, National Chung Cheng University, Chia-Yi, 3Department of Accounting, Providence University, Taichung, Taiwan, Republic of China Abstract: Curcumin (CRM and nerve growth factor (NGF were entrapped in liposomes (LIP with surface wheat germ agglutinin (WGA to downregulate the phosphorylation of kinases in Alzheimer’s disease (AD therapy. Cardiolipin (CL-conjugated LIP carrying CRM (CRM-CL/LIP and also carrying NGF (NGF-CL/LIP were used with AD models of SK-N-MC cells and Wistar rats after an insult with β-amyloid peptide (Aβ. We found that CRM-CL/LIP inhibited the expression of phosphorylated p38 (p-p38, phosphorylated c-Jun N-terminal kinase (p-JNK, and p-tau protein at serine 202 and prevented neurodegeneration of SK-N-MC cells. In addition, NGF-CL/LIP could enhance the quantities of p-neurotrophic tyrosine kinase receptor type 1 and p-extracellular signal-regulated kinase 5 for neuronal rescue. Moreover, WGA-grafted CRM-CL/LIP and WGA-grafted NGF-CL/LIP significantly improved the permeation of CRM and NGF across the blood–brain barrier, reduced Aβ plaque deposition and the malondialdehyde level, and increased the percentage of normal neurons and cholinergic activity in the hippocampus of AD rats. Based on the marker expressions and in vivo evidence, current LIP carriers can be promising drug delivery systems to protect nervous tissue against Aβ-induced apoptosis in the brain during the clinical management of AD. Keywords: liposome, Alzheimer’s disease, β-amyloid, neurodegeneration, blood–brain barrier, wheat germ agglutinin

  18. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...

  19. Halogenated benzimidazole inhibitors of phosphorylation, ''in vitro'' and ''in vivo'', of the surface acidic proteins of the yeast ribosomal 60S subunit by endogenous protein kinases CK-II and PK60S

    International Nuclear Information System (INIS)

    Szyszka, Ryszard; Boguszewska, Aleksandra; Grankowski, Nikodem; Shugar, David

    1996-01-01

    Several halogeno benzimidazoles and 2-azabenzimidazoles, previously shown to be relatively selective inhibitors of protein kinases CK-I and/or CK-II from various sources, including CK-II from yeast [Szyszka et al. (1995) Biochem. Biophys. Res. Commun. 208, 418-424] inhibit also the yeast ribosomal protein kinase PK60S. The most effective inhibitor of CK-II and PK60S was tetrabromo-2-azabenzimidazole (TetraBr-2-azaBz), which was competitive with respect to ATP (and GTP in the case of CK-II) with K i values of 0.7 μM for CK-II, and 0.1 μM for PK60S. PK60S phosphorylates only three (YP1β, YB1β', YP2α) out of five polypeptides of pp13 kDa acidic proteins of 60S subunit phosphorylated by CK-II [Szyszka et al. (1995) Acta Biochim. Polon. 42, 357-362]. Accordingly, TetraBr-azaBz inhibits phosphorylation only of these polypeptides, catalysed by PK60S. Addition of TetraBr-2Bz to cultures of yeast cells, at concentrations which were without effect on cell growth, led to inhibition of intracellular phosphorylation of ribosomal acidic proteins, paralleling that observed ''in vitro''. TetraBr-2-azaBz is shown to be a useful tool for studies on the intracellular regulation of phosphorylation of the ribosomal 60S acidic proteins, which are involved in formation of active ribosomes. (author). 36 refs, 4 figs, 2 tabs

  20. Treatment Option Overview (Ovarian Germ Cell Tumors)

    Science.gov (United States)

    ... Germ Cell Tumors Treatment (PDQ®)–Patient Version Treatment Option Overview Go to Health Professional Version Key Points ... and restore) the body’s blood cells. New treatment options Combination chemotherapy (the use of more than one ...

  1. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  2. Extragonadal Germ Cell Cancer (EGC)

    Science.gov (United States)

    The Testicular Cancer Resource Center Extragonadal Germ Cell Cancer (EGC) 95% of all testicular tumors are germ cell tumors. That is, the tumors originate in the sperm forming cells in the testicles ( ...

  3. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  4. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  5. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  6. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  7. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  8. Sex-specific differences in fetal germ cell apoptosis induced by ionizing radiation

    International Nuclear Information System (INIS)

    Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G.; Bakalska, M.; Frydman, R.; Frydman, R.; Frydman, R.

    2009-01-01

    Background: We have previously shown that male human fetal germ cells are highly radiosensitive and that their death depends on p53 activation. Male germ cell apoptosis was initiated with doses as low as 0.1 Gy and was prevented by pifithrin α, a p53 inhibitor. In this study, we investigated the radiosensitivity of early female and male fetal proliferating germ cells. Methods and results: Both male and female fetal germ cells displayed a similar number of γH2AX foci in response to ionizing radiation (IR). In organ culture of human fetal ovaries, the germ cells underwent apoptosis only when exposed to high doses of IR (1.5 Gy and above). Accumulation of p53 was detected in irradiated male human fetal germ cells but not in female ones. Inhibition of p53 with pifithrin α did not affect oogonia apoptosis following irradiation. IR induced apoptosis similarly in mouse fetal ovaries in organ culture and in vivo during oogonial proliferation. Germ cell survival in testes from p53 knockout or p63 knockout mice exposed to IR was better than wild-type, whereas female germ cell survival was unaffected by p53 or p63 knockout. Conclusions: These findings show that pre-meiotic male and female fetal germ cells behave differently in response to a genotoxic stress-irradiation with oogonia being less sensitive and undergoing p53-independent apoptosis. (authors)

  9. Sex-specific differences in fetal germ cell apoptosis induced by ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [CEA, DSV/DRR/SEGG/LDRG, Laboratory of Differentiation and Radiobiology of the Gonads, Unit of Gametogenesis and Genotoxicity, F-92265 Fontenay aux Roses (France); Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [Univ. Paris 7-Denis Diderot, UFR of Biology, UMR-S 566, F-92265 Fontenay aux Roses (France); Guerquin, M.J.; Duquenne, C.; Coffigny, H.; Rouiller-Fabre, V.; Lambrot, R.; Habert, R.; Livera, G. [INSERM, U566, F-92265 Fontenay aux Roses (France); Bakalska, M. [Institute of Experimental Morphology and Anthropology, Bulgarian Academy of Sciences, Sofia (Bulgaria); Frydman, R. [Univ Paris-Sud, Clamart F-92140 (France); Frydman, R. [AP-HP, Service de Gynecologie-Obstetrique et Medecine de la Reproduction, Hopital Antoine Beclere, Clamart F-92141 (France); Frydman, R. [INSERM, U782, Clamart F-92140 (France)

    2009-07-01

    Background: We have previously shown that male human fetal germ cells are highly radiosensitive and that their death depends on p53 activation. Male germ cell apoptosis was initiated with doses as low as 0.1 Gy and was prevented by pifithrin {alpha}, a p53 inhibitor. In this study, we investigated the radiosensitivity of early female and male fetal proliferating germ cells. Methods and results: Both male and female fetal germ cells displayed a similar number of {gamma}H2AX foci in response to ionizing radiation (IR). In organ culture of human fetal ovaries, the germ cells underwent apoptosis only when exposed to high doses of IR (1.5 Gy and above). Accumulation of p53 was detected in irradiated male human fetal germ cells but not in female ones. Inhibition of p53 with pifithrin {alpha} did not affect oogonia apoptosis following irradiation. IR induced apoptosis similarly in mouse fetal ovaries in organ culture and in vivo during oogonial proliferation. Germ cell survival in testes from p53 knockout or p63 knockout mice exposed to IR was better than wild-type, whereas female germ cell survival was unaffected by p53 or p63 knockout. Conclusions: These findings show that pre-meiotic male and female fetal germ cells behave differently in response to a genotoxic stress-irradiation with oogonia being less sensitive and undergoing p53-independent apoptosis. (authors)

  10. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  11. Determination of Trichuris skrjabini by sequencing of the ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of trichurids.

    Science.gov (United States)

    Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C

    2004-06-01

    Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.

  12. Soy Germ Protein With or Without-Zn Improve Plasma Lipid Profile in Metabolic Syndrome Women

    Directory of Open Access Journals (Sweden)

    SIWI PRAMATAMA MARS WIJAYANTI

    2012-03-01

    Full Text Available The aim of this research was to determine the effect of soy germ protein on lipid profile of metabolic syndrome (MetS patients. Respondents were 30 women with criteria, i.e. blood glucose level > normal, body mass index > 25 kg/m2, hypertriglyceridemia, low cholesterol-HDL level, 40-65 years old, living in Purwokerto, and signed the informed consent. The project was approved by the ethics committee of the Medical Faculty from Gadjah Mada University-Yogyakarta. Respondents were divided into three randomly chosen groups consisting of ten women each. The first, second, and third groups were treated, respectively, with milk enriched soy germ protein plus Zn, milk enriched soy germ protein (without Zn, and placebo for two months. Blood samples were taken at baseline, one and two months after observation. Two months after observation the groups consuming milk enriched with soy germ protein, both with or without Zn, had their level of cholesterol-total decrease from 215.8 to 180.2 mg/dl (P = 0.03, triglyceride from 240.2 to 162.5 mg/dl (P = 0.02, and LDL from 154.01 to 93.85 mg/dl (P = 0.03. In contrast, HDL increased from 38.91 to 49.49 mg/dl (P = 0.0008. In conclusion, soy germ protein can improve lipid profile, thus it can inhibit atherosclerosis incident.

  13. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  14. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

    Science.gov (United States)

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

    2010-08-01

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  15. Mutations in ribosomal proteins, RPL4 and RACK1, suppress the phenotype of a thermospermine-deficient mutant of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Jun-ichi Kakehi

    Full Text Available Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5, shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10, respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5' leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1 homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5' leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine.

  16. Radiation Therapy of Suprasellar Germ Cell Tumors

    International Nuclear Information System (INIS)

    Park, Woo Yoon; Choi, Doo Ho; Choi, Eun Kyung; Kim, Il Han; Ha, Sung Whan; Park, Charn Il

    1988-01-01

    A retrospective study was performed on 15 patients with suprasellar germ cell tumors treated by megavoltage external beam irradiation between Feb. 1979 and Dec. 1985. Follow-up period of survivors was 30 to 91 months. Histologic diagnosis was obtained before radiation therapy in 10 patients (9 germinomas and 1 mixed). Five patients were treated without histologic verification. In 9 patients with biopsy-proven germinomas radiation therapy was delivered to the craniospinal axis in 6, to the whole brain in 3. In 5 patients with mixed germ cell tumor or elevated tumor marker, irradiation was delivered to the craniospinal axis in 2, to the whole brain in 2, and to the primary site only in 1. Total doses ranged from 5,000 to 5,500 cGy to the primary site, 3,000 to 4,400 cGy to the whole brain, and 1,300 to 3,000 cGy to the spine. In these 14, local tumor was controlled and primary or spinal failure was not observed. One patient without elevated tumor marker was treated to the whole brain, The tumor was not controlled and he had spinal recurrence. It is proven that radiation therapy is an effective treatment for suprasellar germ cell tumors. The neuroendocrinologic presentation, tumor marker status, early response to radiation measured on CT seem to be useful means for selecting patients for radiation therapy when tissue diagnosis is not available

  17. Globular conformation of some ribosomal proteins in solution

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Spirin, A.S.

    1978-01-01

    The possibility that such RNA-binding proteins of the 30 S subparticle as S4, S7, S8 and S16 exist in the form of compact globules in solution has been explored experimentally. These proteins have been studied in D 2 O solution by neutron scattering to measure their radii of gyration. This type of radiation using D 2 O as a solvent provides the maximum 'contrast', that is the maximum difference between the scattering of the protein and the solvent. It allowed measurements to be made using protein at <= 1.5 mg/ml. The radii of gyration for the ribosomal proteins S4, S7, S8 and S16 were found to be relatively small corresponding to the radii of gyration of compact globular proteins of the same molecular weights. (Auth.)

  18. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  19. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  20. A role for Lin28 in primordial germ cell development and germ cell malignancy

    Science.gov (United States)

    West, Jason A.; Viswanathan, Srinivas R.; Yabuuchi, Akiko; Cunniff, Kerianne; Takeuchi, Ayumu; Park, In-Hyun; Sero, Julia E.; Zhu, Hao; Perez-Atayde, Antonio; Frazier, A. Lindsay; Surani, M. Azim; Daley, George Q.

    2009-01-01

    The rarity and inaccessibility of the earliest primordial germ cells (PGCs) in the mouse embryo thwarts efforts to investigate molecular mechanisms of germ cell specification. Stella marks the minute founder population of the germ lineage1,2. Here we differentiate mouse embryonic stem cells (ESCs) carrying a Stella transgenic reporter into putative PGCs in vitro. The Stella+ cells possess a transcriptional profile similar to embryo-derived PGCs, and like their counterparts in vivo, lose imprints in a time-dependent manner. Using inhibitory RNAs to screen candidate genes for effects on the development of Stella+ cells in vitro, we discovered that Lin28, a negative regulator of let-7 microRNA processing3-6, is essential for proper PGC development. We further show that Blimp1, a let-7 target and a master regulator of PGC specification7-9, can rescue the effect of Lin28-deficiency during PGC development, thereby establishing a mechanism of action for Lin28 during PGC specification. Over-expression of Lin28 promotes formation of Stella+ cells in vitro and PGCs in chimeric embryos, and is associated with human germ cell tumours. The differentiation of putative PGCs from ESCs in vitro recapitulates the early stages of gamete development in vivo, and provides an accessible system for discovering novel genes involved in germ cell development and malignancy. PMID:19578360

  1. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  2. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    DEFF Research Database (Denmark)

    Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert

    2015-01-01

    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

  3. Treatment Options By Stage (Ovarian Germ Cell Tumors)

    Science.gov (United States)

    ... Germ Cell Tumors Treatment (PDQ®)–Patient Version Treatment Option Overview Go to Health Professional Version Key Points ... and restore) the body’s blood cells. New treatment options Combination chemotherapy (the use of more than one ...

  4. The effects of humanin and its analogues on male germ cell apoptosis induced by chemotherapeutic drugs.

    Science.gov (United States)

    Jia, Yue; Ohanyan, Aikoui; Lue, Yan-He; Swerdloff, Ronald S; Liu, Peter Y; Cohen, Pinchas; Wang, Christina

    2015-04-01

    Human (HN) prevents stress-induced apoptosis in many cells/tissues. In this study we showed that HN ameliorated chemotherapy [cyclophosphamide (CP) and Doxorubicin (DOX)]-induced male germ cell apoptosis both ex vivo in seminiferous tubule cultures and in vivo in the testis. HN acts by several putative mechanisms via binding to: an IL-12 like trimeric membrane receptor; BAX; or insulin-like growth factor binding protein-3 (IGFBP-3, a proapoptotic factor). To understand the mechanisms of HN on male germ cell apoptosis, we studied five HN analogues including: HNG (HN-S14G, a potent agonist), HNG-F6A (no binding to IGFBP-3), HN-S7A (no self-dimerization), HN-C8P (no binding to BAX), and HN-L12A (a HN antagonist) on CP-induced male germ cell apoptosis in mice. CP-induced germ cell apoptosis was inhibited by HN, HNG, HNG-F6A, HN-S7A, and HN-C8P (less effective); but not by HN-L12A. HN-L12A, but not HN-S7A or HN-C8P, blocked the protective effect of HN against CP-induced male germ cell apoptosis. HN, HN-S7A, and HN-C8P restored CP-suppressed STAT3 phosphorylation. These results suggest that HN: (1) decreases DOX (ex vivo) and CP (in vivo) induced male germ cell apoptosis; (2) action is mediated by the membrane receptor/STAT3 with minor contribution by BAX-binding pathway; (3) self-dimerization or binding to IGFBP-3 may not be involved in HN's effect in testis. HN is an important molecule in the regulation of germ cell homeostasis after injury and agonistic analogues may be developed for treating male infertility or protection against chemotherapy side effects.

  5. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  6. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  7. Establishment of the Vertebrate Germ Layers.

    Science.gov (United States)

    Tseng, Wei-Chia; Munisha, Mumingjiang; Gutierrez, Juan B; Dougan, Scott T

    2017-01-01

    The process of germ layer formation is a universal feature of animal development. The germ layers separate the cells that produce the internal organs and tissues from those that produce the nervous system and outer tissues. Their discovery in the early nineteenth century transformed embryology from a purely descriptive field into a rigorous scientific discipline, in which hypotheses could be tested by observation and experimentation. By systematically addressing the questions of how the germ layers are formed and how they generate overall body plan, scientists have made fundamental contributions to the fields of evolution, cell signaling, morphogenesis, and stem cell biology. At each step, this work was advanced by the development of innovative methods of observing cell behavior in vivo and in culture. Here, we take an historical approach to describe our current understanding of vertebrate germ layer formation as it relates to the long-standing questions of developmental biology. By comparing how germ layers form in distantly related vertebrate species, we find that highly conserved molecular pathways can be adapted to perform the same function in dramatically different embryonic environments.

  8. Transduced PEP-1-ribosomal protein S3 (rpS3) ameliorates 12-O-tetradecanoylphorbol-13-acetate-induced inflammation in mice

    International Nuclear Information System (INIS)

    Ahn, Eun Hee; Kim, Dae Won; Kang, Hye Won; Shin, Min Jae; Won, Moo Ho; Kim, Joon; Kim, Dong Joon; Kwon, Oh-Shin; Kang, Tae-Cheon; Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

    2010-01-01

    This study investigated the preventive effect of ribosomal protein S3 (rpS3) on 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced ear edema in mice. A cell permeable expression vector PEP-1-rpS3 was constructed. Topical application of the vector markedly inhibited TPA-induced expression levels of cyclooxygenase-2 (COX-2) and pro-inflammatory cytokines. Application of PEP-1-rpS3 also resulted in a significant reduction in the activation of nuclear factor-kappa B (NF-kB) and mitogen-activated protein kinase (MAPK) in TPA-treated ears. These results indicate that PEP-1-rpS3 inhibits inflammatory response cytokines and enzymes by blocking NF-kB and MAPK, prompting the suggestion that PEP-1-rpS3 can be used as a therapeutic agent against skin inflammation.

  9. EKSTRAKSI DAN ANALISIS FITOSTEROL LEMBAGA GANDUM [Extraction and analysis of Phytosterol from wheat germ (Triticum sp.

    Directory of Open Access Journals (Sweden)

    Latifah K Darusman3

    2005-04-01

    Full Text Available Phytosterol may reduce the absorption of cholesterol, and used for preventing atherosclerosis. It is limited in soybean, but potentially abundant in wheat germ. Research on the utilization of wheat germ sterol had not been reported so far. Many aspects of germ sterol extraction from wheat germ and its characteristics were still unknown. In this research, the best extraction method, kinds and content of phytosterol from wheat germ were investigated.This research consisted of two steps: (1 extraction of phytosterol directly form whole germ and ground germ using hexane, and indirect extraction through germ oil using hexane and mixed solvent of hexane and ethanol, and direct extraction from ground germ using ethanol; (2 analysis of the type and content of phytosterol in the crude extract through the following steps: preparation of crude extract, fractionation, and analysis.Results showed that indirect extraction through germ oil was considered as the best method which yielded 1.37% of phytosterol. The highest yield was obtained when extracted using a mixed solvent of hexane – ethanol 82:18. However, the odor of ethanol and hexane (gasoline like odor was still detected. The solvent’s ratio of hexane to ethanol at 1:2 resulted better odor of the extract. Extraction of sterol using ethanol yielded 18.39% of sterol when the ratio of germ to ethanol at 1:10 (w/v was applied.Results of quantitative analysis on the main component of crude extract of wheat germ sterol showed that the total content of sterol extracted with mixed solvent was higher than those extracted with ethanol. The ratio of hexane to ethanol at 1:1 (v/v gave higher content of total sterol, stigmasterol and campesterol, whereas higher content of -sitosterol was produced at the solvent’s ratio of hexane to ethanol at 1:2 (v/v.

  10. Preconception exposures to potential germ-cell mutagens

    International Nuclear Information System (INIS)

    Draper, G.

    2008-01-01

    Radiation and other agents can cause germ-cell mutations in animal systems. No human germ-cell mutagen has been identified, but this does not mean that human germ-cells are not vulnerable to mutagenesis. There has been particular concern about the possible health effects on offspring following parental preconception exposure to ionizing radiation - both occupational and therapeutic. A strong association with preconception radiation exposure in the fathers of the cases was found in a case-control study of young people with leukaemia living near the Sellafield nuclear plant in the UK. Subsequent studies of workers occupationally exposed to ionizing radiation have failed to confirm these findings. No statistically significant effects have been reported from studies of possible indicators of germ-cell mutagenesis in the A-bomb survivors. Studies of offspring of cancer survivors who receive radiotherapy and mutagenic chemotherapy have found no evidence of germ-cell mutagenesis. Failure to detect human germ-cell mutagenic agents may be a consequence of inadequate study sizes or insufficiently sensitive laboratory techniques. (authors)

  11. Lipase inactivation in wheat germ by gamma irradiation

    International Nuclear Information System (INIS)

    Jha, Pankaj Kumar; Kudachikar, V.B.; Kumar, Sourav

    2013-01-01

    An attempt was made to improve the shelf life of wheat germ by optimizing processing conditions involving γ-irradiation. Studies were carried out to investigate the effect of γ-irradiation (0–30 kGy doses) on the chemical composition of wheat germ with respect to variation in moisture, total ash, crude fat, free fatty acid, protein and lipase activity. The results demonstrate that shelf stability of wheat germ was achieved by inactivation of lipase at doses of γ-irradiation greater than 12 kGy. - Highlights: Ø γ-irradiation was found to inactivate Lipase present in Wheat Germ. Ø The treatment did not result in significant changes in Total Ash, Moisture and Protein Content of Wheat Germ. Ø The irradiation at 30 kGy resulted in 31.2 % inactivation of Lipase in Wheat Germ

  12. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  13. Ribosomal protein S6 kinase1 coordinates with TOR-Raptor2 to regulate thylakoid membrane biosynthesis in rice.

    Science.gov (United States)

    Sun, Linxiao; Yu, Yonghua; Hu, Weiqin; Min, Qiming; Kang, Huiling; Li, Yilu; Hong, Yue; Wang, Xuemin; Hong, Yueyun

    2016-07-01

    Ribosomal protein S6 kinase (S6K) functions as a key component in the target of rapamycin (TOR) pathway involved in multiple processes in eukaryotes. The role and regulation of TOR-S6K in lipid metabolism remained unknown in plants. Here we provide genetic and pharmacological evidence that TOR-Raptor2-S6K1 is important for thylakoid galactolipid biosynthesis and thylakoid grana modeling in rice (Oryza sativa L.). Genetic suppression of S6K1 caused pale yellow-green leaves, defective thylakoid grana architecture. S6K1 directly interacts with Raptor2, a core component in TOR signaling, and S6K1 activity is regulated by Raptor2 and TOR. Plants with suppressed Raptor2 expression or reduced TOR activity by inhibitors mimicked the S6K1-deficient phenotype. A significant reduction in galactolipid content was found in the s6k1, raptor2 mutant or TOR-inhibited plants, which was accompanied by decreased transcript levels of the set of genes such as lipid phosphate phosphatase α5 (LPPα5), MGDG synthase 1 (MGD1), and DGDG synthase 1 (DGD1) involved in galactolipid synthesis, compared to the control plants. Moreover, loss of LPPα5 exhibited a similar phenotype with pale yellow-green leaves. These results suggest that TOR-Raptor2-S6K1 is important for modulating thylakoid membrane lipid biosynthesis, homeostasis, thus enhancing thylakoid grana architecture and normal photosynthesis ability in rice. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Understanding Mammalian Germ Line Development with In Vitro Models.

    Science.gov (United States)

    Martínez-Arroyo, Ana M; Míguez-Forján, Jose M; Remohí, Jose; Pellicer, Antonio; Medrano, Jose V

    2015-09-15

    Germ line development is crucial in organisms with sexual reproduction to complete their life cycle. In mammals, knowledge about germ line development is based mainly on the mouse model, in which genetic and epigenetic events are well described. However, little is known about how germ line development is orchestrated in humans, especially in the earliest stages. New findings derived from human in vitro models to obtain germ cells can shed light on these questions. This comprehensive review summarizes the current knowledge about mammalian germ line development, emphasizing the state of the art obtained from in vitro models for germ cell-like cell derivation. Current knowledge of the pluripotency cycle and germ cell specification has allowed different in vitro strategies to obtain germ cells with proven functionality in mouse models. Several reports during the last 10 years show that in vitro germ cell derivation with proven functionality to generate a healthy offspring is possible in mice. However, differences in the embryo development and pluripotency potential between human and mouse make it difficult to extrapolate these results. Further efforts on both human and mouse in vitro models to obtain germ cells from pluripotent stem cells may help to elucidate how human physiological events take place; therefore, therapeutic strategies can also be considered.

  15. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  16. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  17. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  18. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  19. Malignant primary germ-cell tumor of the brain

    International Nuclear Information System (INIS)

    Yamamoto, Toyoshiro; Sato, Shinichi; Nakao, Satoshi; Ban, Sadahiko; Namba, Koh

    1983-01-01

    The unusual case of a 15 year old boy with three discrete paraventricular germ-cell tumors is reported.FThe first tumor was located just lateral to the left thalamus and included a massive cystic part around it, the second tumor in the paraventricular region above the head of the left caudate nucleus and the third tumor in the medial part of the left parietal lobe.FTotal removal of all tumors was successfully accomplished in stages at four separate operations, namely, the first tumor was removed through the left transsylvian approach, the second tumor via left superior frontal gyrus and the third tumor via left superior frontal gyrus and left superior parietal lobule.FHistological examination revealed that the first tumor was teratoma, the second was choriocarcinoma and the third was germinoma.FPrimary germ-cell tumors of the brain can be divided into 5 groups: 1) germinoma; 2) embryonal carcinoma; 3) choriocarcinoma; 4) yolk-sac tumor; or 5) teratoma.FIn this case, a combination of three different histological patterns was seen. If malignant germ-cell tumor is supected on CT, aggressive extirpation should be done, not only to determine the exact diagnosis, but also to provide the basis for subsequent adjunctive therapy. (author)

  20. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  1. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  2. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  3. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  4. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  5. "Mixed germ cell testicular tumor" in an adult female

    Directory of Open Access Journals (Sweden)

    Udasimath Shivakumarswamy

    2012-01-01

    Full Text Available The androgen insensitivity (testicular feminization syndrome was described by Morris in phenotypic females with 46XY karyotype, presenting with primary amenorrhea, adequate breast development, and absent or scanty pubic or axillary hair. Gonads consist usually of seminiferous tubules without spermatogenesis. These patients have a 5-10% risk of developing germ cell tumors, usually after the complete development of secondary female sexual characteristics. We hereby report a case considered as a female with married life of 15 years, who was operated for severe abdominal pain. Phenotype characters were that of female. Microscopic examination of the tumor from the abdomen revealed germinoma and yolk sac tumor with adjacent seminiferous tubules. Karyotyping showed 46XY. Final diagnosis of malignant mixed germ cell tumor in androgen insensitivity syndrome was made. Surveillance may be the most appropriate option when these conditions are initially diagnosed in adulthood to prevent development of germ cell tumors.

  6. Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage.

    Science.gov (United States)

    Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei

    2013-10-22

    The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.

  7. Germ Plasm Biogenesis--An Oskar-Centric Perspective.

    Science.gov (United States)

    Lehmann, Ruth

    2016-01-01

    Germ granules are the hallmark of all germ cells. These membrane-less, electron-dense structures were first observed over 100 years ago. Today, their role in regulating and processing transcripts critical for the establishment, maintenance, and protection of germ cells is well established, and pathways outlining the biochemical mechanisms and physical properties associated with their biogenesis are emerging. © 2016 Elsevier Inc. All rights reserved.

  8. Germ cell transplantation in an azoospermic Klinefelter bull.

    Science.gov (United States)

    Joerg, Hannes; Janett, Fredi; Schlatt, Stefan; Mueller, Simone; Graphodatskaya, Daria; Suwattana, Duangsmorn; Asai, Mika; Stranzinger, Gerald

    2003-12-01

    Germ cell transplantation is a technique that transfers donor testicular cells into recipient testes. A population of germ cells can colonize the recipient testis, initiate spermatogenesis, and produce sperm capable of fertilization. In the present study, a nonmosaic Klinefelter bull was used as a germ cell recipient. The donor cell suspension was introduced into the rete testis using ultrasound-guided puncture. A pulsatile administration of GnRH was performed to stimulate spermatogenesis. The molecular approach to detect donor cells was done by a quantitative polymerase chain reaction with allele discrimination based on a genetic mutation between donor and recipient. Therefore, a known genetic mutation, associated with coat-color phenotype, was used to calculate the ratio of donor to recipient cells in the biopsy specimens and ejaculates for 10 mo. After slaughtering, meiotic preparations were performed. The injected germ cells did not undergo spermatogenesis. Six months after germ cell transplantation, the donor cells were rejected, which indicates that the donor cells could not incorporate in the testis. The hormone stimulation showed that the testosterone-producing Leydig cells were functionally intact. Despite subfertility therapy, neither the recipient nor the donor cells underwent spermatogenesis. Therefore, nonmosaic Klinefelter bulls are not suitable as germ cell recipients. Future germ cell recipients in cattle could be mosaic Klinefelters, interspecies hybrids, bulls with Sertoli cell-only syndrome, or bulls with disrupted germ cell migration caused by RNA interference.

  9. Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

    DEFF Research Database (Denmark)

    Tchórzewski, M; Boldyreff, B; Issinger, O

    2000-01-01

    The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

  10. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

    Science.gov (United States)

    Abolhassani, Mohsen; Roux, Kenneth H

    2009-06-01

    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  11. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  12. Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

    Science.gov (United States)

    Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

    2000-07-01

    The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

  13. Reduction of the number of germs in spices by radappertization

    International Nuclear Information System (INIS)

    Beczner, Laszlone; Kiss, Istvan

    1983-01-01

    The sterilization by fumigation with ethylene oxide and propylene oxide of ground paprika and spice mixtures used in preserves and meat industry was compared with the radappertization of the same spices. The number of germs including that of spores and moulds was determined. It can be established that irradiation with ionizing radiation (5 kGy) has the same effect on the reduction of the number of germs as sterilization by ethylene oxide. In addition, the side effects of sterilization can be avoided. (V.N.)

  14. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  15. Molecular biological features of male germ cell differentiation

    Science.gov (United States)

    HIROSE, MIKA; TOKUHIRO, KEIZO; TAINAKA, HITOSHI; MIYAGAWA, YASUSHI; TSUJIMURA, AKIRA; OKUYAMA, AKIHIKO; NISHIMUNE, YOSHITAKE

    2007-01-01

    Somatic cell differentiation is required throughout the life of a multicellular organism to maintain homeostasis. In contrast, germ cells have only one specific function; to preserve the species by conveying the parental genes to the next generation. Recent studies of the development and molecular biology of the male germ cell have identified many genes, or isoforms, that are specifically expressed in the male germ cell. In the present review, we consider the unique features of male germ cell differentiation. (Reprod Med Biol 2007; 6: 1–9) PMID:29699260

  16. Over-expression of 60s ribosomal L23a is associated with cellular proliferation in SAG resistant clinical isolates of Leishmania donovani.

    Directory of Open Access Journals (Sweden)

    Sanchita Das

    Full Text Available Sodium antimony gluconate (SAG unresponsiveness of Leishmania donovani (Ld had effectively compromised the chemotherapeutic potential of SAG. 60s ribosomal L23a (60sRL23a, identified as one of the over-expressed protein in different resistant strains of L.donovani as observed with differential proteomics studies indicates towards its possible involvement in SAG resistance in L.donovani. In the present study 60sRL23a has been characterized for its probable association with SAG resistance mechanism.The expression profile of 60s ribosomal L23a (60sRL23a was checked in different SAG resistant as well as sensitive strains of L.donovani clinical isolates by real-time PCR and western blotting and was found to be up-regulated in resistant strains. Ld60sRL23a was cloned, expressed in E.coli system and purified for raising antibody in swiss mice and was observed to have cytosolic localization in L.donovani. 60sRL23a was further over-expressed in sensitive strain of L.donovani to check its sensitivity profile against SAG (Sb V and III and was found to be altered towards the resistant mode.This study reports for the first time that the over expression of 60sRL23a in SAG sensitive parasite decreases the sensitivity of the parasite towards SAG, miltefosine and paramomycin. Growth curve of the tranfectants further indicated the proliferative potential of 60sRL23a assisting the parasite survival and reaffirming the extra ribosomal role of 60sRL23a. The study thus indicates towards the role of the protein in lowering and redistributing the drug pressure by increased proliferation of parasites and warrants further longitudinal study to understand the underlying mechanism.

  17. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  18. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

    2015-01-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  19. 16S Ribosomal DNA Characterization of Nitrogen-Fixing Bacteria Isolated from Banana (Musa spp.) and Pineapple (Ananas comosus (L.) Merril)

    Science.gov (United States)

    Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio

    2001-01-01

    Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127

  20. Post-transcriptional gene silencing of ribosomal protein S6 kinase 1 restores insulin action in leucine-treated skeletal muscle

    DEFF Research Database (Denmark)

    Deshmukh, A; Salehzadeh, F; Metayer-Coustard, S

    2009-01-01

    Excessive nutrients, especially amino acids, impair insulin action on glucose metabolism in skeletal muscle. We tested the hypothesis that the branched-chain amino acid leucine reduces acute insulin action in primary myotubes via a negative feedback mechanism involving ribosomal protein S6 kinase 1...... to excessive leucine. In conclusion, S6K1 plays an important role in the regulation of insulin action on glucose metabolism in skeletal muscle....

  1. Biosynthesis of a hypermodified nucleotide in Saccharomyces carlsbergensis 17S and HeLa-cell 18S ribosomal ribonucleic acid.

    Science.gov (United States)

    Brand, R C; Klootwijk, J; Planta, R J; Maden, B E

    1978-01-01

    The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.

  2. A poly (U) polymerase in ribosome preparations from Ehrlich ascites tumor cells

    International Nuclear Information System (INIS)

    Guimaraes, R.C.; Bloch, D.P.

    1981-01-01

    A ribosome-bound poly (U) polymerase from Ehrlich ascites tumor cells is partially characterized. It adds UMPs to RNAs terminating in U-(3')-OH. The UMP-rich segments added reach average sizes of up to 18 nucleotides. CTP is strongly inhibitory to the enzyme. The main endogenous primers are low molecular weight RNAs which are found, after the addition of UMPs, mostly in the 6-8 S range. Some evidence suggests that a 5 S rRNA or polysome-associated 7 S RNA could be the main endogenous primers. (Author) [pt

  3. Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

    Science.gov (United States)

    Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

    2016-10-01

    Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

  4. Modeling cell elongation during germ band retraction: cell autonomy versus applied anisotropic stress

    International Nuclear Information System (INIS)

    Lynch, Holley E; Shane Hutson, M; Veldhuis, Jim; Wayne Brodland, G

    2014-01-01

    The morphogenetic process of germ band retraction in Drosophila embryos involves coordinated movements of two epithelial tissues—germ band and amnioserosa. The germ band shortens along its rostral–caudal or head-to-tail axis, widens along its perpendicular dorsal-ventral axis, and uncurls from an initial ‘U’ shape. The amnioserosa mechanically assists this process by pulling on the crook of the U-shaped germ band. The amnioserosa may also provide biochemical signals that drive germ band cells to change shape in a mechanically autonomous fashion. Here, we use a finite-element model to investigate how these two contributions reshape the germ band. We do so by modeling the response to laser-induced wounds in each of the germ band’s spatially distinct segments (T1–T3, A1–A9) during the middle of retraction when segments T1–A3 form the ventral arm of the ‘U’, A4–A7 form its crook, and A8–A9 complete the dorsal arm. We explore these responses under a range of externally applied stresses and internal anisotropy of cell edge tensions—akin to a planar cell polarity that can drive elongation of cells in a direction parallel to the minimum edge tension—and identify regions of parameter space (edge-tension anisotropy versus stress anisotropy) that best match previous experiments for each germ band segment. All but three germ band segments are best fit when the applied stress anisotropy and the edge-tension anisotropy work against one another—i.e., when the isolated effects would elongate cells in perpendicular directions. Segments in the crook of the germ band (A4–A7) have cells that elongate in the direction of maximum external stress, i.e., external stress anisotropy is dominant. In most other segments, the dominant factor is internal edge-tension anisotropy. These results are consistent with models in which the amnioserosa pulls on the crook of the germ band to mechanically assist retraction. In addition, they suggest a mechanical cue for

  5. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  6. Carbon magnetic resonance spectroscopy on carbon-13-labeled uracil in 5S ribonucleic acid

    International Nuclear Information System (INIS)

    Hamill, W.D.; Grant, D.M.; Cooper, R.B.; Harmon, S.A.

    1978-01-01

    The carbon-13 nuclear magnetic resonance spectra of the 13 C-enriched C-4 uridine carbons in 5S ribosomal ribonucleic acid of Salmonella typhimurium, strain JL-1055, was obtained. The most striking feature of the 5S RNA spectrum was the large number of well-resolved lines in the uridine band covering a chemical shift range of approximately 3.6 ppM. This data was used to obtain information on the secondary structure. The number of uridines involved in secondary interactions is estimated to be at least 75% and may be as high as 95%

  7. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  8. POMB/ACE chemotherapy for mediastinal germ cell tumours.

    Science.gov (United States)

    Bower, M; Brock, C; Holden, L; Nelstrop, A; Makey, A R; Rustin, G J; Newlands, E S

    1997-05-01

    Mediastinal germ cell tumours (MGCT) are rare and most published series reflect the experiences of individual institutions over many years. Since 1979, we have treated 16 men (12 non-seminomatous germ cell tumours and 4 seminomas) with newly diagnosed primary MGCT with POMB/ACE chemotherapy and elective surgical resection of residual masses. This approach yielded complete remissions in 15/16 (94%) patients. The median follow-up was 6.0 years and no relapses occurred more than 2 years after treatment. The 5 year overall survival in the non-seminomatous germ cell tumours (NSGCT) is 73% (95% confidence interval 43-90%). One patient with NSGCT developed drug-resistant disease and died without achieving remission and 2 patients died of relapsed disease. In addition, 4 patients with bulky and/or metastatic seminoma were treated with POMB/ACE. One died of treatment-related neutropenic sepsis in complete remission and one died of relapsed disease. Finally, 4 patients (2 NSGCT and 2 seminomas) referred at relapse were treated with POMB/ACE and one was successfully salvaged. The combination of POMB/ACE chemotherapy and surgery is effective management for MGCT producing high long-term survival rates.

  9. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

    OpenAIRE

    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

    2017-01-01

    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  10. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  11. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  12. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  13. Studies on the extraction of wheat germ oil by commercial hexane

    Directory of Open Access Journals (Sweden)

    El Kinawy, Omayma S.

    2002-12-01

    Full Text Available Extraction of an edible oil from wheat germ, an important byproduct of wheat milling industry in Egypt, using commercial hexane was studied. The extraction was carried out in a single and in two successive stages using different solvent-to-solid ratios from 2 to 6 m3/ ton. The results showed that a good oil recovery (about 75% can be achieved using 4 m3 hexane for each ton germ extracted in a single stage. This amount of solvent can be reduced to 2.5 m3/ ton if the process is carried out in two successive stages. The study has shown also that the amount of oil recovered from wheat germ is not significantly affected by heating the extraction mixture during the extraction process. The developments of free acids and peroxides in the oil during the storage period of wheat germ prior to extraction and during the hot extraction process were also investigated.Se ha estudiado la extracción de un aceite comestible a partir del germen de trigo, importante subproducto de la industria de la molienda del trigo en Egipto, usando hexano comercial. La extracción se llevó a cabo en una etapa única y en dos sucesivas, usando diferentes relaciones solvente-sólido desde 2 a 6 m3/ton. Los resultados mostraron que una buena recuperación de aceite (alrededor del 75% puede alcanzarse usando 4 m3 de hexano por cada tonelada de germen extraído en una etapa única. Esta cantidad de solvente puede reducirse a 2’5 m3/ton si el proceso se lleva a cabo en dos etapas sucesivas. El estudio mostró también que la cantidad de aceite recuperada a partir del germen de trigo no se afectó significativamente por el calentamiento de la mezcla durante el proceso de extracción. También se estudió la producción de ácidos libres y peróxidos en el aceite durante el período de almacenamiento del germen de trigo anterior a la extracción y durante el proceso de extracción en caliente

  14. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  15. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  16. Patterns of Glycoconjugate Distribution during Molar Tooth Germ Development in Mice

    Directory of Open Access Journals (Sweden)

    AR. Varasteh

    2007-09-01

    Full Text Available Objective: The aim of the present study was to evaluate the structure and distribution of Glycoconjugates during molar tooth germ development in mice.Materials and Methods: Sixteen tooth germs were obtained from BALB/c mice embryos 15 to 18 days post-gestation and fixed in 10% formalin. After routine tissue processing, 5μm sections were cut and stained with BSA1-B4 and PNA using the lectin histochemical method. All slides were evaluated by light microscopy.Results: Both lectins showed positive reaction in the tooth germ but with spatiotemporal differences. During bell stage, the reaction was strong with BSA1-B4 but moderate with PNA. Strong PNA uptake was observed in the odontoblastic and ameloblastic nuclei alongwith the apical cytoplasm of the ameloblasts.Conclusion: Although the lectins that were used in the present study recognize the same terminal sugar residue, they reacted with different disaccharide sequences with various penaltomer sugars. Therefore it may be assumed that the pattern of affinity for different parts of the developing tooth germ such as ameloblasts and odontoblasts is different in various lectins.

  17. Differential Nanos 2 protein stability results in selective germ cell accumulation in the sea urchin.

    Science.gov (United States)

    Oulhen, Nathalie; Wessel, Gary M

    2016-10-01

    Nanos is a translational regulator required for the survival and maintenance of primordial germ cells. In the sea urchin, Strongylocentrotus purpuratus (Sp), Nanos 2 mRNA is broadly transcribed but accumulates specifically in the small micromere (sMic) lineage, in part because of the 3'UTR element GNARLE leads to turnover in somatic cells but retention in the sMics. Here we found that the Nanos 2 protein is also selectively stabilized; it is initially translated throughout the embryo but turned over in the future somatic cells and retained only in the sMics, the future germ line in this animal. This differential stability of Nanos protein is dependent on the open reading frame (ORF), and is independent of the sumoylation and ubiquitylation pathways. Manipulation of the ORF indicates that 68 amino acids in the N terminus of the Nanos protein are essential for its stability in the sMics whereas a 45 amino acid element adjacent to the zinc fingers targets its degradation. Further, this regulation of Nanos protein is cell autonomous, following formation of the germ line. These results are paradigmatic for the unique presence of Nanos in the germ line by a combination of selective RNA retention, distinctive translational control mechanisms (Oulhen et al., 2013), and now also by defined Nanos protein stability. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Germ cell regeneration-mediated, enhanced mutagenesis in the ascidian Ciona intestinalis reveals flexible germ cell formation from different somatic cells.

    Science.gov (United States)

    Yoshida, Keita; Hozumi, Akiko; Treen, Nicholas; Sakuma, Tetsushi; Yamamoto, Takashi; Shirae-Kurabayashi, Maki; Sasakura, Yasunori

    2017-03-15

    The ascidian Ciona intestinalis has a high regeneration capacity that enables the regeneration of artificially removed primordial germ cells (PGCs) from somatic cells. We utilized PGC regeneration to establish efficient methods of germ line mutagenesis with transcription activator-like effector nucleases (TALENs). When PGCs were artificially removed from animals in which a TALEN pair was expressed, somatic cells harboring mutations in the target gene were converted into germ cells, this germ cell population exhibited higher mutation rates than animals not subjected to PGC removal. PGC regeneration enables us to use TALEN expression vectors of specific somatic tissues for germ cell mutagenesis. Unexpectedly, cis elements for epidermis, neural tissue and muscle could be used for germ cell mutagenesis, indicating there are multiple sources of regenerated PGCs, suggesting a flexibility of differentiated Ciona somatic cells to regain totipotency. Sperm and eggs of a single hermaphroditic, PGC regenerated animal typically have different mutations, suggesting they arise from different cells. PGCs can be generated from somatic cells even though the maternal PGCs are not removed, suggesting that the PGC regeneration is not solely an artificial event but could have an endogenous function in Ciona. This study provides a technical innovation in the genome-editing methods, including easy establishment of mutant lines. Moreover, this study suggests cellular mechanisms and the potential evolutionary significance of PGC regeneration in Ciona. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Epigenetic reprogramming in the porcine germ line

    DEFF Research Database (Denmark)

    Matzen, Sara Maj Hyldig; Croxall, Nicola; Contreras, David A.

    2011-01-01

    BACKGROUND: Epigenetic reprogramming is critical for genome regulation during germ line development. Genome-wide demethylation in mouse primordial germ cells (PGC) is a unique reprogramming event essential for erasing epigenetic memory and preventing the transmission of epimutations to the next...... an increased proportion of cells in G2. CONCLUSIONS: Our study demonstrates that epigenetic reprogramming occurs in pig migratory and gonadal PGC, and establishes the window of time for the occurrence of these events. Reprogramming of histone H3K9me2 and H3K27me3 detected between E15-E21 precedes the dynamic...... DNA demethylation at imprinted loci and DNA repeats between E22-E42. Our findings demonstrate that major epigenetic reprogramming in the pig germ line follows the overall dynamics shown in mice, suggesting that epigenetic reprogramming of germ cells is conserved in mammals. A better understanding...

  20. The effect of 2 different housing systems on germ-free mice colonized with a complex gut microbiota

    DEFF Research Database (Denmark)

    Lundberg, Randi; Toft, Martin Fitzner; August, Benjamin

    2015-01-01

    Translational animal models are essential prerequisites in exploring functions and causality of the microbiome in human health and disease. Animal models targeted at microbiome research can be germ-free mice inoculated either with a monoculture or with defined (gnotobiotic) or undefined bacterial......, but there is a lack of knowledge on the stability of complex bacterial communities in IVCs. Germ-free SW mice were inoculated with a complex murine microbiota, housed in an isolator or in IVCs and bred for two generations, corresponding to a time course of 5 months. The gut microbiota was characterized by 16S...... Biosciences and Innovation Fund Denmark. The project is a collaboration between Taconic Biosciences, University of Copenhagen and the 3G Centre (Gut, Grain and Greens)....

  1. Is Tobacco Smoke a Germ-Cell Mutagen?

    Science.gov (United States)

    Although no international organization exists to declare whether an agent is a germ-cell mutagen, tobacco smoke may be a human germ-cell mutagen. In the mouse, tobacco smoke induces a significant increase in the mutation frequency at an expanded simple tandem repeat (ESTR) locus....

  2. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    Science.gov (United States)

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-07

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.

  3. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    DEFF Research Database (Denmark)

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large ...

  4. Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

    DEFF Research Database (Denmark)

    Richter, W W; Zang, K D; Issinger, O G

    1983-01-01

    Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

  5. Immunofluorescence Analysis of Testicular Biopsies With Germ Cell and Sertoli Cell Markers Shows Significant MVH Negative Germ Cell Depletion With Older Age of Orchidopexy

    DEFF Research Database (Denmark)

    Li, Ruili; Thorup, Jørgen Mogens; Sun, Cong

    2014-01-01

    Undescended testis is the most common defect in newborn boys. It is associated with increased risks of infertility and testicular malignancy due to abnormal germ cell development in these testes. Early surgery may limit such risks. The aim of our study was to analyse germ cell development verses ...... age of orchidopexy using a germ cell marker and a Sertoli cell marker on testicular biopsies.......Undescended testis is the most common defect in newborn boys. It is associated with increased risks of infertility and testicular malignancy due to abnormal germ cell development in these testes. Early surgery may limit such risks. The aim of our study was to analyse germ cell development verses...

  6. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  7. Cross-species functionality of pararetroviral elements driving ribosome shunting.

    Directory of Open Access Journals (Sweden)

    Mikhail M Pooggin

    Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.

  8. Malignant primary germ-cell tumor of the brain: case report

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Toyoshiro; Sato, Shinichi; Nakao, Satoshi; Ban, Sadahiko; Namba, Koh (Kobe Municipal Central Hospital (Japan))

    1983-04-01

    The unusual case of a 15 year old boy with three discrete paraventricular germ-cell tumors is reported. The first tumor was located just lateral to the left thalamus and included a massive cystic part around it, the second tumor in the paraventricular region above the head of the left caudate nucleus and the third tumor in the medial part of the left parietal lobe. Total removal of all tumors was successfully accomplished in stages at four separate operations, namely, the first tumor was removed through the left transsylvian approach, the second tumor via left superior frontal gyrus and the third tumor via left superior frontal gyrus and left superior parietal lobule. Histological examination revealed that the first tumor was teratoma, the second was choriocarcinoma and the third was germinoma. Primary germ-cell tumors of the brain can be divided into 5 groups: 1) germinoma; 2) embryonal carcinoma; 3) choriocarcinoma; 4) yolk-sac tumor; or 5) teratoma. In this case, a combination of three different histological patterns was seen. If malignant germ-cell tumor is supected on CT, aggressive extirpation should be done, not only to determine the exact diagnosis, but also to provide the basis for subsequent adjunctive therapy.

  9. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  10. Stopping the Spread of Germs at Home, Work and School

    Science.gov (United States)

    ... Pandemic Other Stopping the Spread of Germs at Home, Work & School Language: English (US) Español Recommend on Facebook ... everyone from getting germs or spreading germs at home, work, or school. Clean and disinfect surfaces or objects. ...

  11. Multidimensional representations: The knowledge domain of germs held by students, teachers and medical professionals

    Science.gov (United States)

    Rua, Melissa Jo

    The present study examined the understandings held by 5th, 8th, and 11th-grade students, their teachers and medical professionals about germs. Specifically, this study describes the content and structure of students' and adults' conceptions in the areas of germ contraction, transmission, and treatment of infectious and non-infectious diseases caused by microorganisms. Naturalistic and empirical research methods were used to investigate participants' conceptions. Between and within group similarities were found using data from concept maps on the topic "flu," drawings of germs, a 20 word card sort related to germs and illness, and a semi-structured interview. Concept maps were coded according to techniques by Novak and Gowan (1984). Drawings of germs were coded into four main categories (bacteria, viruses, animal cell, other) and five subcategories (disease, caricature, insect, protozoa, unclassified). Cluster patterns for the card sorts of each group were found using multidimensional scaling techniques. Six coding categories emerged from the interview transcripts: (a) transmission, (b) treatment, (c) effect of weather on illness, (d) immune response, (e) location of germs, and (f) similarities and differences between bacteria and viruses. The findings showed students, teachers and medical professionals have different understandings about bacteria and viruses and the structures of those understandings vary. Gaps or holes in the participants knowledge were found in areas such as: (a) how germs are transmitted, (b) where germs are found, (c) how the body transports and uses medicine, (d) how the immune system functions, (e) the difference between vaccines and non-prescription medicines, (f) differences that exist between bacteria and viruses, and (g) bacterial resistance to medication. The youngest students relied heavily upon personal experiences with germs rather than formal instruction when explaining their conceptions. As a result, the influence of media was

  12. Ovarian mixed germ cell tumor with yolk sac and teratomatous components in a dog.

    Science.gov (United States)

    Robinson, Nicholas A; Manivel, J Carlos; Olson, Erik J

    2013-05-01

    Mixed germ cell tumors of the ovary have rarely been reported in veterinary species. A 3-year-old intact female Labrador Retriever dog was presented for lethargy, abdominal distention, and a midabdominal mass. An exploratory laparotomy revealed a large (23 cm in diameter) left ovarian tumor and multiple small (2-3 cm in diameter) pale tan masses on the peritoneum and abdominal surface of the diaphragm. Histological examination of the left ovary revealed a mixed germ cell tumor with a yolk sac component with rare Schiller-Duval bodies and a teratomatous component comprised primarily of neural differentiation. The abdominal metastases were solely comprised of the yolk sac component. The yolk sac component was diffusely immunopositive for cytokeratin with scattered cells reactive for α-fetoprotein and placental alkaline phosphatase. Within the teratomatous component, the neuropil was diffusely immunopositive for S100, neuron-specific enolase, and neurofilaments with a few glial fibrillary acidic protein immunopositive cells. Ovarian germ cell tumors may be pure and consist of only 1 germ cell element or may be mixed and include more than 1 germ cell element, such as teratoma and yolk sac tumor.

  13. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  14. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  15. Staphylococcus aureus and Escherichia coli have disparate dependences on KsgA for growth and ribosome biogenesis

    Directory of Open Access Journals (Sweden)

    O’Farrell Heather C

    2012-10-01

    Full Text Available Abstract Background The KsgA methyltransferase has been conserved throughout evolution, methylating two adenosines in the small subunit rRNA in all three domains of life as well as in eukaryotic organelles that contain ribosomes. Understanding of KsgA’s important role in ribosome biogenesis has been recently expanded in Escherichia coli; these studies help explain why KsgA is so highly conserved and also suggest KsgA’s potential as an antimicrobial drug target. Results We have analyzed KsgA’s contribution to ribosome biogenesis and cell growth in Staphylococcus aureus. We found that deletion of ksgA in S. aureus led to a cold-sensitive growth phenotype, although KsgA was not as critical for ribosome biogenesis as it was shown to be in E. coli. Additionally, the ksgA knockout strain showed an increased sensitivity to aminoglycoside antibiotics. Overexpression of a catalytically inactive KsgA mutant was deleterious in the knockout strain but not the wild-type strain; this negative phenotype disappeared at low temperature. Conclusions This work extends the study of KsgA, allowing comparison of this aspect of ribosome biogenesis between a Gram-negative and a Gram-positive organism. Our results in S. aureus are in contrast to results previously described in E. coli, where the catalytically inactive protein showed a negative phenotype in the presence or absence of endogenous KsgA.

  16. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  17. Comparison of phosphorylation of ribosomal proteins from HeLa and Krebs II ascites-tumour cells by cyclic AMP-dependent and cyclic GMP-dependent protein kinases

    DEFF Research Database (Denmark)

    Issinger, O G; Beier, H; Speichermann, N

    1980-01-01

    Phosphorylation of eukaryotic ribosomal proteins in vitro by essentially homogeneous preparations of cyclic AMP-dependent protein kinase catalytic subunit and cyclic GMP-dependent protein kinase was compared. Each protein kinase was added at a concentration of 30nM. Ribosomal proteins were...... by the cyclic AMP-dependent enzyme. Between 0.1 and 0.2 mol of phosphate was incorporated/mol of these phosphorylated proteins. With the exception of protein S7, the same proteins were also major substrates for the cyclic GMP-dependent protein kinase. Time courses of the phosphorylation of individual proteins...... from the small and large ribosomal subunits in the presence of either protein kinase suggested four types of phosphorylation reactions: (1) proteins S2, S10 and L5 were preferably phosphorylated by the cyclic GMP-dependent protein kinase; (2) proteins S3 and L6 were phosphorylated at very similar rates...

  18. Prenatal exposure to chromium induces early reproductive senescence by increasing germ cell apoptosis and advancing germ cell cyst breakdown in the F1 offspring.

    Science.gov (United States)

    Sivakumar, Kirthiram K; Stanley, Jone A; Arosh, Joe A; Pepling, Melissa E; Burghardt, Robert C; Banu, Sakhila K

    2014-04-01

    Hexavalent chromium (CrVI), one of the more toxic heavy metals, is widely used in more than 50 industries such as chrome plating, welding, wood processing and tanneries. As one of the world's leading producers of chromium compounds, the U.S. is facing growing challenges in protecting human health against multiple adverse effects of CrVI. CrVI is rapidly converted to CrIII intracellularly, and can induce apoptosis through different mechanisms. Our previous studies demonstrated postnatal exposure to CrVI results in a delay or arrest in follicle development and puberty. Pregnant rats were treated with 25 ppm potassium dichromate (CrVI) from gestational day (GD) 9.5 to 14.5 through drinking water, placentae were removed on GD 20, and total Cr was estimated in the placentae; ovaries were removed from the F1 offspring on postnatal day (PND)-1 and various analyses were performed. Our results show that gestational exposure to CrVI resulted in (i) increased Cr concentration in the placenta, (ii) increased germ cell apoptosis by up-regulating p53/p27-Bax-caspase-3 proteins and by increasing p53-SOD-2 co-localization; (iii) accelerated germ cell cyst (GCC) breakdown; (iv) advanced primordial follicle assembly and primary follicle transition and (v) down regulation of p-AKT, p-ERK and XIAP. As a result of the above events, CrVI induced early reproductive senescence and decrease in litter size in F1 female progeny. Published by Elsevier Inc.

  19. Multiphoton microscopy imaging of developing tooth germs

    Directory of Open Access Journals (Sweden)

    Pei-Yu Pan

    2014-01-01

    Conclusion: In this study, a novel multiphoton microscopy database of images from developing tooth germs in mice was set up. We confirmed that multiphoton laser microscopy is a powerful tool for investigating the development of tooth germ and is worthy for further application in the study of tooth regeneration.

  20. Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

    Science.gov (United States)

    Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

    2016-09-01

    Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

  1. [Germ cell membrane lipids in spermatogenesis].

    Science.gov (United States)

    Wang, Ting; Shi, Xiao; Quan, Song

    2016-05-01

    Spermatogenesis is a complex developmental process in which a diploid progenitor germ cell transforms into highly specialized spermatozoa. During spermatogenesis, membrane remodeling takes place, and cell membrane permeability and liquidity undergo phase-specific changes, which are all associated with the alteration of membrane lipids. Lipids are important components of the germ cell membrane, whose volume and ratio fluctuate in different phases of spermatogenesis. Abnormal lipid metabolism can cause spermatogenic dysfunction and consequently male infertility. Germ cell membrane lipids are mainly composed of cholesterol, phospholipids and glycolipids, which play critical roles in cell adhesion and signal transduction during spermatogenesis. An insight into the correlation of membrane lipids with spermatogenesis helps us to better understand the mechanisms of spermatogenesis and provide new approaches to the diagnosis and treatment of male infertility.

  2. Clinical identification of bacteria in human chronic wound infections: culturing vs. 16S ribosomal DNA sequencing

    Directory of Open Access Journals (Sweden)

    Rhoads Daniel D

    2012-11-01

    Full Text Available Abstract Background Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing, and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Methods Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. Results One hundred forty-five (145 unique genera were identified using molecular methods, and 68 of these genera were aerotolerant. Fourteen (14 unique genera were identified using aerobic culture methods. One-third (31/92 of the cultures were determined to be Staphylococcus aureus, Pseudomonas aeruginosa, and Enterococcus faecalis with higher relative abundance scores were more likely to be detected by culture as demonstrated with regression modeling. Conclusion Discordance between molecular and culture testing is often observed. However, culture-free 16S ribosomal DNA sequencing and its relative abundance score can provide clinicians with insight into which bacteria are most abundant in a sample and which are most likely to be detected by culture.

  3. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  4. Emergence of Tetracycline Resistance in Helicobacter pylori: Multiple Mutational Changes in 16S Ribosomal DNA and Other Genetic Loci

    Science.gov (United States)

    Dailidiene, Daiva; Bertoli, M. Teresita; Miciuleviciene, Jolanta; Mukhopadhyay, Asish K.; Dailide, Giedrius; Pascasio, Mario Alberto; Kupcinskas, Limas; Berg, Douglas E.

    2002-01-01

    Tetracycline is useful in combination therapies against the gastric pathogen Helicobacter pylori. We found 6 tetracycline-resistant (Tetr) strains among 159 clinical isolates (from El Salvador, Lithuania, and India) and obtained the following four results: (i) 5 of 6 Tetr isolates contained one or two nucleotide substitutions in one part of the primary tetracycline binding site in 16S rRNA (AGA965-967 [Escherichia coli coordinates] changed to gGA, AGc, guA, or gGc [lowercase letters are used to represent the base changes]), whereas the sixth (isolate Ind75) retained AGA965-967; (ii) PCR products containing mutant 16S ribosomal DNA (rDNA) alleles transformed recipient strains to Tetr phenotypes, but transformants containing alleles with single substitutions (gGA and AGc) were less resistant than their Tetr parents; (iii) each of 10 Tetr mutants of reference strain 26695 (in which mutations were induced with metronidazole, a mutagenic anti-H. pylori agent) contained the normal AGA965-967 sequence; and (iv) transformant derivatives of Ind75 and of one of the Tetr 26695 mutants that had acquired mutant rDNA alleles were resistant to tetracycline at levels higher than those to which either parent strain was resistant. Thus, tetracycline resistance in H. pylori results from an accumulation of changes that may affect tetracycline-ribosome affinity and/or other functions (perhaps porins or efflux pumps). We suggest that the rarity of tetracycline resistance among clinical isolates reflects this need for multiple mutations and perhaps also the deleterious effects of such mutations on fitness. Formally equivalent mutations with small but additive effects are postulated to contribute importantly to traits such as host specificity and virulence and to H. pylori's great genetic diversity. PMID:12435699

  5. In vitro germ cell differentiation from cynomolgus monkey embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Kaori Yamauchi

    Full Text Available BACKGROUND: Mouse embryonic stem (ES cells can differentiate into female and male germ cells in vitro. Primate ES cells can also differentiate into immature germ cells in vitro. However, little is known about the differentiation markers and culture conditions for in vitro germ cell differentiation from ES cells in primates. Monkey ES cells are thus considered to be a useful model to study primate gametogenesis in vitro. Therefore, in order to obtain further information on germ cell differentiation from primate ES cells, this study examined the ability of cynomolgus monkey ES cells to differentiate into germ cells in vitro. METHODS AND FINDINGS: To explore the differentiation markers for detecting germ cells differentiated from ES cells, the expression of various germ cell marker genes was examined in tissues and ES cells of the cynomolgus monkey (Macaca fascicularis. VASA is a valuable gene for the detection of germ cells differentiated from ES cells. An increase of VASA expression was observed when differentiation was induced in ES cells via embryoid body (EB formation. In addition, the expression of other germ cell markers, such as NANOS and PIWIL1 genes, was also up-regulated as the EB differentiation progressed. Immunocytochemistry identified the cells expressing stage-specific embryonic antigen (SSEA 1, OCT-4, and VASA proteins in the EBs. These cells were detected in the peripheral region of the EBs as specific cell populations, such as SSEA1-positive, OCT-4-positive cells, OCT-4-positive, VASA-positive cells, and OCT-4-negative, VASA-positive cells. Thereafter, the effect of mouse gonadal cell-conditioned medium and growth factors on germ cell differentiation from monkey ES cells was examined, and this revealed that the addition of BMP4 to differentiating ES cells increased the expression of SCP1, a meiotic marker gene. CONCLUSION: VASA is a valuable gene for the detection of germ cells differentiated from ES cells in monkeys, and the

  6. High-Resolution Melting Curve Analysis of the 16S Ribosomal Gene to Detect and Identify Pathogenic and Saprophytic Leptospira Species in Colombian Isolates.

    Science.gov (United States)

    Peláez Sánchez, Ronald G; Quintero, Juan Álvaro López; Pereira, Martha María; Agudelo-Flórez, Piedad

    2017-05-01

    AbstractIt is important to identify the circulating Leptospira agent to enhance the performance of serodiagnostic tests by incorporating specific antigens of native species, develop vaccines that take into account the species/serovars circulating in different regions, and optimize prevention and control strategies. The objectives of this study were to develop a polymerase chain reaction (PCR)-high-resolution melting (HRM) assay for differentiating between species of the genus Leptospira and to verify its usefulness in identifying unknown samples to species level. A set of primers from the initial region of the 16S ribosomal gene was designed to detect and differentiate the 22 species of Leptospira . Eleven reference strains were used as controls to establish the reference species and differential melting curves. Twenty-five Colombian Leptospira isolates were studied to evaluate the usefulness of the PCR-HRM assay in identifying unknown samples to species level. This identification was confirmed by sequencing and phylogenetic analysis of the 16S ribosomal gene. Eleven Leptospira species were successfully identified, except for Leptospira meyeri / Leptospira yanagawae because the sequences were 100% identical. The 25 isolates from humans, animals, and environmental water sources were identified as Leptospira santarosai (twelve), Leptospira interrogans (nine), and L. meyeri / L. yanagawae (four). The species verification was 100% concordant between PCR-HRM and phylogenetic analysis of the 16S ribosomal gene. The PCR-HRM assay designed in this study is a useful tool for identifying Leptospira species from isolates.

  7. Somatic isoform of angiotensin I-converting enzyme in the pathology of testicular germ cell tumors.

    Science.gov (United States)

    Franke, F E; Pauls, K; Kerkman, L; Steger, K; Klonisch, T; Metzger, R; Alhenc-Gelas, F; Burkhardt, E; Bergmann, M; Danilov, S M

    2000-12-01

    Retained fetal expression of angiotensin I-converting enzyme (ACE, CD143) has recently been shown in intratubular germ cell neoplasms (IGCN) and invasive germ cell tumors (GCT), suggesting the somatic isoform (sACE) as a characteristic component of neoplastic germ cells. We analyzed the distribution of sACE in 159 testicular GCT, including 87 IGCN. sACE protein was determined by immunohistochemistry (MAb CG2) on routinely formalin-fixed and paraffin-embedded tissue sections, supplemented by mRNA expression analysis using in situ hybridization. These data were compared with those obtained by germ cell/placental alkaline phosphatases (PIAP; MAbs PL8-F6 and 8A9) employing an uniform score system for the evaluation of immunoreactivity (IRS; possible values from 0 to 12). Expression of sACE and PIAP was found in all 87 analyzed IGCN (IRS > 4, median IRS of 12). Heterogeneous staining patterns were not related to the type of adjacent GCT but correlated with low expression in adjacent seminomas (P =.032 for sACE; P =.005 for PIAP). Both sACE and PIAP often showed a decreased and more heterogeneous but still moderate expression in 91 classic seminomas (median IRS of 8) and were completely absent in tumor cells of spermatocytic seminomas. Despite all similarities, we found sACE and PIAP differently regulated during GCT progression. This was documented by a well-preserved expression of either sACE or PIAP or both in all classic seminomas, low PIAP immunoreactivity in metastasis of seminomas, and completely diverging expression patterns in nonseminomatous GCT. Our findings underline the close molecular relationship between IGCN and seminoma, and suggest sACE as an appropriate marker for seminomatous differentiated tumors. HUM PATHOL 31:1466-1476. Copyright 2000 by W.B. Saunders Company

  8. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena

    2015-05-12

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways that control cell proliferation, oxidative phosphorylation, cellular respiration, and other redox reactions were activated in the immortalized cells. Here we report that, upon overexpression of S18-2 protein, primary rat skin fibroblasts underwent cell transformation. Cells passed more than 300 population doublings, and two out of three tested clones gave rise to tumors in experimental animals. Transformed cells showed anchorage-independent growth and loss of contact inhibition; they expressed epithelial markers, such as E-cadherin and β-catenin. Transformed cells showed increased telomerase activity, disturbance of the cell cycle, and chromosomal instability. Taken together, our data suggest that S18-2 is a newly identified oncoprotein that may be involved in cancerogenesis.

  9. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  10. Haloperidol Regulates the State of Phosphorylation of Ribosomal Protein S6 via Activation of PKA and Phosphorylation of DARPP-32

    Science.gov (United States)

    Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto

    2011-01-01

    Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187

  11. Erythroblast differentiation at spleen in Q137E mutant ribosomal protein S19 gene knock-in C57BL/6J mice.

    Science.gov (United States)

    Yamanegi, Koji; Yamada, Naoko; Nakasho, Keiji; Nishiura, Hiroshi

    2018-01-01

    We recently found that erythroblast-like cells derived from human leukaemia K562 cells express C5a receptor (C5aR) and produce its antagonistic and agonistic ligand ribosomal protein S19 (RP S19) polymer, which is cross-linked between K122 and Q137 by tissue transglutaminases. RP S19 polymer binds to the reciprocal C5aRs on erythroblast-like cells and macrophage-like cells derived from human monocytic THP-1 cells and promotes differentiation into reticulocyte-like cells through enucleation in vitro. To examine the roles of RP S19 polymer in mouse erythropoiesis, we prepared Q137E mutant RP S19 gene knock-in C57BL/6J mice. In contrast to wild-type mice, erythroblast numbers at the preliminary stage (CD71 high /TER119 low ) in spleen based on transferrin receptor (CD71) and glycophorin A (TER119) values and erythrocyte numbers in orbital artery bloods were not largely changed in knock-in mice. Conversely, erythroblast numbers at the early stage (CD71 high /TER119 high ) were significantly decreased in spleen by knock-in mice. The reduction of early erythroblast numbers in spleen was enhanced by the phenylhydrazine-induced pernicious anemia model knock-in mice and was rescued by a functional analogue of RP S19 dimer S-tagged C5a/RP S19. These data indicated that RP S19 polymer plays the roles in the early erythroblast differentiation of C57BL/6J mouse spleen. Copyright © 2017 Elsevier GmbH. All rights reserved.

  12. Temporal germ cell development strategy during continuous spermatogenesis within the montane lizard, Sceloporus bicanthalis (Squamata; Phrynosomatidae).

    Science.gov (United States)

    Gribbins, Kevin; Anzalone, Marla; Collier, Matthew; Granados-González, Gisela; Villagrán-Santa Cruz, Maricela; Hernández-Gallegos, Oswaldo

    2011-10-01

    Sceloporus bicanthalis is a viviparous lizard that lives at higher elevations in Mexico. Adult male S. bicanthalis were collected (n = 36) from the Nevado de Toluca, Mexico (elevation is 4200 m) during August to December, 2007 and January to July, 2008. Testes were extracted, fixed in Trumps, and dehydrated in a graded series of ethanol. Tissues were embedded, sectioned (2 μm), stained, and examined via a light microscope to determine the spermatogenic developmental strategy of S. bicanthalis. In all months examined, the testes were spermiogenically active; based on this, plus the presence of sperm in the lumina of seminiferous tubules, we inferred that S. bicanthalis had year-round or continuous spermatogenesis, unlike most reptiles that occupy a temperate or montane habitat. It was recently reported that seasonally breeding reptiles had a temporal germ cell development strategy similar to amphibians, where germ cells progress through spermatogenesis as a single population, which leads to a single spermiation event. This was much different than spatial development within the testis of other derived amniotes. We hypothesized that germ cell development was temporal in S. bicanthalis. Therefore, we wanted to determine whether reptiles that practice continuous spermatogenesis have a mammalian-like spatial germ cell development, which is different than the typical temperate reptile exhibiting a temporal development. In the present study, S. bicanthalis had a temporal development strategy, despite its continuous spermatogenic cycle, making them similar to tropical anoles. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  14. Childhood Central Nervous System Germ Cell Tumors Treatment

    Science.gov (United States)

    ... make hormones. Yolk sac tumors make the hormone alpha-fetoprotein (AFP). Mixed germ cell tumors are made of ... used to diagnose some CNS germ cell tumors: Alpha-fetoprotein (AFP). Beta-human chorionic gonadotropin (β-hCG). Blood ...

  15. Lin28a regulates germ cell pool size and fertility

    Science.gov (United States)

    Shinoda, Gen; de Soysa, T. Yvanka; Seligson, Marc T.; Yabuuchi, Akiko; Fujiwara, Yuko; Huang, Pei Yi; Hagan, John P.; Gregory, Richard I.; Moss, Eric G.; Daley, George Q.

    2013-01-01

    Overexpression of LIN28A is associated with human germ cell tumors and promotes primordial germ cell (PGC) development from embryonic stem cells in vitro and in chimeric mice. Knockdown of Lin28a inhibits PGC development in vitro, but how constitutional Lin28a deficiency affects the mammalian reproductive system in vivo remains unknown. Here, we generated Lin28a knockout (KO) mice and found that Lin28a deficiency compromises the size of the germ cell pool in both males and females by affecting PGC proliferation during embryogenesis. Interestingly however, in Lin28a KO males the germ cell pool partially recovers during postnatal expansion, while fertility remains impaired in both males and females mated to wild type mice. Embryonic overexpression of let-7, a microRNA negatively regulated by Lin28a, reduces the germ cell pool, corroborating the role of the Lin28a/let-7 axis in regulating the germ lineage. PMID:23378032

  16. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  17. The role of sex chromosomes in mammalian germ cell differentiation: can the germ cells carrying X and Y chromosomes differentiate into fertile oocytes?

    Directory of Open Access Journals (Sweden)

    Teruko Taketo

    2015-06-01

    Full Text Available The sexual differentiation of germ cells into spermatozoa or oocytes is strictly regulated by their gonadal environment, testis or ovary, which is determined by the presence or absence of the Y chromosome, respectively. Hence, in normal mammalian development, male germ cells differentiate in the presence of X and Y chromosomes, and female germ cells do so in the presence of two X chromosomes. However, gonadal sex reversal occurs in humans as well as in other mammalian species, and the resultant XX males and XY females can lead healthy lives, except for a complete or partial loss of fertility. Germ cells carrying an abnormal set of sex chromosomes are efficiently eliminated by multilayered surveillance mechanisms in the testis, and also, though more variably, in the ovary. Studying the molecular basis for sex-specific responses to a set of sex chromosomes during gametogenesis will promote our understanding of meiotic processes contributing to the evolution of sex determining mechanisms. This review discusses the fate of germ cells carrying various sex chromosomal compositions in mouse models, the limitation of which may be overcome by recent successes in the differentiation of functional germ cells from embryonic stem cells under experimental conditions.

  18. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    Science.gov (United States)

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  19. Rôle des germes parasites des bactéries pathogènes dans l'autoépuration des eaux

    Directory of Open Access Journals (Sweden)

    GUELIN A.

    1969-04-01

    Full Text Available Existence dans les eaux polluées de germes parasites qui s'attaquent aux bactéries pathogènes. Le pouvoir bactéricide des eaux polluées dû, en grande partie à la présence dans ces eaux de différents représentants des germes parasites. Possibilité d'application pratique des germes parasites pour l'assainissement des eaux polluées.

  20. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  1. Developmental arrest of germ cells in the pathogenesis of germ cell neoplasia

    DEFF Research Database (Denmark)

    Rajpert-De Meyts, E; Jørgensen, N; Brøndum-Nielsen, K

    1998-01-01

    Clinical observations and epidemiological evidence suggest that important aetiopathological events that cause neoplastic transformation of the male germ cell may occur in fetal life or early infancy. The incidence of germ cell neoplasia is high in individuals with various disorders of gonadal...... development and sexual differentiation, such as gonadal dysgenesis or androgen insensitivity syndrome. Increased risk has also been noted in individuals with trisomy 21, idiopathic infertility and low birth weight. Infertility is sometimes associated with small aberrations of sex chromosomes (e.g. low...... frequency mosaicism XY/XO) which can also be found in patients with testicular cancer. The variety of conditions that predispose to testicular neoplasia and the rise in its incidence in many countries speaks for the influence of environmental factors which may affect genetically predisposed individuals. We...

  2. Germ cell development in the Honeybee (Apis mellifera; Vasa and Nanos expression

    Directory of Open Access Journals (Sweden)

    Dearden Peter K

    2006-02-01

    Full Text Available Abstract Background Studies of specification of germ-cells in insect embryos has indicated that in many taxa the germ cells form early in development, and their formation is associated with pole plasm, germ plasm or an organelle called the oosome. None of these morphological features associated with germ cell formation have been identified in the Honeybee Apis mellifera. In this study I report the cloning and expression analysis of Honeybee homologues of vasa and nanos, germ cell markers in insects and other animals. Results Apis vasa and nanos RNAs are present in early honeybee embryos, but the RNAs clear rapidly, without any cells expressing these germ cell markers past stage 2. These genes are then only expressed in a line of cells in the abdomen from stage 9 onwards. These cells are the developing germ cells that are moved dorsally by dorsal closure and are placed in the genital ridge. Conclusion This study of the expression of germ cell markers in the honeybee implies that in this species either germ cells are formed by an inductive event, late in embryogenesis, or they are formed early in development in the absence of vasa and nanos expression. This contrasts with germ cell development in other members of the Hymenoptera, Diptera and Lepidoptera.

  3. Oocyte toxicity: female germ-cell loss from radiation and chemical exposures

    International Nuclear Information System (INIS)

    Dobson, R.L.

    1984-01-01

    In some mammals, female germ cells are extraordinarily sensitive to killing by exposure to ionizing radiation, especially during development. Immature oocytes, which constitute the lifetime germ-cell pool of the female, have an LD 50 in juvenile mice of only 6 rad (compared with typical LD 50 s of 100-300 rad for most other cell types studied). Essentially, the entire germ-cell supply in female squirrel monkeys is destroyed prenatally by exposure of only 0.7 rad/day. Severe but lesser destruction has been found in other species. However, evidence suggests (though not ruled out for all developmental stages) that unusually high sensitivity probably does not occur in the human female. Germ cells can also be killed by certain chemicals, and similarities exist between chemical and radiation effects. More than 75 compounds have been quantitatively studied in mice, with determination of OTI values (OTI = oocyte toxicity index = mouse LD 50 /oocyte LD 50 ) to measure the degree of preferential oocyte killing. High sensitivity in mice does not mean necessarily high sensitivity in women. Of special interest is the recent discovery that the lethal target in the extremely sensitive mouse immature oocyte is probably the plasma membrane, not DNA. Since mouse data form the main basis from which human genetic hazard (for both radiation and chemicals) is estimated, this has important implications for the determination of genetic risk in women

  4. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  5. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  6. Vulnerability of female germ cells in developing mice and monkeys to tritium, gamma rays, and polycyclic aromatic hydrocarbons

    International Nuclear Information System (INIS)

    Dobson, R.L.; Koehler, C.G.; Felton, J.S.; Kwan, T.C.; Wuebbles, B.J.; Jones, D.C.L.

    1978-01-01

    During development female germ cells in both mouse and monkey are extremely sensitive to destruction by low-level chronic tritium exposure (via 3 HOH in maternal drinking water). Practical significance of this stems from tritium's importance in nuclear energy production and as an environmental pollutant. In mice exposed from conception to 14 days of age, the LD 50 level for oocytes is only 2 μCi per mililiter of body water. The present studies indicate that, for female germ cells in squirrel monkeys exposed in utero, the LD 50 is even lower, about 0.5 μCi/ml. This striking sensitivity contrasts with reported radioresistance for primate oocytes, chiefly from acute x-irradiation experiments. The discrepancy is reconciled if germ cells in the fetal primate pass through a highly sensitive period of limited duration. In light of other data showing germ-cell loss following repeated semiweekly x-irradiation during late but not during mid gestation, these results indicate that exceedingly high sensitivity occurs probably about the middle of the last trimester, at which time the LD 50 for monkey germ cells is, as for that of the mouse, less than 5 rads. Whereas highest radiosensitivity in primates is before birth, in mice it is after birth. To define the period of sensitivity more sharply, we measured oocyte responses to standard gamma-ray exposures in Swiss-Webster mice at various ages and found them to be maximal between days 5 and 19. Polycyclic aromatic hydrocarbons (PAH's), important as pollutants, also can destroy female germ cells effectively

  7. Evaluation of spaghetti prepared from irradiated and non-irradiated semolina flour, defatted soybean and wheat germ

    International Nuclear Information System (INIS)

    Nassef, A.E.; Assem, N.H.

    2005-01-01

    The aim of the present investigation was to produce spaghetti from semolina flour supplemented with 5, 7.5 and 10% wheat germ and 5, 7.5 and 10% defatted soybean flours and gamma irradiated at 5 and 10 KGy to improve its nutritive value. Part of the blend was left without irradiation to serve as control. All samples of spaghetti were analyzed for chemical composition, color, cooking properties, sensory evaluation and amino acids contents. The results of chemical composition showed high protein and fat contents by increasing the percentage of addition for wheat germ and defatted soybean, which irradiated and non-irradiated, in spaghetti. Sensory evaluation and cooking properties for spaghetti supplemented with 5 and 7.5% non-irradiated or irradiated (5 KGy) defatted soybean gave the best values comparing with supplementation by 10% non-irradiated and irradiated with 10 KGy. The best treatments, based on sensory evaluation results, were analyzed for amino acids. Essential and non-essential amino acid levels were found to be higher in samples supplemented with wheat germ and defatted soybean when compared with control, which was prepared from semolina only

  8. Phylogeny of the Celastraceae inferred from 26S nuclear ribosomal DNA, phytochrome B, rbcL, atpB, and morphology.

    Science.gov (United States)

    Simmons, M P; Savolainen, V; Clevinger, C C; Archer, R H; Davis, J I

    2001-06-01

    Phylogenetic relationships within Celastraceae (spindle-tree family) were inferred from nucleotide sequence characters from the 5' end of 26S nuclear ribosomal DNA (including expansion segments D1-D3; 84 species sampled), phytochrome B (58 species), rbcL (31 species), atpB (23 species), and morphology (94 species). Among taxa of questionable affinity, Forsellesia is a member of Crossosomataceae, and Goupia is excluded from Celastraceae. However, Brexia, Canotia, Lepuropetalon, Parnassia, Siphonodon, and Stackhousiaceae are supported as members of Celastraceae. Gymnosporia and Tricerma are distinct from Maytenus, Cassine is supported as distinct from Elaeodendron, and Dicarpellum is distinct from Salacia. Catha, Maytenus, and Pristimera are not resolved as natural genera. Hippocrateaceae (including Plagiopteron and Lophopetalum) are a clade nested within a paraphyletic Celastraceae. These data also suggest that the Loesener's classification of Celastraceae sensu stricto and Hallé's classification of Hippocrateaceae are artificial. The diversification of the fruit and aril within Celastraceae appears to be complex, with multiple origins of most fruit and aril forms. Copyright 2001 Academic Press.

  9. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  10. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  11. Pulmonary Function in Patients With Germ Cell Cancer Treated With Bleomycin, Etoposide, and Cisplatin

    DEFF Research Database (Denmark)

    Lauritsen, Jakob; Kier, Maria Gry Gundgaard; Bandak, Mikkel

    2016-01-01

    PURPOSE: For patients with germ cell cancer, various pulmonary toxicity risk factors have been hypothesized for treatment with bleomycin, etoposide, and cisplatin (BEP). Because existing studies have shortcomings, we present a large, unselected cohort of patients who have undergone close monitoring...... expiratory volume in 1 second and forced vital capacity remained unchanged after BEP but increased significantly to levels above pretreatment during follow-up. International Germ Cell Cancer Collaborative Group (IGCCCG) prognostic group, mediastinal primary, pulmonary metastases, and smoking all...... PFT. CONCLUSION: After 5 years of follow-up, pulmonary impairment in patients with germ cell cancer who were treated with BEP was limited. Exceptions were patients treated with pulmonary surgery, those who suffered pulmonary embolism, and those in the IGCCCG poor prognostic group....

  12. ATTEMPT TO APPLY STABILIZED WHEAT GERM FOR BREAD SUPPLEMENTATION

    Directory of Open Access Journals (Sweden)

    Halina Gambuś

    2015-02-01

    Full Text Available The increased interest in rational nutrition causes, that from many years is observed a growing consumption of bread, and novel food supplemented with health promoting components. For the bread production in Poland mainly wheat and rye cake flours are used, depleted of a many valuable nutrients such as protein, dietary fibre, minerals and vitamins. Because of their unique chemical composition wheat germs are a particularly valuable resource, both for direct consumption and to enhance the nutritional value of food products. The aim of the study was to prepare wheat bread with a 10% addition of commercial stabilized wheat germs. Based on the obtained results, it was found that wheat germs, due to their unique chemical composition, were a particularly valuable resource to supplement the nutritional value of bread. However, germs had detrimental effect on mechanical properties of dough, and on bread quality. Texture of bread crumb and its chemical composition were analysed. It was shown, that germs subjected to fermentation process could be used in wheat bread production as dietary fibre and mineral compound supplement.

  13. Cold/menthol TRPM8 receptors initiate the cold-shock response and protect germ cells from cold-shock-induced oxidation.

    Science.gov (United States)

    Borowiec, Anne-Sophie; Sion, Benoit; Chalmel, Frédéric; D Rolland, Antoine; Lemonnier, Loïc; De Clerck, Tatiana; Bokhobza, Alexandre; Derouiche, Sandra; Dewailly, Etienne; Slomianny, Christian; Mauduit, Claire; Benahmed, Mohamed; Roudbaraki, Morad; Jégou, Bernard; Prevarskaya, Natalia; Bidaux, Gabriel

    2016-09-01

    Testes of most male mammals present the particularity of being externalized from the body and are consequently slightly cooler than core body temperature (4-8°C below). Although, hypothermia of the testis is known to increase germ cells apoptosis, little is known about the underlying molecular mechanisms, including cold sensors, transduction pathways, and apoptosis triggers. In this study, using a functional knockout mouse model of the cold and menthol receptors, dubbed transient receptor potential melastatine 8 (TRPM8) channels, we found that TRPM8 initiated the cold-shock response by differentially modulating cold- and heat-shock proteins. Besides, apoptosis of germ cells increased in proportion to the cooling level in control mice but was independent of temperature in knockout mice. We also observed that the rate of germ cell death correlated positively with the reactive oxygen species level and negatively with the expression of the detoxifying enzymes. This result suggests that the TRPM8 sensor is a key determinant of germ cell fate under hypothermic stimulation.-Borowiec, A.-S., Sion, B., Chalmel, F., Rolland, A. D., Lemonnier, L., De Clerck, T., Bokhobza, A., Derouiche, S., Dewailly, E., Slomianny, C., Mauduit, C., Benahmed, M., Roudbaraki, M., Jégou, B., Prevarskaya, N., Bidaux, G. Cold/menthol TRPM8 receptors initiate the cold-shock response and protect germ cells from cold-shock-induced oxidation. © The Author(s).

  14. Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli.

    Science.gov (United States)

    Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L

    2017-11-01

    Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In

  15. Phylogenetic Diversity of Lactic Acid Bacteria Associated with Paddy Rice Silage as Determined by 16S Ribosomal DNA Analysis

    OpenAIRE

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the ...

  16. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

    2017-01-01

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  17. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Science.gov (United States)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  18. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  19. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Science.gov (United States)

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  20. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  1. Germ cell tumours in neonates and infants: a distinct subgroup?

    NARCIS (Netherlands)

    Veltman, I.M.; Schepens, M.T.M.; Looijenga, L.H.J.; Strong, L.C.; Geurts van Kessel, A.H.M.

    2003-01-01

    Human germ cell tumours (GCTs) constitute a heterogeneous group of tumours that can be classified into four major subgroups. One of these subgroups encompasses (immature) teratomas and yolk sac tumours of patients under the age of 5 years. In this paper we review the various clinical, histological

  2. Novel Soy Germ Pasta Enriched in Isoflavones Ameliorates Gastroparesis in Type 2 Diabetes

    Science.gov (United States)

    Setchell, Kenneth D.R.; Nardi, Elisabetta; Battezzati, Pier-Maria; Asciutti, Stefania; Castellani, Danilo; Perriello, Gabriele; Clerici, Carlo

    2013-01-01

    OBJECTIVE To determine the effect of soy germ pasta enriched in biologically active isoflavone aglycons on gastric emptying in type 2 diabetic patients with gastroparesis. RESEARCH DESIGN AND METHODS This randomized double-blind, placebo-controlled study compared soy germ pasta with conventional pasta for effects on gastric emptying. Patients (n = 10) with delayed gastric emptying consumed one serving per day of each pasta for 8 weeks, with a 4-week washout. Gastric emptying time (t1/2) was measured using the [13C]octanoic acid breath test at baseline and after each period, and blood glucose and insulin concentrations were determined after oral glucose load. RESULTS Soy germ pasta significantly accelerated the t1/2 in these patients (161.2 ± 17.5 min at baseline vs. 112.6 ± 11.2 min after treatment, P = 0.009). Such change differed significantly (P = 0.009) from that for conventional pasta (153.6 ± 24.2 vs. 156.2 ± 27.4 min), without affecting glucose or insulin concentrations. CONCLUSIONS These findings suggest that soy germ pasta may offer a simple dietary approach to managing diabetic gastropathy. PMID:23835688

  3. The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

    International Nuclear Information System (INIS)

    Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

    1989-01-01

    The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig

  4. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    Science.gov (United States)

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  5. Great migration: epigenetic reprogramming and germ cell-oocyte metamorphosis determine individual ovarian reserve.

    Science.gov (United States)

    Celik, Onder; Aygun, Banu Kumbak; Celik, Nilufer; Aydin, Suleyman; Haberal, Esra Tustas; Sahin, Levent; Yavuz, Yasemin; Celik, Sudenaz

    2016-01-01

    Emigration is defined as a synchronized movement of germ cells between the yolk sack and genital ridges. The miraculous migration of germ cells resembles the remigration of salmon traveling from one habitat to other. This migration of germ cells is indispensible for the development of new generations. It is not, however, clear why germ cells differentiate during migration but not at the place of origin. In order to escape harmful somatic signals which might disturb the proper establishment of germ cells forced germ cell migration may be necessary. Another reason may be to benefit from the opportunities of new habitats. Therefore, emigration may have powerful effects on the population dynamics of the immigrant germ cells. While some of these cells do reach their target, some others die or reach to wrong targets. Only germ cell precursors with genetically, and structurally powerful can reach their target. Likewise, epigenetic reprogramming in both migratory and post-migratory germ cells is essential for the establishment of totipotency. During this journey some germ cells may sacrifice themselves for the goodness of the others. The number and quality of germ cells reaching the genital ridge may vary depending on the problems encountered during migration. If the aim in germ cell specification is to provide an optimal ovarian reserve for the continuity of the generation, then this cascade of events cannot be only accomplished at the same level for every one but also are manifested by several outcomes. This is significant evidence supporting the possibility of unique individual ovarian reserve.

  6. Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

    Science.gov (United States)

    Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

    2006-01-01

    The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

  7. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  8. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  9. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

    Science.gov (United States)

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

    2015-06-01

    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  10. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  11. Prenatal ultrasound and postmortem histologic evaluation of tooth germs: an observational, transversal study.

    Science.gov (United States)

    Seabra, Mariana; Felino, António; Nogueira, Rosete; Valente, Francisco; Braga, Ana Cristina; Vaz, Paula

    2015-05-12

    Hypodontia is the most frequent developmental anomaly of the orofacial complex, and its detection in prenatal ultrasound may indicate the presence of congenital malformations, genetic syndromes and chromosomal abnormalities. To date, only a few studies have evaluated the histological relationship of human tooth germs identified by two-dimensional (2D) ultrasonography. In order to analyze whether two-dimensional ultrasonography of tooth germs may be successfully used for identifying genetic syndromes, prenatal ultrasound images of fetal tooth germs obtained from a Portuguese population sample were compared with histological images obtained from fetal autopsies. Observational, descriptive, transversal study. The study protocol followed the ethical principles outlined by the Helsinki Declaration and was approved by the Ethics Committee of the School of Dental Medicine, University of Porto (FMDUP, Porto, Portugal) and of the Centro Hospitalar de Vila Nova de Gaia/Espinho (CHVNG/EPE, Porto, Portugal) as well as by the CGC Genetics Embryofetal Pathology Laboratory. Eighty-five fetuses examined by prenatal ultrasound screening from May 2011 to August 2012 had an indication for autopsy following spontaneous fetal death or medical termination of pregnancy. Of the 85 fetuses, 37 (43.5%) were randomly selected for tooth germ evaluation by routine histopathological analysis. Fetuses who were up to 30 weeks of gestation, and whose histological pieces were not representative of all maxillary tooth germs was excluded. Twenty four fetus between the 13(th) and 30(th) weeks of gestation fulfilled the parameters to autopsy. Twenty four fetuses were submitted to histological evaluation and were determined the exact number, morphology, and mineralization of their tooth germs. All tooth germs were identifiable with ultrasonography as early as the 13(th) week of gestation. Of the fetuses autopsied, 41.7% had hypodontia (29.1% maxillary hypodontia and 20.9% mandibular hypodontia). This

  12. Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

  13. Tobacco etch virus protein P1 traffics to the nucleolus and associates with the host 60S ribosomal subunits during infection.

    Science.gov (United States)

    Martínez, Fernando; Daròs, José-Antonio

    2014-09-01

    The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly

  14. European consensus on diagnosis and treatment of germ cell cancer: a report of the European Germ Cell Cancer Consensus Group (EGCCCG)

    NARCIS (Netherlands)

    Schmoll, H. J.; Souchon, R.; Krege, S.; Albers, P.; Beyer, J.; Kollmannsberger, C.; Fossa, S. D.; Skakkebaek, N. E.; de Wit, R.; Fizazi, K.; Droz, J. P.; Pizzocaro, G.; Daugaard, G.; de Mulder, P. H. M.; Horwich, A.; Oliver, T.; Huddart, R.; Rosti, G.; Paz Ares, L.; Pont, O.; Hartmann, J. T.; Aass, N.; Algaba, F.; Bamberg, M.; Bodrogi, I.; Bokemeyer, C.; Classen, J.; Clemm, S.; Culine, S.; de Wit, M.; Derigs, H. G.; Dieckmann, K. P.; Flasshove, M.; Garcia del Muro, X.; Gerl, A.; Germa-Lluch, J. R.; Hartmann, M.; Heidenreich, A.; Hoeltl, W.; Joffe, J.; Jones, W.; Kaiser, G.; Klepp, O.; Kliesch, S.; Kisbenedek, L.; Koehrmann, K. U.; Kuczyk, M.; Laguna, M. P.; Leiva, O.; Loy, V.; Mason, M. D.; Mead, G. M.; Mueller, R. P.; Nicolai, N.; Oosterhof, G. O. N.; Pottek, T.; Rick, O.; Schmidberger, H.; Sedlmayer, F.; Siegert, W.; Studer, U.; Tjulandin, S.; von der Maase, H.; Walz, P.; Weinknecht, S.; Weissbach, L.; Winter, E.; Wittekind, C.

    2004-01-01

    Germ cell tumour is the most frequent malignant tumour type in young men with a 100% rise in the incidence every 20 years. Despite this, the high sensitivity of germ cell tumours to platinum-based chemotherapy, together with radiation and surgical measures, leads to the high cure rate of > or = 99%

  15. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Tooth-germ damage by ionizing radiation

    International Nuclear Information System (INIS)

    Sobkowiak, E.M.; Beetke, E.; Bienengraeber, V.; Held, M.; Kittner, K.H.

    1977-01-01

    Experiments on animals (four-week-old dogs) were conducted in an investigation made to study the possibility of dose-dependent tooth-germ damage produced by ionizing radiation. The individual doses were 50 R and 200 R, respectively, and they were administered once to three times at weekly intervals. Hyperemia and edemata could be observed on tooth-germ pulps from 150 R onward. Both of these conditions became more acute as the radiation dose increased (from 150 R to 600 R). Possible damage to both the dentin and enamel is pointed out. (author)

  17. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  18. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...

  19. Nuclear Reprogramming in Mouse Primordial Germ Cells: Epigenetic Contribution

    Directory of Open Access Journals (Sweden)

    Massimo De Felici

    2011-01-01

    Full Text Available The unique capability of germ cells to give rise to a new organism, allowing the transmission of primary genetic information from generation to generation, depends on their epigenetic reprogramming ability and underlying genomic totipotency. Recent studies have shown that genome-wide epigenetic modifications, referred to as “epigenetic reprogramming”, occur during the development of the gamete precursors termed primordial germ cells (PGCs in the embryo. This reprogramming is likely to be critical for the germ line development itself and necessary to erase the parental imprinting and setting the base for totipotency intrinsic to this cell lineage. The status of genome acquired during reprogramming and the associated expression of key pluripotency genes render PGCs susceptible to transform into pluripotent stem cells. This may occur in vivo under still undefined condition, and it is likely at the origin of the formation of germ cell tumors. The phenomenon appears to be reproduced under partly defined in vitro culture conditions, when PGCs are transformed into embryonic germ (EG cells. In the present paper, I will try to summarize the contribution that epigenetic modifications give to nuclear reprogramming in mouse PGCs.

  20. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  1. Evidence against a germ plasm in the milkweed bug Oncopeltus fasciatus, a hemimetabolous insect

    Directory of Open Access Journals (Sweden)

    Ben Ewen-Campen

    2013-04-01

    Primordial germ cell (PGC formation in holometabolous insects like Drosophila melanogaster relies on maternally synthesised germ cell determinants that are asymmetrically localised to the oocyte posterior cortex. Embryonic nuclei that inherit this “germ plasm” acquire PGC fate. In contrast, historical studies of basally branching insects (Hemimetabola suggest that a maternal requirement for germ line genes in PGC specification may be a derived character confined principally to Holometabola. However, there have been remarkably few investigations of germ line gene expression and function in hemimetabolous insects. Here we characterise PGC formation in the milkweed bug Oncopeltus fasciatus, a member of the sister group to Holometabola, thus providing an important evolutionary comparison to members of this clade. We examine the transcript distribution of orthologues of 19 Drosophila germ cell and/or germ plasm marker genes, and show that none of them localise asymmetrically within Oncopeltus oocytes or early embryos. Using multiple molecular and cytological criteria, we provide evidence that PGCs form after cellularisation at the site of gastrulation. Functional studies of vasa and tudor reveal that these genes are not required for germ cell formation, but that vasa is required in adult males for spermatogenesis. Taken together, our results provide evidence that Oncopeltus germ cells may form in the absence of germ plasm, consistent with the hypothesis that germ plasm is a derived strategy of germ cell specification in insects.

  2. Evidence against a germ plasm in the milkweed bug Oncopeltus fasciatus, a hemimetabolous insect.

    Science.gov (United States)

    Ewen-Campen, Ben; Jones, Tamsin E M; Extavour, Cassandra G

    2013-06-15

    Primordial germ cell (PGC) formation in holometabolous insects like Drosophila melanogaster relies on maternally synthesised germ cell determinants that are asymmetrically localised to the oocyte posterior cortex. Embryonic nuclei that inherit this "germ plasm" acquire PGC fate. In contrast, historical studies of basally branching insects (Hemimetabola) suggest that a maternal requirement for germ line genes in PGC specification may be a derived character confined principally to Holometabola. However, there have been remarkably few investigations of germ line gene expression and function in hemimetabolous insects. Here we characterise PGC formation in the milkweed bug Oncopeltus fasciatus, a member of the sister group to Holometabola, thus providing an important evolutionary comparison to members of this clade. We examine the transcript distribution of orthologues of 19 Drosophila germ cell and/or germ plasm marker genes, and show that none of them localise asymmetrically within Oncopeltus oocytes or early embryos. Using multiple molecular and cytological criteria, we provide evidence that PGCs form after cellularisation at the site of gastrulation. Functional studies of vasa and tudor reveal that these genes are not required for germ cell formation, but that vasa is required in adult males for spermatogenesis. Taken together, our results provide evidence that Oncopeltus germ cells may form in the absence of germ plasm, consistent with the hypothesis that germ plasm is a derived strategy of germ cell specification in insects.

  3. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  4. Treatment with some anti-inflammatory drugs reduces germ tube formation in Candida albicans strains

    Directory of Open Access Journals (Sweden)

    Elena Rusu

    2014-12-01

    Full Text Available Candida albicans is an opportunistic dimorphic fungus that inhabits various host mucosal sites. It can cause both superficial and serious systemic disease. Conversion from the yeast to the hyphal form has been associated with increased virulence and mucosal invasiveness. The aim of this study was to investigate the effect of sodium diclofenac and aspirin on germs tube formation of different Candida albicans strains. Prostaglandins may play an important role in fungal colonization. Nonsteroidal anti-inflammatory drugs are inhibitors of the cyclooxygenase isoenzymes. These drugs specifically block the biosynthesis of mammalian prostaglandins by inhibiting one or both of cyclooxygenase isoenzymes. In tests for germ tube formation sodium diclofenac reduced the filamentation to the 12.5%- 5.1%. In the presence of aspirin the filamentation was reduced up to 85-45% depending on the tested strain. Our results suggest that cyclooxygenase-depending synthesis of fungal prostaglandins is important for morphogenesis and fungal virulence. Inhibitors of cyclooxygenase isoensymes (aspirin and diclofenac are effective in decreasing germ tube formation of Candida albicans.

  5. On the number of founding germ cells in humans

    Directory of Open Access Journals (Sweden)

    Byers Breck

    2005-08-01

    Full Text Available Abstract Background The number of founding germ cells (FGCs in mammals is of fundamental significance to the fidelity of gene transmission between generations, but estimates from various methods vary widely. In this paper we obtain a new estimate for the value in humans by using a mathematical model of germ cell development that depends on available oocyte counts for adult women. Results The germline-development model derives from the assumption that oogonial proliferation in the embryonic stage starts with a founding cells at t = 0 and that the subsequent proliferation can be defined as a simple stochastic birth process. It follows that the population size X(t at the end of germline expansion (around the 5th month of pregnancy in humans; t = 0.42 years is a random variable with a negative binomial distribution. A formula based on the expectation and variance of this random variable yields a moment-based estimate of a that is insensitive to the progressive reduction in oocyte numbers due to their utilization and apoptosis at later stages of life. In addition, we describe an algorithm for computing the maximum likelihood estimation of the FGC population size (a, as well as the rates of oogonial division and loss to apoptosis. Utilizing both of these approaches to evaluate available oocyte-counting data, we have obtained an estimate of a = 2 – 3 for Homo sapiens. Conclusion The estimated number of founding germ cells in humans corresponds well with values previously derived from chimerical or mosaic mouse data. These findings suggest that the large variation in oocyte numbers between individual women is consistent with a smaller founding germ cell population size than has been estimated by cytological analyses.

  6. Primary pleuro-pulmonary malignant germ cell tumours.

    Directory of Open Access Journals (Sweden)

    Vaideeswar P

    2002-01-01

    Full Text Available Lungs and pleura are rare sites for malignant germ-cell tumours. Two cases, pure yolk-sac tumour and yolk sac-sac tumour/embryonal carcinoma are described in young males who presented with rapid progression of respiratory symptoms. The malignant mixed germ cell tumour occurred in the right lung, while the yolk-sac tumour had a pseudomesotheliomatous growth pattern suggesting a pleural origin. Alpha-foetoprotein was immunohistochemically demonstrated in both.

  7. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

    Science.gov (United States)

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

  8. Generation of organized germ layers from a single mouse embryonic stem cell.

    Science.gov (United States)

    Poh, Yeh-Chuin; Chen, Junwei; Hong, Ying; Yi, Haiying; Zhang, Shuang; Chen, Junjian; Wu, Douglas C; Wang, Lili; Jia, Qiong; Singh, Rishi; Yao, Wenting; Tan, Youhua; Tajik, Arash; Tanaka, Tetsuya S; Wang, Ning

    2014-05-30

    Mammalian inner cell mass cells undergo lineage-specific differentiation into germ layers of endoderm, mesoderm and ectoderm during gastrulation. It has been a long-standing challenge in developmental biology to replicate these organized germ layer patterns in culture. Here we present a method of generating organized germ layers from a single mouse embryonic stem cell cultured in a soft fibrin matrix. Spatial organization of germ layers is regulated by cortical tension of the colony, matrix dimensionality and softness, and cell-cell adhesion. Remarkably, anchorage of the embryoid colony from the 3D matrix to collagen-1-coated 2D substrates of ~1 kPa results in self-organization of all three germ layers: ectoderm on the outside layer, mesoderm in the middle and endoderm at the centre of the colony, reminiscent of generalized gastrulating chordate embryos. These results suggest that mechanical forces via cell-matrix and cell-cell interactions are crucial in spatial organization of germ layers during mammalian gastrulation. This new in vitro method could be used to gain insights on the mechanisms responsible for the regulation of germ layer formation.

  9. Germ Cell Proteins in Melanoma: Prognosis, Diagnosis, Treatment, and Theories on Expression

    International Nuclear Information System (INIS)

    Rosa, A. M.; Dabas, N.; Byrnes, D. M.; Eller, M. S.; Grichnik, J. M.; Grichnik, J M.; Grichnik, J M.

    2012-01-01

    Germ cell protein expression in melanoma has been shown to correlate with malignancy, severity of disease and to serve as an immunologic target for therapy. However, very little is known about the role that germ cell proteins play in cancer development. Unique germ cell pathways include those involved in immortalization, genetic evolution, and energy metabolism. There is an ever increasing recognition that within tumors there is a subpopulation of cells with stem-cell-like characteristics that play a role in driving tumor genesis. Stem cell and germ cell biology is intertwined. Given the enormous potential and known expression of germ cell proteins in melanoma, it is possible that they represent a largely untapped resource that may play a fundamental role in tumor development and progression. The purpose of this paper is to provide an update on the current value of germ cell protein expression in melanoma diagnosis, prognosis, and therapy, as well as to review critical germ cell pathways and discuss the potential roles these pathways may play in malignant transformation

  10. Renal impairment and late toxicity in germ-cell cancer survivors

    DEFF Research Database (Denmark)

    Lauritsen, J.; Mortensen, M. S.; Kier, M. G. G.

    2015-01-01

    cohort of germ-cell cancer survivors. Patients and methods BEP-treated patients (N = 1206) were identified in the Danish DaTeCa database, and merged with national registers to identify late toxicity. GFR were measured (51Cr-EDTA clearance) before and after treatment and at 1, 3 and 5-year follow...

  11. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    Science.gov (United States)

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  12. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

    Science.gov (United States)

    Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

    2016-09-06

    Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Lipid phosphate phosphatase activity regulates dispersal and bilateral sorting of embryonic germ cells in Drosophila

    Science.gov (United States)

    Renault, Andrew D.; Kunwar, Prabhat S.; Lehmann, Ruth

    2010-01-01

    In Drosophila, germ cell survival and directionality of migration are controlled by two lipid phosphate phosphatases (LPP), wunen (wun) and wunen-2 (wun2). wun wun2 double mutant analysis reveals that the two genes, hereafter collectively called wunens, act redundantly in primordial germ cells. We find that wunens mediate germ cell-germ cell repulsion and that this repulsion is necessary for germ cell dispersal and proper transepithelial migration at the onset of migration and for the equal sorting of the germ cells between the two embryonic gonads during their migration. We propose that this dispersal function optimizes adult fecundity by assuring maximal germ cell occupancy of both gonads. Furthermore, we find that the requirement for wunens in germ cell survival can be eliminated by blocking germ cell migration. We suggest that this essential function of Wunen is needed to maintain cell integrity in actively migrating germ cells. PMID:20431117

  14. Human DAZL, DAZ and BOULE genes modulate primordial germ cell and haploid gamete formation

    Science.gov (United States)

    Kee, Kehkooi; Angeles, Vanessa T; Flores, Martha; Nguyen, Ha Nam; Pera, Renee A Reijo

    2009-01-01

    The leading cause of infertility in men and women is quantitative and qualitative defects in human germ cell (oocyte and sperm) development. Yet, it has not been possible to examine the unique developmental genetics of human germ cell formation and differentiation due to inaccessibility of germ cells during fetal development. Although several studies have shown that germ cells can be differentiated from mouse and human embryonic stem cells, human germ cells differentiated in these studies generally did not develop beyond the earliest stages1-8. Here we used a germ cell reporter to quantitate and isolate primordial germ cells derived from both male and female hESCs. Then, by silencing and overexpressing genes that encode germ cell-specific cytoplasmic RNA-binding proteins (not transcription factors), we modulated human germ cell formation and developmental progression. We observed that human DAZL (Deleted in AZoospermia-Like) functions in primordial germ cell formation, whereas closely-related genes, DAZ and BOULE, promote later stages of meiosis and development of haploid gametes. These results are significant to the generation of gametes for future basic science and potential clinical applications. PMID:19865085

  15. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  16. Germ line determinants are not localized early in sea urchin development, but do accumulate in the small micromere lineage.

    Science.gov (United States)

    Juliano, Celina E; Voronina, Ekaterina; Stack, Christie; Aldrich, Maryanna; Cameron, Andrew R; Wessel, Gary M

    2006-12-01

    Two distinct modes of germ line determination are used throughout the animal kingdom: conditional-an inductive mechanism, and autonomous-an inheritance of maternal factors in early development. This study identifies homologs of germ line determinants in the sea urchin Strongylocentrotus purpuratus to examine its mechanism of germ line determination. A list of conserved germ-line associated genes from diverse organisms was assembled to search the S. purpuratus genome for homologs, and the expression patterns of these genes were examined during embryogenesis by whole mount in situ RNA hybridization and QPCR. Of the 14 genes tested, all transcripts accumulate uniformly during oogenesis and Sp-pumilio, Sp-tudor, Sp-MSY, and Sp-CPEB1 transcripts are also uniformly distributed during embryonic development. Sp-nanos2, Sp-seawi, and Sp-ovo transcripts, however, are enriched in the vegetal plate of the mesenchyme blastula stage and Sp-vasa, Sp-nanos2, Sp-seawi, and Sp-SoxE transcripts are localized in small micromere descendents at the tip of the archenteron during gastrulation and are then enriched in the left coelomic pouch of larvae. The results of this screen suggest that sea urchins conditionally specify their germ line, and support the hypothesis that this mechanism is the basal mode of germ line determination amongst deuterostomes. Furthermore, accumulation of germ line determinants selectively in small micromere descendents supports the hypothesis that these cells contribute to the germ line.

  17. Peculiarities in the CT findings of germ cell tumors in various tumor localizations

    International Nuclear Information System (INIS)

    Tazoe, Makoto; Miyagami, Mitsusuke; Tsubokawa, Takashi

    1991-01-01

    The CT findings of 17 germ cell tumors were studied in relation to the locations of the tumor, the pathological diagnoses, and the tumor markers (AFP and HCG). Generally, the CT findings of germ cell tumors depended on the pathological diagnoses more strongly than on the location of the tumors. On plain CT of 7 germ cell tumors in the pineal region, all of them demonstrated heterogeneous findings. Hydrocephalus was seen in 6 cases (86%) and calcification in 6 cases (86%) of the germ cell tumors in the pineal region. Calcification and hydrocephalus that appeared more often than in other regions were characteristic of germ cell tumors of the pineal region. The germ cell tumors in the basal ganglia had a slightly homogenous high density, with small cysts and calcification in most of them on plain CT. On enhanced CT, the tumors were moderately enhanced in all cases located in the basal ganglia. Four cases of germ cell tumors located in the basal ganglia revealed the dilatation of lateral ventricle due to hemispheric atrophy in the tumor side. The germ cell tumors showing an increase in the tumor markers such as AFP and HCG, which were usually malignant germ cell tumors, were strongly enhanced on enhanced CT. (author)

  18. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  19. Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

    Science.gov (United States)

    Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

    2010-06-12

    For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

  20. Germ-line origins of mutation in families with hemophilia B: The sex ratio varies with the type of mutation

    Energy Technology Data Exchange (ETDEWEB)

    Ketterling, R.P.; Vielhaber, E.; Bottema, C.D.K.; Schaid, D.J.; Sommer, S.S. (Mayo Clinic/Foundation, Rochester, MN (United States)); Cohen, M.P. (Vanderbilt Univ., Nashville, TN (United States)); Sexauer, C.L. (Children' s Hospital, Oklahoma City, OK (United States))

    1993-01-01

    Previous epidemiological and biochemical studies have generated conflicting estimates of the sex ratio of mutation. Direct genomic sequencing in combination with haplotype analysis extends previous analyses by allowing the precise mutation to be determined in a given family. From analysis of the factor IX gene of 260 consecutive families with hemophilia B, the authors report the germ-line origin of mutation in 25 families. When combined with 14 origins of mutation reported by others and with 4 origins previously reported by them, a total of 25 occur in the female germ line, and 18 occur in the male germ line. The excess of germ-line origins in females does not imply an overall excess mutation rate per base pair in the female germ line. Bayesian analysis of the data indicates that the sex ratio varies with the type of mutation. The aggregate of single-base substitutions shows a male predominance of germ-line mutations (P < .002). The maximum-likelihood estimate of the male predominance is 3.5-fold. Of the single-base substitutions, deletions display a sex ratio of unity. Analysis of the parental age at transmission of a new mutation suggests that germ-line mutations are associated with a small increase in parental age in females but little, if any, increase in males. Although direct genomic sequencing offers a general method for defining the origin of mutation in specific families, accurate estimates of the sex ratios of different mutational classes require large sample sizes and careful correction for multiple biases of ascertainment. The biases in the present data result in an underestimate of the enhancement of mutation in males. 62 refs., 1 fig., 5 tabs.

  1. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    Science.gov (United States)

    Long, Katherine S.

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525

  2. Fluorescent in situ hybridization of the ribosomal RNA genes (5S and 35S in the genus Lolium: Lolium canariense, the missing link with Festuca?

    Directory of Open Access Journals (Sweden)

    Inda, Luis A.

    2013-06-01

    Full Text Available Two groups of taxa can be distinguished within the genus Lolium L. based on the pollination system, chromosome size, chromosomal location of nrDNA (5S and 35S (18S-5.8S-26S] and nrDNA phylogeny. The first group includes self-pollinated taxa (L. temulentum, L. persicum and L. remotum, whereas the second group comprises cross-pollinated species (L. perenne, L. multiflorum and L. rigidum. Here we describe that the autogamous species have two 5S sites and four 35S sites in their genome. Two of the 35S sites are present in the chromosomes containing the 5S regions. The allogamous taxa possess two 5S rDNA sites and 6-10 35S sites per genome, depending on the species. Two of these regions (35S may also be present in the chromosomes bearing 5S sites. Our study also demonstrates that Lolium canariense shows a distinctive pattern. It has two 5S and four 35S sites. In this case, the 35S loci are located in different chromosomes than the 5S. This cytogenetic pattern is consistent with that of Festuca pratensis. Thus, despite being allogamous, Lolium canariense does not entirely fit in either of the groups defined for the genus Lolium. The physical mapping of the nrDNA regions in L. canariense is different, and resembles that of F. pratensis, suggesting that this Macaronesian Lolium could be intermediate between Festuca and Lolium.En trabajos previos se ha descrito que el género Lolium L. está formado por dos grupos de taxones basados en el tipo de polinización, tamaño de los cromosomas, localización cromosómica de los loci del ADN ribosómico [5S y 35S (18S-5.8S-26S] y filogenia molecular basada en secuencias de ADN ribosómico. Los dos grupos son: especies autógamas (L. temulentum, L. persicum y L. remotum y especies alógamas (L. perenne, L. multiflorum y L. rigidum. Aquí describimos que según la localización cromosómica de los loci ribosómicos, las especies autógamas tienen dos sitios 5S y cuatro sitios 35S; dos de las cuales coinciden en

  3. A study on effective extraction of isoflavones from soy germ using the electron beam

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Hoon [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of); Choi, Tae Beom [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of); Department of Chemistry, Dongguk University, 3 Pildong, Chunggu, Seoul 100-715 (Korea, Republic of); Kim, Sang Wook [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of)], E-mail: swkim@kaeri.re.kr; Hur, Min Goo; Yang, Seung Dae [Radiation Research Division for Industry and Environment, Korea Atomic Energy Research Institute, 1266 Sinjeong-dong, Jeongup-si, 580-185 Jeollabuk-do (Korea, Republic of); Yu, Kook Hyun [Department of Chemistry, Dongguk University, 3 Pildong, Chunggu, Seoul 100-715 (Korea, Republic of)], E-mail: yukook@dongguk.edu

    2009-07-15

    Soy germ was irradiated with 2 MeV electron beam with different doses ranging from 1 to 20 kGy. The amount of isoflavones from irradiated soy germ was compared with those from natural soy germ by extracting with ethanol and methanol. The changed amounts of isoflavones were measured by high-performance liquid chromatography with standard calibration curve. Each extract of soy germ was quantified for antioxidant activity with 1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical scavenging method. The amount of isoflavones was found to be increased after electron-beam irradiation. Particularly ethanol extract with 15 kGy irradiated soy germ contained the maximum amount of isoflavones. Antioxidant activity of irradiated soy germ was higher than that of natural soy germ.

  4. Spondyloepiphseal dysplasia congenita in siblings born to unaffected parents: ? germ line mosaicism

    Energy Technology Data Exchange (ETDEWEB)

    Mulla, W.; McDonald-McGinn, D.; Zackai, E. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)] [and others

    1994-09-01

    Germ line mosaicism has been used to explain the birth of more than one child affected with a dominantly inherited disorder born to unaffected parents. Furthermore, it has been confirmed clinically in families where recurrence in siblings was originally thought to be autosomal recessive, but were affected individuals have reproduced affected offspring. Firm evidence of germ line mosaicism using mutation analysis by molecular methods exists for some autosomal disorders. We present two siblings with spondyloepipheseal dysplasia congenita (SEDC) born to unaffected parents. This suggests the presence of germ line mosaicism in this entity. Patient 1 was born at 32 weeks gestation to a G1P1 Puerto Rican mother. The pregnancy was complicated by polyhydramnios. The neonate, a short-limbed dwarf, died at 15 hours of age from respiratory distress and a compromised thoracic cavity. Patient 2, the sibling of patient 1 was born at 37 weeks gestation after a pregnancy complicated by polyhydramnios and prenatal ultrasound diagnosis of short-limbed dwarfism. The diagnosis of SEDC was made and, after review of the sibling`s postmortem X-rays, it was felt that she was similarly affected. The family history reveals no history of dwarfism or consanguinity. The SEDC is described as an autosomal dominant form of dwarfism with variable presentation including some cases that have been lethal in the neonatal period. SEDC is now believed to represent a family of collagen II mutations. Sporadic cases that have arisen in families with no history have been ascribed to new heterozygous mutations. Other families in which SEDC and SEMD recurred without a family history most likely represent germ line mosaicism. In these cases molecular studies should be pursued to document a collagen II mutation. We believe that germ line mosaicism is the most plausible explanation for recurrence in our family.

  5. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  6. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  7. Importance of Adding Wheat Germ in Diets of Growing Goats to Improve Some Components of Blood and Growth Performance

    International Nuclear Information System (INIS)

    El-Tarabany, A.A.; Teama, F.E.I.

    2013-01-01

    This experiment was conducted to study the importance of supplementing wheat germ to the diet of growing local goats in Egypt for improving their some blood biochemical components as well as growth performance. Forty goats with 4 months age and average initial body weight 5 ± 0.5 kg were used in the present study which lasted 5 months. The animals were divided randomly into two equal groups; the 1st group fed basic diet without supplement (control) and the 2nd group of animals fed on the same basic diet with supplemented wheat germ at the rate of 5 g/head/day. The body weight was recorded at the beginning and the end of the experiment to calculate the daily gain of body weight for each animal. Blood samples were withdrawn at the end of experiment to estimate some blood parameters concentrations including total protein, albumin, globulin, urea, creatinine, total cholesterol, Ca, P, Mg, Zn, immunoglobulin G (IgG), total antioxidants and triiodothyronine (T3). The results showed that the addition of wheat germ by the rate of 5 gm/ head/ day to the diet of growing goats significantly increased the concentrations of total proteins, globulin, phosphorus, magnesium and zinc and led to significant decrease in the levels of total cholesterol. Significant improvement in levels of IgG, total antioxidants and T3 hormone in the blood were also observed. In addition, there was significant improvement in the feed efficiency of growing goats although total and daily gains of treated animals were affected by the diet supplement. It could be concluded that addition of wheat germ (5 g/head/day) led to modification of all studied blood components and led to improved feed efficiency in growing local goats, therefore, it could be recommended to use the wheat germ in growth stages because the economic return to this addition is preferable.

  8. Specification of primordial germ cells in medaka (Oryzias latipes

    Directory of Open Access Journals (Sweden)

    Raz Erez

    2007-01-01

    Full Text Available Abstract Background Primordial germ cells (PGCs give rise to gametes that are responsible for the development of a new organism in the next generation. Two modes of germ line specification have been described: the inheritance of asymmetrically-localized maternally provided cytoplasmic determinants and the induction of the PGC fate by other cell types. PGCs specification in zebrafish appears to depend on inheritance of germ plasm in which several RNA molecules such as vasa and nanos reside. Whether the specification mode of PGCs found in zebrafish is general for other fish species was brought into question upon analysis of olvas expression – the vasa homologue in another teleost, medaka (Oryzias latipes. Here, in contrast to the findings in zebrafish, the PGCs are found in a predictable position relative to a somatic structure, the embryonic shield. This finding, coupled with the fact that vasa mRNA, which is localized to the germ plasm of zebrafish but does not label a similar structure in medaka opened the possibility of fundamentally different mechanisms governing PGC specification in these two fish species. Results In this study we addressed the question concerning the mode of PGC specification in medaka using embryological experiments, analysis of RNA stability in the PGCs and electron microscopy observations. Dramatic alterations in the somatic environment, i.e. induction of a secondary axis or mesoderm formation alteration, did not affect the PGC number. Furthermore, the PGCs of medaka are capable of protecting specific RNA molecules from degradation and could therefore exhibit a specific mRNA expression pattern controlled by posttrancriptional mechanisms. Subsequent analysis of 4-cell stage medaka embryos using electron microscopy revealed germ plasm-like structures located at a region corresponding to that of zebrafish germ plasm. Conclusion Taken together, these results are consistent with the idea that in medaka the inheritance of

  9. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  10. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Stability of wheat germ oil obtained by supercritical carbon dioxide ...

    African Journals Online (AJOL)

    심정은

    accumulated gas volume passing through the apparatus were measured using a gas flow meter. Wheat germ oil was ..... of rancidity in wheat germ analyzed by headspace gas chromatography and sensory analysis. J. Agric. Food Chem.

  12. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  13. Radiotherapy of patients with germ cell tumor

    International Nuclear Information System (INIS)

    Inomata, Taisuke; Maeda, Tomoho; Yoshida, Shoji; Ogawa, Yasuhiro; Hamada, Fumio; Imajo, Yoshinari; Gose, Kyuhei; Fujiwara, Kiyoshi.

    1986-01-01

    Twenty-one patients with germ cell tumor who received radiotherapy were discussed. There were eight patients with germinoma, two patients with malignant teratoma, three patients with pineocytoma (out of category of germ cell tumor today) and eight unverified patients. Irradiated dose was mostly from 50 Gy to 60 Gy and local irradiation was performed after whole brain irradiation in many cases. The effect of radiotherapy was not so good in patients with malignant teratoma. On the contrary, it was relatively good in patients with germinoma and five out of eight patients are alive with no symptoms of recurrence. Six out of eight unverified patients are also alive. Among them, several patients with germinoma are considered to be included. Germinoma occupies many cases of germ cell tumor and has a good response to radiotherapy. Against spinal cord metastasis and late recurrence, additional therapy, such as chemotherapy, seems to be useful to improve cure ratio. (author)

  14. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  15. Colonization of germ-free mice with a mixture of three lactobacillus strains enhances the integrity of gut mucosa and ameliorates allergic sensitization

    Czech Academy of Sciences Publication Activity Database

    Kozáková, Hana; Schwarzer, Martin; Tučková, Ludmila; Šrůtková, Dagmar; Czarnowska, E.; Rosiak, I.; Hudcovic, Tomáš; Schabussova, I.; Hermanová, Petra; Zákostelská, Zuzana; Aleksandrzak-Piekarczyk, T.; Koryszewska-Baginska, A.; Tlaskalová-Hogenová, Helena; Cukrowska, B.

    2016-01-01

    Roč. 13, č. 2 (2016), s. 251-262 ISSN 1672-7681 R&D Projects: GA ČR(CZ) GAP304/11/1252; GA ČR GA303/09/0449; GA MŠk 7AMB15AT025 Institutional support: RVO:61388971 Keywords : allergic sensitization * germ-free * intestinal barrier Subject RIV: EC - Immunology Impact factor: 5.897, year: 2016

  16. Lack of GNAQ and GNA11 germ-line mutations in familial melanoma pedigrees with uveal melanoma or blue nevi

    Directory of Open Access Journals (Sweden)

    Jason Ezra Hawkes

    2013-06-01

    Full Text Available Approximately 10% of melanoma cases are familial, but only 25-40% of familial melanoma cases can be attributed to germ-line mutations in the CDKN2A - the most significant high-risk melanoma susceptibility locus identified to date. The pathogenic mutation(s in most of the remaining familial melanoma pedigrees have not yet been identified. The most common mutations in nevi and sporadic melanoma are found in BRAF and NRAS, both of which result in constitutive activation of the MAPK pathway. However, these mutations are not found in uveal melanomas or the intradermal melanocytic proliferations known as blue nevi. Rather, multiple studies report a strong association between these lesions and somatic mutations in Guanine nucleotide-binding protein G(q subunit alpha (GNAQ, Guanine nucleotide-binding protein G(q subunit alpha-11 (GNA11 and BRCA1 associated protein-1 (BAP1. Recently, germ-line mutations in BAP1, the gene encoding a tumor suppressing deubiquitinating enzyme, have been associated with predisposition to a variety of cancers including uveal melanoma, but no studies have examined the association of germ-line mutations in GNAQ and GNA11 with uveal melanoma and blue nevi. We have now done so by sequencing exon 5 of both of these genes in 13 unique familial melanoma pedigrees, members of which have had either uveal or cutaneous melanoma and/or blue nevi. Germ-line DNA from a total of 22 individuals was used for sequencing; however no deleterious mutations were detected. Nevertheless, such candidate gene studies and the discovery of novel germ-line mutations associated with an increased MM susceptibility can lead to a better understanding of the pathways involved in melanocyte transformation, formulation of risk assessment, and the development of specific drug therapies.

  17. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  19. Wheat Germ Oil Attenuates Gamma Radiation- Induced Skeletal Muscles Damage in Rats

    International Nuclear Information System (INIS)

    Said, U.Z.; Saada, H.N.; Shedid, Sh.M.; Mahdy, E.M.E.; Shousha, W.Gh.

    2008-01-01

    Muscular strength is important in sport as well as in daily activities. Exposure to ionizing radiation is thought to increase oxidative stress and damage muscle tissue. Wheat germ oil is a natural unrefined vegetable oil. It is an excellent source of vitamin E, octacosanol, linoleic and linolenic essential fatty acids, which may be beneficial in neutralizing the free oxygen radicals. The present study was designed to investigate the efficacy of wheat germ oil, on radiation-induced oxidative damage in rats skeletal muscle. Wheat germ oil was supplemented orally via gavages to rats at a dose of 54 mg/ kg body weight/day for 14 successive days pre- and 7 post-exposure to 5 Gy (one shot dose) of whole body gamma irradiation. Animals were sacrificed 7, 14 and 21 days post radiation exposure. The results revealed that whole body gamma-irradiation of rats induces oxidative stress in skeletal muscles obvious by significant elevation in the level of thiobarbituric acid reactive substances (TBARS) associated with significant decreases in the content of reduced glutathione (GSE1), as well as decreases in superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) activities. Irradiated rats showed, also, significant decreases in creatine phosphokinase (CPK), glutamate dehydrogenase (GDH) and glucose-6-phosphate dehydrogenase (G-6-PD) activities. Furthermore, total iron, total copper and total calcium levels were significantly increased in skeletal muscles of irradiated rats group compared to control group. Wheat germ oil treated-irradiated rats showed significantly less sever damage and remarkable improvement in all the measured parameters, compared to irradiated rats. It could be concluded that wheat germ oil by attenuating radiation induced oxidative stress might play a role in maintaining skeletal muscle integrity

  20. Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

    International Nuclear Information System (INIS)

    Dessen, E.M.B.; Perondini, A.L.P.

    1979-01-01

    Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

  1. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  2. Tre1, a G protein-coupled receptor, directs transepithelial migration of Drosophila germ cells.

    Directory of Open Access Journals (Sweden)

    Prabhat S Kunwar

    2003-12-01

    Full Text Available In most organisms, germ cells are formed distant from the somatic part of the gonad and thus have to migrate along and through a variety of tissues to reach the gonad. Transepithelial migration through the posterior midgut (PMG is the first active step during Drosophila germ cell migration. Here we report the identification of a novel G protein-coupled receptor (GPCR, Tre1, that is essential for this migration step. Maternal tre1 RNA is localized to germ cells, and tre1 is required cell autonomously in germ cells. In tre1 mutant embryos, most germ cells do not exit the PMG. The few germ cells that do leave the midgut early migrate normally to the gonad, suggesting that this gene is specifically required for transepithelial migration and that mutant germ cells are still able to recognize other guidance cues. Additionally, inhibiting small Rho GTPases in germ cells affects transepithelial migration, suggesting that Tre1 signals through Rho1. We propose that Tre1 acts in a manner similar to chemokine receptors required during transepithelial migration of leukocytes, implying an evolutionarily conserved mechanism of transepithelial migration. Recently, the chemokine receptor CXCR4 was shown to direct migration in vertebrate germ cells. Thus, germ cells may more generally use GPCR signaling to navigate the embryo toward their target.

  3. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Guns, Germs and Steel

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 1. Guns, Germs and Steel - A Short History of Everybody for the Last 13,000 years. Suri Venkatachalam. Book Review Volume 6 Issue 1 January 2001 pp 84-88. Fulltext. Click here to view fulltext PDF. Permanent link:

  5. FLI-1 Flightless-1 and LET-60 Ras control germ line morphogenesis in C. elegans

    Directory of Open Access Journals (Sweden)

    Dentler William L

    2008-05-01

    Full Text Available Abstract Background In the C. elegans germ line, syncytial germ line nuclei are arranged at the cortex of the germ line as they exit mitosis and enter meiosis, forming a nucleus-free core of germ line cytoplasm called the rachis. Molecular mechanisms of rachis formation and germ line organization are not well understood. Results Mutations in the fli-1 gene disrupt rachis organization without affecting meiotic differentiation, a phenotype in C. elegans referred to here as the germ line morphogenesis (Glm phenotype. In fli-1 mutants, chains of meiotic germ nuclei spanned the rachis and were partially enveloped by invaginations of germ line plasma membrane, similar to nuclei at the cortex. Extensions of the somatic sheath cells that surround the germ line protruded deep inside the rachis and were associated with displaced nuclei in fli-1 mutants. fli-1 encodes a molecule with leucine-rich repeats and gelsolin repeats similar to Drosophila flightless 1 and human Fliih, which have been shown to act as cytoplasmic actin regulators as well as nuclear transcriptional regulators. Mutations in let-60 Ras, previously implicated in germ line development, were found to cause the Glm phenotype. Constitutively-active LET-60 partially rescued the fli-1 Glm phenotype, suggesting that LET-60 Ras and FLI-1 might act together to control germ line morphogenesis. Conclusion FLI-1 controls germ line morphogenesis and rachis organization, a process about which little is known at the molecular level. The LET-60 Ras GTPase might act with FLI-1 to control germ line morphogenesis.

  6. Localisation of RNAs into the germ plasm of vitellogenic Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Sarbjit Nijjar

    Full Text Available We have studied the localisation of mRNAs in full-grown Xenopus laevis oocytes by injecting fluorescent RNAs, followed by confocal microscopy of the oocyte cortex. Concentrating on RNA encoding the Xenopus Nanos homologue, nanos1 (formerly Xcat2, we find that it consistently localised into aggregated germ plasm ribonucleoprotein (RNP particles, independently of cytoskeletal integrity. This implies that a diffusion/entrapment-mediated mechanism is active, as previously reported for previtellogenic oocytes. Sometimes this was accompanied by localisation into scattered particles of the "late", Vg1/VegT pathway; occasionally only late pathway localisation was seen. The Xpat RNA behaved in an identical fashion and for neither RNA was the localisation changed by any culture conditions tested. The identity of the labelled RNP aggregates as definitive germ plasm was confirmed by their inclusion of abundant mitochondria and co-localisation with the germ plasm protein Hermes. Further, the nanos1/Hermes RNP particles are interspersed with those containing the germ plasm protein Xpat. These aggregates may be followed into the germ plasm of unfertilized eggs, but with a notable reduction in its quantity, both in terms of injected molecules and endogenous structures. Our results conflict with previous reports that there is no RNA localisation in large oocytes, and that during mid-oogenesis even germ plasm RNAs localise exclusively by the late pathway. We find that in mid oogenesis nanos1 RNA also localises to germ plasm but also by the late pathway. Late pathway RNAs, Vg1 and VegT, also may localise into germ plasm. Our results support the view that mechanistically the two modes of localisation are extremely similar, and that in an injection experiment RNAs might utilise either pathway, the distinction in fates being very subtle and subject to variation. We discuss these results in relation to their biological significance and the results of others.

  7. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Science.gov (United States)

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  8. File list: Pol.Gon.05.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Gon.05.AllAg.Testicular_germ_cells mm9 RNA polymerase Gonad Testicular germ cel...ls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Gon.05.AllAg.Testicular_germ_cells.bed ...

  9. File list: DNS.Gon.05.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Gon.05.AllAg.Testicular_germ_cells mm9 DNase-seq Gonad Testicular germ cells ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/DNS.Gon.05.AllAg.Testicular_germ_cells.bed ...

  10. Non-germ cell tumours arising in germ cell tumours (teratoma with malignant transformation) in men: CT and MR findings

    Energy Technology Data Exchange (ETDEWEB)

    Athanasiou, A. [Department of Radiology, Institut Gustave-Roussy, Villejuif (France); Department of Radiology, Institut Curie, Paris (France)], E-mail: alexandra.athanasiou@curie.net; Vanel, D. [Department of Radiology, Institut Gustave-Roussy, Villejuif (France); Department of Radiology, Istituti Ortopedici Rizzoli, Bologna (Italy); El Mesbahi, O. [Department of Medicine, Institut Gustave-Roussy, Villejuif (France); Theodore, C. [Department of Medicine, Institut Gustave-Roussy, Villejuif (France); Department of Oncology, Hopital Foch, Suresnes (France); Fizazi, K. [Department of Medicine, Institut Gustave-Roussy, Villejuif (France)

    2009-02-15

    Purpose: To describe the imaging findings of germ cell tumours (GCT) containing non-germ cell malignant components (also designated teratoma with malignant transformation or TMT). Patients and methods: The records of 14 male patients with GCT and a non-germ cell histological component TMT were retrospectively reviewed. All patients had computed tomography (CT) and/or magnetic resonance (MR) studies before and after initial surgery and chemotherapy, as well as during follow-up. Imaging findings were correlated with the response to treatment and with overall survival. Pathological evaluation, immunohistochemistry, serum alpha-fetoprotein (AFP) and human chorionic gonadotropin (HCG) were also taken into consideration. Sarcoma was identified in 10 out of 14 patients, with rhabdomyosarcoma ranking first (n = 4), followed by osteosarcoma (n = 2), fusiform cell sarcoma (n = 1), undifferentiated sarcoma (n = 1), neurosarcoma (n = 1) and myxoid sarcoma (n = 1). Other histological types of malignant transformation included adenocarcinoma (n = 3) and bronchoalveolar carcinoma (n = 1). Overall, 9 patients relapsed at a median time of 84 months (range 60-168). Results: Non-GCT malignant transformation was identified in the retroperitoneum (5), testis (3), mediastinum (3), peritoneum (2) and lungs (1). The CT and MR imaging findings before treatment and after relapse were evaluated with emphasis on imaging features that could possibly imply the presence of malignant transformation (heterogeneously enhancing soft-tissue masses, ossified masses with calcified lymph nodes, diffuse epiploic thickening associated with ascites and peritoneal nodules, pulmonary alveolar infiltration with septal thickening). All but 1 patient with TMT presented with nodal and distant metastases. The prognosis was poor: within a median follow-up of 59 months (range 3-180), 4 out of 14 patients were alive. Conclusion: TMT is rare and associated with poorer survival compared to GCT. Imaging can be useful

  11. Preterm life in sterile conditions: a study on Preterm, germ-Free Piglets

    Czech Academy of Sciences Publication Activity Database

    Šplíchalová, Alla; Slavíková, Renata; Šplíchalová, Zdislava; Šplíchal, Igor

    2018-01-01

    Roč. 9, FEB 14 (2018), č. článku 220. ISSN 1664-3224 R&D Projects: GA ČR GA13-14736S Institutional support: RVO:61388971 Keywords : preterm * enterocyte * germ-free Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 6.429, year: 2016

  12. Characterization of germ cell-specific expression of the orphan nuclear receptor, germ cell nuclear factor.

    Science.gov (United States)

    Katz, D; Niederberger, C; Slaughter, G R; Cooney, A J

    1997-10-01

    Nuclear receptors, such as those for androgens, estrogens, and progesterones, control many reproductive processes. Proteins with structures similar to these receptors, but for which ligands have not yet been identified, have been termed orphan nuclear receptors. One of these orphans, germ cell nuclear factor (GCNF), has been shown to be germ cell specific in the adult and, therefore, may also participate in the regulation of reproductive functions. In this paper, we examine more closely the expression patterns of GCNF in germ cells to begin to define spatio-temporal domains of its activity. In situ hybridization showed that GCNF messenger RNA (mRNA) is lacking in the testis of hypogonadal mutant mice, which lack developed spermatids, but is present in the wild-type testis. Thus, GCNF is, indeed, germ cell specific in the adult male. Quantitation of the specific in situ hybridization signal in wild-type testis reveals that GCNF mRNA is most abundant in stage VII round spermatids. Similarly, Northern analysis and specific in situ hybridization show that GCNF expression first occurs in testis of 20-day-old mice, when round spermatids first emerge. Therefore, in the male, GCNF expression occurs postmeiotically and may participate in the morphological changes of the maturing spermatids. In contrast, female expression of GCNF is shown in growing oocytes that have not completed the first meiotic division. Thus, GCNF in the female is expressed before the completion of meiosis. Finally, the nature of the two different mRNAs that hybridize to the GCNF complementary DNA was studied. Although both messages contain the DNA binding domain, only the larger message is recognized by a probe from the extreme 3' untranslated region. In situ hybridization with these differential probes demonstrates that both messages are present in growing oocytes. In addition, the coding region and portions of the 3' untranslated region of the GCNF complementary DNA are conserved in the rat.

  13. File list: Oth.Gon.20.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Gon.20.AllAg.Testicular_germ_cells mm9 TFs and others Gonad Testicular germ cel...ls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Gon.20.AllAg.Testicular_germ_cells.bed ...

  14. File list: Oth.Gon.10.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Gon.10.AllAg.Testicular_germ_cells mm9 TFs and others Gonad Testicular germ cel...ls http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Gon.10.AllAg.Testicular_germ_cells.bed ...

  15. Dafachronic acid inhibits C. elegans germ cell proliferation in a DAF-12-dependent manner.

    Science.gov (United States)

    Mukherjee, Madhumati; Chaudhari, Snehal N; Balachandran, Riju S; Vagasi, Alexandra S; Kipreos, Edward T

    2017-12-15

    Dafachronic acid (DA) is a bile acid-like steroid hormone that regulates dauer formation, heterochrony, and lifespan in C. elegans. Here, we describe that DA is an inhibitor of C. elegans germ stem cell proliferation in adult hermaphrodites. Using a C. elegans germ cell primary culture system, we show that DA inhibits the proliferation of germ cells in vitro. Exogenous DA reduces the frequency of large tumors in adult tumorous germline mutants and decreases the proliferation of wild-type germ stem cells in adult hermaphrodites. In contrast, DA has no appreciable effect on the proliferation of larval-stage germ cells in wild type. The inhibition of adult germ cell proliferation by DA requires its canonical receptor DAF-12. Blocking DA production by inactivating the cytochrome P450 DAF-9 increases germ cell proliferation in wild-type adult hermaphrodites and the frequency of large tumors in germline tumorous mutants, suggesting that DA inhibits the rate of germ cell proliferation under normal growth conditions. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  17. Insights into female germ cell biology: from in vivo development to in vitro derivations.

    Science.gov (United States)

    Jung, Dajung; Kee, Kehkooi

    2015-01-01

    Understanding the mechanisms of human germ cell biology is important for developing infertility treatments. However, little is known about the mechanisms that regulate human gametogenesis due to the difficulties in collecting samples, especially germ cells during fetal development. In contrast to the mitotic arrest of spermatogonia stem cells in the fetal testis, female germ cells proceed into meiosis and began folliculogenesis in fetal ovaries. Regulations of these developmental events, including the initiation of meiosis and the endowment of primordial follicles, remain an enigma. Studying the molecular mechanisms of female germ cell biology in the human ovary has been mostly limited to spatiotemporal characterizations of genes or proteins. Recent efforts in utilizing in vitro differentiation system of stem cells to derive germ cells have allowed researchers to begin studying molecular mechanisms during human germ cell development. Meanwhile, the possibility of isolating female germline stem cells in adult ovaries also excites researchers and generates many debates. This review will mainly focus on presenting and discussing recent in vivo and in vitro studies on female germ cell biology in human. The topics will highlight the progress made in understanding the three main stages of germ cell developments: namely, primordial germ cell formation, meiotic initiation, and folliculogenesis.

  18. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  19. Novel soy germ pasta enriched in isoflavones ameliorates gastroparesis in type 2 diabetes: a pilot study.

    Science.gov (United States)

    Setchell, Kenneth D R; Nardi, Elisabetta; Battezzati, Pier-Maria; Asciutti, Stefania; Castellani, Danilo; Perriello, Gabriele; Clerici, Carlo

    2013-11-01

    To determine the effect of soy germ pasta enriched in biologically active isoflavone aglycons on gastric emptying in type 2 diabetic patients with gastroparesis. This randomized double-blind, placebo-controlled study compared soy germ pasta with conventional pasta for effects on gastric emptying. Patients (n = 10) with delayed gastric emptying consumed one serving per day of each pasta for 8 weeks, with a 4-week washout. Gastric emptying time (t1/2) was measured using the [(13)C]octanoic acid breath test at baseline and after each period, and blood glucose and insulin concentrations were determined after oral glucose load. Soy germ pasta significantly accelerated the t1/2 in these patients (161.2 ± 17.5 min at baseline vs. 112.6 ± 11.2 min after treatment, P = 0.009). Such change differed significantly (P = 0.009) from that for conventional pasta (153.6 ± 24.2 vs. 156.2 ± 27.4 min), without affecting glucose or insulin concentrations. These findings suggest that soy germ pasta may offer a simple dietary approach to managing diabetic gastropathy.

  20. Childhood Central Nervous System Germ Cell Tumors Treatment (PDQ®)—Patient Version

    Science.gov (United States)

    Childhood central nervous system (CNS) germ cell tumors form from germ cells (a type of cell that forms as a fetus develops and later becomes sperm in the testicles or eggs in the ovaries). Learn about the signs, tests to diagnose, and treatment of pediatric germ cell tumors in the brain in this expert-reviewed summary.

  1. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  2. Generation of juvenile rainbow trout derived from cryopreserved whole ovaries by intraperitoneal transplantation of ovarian germ cells.

    Science.gov (United States)

    Lee, Seungki; Katayama, Naoto; Yoshizaki, Goro

    2016-09-23

    Cryopreservation of fish sperm offers the practical applications in the selective breeding and biodiversity conservation. However, because of the lack of cryopreservation methods for fish eggs and embryos, maternally inherited cytoplasmic compartments cannot be successfully preserved. We previously developed an alternative method to derive functional eggs and sperm from cryopreserved whole testis by transplanting testicular cells into female and male recipients. However, if target fish had ovaries, the previous method employing male-derived germ cells would be ineffective. Here, we aimed to generate functional gametes from cryopreserved whole ovaries by transplanting ovarian germ cells into peritoneal cavity of sterile hatchlings. Cryopreservation conditions for rainbow trout ovaries (1.0 M DMSO, 0.1 M trehalose, and 10% egg yolk) were optimized by testing several different cryoprotective agents. Ovarian germ cells from thawed ovaries were intraperitoneally transplanted into allogeneic triploid hatchlings. Transplanted germ cells migrated toward and were incorporated into recipient gonads, where they underwent gametogenesis. Transplantation efficiency of ovarian germ cells remained stable after cryopreservation period up to 1185 days. Although all triploid recipients that did not undergo transplantation were functionally sterile, 5 of 25 female recipients and 7 of 25 male recipients reached sexual maturity at 2.5 years post-transplantation. Inseminating the resultant eggs and sperm generated viable offspring displaying the donor characteristics of orange body color, green fluorescence, and chromosome numbers. This method is thus a breakthrough tool for the conservation of endangered fish species that are crucial to cryopreserve the genetic resources of female fish. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Isolation and purification of wheat germ agglutinin and analysis of its properties

    Science.gov (United States)

    Wang, Han

    2017-12-01

    In this paper, the wheat germ agglutinin was isolated and purified by affinity chromatography of chicken ovomucoid as ligand. The physicochemical properties were analyzed. The chicken ovomucoid was isolated from egg white and conjugated to affinity chromatography column agarose gel to prepare affinity adsorbent. The crude extract of wheat germ was freezedried by affinity chromatography. The physicochemical properties were analyzed by SDSpolyacrylamide gel electrophoresis and isoelectric focusing electrophoresis. And the relative molecular mass and isoelectric point of wheat germ agglutinin were obtained, and the high efficiency of purification of wheat germ agglutinin was proved by affinity chromatography.

  4. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    International Nuclear Information System (INIS)

    Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji

    2007-01-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21

  5. Chlamydospore production and germ-tube formation by auxotrophs of Candida albicans.

    Science.gov (United States)

    Balish, E

    1973-04-01

    A prototrophic strain and 21 auxotrophic strains of Candida albicans were assessed for their capacity to produce chlamydospores and germ tubes. All of the mutants were able to produce germ-tubes in human serum but only two mutants produced them in defined medium with L-alpha-amino-n-butyric acid as the sole source of nitrogen. Most auxotrophs were not able to produce chlamydospores on corn meal agar with 1% Tween 80, but they could be induced to do so if the medium was supplemented with their growth requirement(s). Although L-cysteine was able to support the growth of two methionine mutants, it did not support chlamydospore formation when added to corn meal agar with 1% Tween 80. Mutants of C. albicans that do not form chlamydospores could be incorrectly identified in laboratories that rely on chlamydospore formation for identification.

  6. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  7. Mitochondrial 12S ribosomal RNA A1555G mutation associated with cardiomyopathy and hearing loss following high-dose chemotherapy and repeated aminoglycoside exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... of febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

  8. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites.

    Science.gov (United States)

    Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas

    2017-12-15

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Primordial germ cells and amnion development in the avian embryo

    NARCIS (Netherlands)

    De Melo Bernardo, Ana

    2016-01-01

    Primordial germ cells (PGCs) are the progenitors of the gametes, responsible for transmitting genetic information from generation to generation. Although there is a long history of gamete biology research, there is still a lot to be learned about many of the mechanisms underlying germ cell

  10. Editorial Introduction [to Female Germ Cells: Biology and Genetic Risk

    Science.gov (United States)

    This is an editorial introduction to the special issue of utation Research, titled, emale Germ Cells: Biology and Genetic isk, which is an attempt to present a collection of papers that emphasize the distinct properties of female germ cells and their characteristic response to mu...

  11. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

    Science.gov (United States)

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

    2012-12-18

    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  12. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    Energy Technology Data Exchange (ETDEWEB)

    Svergun, D.I.; Koch, M.H.J. [Hamburg Outstation (Germany); Pedersen, J.S. [Riso National Laboratory, Roskilde (Denmark); Serdyuk, I.N. [Inst. of Protein Research, Moscow (Russian Federation)

    1994-12-31

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA.

  13. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    International Nuclear Information System (INIS)

    Svergun, D.I.; Koch, M.H.J.; Pedersen, J.S.; Serdyuk, I.N.

    1994-01-01

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA

  14. Post-translational modification of ribosomally synthesized peptides by a radical SAM epimerase in Bacillus subtilis

    Science.gov (United States)

    Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier

    2017-07-01

    Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.

  15. Differentiation of primordial germ cells from induced pluripotent stem cells of primary ovarian insufficiency.

    Science.gov (United States)

    Leng, Lizhi; Tan, Yueqiu; Gong, Fei; Hu, Liang; Ouyang, Qi; Zhao, Yan; Lu, Guangxiu; Lin, Ge

    2015-03-01

    , POI2-iPS-V.1 and hEF-iPS-V.1 produced green fluorescent cells in the differentiated cultures, and the percentage of GFP-positive cells increased over the 12 days of differentiation to a maximum of 6.9 ± 0.33%, 5.3 ± 0.57% and 8.5 ± 0.29%, respectively, of the total cell population. Immunohistochemical analysis confirmed that endogenous VASA was enriched in the GFP-positive cells. Quantitative reverse transcription-PCR revealed significantly higher expression of germ cell markers [PR domain containing 1, with ZNF domain (PRDM1, BLIMP1), developmental pluripotency-associated 3 (DPPA3, STELLA), deleted in azoospermia-like (DAZL), and VASA (DDX4)] in GFP-positive cells than in GFP-negative cells. Moreover, the GFP-positive cells from POI-iPSCs had reduced expression of the family with sequence similarity 122C (FAM122C), inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), and RNA binding motif protein, X-linked (RBMX), genes located in the deleted region of the X chromosome and that are highly expressed in differentiated germ cells, compared with cells from normal iPSCs. Gene expression profiling indicated that the germ cells differentiated from POI-iPSCs were pre-meiotic. Therefore, how the differentiated primordial germ cells could progress further to meiosis and form follicles remains to be determined in the study of POI. Our results might provide an in vitro model for studying germ cell development in patients with POI. This work was supported by grants from the Major State Basic Research Development Program of China (No. 2012CB944901), the National Science Foundation of China (No. 81222007 and 81471432), the Program for New Century Excellent Talents in University and the Fundamental Research Funds for Central Universities (No. 721500003). The authors have no competing interests to declare. Not applicable. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology

  16. Early imaging findings in germ cell tumors arising from the basal ganglia

    International Nuclear Information System (INIS)

    Lee, So Mi; Kim, In-One; Choi, Young Hun; Cheon, Jung-Eun; Kim, Woo Sun; Cho, Hyun-Hae; You, Sun Kyoung

    2016-01-01

    It is difficult to diagnosis early stage germ cell tumors originating in the basal ganglia, but early recognition is important for better outcome. To evaluate serial MR images of basal ganglia germ cell tumors, with emphasis on the features of early stage tumors. We retrospectively reviewed serial MR images of 15 tumors in 14 children and young adults. We categorized MR images of the tumors as follows: type I, ill-defined patchy lesions (<3 cm) without cyst; type II, small mass lesions (<3 cm) with cyst; and type III, large lesions (≥3 cm) with cyst. We also assessed temporal changes of the MR images. On the initial images, 8 of 11 (73%) type I tumors progressed to types II or III, and 3 of 4 (75%) type II tumors progressed to type III. The remaining 4 tumors did not change in type. All type II tumors (5/5, 100%) that changed from type I had a few tiny cysts. Intratumoral hemorrhage was observed even in the type I tumor. Ipsilateral hemiatrophy was observed in most of the tumors (13/15, 87%) on initial MR images. As tumors grew, cystic changes, intratumoral hemorrhage, and ipsilateral hemiatrophy became more apparent. Early stage basal ganglia germ cell tumors appear as ill-defined small patchy hyperintense lesions without cysts on T2-weighted images, are frequently associated with ipsilateral hemiatrophy, and sometimes show microhemorrhage. Tumors develop tiny cysts at a relatively early stage. (orig.)

  17. Early imaging findings in germ cell tumors arising from the basal ganglia

    Energy Technology Data Exchange (ETDEWEB)

    Lee, So Mi [Seoul National University College of Medicine, Department of Radiology, 101 Daehak-ro, Jongno-gu, Seoul (Korea, Republic of); Kyungpook National University Medical Center, Department of Radiology, Daegu (Korea, Republic of); Kim, In-One; Choi, Young Hun; Cheon, Jung-Eun; Kim, Woo Sun [Seoul National University College of Medicine, Department of Radiology and Institute of Radiation Medicine, 101 Daehak-ro, Jongno-gu, Seoul (Korea, Republic of); Cho, Hyun-Hae [Seoul National University College of Medicine, Department of Radiology, 101 Daehak-ro, Jongno-gu, Seoul (Korea, Republic of); Ewha Woman' s University Mokdong Hospital, Department of Radiology, Seoul (Korea, Republic of); You, Sun Kyoung [Seoul National University College of Medicine, Department of Radiology, 101 Daehak-ro, Jongno-gu, Seoul (Korea, Republic of); Chungnam National University Hospital, Department of Radiology, Daejeon (Korea, Republic of)

    2016-05-15

    It is difficult to diagnosis early stage germ cell tumors originating in the basal ganglia, but early recognition is important for better outcome. To evaluate serial MR images of basal ganglia germ cell tumors, with emphasis on the features of early stage tumors. We retrospectively reviewed serial MR images of 15 tumors in 14 children and young adults. We categorized MR images of the tumors as follows: type I, ill-defined patchy lesions (<3 cm) without cyst; type II, small mass lesions (<3 cm) with cyst; and type III, large lesions (≥3 cm) with cyst. We also assessed temporal changes of the MR images. On the initial images, 8 of 11 (73%) type I tumors progressed to types II or III, and 3 of 4 (75%) type II tumors progressed to type III. The remaining 4 tumors did not change in type. All type II tumors (5/5, 100%) that changed from type I had a few tiny cysts. Intratumoral hemorrhage was observed even in the type I tumor. Ipsilateral hemiatrophy was observed in most of the tumors (13/15, 87%) on initial MR images. As tumors grew, cystic changes, intratumoral hemorrhage, and ipsilateral hemiatrophy became more apparent. Early stage basal ganglia germ cell tumors appear as ill-defined small patchy hyperintense lesions without cysts on T2-weighted images, are frequently associated with ipsilateral hemiatrophy, and sometimes show microhemorrhage. Tumors develop tiny cysts at a relatively early stage. (orig.)

  18. Immature germ cells in semen - correlation with total sperm count and sperm motility.

    Science.gov (United States)

    Patil, Priya S; Humbarwadi, Rajendra S; Patil, Ashalata D; Gune, Anita R

    2013-07-01

    Current data regarding infertility suggests that male factor contributes up to 30% of the total cases of infertility. Semen analysis reveals the presence of spermatozoa as well as a number of non-sperm cells, presently being mentioned in routine semen report as "round cells" without further differentiating them into leucocytes or immature germ cells. The aim of this work was to study a simple, cost-effective, and convenient method for differentiating the round cells in semen into immature germ cells and leucocytes and correlating them with total sperm counts and motility. Semen samples from 120 males, who had come for investigation for infertility, were collected, semen parameters recorded, and stained smears studied for different round cells. Statistical analysis of the data was done to correlate total sperm counts and sperm motility with the occurrence of immature germ cells and leucocytes. The average shedding of immature germ cells in different groups with normal and low sperm counts was compared. The clinical significance of "round cells" in semen and their differentiation into leucocytes and immature germ cells are discussed. Round cells in semen can be differentiated into immature germ cells and leucocytes using simple staining methods. The differential counts mentioned in a semen report give valuable and clinically relevant information. In this study, we observed a negative correlation between total count and immature germ cells, as well as sperm motility and shedding of immature germ cells. The latter was statistically significant with a P value 0.000.

  19. CT and MRI of germ-cell tumors with metastasis or multi-located tumors

    International Nuclear Information System (INIS)

    Miyagami, Mitsusuke; Tazoe, Makoto; Tsubokawa, Takashi

    1989-01-01

    Twenty-seven cases of germ-cell tumors were examined with a CT scan in our clinic. In the 11 cases of metastasis or multi-localized tumors, the CT findings were studied in connection with the MRI findings. There were 6 cases of germ-cell tumors which had broad infiltrating tumors with multiple lesions on first admission. Their tumor sites were different from that in cases of malignant glioma, being frequently localized in the pineal and/or the suprasellar region, on the wall of the third and/or lateral ventricle, and in the region of the basal ganglia. Five of the cases of germ-cell tumors had metastasis with various patterns connected to a remote area - that is, to spinal cords, to the ventricular wall and basal cistern of the brain stem by CSF dissemination, to a lung by hematogeneous metastasis, and to the peritoneal wall or organs by a V-P shunt. The CT findings of germ-cell tumors were correlated mainly with the results of the histological diagnosis; they were found not to differ with the tumor site. The germinoma in the suprasellar region had less calcification than in the pineal region. Cysts, calcification, and an enlargement of the lateral ventricle on the tumor side were frequently seen in the germinoma of the basal ganglia. On the MRI of 5 cases of germinoma, the T 1 -weighted image revealed a slightly low or iso signal intensity, while the T 2 -weighted image showed a high signal intensity. In the case of multiple tumor lesions, some cases demonstrated different CT findings and radiosensitivities for each tumor. The possibility of a multicentric origin for the tumors is thus suggested in some cases of germ-cell tumors. (author)

  20. Exome Sequencing of Bilateral Testicular Germ Cell Tumors Suggests Independent Development Lineages

    Directory of Open Access Journals (Sweden)

    Sigmund Brabrand

    2015-02-01

    Full Text Available Intratubular germ cell neoplasia, the precursor of testicular germ cell tumors (TGCTs, is hypothesized to arise during embryogenesis from developmentally arrested primordial germ cells (PGCs or gonocytes. In early embryonal life, the PGCs migrate from the yolk sac to the dorsal body wall where the cell population separates before colonizing the genital ridges. However, whether the malignant transformation takes place before or after this separation is controversial. We have explored the somatic exome-wide mutational spectra of bilateral TGCT to provide novel insight into the in utero critical time frame of malignant transformation and TGCT pathogenesis. Exome sequencing was performed in five patients with bilateral TGCT (eight tumors, of these three patients in whom both tumors were available (six tumors and two patients each with only one available tumor (two tumors. Selected loci were explored by Sanger sequencing in 71 patients with bilateral TGCT. From the exome-wide mutational spectra, no identical mutations in any of the three bilateral tumor pairs were identified. Exome sequencing of all eight tumors revealed 87 somatic non-synonymous mutations (median 10 per tumor; range 5-21, some in already known cancer genes such as CIITA, NEB, platelet-derived growth factor receptor α (PDGFRA, and WHSC1. SUPT6H was found recurrently mutated in two tumors. We suggest independent development lineages of bilateral TGCT. Thus, malignant transformation into intratubular germ cell neoplasia is likely to occur after the migration of PGCs. We reveal possible drivers of TGCT pathogenesis, such as mutated PDGFRA, potentially with therapeutic implications for TGCT patients.

  1. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    Science.gov (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  2. Generation of male differentiated germ cells from various types of stem cells.

    Science.gov (United States)

    Hou, Jingmei; Yang, Shi; Yang, Hao; Liu, Yang; Liu, Yun; Hai, Yanan; Chen, Zheng; Guo, Ying; Gong, Yuehua; Gao, Wei-Qiang; Li, Zheng; He, Zuping

    2014-06-01

    Infertility is a major and largely incurable disease caused by disruption and loss of germ cells. It affects 10-15% of couples, and male factor accounts for half of the cases. To obtain human male germ cells 'especially functional spermatids' is essential for treating male infertility. Currently, much progress has been made on generating male germ cells, including spermatogonia, spermatocytes, and spermatids, from various types of stem cells. These germ cells can also be used in investigation of the pathology of male infertility. In this review, we focused on advances on obtaining male differentiated germ cells from different kinds of stem cells, with an emphasis on the embryonic stem (ES) cells, the induced pluripotent stem (iPS) cells, and spermatogonial stem cells (SSCs). We illustrated the generation of male differentiated germ cells from ES cells, iPS cells and SSCs, and we summarized the phenotype for these stem cells, spermatocytes and spermatids. Moreover, we address the differentiation potentials of ES cells, iPS cells and SSCs. We also highlight the advantages, disadvantages and concerns on derivation of the differentiated male germ cells from several types of stem cells. The ability of generating mature and functional male gametes from stem cells could enable us to understand the precise etiology of male infertility and offer an invaluable source of autologous male gametes for treating male infertility of azoospermia patients. © 2014 Society for Reproduction and Fertility.

  3. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  4. Rescuing apoptotic neurons in Alzheimer’s disease using wheat germ agglutinin-conjugated and cardiolipin-conjugated liposomes with encapsulated nerve growth factor and curcumin

    Directory of Open Access Journals (Sweden)

    Kuo YC

    2015-04-01

    Full Text Available Yung-Chih Kuo, Ching-Chun Lin Department of Chemical Engineering, National Chung Cheng University, Chia-Yi, Taiwan, Republic of China Abstract: Liposomes with cardiolipin (CL and wheat germ agglutinin (WGA were developed to permeate the blood–brain barrier and treat Alzheimer’s disease. WGA-conjugated and CL-incorporated liposomes (WGA-CL-liposomes were used to transport nerve growth factor (NGF and curcumin (CUR across a monolayer of human brain-microvascular endothelial cells regulated by human astrocytes and to protect SK-N-MC cells against apoptosis induced by ß-amyloid1–42 (Aß1–42 fibrils. An increase in the CL mole percentage in lipids increased the liposomal diameter, absolute zeta potential value, entrapment efficiency of NGF and CUR, release of NGF, biocompatibility, and viability of SK-N-MC cells with Aß1–42, but decreased the atomic ratio of nitrogen to phosphorus and release of CUR. In addition, an increase in the WGA concentration for grafting enhanced the liposomal diameter, atomic ratio of nitrogen to phosphorus, and permeability of NGF and CUR across the blood–brain barrier, but reduced the absolute zeta potential value and biocompatibility. WGA-CL-liposomes carrying NGF and CUR could be promising colloidal delivery carriers for future clinical application in targeting the blood–brain barrier and inhibiting neurotoxicity. Keywords: Alzheimer’s disease, nerve growth factor, curcumin, wheat germ agglutinin, cardiolipin, liposome

  5. Pathogenesis of germ cell neoplasia in testicular dysgenesis and disorders of sex development

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Lindhardt Johansen, Marie; Juul, Anders

    2015-01-01

    in individuals with 46,XY DSD. We summarise knowledge concerning development and sex differentiation of human gonads, with focus on sex-dimorphic steps of germ cell maturation, including meiosis. We also briefly outline the histopathology of germ cell neoplasia in situ (GCNIS) and gonadoblastoma (GDB), which......Development of human gonads is a sex-dimorphic process which evolved to produce sex-specific types of germ cells. The process of gonadal sex differentiation is directed by the action of the somatic cells and ultimately results in germ cells differentiating to become functional gametes through...

  6. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    2016-04-01

    Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.

  7. Multi-modality treatment in males with advanced malignant germ cell tumours

    International Nuclear Information System (INIS)

    Fossaa, S.D.; Klepp, O.; Ous, S.; Lien, H.; Stenwig, J.T.; Abeler, V.; Eliasson, G.; Hoest, H.

    1984-01-01

    After chemotherapy with cis-platinum, vinblastine and bleomycin, 33 surgical prosedures were performed in 29 patients with advanced malignant germ-cell tumours. The tumour masses could be completely resected macroscopially in 26 patients. Patients with fibros/necrosis or completely resected mature teratoma had an excellent prognosis, whereas only 5 of the 11 patients with vital malignant tumour survived in spite of second-line treatment with chemotherapy/radiotherapy. Preoperatively elevated serum levels of AFP, β-HCG and/or LDH indicated the presence of residual germ cell tumour. Eight of 14 patients were rendered tumour-free by radiotherapy given as second- or third-line treatment. In general, tumour masses, remaining after cis-platinum-based induction chemotherapy should be resected as completely as possible even in the case of mature teratoma or fibrosis/necrosis. Radiotherapy should be considered as second -and thirdline treatment

  8. File list: InP.Gon.10.AllAg.Testicular_germ_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Gon.10.AllAg.Testicular_germ_cells mm9 Input control Gonad Testicular germ cell.../dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Gon.10.AllAg.Testicular_germ_cells.bed ...

  9. Release of newly synthesized nucleoplasmic ribosomal subunits or their precursor particles from isolated nuclei of regenerating rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Usami, K; Ogata, K [Niigata Univ. (Japan). School of Medicine

    1930-06-16

    The authors present the time course of the labeling of RNA and protein moieties of these particles in vivo as well as the pattern of one-dimensional acrylamide gel electrophoresis of their protein moieties labeled with (/sup 35/S)methionine in vivo, which shows that released 60 S particles are newly synthesized ribosomal large subunits or their precursor particles in the nucleoplasm on their way from the nucleolus to the cytoplasm. It appears likely that released 40 S particles contain newly synthesized ribosomal small subunits or their precursors in the nucleoplasm.

  10. Human iPS Cell-Derived Germ Cells: Current Status and Clinical Potential

    Directory of Open Access Journals (Sweden)

    Tetsuya Ishii

    2014-10-01

    Full Text Available Recently, fertile spermatozoa and oocytes were generated from mouse induced pluripotent (iPS cells using a combined in vitro and in vivo induction system. With regard to germ cell induction from human iPS cells, progress has been made particularly in the male germline, demonstrating in vitro generation of haploid, round spermatids. Although iPS-derived germ cells are expected to be developed to yield a form of assisted reproductive technology (ART that can address unmet reproductive needs, genetic and/or epigenetic instabilities abound in iPS cell generation and germ cell induction. In addition, there is still room to improve the induction protocol in the female germline. However, rapid advances in stem cell research are likely to make such obstacles surmountable, potentially translating induced germ cells into the clinical setting in the immediate future. This review examines the current status of the induction of germ cells from human iPS cells and discusses the clinical potential, as well as future directions.

  11. Risk stratification for venous thromboembolism in patients with testicular germ cell tumors.

    Directory of Open Access Journals (Sweden)

    Angelika Bezan

    Full Text Available Patients with testicular germ cell tumors (TGCT have an increased risk for venous thromboembolism (VTE. We identified risk factors for VTE in this patient cohort and developed a clinical risk model.In this retrospective cohort study at the Medical University of Graz we included 657 consecutive TGCT patients across all clinical stages. A predictive model for VTE was developed and externally validated in 349 TGCT patients treated at the University Hospital Zurich.Venous thromboembolic events occurred in 34 (5.2% patients in the Graz cohort. In univariable competing risk analysis, higher clinical stage (cS and a retroperitoneal lymphadenopathy (RPLN were the strongest predictors of VTE (p<0.0001. As the presence of a RPLN with more than 5cm in greatest dimension without coexisting visceral metastases is classified as cS IIC, we constructed an empirical VTE risk model with the following four categories (12-month-cumulative incidence: cS IA-B 8/463 patients (1.7%, cS IS-IIB 5/86 patients (5.9%, cS IIC 3/21 patients (14.3% and cS IIIA-C 15/70 patients (21.4%. This risk model was externally validated in the Zurich cohort (12-month-cumulative incidence: cS IA-B (0.5%, cS IS-IIB (6.0%, cS IIC (11.1% and cS IIIA-C (19.1%. Our model had a significantly higher discriminatory performance than a previously published classifier (RPLN-VTE-risk-classifier which is based on the size of RPLN alone (AUC-ROC: 0.75 vs. 0.63, p = 0.007.According to our risk stratification, TGCT patients with cS IIC and cS III disease have a very high risk of VTE and may benefit from primary thromboprophylaxis for the duration of chemotherapy.

  12. Differentiation of Actinobacillus pleuropneumoniae strains by sequence analysis of 16S rDNA and ribosomal intergenic regions, and development of a species specific oligonucleotide for in situ detection

    DEFF Research Database (Denmark)

    Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.

    1998-01-01

    . The larger RIS's were different between the 3 species tested. The sequence of the 16S ribosomal gene was determined for 8 serotypes of A. pleuropneumoniae. These sequences showed only minor base differences, indicating a close genetic relatedness of these serotypes within the species. An oligonucleotide DNA...... probe designed from the 16S rRNA gene sequence of A. pleuropneumoniae was specific for all strains of the target species and did not cross react with A. lignieresii, the closest known relative of A. pleuropneumoniae. This species-specific DNA probe labeled with fluorescein was used for in situ......The aims of this study were to characterize and determine intraspecies and interspecies relatedness of Actinobacillus pleuropneumoniae to Actinobacillus lignieresii and Actinobacillus suis by sequence analysis of the ribosomal operon and to find a species-specific area for in situ detection of A...

  13. Sexual dimorphic expression of dnd in germ cells during sex reversal and its requirement for primordial germ cell survival in protogynous hermaphroditic grouper.

    Science.gov (United States)

    Sun, Zhi-Hui; Zhou, Li; Li, Zhi; Liu, Xiao-Chun; Li, Shui-Sheng; Wang, Yang; Gui, Jian-Fang

    2017-06-01

    Dead end (dnd), vertebrate-specific germ cell marker, had been demonstrated to be essential for primordial germ cell (PGC) migration and survival, and the link between PGC number and sex change had been revealed in some teleost species, but little is known about dnd in hermaphroditic vertebrates. In the present study, a protogynous hermaphroditic orange-spotted grouper (Epinephelus coioides) dnd homologue (Ecdnd) was identified and characterized. Quantitative real-time PCR and in situ hybridization analysis revealed a dynamic and sexually dimorphic expression pattern in PGCs and germ cells of gonads. During sex changing, the Ecdnd transcript sharply increased in early transitional gonad, reached the highest level at late transitional gonad stage, and decreased after testis maturation. Visualization of zebrafish PGCs by injecting with RFP-Ecdnd-3'UTR RNA and GFP-zfnanos3-3'UTR RNA confirmed importance of Ecdnd 3'UTR for the PGC distribution. In addition, knockdown of EcDnd by using antisense morpholinos (MO) caused the ablation of PGCs in orange-spotted grouper. Therefore, the current data indicate that Ecdnd is essential for PGCs survival and may serve as a useful germ cell marker during gametogenesis in hermaphroditic grouper. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  15. Utilization of 14C-labelled cellulose in conventional, germ-free and mono-associated rats

    International Nuclear Information System (INIS)

    Juhr, N.C.; Franke, J.; Ratsch, H.

    1987-01-01

    This report deals with the ultilization of 14 C-labelled cellulose in conventional, defined associated, and germ-free rats. With conventional animals 35.8% of the administered 14 C dose can be demonstrated in the exhaled air, 5.9% in organs, and 3.9% in the urine. 58.6% could be identified as not utilized in the intestinal and fecal contents. Animals mono-associated with Bacteroides succinogenes have about the same utilization rate. The appearance of 14 C in the exhaled air, in organs and the urine of germ-free animals is caused by a part of 14 C-labelled starch in the used test material. (author)

  16. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

    Science.gov (United States)

    Campbell, A J; Gasser, R B; Chilton, N B

    1995-03-01

    In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

  17. Impact of Coagulase-Negative Staphylococci and Other Germs on Sperm Forms

    Directory of Open Access Journals (Sweden)

    Ricardo Lozano-Hernández

    2017-08-01

    Full Text Available Coagulase-negative Staphylococci (CoNS is part of the microbiota of the male genitourinary tract, sometimes it has been considered as possible pathogenic microorganism. In the 5th version of sperm manual (WHO, 2010 sperm morphology criterion is very restricted to 4% of normal heads whereas David’s criterion evaluates several spermatic forms. The abnormalities of sperm forms were evaluated according to criteria of spermatic morphology: WHO and David in semen samples with bacterial concentrations ≤ 103, 104 and ≥ 105 CFU/mL of CoNS as of other bacteria. Spermogram, sperm culture and antibodies anti-Chlamydia trachomatis IgA detection in 281 semen samples men were performed. CoNS was the most frequent germ isolated in pure culture (9.25%. Semen samples with CoNS showed higher round cells and microcephalus forms by means of David’s criterion. CoNS in higher concentrations than 104 CFU/mL may have a negative impact on sperm cellularity, sperm head and probably on fertility.

  18. The ethics of germ line gene manipulation--a five dimensional debate.

    Science.gov (United States)

    Carter, Lucy

    2002-10-01

    Contributors to the debate surrounding the ethics of germ line gene manipulation have by and large concentrated their efforts on discussions of the potential risks that are associated with the use of this technology. Many international advisory committees have ruled out the acceptability of germ line gene manipulation at least for the time being. The purpose of this work is to generate much needed discussion on the many other ethical issues concerning the implementation of not only germ line gene manipulation but also other related biotechnologies. In this paper I systematically investigate and analyse the most salient issues put forward by proponents and opponents alike. I argue that if germ line manipulation proves to be a safe and effective procedure, then the principle of beneficence imposes on the medical profession a moral duty to pursue the technology.

  19. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller

    2014-09-01

    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  20. Several genes encoding ribosomal proteins are over-expressed in prostate-cancer cell lines: confirmation of L7a and L37 over-expression in prostate-cancer tissue samples.

    Science.gov (United States)

    Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T

    1998-09-25

    A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.

  1. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  2. The early human germ cell lineage does not express SOX2 during in vivo development or upon in vitro culture

    DEFF Research Database (Denmark)

    Perrett, Rebecca M; Turnpenny, Lee; Eckert, Judith J

    2008-01-01

    NANOG, POU5F1, and SOX2 are required by the inner cell mass of the blastocyst and act cooperatively to maintain pluripotency in both mouse and human embryonic stem cells. Inadequacy of any one of them causes loss of the undifferentiated state. Mouse primordial germ cells (PGCs), from which...... pluripotent embryonic germ cells (EGCs) are derived, also express POU5F1, NANOG, and SOX2. Thus, a similar expression profile has been predicted for human PGCs. Here we show by RT-PCR, immunoblotting, and immunohistochemistry that human PGCs express POU5F1 and NANOG but not SOX2, with no evidence...... of redundancy within the group B family of human SOX genes. Although lacking SOX2, proliferative human germ cells can still be identified in situ during early development and are capable of culture in vitro. Surprisingly, with the exception of FGF4, many stem cell-restricted SOX2 target genes remained detected...

  3. Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10

    International Nuclear Information System (INIS)

    Pereira, Larissa Miranda

    2009-01-01

    The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813 Q M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by β- sheet feature. (author)

  4. [Investigation of the effect of oil and flour from wheat germ meal on lipid metabolism of students and teachers of the university].

    Science.gov (United States)

    Rodionova, N S; Isaev, V A; Vishnyakov, A B; Popov, E S; Safonova, N V; Srorublyovtsev, S A

    2016-01-01

    The results of investigation of alimentary correction of lipid metabolism under the admin­istration of processed products from wheat germ - oil (with the content of policosanol at least 1.5-8.0 mg/100 g, vitamin E - 180-200 mg/100 g, PUFA - 60-65%) and cake flour (with the content of protein - 30-35%, oil with analogue composition -5-7%, digestible carbohydrates - 45-47%, fiber - 18-26%, vitamins B1, B3, B6, B9, E, PP, minerals and trace elements - Zn, Mn, K, Fe, Se, P) are presented. Volunteers among teachers and students of the university aged 16 to 65 years daily consumed wheat germ oil obtained by cold pressing in an amount of 3.5 g, regardless of the meal within 30 days. Then a part of them (30 persons) consumed daily 50 g of oil cake obtained after pressing oil, which provided the intake of the same amount of oil (3.5 g). Lipid metabolism param­eters were monitored in experiment participants before receiving the processed products of wheat germ, after germ meal intake and beyond 30 and 60 days after consumption of wheat germ. Data analysis was carried out on three age groups: 16-24, 25-44 and 45- 65 years. All participants of the experiment showed a reduction in total cholesterol level by 6-8%, increasing the concentration of HDL cholesterol by 3-24%, lowering LDL cholesterol concentrations by 4-21%, reduction of triglyceride concentration by 12-24%, a positive correction of atherogenic factor values by for 10-25%. Prolonged action of the investigated foods was established: lipid metabolism parameters in the tested group were better than in the control group after 30 days of intake discontinuation of oil or wheat germ flour, the positive adjustment effect disappeared 60 days after consuming the products. The findings demonstrate a positive effect on the normalization of lipid metabolism when cake flour of wheat germ was administered in daily food ration, similar to the effect of oil intake, which is important for the prevention of cardiovascular diseases

  5. Mice deficient in ribosomal protein S6 phosphorylation suffer from muscle weakness that reflects a growth defect and energy deficit.

    Directory of Open Access Journals (Sweden)

    Igor Ruvinsky

    Full Text Available BACKGROUND: Mice, whose ribosomal protein S6 cannot be phosphorylated due to replacement of all five phosphorylatable serine residues by alanines (rpS6(P-/-, are viable and fertile. However, phenotypic characterization of these mice and embryo fibroblasts derived from them, has established the role of these modifications in the regulation of the size of several cell types, as well as pancreatic beta-cell function and glucose homeostasis. A relatively passive behavior of these mice has raised the possibility that they suffer from muscle weakness, which has, indeed, been confirmed by a variety of physical performance tests. METHODOLOGY/PRINCIPAL FINDINGS: A large variety of experimental methodologies, including morphometric measurements of histological preparations, high throughput proteomic analysis, positron emission tomography (PET and numerous biochemical assays, were used in an attempt to establish the mechanism underlying the relative weakness of rpS6(P-/- muscles. Collectively, these experiments have demonstrated that the physical inferiority appears to result from two defects: a a decrease in total muscle mass that reflects impaired growth, rather than aberrant differentiation of myofibers, as well as a diminished abundance of contractile proteins; and b a reduced content of ATP and phosphocreatine, two readily available energy sources. The abundance of three mitochondrial proteins has been shown to diminish in the knockin mouse. However, the apparent energy deficiency in this genotype does not result from a lower mitochondrial mass or compromised activity of enzymes of the oxidative phosphorylation, nor does it reflect a decline in insulin-dependent glucose uptake, or diminution in storage of glycogen or triacylglycerol (TG in the muscle. CONCLUSIONS/SIGNIFICANCE: This study establishes rpS6 phosphorylation as a determinant of muscle strength through its role in regulation of myofiber growth and energy content. Interestingly, a similar

  6. Origin of pluripotent germ cell tumours: the role of microenvironment during embryonic development

    DEFF Research Database (Denmark)

    Kristensen, David Møbjerg; Sonne, Si Brask; Ottesen, Anne Marie

    2008-01-01

    into virtually any type of tissue and form teratomas (non-seminomas). CIS cells display a close phenotypic similarity to fetal germ cells (primordial germ cells or gonocytes) suggesting an origin due to a developmental delay or arrest of differentiation of early germ cells. The pluripotency of these neoplasms...... in several tissue specific stem cells, such as TFAP2C (AP-2gamma) or KIT. CIS and seminomas highly express a number of pre-meiotic germ cell specific genes, which are down-regulated during development to non-seminomas, while the expression of other embryonic markers, such as SOX2, is up...

  7. Germ-line gene therapy and the medical imperative.

    Science.gov (United States)

    Munson, Ronald; Davis, Lawrence H

    1992-06-01

    Somatic cell gene therapy has yielded promising results. If germ cell gene therapy can be developed, the promise is even greater: hundreds of genetic diseases might be virtually eliminated. But some claim the procedure is morally unacceptable. We thoroughly and sympathetically examine several possible reasons for this claim but find them inadequate. There is no moral reason, then, not to develop and employ germ-line gene therapy. Taking the offensive, we argue next that medicine has a prima facie moral obligation to do so.

  8. Testicular germ cell cancer incidence in an immigration perspective, Denmark, 1978 to 2003

    DEFF Research Database (Denmark)

    Schmiedel, Sven; Schüz, Joachim; Skakkebaek, Niels E

    2010-01-01

    The incidence rate of testicular germ cell cancer in Denmark increased up to the 1990s to become among the highest in the world. Since recently rate stabilization was suggested, we determined whether it is due to an increasing number of immigrants at lower risk for this cancer....

  9. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  10. Carcinoma in situ testis displays permissive chromatin modifications similar to immature foetal germ cells

    DEFF Research Database (Denmark)

    Almstrup, K; Nielsen, J E; Mlynarska, O

    2010-01-01

    The majority of testicular germ cell cancers develop through a pre-invasive carcinoma in situ (CIS) stage. The CIS cell is a neoplastic counterpart of foetal germ cells. During their development, foetal germ cells undergo extensive and essential epigenetic modifications, but little is known about...

  11. Diet Matters: Endotoxin in the Diet Impacts the Level of Allergic Sensitization in Germ-Free Mice.

    Directory of Open Access Journals (Sweden)

    Martin Schwarzer

    Full Text Available Germ-free animals have been used to define the vital role of commensal bacteria on the maturation of the host immune system. However, the role of bacterial residues in diet in this setting is poorly understood. Here we investigated the effect of bacterial contamination in sterile diet on the level of allergic sensitization in germ-free mice. Sterile grain-based diets ST1 and R03 were tested for the level of bacterial contamination. ST1 contained higher amount of bacterial DNA, approximately ten times more endotoxin, and induced higher, TLR4-dependent, cytokine production in dendritic cells compared to R03. In a germ-free mouse model of sensitization to the major birch pollen allergen Bet v 1, feeding on ST1 for at least two generations was associated with decreased production of allergen-specific IgE and IgG1 antibodies in sera in comparison to R03. Furthermore, reduced levels of allergen-specific and ConA-induced cytokines IL-4, IL-5 and IL-13 accompanied by increased levels of IFN-γ were detected in splenocytes cultures of these mice. Our results show that contamination of experimental diet with bacterial residues, such as endotoxin, significantly affects the development of allergic sensitization in germ-free mice. Therefore, careful selection of sterile food is critical for the outcomes of germ-free or gnotobiotic experimental models of immune-deviated diseases.

  12. Germ line mechanics – and unfinished business

    Science.gov (United States)

    Wessel, Gary M.

    2016-01-01

    Primordial germ cells are usually made early in the development of an organism. These are the mother of all stem cells that are necessary for propagation of the species, yet use highly diverse mechanisms between organisms. How they are specified, and when and where they form, are central to developmental biology. Using diverse organisms to study this development is illuminating for understanding the mechanics these cells use in this essential function, and for identifying the breadth of evolutionary changes that have occurred between species. This essay emphasizes how echinoderms may contribute to the patch-work quilt of our understanding of germ line formation during embryogenesis. PMID:26970000

  13. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  14. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  15. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  16. A landscape of germ line mutations in a cohort of inherited bone marrow failure patients.

    Science.gov (United States)

    Bluteau, Olivier; Sebert, Marie; Leblanc, Thierry; Peffault de Latour, Régis; Quentin, Samuel; Lainey, Elodie; Hernandez, Lucie; Dalle, Jean-Hugues; Sicre de Fontbrune, Flore; Lengline, Etienne; Itzykson, Raphael; Clappier, Emmanuelle; Boissel, Nicolas; Vasquez, Nadia; Da Costa, Mélanie; Masliah-Planchon, Julien; Cuccuini, Wendy; Raimbault, Anna; De Jaegere, Louis; Adès, Lionel; Fenaux, Pierre; Maury, Sébastien; Schmitt, Claudine; Muller, Marc; Domenech, Carine; Blin, Nicolas; Bruno, Bénédicte; Pellier, Isabelle; Hunault, Mathilde; Blanche, Stéphane; Petit, Arnaud; Leverger, Guy; Michel, Gérard; Bertrand, Yves; Baruchel, André; Socié, Gérard; Soulier, Jean

    2018-02-15

    Bone marrow (BM) failure (BMF) in children and young adults is often suspected to be inherited, but in many cases diagnosis remains uncertain. We studied a cohort of 179 patients (from 173 families) with BMF of suspected inherited origin but unresolved diagnosis after medical evaluation and Fanconi anemia exclusion. All patients had cytopenias, and 12.0% presented ≥5% BM blast cells. Median age at genetic evaluation was 11 years; 20.7% of patients were aged ≤2 years and 36.9% were ≥18 years. We analyzed genomic DNA from skin fibroblasts using whole-exome sequencing, and were able to assign a causal or likely causal germ line mutation in 86 patients (48.0%), involving a total of 28 genes. These included genes in familial hematopoietic disorders ( GATA2 , RUNX1 ), telomeropathies ( TERC , TERT , RTEL1 ), ribosome disorders ( SBDS , DNAJC21 , RPL5 ), and DNA repair deficiency ( LIG4 ). Many patients had an atypical presentation, and the mutated gene was often not clinically suspected. We also found mutations in genes seldom reported in inherited BMF (IBMF), such as SAMD9 and SAMD9L (N = 16 of the 86 patients, 18.6%), MECOM/EVI1 (N = 6, 7.0%), and ERCC6L2 (N = 7, 8.1%), each of which was associated with a distinct natural history; SAMD9 and SAMD9L patients often experienced transient aplasia and monosomy 7, whereas MECOM patients presented early-onset severe aplastic anemia, and ERCC6L2 patients, mild pancytopenia with myelodysplasia. This study broadens the molecular and clinical portrait of IBMF syndromes and sheds light on newly recognized disease entities. Using a high-throughput sequencing screen to implement precision medicine at diagnosis can improve patient management and family counseling. © 2018 by The American Society of Hematology.

  17. The diversity of nanos expression in echinoderm embryos supports different mechanisms in germ cell specification.

    Science.gov (United States)

    Fresques, Tara; Swartz, Steven Zachary; Juliano, Celina; Morino, Yoshiaki; Kikuchi, Mani; Akasaka, Koji; Wada, Hiroshi; Yajima, Mamiko; Wessel, Gary M

    2016-07-01

    Specification of the germ cell lineage is required for sexual reproduction in all animals. However, the timing and mechanisms of germ cell specification is remarkably diverse in animal development. Echinoderms, such as sea urchins and sea stars, are excellent model systems to study the molecular and cellular mechanisms that contribute to germ cell specification. In several echinoderm embryos tested, the germ cell factor Vasa accumulates broadly during early development and is restricted after gastrulation to cells that contribute to the germ cell lineage. In the sea urchin, however, the germ cell factor Vasa is restricted to a specific lineage by the 32-cell stage. We therefore hypothesized that the germ cell specification program in the sea urchin/Euechinoid lineage has evolved to an earlier developmental time point. To test this hypothesis we determined the expression pattern of a second germ cell factor, Nanos, in four out of five extant echinoderm clades. Here we find that Nanos mRNA does not accumulate until the blastula stage or later during the development of all other echinoderm embryos except those that belong to the Echinoid lineage. Instead, Nanos is expressed in a restricted domain at the 32-128 cell stage in Echinoid embryos. Our results support the model that the germ cell specification program underwent a heterochronic shift in the Echinoid lineage. A comparison of Echinoid and non-Echinoid germ cell specification mechanisms will contribute to our understanding of how these mechanisms have changed during animal evolution. © 2016 Wiley Periodicals, Inc.

  18. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  19. Maintaining success, reducing treatment burden, focusing on survivorship: highlights from the third European consensus conference on diagnosis and treatment of germ-cell cancer.

    Science.gov (United States)

    Beyer, J; Albers, P; Altena, R; Aparicio, J; Bokemeyer, C; Busch, J; Cathomas, R; Cavallin-Stahl, E; Clarke, N W; Claßen, J; Cohn-Cedermark, G; Dahl, A A; Daugaard, G; De Giorgi, U; De Santis, M; De Wit, M; De Wit, R; Dieckmann, K P; Fenner, M; Fizazi, K; Flechon, A; Fossa, S D; Germá Lluch, J R; Gietema, J A; Gillessen, S; Giwercman, A; Hartmann, J T; Heidenreich, A; Hentrich, M; Honecker, F; Horwich, A; Huddart, R A; Kliesch, S; Kollmannsberger, C; Krege, S; Laguna, M P; Looijenga, L H J; Lorch, A; Lotz, J P; Mayer, F; Necchi, A; Nicolai, N; Nuver, J; Oechsle, K; Oldenburg, J; Oosterhuis, J W; Powles, T; Rajpert-De Meyts, E; Rick, O; Rosti, G; Salvioni, R; Schrader, M; Schweyer, S; Sedlmayer, F; Sohaib, A; Souchon, R; Tandstad, T; Winter, C; Wittekind, C

    2013-04-01

    In November 2011, the Third European Consensus Conference on Diagnosis and Treatment of Germ-Cell Cancer (GCC) was held in Berlin, Germany. This third conference followed similar meetings in 2003 (Essen, Germany) and 2006 (Amsterdam, The Netherlands) [Schmoll H-J, Souchon R, Krege S et al. European consensus on diagnosis and treatment of germ-cell cancer: a report of the European Germ-Cell Cancer Consensus Group (EGCCCG). Ann Oncol 2004; 15: 1377-1399; Krege S, Beyer J, Souchon R et al. European consensus conference on diagnosis and treatment of germ-cell cancer: a report of the second meeting of the European Germ-Cell Cancer Consensus group (EGCCCG): part I. Eur Urol 2008; 53: 478-496; Krege S, Beyer J, Souchon R et al. European consensus conference on diagnosis and treatment of germ-cell cancer: a report of the second meeting of the European Germ-Cell Cancer Consensus group (EGCCCG): part II. Eur Urol 2008; 53: 497-513]. A panel of 56 of 60 invited GCC experts from all across Europe discussed all aspects on diagnosis and treatment of GCC, with a particular focus on acute and late toxic effects as well as on survivorship issues. The panel consisted of oncologists, urologic surgeons, radiooncologists, pathologists and basic scientists, who are all actively involved in care of GCC patients. Panelists were chosen based on the publication activity in recent years. Before the meeting, panelists were asked to review the literature published since 2006 in 20 major areas concerning all aspects of diagnosis, treatment and follow-up of GCC patients, and to prepare an updated version of the previous recommendations to be discussed at the conference. In addition, ∼50 E-vote questions were drafted and presented at the conference to address the most controversial areas for a poll of expert opinions. Here, we present the main recommendations and controversies of this meeting. The votes of the panelists are added as online supplements.

  20. Forskolin and the meiosis inducing substance synergistically initiate meiosis in fetal male germ cells

    DEFF Research Database (Denmark)

    Byskov, A G; Fenger, M; Westergaard, L

    1993-01-01

    We have shown that Meiosis Inducing Substance (MIS) and forskolin synergistically and dose dependently induce meiosis in germ cells of cultured fetal mouse testes. We used a bioassay which consists of fetal mouse testes and ovaries cultured for 6 days. In this study MIS media are spent culture...... are fixed, squashed, and DNA-stained. In these preparations germ cells and somatic cells can be distinguished, and the number of germ cells in the different stages of meiosis is counted as is the number of somatic cells in mitosis. MIS activity is defined to be present in a medium when meiosis is induced...... in male germ cells during culture. We found that MIS media as well as forskolin induced meiosis in fetal male germ cells in a dose-dependent manner. In addition, MIS media and forskolin acted synergistically by inducing meiosis. Female germ cells seem to be unaffected by the various culture media...