DEFF Research Database (Denmark)
Larsen, Jesper; Kuhnert, Peter; Frey, Joachim
2007-01-01
subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...
DEFF Research Database (Denmark)
Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas
2014-01-01
, a non-negligible fraction of the resulting sequence reads are not homologous to the bait. We demonstrate that during capture, the bait-hybridized library molecules add additional flanking library sequences iteratively, such that baits limited to targeting relatively short regions (e.g. few hundred...... nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...
DEFF Research Database (Denmark)
Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas
2014-01-01
nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...
Directory of Open Access Journals (Sweden)
Liang Rubing
2010-08-01
Full Text Available Abstract Background The lambda Red recombination system has been used to inactivate chromosomal genes in various bacteria and fungi. The procedure consists of electroporating a polymerase chain reaction (PCR fragment containing antibiotic cassette flanked by homology regions to the target locus into a strain that can express the lambda Red proteins (Gam, Bet, Exo. Results Here a scarless gene modification strategy based on the Red recombination system has been developed to modify Pseudomonas genome DNA via sequential deletion of multiple targets. This process was mediated by plasmid pRKaraRed encoding the Red proteins regulated by PBAD promoter, which was functional in P. aeruginosa as well as in other bacteria. First the target gene was substituted for the sacB-bla cassette flanked by short homology regions (50 bp, and then this marker gene cassette could be replaced by the PCR fragment flanking itself, generating target-deleted genome without any remnants and no change happened to the surrounding region. Twenty genes involved in the synthesis and regulation pathways of the phenazine derivate, pyocyanin, were modified, including one single-point mutation and deletion of two large operons. The recombination efficiencies ranged from 88% to 98%. Multiple-gene modification was also achieved, generating a triple-gene deletion strain PCA (PAO1, ΔphzHΔphzMΔphzS, which could produce another phenazine derivate, phenazine-1-carboxylic acid (PCA, efficiently and exclusively. Conclusions This lambda Red-based technique can be used to generate scarless and sequential gene modification mutants of P. aeruginosa efficiently, using one-step PCR product flanked by short homology regions. Single-point mutation, scarless deletion of genes can be achieved easily in less than three days. This method may give a new way to construct genetically modified P. aeruginosa strains more efficiently and advance the regulatory network study of this organism.
Directory of Open Access Journals (Sweden)
Bingfu Guo
2016-07-01
Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.
Telomere maintenance through recruitment of internal genomic regions.
Seo, Beomseok; Kim, Chuna; Hills, Mark; Sung, Sanghyun; Kim, Hyesook; Kim, Eunkyeong; Lim, Daisy S; Oh, Hyun-Seok; Choi, Rachael Mi Jung; Chun, Jongsik; Shim, Jaegal; Lee, Junho
2015-09-18
Cells surviving crisis are often tumorigenic and their telomeres are commonly maintained through the reactivation of telomerase. However, surviving cells occasionally activate a recombination-based mechanism called alternative lengthening of telomeres (ALT). Here we establish stably maintained survivors in telomerase-deleted Caenorhabditis elegans that escape from sterility by activating ALT. ALT survivors trans-duplicate an internal genomic region, which is already cis-duplicated to chromosome ends, across the telomeres of all chromosomes. These 'Template for ALT' (TALT) regions consist of a block of genomic DNA flanked by telomere-like sequences, and are different between two genetic background. We establish a model that an ancestral duplication of a donor TALT region to a proximal telomere region forms a genomic reservoir ready to be incorporated into telomeres on ALT activation.
Sharp, Andrew J.; Hansen, Sierra; Selzer, Rebecca R.; Cheng, Ze; Regan, Regina; Hurst, Jane A.; Stewart, Helen; Price, Sue M.; Blair, Edward; Hennekam, Raoul C.; Fitzpatrick, Carrie A.; Segraves, Rick; Richmond, Todd A.; Guiver, Cheryl; Albertson, Donna G.; Pinkel, Daniel; Eis, Peggy S.; Schwartz, Stuart; Knight, Samantha J. L.; Eichler, Evan E.
2006-01-01
Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic
Holland, M J; Holland, J P; Thill, G P; Jackson, K A
1981-02-10
Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5
Cloning and characterization of the 5'-flanking region of the Ehox gene
International Nuclear Information System (INIS)
Lee, Woon Kyu; Kim, Yong-Man; Malik, Nasir; Ma Chang; Westphal, Heiner
2006-01-01
The paired-like homeobox-containing gene Ehox plays a role in embryonic stem cell differentiation and is highly expressed in the developing placenta and thymus. To understand the mechanisms of regulation of Ehox gene expression, the 5'-flanking region of the Ehox gene was isolated from a mouse BAC library. 5'-RACE analysis revealed a single transcriptional start site 130 nucleotides upstream of the translation initiation codon. Transient transfection with a luciferase reporter gene under the control of serially deleted 5'-flanking sequences revealed that the nt -84 to -68 region contained a positive cis-acting element for efficient expression of the Ehox gene. Mutational analysis of this region and oligonucleotide competition in the electrophoretic mobility shift assay revealed the presence of a CCAAT box, which is a target for transcription nuclear factor Y (NFY). NFY is essential for positive gene regulation. No tissue-specific enhancer was identified in the 1.9-kb 5'-flanking region of the Ehox gene. Ehox is expressed during the early stages of embryo development, specifically in Brain at 9.5 dpc, as well as during the late stages of embryo development. These results suggest that NFY is an essential regulatory factor for Ehox transcriptional activity, which is important for the post-implantation stage of the developing embryo
Single nucleotide polymorphisms in the 5'-flanking region of the ...
African Journals Online (AJOL)
Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...
Sharp, Andrew J; Hansen, Sierra; Selzer, Rebecca R; Cheng, Ze; Regan, Regina; Hurst, Jane A; Stewart, Helen; Price, Sue M; Blair, Edward; Hennekam, Raoul C; Fitzpatrick, Carrie A; Segraves, Rick; Richmond, Todd A; Guiver, Cheryl; Albertson, Donna G; Pinkel, Daniel; Eis, Peggy S; Schwartz, Stuart; Knight, Samantha J L; Eichler, Evan E
2006-09-01
Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic disorders. We tested 290 individuals with mental retardation by BAC array comparative genomic hybridization and identified 16 pathogenic rearrangements, including de novo microdeletions of 17q21.31 found in four individuals. Using oligonucleotide arrays, we refined the breakpoints of this microdeletion, defining a 478-kb critical region containing six genes that were deleted in all four individuals. We mapped the breakpoints of this deletion and of four other pathogenic rearrangements in 1q21.1, 15q13, 15q24 and 17q12 to flanking segmental duplications, suggesting that these are also sites of recurrent rearrangement. In common with the 17q21.31 deletion, these breakpoint regions are sites of copy number polymorphism in controls, indicating that these may be inherently unstable genomic regions.
Biophysical properties of regions flanking the bHLH-Zip motif in the p22 Max protein
International Nuclear Information System (INIS)
Pursglove, Sharon E.; Fladvad, Malin; Bellanda, Massimo; Moshref, Ahmad; Henriksson, Marie; Carey, Jannette; Sunnerhagen, Maria
2004-01-01
The Max protein is the central dimerization partner in the Myc-Max-Mad network of transcriptional regulators, and a founding structural member of the family of basic-helix-loop-helix (bHLH)-leucine zipper (Zip) proteins. Biologically important regions flanking its bHLH-Zip motif have been disordered or absent in crystal structures. The present study shows that these regions are resistant to proteolysis in both the presence and absence of DNA, and that Max dimers containing both flanking regions have significantly higher helix content as measured by circular dichroism than that predicted from the crystal structures. Nuclear magnetic resonance measurements in the absence of DNA also support the inferred structural order. Deletion of both flanking regions is required to achieve maximal DNA affinity as measured by EMSA. Thus, the previously observed functionalities of these Max regions in DNA binding, phosphorylation, and apoptosis are suggested to be linked to structural properties
Microsatellites grant more stable flanking genes
Directory of Open Access Journals (Sweden)
Joukhadar Reem
2012-10-01
Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are DNA sequences that include tandem copies of specific sequences no longer than six bases. SSRs are ubiquitous in all genomes and highly mutable. Presentation of the hypothesis Results from previous studies suggest that flanking regions of SSR are exhibit high stability in a wide range of organisms. We hypothesized that the SSRs ability to discard weak DNA polymerases could be responsible for this unusual stability. . When the weak polymerases are being decayed over SSRs, the flanking sequences would have higher opportunity to be replicated by more stable DNA polymerases. We present evidence of the molecular basis of our hypothesis. Testing the hypothesis The hypothesis could be tested by examining the activity of DNA polymerase during and after a number of PCRs. The PCR reactions should be run with the same SSR locus possessing differences in the SSR length. The hypothesis could also be tested by comparing the mutational rate of a transferred gene between two transformations. The first one has a naked T-DNA (transferred DNA, while the second one has the same T-DNA flanked with two SSRs. Implications of the hypothesis In any transformation experiment, flanking the T-DNA fragment with SSR sequences would result in more stably transferred genes. This process would decrease the unpredictable risks that may occur because of the mutational pressure on this foreign segment.
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
International Nuclear Information System (INIS)
Riley, L.K.; Morrow, J.K.; Danton, M.J.; Coleman, M.S.
1988-01-01
Human terminal deoxyribonucleotidyltransferase cDNA contains an open reading frame of 1530 base pairs (bp) corresponding to a protein containing 510 amino acids. The encoded protein is a template-independent DNA polymerase found only in a restricted population of normal and malignant prelymphocytes. To begin to investigate the genetic elements responsible for the tissue-specific expression of terminal deoxyribonucleotidyltransferase, genomic clones, containing the entire human gene were isolated and characterized. Initially, cDNA clones were isolated from a library generated from the human lymphoblastoid cell line, MOLT-4R. A cDNA clone containing the entire coding region of the protein was used to isolate a series of overlapping clones from two human genomic libraries. The gene comprises 11 exons and 10 introns and spans 49.4 kilobases. The 5' flanking region (709 bp) including exon 1 was sequenced. Several putative transcription initiation sites were mapped. Within 500 nucleotides of the translation start site, a series of promoter elements was detected. TATA and CAAT sequences, respectively, were found to start at nucleotides -185 and -204, -328 and -370, and -465 and -505. Start sites were found for a cyclic AMP-dependent promoter analog at nucleotide -121, an eight-base sequence corresponding to the IgG promoter enhancer (cd) at nucleotide -455, and an analog of the IgG promoter (pd) at nucleotide -159. These findings suggest that transcripts coding for terminal deoxyribonucleotidyltransferase may be variable in length and that transcription may be influenced by a variety of genetic elements
The 5′ and 3′ Untranslated Regions of the Flaviviral Genome
Directory of Open Access Journals (Sweden)
Wy Ching Ng
2017-06-01
Full Text Available Flaviviruses are enveloped arthropod-borne viruses with a single-stranded, positive-sense RNA genome that can cause serious illness in humans and animals. The 11 kb 5′ capped RNA genome consists of a single open reading frame (ORF, and is flanked by 5′ and 3′ untranslated regions (UTR. The ORF is a polyprotein that is processed into three structural and seven non-structural proteins. The UTRs have been shown to be important for viral replication and immune modulation. Both of these regions consist of elements that are essential for genome cyclization, resulting in initiation of RNA synthesis. Genome mutation studies have been employed to investigate each component of the essential elements to show the necessity of each component and its role in viral RNA replication and growth. Furthermore, the highly structured 3′UTR is responsible for the generation of subgenomic flavivirus RNA (sfRNA that helps the virus evade host immune response, thereby affecting viral pathogenesis. In addition, changes within the 3′UTR have been shown to affect transmissibility between vector and host, which can influence the development of vaccines.
Association of the polymorphism in the 5' flanking region of the ovine ...
African Journals Online (AJOL)
The insulin-like growth factor 1 (IGF-I) gene has been described in several studies as a candidate gene for growth traits in farm animals. The present preliminary study attempts to establish associations between growth traits and genetic polymorphisms at the 5' flanking region s IGF-I in the Baluchi sheep. The DNA of 102 ...
Identification of functional SNPs in the 5-prime flanking sequences of human genes
Directory of Open Access Journals (Sweden)
Lenhard Boris
2005-02-01
Full Text Available Abstract Background Over 4 million single nucleotide polymorphisms (SNPs are currently reported to exist within the human genome. Only a small fraction of these SNPs alter gene function or expression, and therefore might be associated with a cell phenotype. These functional SNPs are consequently important in understanding human health. Information related to functional SNPs in candidate disease genes is critical for cost effective genetic association studies, which attempt to understand the genetics of complex diseases like diabetes, Alzheimer's, etc. Robust methods for the identification of functional SNPs are therefore crucial. We report one such experimental approach. Results Sequence conserved between mouse and human genomes, within 5 kilobases of the 5-prime end of 176 GPCR genes, were screened for SNPs. Sequences flanking these SNPs were scored for transcription factor binding sites. Allelic pairs resulting in a significant score difference were predicted to influence the binding of transcription factors (TFs. Ten such SNPs were selected for mobility shift assays (EMSA, resulting in 7 of them exhibiting a reproducible shift. The full-length promoter regions with 4 of the 7 SNPs were cloned in a Luciferase based plasmid reporter system. Two out of the 4 SNPs exhibited differential promoter activity in several human cell lines. Conclusions We propose a method for effective selection of functional, regulatory SNPs that are located in evolutionary conserved 5-prime flanking regions (5'-FR regions of human genes and influence the activity of the transcriptional regulatory region. Some SNPs behave differently in different cell types.
Wong, S W; Schaffer, P A
1991-05-01
Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.
Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
Genomic organization of the canine herpesvirus US region.
Haanes, E J; Tomlinson, C C
1998-02-01
Canine herpesvirus (CHV) is an alpha-herpesvirus of limited pathogenicity in healthy adult dogs and infectivity of the virus appears to be largely limited to cells of canine origin. CHV's low virulence and species specificity make it an attractive candidate for a recombinant vaccine vector to protect dogs against a variety of pathogens. As part of the analysis of the CHV genome, the authors determined the complete nucleotide sequence of the CHV US region as well as portions of the flanking inverted repeats. Seven full open reading frames (ORFs) encoding proteins larger than 100 amino acids were identified within, or partially within the CHV US: cUS2, cUS3, cUS4, cUS6, cUS7, cUS8 and cUS9; which are homologs of the herpes simplex virus type-1 US2; protein kinase; gG, gD, gI, gE; and US9 genes, respectively. An eighth ORF was identified in the inverted repeat region, cIR6, a homolog of the equine herpesvirus type-1 IR6 gene. The authors identified and mapped most of the major transcripts for the predicted CHV US ORFs by Northern analysis.
Kass, David H; Janoušek, Václav; Wang, Liuyang; Tucker, Priscilla K
2014-06-01
Reproductive barriers exist between the house mouse subspecies, Mus musculus musculus and M. m. domesticus, members of the Mus musculus species complex, primarily as a result of hybrid male infertility, and a hybrid zone exists where their ranges intersect in Europe. Using single nucleotide polymorphisms (SNPs) diagnostic for the two taxa, the extent of introgression across the genome was previously compared in these hybrid populations. Sixty-nine of 1316 autosomal SNPs exhibited reduced introgression in two hybrid zone transects suggesting maladaptive interactions among certain loci. One of these markers is within a region on chromosome 11 that, in other studies, has been associated with hybrid male sterility of these subspecies. We assessed sequence variation in a 20 Mb region on chromosome 11 flanking this marker, and observed its inclusion within a roughly 150 kb stretch of DNA showing elevated sequence differentiation between the two subspecies. Four genes are associated with this genomic subregion, with two entirely encompassed. One of the two genes, the uncharacterized 1700093K21Rik gene, displays distinguishing features consistent with a potential role in reproductive isolation between these subspecies. Along with its expression specifically within spermatogenic cells, we present various sequence analyses that demonstrate a high rate of molecular evolution of this gene, as well as identify a subspecies amino acid variant resulting in a structural difference. Taken together, the data suggest a role for this gene in reproductive isolation.
Wateren, F.M. van der; Dunai, T.J.; Balen, R.T. van; Klas, W.; Verbers, A.L.L.M.; Passchier, S.; Herpers, U.
1999-01-01
Separate regions within the Transantarctic Mountains, the uplifted flank of the West Antarctic rift system, appear to have distinct Neogene histories of glaciation and valley downcutting. Incision of deep glacial outlet valleys occurred at different times throughout central and northern Victoria
Characterization of Bovine 5′-flanking Region during Differentiation of Mouse Embryonic Stem Cells
Directory of Open Access Journals (Sweden)
Hye-Jeong Jang
2015-12-01
Full Text Available Embryonic stem cells (ESCs have been used as a powerful tool for research including gene manipulated animal models and the study of developmental gene regulation. Among the critical regulatory factors that maintain the pluripotency and self-renewal of undifferentiated ESCs, NANOG plays a very important role. Nevertheless, because pluripotency maintaining factors and specific markers for livestock ESCs have not yet been probed, few studies of the NANOG gene from domestic animals including bovine have been reported. Therefore, we chose mouse ESCs in order to understand and compare NANOG expression between bovine, human, and mouse during ESCs differentiation. We cloned a 600 bp (−420/+181 bovine NANOG 5′-flanking region, and tagged it with humanized recombinant green fluorescent protein (hrGFP as a tracing reporter. Very high GFP expression for bovine NANOG promoter was observed in the mouse ESC line. GFP expression was monitored upon ESC differentiation and was gradually reduced along with differentiation toward neurons and adipocyte cells. Activity of bovine NANOG (−420/+181 promoter was compared with already known mouse and human NANOG promoters in mouse ESC and they were likely to show a similar pattern of regulation. In conclusion, bovine NANOG 5-flanking region functions in mouse ES cells and has characteristics similar to those of mouse and human. These results suggest that bovine gene function studied in mouse ES cells should be evaluated and extrapolated for application to characterization of bovine ES cells.
GRAbB : Selective Assembly of Genomic Regions, a New Niche for Genomic Research
Brankovics, Balázs; Zhang, Hao; van Diepeningen, Anne D; van der Lee, Theo A J; Waalwijk, Cees; de Hoog, G Sybren
GRAbB (Genomic Region Assembly by Baiting) is a new program that is dedicated to assemble specific genomic regions from NGS data. This approach is especially useful when dealing with multi copy regions, such as mitochondrial genome and the rDNA repeat region, parts of the genome that are often
International Nuclear Information System (INIS)
Forrester, H.B.; Radford, I.R.
2003-01-01
Full text: DNA rearrangement events leading to chromosomal aberrations are central to ionizing radiation-induced cell death. Although DNA double-strand breaks are probably the lesion that initiates formation of chromosomal aberrations, little is understood about the molecular mechanisms that generate and modulate DNA rearrangement. Examination of the sequences that flank sites of DNA rearrangement may provide information regarding the processes and enzymes involved in rearrangement events. Accordingly, we developed a method using inverse PCR that allows the detection and sequencing of putative radiation-induced DNA rearrangements in defined regions of the human genome. The method can detect single copies of a rearrangement event that has occurred in a particular region of the genome and, therefore, DNA rearrangement detection does not require survival and continued multiplication of the affected cell. Ionizing radiation-induced DNA rearrangements were detected in several different regions of the genome of human fibroblast cells that were exposed to 30 Gy of γ-irradiation and then incubated for 24 hours at 37 deg C. There was a 3- to 5-fold increase in the number of products amplified from irradiated as compared with control cells in the target regions 5' to the C-MYC, CDKN1A, RB1, and FGFR2 genes. Sequences were examined from 121 DNA rearrangements. Approximately half of the PCR products were derived from possible inter-chromosomal rearrangements and the remainder were from intra-chromosomal events. A high proportion of the sequences that rearranged with target regions were located in genes, suggesting that rearrangements may occur preferentially in transcribed regions. Eighty-four percent of the sequences examined by reverse transcriptase PCR were from transcribed sequences in IMR-90 cells. The distribution of DNA rearrangements within the target regions is non-random and homology occurs between the sequences involved in rearrangements in some cases but is not
International Nuclear Information System (INIS)
Andrade, S.M. de; Camarco, P.E.N.
1984-01-01
The Carboniferous sequences of the northeast flank of the Parana Basin and those of the southwest flank of the Parnaiba Basin have been the subject of discussion and polemics for quite a long time, especially in terms of their stratigraphic relations and depositional environments. Thus, we reinforce our main objective, which is to furnish data for the definition of the uranium potential in these Carboniferous sediments, by adding recently acquired information that should aid in the clarification of the existing controversies. The Carboniferous along the northeast flank of the Parana Basin is represented by the Aquidauana Formation which has been informally divided into three members: lower, middle and upper members. The middle member, of marine origin, constitutes a prospective target for uranium and phosphate associations, in which sandstones interbedded with shales constitute the host rocks. On the other hand, the Carboniferous of the southwest margin of the Parnaiba Basin, which encompasses the Longa, Poti and Piaui Formations has shown very remote possibilities of uranium occurrences. The regional structural framework, as reflected by the Carboniferous rocks along both basin flanks, is characterized by homoclines cut by gravity faults. The faults along these weakness zones were occasionally intruded by basic rocks of Cretaceous age. Superimposed on the regional structure, open folds appear in the form of anticlines and domes. These folds are discontinuous structures resulting from uplift due to vertical stresses or result from differential subsidence along the limbs of the folds. (Author) [pt
Oosumi, Teruko; Ruiz-Rojas, Juan Jairo; Veilleux, Richard E; Dickerman, Allan; Shulaev, Vladimir
2010-09-01
Reverse genetics is used for functional genomics research in model plants. To establish a model system for the systematic reverse genetics research in the Rosaceae family, we analyzed genomic DNA flanking the T-DNA insertions in 191 transgenic plants of the diploid strawberry, Fragaria vesca. One hundred and seventy-six T-DNA flanking sequences were amplified from the right border (RB) and 37 from the left border (LB) by thermal asymmetric interlaced PCR. Analysis of the T-DNA nick positions revealed that T-DNA was most frequently nicked at the cleavage sites. Analysis of 11 T-DNA integration sites indicated that T-DNA was integrated into the F. vesca genome by illegitimate recombination, as reported in other model plants: Arabidopsis, rice and tobacco. First, deletion of DNA was found at T-DNA integration target sites in all transgenic plants tested. Second, microsimilarities of a few base pairs between the left and/or right ends of the T-DNA and genomic sites were found in all transgenic plants tested. Finally, filler DNA was identified in four break-points. Out of 191 transgenic plants, T-DNA flanking sequences of 79 plants (41%) showed significant similarity to genes, elements or proteins of other plant species and 67 (35%) of the sequences are still unknown strawberry gene fragments. T-DNA flanking sequences of 126 plants (66%) showed homology to plant ESTs. This is the first report of T-DNA integration in a sizeable population of a rosaceous species. We have shown in this paper that T-DNA integration in strawberry is not random but directed by sequence microsimilarities in the host genome.
Flank tectonics of Martian volcanoes
International Nuclear Information System (INIS)
Thomas, P.J.; Squyres, S.W.; Carr, M.H.
1990-01-01
On the flanks of Olympus Mons is a series of terraces, concentrically distributed around the caldera. Their morphology and location suggest that they could be thrust faults caused by compressional failure of the cone. In an attempt to understand the mechanism of faulting and the possible influences of the interior structure of Olympus Mons, the authors have constructed a numerical model for elastic stresses within a Martian volcano. In the absence of internal pressurization, the middle slopes of the cone are subjected to compressional stress, appropriate to the formation of thrust faults. These stresses for Olympus Mons are ∼250 MPa. If a vacant magma chamber is contained within the cone, the region of maximum compressional stress is extended toward the base of the cone. If the magma chamber is pressurized, extensional stresses occur at the summit and on the upper slopes of the cone. For a filled but unpressurized magma chamber, the observed positions of the faults agree well with the calculated region of high compressional stress. Three other volcanoes on Mars, Ascraeus Mons, Arsia Mons, and Pavonis Mons, possess similar terraces. Extending the analysis to other Martian volcanoes, they find that only these three and Olympus Mons have flank stresses that exceed the compressional failure strength of basalt, lending support to the view that the terraces on all four are thrust faults
International Nuclear Information System (INIS)
Kantor, G.J.; Deiss-Tolbert, D.M.
1995-01-01
Size separation after UV-endonuclease digestion of DNA from UV-irradiated human cells using denaturing conditions fractionates the genome based on cyclobutane pyrimidine dimer content. We have examined the largest molecules available (50-80 kb; about 5% of the DNA) after fractionation and those of average size (5-15 kb) for content of some specific genes. We find that the largest molecules are not a representative sampling of the genome. Three contiguous genes located in a G+C-rich isochore (tyrosine hydroxylase, insulin, insulin-like growth factor II) have concentrations two to three times greater in the largest molecules. This shows that this genomic region has fewer pyrimidine dimers than most other genomic regions. In contrast, the β-actin genomic region, which has a similar G+C content, has an equal concentration in both fractions as do the p53 and β-globin genomic regions, which are A+T-rich. These data show that DNA damage in the form of cyclobutane pyrimidine dimers occurs with different probabilities in specific isochores. Part of the reason may be the relative G-C content, but other factors must play a significant role. We also report that the transcriptionally inactive insulin region is repaired at the genome-overall rate in normal cells and is not repaired in xeroderma pigmentosum complementation group C cells. (author)
Zhang, Fan; Zhang, Bing; Xiang, Hua; Hu, Songnian
2009-11-01
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a widespread system that provides acquired resistance against phages in bacteria and archaea. Here we aim to genome-widely analyze the CRISPR in extreme halophilic archaea, of which the whole genome sequences are available at present time. We used bioinformatics methods including alignment, conservation analysis, GC content and RNA structure prediction to analyze the CRISPR structures of 7 haloarchaeal genomes. We identified the CRISPR structures in 5 halophilic archaea and revealed a conserved palindromic motif in the flanking regions of these CRISPR structures. In addition, we found that the repeat sequences of large CRISPR structures in halophilic archaea were greatly conserved, and two types of predicted RNA secondary structures derived from the repeat sequences were likely determined by the fourth base of the repeat sequence. Our results support the proposal that the leader sequence may function as recognition site by having palindromic structures in flanking regions, and the stem-loop secondary structure formed by repeat sequences may function in mediating the interaction between foreign genetic elements and CAS-encoded proteins.
Flanking Variation Influences Rates of Stutter in Simple Repeats
Directory of Open Access Journals (Sweden)
August E. Woerner
2017-11-01
Full Text Available It has been posited that the longest uninterrupted stretch (LUS of tandem repeats, as defined by the number of exactly matching repeating motif units, is a better predictor of rates of stutter than the parental allele length (PAL. While there are cases where this hypothesis is likely correct, such as the 9.3 allele in the TH01 locus, there can be situations where it may not apply as well. For example, the PAL may capture flanking indel variations while remaining insensitive to polymorphisms in the repeat, and these haplotypic changes may impact the stutter rate. To address this, rates of stutter were contrasted against the LUS as well as the PAL on different flanking haplotypic backgrounds. This study shows that rates of stutter can vary substantially depending on the flanking haplotype, and while there are cases where the LUS is a better predictor of stutter than the PAL, examples to the contrary are apparent in commonly assayed forensic markers. Further, flanking variation that is 7 bp from the repeat region can impact rates of stutter. These findings suggest that non-proximal effects, such as DNA secondary structure, may be impacting the rates of stutter in common forensic short tandem repeat markers.
... how to do these exercises at home. Nonsteroidal anti-inflammatory drugs (NSAIDs) and physical therapy may be prescribed for flank pain caused by spinal arthritis. Antibiotics are used to treat most kidney infections. You ...
Directory of Open Access Journals (Sweden)
Ariel M Pani
2010-08-01
Full Text Available Intellectual disability (ID affects 2-3% of the population and may occur with or without multiple congenital anomalies (MCA or other medical conditions. Established genetic syndromes and visible chromosome abnormalities account for a substantial percentage of ID diagnoses, although for approximately 50% the molecular etiology is unknown. Individuals with features suggestive of various syndromes but lacking their associated genetic anomalies pose a formidable clinical challenge. With the advent of microarray techniques, submicroscopic genome alterations not associated with known syndromes are emerging as a significant cause of ID and MCA.High-density SNP microarrays were used to determine genome wide copy number in 42 individuals: 7 with confirmed alterations in the WS region but atypical clinical phenotypes, 31 with ID and/or MCA, and 4 controls. One individual from the first group had the most telomeric gene in the WS critical region deleted along with 2 Mb of flanking sequence. A second person had the classic WS deletion and a rearrangement on chromosome 5p within the Cri du Chat syndrome (OMIM:123450 region. Six individuals from the ID/MCA group had large rearrangements (3 deletions, 3 duplications, one of whom had a large inversion associated with a deletion that was not detected by the SNP arrays.Combining SNP microarray analyses and qPCR allowed us to clone and sequence 21 deletion breakpoints in individuals with atypical deletions in the WS region and/or ID or MCA. Comparison of these breakpoints to databases of genomic variation revealed that 52% occurred in regions harboring structural variants in the general population. For two probands the genomic alterations were flanked by segmental duplications, which frequently mediate recurrent genome rearrangements; these may represent new genomic disorders. While SNP arrays and related technologies can identify potentially pathogenic deletions and duplications, obtaining sequence information
Estimation of (co)variances for genomic regions of flexible sizes
DEFF Research Database (Denmark)
Sørensen, Lars P; Janss, Luc; Madsen, Per
2012-01-01
was used. There was a clear difference in the region-wise patterns of genomic correlation among combinations of traits, with distinctive peaks indicating the presence of pleiotropic QTL. CONCLUSIONS: The results show that it is possible to estimate, genome-wide and region-wise genomic (co)variances......BACKGROUND: Multi-trait genomic models in a Bayesian context can be used to estimate genomic (co)variances, either for a complete genome or for genomic regions (e.g. per chromosome) for the purpose of multi-trait genomic selection or to gain further insight into the genomic architecture of related...... with a common prior distribution for the marker allele substitution effects and estimation of the hyperparameters in this prior distribution from the progeny means data. From the Markov chain Monte Carlo samples of the allele substitution effects, genomic (co)variances were calculated on a whole-genome level...
Hess, A.D.; Thoburn, C.; Chen, W.; Miura, Y.; Wall, E. van der
2001-01-01
The N-terminal flanking region of the invariant chain peptide termed CLIP appears to have superagonistic properties interacting with the T cell receptor and the MHC class II molecule at or near the binding site for the bacterial superantigen Staphylococcal enterotoxin B (SEB). The present studies
Directory of Open Access Journals (Sweden)
Jumpei Saito
Full Text Available MicroRNA (miRNA are non-coding small RNA that regulate gene expression. MiR-328 is reported to influence breast cancer resistance protein (BCRP expression in cancer cells. As a large inter-individual difference in BCRP levels is observed in various human tissues, the contribution of miR-328 to these differences is of interest. We hypothesized that DNA methylation in the miR-328 promoter region is responsible for the difference in miR-328 levels, leading to inter-individual variability in BCRP levels in human placenta. The association between placental miR-328 and BCRP levels was analyzed, and then DNA methylation in the miR-328 5'-flanking region and regulatory mechanisms causing inter-individual differences in miR-328 and BCRP levels were examined. MiR-328 expression was significantly correlated with BCRP mRNA (Rs = -0.560, P < 0.01 and protein (Rs = -0.730, P < 0.01 levels. It was also up-regulated by the demethylating agent 5-aza-2'-deoxycytidine in BCRP-expressing cells. Luciferase assays with differentially methylated reporter constructs indicated that methylation in the miR-328 5'-flanking region including a predicted CpG island remarkably decreased transcriptional activity compared to that in unmethylated constructs. We selected CCAAT/enhancer binding protein α (C/EBPα, located within the predicted CpG island, by in silico analysis. To elucidate the role of C/EBPα in miR-328 expression, a chromatin immunoprecipitation assay, promoter deletion analysis, and electrophoretic mobility shift assay (EMSA were performed. C/EBPα-binding site-truncated constructs showed significantly decreased promoter activity, and EMSA indicated that the C/EBPα-binding sites were located in the CpG island. Finally, the methylation patterns of several CpG dinucleotides proximal to two C/EBPα-binding sites in the miR-328 5'-flanking region were correlated negatively with miR-328 levels, and positively with BCRP levels in human placental samples. These
GRAbB: Selective Assembly of Genomic Regions, a New Niche for Genomic Research.
Directory of Open Access Journals (Sweden)
Balázs Brankovics
2016-06-01
Full Text Available GRAbB (Genomic Region Assembly by Baiting is a new program that is dedicated to assemble specific genomic regions from NGS data. This approach is especially useful when dealing with multi copy regions, such as mitochondrial genome and the rDNA repeat region, parts of the genome that are often neglected or poorly assembled, although they contain interesting information from phylogenetic or epidemiologic perspectives, but also single copy regions can be assembled. The program is capable of targeting multiple regions within a single run. Furthermore, GRAbB can be used to extract specific loci from NGS data, based on homology, like sequences that are used for barcoding. To make the assembly specific, a known part of the region, such as the sequence of a PCR amplicon or a homologous sequence from a related species must be specified. By assembling only the region of interest, the assembly process is computationally much less demanding and may lead to assemblies of better quality. In this study the different applications and functionalities of the program are demonstrated such as: exhaustive assembly (rDNA region and mitochondrial genome, extracting homologous regions or genes (IGS, RPB1, RPB2 and TEF1a, as well as extracting multiple regions within a single run. The program is also compared with MITObim, which is meant for the exhaustive assembly of a single target based on a similar query sequence. GRAbB is shown to be more efficient than MITObim in terms of speed, memory and disk usage. The other functionalities (handling multiple targets simultaneously and extracting homologous regions of the new program are not matched by other programs. The program is available with explanatory documentation at https://github.com/b-brankovics/grabb. GRAbB has been tested on Ubuntu (12.04 and 14.04, Fedora (23, CentOS (7.1.1503 and Mac OS X (10.7. Furthermore, GRAbB is available as a docker repository: brankovics/grabb (https://hub.docker.com/r/brankovics/grabb/.
Genome analysis of an atypical bovine pestivirus from fetal bovine serum.
Gao, Shandian; Du, Junzheng; Tian, Zhancheng; Xing, Shanshan; Chang, Huiyun; Liu, Guangyuan; Luo, Jianxun; Yin, Hong
2016-08-01
We report the complete genome sequence of a bovine pestivirus LVRI/cont-1 originated from a commercial batch of fetal bovine serum. Its complete genome consists of 12,282 nucleotides (nt), which contain an open reading frame (ORF) of 11,700 bp flanked by 5' and 3' untranslated regions (383 and 199 bp). The size of the 5'UTR and the individual protein coding region of LVRI/cont-1 are identical to those of the reference virus Th/04_KhonKaen, but it has a deletion of the first 56 nt in the 3'UTR. Alignment of the complete nucleotide sequence and phylogenetic analysis indicate that this viral isolate belongs to atypical pestiviruses.
DISQUIETUDE ON THE EASTERN FLANK: AWAITING ALLIANCE RESPONSE
Directory of Open Access Journals (Sweden)
Octavian Manea
2010-03-01
Full Text Available The absence of significant and tangible military defensive infrastructure on the Eastern flank generated over time a breach of credibility in the security guarantee provided by NATO under its Article 5 commitment. The main argument of the countries in the New Europe now is that, in order to be credible enough, and not just a paper guarantee, a collective defence commitment must be backed by “boots on the ground” and by military tangible logistics.While assuming this perspective, the present article looks at some of the alarm signals coming from the countries on NATO’s Eastern flank, trying to explain the feeling of insecurity perceived by the states in the region as well as the options available to the Euro-Atlantic community in order to engage in a much-needed process of strategic reassurance.
Understanding Etna flank instability through numerical models
Apuani, Tiziana; Corazzato, Claudia; Merri, Andrea; Tibaldi, Alessandro
2013-02-01
As many active volcanoes, Mount Etna shows clear evidence of flank instability, and different mechanisms were suggested to explain this flank dynamics, based on the recorded deformation pattern and character. Shallow and deep deformations, mainly associated with both eruptive and seismic events, are concentrated along recognised fracture and fault systems, mobilising the eastern and south-eastern flank of the volcano. Several interacting causes were postulated to control the phenomenon, including gravity force, magma ascent along the feeding system, and a very complex local and/or regional tectonic activity. Nevertheless, the complexity of such dynamics is still an open subject of research and being the volcano flanks heavily urbanised, the comprehension of the gravitative dynamics is a major issue for public safety and civil protection. The present research explores the effects of the main geological features (in particular the role of the subetnean clays, interposed between the Apennine-Maghrebian flysch and the volcanic products) and the role of weakness zones, identified by fracture and fault systems, on the slope instability process. The effects of magma intrusions are also investigated. The problem is addressed by integrating field data, laboratory tests and numerical modelling. A bi- and tri-dimensional stress-strain analysis was performed by a finite difference numerical code (FLAC and FLAC3D), mainly aimed at evaluating the relationship among geological features, volcano-tectonic structures and magmatic activity in controlling the deformation processes. The analyses are well supported by dedicated structural-mechanical field surveys, which allowed to estimate the rock mass strength and deformability parameters. To take into account the uncertainties which inevitably occur in a so complicated model, many efforts were done in performing a sensitivity analysis along a WNW-ESE section crossing the volcano summit and the Valle del Bove depression. This was
Annotating non-coding regions of the genome.
Alexander, Roger P; Fang, Gang; Rozowsky, Joel; Snyder, Michael; Gerstein, Mark B
2010-08-01
Most of the human genome consists of non-protein-coding DNA. Recently, progress has been made in annotating these non-coding regions through the interpretation of functional genomics experiments and comparative sequence analysis. One can conceptualize functional genomics analysis as involving a sequence of steps: turning the output of an experiment into a 'signal' at each base pair of the genome; smoothing this signal and segmenting it into small blocks of initial annotation; and then clustering these small blocks into larger derived annotations and networks. Finally, one can relate functional genomics annotations to conserved units and measures of conservation derived from comparative sequence analysis.
International Nuclear Information System (INIS)
Nouroz, F.; Naveed, M.
2018-01-01
The non-LTR retrotransposons (retroposons) are abundant in plant genomes including members of Brassicaceae. Of the retroposons, long interspersed nuclear elements (LINEs) are more copious followed by short interspersed nuclear elements (SINEs) in sequenced eukaryotic genomes. The SINEs are short elements and ranged from 100-500 bps flanked by variable sized target site duplications, 5' tRNA region with polymerase III promoter, internal tRNA unrelated region, 3' LINEs derived region and a poly adenosine tail. Different computational approaches were used for the identification and characterization of SINEs, while PCR was used to detect the SINEs insertion polymorphisms in various Brassica genotypes. Ten previously unidentified families of SINEs were identified and characterized from Brassica genomes. The structural features of these SINEs were studied in detail, which showed typical SINE features displaying small sizes, target site duplications, head regions, internal regions (body) of variable sizes and a poly (A) tail at the 3' terminus. The elements from various families ranged from 206-558 bp, where BoSINE2 family displayed smallest SINE element (206 bp), while larger members belonged to BoSINE9 family (524-558 bp). The distribution and abundance of SINEs in various Brassica species and genotypes (40) at a particular site/locus were investigated by SINEs based PCR markers. Various SINE insertion polymorphisms were detected from different genotypes, where higher PCR bands amplified the SINE insertions, while lower bands amplified the pre-insertion sites (flanking regions). The analysis of Brassica SINEs copy numbers from 10 identified families revealed that around 860 and 1712 copies of SINEs were calculated from B. rapa and B. oleracea Whole-genome shotgun contigs (WGS) respectively. Analysis of insertion sites of Brassica SINEs revealed that the members from all 10 SINE families had shown an insertion preference in AT rich regions. The present
Genome-wide prediction of cis-regulatory regions using supervised deep learning methods.
Li, Yifeng; Shi, Wenqiang; Wasserman, Wyeth W
2018-05-31
In the human genome, 98% of DNA sequences are non-protein-coding regions that were previously disregarded as junk DNA. In fact, non-coding regions host a variety of cis-regulatory regions which precisely control the expression of genes. Thus, Identifying active cis-regulatory regions in the human genome is critical for understanding gene regulation and assessing the impact of genetic variation on phenotype. The developments of high-throughput sequencing and machine learning technologies make it possible to predict cis-regulatory regions genome wide. Based on rich data resources such as the Encyclopedia of DNA Elements (ENCODE) and the Functional Annotation of the Mammalian Genome (FANTOM) projects, we introduce DECRES based on supervised deep learning approaches for the identification of enhancer and promoter regions in the human genome. Due to their ability to discover patterns in large and complex data, the introduction of deep learning methods enables a significant advance in our knowledge of the genomic locations of cis-regulatory regions. Using models for well-characterized cell lines, we identify key experimental features that contribute to the predictive performance. Applying DECRES, we delineate locations of 300,000 candidate enhancers genome wide (6.8% of the genome, of which 40,000 are supported by bidirectional transcription data), and 26,000 candidate promoters (0.6% of the genome). The predicted annotations of cis-regulatory regions will provide broad utility for genome interpretation from functional genomics to clinical applications. The DECRES model demonstrates potentials of deep learning technologies when combined with high-throughput sequencing data, and inspires the development of other advanced neural network models for further improvement of genome annotations.
Cloning and analysis of the promoter region of the human fibronectin gene
International Nuclear Information System (INIS)
Dean, D.C.; Bowlus, C.L.; Bourgeois, S.
1987-01-01
Human fibronectin (FN) genomic clones were isolated by screening a human genomic library with a 75-base oligonucleotide. The sequence of the oligonucleotide corresponds to a region near the 5' end of the human FN cDNA clone pFH6 that contains the amino-terminal coding sequences but does not extend to the 5' end of the mRNA. The 5' end of the FN gene is found on a 3.7-kilobase-pair EcoRI fragment that contains about 2.7 kilobase pairs of flanking sequence. The first exon is 414 base pairs long, with a 5' untranslated region of 267 base pairs. As deduced on the basis of the position of the initiation codon, FN is synthesized with a 31-residue amino acid extension on the amion terminus that is not present in the mature polypeptide. This amino-terminal extension appears to contain both a signal peptide and a propeptide. The first 200 base pairs of 5'-flanking sequence is very G+C rich. Upstream of this the sequence becomes relatively A+T rich. The sequence ATATAA is found at -25 and the sequence CAAT is present at -150. The sequence GGGGCGGGGC at -102 exhibits homology to the binding site for the transcription factor SP1, and the sequence TGACGTCA at -173 exhibits homology to 5'-flanking sequences important for induction by cAMP
Hyb-Seq: Combining Target Enrichment and Genome Skimming for Plant Phylogenomics
Directory of Open Access Journals (Sweden)
Kevin Weitemier
2014-08-01
Full Text Available Premise of the study: Hyb-Seq, the combination of target enrichment and genome skimming, allows simultaneous data collection for low-copy nuclear genes and high-copy genomic targets for plant systematics and evolution studies. Methods and Results: Genome and transcriptome assemblies for milkweed (Asclepias syriaca were used to design enrichment probes for 3385 exons from 768 genes (>1.6 Mbp followed by Illumina sequencing of enriched libraries. Hyb-Seq of 12 individuals (10 Asclepias species and two related genera resulted in at least partial assembly of 92.6% of exons and 99.7% of genes and an average assembly length >2 Mbp. Importantly, complete plastomes and nuclear ribosomal DNA cistrons were assembled using off-target reads. Phylogenomic analyses demonstrated signal conflict between genomes. Conclusions: The Hyb-Seq approach enables targeted sequencing of thousands of low-copy nuclear exons and flanking regions, as well as genome skimming of high-copy repeats and organellar genomes, to efficiently produce genome-scale data sets for phylogenomics.
Directory of Open Access Journals (Sweden)
Li Jia
Full Text Available The androgen receptor (AR is a steroid-activated transcription factor that binds at specific DNA locations and plays a key role in the etiology of prostate cancer. While numerous studies have identified a clear connection between AR binding and expression of target genes for a limited number of loci, high-throughput elucidation of these sites allows for a deeper understanding of the complexities of this process.We have mapped 189 AR occupied regions (ARORs and 1,388 histone H3 acetylation (AcH3 loci to a 3% continuous stretch of human genomic DNA using chromatin immunoprecipitation (ChIP microarray analysis. Of 62 highly reproducible ARORs, 32 (52% were also marked by AcH3. While the number of ARORs detected in prostate cancer cells exceeded the number of nearby DHT-responsive genes, the AcH3 mark defined a subclass of ARORs much more highly associated with such genes -- 12% of the genes flanking AcH3+ARORs were DHT-responsive, compared to only 1% of genes flanking AcH3-ARORs. Most ARORs contained enhancer activities as detected in luciferase reporter assays. Analysis of the AROR sequences, followed by site-directed ChIP, identified binding sites for AR transcriptional coregulators FoxA1, CEBPbeta, NFI and GATA2, which had diverse effects on endogenous AR target gene expression levels in siRNA knockout experiments.We suggest that only some ARORs function under the given physiological conditions, utilizing diverse mechanisms. This diversity points to differential regulation of gene expression by the same transcription factor related to the chromatin structure.
International Nuclear Information System (INIS)
Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.
1988-01-01
Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa
Hyb-Seq: Combining target enrichment and genome skimming for plant phylogenomics1
Weitemier, Kevin; Straub, Shannon C. K.; Cronn, Richard C.; Fishbein, Mark; Schmickl, Roswitha; McDonnell, Angela; Liston, Aaron
2014-01-01
• Premise of the study: Hyb-Seq, the combination of target enrichment and genome skimming, allows simultaneous data collection for low-copy nuclear genes and high-copy genomic targets for plant systematics and evolution studies. • Methods and Results: Genome and transcriptome assemblies for milkweed (Asclepias syriaca) were used to design enrichment probes for 3385 exons from 768 genes (>1.6 Mbp) followed by Illumina sequencing of enriched libraries. Hyb-Seq of 12 individuals (10 Asclepias species and two related genera) resulted in at least partial assembly of 92.6% of exons and 99.7% of genes and an average assembly length >2 Mbp. Importantly, complete plastomes and nuclear ribosomal DNA cistrons were assembled using off-target reads. Phylogenomic analyses demonstrated signal conflict between genomes. • Conclusions: The Hyb-Seq approach enables targeted sequencing of thousands of low-copy nuclear exons and flanking regions, as well as genome skimming of high-copy repeats and organellar genomes, to efficiently produce genome-scale data sets for phylogenomics. PMID:25225629
Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN
Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger
2016-01-01
Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831
Donaldson, Zoe R; Kondrashov, Fyodor A; Putnam, Andrea; Bai, Yaohui; Stoinski, Tara L; Hammock, Elizabeth A D; Young, Larry J
2008-06-23
The arginine vasopressin V1a receptor (V1aR) modulates social cognition and behavior in a wide variety of species. Variation in a repetitive microsatellite element in the 5' flanking region of the V1aR gene (AVPR1A) in rodents has been associated with variation in brain V1aR expression and in social behavior. In humans, the 5' flanking region of AVPR1A contains a tandem duplication of two approximately 350 bp, microsatellite-containing elements located approximately 3.5 kb upstream of the transcription start site. The first block, referred to as DupA, contains a polymorphic (GT)25 microsatellite; the second block, DupB, has a complex (CT)4-(TT)-(CT)8-(GT)24 polymorphic motif, known as RS3. Polymorphisms in RS3 have been associated with variation in sociobehavioral traits in humans, including autism spectrum disorders. Thus, evolution of these regions may have contributed to variation in social behavior in primates. We examined the structure of these regions in six ape, six monkey, and one prosimian species. Both tandem repeat blocks are present upstream of the AVPR1A coding region in five of the ape species we investigated, while monkeys have only one copy of this region. As in humans, the microsatellites within DupA and DupB are polymorphic in many primate species. Furthermore, both single (lacking DupB) and duplicated alleles (containing both DupA and DupB) are present in chimpanzee (Pan troglodytes) populations with allele frequencies of 0.795 and 0.205 for the single and duplicated alleles, respectively, based on the analysis of 47 wild-caught individuals. Finally, a phylogenetic reconstruction suggests two alternate evolutionary histories for this locus. There is no obvious relationship between the presence of the RS3 duplication and social organization in primates. However, polymorphisms identified in some species may be useful in future genetic association studies. In particular, the presence of both single and duplicated alleles in chimpanzees provides a
Directory of Open Access Journals (Sweden)
Bai Yaohui
2008-06-01
Full Text Available Abstract Background The arginine vasopressin V1a receptor (V1aR modulates social cognition and behavior in a wide variety of species. Variation in a repetitive microsatellite element in the 5' flanking region of the V1aR gene (AVPR1A in rodents has been associated with variation in brain V1aR expression and in social behavior. In humans, the 5' flanking region of AVPR1A contains a tandem duplication of two ~350 bp, microsatellite-containing elements located approximately 3.5 kb upstream of the transcription start site. The first block, referred to as DupA, contains a polymorphic (GT25 microsatellite; the second block, DupB, has a complex (CT4-(TT-(CT8-(GT24 polymorphic motif, known as RS3. Polymorphisms in RS3 have been associated with variation in sociobehavioral traits in humans, including autism spectrum disorders. Thus, evolution of these regions may have contributed to variation in social behavior in primates. We examined the structure of these regions in six ape, six monkey, and one prosimian species. Results Both tandem repeat blocks are present upstream of the AVPR1A coding region in five of the ape species we investigated, while monkeys have only one copy of this region. As in humans, the microsatellites within DupA and DupB are polymorphic in many primate species. Furthermore, both single (lacking DupB and duplicated alleles (containing both DupA and DupB are present in chimpanzee (Pan troglodytes populations with allele frequencies of 0.795 and 0.205 for the single and duplicated alleles, respectively, based on the analysis of 47 wild-caught individuals. Finally, a phylogenetic reconstruction suggests two alternate evolutionary histories for this locus. Conclusion There is no obvious relationship between the presence of the RS3 duplication and social organization in primates. However, polymorphisms identified in some species may be useful in future genetic association studies. In particular, the presence of both single and duplicated
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
Siebor, Eliane; Neuwirth, Catherine
2014-12-01
To analyse the genetic environment of the antibiotic resistance genes in two clinical Proteus mirabilis isolates resistant to multiple antibiotics. PCR, gene walking and whole-genome sequencing were used to determine the sequence of the resistance regions, the surrounding genetic structure and the flanking chromosomal regions. A genomic island of 81.1 kb named Proteus genomic island 1 (PGI1) located at the 3'-end of trmE (formerly known as thdF) was characterized. The large MDR region of PGI1 (55.4 kb) included a class 1 integron (aadB and aadA2) and regions deriving from several transposons: Tn2 (blaTEM-135), Tn21, Tn6020-like transposon (aphA1b), a hybrid Tn502/Tn5053 transposon, Tn501, a hybrid Tn1696/Tn1721 transposon [tetA(A)] carrying a class 1 integron (aadA1) and Tn5393 (strA and strB). Several ISs were also present (IS4321, IS1R and IS26). The PGI1 backbone (25.7 kb) was identical to that identified in Salmonella Heidelberg SL476 and shared some identity with the Salmonella genomic island 1 (SGI1) backbone. An IS26-mediated recombination event caused the division of the MDR region into two parts separated by a large chromosomal DNA fragment of 197 kb, the right end of PGI1 and this chromosomal sequence being in inverse orientation. PGI1 is a new resistance genomic island from P. mirabilis belonging to the same island family as SGI1. The role of PGI1 in the spread of antimicrobial resistance genes among Enterobacteriaceae of medical importance needs to be evaluated. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Singer Peter A
2005-01-01
Full Text Available Abstract Background While innovations in medicine, science and technology have resulted in improved health and quality of life for many people, the benefits of modern medicine continue to elude millions of people in many parts of the world. To assess the potential of genomics to address health needs in EMR, the World Health Organization's Eastern Mediterranean Regional Office and the University of Toronto Joint Centre for Bioethics jointly organized a Genomics and Public Health Policy Executive Course, held September 20th–23rd, 2003, in Muscat, Oman. The 4-day course was sponsored by WHO-EMRO with additional support from the Canadian Program in Genomics and Global Health. The overall objective of the course was to collectively explore how to best harness genomics to improve health in the region. This article presents the course findings and recommendations for genomics policy in EMR. Methods The course brought together senior representatives from academia, biotechnology companies, regulatory bodies, media, voluntary, and legal organizations to engage in discussion. Topics covered included scientific advances in genomics, followed by innovations in business models, public sector perspectives, ethics, legal issues and national innovation systems. Results A set of recommendations, summarized below, was formulated for the Regional Office, the Member States and for individuals. • Advocacy for genomics and biotechnology for political leadership; • Networking between member states to share information, expertise, training, and regional cooperation in biotechnology; coordination of national surveys for assessment of health biotechnology innovation systems, science capacity, government policies, legislation and regulations, intellectual property policies, private sector activity; • Creation in each member country of an effective National Body on genomics, biotechnology and health to: - formulate national biotechnology strategies - raise
Washington, Shannan D; Musarrat, Farhana; Ertel, Monica K; Backes, Gregory L; Neumann, Donna M
2018-04-15
There are seven conserved CTCF binding domains in the herpes simplex virus 1 (HSV-1) genome. These binding sites individually flank the latency-associated transcript (LAT) and the immediate early (IE) gene regions, suggesting that CTCF insulators differentially control transcriptional domains in HSV-1 latency. In this work, we show that two CTCF binding motifs in HSV-1 display enhancer blocking in a cell-type-specific manner. We found that CTCF binding to the latent HSV-1 genome was LAT dependent and that the quantity of bound CTCF was site specific. Following reactivation, CTCF eviction was dynamic, suggesting that each CTCF site was independently regulated. We explored whether CTCF sites recruit the polycomb-repressive complex 2 (PRC2) to establish repressive domains through a CTCF-Suz12 interaction and found that Suz12 colocalized to the CTCF insulators flanking the ICP0 and ICP4 regions and, conversely, was removed at early times postreactivation. Collectively, these data support the idea that CTCF sites in HSV-1 are independently regulated and may contribute to lytic-latent HSV-1 control in a site-specific manner. IMPORTANCE The role of chromatin insulators in DNA viruses is an area of interest. It has been shown in several beta- and gammaherpesviruses that insulators likely control the lytic transcriptional profile through protein recruitment and through the formation of three-dimensional (3D) chromatin loops. The ability of insulators to regulate alphaherpesviruses has been understudied to date. The alphaherpesvirus HSV-1 has seven conserved insulator binding motifs that flank regions of the genome known to contribute to the establishment of latency. Our work presented here contributes to the understanding of how insulators control transcription of HSV-1. Copyright © 2018 American Society for Microbiology.
Genomic imprinting of IGF2 in marsupials is methylation dependent
Directory of Open Access Journals (Sweden)
Imumorin Ikhide
2008-05-01
Full Text Available Abstract Background- Parent-specific methylation of specific CpG residues is critical to imprinting in eutherian mammals, but its importance to imprinting in marsupials and, thus, the evolutionary origins of the imprinting mechanism have been the subject of controversy. This has been particularly true for the imprinted Insulin-like Growth Factor II (IGF2, a key regulator of embryonic growth in vertebrates and a focal point of the selective forces leading to genomic imprinting. The presence of the essential imprinting effector, DNMT3L, in marsupial genomes and the demonstration of a differentially methylated region (DMR in the retrotransposon-derived imprinted gene, PEG10, in tammar wallaby argue for a role for methylation in imprinting, but several studies have found no evidence of parent-specific methylation at other imprinted loci in marsupials. Results- We performed the most extensive search to date for allele-specific patterns of CpG methylation within CpG isochores or CpG enriched segments across a 22 kilobase region surrounding the IGF2 gene in the South American opossum Monodelphis domestica. We identified a previously unknown 5'-untranslated exon for opossum IGF2, which is flanked by sequences defining a putative neonatal promoter, a DMR and an active Matrix Attachment Region (MAR. Demethylation of this DMR in opossum neonatal fibroblasts results in abherrant biallelic expression of IGF2. Conclusion- The demonstration of a DMR and an active MAR in the 5' flank of opossum IGF2 mirrors the regulatory features of the 5' flank of Igf2 in mice. However, demethylation induced activation of the maternal allele of IGF2 in opossum differs from the demethylation induced repression of the paternal Igf2 allele in mice. While it can now be concluded that parent-specific DNA methylation is an epigentic mark common to Marsupialia and Eutheria, the molecular mechanisms of transcriptional silencing at imprinted loci have clearly evolved along independent
Directory of Open Access Journals (Sweden)
Tobias Mourier
Full Text Available BACKGROUND: Eukaryotic genomes are scattered with retroelements that proliferate through retrotransposition. Although retroelements make up around 40 percent of the human genome, large regions are found to be completely devoid of retroelements. This has been hypothesised to be a result of genomic regions being intolerant to insertions of retroelements. The inadvertent transcriptional activity of retroelements may affect neighbouring genes, which in turn could be detrimental to an organism. We speculate that such retroelement transcription, or transcriptional interference, is a contributing factor in generating and maintaining retroelement-free regions in the human genome. METHODOLOGY/PRINCIPAL FINDINGS: Based on the known transcriptional properties of retroelements, we expect long interspersed elements (LINEs to be able to display a high degree of transcriptional interference. In contrast, we expect short interspersed elements (SINEs to display very low levels of transcriptional interference. We find that genomic regions devoid of long interspersed elements (LINEs are enriched for protein-coding genes, but that this is not the case for regions devoid of short interspersed elements (SINEs. This is expected if genes are subject to selection against transcriptional interference. We do not find microRNAs to be associated with genomic regions devoid of either SINEs or LINEs. We further observe an increased relative activity of genes overlapping LINE-free regions during early embryogenesis, where activity of LINEs has been identified previously. CONCLUSIONS/SIGNIFICANCE: Our observations are consistent with the notion that selection against transcriptional interference has contributed to the maintenance and/or generation of retroelement-free regions in the human genome.
International Nuclear Information System (INIS)
Hickey, M.J.; Williams, S.A.; Roth, G.J.
1989-01-01
The glycoprotein (GP) Ib-IX complex on the surface of human platelets functions as the von Willebrand factor receptor and mediates von Willebrand factor-dependent platelet adhesion to blood vessels. GPIX is a relatively small (M r , 17,000) protein that may provide for membrane insertion and orientation of the larger component of the complex. GPIb (M r , 165,000). Using antibody screening, the authors cloned a cDNA encoding GPIX from a human erythroleukemia cell cDNA library constructed in phage λgt11. Lacking a 5' untranslated region and start codon, the cDNA sequence includes 604 nucleotides, beginning with 495 bases at the 5' end coding for 165 amino acids, followed by a stop codon and 106 noncoding bases at the 3' end. By Northern blot analysis, the GPIX cDNA hybridizes with a single 1.0-kilobase species of platelet poly(A) + RNA. Translation of the cDNA sequence gives a predicted protein sequence beginning with a truncated putative signal sequence of 5 amino acids followed by a sequence of 17 amino acids matching that determined directly by Edman degradation of intact GPIX. GPIX contains a leucine-rich glycoprotein (LRG) sequence of 24 amino acids similar to conserved LRG sequences in GPIb and other proteins from humans, Drosophila, and yeast. The role of the flank-LRG center-flank structure in the evolution and function of the LRG proteins remains to be defined
Trade-off between Transcriptome Plasticity and Genome Evolution in Cephalopods.
Liscovitch-Brauer, Noa; Alon, Shahar; Porath, Hagit T; Elstein, Boaz; Unger, Ron; Ziv, Tamar; Admon, Arie; Levanon, Erez Y; Rosenthal, Joshua J C; Eisenberg, Eli
2017-04-06
RNA editing, a post-transcriptional process, allows the diversification of proteomes beyond the genomic blueprint; however it is infrequently used among animals for this purpose. Recent reports suggesting increased levels of RNA editing in squids thus raise the question of the nature and effects of these events. We here show that RNA editing is particularly common in behaviorally sophisticated coleoid cephalopods, with tens of thousands of evolutionarily conserved sites. Editing is enriched in the nervous system, affecting molecules pertinent for excitability and neuronal morphology. The genomic sequence flanking editing sites is highly conserved, suggesting that the process confers a selective advantage. Due to the large number of sites, the surrounding conservation greatly reduces the number of mutations and genomic polymorphisms in protein-coding regions. This trade-off between genome evolution and transcriptome plasticity highlights the importance of RNA recoding as a strategy for diversifying proteins, particularly those associated with neural function. PAPERCLIP. Copyright © 2017 Elsevier Inc. All rights reserved.
Draft genome of the American Eel (Anguilla rostrata).
Pavey, Scott A; Laporte, Martin; Normandeau, Eric; Gaudin, Jérémy; Letourneau, Louis; Boisvert, Sébastien; Corbeil, Jacques; Audet, Céline; Bernatchez, Louis
2017-07-01
Freshwater eels (Anguilla sp.) have large economic, cultural, ecological and aesthetic importance worldwide, but they suffered more than 90% decline in global stocks over the past few decades. Proper genetic resources, such as sequenced, assembled and annotated genomes, are essential to help plan sustainable recoveries by identifying physiological, biochemical and genetic mechanisms that caused the declines or that may lead to recoveries. Here, we present the first sequenced genome of the American eel. This genome contained 305 043 contigs (N50 = 7397) and 79 209 scaffolds (N50 = 86 641) for a total size of 1.41 Gb, which is in the middle of the range of previous estimations for this species. In addition, protein-coding regions, including introns and flanking regions, are very well represented in the genome, as 95.2% of the 458 core eukaryotic genes and 98.8% of the 248 ultra-conserved subset were represented in the assembly and a total of 26 564 genes were annotated for future functional genomics studies. We performed a candidate gene analysis to compare three genes among all three freshwater eel species and, congruent with the phylogenetic relationships, Japanese eel (A. japanica) exhibited the most divergence. Overall, the sequenced genome presented in this study is a crucial addition to the presently available genetic tools to help guide future conservation efforts of freshwater eels. © 2016 John Wiley & Sons Ltd.
Identification of low-confidence regions in the pig reference genome (Sscrofa10.2
Directory of Open Access Journals (Sweden)
Amanda eWarr
2015-11-01
Full Text Available Many applications of high throughput sequencing rely on the availability of an accurate reference genome. Variant calling often produces large data sets that cannot be realistically validated and which may contain large numbers of false-positives. Errors in the reference assembly increase the number of false-positives. While resources are available to aid in the filtering of variants from human data, for other species these do not yet exist and strict filtering techniques must be employed which are more likely to exclude true-positives. This work assesses the accuracy of the pig reference genome (Sscrofa10.2 using whole genome sequencing reads from the Duroc sow whose genome the assembly was based on. Indicators of structural variation including high regional coverage, unexpected insert sizes, improper pairing and homozygous variants were used to identify low quality (LQ regions of the assembly. Low coverage (LC regions were also identified and analyzed separately. The LQ regions covered 13.85% of the genome, the LC regions covered 26.6% of the genome and combined (LQLC they covered 33.07% of the genome. Over half of dbSNP variants were located in the LQLC regions. Of CNVRs identified in a previous study, 86.3% were located in the LQLC regions. The regions were also enriched for gene predictions from RNA-seq data with 42.98% falling in the LQLC regions. Excluding variants in the LQ, LC or LQLC from future analyses will help reduce the number of false-positive variant calls. Researchers using WGS data should be aware that the current pig reference genome does not give an accurate representation of the copy number of alleles in the original Duroc sow’s genome.
Energy Technology Data Exchange (ETDEWEB)
McGinnis, R.E.; Spielman, R.S. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)
1994-09-01
The 5{prime} flanking polymorphism (5{prime}FP), a hypervariable region at the 5{prime} end of the insulin gene, has {open_quotes}class 1{close_quotes} alleles (650-900 bp long) that are in positive linkage disequilibrium with insulin-dependent diabetes mellitus (IDDM). The authors report that precise sizing of the 5{prime}FP yields a bimodal frequency distribution of class 1 allele lengths. Class 1 alleles belonging to the lower component (650-750 bp) of the bimodal distribution were somewhat more highly associated with IDDM than were alleles from the upper component (760-900 bp), but the difference was not statistically significant. They also examined 5{prime}FP length variation in relation to allelic variation at nearby polymorphisms. At biallelic RFLPs on both sides of the 5{prime}FP, they found that one allele exhibits near-total association with the upper component of the 5FP class 1 distribution. Such associations represent a little-known but potentially wide-spread form of linkage disequilibrium. In this type of disequilibrium, a flanking allele has near-complete association with a single mode of VNTR alleles whose lengths represent consecutive numbers of tandem repeats (CNTR). Such extreme disequilibrium between a CNTR mode and flanking alleles may originate and persist because length mutations at some VNTR loci usually add or delete only one or two repeat units. 22 refs., 5 figs., 6 tabs.
DEFF Research Database (Denmark)
Mourier, Tobias; Willerslev, Eske
2008-01-01
in generating and maintaining retroelement-free regions in the human genome. METHODOLOGY/PRINCIPAL FINDINGS: Based on the known transcriptional properties of retroelements, we expect long interspersed elements (LINEs) to be able to display a high degree of transcriptional interference. In contrast, we expect......BACKGROUND: Eukaryotic genomes are scattered with retroelements that proliferate through retrotransposition. Although retroelements make up around 40 percent of the human genome, large regions are found to be completely devoid of retroelements. This has been hypothesised to be a result of genomic...... activity of LINEs has been identified previously. CONCLUSIONS/SIGNIFICANCE: Our observations are consistent with the notion that selection against transcriptional interference has contributed to the maintenance and/or generation of retroelement-free regions in the human genome....
CpG islands undermethylation in human genomic regions under selective pressure.
Directory of Open Access Journals (Sweden)
Sergio Cocozza
Full Text Available DNA methylation at CpG islands (CGIs is one of the most intensively studied epigenetic mechanisms. It is fundamental for cellular differentiation and control of transcriptional potential. DNA methylation is involved also in several processes that are central to evolutionary biology, including phenotypic plasticity and evolvability. In this study, we explored the relationship between CpG islands methylation and signatures of selective pressure in Homo Sapiens, using a computational biology approach. By analyzing methylation data of 25 cell lines from the Encyclopedia of DNA Elements (ENCODE Consortium, we compared the DNA methylation of CpG islands in genomic regions under selective pressure with the methylation of CpG islands in the remaining part of the genome. To define genomic regions under selective pressure, we used three different methods, each oriented to provide distinct information about selective events. Independently of the method and of the cell type used, we found evidences of undermethylation of CGIs in human genomic regions under selective pressure. Additionally, by analyzing SNP frequency in CpG islands, we demonstrated that CpG islands in regions under selective pressure show lower genetic variation. Our findings suggest that the CpG islands in regions under selective pressure seem to be somehow more "protected" from methylation when compared with other regions of the genome.
RGmatch: matching genomic regions to proximal genes in omics data integration
Directory of Open Access Journals (Sweden)
Pedro Furió-Tarí
2016-11-01
Full Text Available Abstract Background The integrative analysis of multiple genomics data often requires that genome coordinates-based signals have to be associated with proximal genes. The relative location of a genomic region with respect to the gene (gene area is important for functional data interpretation; hence algorithms that match regions to genes should be able to deliver insight into this information. Results In this work we review the tools that are publicly available for making region-to-gene associations. We also present a novel method, RGmatch, a flexible and easy-to-use Python tool that computes associations either at the gene, transcript, or exon level, applying a set of rules to annotate each region-gene association with the region location within the gene. RGmatch can be applied to any organism as long as genome annotation is available. Furthermore, we qualitatively and quantitatively compare RGmatch to other tools. Conclusions RGmatch simplifies the association of a genomic region with its closest gene. At the same time, it is a powerful tool because the rules used to annotate these associations are very easy to modify according to the researcher’s specific interests. Some important differences between RGmatch and other similar tools already in existence are RGmatch’s flexibility, its wide range of user options, compatibility with any annotatable organism, and its comprehensive and user-friendly output.
Flanking region sequence information to refine microRNA target ...
Indian Academy of Sciences (India)
Prakash
(SVM)-based target prediction refinement approach has been introduced through .... are kernel-based statistical learning machines, where a discriminant ...... Cox T and Cuff J 2002 The Ensembl genome database project;. Nucleic Acids Res.
International Nuclear Information System (INIS)
Kuhn, R.J.; Tada, H.; Ypma-Wong, M.F.; Dunn, J.J.; Semler, B.L.; Wimmer, E.
1988-01-01
By following a strategy of genetic analysis of poliovirus, the authors have constructed a synthetic mutagenesis cartridge spanning the genome-linked viral protein coding region and flanking cleavage sites in an infectious cDNA clone of the type I (Mahoney) genome. The insertion of new restriction sites within the infectious clone has allowed them to replace the wild-type sequences with short complementary pairs of synthetic oligonucleotides containing various mutations. A set of mutations have been made that create methionine codons within the genome-linked viral protein region. The resulting viruses have growth characteristics similar to wild type. Experiments that led to an alteration of the tyrosine residue responsible for the linkage to RNA have resulted in nonviable virus. In one mutant, proteolytic processing assayed in vitro appeared unimpaired by the mutation. They suggest that the position of the tyrosine residue is important for genome-linked viral protein function(s)
Bakhtiar, R; Abdolmohammadi, A; Hajarian, H; Nikousefat, Z; Kalantar-Neyestanaki, D
2017-12-01
In this study, semen samples were collected from 96 Sanjabi rams in order to investigate the IGF-1 gene polymorphisms and their relationship with the characteristics of semen quality and testicular size. The dimensions of scrotal length, width and circumference were measured during autumn and spring over two years. Blood samples were simultaneously collected from jugular vein to extract DNA. PCR was performed using specific primers to amplify 294 and 272bp fragments including 5' regulatory region and exon 3 of IGF-1 gene, respectively. PCR products were digested by BFOI and Eco88l restriction enzymes, respectively. Two genotypes including AA (194 and 100bp), AB (294, 194 and 100bp) and all possible genotypes including CC (182 and 90bp), CT (272, 182, and 90bp) and TT (272bp) were observed for 5' flanking region and exon 3 of IGF-1 gene, respectively. The significant differences among IGF-1 genotypes for testicular dimensions were not observed. However, the polymorphism of 5' flanking region in the studied population had significant effect on individual motility and percent morphology traits. Animals with AB genotype had significantly higher individual motility compared with AA genotype (P IGF-1 gene had significant effect on individual motility, concentration, morphology and water test traits. Animals with CT genotype had the highest sperm concentration (P IGF-1 genotypes. It might be concluded that polymorphisms in IGF-1gene can be considered to develop male fertility in future and for using in selection process of better animals under masker assisted selection programs. Copyright © 2017 Elsevier Inc. All rights reserved.
Walker, Joseph F; Zanis, Michael J; Emery, Nancy C
2014-04-01
Complete chloroplast genome studies can help resolve relationships among large, complex plant lineages such as Asteraceae. We present the first whole plastome from the Madieae tribe and compare its sequence variation to other chloroplast genomes in Asteraceae. We used high throughput sequencing to obtain the Lasthenia burkei chloroplast genome. We compared sequence structure and rates of molecular evolution in the small single copy (SSC), large single copy (LSC), and inverted repeat (IR) regions to those for eight Asteraceae accessions and one Solanaceae accession. The chloroplast sequence of L. burkei is 150 746 bp and contains 81 unique protein coding genes and 4 coding ribosomal RNA sequences. We identified three major inversions in the L. burkei chloroplast, all of which have been found in other Asteraceae lineages, and a previously unreported inversion in Lactuca sativa. Regions flanking inversions contained tRNA sequences, but did not have particularly high G + C content. Substitution rates varied among the SSC, LSC, and IR regions, and rates of evolution within each region varied among species. Some observed differences in rates of molecular evolution may be explained by the relative proportion of coding to noncoding sequence within regions. Rates of molecular evolution vary substantially within and among chloroplast genomes, and major inversion events may be promoted by the presence of tRNAs. Collectively, these results provide insight into different mechanisms that may promote intramolecular recombination and the inversion of large genomic regions in the plastome.
Attenuation of monkeypox virus by deletion of genomic regions
Lopera, Juan G.; Falendysz, Elizabeth A.; Rocke, Tonie E.; Osorio, Jorge E.
2015-01-01
Monkeypox virus (MPXV) is an emerging pathogen from Africa that causes disease similar to smallpox. Two clades with different geographic distributions and virulence have been described. Here, we utilized bioinformatic tools to identify genomic regions in MPXV containing multiple virulence genes and explored their roles in pathogenicity; two selected regions were then deleted singularly or in combination. In vitro and in vivostudies indicated that these regions play a significant role in MPXV replication, tissue spread, and mortality in mice. Interestingly, while deletion of either region led to decreased virulence in mice, one region had no effect on in vitro replication. Deletion of both regions simultaneously also reduced cell culture replication and significantly increased the attenuation in vivo over either single deletion. Attenuated MPXV with genomic deletions present a safe and efficacious tool in the study of MPX pathogenesis and in the identification of genetic factors associated with virulence.
Genome-wide analysis of regions similar to promoters of histone genes
Chowdhary, Rajesh
2010-05-28
Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
Le Gal, V.; Lucazeau, F.; Cannat, M.; Poort, J.; Monnin, C.; Battani, A.; Fontaine, F.; Goutorbe, B.; Rolandone, F.; Poitou, C.; Blanc-Valleron, M.-M.; Piedade, A.; Hipólito, A.
2018-01-01
Hydrothermal circulation affects heat and mass transfers in the oceanic lithosphere, not only at the ridge axis but also on their flanks, where the magnitude of this process has been related to sediment blanket and seamounts density. This was documented in several areas of the Pacific Ocean by heat flow measurements and pore water analysis. However, as the morphology of Atlantic and Indian ridge flanks is generally rougher than in the Pacific, these regions of slow and ultra-slow accretion may be affected by hydrothermal processes of different regimes. We carried out a survey of two regions on the eastern and western flanks of the Mid-Atlantic Ridge between Oceanographer and Hayes fracture zones. Two hundred and eight new heat flow measurements were obtained along six seismic profiles, on 5 to 14 Ma old seafloor. Thirty sediment cores (from which porewaters have been extracted) have been collected with a Kullenberg corer equipped with thermistors thus allowing simultaneous heat flow measurement. Most heat flow values are lower than those predicted by purely conductive cooling models, with some local variations and exceptions: heat flow values on the eastern flank of the study area are more variable than on the western flank, where they tend to increase westward as the sedimentary cover in the basins becomes thicker and more continuous. Heat flow is also higher, on average, on the northern sides of both the western and eastern field regions and includes values close to conductive predictions near the Oceanographer Fracture Zone. All the sediment porewaters have a chemical composition similar to that of bottom seawater (no anomaly linked to fluid circulation has been detected). Heat flow values and pore fluid compositions are consistent with fluid circulation in volcanic rocks below the sediment. The short distances between seamounts and short fluid pathways explain that fluids flowing in the basaltic aquifer below the sediment have remained cool and unaltered
Directory of Open Access Journals (Sweden)
S. Yu. Sokolov
2017-01-01
Full Text Available This article presents the first map showing the vertical amplitudes of modern disjunctive dislocations inNorthern Atlantic, based on the estimated phase shifts of reflected waves recorded by high-frequency seismic acoustic surveys. The amplitude distribution pattern is mosaic with alternating areas of compression and extension in the flanks of the Knipovich rift system. The modern structure of the Knipovich Ridge, including two strike-slip faults, represents a local rift in the pull-apart setting. The asymmetry of stresses and the presence of compression in the ridge flanks is evidenced by the distribution of the focal mechanisms of strong earthquakes related to reverse faults. In the southeastern Knipovich Ridge, tectonic activity is marked by the asymmetric pattern of the epicenters of small earthquakes.
Right psoas abscess following right flank trauma: a case report ...
African Journals Online (AJOL)
This is a case of 15 year old boy who presented with three weeks history of right flank pain, two weeks history of fever and five days history of inability to walk well. There was history of right flank trauma a week before the onset of right flank pain. He had earlier presented in two different hospitals before he was brought to our ...
Directory of Open Access Journals (Sweden)
Christina L. Zheng
2014-11-01
Full Text Available Somatic mutations in cancer are more frequent in heterochromatic and late-replicating regions of the genome. We report that regional disparities in mutation density are virtually abolished within transcriptionally silent genomic regions of cutaneous squamous cell carcinomas (cSCCs arising in an XPC−/− background. XPC−/− cells lack global genome nucleotide excision repair (GG-NER, thus establishing differential access of DNA repair machinery within chromatin-rich regions of the genome as the primary cause for the regional disparity. Strikingly, we find that increasing levels of transcription reduce mutation prevalence on both strands of gene bodies embedded within H3K9me3-dense regions, and only to those levels observed in H3K9me3-sparse regions, also in an XPC-dependent manner. Therefore, transcription appears to reduce mutation prevalence specifically by relieving the constraints imposed by chromatin structure on DNA repair. We model this relationship among transcription, chromatin state, and DNA repair, revealing a new, personalized determinant of cancer risk.
Linkage disequilibrium of evolutionarily conserved regions in the human genome
Directory of Open Access Journals (Sweden)
Johnson Todd A
2006-12-01
Full Text Available Abstract Background The strong linkage disequilibrium (LD recently found in genic or exonic regions of the human genome demonstrated that LD can be increased by evolutionary mechanisms that select for functionally important loci. This suggests that LD might be stronger in regions conserved among species than in non-conserved regions, since regions exposed to natural selection tend to be conserved. To assess this hypothesis, we used genome-wide polymorphism data from the HapMap project and investigated LD within DNA sequences conserved between the human and mouse genomes. Results Unexpectedly, we observed that LD was significantly weaker in conserved regions than in non-conserved regions. To investigate why, we examined sequence features that may distort the relationship between LD and conserved regions. We found that interspersed repeats, and not other sequence features, were associated with the weak LD tendency in conserved regions. To appropriately understand the relationship between LD and conserved regions, we removed the effect of repetitive elements and found that the high degree of sequence conservation was strongly associated with strong LD in coding regions but not with that in non-coding regions. Conclusion Our work demonstrates that the degree of sequence conservation does not simply increase LD as predicted by the hypothesis. Rather, it implies that purifying selection changes the polymorphic patterns of coding sequences but has little influence on the patterns of functional units such as regulatory elements present in non-coding regions, since the former are generally restricted by the constraint of maintaining a functional protein product across multiple exons while the latter may exist more as individually isolated units.
Pore Pressure Distribution and Flank Instability in Hydrothermally Altered Stratovolcanoes
Ball, J. L.; Taron, J.; Hurwitz, S.; Reid, M. E.
2015-12-01
Field and geophysical investigations of stratovolcanoes with long-lived hydrothermal systems commonly reveal that initially permeable regions (such as brecciated layers of pyroclastic material) can become both altered and water-bearing. Hydrothermal alteration in these regions, including clay formation, can turn them into low-permeability barriers to fluid flow, which could increase pore fluid pressures resulting in flank slope instability. We examined elevated pore pressure conditions using numerical models of hydrothermal flow in stratovolcanoes, informed by geophysical data about internal structures and deposits. Idealized radially symmetric meshes were developed based on cross-sectional profiles and alteration/permeability structures of Cascade Range stratovolcanoes. We used the OpenGeoSys model to simulate variably saturated conditions in volcanoes heated only by regional heat fluxes, as well as 650°C intrusions at two km depth below the surface. Meteoric recharge was estimated from precipitation rates in the Cascade Range. Preliminary results indicate zones of elevated pore pressures form: 1) where slopes are underlain by continuous low-permeability altered layers, or 2) when the edifice has an altered core with saturated, less permeable limbs. The first scenario might control shallow collapses on the slopes above the altered layers. The second could promote deeper flank collapses that are initially limited to the summit and upper slopes, but could progress to the core of an edifice. In both scenarios, pore pressures can be further elevated by shallow intrusions, or evolve over longer time scales under forcing from regional heat flux. Geometries without confining low-permeability layers do not show these pressure effects. Our initial scenarios use radially symmetric models, but we are also simulating hydrothermal flow under real 3D geometries with asymmetric subsurface structures (Mount Adams). Simulation results will be used to inform 3D slope
Origin of the duplicated regions in the yeast genomes
DEFF Research Database (Denmark)
Piskur, Jure
2001-01-01
The genome of Saccharomyces cerevisiae contains several duplicated regions. The recent sequencing results of several yeast species suggest that the duplicated regions found in the modern Saccharomyces species are probably the result of a single gross duplication, as well as a series of sporadic...
The transcriptionally active regions in the genome of Bacillus subtilis
DEFF Research Database (Denmark)
Rasmussen, Simon; Nielsen, Henrik Bjørn; Jarmer, Hanne Østergaard
2009-01-01
The majority of all genes have so far been identified and annotated systematically through in silico gene finding. Here we report the finding of 3662 strand-specific transcriptionally active regions (TARs) in the genome of Bacillus subtilis by the use of tiling arrays. We have measured the genome...
Selective constraint on noncoding regions of hominid genomes.
Directory of Open Access Journals (Sweden)
Eliot C Bush
2005-12-01
Full Text Available An important challenge for human evolutionary biology is to understand the genetic basis of human-chimpanzee differences. One influential idea holds that such differences depend, to a large extent, on adaptive changes in gene expression. An important step in assessing this hypothesis involves gaining a better understanding of selective constraint on noncoding regions of hominid genomes. In noncoding sequence, functional elements are frequently small and can be separated by large nonfunctional regions. For this reason, constraint in hominid genomes is likely to be patchy. Here we use conservation in more distantly related mammals and amniotes as a way of identifying small sequence windows that are likely to be functional. We find that putatively functional noncoding elements defined in this manner are subject to significant selective constraint in hominids.
Selective Constraint on Noncoding Regions of Hominid Genomes.
Directory of Open Access Journals (Sweden)
2005-12-01
Full Text Available An important challenge for human evolutionary biology is to understand the genetic basis of human-chimpanzee differences. One influential idea holds that such differences depend, to a large extent, on adaptive changes in gene expression. An important step in assessing this hypothesis involves gaining a better understanding of selective constraint on noncoding regions of hominid genomes. In noncoding sequence, functional elements are frequently small and can be separated by large nonfunctional regions. For this reason, constraint in hominid genomes is likely to be patchy. Here we use conservation in more distantly related mammals and amniotes as a way of identifying small sequence windows that are likely to be functional. We find that putatively functional noncoding elements defined in this manner are subject to significant selective constraint in hominids.
Osipova, Svetlana; Permyakov, Alexey; Permyakova, Marina; Pshenichnikova, Tatyana; Verkhoturov, Vasiliy; Rudikovsky, Alexandr; Rudikovskaya, Elena; Shishparenok, Alexandr; Doroshkov, Alexey; Börner, Andreas
2016-05-01
A quantitative trait locus (QTL) approach was taken to reveal the genetic basis in wheat of traits associated with photosynthesis during a period of exposure to water deficit stress. The performance, with respect to shoot biomass, gas exchange and chlorophyll fluorescence, leaf pigment content and the activity of various ascorbate-glutathione cycle enzymes and catalase, of a set of 80 wheat lines, each containing a single chromosomal segment introgressed from the bread wheat D genome progenitor Aegilops tauschii, was monitored in plants exposed to various water regimes. Four of the seven D genome chromosomes (1D, 2D, 5D, and 7D) carried clusters of both major (LOD >3.0) and minor (LOD between 2.0 and 3.0) QTL. A major QTL underlying the activity of glutathione reductase was located on chromosome 2D, and another, controlling the activity of ascorbate peroxidase, on chromosome 7D. A region of chromosome 2D defined by the microsatellite locus Xgwm539 and a second on chromosome 7D flanked by the marker loci Xgwm1242 and Xgwm44 harbored a number of QTL associated with the water deficit stress response.
Directory of Open Access Journals (Sweden)
Sahu Binod B
2012-01-01
Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for
Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis
DEFF Research Database (Denmark)
Ladefoged, Søren; Christiansen, Gunna
1994-01-01
of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene.......The homolog of the gyrB gene, which has been reported to be present in the vicinity of the initiation site of replication in bacteria, was mapped on the Mycoplasma hominis genome, and the region was subsequently sequenced. Five open reading frames were identified flanking the gyrB gene, one...
Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.
Directory of Open Access Journals (Sweden)
Mohammed Uddin
Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.
Genomic Islands: an overview of current software tools and future improvements
Directory of Open Access Journals (Sweden)
Soares Siomar de Castro
2016-03-01
Full Text Available Microbes are highly diverse and widely distributed organisms. They account for ~60% of Earth’s biomass and new predictions point for the existence of 1011 to 1012 species, which are constantly sharing genes through several different mechanisms. Genomic Islands (GI are critical in this context, as they are large regions acquired through horizontal gene transfer. Also, they present common features like genomic signature deviation, transposase genes, flanking tRNAs and insertion sequences. GIs carry large numbers of genes related to specific lifestyle and are commonly classified in Pathogenicity, Resistance, Metabolic or Symbiotic Islands. With the advent of the next-generation sequencing technologies and the deluge of genomic data, many software tools have been developed that aim to tackle the problem of GI prediction and they are all based on the prediction of GI common features. However, there is still room for the development of new software tools that implements new approaches, such as, machine learning and pangenomics based analyses. Finally, GIs will always hold a potential application in every newly invented genomic approach as they are directly responsible for much of the genomic plasticity of bacteria.
Genomic Islands: an overview of current software tools and future improvements.
Soares, Siomar de Castro; Oliveira, Letícia de Castro; Jaiswal, Arun Kumar; Azevedo, Vasco
2016-03-01
Microbes are highly diverse and widely distributed organisms. They account for ~60% of Earth's biomass and new predictions point for the existence of 1011 to 1012 species, which are constantly sharing genes through several different mechanisms. Genomic Islands (GI) are critical in this context, as they are large regions acquired through horizontal gene transfer. Also, they present common features like genomic signature deviation, transposase genes, flanking tRNAs and insertion sequences. GIs carry large numbers of genes related to specific lifestyle and are commonly classified in Pathogenicity, Resistance, Metabolic or Symbiotic Islands. With the advent of the next-generation sequencing technologies and the deluge of genomic data, many software tools have been developed that aim to tackle the problem of GI prediction and they are all based on the prediction of GI common features. However, there is still room for the development of new software tools that implements new approaches, such as, machine learning and pangenomics based analyses. Finally, GIs will always hold a potential application in every newly invented genomic approach as they are directly responsible for much of the genomic plasticity of bacteria.
Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features
Directory of Open Access Journals (Sweden)
Gillet Laurent
2011-08-01
Full Text Available Abstract Background Bovine herpesvirus 4 (BoHV-4 is a useful model for the human pathogenic gammaherpesviruses Epstein-Barr virus and Kaposi's Sarcoma-associated Herpesvirus. Although genome manipulations of this virus have been greatly facilitated by the cloning of the BoHV-4 V.test strain as a Bacterial Artificial Chromosome (BAC, the lack of a complete genome sequence for this strain limits its experimental use. Methods In this study, we have determined the complete sequence of BoHV-4 V.test strain by a pyrosequencing approach. Results The long unique coding region (LUR consists of 108,241 bp encoding at least 79 open reading frames and is flanked by several polyrepetitive DNA units (prDNA. As previously suggested, we showed that the prDNA unit located at the left prDNA-LUR junction (prDNA-G differs from the other prDNA units (prDNA-inner. Namely, the prDNA-G unit lacks the conserved pac-2 cleavage and packaging signal in its right terminal region. Based on the mechanisms of cleavage and packaging of herpesvirus genomes, this feature implies that only genomes bearing left and right end prDNA units are encapsulated into virions. Conclusions In this study, we have determined the complete genome sequence of the BAC-cloned BoHV-4 V.test strain and identified genome organization features that could be important in other herpesviruses.
PCR artifact in testing for homologous recombination in genomic editing in zebrafish.
Directory of Open Access Journals (Sweden)
Minho Won
Full Text Available We report a PCR-induced artifact in testing for homologous recombination in zebrafish. We attempted to replace the lnx2a gene with a donor cassette, mediated by a TALEN induced double stranded cut. The donor construct was flanked with homology arms of about 1 kb at the 5' and 3' ends. Injected embryos (G0 were raised and outcrossed to wild type fish. A fraction of the progeny appeared to have undergone the desired homologous recombination, as tested by PCR using primer pairs extending from genomic DNA outside the homology region to a site within the donor cassette. However, Southern blots revealed that no recombination had taken place. We conclude that recombination happened during PCR in vitro between the donor integrated elsewhere in the genome and the lnx2a locus. We conclude that PCR alone may be insufficient to verify homologous recombination in genome editing experiments in zebrafish.
Genomic DNA extraction and barcoding of endophytic fungi.
Diaz, Patricia L; Hennell, James R; Sucher, Nikolaus J
2012-01-01
Endophytes live inter- and/or intracellularly inside healthy aboveground tissues of plants without causing disease. Endophytic fungi are found in virtually every vascular plant species examined. The origins of this symbiotic relationship between endophytes go back to the emergence of vascular plants. Endophytic fungi receive nutrition and protection from their hosts while the plants benefit from the production of fungal secondary metabolites, which enhance the host plants' resistance to herbivores, pathogens, and various abiotic stresses. Endophytic fungi have attracted increased interest as potential sources of secondary metabolites with agricultural, industrial, and medicinal use. This chapter provides detailed protocols for isolation of genomic DNA from fungal endophytes and its use in polymerase chain reaction-based amplification of the internal transcribed spacer region between the conserved flanking regions of the small and large subunit of ribosomal RNA for barcoding purposes.
Unilateral flank ovariohysterectomy in guinea pigs (Cavia porcellus).
Rozanska, D; Rozanski, P; Orzelski, M; Chlebicka, N; Putowska, K
2016-11-01
To describe a simple, minimally invasive method of ovariohysterectomy via a unilateral flank approach in guinea pigs, for use in routine desexing of healthy female guinea pigs or treatment of ovarian cysts. The subjects of this retrospective study were 41 client-owned guinea pigs submitted for routine desexing or treatment of ovarian cysts. They included 16 healthy female guinea pigs aged 8-12 months (Group 1), and 15 females aged from 9 months to 3 years (Group 2), and 10 females aged from 3 to 7 years (Group 3) with different-sized ovarian cysts. Prior to surgery, the animals received clinical examination, blood testing (complete blood count and serum biochemistry profile) and examination of the abdomen using ultrasonography, to assess the condition of the reproductive tract and ensure the guinea pigs were fit for surgery. Ovariohysterectomy was performed via a unilateral flank incision made close to the erector spinae muscle starting approximately 1 cm caudal to the last rib. Both ovaries, uterine horns, and the uterine cervix were localised, ligated, and dissected through this unilateral retroperitoneal incision. Ovariohysterectomy was successfully completed via a single flank incision in 38/41 (93%) guinea pigs. Three guinea pigs with ovarian cysts from Group 3, which were >6 years old died during surgery due to circulatory and respiratory failure under anaesthesia. In the remaining 38 cases, surgery proceeded without complications. A further two guinea pigs from Group 3 were reluctant to move or eat for the first 3 days after surgery but recovered after provision of supportive care. All 38 animals fully recovered and wound healing was normal. This is the first report of ovariohysterectomy via a unilateral flank incision in guinea pigs. This approach is a simple, minimally invasive and safe alternative to the midline or bilateral flank approaches currently used for surgery of the reproductive tract in guinea pigs.
Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi
2015-12-10
D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.
Highly syntenic regions in the genomes of soybean, Medicago truncatula, and Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
Roe Bruce A
2005-08-01
Full Text Available Abstract Background Recent genome sequencing enables mega-base scale comparisons between related genomes. Comparisons between animals, plants, fungi, and bacteria demonstrate extensive synteny tempered by rearrangements. Within the legume plant family, glimpses of synteny have also been observed. Characterizing syntenic relationships in legumes is important in transferring knowledge from model legumes to crops that are important sources of protein, fixed nitrogen, and health-promoting compounds. Results We have uncovered two large soybean regions exhibiting synteny with M. truncatula and with a network of segmentally duplicated regions in Arabidopsis. In all, syntenic regions comprise over 500 predicted genes spanning 3 Mb. Up to 75% of soybean genes are colinear with M. truncatula, including one region in which 33 of 35 soybean predicted genes with database support are colinear to M. truncatula. In some regions, 60% of soybean genes share colinearity with a network of A. thaliana duplications. One region is especially interesting because this 500 kbp segment of soybean is syntenic to two paralogous regions in M. truncatula on different chromosomes. Phylogenetic analysis of individual genes within these regions demonstrates that one is orthologous to the soybean region, with which it also shows substantially denser synteny and significantly lower levels of synonymous nucleotide substitutions. The other M. truncatula region is inferred to be paralogous, presumably resulting from a duplication event preceding speciation. Conclusion The presence of well-defined M. truncatula segments showing orthologous and paralogous relationships with soybean allows us to explore the evolution of contiguous genomic regions in the context of ancient genome duplication and speciation events.
Human-specific HERV-K insertion causes genomic variations in the human genome.
Directory of Open Access Journals (Sweden)
Wonseok Shin
Full Text Available Human endogenous retroviruses (HERV sequences account for about 8% of the human genome. Through comparative genomics and literature mining, we identified a total of 29 human-specific HERV-K insertions. We characterized them focusing on their structure and flanking sequence. The results showed that four of the human-specific HERV-K insertions deleted human genomic sequences via non-classical insertion mechanisms. Interestingly, two of the human-specific HERV-K insertion loci contained two HERV-K internals and three LTR elements, a pattern which could be explained by LTR-LTR ectopic recombination or template switching. In addition, we conducted a polymorphic test and observed that twelve out of the 29 elements are polymorphic in the human population. In conclusion, human-specific HERV-K elements have inserted into human genome since the divergence of human and chimpanzee, causing human genomic changes. Thus, we believe that human-specific HERV-K activity has contributed to the genomic divergence between humans and chimpanzees, as well as within the human population.
Greally, John M
2002-01-08
To test whether regions undergoing genomic imprinting have unique genomic characteristics, imprinted and nonimprinted human loci were compared for nucleotide and retroelement composition. Maternally and paternally expressed subgroups of imprinted genes were found to differ in terms of guanine and cytosine, CpG, and retroelement content, indicating a segregation into distinct genomic compartments. Imprinted regions have been normally permissive to L1 long interspersed transposable element retroposition during mammalian evolution but universally and significantly lack short interspersed transposable elements (SINEs). The primate-specific Alu SINEs, as well as the more ancient mammalian-wide interspersed repeat SINEs, are found at significantly low densities in imprinted regions. The latter paleogenomic signature indicates that the sequence characteristics of currently imprinted regions existed before the mammalian radiation. Transitions from imprinted to nonimprinted genomic regions in cis are characterized by a sharp inflection in SINE content, demonstrating that this genomic characteristic can help predict the presence and extent of regions undergoing imprinting. During primate evolution, SINE accumulation in imprinted regions occurred at a decreased rate compared with control loci. The constraint on SINE accumulation in imprinted regions may be mediated by an active selection process. This selection could be because of SINEs attracting and spreading methylation, as has been found at other loci. Methylation-induced silencing could lead to deleterious consequences at imprinted loci, where inactivation of one allele is already established, and expression is often essential for embryonic growth and survival.
Statistical analyses of conserved features of genomic islands in bacteria.
Guo, F-B; Xia, Z-K; Wei, W; Zhao, H-L
2014-03-17
We performed statistical analyses of five conserved features of genomic islands of bacteria. Analyses were made based on 104 known genomic islands, which were identified by comparative methods. Four of these features include sequence size, abnormal G+C content, flanking tRNA gene, and embedded mobility gene, which are frequently investigated. One relatively new feature, G+C homogeneity, was also investigated. Among the 104 known genomic islands, 88.5% were found to fall in the typical length of 10-200 kb and 80.8% had G+C deviations with absolute values larger than 2%. For the 88 genomic islands whose hosts have been sequenced and annotated, 52.3% of them were found to have flanking tRNA genes and 64.7% had embedded mobility genes. For the homogeneity feature, 85% had an h homogeneity index less than 0.1, indicating that their G+C content is relatively uniform. Taking all the five features into account, 87.5% of 88 genomic islands had three of them. Only one genomic island had only one conserved feature and none of the genomic islands had zero features. These statistical results should help to understand the general structure of known genomic islands. We found that larger genomic islands tend to have relatively small G+C deviations relative to absolute values. For example, the absolute G+C deviations of 9 genomic islands longer than 100,000 bp were all less than 5%. This is a novel but reasonable result given that larger genomic islands should have greater restrictions in their G+C contents, in order to maintain the stable G+C content of the recipient genome.
File list: InP.Emb.50.AllAg.Embryonic_flank [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available InP.Emb.50.AllAg.Embryonic_flank mm9 Input control Embryo Embryonic flank SRX804059... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Emb.50.AllAg.Embryonic_flank.bed ...
Forces shaping the fastest evolving regions in the human genome.
Directory of Open Access Journals (Sweden)
Katherine S Pollard
2006-10-01
Full Text Available Comparative genomics allow us to search the human genome for segments that were extensively changed in the last approximately 5 million years since divergence from our common ancestor with chimpanzee, but are highly conserved in other species and thus are likely to be functional. We found 202 genomic elements that are highly conserved in vertebrates but show evidence of significantly accelerated substitution rates in human. These are mostly in non-coding DNA, often near genes associated with transcription and DNA binding. Resequencing confirmed that the five most accelerated elements are dramatically changed in human but not in other primates, with seven times more substitutions in human than in chimp. The accelerated elements, and in particular the top five, show a strong bias for adenine and thymine to guanine and cytosine nucleotide changes and are disproportionately located in high recombination and high guanine and cytosine content environments near telomeres, suggesting either biased gene conversion or isochore selection. In addition, there is some evidence of directional selection in the regions containing the two most accelerated regions. A combination of evolutionary forces has contributed to accelerated evolution of the fastest evolving elements in the human genome.
Two Genomic Regions Involved in Catechol Siderophore Production by Erwinia carotovora
Bull, Carolee T.; Ishimaru, Carol A.; Loper, Joyce E.
1994-01-01
Two regions involved in catechol biosynthesis (cbs) of Erwinia carotovora W3C105 were cloned by functional complementation of Escherichia coli mutants that were deficient in the biosynthesis of the catechol siderophore enterobactin (ent). A 4.3-kb region of genomic DNA of E. carotovora complemented the entB402 mutation of E. coli. A second genomic region of 12.8 kb complemented entD, entC147, entE405, and entA403 mutations of E. coli. Although functions encoded by catechol biosynthesis genes (cbsA, cbsB, cbsC, cbsD, and cbsE) of E. carotovora were interchangeable with those encoded by corresponding enterobactin biosynthesis genes (entA, entB, entC, entD, and entE), only cbsE hybridized to its functional counterpart (entE) in E. coli. The cbsEA region of E. carotovora W3C105 hybridized to genomic DNA of 21 diverse strains of E. carotovora but did not hybridize to that of a chrysobactin-producing strain of Erwinia chrysanthemi. Strains of E. carotovora fell into nine groups on the basis of sizes of restriction fragments that hybridized to the cbsEA region, indicating that catechol biosynthesis genes were highly polymorphic among strains of E. carotovora. PMID:16349193
Spradling, A C; Stern, D M; Kiss, I; Roote, J; Laverty, T; Rubin, G M
1995-01-01
Biologists require genetic as well as molecular tools to decipher genomic information and ultimately to understand gene function. The Berkeley Drosophila Genome Project is addressing these needs with a massive gene disruption project that uses individual, genetically engineered P transposable elements to target open reading frames throughout the Drosophila genome. DNA flanking the insertions is sequenced, thereby placing an extensive series of genetic markers on the physical genomic map and a...
Energy Technology Data Exchange (ETDEWEB)
Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio
2006-03-01
The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential
Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain
International Nuclear Information System (INIS)
Maeda, Toyoki; Chijiiwa, Yoshiharu; Tsuji, Hideo; Sakoda, Saburo; Tani, Kenzaburo; Suzuki, Tomokazu
2004-01-01
In this study, a mouse genomic region is identified that undergoes DNA rearrangement and yields circular DNA in brain during embryogenesis. External region-directed inverse polymerase chain reaction on circular DNA extracted from late embryonic brain tissue repeatedly detected DNA of this region containing recombination joints. Wide-range genomic PCR and digestion-circularization PCR analysis showed this region underwent recombination accompanied with deletion of intervening sequences, including the circularized regions. This region was mapped by fluorescence in situ hybridization to C1 on mouse chromosome 16, where no gene and no physiological DNA rearrangement had been identified. DNA sequence in the region has segmental homology to an orthologous region on human chromosome 3q.13. These observations demonstrated somatic DNA recombination yielding genomic deletions in brain during embryogenesis
DEFF Research Database (Denmark)
Jensen, E O; Marcker, K A; Villadsen, IS
1986-01-01
The TM1 yeast mutant was transformed with a 2 micron-derived plasmid (YEp24) which carries a chimaeric gene containing the Escherichia coli chloramphenicol acetyl transferase (CAT) gene fused to the 5'- and 3'-flanking regions of the soybean leghemoglobin (Lb) c3 gene. Expression of the chimaeric...
Ranade, Sonali Sachin; García-Gil, María Rosario; Rosselló, Josep A
2016-04-01
Many genes have been lost from the prokaryote plastidial genome during the early events of endosymbiosis in eukaryotes. Some of them were definitively lost, but others were relocated and functionally integrated to the host nuclear genomes through serial events of gene transfer during plant evolution. In gymnosperms, plastid genome sequencing has revealed the loss of ndh genes from several species of Gnetales and Pinaceae, including Norway spruce (Picea abies). This study aims to trace the ndh genes in the nuclear and organellar Norway spruce genomes. The plastid genomes of higher plants contain 11 ndh genes which are homologues of mitochondrial genes encoding subunits of the proton-pumping NADH-dehydrogenase (nicotinamide adenine dinucleotide dehydrogenase) or complex I (electron transport chain). Ndh genes encode 11 NDH polypeptides forming the Ndh complex (analogous to complex I) which seems to be primarily involved in chloro-respiration processes. We considered ndh genes from the plastidial genome of four gymnosperms (Cryptomeria japonica, Cycas revoluta, Ginkgo biloba, Podocarpus totara) and a single angiosperm species (Arabidopsis thaliana) to trace putative homologs in the nuclear and organellar Norway spruce genomes using tBLASTn to assess the evolutionary fate of ndh genes in Norway spruce and to address their genomic location(s), structure, integrity and functionality. The results obtained from tBLASTn were subsequently analyzed by performing homology search for finding ndh specific conserved domains using conserved domain search. We report the presence of non-functional plastid ndh gene fragments, excepting ndhE and ndhG genes, in the nuclear genome of Norway spruce. Regulatory transcriptional elements like promoters, TATA boxes and enhancers were detected in the upstream regions of some ndh fragments. We also found transposable elements in the flanking regions of few ndh fragments suggesting nuclear rearrangements in those regions. These evidences
Regions identity between the genome of vertebrates and non-retroviral families of insect viruses.
Fan, Gaowei; Li, Jinming
2011-11-10
The scope of our understanding of the evolutionary history between viruses and animals is limited. The fact that the recent availability of many complete insect virus genomes and vertebrate genomes as well as the ability to screen these sequences makes it possible to gain a new perspective insight into the evolutionary interaction between insect viruses and vertebrates. This study is to determine the possibility of existence of sequence identity between the genomes of insect viruses and vertebrates, attempt to explain this phenomenon in term of genetic mobile element, and try to investigate the evolutionary relationship between these short regions of identity among these species. Some of studied insect viruses contain variable numbers of short regions of sequence identity to the genomes of vertebrate with nucleotide sequence length from 28 bp to 124 bp. They are found to locate in multiple sites of the vertebrate genomes. The ontology of animal genes with identical regions involves in several processes including chromatin remodeling, regulation of apoptosis, signaling pathway, nerve system development and some enzyme-like catalysis. Phylogenetic analysis reveals that at least some short regions of sequence identity in the genomes of vertebrate are derived the ancestral of insect viruses. Short regions of sequence identity were found in the vertebrates and insect viruses. These sequences played an important role not only in the long-term evolution of vertebrates, but also in promotion of insect virus. This typical win-win strategy may come from natural selection.
Vartiainen, Johanna; Kesäniemi, Y Antero; Ukkola, Olavi
2006-10-01
Ghrelin is a 28-amino-acid peptide with several functions linked to energy metabolism. Low ghrelin plasma concentrations are associated with obesity, hypertension, and type 2 diabetes mellitus, whereas high concentrations reflect states of negative energy balance. Several studies addressing the hormonal and neural regulation of ghrelin gene expression have been carried out, but the role of genetic factors in the regulation of ghrelin plasma levels remains unclear. To elucidate the role of genetic factors in the regulation of ghrelin expression, we screened 1657 nucleotides of the ghrelin gene 5' flanking region (promoter and possible regulatory sites) for new sequential variations from patient samples with low (n = 50) and high (n = 50) fasting plasma total ghrelin concentrations (low- and high-ghrelin groups). Eleven single nucleotide polymorphisms (SNPs), 3 of which were rare variants (allelic frequency less than 1%) were found in our population. The genotype distribution patterns of the SNPs did not differ between the study groups, except for SNP-501A>C (P = .039). In addition, the SNP-01A>C was associated with body mass index (BMI) (P = .018). This variant was studied further in our large and well-defined Oulu Project Elucidating Risk for Atherosclerosis (OPERA) cohort (n = 1045) by the restriction fragment length polymorphism (RFLP) technique. No significant association of SNP-501A>C genotypes with fasting ghrelin plasma concentrations was found in the whole OPERA population. However, the association of this SNP with BMI and with waist circumference reached statistical significance in OPERA (P = .047 and .049, respectively), remaining of borderline significance for BMI after adjustments (P = .055). The results indicate that factors other than the 11 SNPs found in this study in the 5' flanking region of ghrelin gene are the main determinants of ghrelin plasma levels. However, SNP-501 A>C genotype distribution seems to be different in subjects having the highest
The SHOX region and its mutations.
Capone, L; Iughetti, L; Sabatini, S; Bacciaglia, A; Forabosco, A
2010-06-01
The short stature homeobox-containing (SHOX) gene lies in the pseudoautosomal region 1 (PAR1) that comprises 2.6 Mb of the short-arm tips of both the X and Y chromosomes. It is known that its heterozygous mutations cause Leri-Weill dyschondrosteosis (LWD) (OMIM #127300), while its homozygous mutations cause a severe form of dwarfism known as Langer mesomelic dysplasia (LMD) (OMIM #249700). The analysis of 238 LWD patients between 1998 and 2007 by multiple authors shows a prevalence of deletions (46.4%) compared to point mutations (21.2%). On the whole, deletions and point mutations account for about 67% of LWD patients. SHOX is located within a 1000 kb desert region without genes. The comparative genomic analysis of this region between genomes of different vertebrates has led to the identification of evolutionarily conserved non-coding DNA elements (CNE). Further functional studies have shown that one of these CNE downstream of the SHOX gene is necessary for the expression of SHOX; this is considered to be typical "enhancer" activity. Including the enhancer, the overall mutation of the SHOX region in LWD patients does not hold in 100% of cases. Various authors have demonstrated the existence of other CNE both downstream and upstream of SHOX regions. The resulting conclusion is that it is necessary to reanalyze all LWD/LMD patients without SHOX mutations for the presence of mutations in the 5'- and 3'-flanking SHOX regions.
Energy Technology Data Exchange (ETDEWEB)
Maeder, Dennis L.; Anderson, Iain; Brettin, Thomas S.; Bruce,David C.; Gilna, Paul; Han, Cliff S.; Lapidus, Alla; Metcalf, William W.; Saunders, Elizabeth; Tapia, Roxanne; Sowers, Kevin R.
2006-05-19
We report here a comparative analysis of the genome sequence of Methanosarcina barkeri with those of Methanosarcina acetivorans and Methanosarcina mazei. All three genomes share a conserved double origin of replication and many gene clusters. M. barkeri is distinguished by having an organization that is well conserved with respect to the other Methanosarcinae in the region proximal to the origin of replication with interspecies gene similarities as high as 95%. However it is disordered and marked by increased transposase frequency and decreased gene synteny and gene density in the proximal semi-genome. Of the 3680 open reading frames in M. barkeri, 678 had paralogs with better than 80% similarity to both M. acetivorans and M. mazei while 128 nonhypothetical orfs were unique (non-paralogous) amongst these species including a complete formate dehydrogenase operon, two genes required for N-acetylmuramic acid synthesis, a 14 gene gas vesicle cluster and a bacterial P450-specific ferredoxin reductase cluster not previously observed or characterized in this genus. A cryptic 36 kbp plasmid sequence was detected in M. barkeri that contains an orc1 gene flanked by a presumptive origin of replication consisting of 38 tandem repeats of a 143 nt motif. Three-way comparison of these genomes reveals differing mechanisms for the accrual of changes. Elongation of the large M. acetivorans is the result of multiple gene-scale insertions and duplications uniformly distributed in that genome, while M. barkeri is characterized by localized inversions associated with the loss of gene content. In contrast, the relatively short M. mazei most closely approximates the ancestral organizational state.
Regions identity between the genome of vertebrates and non-retroviral families of insect viruses
Directory of Open Access Journals (Sweden)
Fan Gaowei
2011-11-01
Full Text Available Abstract Background The scope of our understanding of the evolutionary history between viruses and animals is limited. The fact that the recent availability of many complete insect virus genomes and vertebrate genomes as well as the ability to screen these sequences makes it possible to gain a new perspective insight into the evolutionary interaction between insect viruses and vertebrates. This study is to determine the possibility of existence of sequence identity between the genomes of insect viruses and vertebrates, attempt to explain this phenomenon in term of genetic mobile element, and try to investigate the evolutionary relationship between these short regions of identity among these species. Results Some of studied insect viruses contain variable numbers of short regions of sequence identity to the genomes of vertebrate with nucleotide sequence length from 28 bp to 124 bp. They are found to locate in multiple sites of the vertebrate genomes. The ontology of animal genes with identical regions involves in several processes including chromatin remodeling, regulation of apoptosis, signaling pathway, nerve system development and some enzyme-like catalysis. Phylogenetic analysis reveals that at least some short regions of sequence identity in the genomes of vertebrate are derived the ancestral of insect viruses. Conclusion Short regions of sequence identity were found in the vertebrates and insect viruses. These sequences played an important role not only in the long-term evolution of vertebrates, but also in promotion of insect virus. This typical win-win strategy may come from natural selection.
Chen, Zhuo-Yu; Gan, Jian-Kang; Xiao, Xiong; Jiang, Li-Yan; Zhang, Xi-Quan; Luo, Qing-Bin
2013-09-01
Thermo stress induces heat shock proteins (HSPs) expression and HSP90 family is one of them that has been reported to involve in cellular protection against heat stress. But whether there is any association of genetic variation in the Hsp90β gene in chicken with thermo tolerance is still unknown. Direct sequencing was used to detect possible SNPs in Hsp90β gene 5' flanking region in 3 chicken breeds (n = 663). Six mutations, among which 2 SNPs were chosen and genotypes were analyzed with PCR-RFLP method, were found in Hsp90β gene in these 3 chicken breeds. Association analysis indicated that SNP of C.-141G>A in the 5' flanking region of the Hsp90β gene in chicken had some effect on thermo tolerance traits, which may be a potential molecular marker of thermo tolerance, and the genotype GG was the thermo tolerance genotype. Hsp90β gene mRNA expression in different tissues detected by quantitative real-time PCR assay were demonstrated to be tissue dependent, implying that different tissues have distinct sensibilities to thermo stress. Besides, it was shown time specific and varieties differences. The expression of Hsp90β mRNA in Lingshan chickens in some tissues including heart, liver, brain and spleen were significantly higher or lower than that of White Recessive Rock (WRR). In this study, we presume that these mutations could be used in marker assisted selection for anti-heat stress chickens in our breeding program, and WRR were vulnerable to tropical thermo stress whereas Lingshan chickens were well adapted.
Directory of Open Access Journals (Sweden)
Ying Wu
Full Text Available Inter-specific hybridization occurs frequently in higher plants, and represents a driving force of evolution and speciation. Inter-specific hybridization often induces genetic and epigenetic instabilities in the resultant homoploid hybrids or allopolyploids, a phenomenon known as genome shock. Although genetic and epigenetic consequences of hybridizations between rice subspecies (e.g., japonica and indica and closely related species sharing the same AA genome have been extensively investigated, those of inter-specific hybridizations between more remote species with different genomes in the rice genus, Oryza, remain largely unknown.We investigated the immediate chromosomal and molecular genetic/epigenetic instability of three triploid F1 hybrids produced by inter-specific crossing between species with divergent genomes of Oryza by genomic in situ hybridization (GISH and molecular marker analysis. Transcriptional and transpositional activity of several transposable elements (TEs and methylation stability of their flanking regions were also assessed. We made the following principle findings: (i all three triploid hybrids are stable in both chromosome number and gross structure; (ii stochastic changes in both DNA sequence and methylation occurred in individual plants of all three triploid hybrids, but in general methylation changes occurred at lower frequencies than genetic changes; (iii alteration in DNA methylation occurred to a greater extent in genomic loci flanking potentially active TEs than in randomly sampled loci; (iv transcriptional activation of several TEs commonly occurred in all three hybrids but transpositional events were detected in a genetic context-dependent manner.Artificially constructed inter-specific hybrids of remotely related species with divergent genomes in genus Oryza are chromosomally stable but show immediate and highly stochastic genetic and epigenetic instabilities at the molecular level. These novel hybrids might
Ter-Voskanyan, Hasmik; Allgaier, Martin; Borsch, Thomas
2014-01-01
Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae)—a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC–trnV, trnR–atpA, ndhF–rpl32, psbM–trnD, and trnQ–rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters). Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid), Olea (asterids) and Cymbidium (monocots) showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF–rpl32 and trnK–rps16) were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations
Directory of Open Access Journals (Sweden)
Nadja Korotkova
Full Text Available Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae-a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC-trnV, trnR-atpA, ndhF-rpl32, psbM-trnD, and trnQ-rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters. Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid, Olea (asterids and Cymbidium (monocots showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF-rpl32 and trnK-rps16 were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations. Sequencing
Intervene: a tool for intersection and visualization of multiple gene or genomic region sets.
Khan, Aziz; Mathelier, Anthony
2017-05-31
A common task for scientists relies on comparing lists of genes or genomic regions derived from high-throughput sequencing experiments. While several tools exist to intersect and visualize sets of genes, similar tools dedicated to the visualization of genomic region sets are currently limited. To address this gap, we have developed the Intervene tool, which provides an easy and automated interface for the effective intersection and visualization of genomic region or list sets, thus facilitating their analysis and interpretation. Intervene contains three modules: venn to generate Venn diagrams of up to six sets, upset to generate UpSet plots of multiple sets, and pairwise to compute and visualize intersections of multiple sets as clustered heat maps. Intervene, and its interactive web ShinyApp companion, generate publication-quality figures for the interpretation of genomic region and list sets. Intervene and its web application companion provide an easy command line and an interactive web interface to compute intersections of multiple genomic and list sets. They have the capacity to plot intersections using easy-to-interpret visual approaches. Intervene is developed and designed to meet the needs of both computer scientists and biologists. The source code is freely available at https://bitbucket.org/CBGR/intervene , with the web application available at https://asntech.shinyapps.io/intervene .
Multi-stage volcanic island flank collapses with coeval explosive caldera-forming eruptions
Hunt, James E.; Cassidy, Michael; Talling, Peter J.
2018-01-01
Volcanic flank collapses and explosive eruptions are among the largest and most destructive processes on Earth. Events at Mount St. Helens in May 1980 demonstrated how a relatively small (<5 km3) flank collapse on a terrestrial volcano could immediately precede a devastating eruption. The lateral collapse of volcanic island flanks, such as in the Canary Islands, can be far larger (>300 km3), but can also occur in complex multiple stages. Here, we show that multistage retrogressive lands...
The genome landscape of ER{alpha}- and ER{beta}-binding DNA regions
DEFF Research Database (Denmark)
Liu, Yawen; Gao, Hui; Marstrand, Troels Torben
2008-01-01
, but there are also regions that are bound by ERalpha only in the presence of ERbeta, as well as regions that are selectively bound by either receptor. Analysis of bound regions shows that regions bound by ERalpha have distinct properties in terms of genome landscape, sequence features, and conservation compared...
DEFF Research Database (Denmark)
Höglund, Johanna; Guldbrandtsen, Bernt; Lund, Mogens Sandø
2015-01-01
6 QTL were detected for FTI: one QTL on each of BTA7, BTA20, BTA23, BTA25, and two QTL on BTA9 (QTL9–1 and QTL9–2). In the second step, ICF showed association with the QTL regions on BTA7, QTL9–2 QTL2 on BTA9, and BTA25, AIS for cows on BTA20 and BTA23, AIS for heifers on QTL9–2 on BTA9, IFL...... for cows on BTA20, BTA23 and BTA25, IFL for heifers on BTA7 and QTL9-2 on BTA9, NRR for heifers on BTA7 and BTA23, and NRR for cows on BTA23. Conclusion: The genome wide association study presented here revealed 6 genomic regions associated with FTI. Screening these 6 QTL regions for the underlying female...... quantitative trait locus regions were re-analyzed using a linear mixed model (animal model) for both FTI and its component traits AIS, NRR, IFL and ICF. The underlying traits were analyzed separately for heifers (first parity cows) and cows (later parity cows) for AIS, NRR, and IFL. Results: In the first step...
Enhancer Identification through Comparative Genomics
Energy Technology Data Exchange (ETDEWEB)
Visel, Axel; Bristow, James; Pennacchio, Len A.
2006-10-01
With the availability of genomic sequence from numerousvertebrates, a paradigm shift has occurred in the identification ofdistant-acting gene regulatory elements. In contrast to traditionalgene-centric studies in which investigators randomly scanned genomicfragments that flank genes of interest in functional assays, the modernapproach begins electronically with publicly available comparativesequence datasets that provide investigators with prioritized lists ofputative functional sequences based on their evolutionary conservation.However, although a large number of tools and resources are nowavailable, application of comparative genomic approaches remains far fromtrivial. In particular, it requires users to dynamically consider thespecies and methods for comparison depending on the specific biologicalquestion under investigation. While there is currently no single generalrule to this end, it is clear that when applied appropriately,comparative genomic approaches exponentially increase our power ingenerating biological hypotheses for subsequent experimentaltesting.
Genome-wide methylation analysis identified sexually dimorphic methylated regions in hybrid tilapia
Wan, Zi Yi; Xia, Jun Hong; Lin, Grace; Wang, Le; Lin, Valerie C. L.; Yue, Gen Hua
2016-01-01
Sexual dimorphism is an interesting biological phenomenon. Previous studies showed that DNA methylation might play a role in sexual dimorphism. However, the overall picture of the genome-wide methylation landscape in sexually dimorphic species remains unclear. We analyzed the DNA methylation landscape and transcriptome in hybrid tilapia (Oreochromis spp.) using whole genome bisulfite sequencing (WGBS) and RNA-sequencing (RNA-seq). We found 4,757 sexually dimorphic differentially methylated regions (DMRs), with significant clusters of DMRs located on chromosomal regions associated with sex determination. CpG methylation in promoter regions was negatively correlated with the gene expression level. MAPK/ERK pathway was upregulated in male tilapia. We also inferred active cis-regulatory regions (ACRs) in skeletal muscle tissues from WGBS datasets, revealing sexually dimorphic cis-regulatory regions. These results suggest that DNA methylation contribute to sex-specific phenotypes and serve as resources for further investigation to analyze the functions of these regions and their contributions towards sexual dimorphisms. PMID:27782217
Genomic region operation kit for flexible processing of deep sequencing data.
Ovaska, Kristian; Lyly, Lauri; Sahu, Biswajyoti; Jänne, Olli A; Hautaniemi, Sampsa
2013-01-01
Computational analysis of data produced in deep sequencing (DS) experiments is challenging due to large data volumes and requirements for flexible analysis approaches. Here, we present a mathematical formalism based on set algebra for frequently performed operations in DS data analysis to facilitate translation of biomedical research questions to language amenable for computational analysis. With the help of this formalism, we implemented the Genomic Region Operation Kit (GROK), which supports various DS-related operations such as preprocessing, filtering, file conversion, and sample comparison. GROK provides high-level interfaces for R, Python, Lua, and command line, as well as an extension C++ API. It supports major genomic file formats and allows storing custom genomic regions in efficient data structures such as red-black trees and SQL databases. To demonstrate the utility of GROK, we have characterized the roles of two major transcription factors (TFs) in prostate cancer using data from 10 DS experiments. GROK is freely available with a user guide from >http://csbi.ltdk.helsinki.fi/grok/.
Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa
Directory of Open Access Journals (Sweden)
Shahin Arwa
2012-11-01
Full Text Available Abstract Background Bulbous flowers such as lily and tulip (Liliaceae family are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Results Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups and among the three monocot species: lily, tulip, and rice (6,900 groups were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Conclusions
Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.
Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul
2012-11-20
Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable
Directory of Open Access Journals (Sweden)
Mark Ravinet
2018-05-01
Full Text Available Speciation is a continuous process and analysis of species pairs at different stages of divergence provides insight into how it unfolds. Previous genomic studies on young species pairs have revealed peaks of divergence and heterogeneous genomic differentiation. Yet less known is how localised peaks of differentiation progress to genome-wide divergence during the later stages of speciation in the presence of persistent gene flow. Spanning the speciation continuum, stickleback species pairs are ideal for investigating how genomic divergence builds up during speciation. However, attention has largely focused on young postglacial species pairs, with little knowledge of the genomic signatures of divergence and introgression in older stickleback systems. The Japanese stickleback species pair, composed of the Pacific Ocean three-spined stickleback (Gasterosteus aculeatus and the Japan Sea stickleback (G. nipponicus, which co-occur in the Japanese islands, is at a late stage of speciation. Divergence likely started well before the end of the last glacial period and crosses between Japan Sea females and Pacific Ocean males result in hybrid male sterility. Here we use coalescent analyses and Approximate Bayesian Computation to show that the two species split approximately 0.68-1 million years ago but that they have continued to exchange genes at a low rate throughout divergence. Population genomic data revealed that, despite gene flow, a high level of genomic differentiation is maintained across the majority of the genome. However, we identified multiple, small regions of introgression, occurring mainly in areas of low recombination rate. Our results demonstrate that a high level of genome-wide divergence can establish in the face of persistent introgression and that gene flow can be localized to small genomic regions at the later stages of speciation with gene flow.
Ravinet, Mark; Yoshida, Kohta; Shigenobu, Shuji; Toyoda, Atsushi; Fujiyama, Asao; Kitano, Jun
2018-05-01
Speciation is a continuous process and analysis of species pairs at different stages of divergence provides insight into how it unfolds. Previous genomic studies on young species pairs have revealed peaks of divergence and heterogeneous genomic differentiation. Yet less known is how localised peaks of differentiation progress to genome-wide divergence during the later stages of speciation in the presence of persistent gene flow. Spanning the speciation continuum, stickleback species pairs are ideal for investigating how genomic divergence builds up during speciation. However, attention has largely focused on young postglacial species pairs, with little knowledge of the genomic signatures of divergence and introgression in older stickleback systems. The Japanese stickleback species pair, composed of the Pacific Ocean three-spined stickleback (Gasterosteus aculeatus) and the Japan Sea stickleback (G. nipponicus), which co-occur in the Japanese islands, is at a late stage of speciation. Divergence likely started well before the end of the last glacial period and crosses between Japan Sea females and Pacific Ocean males result in hybrid male sterility. Here we use coalescent analyses and Approximate Bayesian Computation to show that the two species split approximately 0.68-1 million years ago but that they have continued to exchange genes at a low rate throughout divergence. Population genomic data revealed that, despite gene flow, a high level of genomic differentiation is maintained across the majority of the genome. However, we identified multiple, small regions of introgression, occurring mainly in areas of low recombination rate. Our results demonstrate that a high level of genome-wide divergence can establish in the face of persistent introgression and that gene flow can be localized to small genomic regions at the later stages of speciation with gene flow.
Directory of Open Access Journals (Sweden)
Wei-Chun Hung
Full Text Available Methicillin-resistant Staphylococcus aureus (MRSA with ST59/SCCmecV and Panton-Valentine leukocidin gene is a major community-acquired MRSA (CA-MRSA lineage in Taiwan and has been multidrug-resistant since its initial isolation. In this study, we studied the acquisition mechanism of multidrug resistance in an ST59 CA-MRSA strain (PM1 by comparative genomics. PM1's non-β-lactam resistance was encoded by two unique genetic traits. One was a 21,832-bp composite mobile element structure (MES(PM1, which was flanked by direct repeats of enterococcal IS1216V and was inserted into the chromosomal sasK gene; the target sequence (att was 8 bp long and was duplicated at both ends of MES(PM1. MES(PM1 consisted of two regions: the 5'-end side 12.4-kb region carrying Tn551 (with ermB and Tn5405-like (with aph[3']-IIIa and aadE, similar to an Enterococcus faecalis plasmid, and the 3'-end side 6,587-bp region (MES(cat that carries cat and is flanked by inverted repeats of IS1216V. MES(cat possessed att duplication at both ends and additional two copies of IS1216V inside. MES(PM1 represents the first enterococcal IS1216V-mediated composite transposon emerged in MRSA. IS1216V-mediated deletion likely occurred in IS1216V-rich MES(PM1, resulting in distinct resistance patterns in PM1-derivative strains. Another structure was a 6,025-bp tet-carrying element (MES(tet on a 25,961-bp novel mosaic penicillinase plasmid (pPM1; MES(tet was flanked by direct repeats of IS431, but with no target sequence repeats. Moreover, the PM1 genome was deficient in a copy of the restriction and modification genes (hsdM and hsdS, which might have contributed to the acquisition of enterococcal multidrug resistance.
BRAD, the genetics and genomics database for Brassica plants
Directory of Open Access Journals (Sweden)
Li Pingxia
2011-10-01
Full Text Available Abstract Background Brassica species include both vegetable and oilseed crops, which are very important to the daily life of common human beings. Meanwhile, the Brassica species represent an excellent system for studying numerous aspects of plant biology, specifically for the analysis of genome evolution following polyploidy, so it is also very important for scientific research. Now, the genome of Brassica rapa has already been assembled, it is the time to do deep mining of the genome data. Description BRAD, the Brassica database, is a web-based resource focusing on genome scale genetic and genomic data for important Brassica crops. BRAD was built based on the first whole genome sequence and on further data analysis of the Brassica A genome species, Brassica rapa (Chiifu-401-42. It provides datasets, such as the complete genome sequence of B. rapa, which was de novo assembled from Illumina GA II short reads and from BAC clone sequences, predicted genes and associated annotations, non coding RNAs, transposable elements (TE, B. rapa genes' orthologous to those in A. thaliana, as well as genetic markers and linkage maps. BRAD offers useful searching and data mining tools, including search across annotation datasets, search for syntenic or non-syntenic orthologs, and to search the flanking regions of a certain target, as well as the tools of BLAST and Gbrowse. BRAD allows users to enter almost any kind of information, such as a B. rapa or A. thaliana gene ID, physical position or genetic marker. Conclusion BRAD, a new database which focuses on the genetics and genomics of the Brassica plants has been developed, it aims at helping scientists and breeders to fully and efficiently use the information of genome data of Brassica plants. BRAD will be continuously updated and can be accessed through http://brassicadb.org.
Analysis of genomic regions of Trichoderma harzianum IOC-3844 related to biomass degradation.
Crucello, Aline; Sforça, Danilo Augusto; Horta, Maria Augusta Crivelente; dos Santos, Clelton Aparecido; Viana, Américo José Carvalho; Beloti, Lilian Luzia; de Toledo, Marcelo Augusto Szymanski; Vincentz, Michel; Kuroshu, Reginaldo Massanobu; de Souza, Anete Pereira
2015-01-01
Trichoderma harzianum IOC-3844 secretes high levels of cellulolytic-active enzymes and is therefore a promising strain for use in biotechnological applications in second-generation bioethanol production. However, the T. harzianum biomass degradation mechanism has not been well explored at the genetic level. The present work investigates six genomic regions (~150 kbp each) in this fungus that are enriched with genes related to biomass conversion. A BAC library consisting of 5,760 clones was constructed, with an average insert length of 90 kbp. The assembled BAC sequences revealed 232 predicted genes, 31.5% of which were related to catabolic pathways, including those involved in biomass degradation. An expression profile analysis based on RNA-Seq data demonstrated that putative regulatory elements, such as membrane transport proteins and transcription factors, are located in the same genomic regions as genes related to carbohydrate metabolism and exhibit similar expression profiles. Thus, we demonstrate a rapid and efficient tool that focuses on specific genomic regions by combining a BAC library with transcriptomic data. This is the first BAC-based structural genomic study of the cellulolytic fungus T. harzianum, and its findings provide new perspectives regarding the use of this species in biomass degradation processes.
Tam, Annie S; Chu, Jeffrey S C; Rose, Ann M
2015-11-12
Cancer therapy largely depends on chemotherapeutic agents that generate DNA lesions. However, our understanding of the nature of the resulting lesions as well as the mutational profiles of these chemotherapeutic agents is limited. Among these lesions, DNA interstrand crosslinks are among the more toxic types of DNA damage. Here, we have characterized the mutational spectrum of the commonly used DNA interstrand crosslinking agent mitomycin C (MMC). Using a combination of genetic mapping, whole genome sequencing, and genomic analysis, we have identified and confirmed several genomic lesions linked to MMC-induced DNA damage in Caenorhabditis elegans. Our data indicate that MMC predominantly causes deletions, with a 5'-CpG-3' sequence context prevalent in the deleted regions of DNA. Furthermore, we identified microhomology flanking the deletion junctions, indicative of DNA repair via nonhomologous end joining. Based on these results, we propose a general repair mechanism that is likely to be involved in the biological response to this highly toxic agent. In conclusion, the systematic study we have described provides insight into potential sequence specificity of MMC with DNA. Copyright © 2016 Tam et al.
Genome-Wide Mutational Signature of the Chemotherapeutic Agent Mitomycin C in Caenorhabditis elegans
Directory of Open Access Journals (Sweden)
Annie S. Tam
2016-01-01
Full Text Available Cancer therapy largely depends on chemotherapeutic agents that generate DNA lesions. However, our understanding of the nature of the resulting lesions as well as the mutational profiles of these chemotherapeutic agents is limited. Among these lesions, DNA interstrand crosslinks are among the more toxic types of DNA damage. Here, we have characterized the mutational spectrum of the commonly used DNA interstrand crosslinking agent mitomycin C (MMC. Using a combination of genetic mapping, whole genome sequencing, and genomic analysis, we have identified and confirmed several genomic lesions linked to MMC-induced DNA damage in Caenorhabditis elegans. Our data indicate that MMC predominantly causes deletions, with a 5′-CpG-3′ sequence context prevalent in the deleted regions of DNA. Furthermore, we identified microhomology flanking the deletion junctions, indicative of DNA repair via nonhomologous end joining. Based on these results, we propose a general repair mechanism that is likely to be involved in the biological response to this highly toxic agent. In conclusion, the systematic study we have described provides insight into potential sequence specificity of MMC with DNA.
Comparative Genomics of Carp Herpesviruses
Kurobe, Tomofumi; Gatherer, Derek; Cunningham, Charles; Korf, Ian; Fukuda, Hideo; Hedrick, Ronald P.; Waltzek, Thomas B.
2013-01-01
Three alloherpesviruses are known to cause disease in cyprinid fish: cyprinid herpesviruses 1 and 3 (CyHV1 and CyHV3) in common carp and koi and cyprinid herpesvirus 2 (CyHV2) in goldfish. We have determined the genome sequences of CyHV1 and CyHV2 and compared them with the published CyHV3 sequence. The CyHV1 and CyHV2 genomes are 291,144 and 290,304 bp, respectively, in size, and thus the CyHV3 genome, at 295,146 bp, remains the largest recorded among the herpesviruses. Each of the three genomes consists of a unique region flanked at each terminus by a sizeable direct repeat. The CyHV1, CyHV2, and CyHV3 genomes are predicted to contain 137, 150, and 155 unique, functional protein-coding genes, respectively, of which six, four, and eight, respectively, are duplicated in the terminal repeat. The three viruses share 120 orthologous genes in a largely colinear arrangement, of which up to 55 are also conserved in the other member of the genus Cyprinivirus, anguillid herpesvirus 1. Twelve genes are conserved convincingly in all sequenced alloherpesviruses, and two others are conserved marginally. The reference CyHV3 strain has been reported to contain five fragmented genes that are presumably nonfunctional. The CyHV2 strain has two fragmented genes, and the CyHV1 strain has none. CyHV1, CyHV2, and CyHV3 have five, six, and five families of paralogous genes, respectively. One family unique to CyHV1 is related to cellular JUNB, which encodes a transcription factor involved in oncogenesis. To our knowledge, this is the first time that JUNB-related sequences have been reported in a herpesvirus. PMID:23269803
Gussow, Ayal B; Copeland, Brett R; Dhindsa, Ryan S; Wang, Quanli; Petrovski, Slavé; Majoros, William H; Allen, Andrew S; Goldstein, David B
2017-01-01
There is broad agreement that genetic mutations occurring outside of the protein-coding regions play a key role in human disease. Despite this consensus, we are not yet capable of discerning which portions of non-coding sequence are important in the context of human disease. Here, we present Orion, an approach that detects regions of the non-coding genome that are depleted of variation, suggesting that the regions are intolerant of mutations and subject to purifying selection in the human lineage. We show that Orion is highly correlated with known intolerant regions as well as regions that harbor putatively pathogenic variation. This approach provides a mechanism to identify pathogenic variation in the human non-coding genome and will have immediate utility in the diagnostic interpretation of patient genomes and in large case control studies using whole-genome sequences.
Evidence for widespread degradation of gene control regions in hominid genomes.
Directory of Open Access Journals (Sweden)
Peter D Keightley
2005-02-01
Full Text Available Although sequences containing regulatory elements located close to protein-coding genes are often only weakly conserved during evolution, comparisons of rodent genomes have implied that these sequences are subject to some selective constraints. Evolutionary conservation is particularly apparent upstream of coding sequences and in first introns, regions that are enriched for regulatory elements. By comparing the human and chimpanzee genomes, we show here that there is almost no evidence for conservation in these regions in hominids. Furthermore, we show that gene expression is diverging more rapidly in hominids than in murids per unit of neutral sequence divergence. By combining data on polymorphism levels in human noncoding DNA and the corresponding human-chimpanzee divergence, we show that the proportion of adaptive substitutions in these regions in hominids is very low. It therefore seems likely that the lack of conservation and increased rate of gene expression divergence are caused by a reduction in the effectiveness of natural selection against deleterious mutations because of the low effective population sizes of hominids. This has resulted in the accumulation of a large number of deleterious mutations in sequences containing gene control elements and hence a widespread degradation of the genome during the evolution of humans and chimpanzees.
Zhang, Yan-Cong; Lin, Kui
2015-01-01
Overlapping genes (OGs) represent one type of widespread genomic feature in bacterial genomes and have been used as rare genomic markers in phylogeny inference of closely related bacterial species. However, the inference may experience a decrease in performance for phylogenomic analysis of too closely or too distantly related genomes. Another drawback of OGs as phylogenetic markers is that they usually take little account of the effects of genomic rearrangement on the similarity estimation, such as intra-chromosome/genome translocations, horizontal gene transfer, and gene losses. To explore such effects on the accuracy of phylogeny reconstruction, we combine phylogenetic signals of OGs with collinear genomic regions, here called locally collinear blocks (LCBs). By putting these together, we refine our previous metric of pairwise similarity between two closely related bacterial genomes. As a case study, we used this new method to reconstruct the phylogenies of 88 Enterobacteriale genomes of the class Gammaproteobacteria. Our results demonstrated that the topological accuracy of the inferred phylogeny was improved when both OGs and LCBs were simultaneously considered, suggesting that combining these two phylogenetic markers may reduce, to some extent, the influence of gene loss on phylogeny inference. Such phylogenomic studies, we believe, will help us to explore a more effective approach to increasing the robustness of phylogeny reconstruction of closely related bacterial organisms. PMID:26715828
An orphan gyrB in the Mycobacterium smegmatis genome
Indian Academy of Sciences (India)
DNA gyrase is an essential topoisomerase found in all bacteria. It is encoded by gyrB and gyrA genes. These genes are organized differently in different bacteria. Direct comparison of Mycobacterium tuberculosis and Mycobacterium smegmatis genomes reveals presence of an additional gyrB in M. smegmatis flanked by ...
Directory of Open Access Journals (Sweden)
Reyes Alejandro
2012-06-01
Full Text Available Abstract Background The insertion element IS6110 is one of the main sources of genomic variability in Mycobacterium tuberculosis, the etiological agent of human tuberculosis. Although IS 6110 has been used extensively as an epidemiological marker, the identification of the precise chromosomal insertion sites has been limited by technical challenges. Here, we present IS-seq, a novel method that combines high-throughput sequencing using Illumina technology with efficient combinatorial sample multiplexing to simultaneously probe 519 clinical isolates, identifying almost all the flanking regions of the element in a single experiment. Results We identified a total of 6,976 IS6110 flanking regions on the different isolates. When validated using reference strains, the method had 100% specificity and 98% positive predictive value. The insertions mapped to both coding and non-coding regions, and in some cases interrupted genes thought to be essential for virulence or in vitro growth. Strains were classified into families using insertion sites, and high agreement with previous studies was observed. Conclusions This high-throughput IS-seq method, which can also be used to map insertions in other organisms, extends previous surveys of in vivo interrupted loci and provides a baseline for probing the consequences of disruptions in M. tuberculosis strains.
Hertel, Robert; Rodríguez, David Pintor; Hollensteiner, Jacqueline; Dietrich, Sascha; Leimbach, Andreas; Hoppert, Michael; Liesegang, Heiko; Volland, Sonja
2015-01-01
Prophages are viruses, which have integrated their genomes into the genome of a bacterial host. The status of the prophage genome can vary from fully intact with the potential to form infective particles to a remnant state where only a few phage genes persist. Prophages have impact on the properties of their host and are therefore of great interest for genomic research and strain design. Here we present a genome- and next generation sequencing (NGS)-based approach for identification and activity evaluation of prophage regions. Seven prophage or prophage-like regions were identified in the genome of Bacillus licheniformis DSM13. Six of these regions show similarity to members of the Siphoviridae phage family. The remaining region encodes the B. licheniformis orthologue of the PBSX prophage from Bacillus subtilis. Analysis of isolated phage particles (induced by mitomycin C) from the wild-type strain and prophage deletion mutant strains revealed activity of the prophage regions BLi_Pp2 (PBSX-like), BLi_Pp3 and BLi_Pp6. In contrast to BLi_Pp2 and BLi_Pp3, neither phage DNA nor phage particles of BLi_Pp6 could be visualized. However, the ability of prophage BLi_Pp6 to generate particles could be confirmed by sequencing of particle-protected DNA mapping to prophage locus BLi_Pp6. The introduced NGS-based approach allows the investigation of prophage regions and their ability to form particles. Our results show that this approach increases the sensitivity of prophage activity analysis and can complement more conventional approaches such as transmission electron microscopy (TEM). PMID:25811873
A genomic audit of newly-adopted autosomal STRs for forensic identification.
Phillips, C
2017-07-01
In preparation for the growing use of massively parallel sequencing (MPS) technology to genotype forensic STRs, a comprehensive genomic audit of 73 STRs was made in 2016 [Parson et al., Forensic Sci. Int. Genet. 22, 54-63]. The loci examined included miniSTRs that were not in widespread use, but had been incorporated into MPS kits or were under consideration for this purpose. The current study expands the genomic analysis of autosomal STRs that are not commonly used, to include the full set of developed miniSTRs and an additional 24 STRs, most of which have been recently included in several supplementary forensic multiplex kits for capillary electrophoresis. The genomic audit of these 47 newly-adopted STRs examined the linkage status of new loci on the same chromosome as established forensic STRs; analyzed world-wide population variation of the newly-adopted STRs using published data; assessed their forensic informativeness; and compiled the sequence characteristics, repeat structures and flanking regions of each STR. A further 44 autosomal STRs developed for forensic analyses but not incorporated into commercial kits, are also briefly described. Copyright © 2017 Elsevier B.V. All rights reserved.
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Sodium Ion Dynamics in the Magnetospheric Flanks of Mercury
Aizawa, Sae; Delcourt, Dominique; Terada, Naoki
2018-01-01
We investigate the transport of planetary ions in the magnetospheric flanks of Mercury. In situ measurements from the MErcury Surface, Space ENvironment, GEochemistry, and Ranging spacecraft show evidences of Kelvin-Helmholtz instability development in this region of space, due to the velocity shear between the downtail streaming flow of solar wind originating protons in the magnetosheath and the magnetospheric populations. Ions that originate from the planet exosphere and that gain access to this region of space may be transported across the magnetopause along meandering orbits. We examine this transport using single-particle trajectory calculations in model Magnetohydrodynamics simulations of the Kelvin-Helmholtz instability. We show that heavy ions of planetary origin such as Na+ may experience prominent nonadiabatic energization as they E × B drift across large-scale rolled up vortices. This energization is controlled by the characteristics of the electric field burst encountered along the particle path, the net energy change realized corresponding to the maximum E × B drift energy. This nonadiabatic energization also is responsible for prominent scattering of the particles toward the direction perpendicular to the magnetic field.
2014-01-01
Background Discerning the traits evolving under neutral conditions from those traits evolving rapidly because of various selection pressures is a great challenge. We propose a new method, composite selection signals (CSS), which unifies the multiple pieces of selection evidence from the rank distribution of its diverse constituent tests. The extreme CSS scores capture highly differentiated loci and underlying common variants hauling excess haplotype homozygosity in the samples of a target population. Results The data on high-density genotypes were analyzed for evidence of an association with either polledness or double muscling in various cohorts of cattle and sheep. In cattle, extreme CSS scores were found in the candidate regions on autosome BTA-1 and BTA-2, flanking the POLL locus and MSTN gene, for polledness and double muscling, respectively. In sheep, the regions with extreme scores were localized on autosome OAR-2 harbouring the MSTN gene for double muscling and on OAR-10 harbouring the RXFP2 gene for polledness. In comparison to the constituent tests, there was a partial agreement between the signals at the four candidate loci; however, they consistently identified additional genomic regions harbouring no known genes. Persuasively, our list of all the additional significant CSS regions contains genes that have been successfully implicated to secondary phenotypic diversity among several subpopulations in our data. For example, the method identified a strong selection signature for stature in cattle capturing selective sweeps harbouring UQCC-GDF5 and PLAG1-CHCHD7 gene regions on BTA-13 and BTA-14, respectively. Both gene pairs have been previously associated with height in humans, while PLAG1-CHCHD7 has also been reported for stature in cattle. In the additional analysis, CSS identified significant regions harbouring multiple genes for various traits under selection in European cattle including polledness, adaptation, metabolism, growth rate, stature
Cluster Observations of reconnection along the dusk flank of the magnetosphere
Escoubet, C.-Philippe; Grison, Benjamin; Berchem, Jean; Trattner, Karlheinz; Lavraud, Benoit; Pitout, Frederic; Soucek, Jan; Richard, Robert; Laakso, Harri; Masson, Arnaud; Dunlop, Malcolm; Dandouras, Iannis; Reme, Henri; Fazakerley, Andrew; Daly, Patrick
2015-04-01
Magnetic reconnection is generally accepted to be the main process that transfers particles and energy from the solar wind to the magnetosphere. The location of the reconnection site depends on the orientation of the interplanetary magnetic field (IMF) in the solar wind: on the dayside magnetosphere for an IMF southward, on the lobes for an IMF northward and on the flanks for an IMF in the East-West direction. Since most of observations of reconnection events have sampled a limited region of space simultaneously it is still not yet know if the reconnection line is extended over large regions of the magnetosphere or if is patchy and made of many reconnection lines. We report a Cluster crossing on 5 January 2002 near the exterior cusp on the southern dusk side where we observe multiple sources of reconnection/injections. The IMF was mainly azimuthal (IMF-By around -5 nT), the solar wind speed lower than usual around 280 km/s with the density of order 5 cm-3. The four Cluster spacecraft had an elongated configuration near the magnetopause. C4 was the first spacecraft to enter the cusp around 19:52:04 UT, followed by C2 at 19:52:35 UT, C1 at 19:54:24 UT and C3 at 20:13:15 UT. C4 and C1 observed two ion energy dispersions at 20:10 UT and 20:40 UT and C3 at 20:35 UT and 21:15 UT. Using the time of flight technique on the upgoing and downgoing ions, which leads to energy dispersions, we obtain distances of the ion sources between 14 and 20 RE from the spacecraft. The slope of the ion energy dispersions confirmed these distances. Using Tsyganenko model, we find that these sources are located on the dusk flank, past the terminator. The first injection by C3 is seen at approximately the same time as the 2nd injection on C1 but their sources at the magnetopause were separated by more than 7 RE. This would imply that two distinct sources were active at the same time on the dusk flank of the magnetosphere. In addition, a flow reversal was observed at the magnetopause on C4
Comparative genomics of multidrug resistance in Acinetobacter baumannii.
Directory of Open Access Journals (Sweden)
Pierre-Edouard Fournier
2006-01-01
Full Text Available Acinetobacter baumannii is a species of nonfermentative gram-negative bacteria commonly found in water and soil. This organism was susceptible to most antibiotics in the 1970s. It has now become a major cause of hospital-acquired infections worldwide due to its remarkable propensity to rapidly acquire resistance determinants to a wide range of antibacterial agents. Here we use a comparative genomic approach to identify the complete repertoire of resistance genes exhibited by the multidrug-resistant A. baumannii strain AYE, which is epidemic in France, as well as to investigate the mechanisms of their acquisition by comparison with the fully susceptible A. baumannii strain SDF, which is associated with human body lice. The assembly of the whole shotgun genome sequences of the strains AYE and SDF gave an estimated size of 3.9 and 3.2 Mb, respectively. A. baumannii strain AYE exhibits an 86-kb genomic region termed a resistance island--the largest identified to date--in which 45 resistance genes are clustered. At the homologous location, the SDF strain exhibits a 20 kb-genomic island flanked by transposases but devoid of resistance markers. Such a switching genomic structure might be a hotspot that could explain the rapid acquisition of resistance markers under antimicrobial pressure. Sequence similarity and phylogenetic analyses confirm that most of the resistance genes found in the A. baumannii strain AYE have been recently acquired from bacteria of the genera Pseudomonas, Salmonella, or Escherichia. This study also resulted in the discovery of 19 new putative resistance genes. Whole-genome sequencing appears to be a fast and efficient approach to the exhaustive identification of resistance genes in epidemic infectious agents of clinical significance.
Comparative Genomics of Multidrug Resistance in Acinetobacter baumannii.
Directory of Open Access Journals (Sweden)
2006-01-01
Full Text Available Acinetobacter baumannii is a species of nonfermentative gram-negative bacteria commonly found in water and soil. This organism was susceptible to most antibiotics in the 1970s. It has now become a major cause of hospital-acquired infections worldwide due to its remarkable propensity to rapidly acquire resistance determinants to a wide range of antibacterial agents. Here we use a comparative genomic approach to identify the complete repertoire of resistance genes exhibited by the multidrug-resistant A. baumannii strain AYE, which is epidemic in France, as well as to investigate the mechanisms of their acquisition by comparison with the fully susceptible A. baumannii strain SDF, which is associated with human body lice. The assembly of the whole shotgun genome sequences of the strains AYE and SDF gave an estimated size of 3.9 and 3.2 Mb, respectively. A. baumannii strain AYE exhibits an 86-kb genomic region termed a resistance island-the largest identified to date-in which 45 resistance genes are clustered. At the homologous location, the SDF strain exhibits a 20 kb-genomic island flanked by transposases but devoid of resistance markers. Such a switching genomic structure might be a hotspot that could explain the rapid acquisition of resistance markers under antimicrobial pressure. Sequence similarity and phylogenetic analyses confirm that most of the resistance genes found in the A. baumannii strain AYE have been recently acquired from bacteria of the genera Pseudomonas, Salmonella, or Escherichia. This study also resulted in the discovery of 19 new putative resistance genes. Whole-genome sequencing appears to be a fast and efficient approach to the exhaustive identification of resistance genes in epidemic infectious agents of clinical significance.
Directory of Open Access Journals (Sweden)
Margaret Staton
Full Text Available Forest health issues are on the rise in the United States, resulting from introduction of alien pests and diseases, coupled with abiotic stresses related to climate change. Increasingly, forest scientists are finding genetic/genomic resources valuable in addressing forest health issues. For a set of ten ecologically and economically important native hardwood tree species representing a broad phylogenetic spectrum, we used low coverage whole genome sequencing from multiplex Illumina paired ends to economically profile their genomic content. For six species, the genome content was further analyzed by flow cytometry in order to determine the nuclear genome size. Sequencing yielded a depth of 0.8X to 7.5X, from which in silico analysis yielded preliminary estimates of gene and repetitive sequence content in the genome for each species. Thousands of genomic SSRs were identified, with a clear predisposition toward dinucleotide repeats and AT-rich repeat motifs. Flanking primers were designed for SSR loci for all ten species, ranging from 891 loci in sugar maple to 18,167 in redbay. In summary, we have demonstrated that useful preliminary genome information including repeat content, gene content and useful SSR markers can be obtained at low cost and time input from a single lane of Illumina multiplex sequence.
Uncovering the Repertoire of Endogenous Flaviviral Elements in Aedes Mosquito Genomes.
Suzuki, Yasutsugu; Frangeul, Lionel; Dickson, Laura B; Blanc, Hervé; Verdier, Yann; Vinh, Joelle; Lambrechts, Louis; Saleh, Maria-Carla
2017-08-01
Endogenous viral elements derived from nonretroviral RNA viruses have been described in various animal genomes. Whether they have a biological function, such as host immune protection against related viruses, is a field of intense study. Here, we investigated the repertoire of endogenous flaviviral elements (EFVEs) in Aedes mosquitoes, the vectors of arboviruses such as dengue and chikungunya viruses. Previous studies identified three EFVEs from Aedes albopictus cell lines and one from Aedes aegypti cell lines. However, an in-depth characterization of EFVEs in wild-type mosquito populations and individual mosquitoes in vivo has not been performed. We detected the full-length DNA sequence of the previously described EFVEs and their respective transcripts in several A. albopictus and A. aegypti populations from geographically distinct areas. However, EFVE-derived proteins were not detected by mass spectrometry. Using deep sequencing, we detected the production of PIWI-interacting RNA-like small RNAs, in an antisense orientation, targeting the EFVEs and their flanking regions in vivo The EFVEs were integrated in repetitive regions of the mosquito genomes, and their flanking sequences varied among mosquito populations. We bioinformatically predicted several new EFVEs from a Vietnamese A. albopictus population and observed variation in the occurrence of those elements among mosquitoes. Phylogenetic analysis of an A. aegypti EFVE suggested that it integrated prior to the global expansion of the species and subsequently diverged among and within populations. The findings of this study together reveal the substantial structural and nucleotide diversity of flaviviral integrations in Aedes genomes. Unraveling this diversity will help to elucidate the potential biological function of these EFVEs. IMPORTANCE Endogenous viral elements (EVEs) are whole or partial viral sequences integrated in host genomes. Interestingly, some EVEs have important functions for host fitness and
Directory of Open Access Journals (Sweden)
Zhiliang Yu
2017-07-01
Full Text Available Methanopyrus spp. are usually isolated from harsh niches, such as high osmotic pressure and extreme temperature. However, the molecular mechanisms for their environmental adaption are poorly understood. Archaeal species is commonly considered as primitive organism. The evolutional placement of archaea is a fundamental and intriguing scientific question. We sequenced the genomes of Methanopyrus strains SNP6 and KOL6 isolated from the Atlantic and Iceland, respectively. Comparative genomic analysis revealed genetic diversity and instability implicated in niche adaption, including a number of transporter- and integrase/transposase-related genes. Pan-genome analysis also defined the gene pool of Methanopyrus spp., in addition of ~120-Kb genomic region of plasticity impacting cognate genomic architecture. We believe that Methanopyrus genomics could facilitate efficient investigation/recognition of archaeal phylogenetic diverse patterns, as well as improve understanding of biological roles and significance of these versatile microbes.
Directory of Open Access Journals (Sweden)
Amaury Vaysse
2011-10-01
Full Text Available The extraordinary phenotypic diversity of dog breeds has been sculpted by a unique population history accompanied by selection for novel and desirable traits. Here we perform a comprehensive analysis using multiple test statistics to identify regions under selection in 509 dogs from 46 diverse breeds using a newly developed high-density genotyping array consisting of >170,000 evenly spaced SNPs. We first identify 44 genomic regions exhibiting extreme differentiation across multiple breeds. Genetic variation in these regions correlates with variation in several phenotypic traits that vary between breeds, and we identify novel associations with both morphological and behavioral traits. We next scan the genome for signatures of selective sweeps in single breeds, characterized by long regions of reduced heterozygosity and fixation of extended haplotypes. These scans identify hundreds of regions, including 22 blocks of homozygosity longer than one megabase in certain breeds. Candidate selection loci are strongly enriched for developmental genes. We chose one highly differentiated region, associated with body size and ear morphology, and characterized it using high-throughput sequencing to provide a list of variants that may directly affect these traits. This study provides a catalogue of genomic regions showing extreme reduction in genetic variation or population differentiation in dogs, including many linked to phenotypic variation. The many blocks of reduced haplotype diversity observed across the genome in dog breeds are the result of both selection and genetic drift, but extended blocks of homozygosity on a megabase scale appear to be best explained by selection. Further elucidation of the variants under selection will help to uncover the genetic basis of complex traits and disease.
Genomic Regions Affecting Cheese Making Properties Identified in Danish Holsteins
DEFF Research Database (Denmark)
Gregersen, Vivi Raundahl; Bertelsen, Henriette Pasgaard; Poulsen, Nina Aagaard
The cheese renneting process is affected by a number of factors associated to milk composition and a number of Danish Holsteins has previously been identified to have poor milk coagulation ability. Therefore, the aim of this study was to identify genomic regions affecting the technological...
Mitigation of Flanking Noise Transmission in Periodic Structures of Lightweight Elements
DEFF Research Database (Denmark)
Domadiya, Parthkumar Gandalal
through structural junctions and radiates into neighbouring rooms. To diminish the flanking transmission of sound, frames are usually designed with single or double studs or constructed with layers of foam or another viscoelastic material. This thesis is investigating the behaviour of flanking noise...... transmission in periodic structures of lightweight elements by employing various numerical, analytical and experimental methods. At first, three dimensional finite-element (FE) models of a Z-shaped lightweight panel structure based on various frame designs, inclusion of air and structural coupling between...... elements are considered for describing flanking noise transmission through panels. It is assumed that the ribs are fully fixed to the plates in case of various frame designs, and a parametric study is carried out on the centre panel with regard to various spacing between the ribs. Solid finite elements...
Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.
Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S
2015-12-01
Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.
DEFF Research Database (Denmark)
Staaf, Johan; Törngren, Therese; Rambech, Eva
2008-01-01
Disease-predisposing germline mutations in cancer susceptibility genes may consist of large genomic rearrangements that are challenging to detect and characterize using standard PCR-based mutation screening methods. Here, we describe a custom-made zoom-in microarray comparative genomic hybridizat......Disease-predisposing germline mutations in cancer susceptibility genes may consist of large genomic rearrangements that are challenging to detect and characterize using standard PCR-based mutation screening methods. Here, we describe a custom-made zoom-in microarray comparative genomic...... deletions or duplications occurring in BRCA1 (n=11), BRCA2 (n=2), MSH2 (n=7), or MLH1 (n=9). Additionally, we demonstrate its applicability for uncovering complex somatic rearrangements, exemplified by zoom-in analysis of the PTEN and CDKN2A loci in breast cancer cells. The sizes of rearrangements ranged...... from several 100 kb, including large flanking regions, to rearrangements, allowing convenient design...
Directory of Open Access Journals (Sweden)
Feltus Frank A
2011-07-01
Full Text Available Abstract Background Switchgrass, a C4 species and a warm-season grass native to the prairies of North America, has been targeted for development into an herbaceous biomass fuel crop. Genetic improvement of switchgrass feedstock traits through marker-assisted breeding and biotechnology approaches calls for genomic tools development. Establishment of integrated physical and genetic maps for switchgrass will accelerate mapping of value added traits useful to breeding programs and to isolate important target genes using map based cloning. The reported polyploidy series in switchgrass ranges from diploid (2X = 18 to duodecaploid (12X = 108. Like in other large, repeat-rich plant genomes, this genomic complexity will hinder whole genome sequencing efforts. An extensive physical map providing enough information to resolve the homoeologous genomes would provide the necessary framework for accurate assembly of the switchgrass genome. Results A switchgrass BAC library constructed by partial digestion of nuclear DNA with EcoRI contains 147,456 clones covering the effective genome approximately 10 times based on a genome size of 3.2 Gigabases (~1.6 Gb effective. Restriction digestion and PFGE analysis of 234 randomly chosen BACs indicated that 95% of the clones contained inserts, ranging from 60 to 180 kb with an average of 120 kb. Comparative sequence analysis of two homoeologous genomic regions harboring orthologs of the rice OsBRI1 locus, a low-copy gene encoding a putative protein kinase and associated with biomass, revealed that orthologous clones from homoeologous chromosomes can be unambiguously distinguished from each other and correctly assembled to respective fingerprint contigs. Thus, the data obtained not only provide genomic resources for further analysis of switchgrass genome, but also improve efforts for an accurate genome sequencing strategy. Conclusions The construction of the first switchgrass BAC library and comparative analysis of
Cormier, Fabien; Le Gouis, Jacques; Dubreuil, Pierre; Lafarge, Stéphane; Praud, Sébastien
2014-12-01
This study identified 333 genomic regions associated to 28 traits related to nitrogen use efficiency in European winter wheat using genome-wide association in a 214-varieties panel experimented in eight environments. Improving nitrogen use efficiency is a key factor to sustainably ensure global production increase. However, while high-throughput screening methods remain at a developmental stage, genetic progress may be mainly driven by marker-assisted selection. The objective of this study was to identify chromosomal regions associated with nitrogen use efficiency-related traits in bread wheat (Triticum aestivum L.) using a genome-wide association approach. Two hundred and fourteen European elite varieties were characterised for 28 traits related to nitrogen use efficiency in eight environments in which two different nitrogen fertilisation levels were tested. The genome-wide association study was carried out using 23,603 SNP with a mixed model for taking into account parentage relationships among varieties. We identified 1,010 significantly associated SNP which defined 333 chromosomal regions associated with at least one trait and found colocalisations for 39 % of these chromosomal regions. A method based on linkage disequilibrium to define the associated region was suggested and discussed with reference to false positive rate. Through a network approach, colocalisations were analysed and highlighted the impact of genomic regions controlling nitrogen status at flowering, precocity, and nitrogen utilisation on global agronomic performance. We were able to explain 40 ± 10 % of the total genetic variation. Numerous colocalisations with previously published genomic regions were observed with such candidate genes as Ppd-D1, Rht-D1, NADH-Gogat, and GSe. We highlighted selection pressure on yield and nitrogen utilisation discussing allele frequencies in associated regions.
Evolution of the hepatitis E virus hypervariable region.
Smith, Donald B; Vanek, Jeff; Ramalingam, Sandeep; Johannessen, Ingolfur; Templeton, Kate; Simmonds, Peter
2012-11-01
The presence of a hypervariable (HVR) region within the genome of hepatitis E virus (HEV) remains unexplained. Previous studies have described the HVR as a proline-rich spacer between flanking functional domains of the ORF1 polyprotein. Others have proposed that the region has no function, that it reflects a hypermutable region of the virus genome, that it is derived from the insertion and evolution of host sequences or that it is subject to positive selection. This study attempts to differentiate between these explanations by documenting the evolutionary processes occurring within the HVR. We have measured the diversity of HVR sequences within acutely infected individuals or amongst sequences derived from epidemiologically linked samples and, surprisingly, find relative homogeneity amongst these datasets. We found no evidence of positive selection for amino acid substitution in the HVR. Through an analysis of published sequences, we conclude that the range of HVR diversity observed within virus genotypes can be explained by the accumulation of substitutions and, to a much lesser extent, through deletions or duplications of this region. All published HVR amino acid sequences display a relative overabundance of proline and serine residues that cannot be explained by a local bias towards cytosine in this part of the genome. Although all published HVRs contain one or more SH3-binding PxxP motifs, this motif does not occur more frequently than would be expected from the proportion of proline residues in these sequences. Taken together, these observations are consistent with the hypothesis that the HVR has a structural role that is dependent upon length and amino acid composition, rather than a specific sequence.
Evolution of the hepatitis E virus hypervariable region
Vanek, Jeff; Ramalingam, Sandeep; Johannessen, Ingolfur; Templeton, Kate; Simmonds, Peter
2012-01-01
The presence of a hypervariable (HVR) region within the genome of hepatitis E virus (HEV) remains unexplained. Previous studies have described the HVR as a proline-rich spacer between flanking functional domains of the ORF1 polyprotein. Others have proposed that the region has no function, that it reflects a hypermutable region of the virus genome, that it is derived from the insertion and evolution of host sequences or that it is subject to positive selection. This study attempts to differentiate between these explanations by documenting the evolutionary processes occurring within the HVR. We have measured the diversity of HVR sequences within acutely infected individuals or amongst sequences derived from epidemiologically linked samples and, surprisingly, find relative homogeneity amongst these datasets. We found no evidence of positive selection for amino acid substitution in the HVR. Through an analysis of published sequences, we conclude that the range of HVR diversity observed within virus genotypes can be explained by the accumulation of substitutions and, to a much lesser extent, through deletions or duplications of this region. All published HVR amino acid sequences display a relative overabundance of proline and serine residues that cannot be explained by a local bias towards cytosine in this part of the genome. Although all published HVRs contain one or more SH3-binding PxxP motifs, this motif does not occur more frequently than would be expected from the proportion of proline residues in these sequences. Taken together, these observations are consistent with the hypothesis that the HVR has a structural role that is dependent upon length and amino acid composition, rather than a specific sequence. PMID:22837418
Yeh, Hsin-Chih; Jan, Hau-Chern; Wu, Wen-Jeng; Li, Ching-Chia; Li, Wei-Ming; Ke, Hung-Lung; Huang, Shu-Pin; Liu, Chia-Chu; Lee, Yung-Chin; Yang, Sheau-Fang; Liang, Peir-In; Huang, Chun-Nung
2015-01-01
To investigate the impact of preoperative hydronephrosis and flank pain on prognosis of patients with upper tract urothelial carcinoma. In total, 472 patients with upper tract urothelial carcinoma managed by radical nephroureterectomy were included from Kaohsiung Medical University Hospital Healthcare System. Clinicopathological data were collected retrospectively for analysis. The significance of hydronephrosis, especially when combined with flank pain, and other relevant factors on overall and cancer-specific survival were evaluated. Of the 472 patients, 292 (62%) had preoperative hydronephrosis and 121 (26%) presented with flank pain. Preoperative hydronephrosis was significantly associated with age, hematuria, flank pain, tumor location, and pathological tumor stage. Concurrent presence of hydronephrosis and flank pain was a significant predictor of non-organ-confined disease (multivariate-adjusted hazard ratio = 2.10, P = 0.025). Kaplan-Meier analysis showed significantly poorer overall and cancer-specific survival in patients with preoperative hydronephrosis (P = 0.005 and P = 0.026, respectively) and in patients with flank pain (P hydronephrosis and flank pain independently predicted adverse outcome (hazard ratio = 1.98, P = 0.016 for overall survival and hazard ratio = 1.87, P = 0.036 for and cancer-specific survival, respectively) in multivariate Cox proportional hazards models. In addition, concurrent presence of hydronephrosis and flank pain was also significantly predictive of worse survival in patient with high grade or muscle-invasive disease. Notably, there was no difference in survival between patients with hydronephrosis but devoid of flank pain and those without hydronephrosis. Concurrent preoperative presence of hydronephrosis and flank pain predicted non-organ-confined status of upper tract urothelial carcinoma. When accompanied with flank pain, hydronephrosis represented an independent predictor for worse outcome in patients with upper tract
Natural selection among Eurasians at genomic regions associated with HIV-1 control
Directory of Open Access Journals (Sweden)
Allison David B
2011-06-01
Full Text Available Abstract Background HIV susceptibility and pathogenicity exhibit both interindividual and intergroup variability. The etiology of intergroup variability is still poorly understood, and could be partly linked to genetic differences among racial/ethnic groups. These genetic differences may be traceable to different regimes of natural selection in the 60,000 years since the human radiation out of Africa. Here, we examine population differentiation and haplotype patterns at several loci identified through genome-wide association studies on HIV-1 control, as determined by viral-load setpoint, in European and African-American populations. We use genome-wide data from the Human Genome Diversity Project, consisting of 53 world-wide populations, to compare measures of FST and relative extended haplotype homozygosity (REHH at these candidate loci to the rest of the respective chromosome. Results We find that the Europe-Middle East and Europe-South Asia pairwise FST in the most strongly associated region are elevated compared to most pairwise comparisons with the sub-Saharan African group, which exhibit very low FST. We also find genetic signatures of recent positive selection (higher REHH at these associated regions among all groups except for sub-Saharan Africans and Native Americans. This pattern is consistent with one in which genetic differentiation, possibly due to diversifying/positive selection, occurred at these loci among Eurasians. Conclusions These findings are concordant with those from earlier studies suggesting recent evolutionary change at immunity-related genomic regions among Europeans, and shed light on the potential genetic and evolutionary origin of population differences in HIV-1 control.
The objective of this research was to identify genomic regions associated with clinical mastitis (MAST) in US Holsteins using producer-reported data. Genome-wide association studies (GWAS) were performed on deregressed PTA using GEMMA v. 0.94. Genotypes included 60,671 SNP for all predictor bulls (n...
Targeted sequencing of large genomic regions with CATCH-Seq.
Directory of Open Access Journals (Sweden)
Kenneth Day
Full Text Available Current target enrichment systems for large-scale next-generation sequencing typically require synthetic oligonucleotides used as capture reagents to isolate sequences of interest. The majority of target enrichment reagents are focused on gene coding regions or promoters en masse. Here we introduce development of a customizable targeted capture system using biotinylated RNA probe baits transcribed from sheared bacterial artificial chromosome clone templates that enables capture of large, contiguous blocks of the genome for sequencing applications. This clone adapted template capture hybridization sequencing (CATCH-Seq procedure can be used to capture both coding and non-coding regions of a gene, and resolve the boundaries of copy number variations within a genomic target site. Furthermore, libraries constructed with methylated adapters prior to solution hybridization also enable targeted bisulfite sequencing. We applied CATCH-Seq to diverse targets ranging in size from 125 kb to 3.5 Mb. Our approach provides a simple and cost effective alternative to other capture platforms because of template-based, enzymatic probe synthesis and the lack of oligonucleotide design costs. Given its similarity in procedure, CATCH-Seq can also be performed in parallel with commercial systems.
A Boy with an LCR3/4-Flanked 10q22.3q23.2 Microdeletion and Uncommon Phenotypic Features
Petrova, E.; Neuner, C.; Haaf, T.; Schmid, M.; Wirbelauer, J.; Jurkutat, A.; Wermke, K.; Nanda, I.; Kunstmann, E.
2014-01-01
The recurrent 10q22.3q23.2 deletion with breakpoints within low copy repeats 3 and 4 is a rare genomic disorder, reported in only 13 patients to date. The phenotype is rather uncharacteristic, which makes a clinical diagnosis difficult. A phenotypic feature described in almost all patients is a delay in speech development, albeit systematic studies are still pending. In this study, we report on a boy with an LCR3/4-flanked 10q22.3q23.2 deletion exhibiting an age-appropriate language development evaluated by a standardized test at an age of 2 years and 3 months. The boy was born with a cleft palate – a feature not present in any of the patients described before. Previously reported cases are reviewed, and the role of the BMPR1A gene is discussed. The phenotype of patients with an LCR3/4-flanked 10q22.3q23.2 deletion can be rather variable, so counseling the families regarding the prognosis of an affected child should be done with caution. Long-term studies of affected children are needed to delineate the natural history of this rare disorder. PMID:24550761
Gasc, Cyrielle; Peyretaillade, Eric; Peyret, Pierre
2016-06-02
The recent expansion of next-generation sequencing has significantly improved biological research. Nevertheless, deep exploration of genomes or metagenomic samples remains difficult because of the sequencing depth and the associated costs required. Therefore, different partitioning strategies have been developed to sequence informative subsets of studied genomes. Among these strategies, hybridization capture has proven to be an innovative and efficient tool for targeting and enriching specific biomarkers in complex DNA mixtures. It has been successfully applied in numerous areas of biology, such as exome resequencing for the identification of mutations underlying Mendelian or complex diseases and cancers, and its usefulness has been demonstrated in the agronomic field through the linking of genetic variants to agricultural phenotypic traits of interest. Moreover, hybridization capture has provided access to underexplored, but relevant fractions of genomes through its ability to enrich defined targets and their flanking regions. Finally, on the basis of restricted genomic information, this method has also allowed the expansion of knowledge of nonreference species and ancient genomes and provided a better understanding of metagenomic samples. In this review, we present the major advances and discoveries permitted by hybridization capture and highlight the potency of this approach in all areas of biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Detection of genomic variation by selection of a 9 mb DNA region and high throughput sequencing.
Directory of Open Access Journals (Sweden)
Sergey I Nikolaev
Full Text Available Detection of the rare polymorphisms and causative mutations of genetic diseases in a targeted genomic area has become a major goal in order to understand genomic and phenotypic variability. We have interrogated repeat-masked regions of 8.9 Mb on human chromosomes 21 (7.8 Mb and 7 (1.1 Mb from an individual from the International HapMap Project (NA12872. We have optimized a method of genomic selection for high throughput sequencing. Microarray-based selection and sequencing resulted in 260-fold enrichment, with 41% of reads mapping to the target region. 83% of SNPs in the targeted region had at least 4-fold sequence coverage and 54% at least 15-fold. When assaying HapMap SNPs in NA12872, our sequence genotypes are 91.3% concordant in regions with coverage > or = 4-fold, and 97.9% concordant in regions with coverage > or = 15-fold. About 81% of the SNPs recovered with both thresholds are listed in dbSNP. We observed that regions with low sequence coverage occur in close proximity to low-complexity DNA. Validation experiments using Sanger sequencing were performed for 46 SNPs with 15-20 fold coverage, with a confirmation rate of 96%, suggesting that DNA selection provides an accurate and cost-effective method for identifying rare genomic variants.
Economic method for helical gear flank surface characterisation
Koulin, G.; Reavie, T.; Frazer, R. C.; Shaw, B. A.
2018-03-01
Typically the quality of a gear pair is assessed based on simplified geometric tolerances which do not always correlate with functional performance. In order to identify and quantify functional performance based parameters, further development of the gear measurement approach is required. Methodology for interpolation of the full active helical gear flank surface, from sparse line measurements, is presented. The method seeks to identify the minimum number of line measurements required to sufficiently characterise an active gear flank. In the form ground gear example presented, a single helix and three profile line measurements was considered to be acceptable. The resulting surfaces can be used to simulate the meshing engagement of a gear pair and therefore provide insight into functional performance based parameters. Therefore the assessment of the quality can be based on the predicted performance in the context of an application.
Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y
2015-10-22
Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.
5' Region of the human interleukin 4 gene: structure and potential regulatory elements
Energy Technology Data Exchange (ETDEWEB)
Eder, A; Krafft-Czepa, H; Krammer, P H
1988-01-25
The lymphokine Interleukin 4 (IL-4) is secreted by antigen or mitogen activated T lymphocytes. IL-4 stimulates activation and differentiation of B lymphocytes and growth of T lymphocytes and mast cells. The authors isolated the human IL-4 gene from a lambda EMBL3 genomic library. As a probe they used a synthetic oligonucleotide spanning position 40 to 79 of the published IL-4 cDNA sequence. The 5' promoter region contains several sequence elements which may have a cis-acting regulatory function for IL-4 gene expression. These elements include a TATA-box, three CCAAT-elements (two are on the non-coding strand) and an octamer motif. A comparison of the 5' flanking region of the human murine IL-4 gene (4) shows that the region between position -306 and +44 is highly conserved (83% homology).
International Nuclear Information System (INIS)
Silva, K.F.S.T.
1989-01-01
The investigations described in this dissertation were designed to determine the transcriptionally active DNA sequences of IIR region and to identify the viral mRNA transcribed from the transcriptionally most active DNA sequences of that region during late phase of HCMV Towne infection. Preliminary transcriptional studies which included the hybridization of a southern blot of XbaI digested entire HCMV genome to 32 P-labelled late phase infected cell A + RNA, indicated that late viral transcripts homologous to XbaI Q fragment of IIR region were very highly abundant while XbaI Q fragment showed a very low transcriptional activity. To facilitate further analysis of late transcription of IIR region, the entire DNA sequences of IIR region were molecularly cloned as U, S, and H BamHI fragments in pACYC-184 plasmid vector. In addition, to be used in future studies on other regions of the genome, except for y and c' smaller fragments the entire 240 kb HCMV genome was cloned as BamHI fragments in the same vector. Furthermore, the U, S, and H BamHI fragments were mapped with six other restriction enzymes in order to use that mapping data in subsequent transcriptional analysis of the IIR region. Further localization of transcriptionally active DNA sequences within IIR region was achieved by hybridization of southern blots of restricted U, S, and H BamHI fragments with 3' 32 P-labelled infected cell late A + RNA. The 1.5 kb EcooRI subfragments of S BamHI fragment and the adjoining 0.72 kb XhoI subfragment of H BamHI fragment revealed the highest level of transcription, although the remainder of the S fragment was also transcribed at a substantial level. The U fragment and the remainder of the H fragment was transcribed at a very low level
A method for accurate detection of genomic microdeletions using real-time quantitative PCR
Directory of Open Access Journals (Sweden)
Bassett Anne S
2005-12-01
Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a well-established method for quantifying levels of gene expression, but has not been routinely applied to the detection of constitutional copy number alterations of human genomic DNA. Microdeletions or microduplications of the human genome are associated with a variety of genetic disorders. Although, clinical laboratories routinely use fluorescence in situ hybridization (FISH to identify such cryptic genomic alterations, there remains a significant number of individuals in which constitutional genomic imbalance is suspected, based on clinical parameters, but cannot be readily detected using current cytogenetic techniques. Results In this study, a novel application for real-time qPCR is presented that can be used to reproducibly detect chromosomal microdeletions and microduplications. This approach was applied to DNA from a series of patient samples and controls to validate genomic copy number alteration at cytoband 22q11. The study group comprised 12 patients with clinical symptoms of chromosome 22q11 deletion syndrome (22q11DS, 1 patient trisomic for 22q11 and 4 normal controls. 6 of the patients (group 1 had known hemizygous deletions, as detected by standard diagnostic FISH, whilst the remaining 6 patients (group 2 were classified as 22q11DS negative using the clinical FISH assay. Screening of the patients and controls with a set of 10 real time qPCR primers, spanning the 22q11.2-deleted region and flanking sequence, confirmed the FISH assay results for all patients with 100% concordance. Moreover, this qPCR enabled a refinement of the region of deletion at 22q11. Analysis of DNA from chromosome 22 trisomic sample demonstrated genomic duplication within 22q11. Conclusion In this paper we present a qPCR approach for the detection of chromosomal microdeletions and microduplications. The strategic use of in silico modelling for qPCR primer design to avoid regions of repetitive
Relaxation of the south flank after the 7.2-magnitude Kalapana earthquake, Kilauea Volcano, Hawaii
Dvorak, John J.; Klein, Fred W.; Swanson, Donald A.
1994-01-01
An M = 7.2 earthquake on 29 November 1975 caused the south flank of Kilauea Volcano, Hawaii, to move seaward several meters: a catastrophic release of compression of the south flank caused by earlier injections of magma into the adjacent segment of a rift zone. The focal mechanisms of the mainshock, the largest foreshock, and the largest aftershock suggest seaward movement of the upper block. The rate of aftershocks decreased in a familiar hyperbolic decay, reaching the pre-1975 rate of seismicity by the mid-1980s. Repeated rift-zone intrusions and eruptions after 1975, which occurred within 25 km of the summit area, compressed the adjacent portion of the south flank, apparently masking continued seaward displacement of the south flank. This is evident along a trilateration line that continued to extend, suggesting seaward displacement, immediately after the M = 7.2 earthquake, but then was compressed during a series of intrusions and eruptions that began in September 1977. Farther to the east, trilateration measurements show that the portion of the south flank above the aftershock zone, but beyond the area of compression caused by the rift-zone intrusions and eruptions, continued to move seaward at a decreasing rate until the mid-1980s, mimicking the decay in aftershock rate. Along the same portion of the south flank, the pattern of vertical surface displacements can be explained by continued seaward movement of the south flank and development of two eruptive fissures along the east rift zone, each of which extended from a depth of ∼3 km to the surface. The aftershock rate and continued seaward movement of the south flank are reminiscent of crustal response to other large earthquakes, such as the 1966 M = 6 Parkfield earthquake and the 1983 M = 6.5 Coalinga earthquake.
Multi-region and single-cell sequencing reveal variable genomic heterogeneity in rectal cancer.
Liu, Mingshan; Liu, Yang; Di, Jiabo; Su, Zhe; Yang, Hong; Jiang, Beihai; Wang, Zaozao; Zhuang, Meng; Bai, Fan; Su, Xiangqian
2017-11-23
Colorectal cancer is a heterogeneous group of malignancies with complex molecular subtypes. While colon cancer has been widely investigated, studies on rectal cancer are very limited. Here, we performed multi-region whole-exome sequencing and single-cell whole-genome sequencing to examine the genomic intratumor heterogeneity (ITH) of rectal tumors. We sequenced nine tumor regions and 88 single cells from two rectal cancer patients with tumors of the same molecular classification and characterized their mutation profiles and somatic copy number alterations (SCNAs) at the multi-region and the single-cell levels. A variable extent of genomic heterogeneity was observed between the two patients, and the degree of ITH increased when analyzed on the single-cell level. We found that major SCNAs were early events in cancer development and inherited steadily. Single-cell sequencing revealed mutations and SCNAs which were hidden in bulk sequencing. In summary, we studied the ITH of rectal cancer at regional and single-cell resolution and demonstrated that variable heterogeneity existed in two patients. The mutational scenarios and SCNA profiles of two patients with treatment naïve from the same molecular subtype are quite different. Our results suggest each tumor possesses its own architecture, which may result in different diagnosis, prognosis, and drug responses. Remarkable ITH exists in the two patients we have studied, providing a preliminary impression of ITH in rectal cancer.
Effect of the bases flanking an abasic site on the recognition of nucleobase by amiloride.
Rajendran, Arivazhagan; Zhao, Chunxia; Rajendar, Burki; Thiagarajan, Viruthachalam; Sato, Yusuke; Nishizawa, Seiichi; Teramae, Norio
2010-06-01
We explain here the various non-covalent interactions which are responsible for the different binding modes of a small ligand with DNA. The combination of experimental and theoretical methods was used. The interaction of amiloride with thymine was found to depend on the bases flanking the AP site and different binding modes were observed for different flanking bases. Molecular modeling, absorption studies and binding constant measurements support for the different binding patterns. The flanking base dependent recognition of AP site phosphates was investigated by (31)P NMR experiments. The thermodynamics of the ligand-nucleotide interaction was demonstrated by isothermal titration calorimetry. The emission behavior of amiloride was found to depend on the bases flanking the AP site. Amiloride photophysics in the context of AP-site containing DNA is investigated by time-dependent density functional theory. Flanking bases affect the ground and excited electronic states of amiloride when binding to AP site, which causes flanking base-dependent fluorescence signaling. The various noncovalent interactions have been well characterized for the determination of nucleic acid structure and dynamics, and protein-DNA interactions. However, these are not clear for the DNA-small molecule interactions and we believe that our studies will bring a new insight into such phenomena. Copyright 2010 Elsevier B.V. All rights reserved.
Novel transcripts discovered by mining genomic DNA from defined regions of bovine chromosome 6
Directory of Open Access Journals (Sweden)
Eberlein Annett
2009-04-01
Full Text Available Abstract Background Linkage analyses strongly suggest a number of QTL for production, health and conformation traits in the middle part of bovine chromosome 6 (BTA6. The identification of the molecular background underlying the genetic variation at the QTL and subsequent functional studies require a well-annotated gene sequence map of the critical QTL intervals. To complete the sequence map of the defined subchromosomal regions on BTA6 poorly covered with comparative gene information, we focused on targeted isolation of transcribed sequences from bovine bacterial artificial chromosome (BAC clones mapped to the QTL intervals. Results Using the method of exon trapping, 92 unique exon trapping sequences (ETS were discovered in a chromosomal region of poor gene coverage. Sequence identity to the current NCBI sequence assembly for BTA6 was detected for 91% of unique ETS. Comparative sequence similarity search revealed that 11% of the isolated ETS displayed high similarity to genomic sequences located on the syntenic chromosomes of the human and mouse reference genome assemblies. Nearly a third of the ETS identified similar equivalent sequences in genomic sequence scaffolds from the alternative Celera-based sequence assembly of the human genome. Screening gene, EST, and protein databases detected 17% of ETS with identity to known transcribed sequences. Expression analysis of a subset of the ETS showed that most ETS (84% displayed a distinctive expression pattern in a multi-tissue panel of a lactating cow verifying their existence in the bovine transcriptome. Conclusion The results of our study demonstrate that the exon trapping method based on region-specific BAC clones is very useful for targeted screening for novel transcripts located within a defined chromosomal region being deficiently endowed with annotated gene information. The majority of identified ETS represents unknown noncoding sequences in intergenic regions on BTA6 displaying a
Genomic Variants Revealed by Invariably Missing Genotypes in Nelore Cattle.
Directory of Open Access Journals (Sweden)
Joaquim Manoel da Silva
Full Text Available High density genotyping panels have been used in a wide range of applications. From population genetics to genome-wide association studies, this technology still offers the lowest cost and the most consistent solution for generating SNP data. However, in spite of the application, part of the generated data is always discarded from final datasets based on quality control criteria used to remove unreliable markers. Some discarded data consists of markers that failed to generate genotypes, labeled as missing genotypes. A subset of missing genotypes that occur in the whole population under study may be caused by technical issues but can also be explained by the presence of genomic variations that are in the vicinity of the assayed SNP and that prevent genotyping probes from annealing. The latter case may contain relevant information because these missing genotypes might be used to identify population-specific genomic variants. In order to assess which case is more prevalent, we used Illumina HD Bovine chip genotypes from 1,709 Nelore (Bos indicus samples. We found 3,200 missing genotypes among the whole population. NGS re-sequencing data from 8 sires were used to verify the presence of genomic variations within their flanking regions in 81.56% of these missing genotypes. Furthermore, we discovered 3,300 novel SNPs/Indels, 31% of which are located in genes that may affect traits of importance for the genetic improvement of cattle production.
Genome editing for crop improvement: Challenges and opportunities.
Abdallah, Naglaa A; Prakash, Channapatna S; McHughen, Alan G
2015-01-01
Genome or gene editing includes several new techniques to help scientists precisely modify genome sequences. The techniques also enables us to alter the regulation of gene expression patterns in a pre-determined region and facilitates novel insights into the functional genomics of an organism. Emergence of genome editing has brought considerable excitement especially among agricultural scientists because of its simplicity, precision and power as it offers new opportunities to develop improved crop varieties with clear-cut addition of valuable traits or removal of undesirable traits. Research is underway to improve crop varieties with higher yields, strengthen stress tolerance, disease and pest resistance, decrease input costs, and increase nutritional value. Genome editing encompasses a wide variety of tools using either a site-specific recombinase (SSR) or a site-specific nuclease (SSN) system. Both systems require recognition of a known sequence. The SSN system generates single or double strand DNA breaks and activates endogenous DNA repair pathways. SSR technology, such as Cre/loxP and Flp/FRT mediated systems, are able to knockdown or knock-in genes in the genome of eukaryotes, depending on the orientation of the specific sites (loxP, FLP, etc.) flanking the target site. There are 4 main classes of SSN developed to cleave genomic sequences, mega-nucleases (homing endonuclease), zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), and the CRISPR/Cas nuclease system (clustered regularly interspaced short palindromic repeat/CRISPR-associated protein). The recombinase mediated genome engineering depends on recombinase (sub-) family and target-site and induces high frequencies of homologous recombination. Improving crops with gene editing provides a range of options: by altering only a few nucleotides from billions found in the genomes of living cells, altering the full allele or by inserting a new gene in a targeted region of
Structured RNAs in the ENCODE selected regions of the human genome
DEFF Research Database (Denmark)
Washietl, Stefan; Pedersen, Jakob Skou; Korbel, Jan O
2007-01-01
Functional RNA structures play an important role both in the context of noncoding RNA transcripts as well as regulatory elements in mRNAs. Here we present a computational study to detect functional RNA structures within the ENCODE regions of the human genome. Since structural RNAs in general lack...... with the GENCODE annotation points to functional RNAs in all genomic contexts, with a slightly increased density in 3'-UTRs. While we estimate a significant false discovery rate of approximately 50%-70% many of the predictions can be further substantiated by additional criteria: 248 loci are predicted by both RNAz...
New Regions of the Human Genome Linked to Skin Color Variation in Some African Populations
In the first study of its kind, an international team of genomics researchers has identified new regions of the human genome that are associated with skin color variation in some African populations, opening new avenues for research on skin diseases and cancer in all populations.
Lu, Qiongshi; Hu, Yiming; Sun, Jiehuan; Cheng, Yuwei; Cheung, Kei-Hoi; Zhao, Hongyu
2015-05-27
Identifying functional regions in the human genome is a major goal in human genetics. Great efforts have been made to functionally annotate the human genome either through computational predictions, such as genomic conservation, or high-throughput experiments, such as the ENCODE project. These efforts have resulted in a rich collection of functional annotation data of diverse types that need to be jointly analyzed for integrated interpretation and annotation. Here we present GenoCanyon, a whole-genome annotation method that performs unsupervised statistical learning using 22 computational and experimental annotations thereby inferring the functional potential of each position in the human genome. With GenoCanyon, we are able to predict many of the known functional regions. The ability of predicting functional regions as well as its generalizable statistical framework makes GenoCanyon a unique and powerful tool for whole-genome annotation. The GenoCanyon web server is available at http://genocanyon.med.yale.edu.
HLA region excluded by linkage analyses of early onset periodontitis
Energy Technology Data Exchange (ETDEWEB)
Sun, C.; Wang, S.; Lopez, N.
1994-09-01
Previous studies suggested that HLA genes may influence susceptibility to early-onset periodontitis (EOP). Segregation analyses indicate that EOP may be due to a single major gene. We conducted linkage analyses to assess possible HLA effects on EOP. Fifty families with two or more close relatives affected by EOP were ascertained in Virginia and Chile. A microsatellite polymorphism within the HLA region (at the tumor necrosis factor beta locus) was typed using PCR. Linkage analyses used a donimant model most strongly supported by previous studies. Assuming locus homogeneity, our results exclude a susceptibility gene within 10 cM on either side of our marker locus. This encompasses all of the HLA region. Analyses assuming alternative models gave qualitatively similar results. Allowing for locus heterogeneity, our data still provide no support for HLA-region involvement. However, our data do not statistically exclude (LOD <-2.0) hypotheses of disease-locus heterogeneity, including models where up to half of our families could contain an EOP disease gene located in the HLA region. This is due to the limited power of even our relatively large collection of families and the inherent difficulties of mapping genes for disorders that have complex and heterogeneous etiologies. Additional statistical analyses, recruitment of families, and typing of flanking DNA markers are planned to more conclusively address these issues with respect to the HLA region and other candidate locations in the human genome. Additional results for markers covering most of the human genome will also be presented.
Flank solar wind interaction. Annual report, June 1991-July 1992
International Nuclear Information System (INIS)
Moses, S.L.; Greenstadt, E.W.
1992-08-01
This report summarizes the results of the first 12 months of our program to study the interaction of the Earth's magnetosphere with the solar wind on the far flanks of the bow shock. This study employs data from the ISEE-3 spacecraft during its traversals of the Earth's magnetotail and correlative data from spacecraft monitoring the solar wind upstream. Our main effort to date has involved assembling data sets and developing new plotting programs. Two talks were given at the Spring Meeting of the American Geophysical Union describing our initial results from analyzing data from the far flank foreshock and magnetosheath. The following sections summarize our results
Wear evaluation of flank in burins of high speed steel modified with titanium ions
E Caballero, J.; V-Niño, E. D.
2017-12-01
This report shows the results obtained researching the flank wearing resistance performed by the high-speed steel (HSS) burins without any surface treatment (reference substrate) and others with surface treatment based on Titanium ions. The flank wearing was carried out by means of an industrial process by chip removal with repetitive tests of dry finished turning of AISI/SAE 1045 steel bars. The useful service life of the burins was evaluated according to ISO 3685:1993, and it was found that the burins treated with Titanium ions showed an increase in the flank wearing resistance with respect to the ones used as reference.
Generation and characterization of a stable red fluorescent ...
African Journals Online (AJOL)
An approximately 1.0 kb fragment amplified from 5'-flanking sequence of transgenes was identified in wild-type T. albonubes genome, and bears no homologous sequence in the GenBank database. In the 3'-flanking region, an approximately 1.2 kb fragment with unidentified source was amplified which has 99% homology ...
Method for Friction Force Estimation on the Flank of Cutting Tools
Directory of Open Access Journals (Sweden)
Luis Huerta
2017-01-01
Full Text Available Friction forces are present in any machining process. These forces could play an important role in the dynamics of the system. In the cutting process, friction is mainly present in the rake face and the flank of the tool. Although the one that acts on the rake face has a major influence, the other one can become also important and could take part in the stability of the system. In this work, experimental identification of the friction on the flank is presented. The experimental determination was carried out by machining aluminum samples in a CNC lathe. As a result, two friction functions were obtained as a function of the cutting speed and the relative motion of the contact elements. Experiments using a worn and a new insert were carried out. Force and acceleration were recorded simultaneously and, from these results, different friction levels were observed depending on the cutting parameters, such as cutting speed, feed rate, and tool condition. Finally, a friction model for the flank friction is presented.
Metagenome sequencing and 98 microbial genomes from Juan de Fuca Ridge flank subsurface fluids
Jungbluth, Sean P.; Amend, Jan P.; Rappé, Michael S.
2017-03-01
The global deep subsurface biosphere is one of the largest reservoirs for microbial life on our planet. This study takes advantage of new sampling technologies and couples them with improvements to DNA sequencing and associated informatics tools to reconstruct the genomes of uncultivated Bacteria and Archaea from fluids collected deep within the Juan de Fuca Ridge subseafloor. Here, we generated two metagenomes from borehole observatories located 311 meters apart and, using binning tools, retrieved 98 genomes from metagenomes (GFMs). Of the GFMs, 31 were estimated to be >90% complete, while an additional 17 were >70% complete. Phylogenomic analysis revealed 53 bacterial and 45 archaeal GFMs, of which nearly all were distantly related to known cultivated isolates. In the GFMs, abundant Bacteria included Chloroflexi, Nitrospirae, Acetothermia (OP1), EM3, Aminicenantes (OP8), Gammaproteobacteria, and Deltaproteobacteria, while abundant Archaea included Archaeoglobi, Bathyarchaeota (MCG), and Marine Benthic Group E (MBG-E). These data are the first GFMs reconstructed from the deep basaltic subseafloor biosphere, and provide a dataset available for further interrogation.
The hamster flank organ model: Is it relevant to man
International Nuclear Information System (INIS)
Franz, T.J.; Lehman, P.A.; Pochi, P.; Odland, G.F.; Olerud, J.
1989-01-01
The critical role that androgens play in the etiology of acne has led to a search for topically active antiandrogens and the frequent use of the flank organ of the golden Syrian hamster as an animal model. 17-alpha-propyltestosterone (17-PT) has been identified as having potent antiandrogenic activity in the hamster model, and this report describes its clinical evaluation. Two double-blind placebo controlled studies comparing 4% 17-PT in 80% alcohol versus vehicle alone were conducted. One study examined 17-PT sebosuppressive activity in 20 subjects. The second study examined its efficacy in 44 subjects having mild to moderate acne. A third study measured in vitro percutaneous absorption of 17-PT through hamster flank and monkey skin, and human face skin in-vivo, using radioactive drug. 17-PT was found to be ineffective in reducing either the sebum excretion rate or the number of inflammatory acne lesions. Failure of 17-PT to show clinical activity was not a result of poor percutaneous absorption. Total absorption in man was 7.7% of the dose and only 1.0% in the hamster. The sebaceous gland of hamster flank organ is apparently more sensitive to antiandrogens than the human sebaceous gland
2013-01-01
Background The Brassica B genome is known to carry several important traits, yet there has been limited analyses of its underlying genome structure, especially in comparison to the closely related A and C genomes. A bacterial artificial chromosome (BAC) library of Brassica nigra was developed and screened with 17 genes from a 222 kb region of A. thaliana that had been well characterised in both the Brassica A and C genomes. Results Fingerprinting of 483 apparently non-redundant clones defined physical contigs for the corresponding regions in B. nigra. The target region is duplicated in A. thaliana and six homologous contigs were found in B. nigra resulting from the whole genome triplication event shared by the Brassiceae tribe. BACs representative of each region were sequenced to elucidate the level of microscale rearrangements across the Brassica species divide. Conclusions Although the B genome species separated from the A/C lineage some 6 Mya, comparisons between the three paleopolyploid Brassica genomes revealed extensive conservation of gene content and sequence identity. The level of fractionation or gene loss varied across genomes and genomic regions; however, the greatest loss of genes was observed to be common to all three genomes. One large-scale chromosomal rearrangement differentiated the B genome suggesting such events could contribute to the lack of recombination observed between B genome species and those of the closely related A/C lineage. PMID:23586706
Kumar, Nitin; Cai, Haoyang; von Mering, Christian; Baudis, Michael
2012-01-01
Regional genomic copy number alterations (CNA) are observed in the vast majority of cancers. Besides specifically targeting well-known, canonical oncogenes, CNAs may also play more subtle roles in terms of modulating genetic potential and broad gene expression patterns of developing tumors. Any significant differences in the overall CNA patterns between different cancer types may thus point towards specific biological mechanisms acting in those cancers. In addition, differences among CNA profiles may prove valuable for cancer classifications beyond existing annotation systems. We have analyzed molecular-cytogenetic data from 25579 tumors samples, which were classified into 160 cancer types according to the International Classification of Disease (ICD) coding system. When correcting for differences in the overall CNA frequencies between cancer types, related cancers were often found to cluster together according to similarities in their CNA profiles. Based on a randomization approach, distance measures from the cluster dendrograms were used to identify those specific genomic regions that contributed significantly to this signal. This approach identified 43 non-neutral genomic regions whose propensity for the occurrence of copy number alterations varied with the type of cancer at hand. Only a subset of these identified loci overlapped with previously implied, highly recurrent (hot-spot) cytogenetic imbalance regions. Thus, for many genomic regions, a simple null-hypothesis of independence between cancer type and relative copy number alteration frequency can be rejected. Since a subset of these regions display relatively low overall CNA frequencies, they may point towards second-tier genomic targets that are adaptively relevant but not necessarily essential for cancer development.
Genomics using the Assembly of the Mink Genome
DEFF Research Database (Denmark)
Guldbrandtsen, Bernt; Cai, Zexi; Sahana, Goutam
2018-01-01
The American Mink’s (Neovison vison) genome has recently been sequenced. This opens numerous avenues of research both for studying the basic genetics and physiology of the mink as well as genetic improvement in mink. Using genotyping-by-sequencing (GBS) generated marker data for 2,352 Danish farm...... mink runs of homozygosity (ROH) were detect in mink genomes. Detectable ROH made up on average 1.7% of the genome indicating the presence of at most a moderate level of genomic inbreeding. The fraction of genome regions found in ROH varied. Ten percent of the included regions were never found in ROH....... The ability to detect ROH in the mink genome also demonstrates the general reliability of the new mink genome assembly. Keywords: american mink, run of homozygosity, genome, selection, genomic inbreeding...
Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S
1992-09-05
We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or
Li, Yongsheng; Camarillo, Cynthia; Xu, Juan; Arana, Tania Bedard; Xiao, Yun; Zhao, Zheng; Chen, Hong; Ramirez, Mercedes; Zavala, Juan; Escamilla, Michael A.; Armas, Regina; Mendoza, Ricardo; Ontiveros, Alfonso; Nicolini, Humberto; Jerez Magaña, Alvaro Antonio; Rubin, Lewis P.; Li, Xia; Xu, Chun
2015-01-01
Schizophrenia (SZ) and bipolar disorder (BP) are complex genetic disorders. Their appearance is also likely informed by as yet only partially described epigenetic contributions. Using a sequencing-based method for genome-wide analysis, we quantitatively compared the blood DNA methylation landscapes in SZ and BP subjects to control, both in an understudied population, Hispanics along the US-Mexico border. Remarkably, we identified thousands of differentially methylated regions for SZ and BP preferentially located in promoters 3′-UTRs and 5′-UTRs of genes. Distinct patterns of aberrant methylation of promoter sequences were located surrounding transcription start sites. In these instances, aberrant methylation occurred in CpG islands (CGIs) as well as in flanking regions as well as in CGI sparse promoters. Pathway analysis of genes displaying these distinct aberrant promoter methylation patterns showed enhancement of epigenetic changes in numerous genes previously related to psychiatric disorders and neurodevelopment. Integration of gene expression data further suggests that in SZ aberrant promoter methylation is significantly associated with altered gene transcription. In particular, we found significant associations between (1) promoter CGIs hypermethylation with gene repression and (2) CGI 3′-shore hypomethylation with increased gene expression. Finally, we constructed a specific methylation analysis platform that facilitates viewing and comparing aberrant genome methylation in human neuropsychiatric disorders. PMID:25734057
Directory of Open Access Journals (Sweden)
William A. MacDonald
2012-01-01
Full Text Available Genomic imprinting is a form of epigenetic inheritance whereby the regulation of a gene or chromosomal region is dependent on the sex of the transmitting parent. During gametogenesis, imprinted regions of DNA are differentially marked in accordance to the sex of the parent, resulting in parent-specific expression. While mice are the primary research model used to study genomic imprinting, imprinted regions have been described in a broad variety of organisms, including other mammals, plants, and insects. Each of these organisms employs multiple, interrelated, epigenetic mechanisms to maintain parent-specific expression. While imprinted genes and imprint control regions are often species and locus-specific, the same suites of epigenetic mechanisms are often used to achieve imprinted expression. This review examines some examples of the epigenetic mechanisms responsible for genomic imprinting in mammals, plants, and insects.
International Nuclear Information System (INIS)
Kudo, Shinichi; Fukuda, Minoru
1989-01-01
Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication
Directory of Open Access Journals (Sweden)
Harvey Steven P
2007-03-01
Full Text Available Abstract Background The facultative, intracellular bacterium Burkholderia pseudomallei is the causative agent of melioidosis, a serious infectious disease of humans and animals. We identified and categorized tandem repeat arrays and their distribution throughout the genome of B. pseudomallei strain K96243 in order to develop a genetic typing method for B. pseudomallei. We then screened 104 of the potentially polymorphic loci across a diverse panel of 31 isolates including B. pseudomallei, B. mallei and B. thailandensis in order to identify loci with varying degrees of polymorphism. A subset of these tandem repeat arrays were subsequently developed into a multiple-locus VNTR analysis to examine 66 B. pseudomallei and 21 B. mallei isolates from around the world, as well as 95 lineages from a serial transfer experiment encompassing ~18,000 generations. Results B. pseudomallei contains a preponderance of tandem repeat loci throughout its genome, many of which are duplicated elsewhere in the genome. The majority of these loci are composed of repeat motif lengths of 6 to 9 bp with 4 to 10 repeat units and are predominately located in intergenic regions of the genome. Across geographically diverse B. pseudomallei and B.mallei isolates, the 32 VNTR loci displayed between 7 and 28 alleles, with Nei's diversity values ranging from 0.47 and 0.94. Mutation rates for these loci are comparable (>10-5 per locus per generation to that of the most diverse tandemly repeated regions found in other less diverse bacteria. Conclusion The frequency, location and duplicate nature of tandemly repeated regions within the B. pseudomallei genome indicate that these tandem repeat regions may play a role in generating and maintaining adaptive genomic variation. Multiple-locus VNTR analysis revealed extensive diversity within the global isolate set containing B. pseudomallei and B. mallei, and it detected genotypic differences within clonal lineages of both species that were
Optimization of turning process through the analytic flank wear modelling
Del Prete, A.; Franchi, R.; De Lorenzis, D.
2018-05-01
In the present work, the approach used for the optimization of the process capabilities for Oil&Gas components machining will be described. These components are machined by turning of stainless steel castings workpieces. For this purpose, a proper Design Of Experiments (DOE) plan has been designed and executed: as output of the experimentation, data about tool wear have been collected. The DOE has been designed starting from the cutting speed and feed values recommended by the tools manufacturer; the depth of cut parameter has been maintained as a constant. Wear data has been obtained by means the observation of the tool flank wear under an optical microscope: the data acquisition has been carried out at regular intervals of working times. Through a statistical data and regression analysis, analytical models of the flank wear and the tool life have been obtained. The optimization approach used is a multi-objective optimization, which minimizes the production time and the number of cutting tools used, under the constraint on a defined flank wear level. The technique used to solve the optimization problem is a Multi Objective Particle Swarm Optimization (MOPS). The optimization results, validated by the execution of a further experimental campaign, highlighted the reliability of the work and confirmed the usability of the optimized process parameters and the potential benefit for the company.
Ustek, Duran; Sirma, Sema; Gumus, Ergun; Arikan, Muzaffer; Cakiris, Aris; Abaci, Neslihan; Mathew, Jaicy; Emrence, Zeliha; Azakli, Hulya; Cosan, Fulya; Cakar, Atilla; Parlak, Mahmut; Kursun, Olcay
2012-10-01
One application of next-generation sequencing (NGS) is the targeted resequencing of interested genes which has not been used in viral integration site analysis of gene therapy applications. Here, we combined targeted sequence capture array and next generation sequencing to address the whole genome profiling of viral integration sites. Human 293T and K562 cells were transduced with a HIV-1 derived vector. A custom made DNA probe sets targeted pLVTHM vector used to capture lentiviral vector/human genome junctions. The captured DNA was sequenced using GS FLX platform. Seven thousand four hundred and eighty four human genome sequences flanking the long terminal repeats (LTR) of pLVTHM fragment sequences matched with an identity of at least 98% and minimum 50 bp criteria in both cells. In total, 203 unique integration sites were identified. The integrations in both cell lines were totally distant from the CpG islands and from the transcription start sites and preferentially located in introns. A comparison between the two cell lines showed that the lentiviral-transduced DNA does not have the same preferred regions in the two different cell lines. Copyright © 2012 Elsevier B.V. All rights reserved.
Calvari, S.; Branca, S.; Corsaro, R.A.; De Beni, E.; Miraglia, L.; Norini, G.; Wijbrans, J.R.; Boschi, E.
2011-01-01
A multidisciplinary geological and compositional investigation allowed us to reconstruct the occurrence of flank eruptions on the lower NE flank of Stromboli volcano since 15 ka. The oldest flank eruption recognised is Roisa, which occurred at ~15 ka during the Vancori period, and has transitional
Canine adenovirus type 2 vector generation via I-Sce1-mediated intracellular genome release.
Directory of Open Access Journals (Sweden)
Sandy Ibanes
Full Text Available When canine adenovirus type 2 (CAdV-2, or also commonly referred to as CAV-2 vectors are injected into the brain parenchyma they preferentially transduce neurons, are capable of efficient axonal transport to afferent regions, and allow transgene expression for at last >1 yr. Yet, translating these data into a user-friendly vector platform has been limited because CAV-2 vector generation is challenging. Generation of E1-deleted adenovirus vectors often requires transfection of linear DNA fragments of >30 kb containing the vector genome into an E1-transcomplementing cell line. In contrast to human adenovirus type 5 vector generation, CAV-2 vector generation is less efficient due, in part, to a reduced ability to initiate replication and poor transfectibility of canine cells with large, linear DNA fragments. To improve CAV-2 vector generation, we generated an E1-transcomplementing cell line expressing the estrogen receptor (ER fused to I-SceI, a yeast meganuclease, and plasmids containing the I-SceI recognition sites flanking the CAV-2 vector genome. Using transfection of supercoiled plasmid and intracellular genome release via 4-OH-tamoxifen-induced nuclear translocation of I-SceI, we improved CAV-2 vector titers 1,000 fold, and in turn increased the efficacy of CAV-2 vector generation.
Canine Adenovirus Type 2 Vector Generation via I-Sce1-Mediated Intracellular Genome Release
Ibanes, Sandy; Kremer, Eric J.
2013-01-01
When canine adenovirus type 2 (CAdV-2, or also commonly referred to as CAV-2) vectors are injected into the brain parenchyma they preferentially transduce neurons, are capable of efficient axonal transport to afferent regions, and allow transgene expression for at last >1 yr. Yet, translating these data into a user-friendly vector platform has been limited because CAV-2 vector generation is challenging. Generation of E1-deleted adenovirus vectors often requires transfection of linear DNA fragments of >30 kb containing the vector genome into an E1-transcomplementing cell line. In contrast to human adenovirus type 5 vector generation, CAV-2 vector generation is less efficient due, in part, to a reduced ability to initiate replication and poor transfectibility of canine cells with large, linear DNA fragments. To improve CAV-2 vector generation, we generated an E1-transcomplementing cell line expressing the estrogen receptor (ER) fused to I-SceI, a yeast meganuclease, and plasmids containing the I-SceI recognition sites flanking the CAV-2 vector genome. Using transfection of supercoiled plasmid and intracellular genome release via 4-OH-tamoxifen-induced nuclear translocation of I-SceI, we improved CAV-2 vector titers 1,000 fold, and in turn increased the efficacy of CAV-2 vector generation. PMID:23936483
Distinct sources of particles near the cusp and the dusk flank of the magnetosphere
Escoubet, C. P.; Grison, B.; Berchem, J.; Trattner, K. J.; Lavraud, B.; Pitout, F.; Soucek, J.; Richard, R. L.; Laakso, H. E.; Masson, A.; Dunlop, M.; Dandouras, I. S.; Rème, H.; Fazakerley, A. N.; Daly, P. W.
2015-12-01
At the magnetopause, the location of the magnetic reconnection sites depends on the orientation of the interplanetary magnetic field (IMF) in the solar wind: on the dayside magnetosphere for an IMF southward, on the lobes for an IMF northward and on the flanks for an IMF in the East-West direction. Since most of observations of reconnection events have sampled a limited region of space simultaneously it is still not yet know if the reconnection line is extended over large regions of the magnetosphere or if is patchy and made of many reconnection lines. We report a Cluster crossing on 5 January 2002 near the exterior cusp on the southern dusk side where we observe multiple sources of reconnection/injections. The IMF was mainly azimuthal (IMF-By around -5 nT), the solar wind speed lower than usual around 280 km/s with the density of order 5 cm-3. The four Cluster spacecraft had an elongated configuration near the magnetopause. C4 was the first spacecraft to enter the cusp around 19:52:04 UT, followed by C2 at 19:52:35 UT, C1 at 19:54:24 UT and C3 at 20:13:15 UT. C4 and C1 observed two ion energy dispersions at 20:10 UT and 20:40 UT and C3 at 20:35 UT and 21:15 UT. Using the time of flight technique on the upgoing and downgoing ions, which leads to energy dispersions, we obtain distances of the ion sources between 14 and 20 RE from the spacecraft. The slope of the ion energy dispersions confirmed these distances. Using Tsyganenko model, we find that these sources are located on the dusk flank, past the terminator. The first injection by C3 is seen at approximately the same time as the 2nd injection on C1 but their sources at the magnetopause were separated by more than 7 RE. This would imply that two distinct sources were active at the same time on the dusk flank of the magnetosphere. In addition, a flow reversal was observed at the magnetopause on C4 which would be an indication that reconnection is also taking place near the exterior cusp quasi-simultaneously. A
Doran, Anthony G; Berry, Donagh P; Creevey, Christopher J
2014-10-01
Four traits related to carcass performance have been identified as economically important in beef production: carcass weight, carcass fat, carcass conformation of progeny and cull cow carcass weight. Although Holstein-Friesian cattle are primarily utilized for milk production, they are also an important source of meat for beef production and export. Because of this, there is great interest in understanding the underlying genomic structure influencing these traits. Several genome-wide association studies have identified regions of the bovine genome associated with growth or carcass traits, however, little is known about the mechanisms or underlying biological pathways involved. This study aims to detect regions of the bovine genome associated with carcass performance traits (employing a panel of 54,001 SNPs) using measures of genetic merit (as predicted transmitting abilities) for 5,705 Irish Holstein-Friesian animals. Candidate genes and biological pathways were then identified for each trait under investigation. Following adjustment for false discovery (q-value carcass traits using a single SNP regression approach. Using a Bayesian approach, 46 QTL were associated (posterior probability > 0.5) with at least one of the four traits. In total, 557 unique bovine genes, which mapped to 426 human orthologs, were within 500kbs of QTL found associated with a trait using the Bayesian approach. Using this information, 24 significantly over-represented pathways were identified across all traits. The most significantly over-represented biological pathway was the peroxisome proliferator-activated receptor (PPAR) signaling pathway. A large number of genomic regions putatively associated with bovine carcass traits were detected using two different statistical approaches. Notably, several significant associations were detected in close proximity to genes with a known role in animal growth such as glucagon and leptin. Several biological pathways, including PPAR signaling, were
Hazza, Muataz Hazza F. Al; Adesta, Erry Y. T.; Riza, Muhammad
2013-12-01
High speed milling has many advantages such as higher removal rate and high productivity. However, higher cutting speed increase the flank wear rate and thus reducing the cutting tool life. Therefore estimating and predicting the flank wear length in early stages reduces the risk of unaccepted tooling cost. This research presents a neural network model for predicting and simulating the flank wear in the CNC end milling process. A set of sparse experimental data for finish end milling on AISI H13 at hardness of 48 HRC have been conducted to measure the flank wear length. Then the measured data have been used to train the developed neural network model. Artificial neural network (ANN) was applied to predict the flank wear length. The neural network contains twenty hidden layer with feed forward back propagation hierarchical. The neural network has been designed with MATLAB Neural Network Toolbox. The results show a high correlation between the predicted and the observed flank wear which indicates the validity of the models.
International Nuclear Information System (INIS)
Al Hazza, Muataz Hazza F; Adesta, Erry Y T; Riza, Muhammad
2013-01-01
High speed milling has many advantages such as higher removal rate and high productivity. However, higher cutting speed increase the flank wear rate and thus reducing the cutting tool life. Therefore estimating and predicting the flank wear length in early stages reduces the risk of unaccepted tooling cost. This research presents a neural network model for predicting and simulating the flank wear in the CNC end milling process. A set of sparse experimental data for finish end milling on AISI H13 at hardness of 48 HRC have been conducted to measure the flank wear length. Then the measured data have been used to train the developed neural network model. Artificial neural network (ANN) was applied to predict the flank wear length. The neural network contains twenty hidden layer with feed forward back propagation hierarchical. The neural network has been designed with MATLAB Neural Network Toolbox. The results show a high correlation between the predicted and the observed flank wear which indicates the validity of the models
Yutin, Natalya; Bäckström, Disa; Ettema, Thijs J G; Krupovic, Mart; Koonin, Eugene V
2018-04-10
Analysis of metagenomic sequences has become the principal approach for the study of the diversity of viruses. Many recent, extensive metagenomic studies on several classes of viruses have dramatically expanded the visible part of the virosphere, showing that previously undetected viruses, or those that have been considered rare, actually are important components of the global virome. We investigated the provenance of viruses related to tail-less bacteriophages of the family Tectiviridae by searching genomic and metagenomics sequence databases for distant homologs of the tectivirus-like Double Jelly-Roll major capsid proteins (DJR MCP). These searches resulted in the identification of numerous genomes of virus-like elements that are similar in size to tectiviruses (10-15 kilobases) and have diverse gene compositions. By comparison of the gene repertoires, the DJR MCP-encoding genomes were classified into 6 distinct groups that can be predicted to differ in reproduction strategies and host ranges. Only the DJR MCP gene that is present by design is shared by all these genomes, and most also encode a predicted DNA-packaging ATPase; the rest of the genes are present only in subgroups of this unexpectedly diverse collection of DJR MCP-encoding genomes. Only a minority encode a DNA polymerase which is a hallmark of the family Tectiviridae and the putative family "Autolykiviridae". Notably, one of the identified putative DJR MCP viruses encodes a homolog of Cas1 endonuclease, the integrase involved in CRISPR-Cas adaptation and integration of transposon-like elements called casposons. This is the first detected occurrence of Cas1 in a virus. Many of the identified elements are individual contigs flanked by inverted or direct repeats and appear to represent complete, extrachromosomal viral genomes, whereas others are flanked by bacterial genes and thus can be considered as proviruses. These contigs come from metagenomes of widely different environments, some dominated by
Directory of Open Access Journals (Sweden)
Blackmon Barbara P
2011-07-01
Full Text Available Abstract Background BAC-based physical maps provide for sequencing across an entire genome or a selected sub-genomic region of biological interest. Such a region can be approached with next-generation whole-genome sequencing and assembly as if it were an independent small genome. Using the minimum tiling path as a guide, specific BAC clones representing the prioritized genomic interval are selected, pooled, and used to prepare a sequencing library. Results This pooled BAC approach was taken to sequence and assemble a QTL-rich region, of ~3 Mbp and represented by twenty-seven BACs, on linkage group 5 of the Theobroma cacao cv. Matina 1-6 genome. Using various mixtures of read coverages from paired-end and linear 454 libraries, multiple assemblies of varied quality were generated. Quality was assessed by comparing the assembly of 454 reads with a subset of ten BACs individually sequenced and assembled using Sanger reads. A mixture of reads optimal for assembly was identified. We found, furthermore, that a quality assembly suitable for serving as a reference genome template could be obtained even with a reduced depth of sequencing coverage. Annotation of the resulting assembly revealed several genes potentially responsible for three T. cacao traits: black pod disease resistance, bean shape index, and pod weight. Conclusions Our results, as with other pooled BAC sequencing reports, suggest that pooling portions of a minimum tiling path derived from a BAC-based physical map is an effective method to target sub-genomic regions for sequencing. While we focused on a single QTL region, other QTL regions of importance could be similarly sequenced allowing for biological discovery to take place before a high quality whole-genome assembly is completed.
Plasma Transport at the Magnetospheric Flank Boundary. Final report
International Nuclear Information System (INIS)
Otto, Antonius
2012-01-01
Progress is highlighted in these areas: 1. Model of magnetic reconnection induced by three-dimensional Kelvin Helmholtz (KH) modes at the magnetospheric flank boundary; 2. Quantitative evaluation of mass transport from the magnetosheath onto closed geomagnetic field for northward IMF; 3. Comparison of mass transfer by cusp reconnection and Flank Kelvin Helmholtz modes; 4. Entropy constraint and plasma transport in the magnetotail - a new mechanism for current sheet thinning; 5. Test particle model for mass transport onto closed geomagnetic field for northward IMF; 6. Influence of density asymmetry and magnetic shear on (a) the linear and nonlinear growth of 3D Kelvin Helmholtz (KH) modes, and (b) three-dimensional KH mediated mass transport; 7. Examination of entropy and plasma transport in the magnetotail; 8. Entropy change and plasma transport by KH mediated reconnection - mixing and heating of plasma; 9. Entropy and plasma transport in the magnetotail - tail reconnection; and, 10. Wave coupling at the magnetospheric boundary and generation of kinetic Alfven waves
Force Modelling in Orthogonal Cutting Considering Flank Wear Effect
Rathod, Kanti Bhikhubhai; Lalwani, Devdas I.
2017-05-01
In the present work, an attempt has been made to provide a predictive cutting force model during orthogonal cutting by combining two different force models, that is, a force model for a perfectly sharp tool plus considering the effect of edge radius and a force model for a worn tool. The first force model is for a perfectly sharp tool that is based on Oxley's predictive machining theory for orthogonal cutting as the Oxley's model is for perfectly sharp tool, the effect of cutting edge radius (hone radius) is added and improve model is presented. The second force model is based on worn tool (flank wear) that was proposed by Waldorf. Further, the developed combined force model is also used to predict flank wear width using inverse approach. The performance of the developed combined total force model is compared with the previously published results for AISI 1045 and AISI 4142 materials and found reasonably good agreement.
Straub, Shannon C.K.; Cronn, Richard C.; Edwards, Christopher; Fishbein, Mark; Liston, Aaron
2013-01-01
Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae]) and found evidence of intracellular HGT for a 2.4-kb segment of mitochondrial DNA to the rps2–rpoC2 intergenic spacer of the plastome. The transferred region contains an rpl2 pseudogene and is flanked by plastid sequence in the mitochondrial genome, including an rpoC2 pseudogene, which likely provided the mechanism for HGT back to the plastome through double-strand break repair involving homologous recombination. The plastome insertion is restricted to tribe Asclepiadeae of subfamily Asclepiadoideae, whereas the mitochondrial rpoC2 pseudogene is present throughout the subfamily, which confirms that the plastid to mitochondrial HGT event preceded the HGT to the plastome. Although the plastome insertion has been maintained in all lineages of Asclepiadoideae, it shows minimal evidence of transcription in A. syriaca and is likely nonfunctional. Furthermore, we found recent gene conversion of the mitochondrial rpoC2 pseudogene in Asclepias by the plastid gene, which reflects continued interaction of these genomes. PMID:24029811
Farr, Alex; Ott, Johannes; Kueronya, Verena; Margreiter, Markus; Javadli, Elchin; Einig, Sabrina; Husslein, Peter W; Bancher-Todesca, Dagmar
2017-10-01
Maternal hydronephrosis may cause flank pain during pregnancy. We aimed to investigate the association between maternal hydronephrosis and flank pain intensity. From 2014 to 2015, all consecutive women with singleton pregnancies, who presented at our tertiary center due to acute flank pain, were prospectively evaluated by renal ultrasonography and pain questionnaires. A visual analogue scale was used to assess pain intensity. The study had 90% power to detect a significant correlation between hydronephrosis and flank pain (Spearman's test). A total of 51 consecutive women with left-sided (13.7%), right-sided (64.7%) or bilateral (21.6%) pain were enrolled. The mean gestational age of these women, who presented due to their pain, was 27.5 ± 6.8 weeks at the time of consultation. The mean VAS score was 7.6 ± 2.2. In 43/51 (84.3%) women, hydronephrosis was found on renal sonograms. No correlation was found between the grade of hydronephrosis and pain intensity (p = 0.466; r= -0.28). Women delivered at a mean gestational age of 38.1 ± 2.4 weeks and their infants had a mean birthweight of 3138 ± 677 g. Hydronephrosis is a common finding among pregnant women with acute flank pain. The grade of hydronephrosis does not affect pain intensity. This study suggests normal pregnancy outcomes in these women.
Hybridization Capture Reveals Evolution and Conservation across the Entire Koala Retrovirus Genome
Ishida, Yasuko; Cui, Pin; Vielgrader, Hanna; Helgen, Kristofer M.; Roca, Alfred L.; Greenwood, Alex D.
2014-01-01
The koala retrovirus (KoRV) is the only retrovirus known to be in the midst of invading the germ line of its host species. Hybridization capture and next generation sequencing were used on modern and museum DNA samples of koala (Phascolarctos cinereus) to examine ca. 130 years of evolution across the full KoRV genome. Overall, the entire proviral genome appeared to be conserved across time in sequence, protein structure and transcriptional binding sites. A total of 138 polymorphisms were detected, of which 72 were found in more than one individual. At every polymorphic site in the museum koalas, one of the character states matched that of modern KoRV. Among non-synonymous polymorphisms, radical substitutions involving large physiochemical differences between amino acids were elevated in env, potentially reflecting anti-viral immune pressure or avoidance of receptor interference. Polymorphisms were not detected within two functional regions believed to affect infectivity. Host sequences flanking proviral integration sites were also captured; with few proviral loci shared among koalas. Recently described variants of KoRV, designated KoRV-B and KoRV-J, were not detected in museum samples, suggesting that these variants may be of recent origin. PMID:24752422
Hybridization capture reveals evolution and conservation across the entire Koala retrovirus genome.
Directory of Open Access Journals (Sweden)
Kyriakos Tsangaras
Full Text Available The koala retrovirus (KoRV is the only retrovirus known to be in the midst of invading the germ line of its host species. Hybridization capture and next generation sequencing were used on modern and museum DNA samples of koala (Phascolarctos cinereus to examine ca. 130 years of evolution across the full KoRV genome. Overall, the entire proviral genome appeared to be conserved across time in sequence, protein structure and transcriptional binding sites. A total of 138 polymorphisms were detected, of which 72 were found in more than one individual. At every polymorphic site in the museum koalas, one of the character states matched that of modern KoRV. Among non-synonymous polymorphisms, radical substitutions involving large physiochemical differences between amino acids were elevated in env, potentially reflecting anti-viral immune pressure or avoidance of receptor interference. Polymorphisms were not detected within two functional regions believed to affect infectivity. Host sequences flanking proviral integration sites were also captured; with few proviral loci shared among koalas. Recently described variants of KoRV, designated KoRV-B and KoRV-J, were not detected in museum samples, suggesting that these variants may be of recent origin.
Efficient engineering of a bacteriophage genome using the type I-E CRISPR-Cas system.
Kiro, Ruth; Shitrit, Dror; Qimron, Udi
2014-01-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) system has recently been used to engineer genomes of various organisms, but surprisingly, not those of bacteriophages (phages). Here we present a method to genetically engineer the Escherichia coli phage T7 using the type I-E CRISPR-Cas system. T7 phage genome is edited by homologous recombination with a DNA sequence flanked by sequences homologous to the desired location. Non-edited genomes are targeted by the CRISPR-Cas system, thus enabling isolation of the desired recombinant phages. This method broadens CRISPR Cas-based editing to phages and uses a CRISPR-Cas type other than type II. The method may be adjusted to genetically engineer any bacteriophage genome.
Hazard Potential of Volcanic Flank Collapses Raised by New Megatsunami Evidence
Ramalho, R. S.; Winckler, G.; Madeira, J.; Helffrich, G. R.; Hipólito, A.; Quartau, R.; Adena, K.; Schaefer, J. M.
2015-12-01
Large-scale gravitational flank collapses of steep volcanic islands are hypothetically capable of triggering megatsunamis with highly catastrophic effects. Yet evidence for the existence and impact of collapsed-triggered megatsunamis and their run-up heights remains scarce and/or is highly contentious. Therefore a considerable debate still exists over the potential magnitude of collapse-triggered tsunamis and their inherent hazard. In particular, doubts still remain whether or not large-scale flank failures typically generate enough volume flux to result in megatsunamis, or alternatively operate by slow-moving or multiple smaller episodic failures with much lower tsunamigenic potential. Here we show that one of the tallest and most active oceanic volcanoes on Earth - Fogo, in the Cape Verde Islands - collapsed catastrophically and triggered a megatsunami with devastating near-field effects ~73,000 years ago. Our deductions are based on the recent discovery and cosmogenic 3He dating of tsunamigenic deposits - comprising fields of stranded megaclasts, chaotic conglomerates, and sand sheets - found on the adjacent Santiago Island, which attest to the impact of this megatsunami and document wave run-up heights exceeding 270 m. The evidence reported here implies that Fogo's flank failure involved at least one sudden and voluminous event that resulted in a megatsunami, in contrast to what has been suggested before. Our work thus provides another line of evidence that large-scale flank failures at steep volcanic islands may indeed happen catastrophically and are capable of triggering tsunamis of enormous height and energy. This new line of evidence therefore reinforces the hazard potential of volcanic island collapses and stands as a warning that such hazard should not be underestimated, particularly in areas where volcanic island edifices are close to other islands or to highly populated continental margins.
Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin
2015-04-01
This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.
Directory of Open Access Journals (Sweden)
Stéphane Vuilleumier
Full Text Available Methylotrophy describes the ability of organisms to grow on reduced organic compounds without carbon-carbon bonds. The genomes of two pink-pigmented facultative methylotrophic bacteria of the Alpha-proteobacterial genus Methylobacterium, the reference species Methylobacterium extorquens strain AM1 and the dichloromethane-degrading strain DM4, were compared.The 6.88 Mb genome of strain AM1 comprises a 5.51 Mb chromosome, a 1.26 Mb megaplasmid and three plasmids, while the 6.12 Mb genome of strain DM4 features a 5.94 Mb chromosome and two plasmids. The chromosomes are highly syntenic and share a large majority of genes, while plasmids are mostly strain-specific, with the exception of a 130 kb region of the strain AM1 megaplasmid which is syntenic to a chromosomal region of strain DM4. Both genomes contain large sets of insertion elements, many of them strain-specific, suggesting an important potential for genomic plasticity. Most of the genomic determinants associated with methylotrophy are nearly identical, with two exceptions that illustrate the metabolic and genomic versatility of Methylobacterium. A 126 kb dichloromethane utilization (dcm gene cluster is essential for the ability of strain DM4 to use DCM as the sole carbon and energy source for growth and is unique to strain DM4. The methylamine utilization (mau gene cluster is only found in strain AM1, indicating that strain DM4 employs an alternative system for growth with methylamine. The dcm and mau clusters represent two of the chromosomal genomic islands (AM1: 28; DM4: 17 that were defined. The mau cluster is flanked by mobile elements, but the dcm cluster disrupts a gene annotated as chelatase and for which we propose the name "island integration determinant" (iid.These two genome sequences provide a platform for intra- and interspecies genomic comparisons in the genus Methylobacterium, and for investigations of the adaptive mechanisms which allow bacterial lineages to acquire
Vuilleumier, Stéphane; Chistoserdova, Ludmila; Lee, Ming-Chun; Bringel, Françoise; Lajus, Aurélie; Zhou, Yang; Gourion, Benjamin; Barbe, Valérie; Chang, Jean; Cruveiller, Stéphane; Dossat, Carole; Gillett, Will; Gruffaz, Christelle; Haugen, Eric; Hourcade, Edith; Levy, Ruth; Mangenot, Sophie; Muller, Emilie; Nadalig, Thierry; Pagni, Marco; Penny, Christian; Peyraud, Rémi; Robinson, David G; Roche, David; Rouy, Zoé; Saenampechek, Channakhone; Salvignol, Grégory; Vallenet, David; Wu, Zaining; Marx, Christopher J; Vorholt, Julia A; Olson, Maynard V; Kaul, Rajinder; Weissenbach, Jean; Médigue, Claudine; Lidstrom, Mary E
2009-01-01
Methylotrophy describes the ability of organisms to grow on reduced organic compounds without carbon-carbon bonds. The genomes of two pink-pigmented facultative methylotrophic bacteria of the Alpha-proteobacterial genus Methylobacterium, the reference species Methylobacterium extorquens strain AM1 and the dichloromethane-degrading strain DM4, were compared. The 6.88 Mb genome of strain AM1 comprises a 5.51 Mb chromosome, a 1.26 Mb megaplasmid and three plasmids, while the 6.12 Mb genome of strain DM4 features a 5.94 Mb chromosome and two plasmids. The chromosomes are highly syntenic and share a large majority of genes, while plasmids are mostly strain-specific, with the exception of a 130 kb region of the strain AM1 megaplasmid which is syntenic to a chromosomal region of strain DM4. Both genomes contain large sets of insertion elements, many of them strain-specific, suggesting an important potential for genomic plasticity. Most of the genomic determinants associated with methylotrophy are nearly identical, with two exceptions that illustrate the metabolic and genomic versatility of Methylobacterium. A 126 kb dichloromethane utilization (dcm) gene cluster is essential for the ability of strain DM4 to use DCM as the sole carbon and energy source for growth and is unique to strain DM4. The methylamine utilization (mau) gene cluster is only found in strain AM1, indicating that strain DM4 employs an alternative system for growth with methylamine. The dcm and mau clusters represent two of the chromosomal genomic islands (AM1: 28; DM4: 17) that were defined. The mau cluster is flanked by mobile elements, but the dcm cluster disrupts a gene annotated as chelatase and for which we propose the name "island integration determinant" (iid). These two genome sequences provide a platform for intra- and interspecies genomic comparisons in the genus Methylobacterium, and for investigations of the adaptive mechanisms which allow bacterial lineages to acquire methylotrophic
Energy Technology Data Exchange (ETDEWEB)
Bejerman, Nicolás, E-mail: n.bejerman@uq.edu.au [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia); Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Dietzgen, Ralf G. [Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia)
2015-09-15
Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses.
International Nuclear Information System (INIS)
Bejerman, Nicolás; Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio; Dietzgen, Ralf G.
2015-01-01
Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses
DEFF Research Database (Denmark)
Rossin, Elizabeth J.; Hansen, Kasper Lage; Raychaudhuri, Soumya
2011-01-01
Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed by these r......Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed...... in rheumatoid arthritis (RA) and Crohn's disease (CD) GWAS, we build protein-protein interaction (PPI) networks for genes within associated loci and find abundant physical interactions between protein products of associated genes. We apply multiple permutation approaches to show that these networks are more...... that the RA and CD networks have predictive power by demonstrating that proteins in these networks, not encoded in the confirmed list of disease associated loci, are significantly enriched for association to the phenotypes in question in extended GWAS analysis. Finally, we test our method in 3 non...
Dikmen, Serdal; Cole, John B.; Null, Daniel J.; Hansen, Peter J.
2013-01-01
Heat stress compromises production, fertility, and health of dairy cattle. One mitigation strategy is to select individuals that are genetically resistant to heat stress. Most of the negative effects of heat stress on animal performance are a consequence of either physiological adaptations to regulate body temperature or adverse consequences of failure to regulate body temperature. Thus, selection for regulation of body temperature during heat stress could increase thermotolerance. The objective was to perform a genome-wide association study (GWAS) for rectal temperature (RT) during heat stress in lactating Holstein cows and identify SNPs associated with genes that have large effects on RT. Records on afternoon RT where the temperature-humidity index was ≥78.2 were obtained from 4,447 cows sired by 220 bulls, resulting in 1,440 useable genotypes from the Illumina BovineSNP50 BeadChip with 39,759 SNP. For GWAS, 2, 3, 4, 5, and 10 adjacent SNP were averaged to identify consensus genomic regions associated with RT. The largest proportion of SNP variance (0.07 to 0.44%) was explained by markers flanking the region between 28,877,547 and 28,907,154 bp on Bos taurus autosome (BTA) 24. That region is flanked by U1 (28,822,883 to 28,823,043) and NCAD (28,992,666 to 29,241,119). In addition, the SNP at 58,500,249 bp on BTA 16 explained 0.08% and 0.11% of the SNP variance for 2- and 3-SNP analyses, respectively. That contig includes SNORA19, RFWD2 and SCARNA3. Other SNPs associated with RT were located on BTA 16 (close to CEP170 and PLD5), BTA 5 (near SLCO1C1 and PDE3A), BTA 4 (near KBTBD2 and LSM5), and BTA 26 (located in GOT1, a gene implicated in protection from cellular stress). In conclusion, there are QTL for RT in heat-stressed dairy cattle. These SNPs could prove useful in genetic selection and for identification of genes involved in physiological responses to heat stress. PMID:23935954
Genomic regions associated with the sex-linked inhibitor of dermal melanin in Silkie chicken
Directory of Open Access Journals (Sweden)
Ming TIAN,Rui HAO,Suyun FANG,Yanqiang WANG,Xiaorong GU,Chungang FENG,Xiaoxiang HU,Ning LI
2014-09-01
Full Text Available A unique characteristic of the Silkie chicken is its fibromelanosis phenotype. The dermal layer of its skin, its connective tissue and shank dermis are hyperpigmented. This dermal hyperpigmentation phenotype is controlled by the sex-linked inhibitor of dermal melanin gene (ID and the dominant fibromelanosis allele. This study attempted to confirm the genomic region associated with ID. By genotyping, ID was found to be closely linked to the region between GGA_rs16127903 and GGA_rs14685542 (8406919 bp on chromosome Z, which contains ten functional genes. The expression of these genes was characterized in the embryo and 4 days after hatching and it was concluded that MTAP, encoding methylthioadenosinephosphorylase, would be the most likely candidate gene. Finally, target DNA capture and sequence analysis was performed, but no specific SNP(s was found in the targeted region of the Silkie genome. Further work is necessary to identify the causal ID mutation located on chromosome Z.
Sediment transport along the Cap de Creus Canyon flank during a mild, wet winter
Directory of Open Access Journals (Sweden)
J. Martín
2013-05-01
direction (from SE to NW on 16 March, downwelling ceased, currents inside the canyon reversed from down- to up-canyon, and the turbid shelf plume was evacuated from the canyon, most probably flowing along the southern canyon flank and being entrained by the general SW circulation after leaving the canyon confinement. This study highlights that remarkable sediment transport occurs in the CCC, and particularly along its southern flank, even during mild and wet winters, in absence of cascading and under limited external forcing. The sediment transport associated with eastern storms like the ones described in this paper tends to enter the canyon by its downstream flank, partially affecting the canyon head region. Sediment transport during these events is not constrained near the seafloor but distributed in a depth range of 200–300 m above the bottom. Our paper broadens the understanding of the complex set of atmosphere-driven sediment transport processes acting in this highly dynamic area of the northwestern Mediterranean Sea.
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.
Tyson, Jess; Armour, John A L
2012-12-11
Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR
Directory of Open Access Journals (Sweden)
Tyson Jess
2012-12-01
Full Text Available Abstract Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.
Reifenberger, Jeffrey; Dorfman, Kevin; Cao, Han
Human DNA is a not a polymer consisting of a uniform distribution of all 4 nucleic acids, but rather contains regions of high AT and high GC content. When confined, these regions could have different stretch due to the extra hydrogen bond present in the GC basepair. To measure this potential difference, human genomic DNA was nicked with NtBspQI, labeled with a cy3 like fluorophore at the nick site, stained with YOYO, loaded into a device containing an array of nanochannels, and imaged. Over 473,000 individual molecules of DNA, corresponding to roughly 30x coverage of a human genome, were collected and aligned to the human reference. Based on the known AT/GC content between aligned pairs of labels, the stretch was measured for regions of similar size but different AT/GC content. We found that regions of high GC content were consistently more stretched than regions of high AT content between pairs of labels varying in size between 2.5 kbp and 500 kbp. We measured that for every 1% increase in GC content there was roughly a 0.06% increase in stretch. While this effect is small, it is important to take into account differences in stretch between AT and GC rich regions to improve the sensitivity of detection of structural variations from genomic variations. NIH Grant: R01-HG006851.
Human Xq28 Inversion Polymorphism: From Sex Linkage to Genomics--A Genetic Mother Lode
Kirby, Cait S.; Kolber, Natalie; Salih Almohaidi, Asmaa M.; Bierwert, Lou Ann; Saunders, Lori; Williams, Steven; Merritt, Robert
2016-01-01
An inversion polymorphism of the filamin and emerin genes at the tip of the long arm of the human X-chromosome serves as the basis of an investigative laboratory in which students learn something new about their own genomes. Long, nearly identical inverted repeats flanking the filamin and emerin genes illustrate how repetitive elements can lead to…
Zmienko, Agnieszka; Samelak-Czajka, Anna; Kozlowski, Piotr; Szymanska, Maja; Figlerowicz, Marek
2016-11-08
Intraspecies copy number variations (CNVs), defined as unbalanced structural variations of specific genomic loci, ≥1 kb in size, are present in the genomes of animals and plants. A growing number of examples indicate that CNVs may have functional significance and contribute to phenotypic diversity. In the model plant Arabidopsis thaliana at least several hundred protein-coding genes might display CNV; however, locus-specific genotyping studies in this plant have not been conducted. We analyzed the natural CNVs in the region overlapping MSH2 gene that encodes the DNA mismatch repair protein, and AT3G18530 and AT3G18535 genes that encode poorly characterized proteins. By applying multiplex ligation-dependent probe amplification and droplet digital PCR we genotyped those genes in 189 A. thaliana accessions. We found that AT3G18530 and AT3G18535 were duplicated (2-14 times) in 20 and deleted in 101 accessions. MSH2 was duplicated in 12 accessions (up to 12-14 copies) but never deleted. In all but one case, the MSH2 duplications were associated with those of AT3G18530 and AT3G18535. Considering the structure of the CNVs, we distinguished 5 genotypes for this region, determined their frequency and geographical distribution. We defined the CNV breakpoints in 35 accessions with AT3G18530 and AT3G18535 deletions and tandem duplications and showed that they were reciprocal events, resulting from non-allelic homologous recombination between 99 %-identical sequences flanking these genes. The widespread geographical distribution of the deletions supported by the SNP and linkage disequilibrium analyses of the genomic sequence confirmed the recurrent nature of this CNV. We characterized in detail for the first time the complex multiallelic CNV in Arabidopsis genome. The region encoding MSH2, AT3G18530 and AT3G18535 genes shows enormous variation of copy numbers among natural ecotypes, being a remarkable example of high Arabidopsis genome plasticity. We provided the molecular
Directory of Open Access Journals (Sweden)
Shultz Jeffry
2008-07-01
Full Text Available Abstract Background Many of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation. The soybean (Glycine max genome has been shown to be composed of approximately four thousand short interspersed homeologous regions with 1, 2 or 4 copies per haploid genome by RFLP analysis, microsatellite anchors to BACs and by contigs formed from BAC fingerprints. Despite these similar regions,, the genome has been sequenced by whole genome shotgun sequence (WGS. Here the aim was to use BAC end sequences (BES derived from three minimum tile paths (MTP to examine the extent and homogeneity of polyploid-like regions within contigs and the extent of correlation between the polyploid-like regions inferred from fingerprinting and the polyploid-like sequences inferred from WGS matches. Results Results show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs were single nucleotide polymorphisms (SNPs; 89% and single nucleotide indels (SNIs 10%. Larger indels were rare but present (1%. Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed. Conclusion The use of HSVs like SNPs and SNIs to characterize BACs wil improve contig building methods. The implications for bioinformatic and functional annotation of polyploid and paleopolyploid genomes show that a combined approach of BAC fingerprint based physical maps, WGS sequence and HSV-based partitioning of BAC clones from homeologous regions to separate contigs will allow reliable de
Directory of Open Access Journals (Sweden)
William Amos
Full Text Available The "heterozygote instability" (HI hypothesis suggests that gene conversion events focused on heterozygous sites during meiosis locally increase the mutation rate, but this hypothesis remains largely untested. As humans left Africa they lost variability, which, if HI operates, should have reduced the mutation rate in non-Africans. Relative substitution rates were quantified in diverse humans using aligned whole genome sequences from the 1,000 genomes project. Substitution rate is consistently greater in Africans than in non-Africans, but only in diploid regions of the genome, consistent with a role for heterozygosity. Analysing the same data partitioned into a series of non-overlapping 2 Mb windows reveals a strong, non-linear correlation between the amount of heterozygosity lost "out of Africa" and the difference in substitution rate between Africans and non-Africans. Putative recent mutations, derived variants that occur only once among the 80 human chromosomes sampled, occur preferentially at the centre of 2 Kb windows that have elevated heterozygosity compared both with the same region in a closely related population and with an immediately adjacent region in the same population. More than half of all substitutions appear attributable to variation in heterozygosity. This observation provides strong support for HI with implications for many branches of evolutionary biology.
Directory of Open Access Journals (Sweden)
Chuanzhi Zhao
2017-07-01
Full Text Available Despite several efforts in the last decade toward development of simple sequence repeat (SSR markers in peanut, there is still a need for more markers for conducting different genetic and breeding studies. With the effort of the International Peanut Genome Initiative, the availability of reference genome for both the diploid progenitors of cultivated peanut allowed us to identify 135,529 and 199,957 SSRs from the A (Arachis duranensis and B genomes (Arachis ipaensis, respectively. Genome sequence analysis showed uneven distribution of the SSR motifs across genomes with variation in parameters such as SSR type, repeat number, and SSR length. Using the flanking sequences of identified SSRs, primers were designed for 51,354 and 60,893 SSRs with densities of 49 and 45 SSRs per Mb in A. duranensis and A. ipaensis, respectively. In silico PCR analysis of these SSR markers showed high transferability between wild and cultivated Arachis species. Two physical maps were developed for the A genome and the B genome using these SSR markers, and two reported disease resistance quantitative trait loci (QTLs, qF2TSWV5 for tomato spotted wilt virus (TSWV and qF2LS6 for leaf spot (LS, were mapped in the 8.135 Mb region of chromosome A04 of A. duranensis. From this genomic region, 719 novel SSR markers were developed, which provide the possibility for fine mapping of these QTLs. In addition, this region also harbors 652 genes and 49 of these are defense related genes, including two NB-ARC genes, three LRR receptor-like genes and three WRKY transcription factors. These disease resistance related genes could contribute to resistance to viral (such as TSWV and fungal (such as LS diseases in peanut. In summary, this study not only provides a large number of molecular markers for potential use in peanut genetic map development and QTL mapping but also for map-based gene cloning and molecular breeding.
Directory of Open Access Journals (Sweden)
Luis E. Rojas
2014-07-01
Full Text Available The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol. In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR. From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend different regions of the genome through PCR. Furthermore, it was possible to amplify a fragment of avr-4 gene DNA purified from lyophilized mycelium of Mycosphaerella fijiensis. Additionally, it was possible to amplify the region ap24 transgene inserted into the genome of banana cv. `Grande naine' (Musa AAA. Key words: alkaline lysis, Carica papaya L., Digitalis purpurea L., Musa, Saccharum officinarum L.
International Nuclear Information System (INIS)
Lucky, A.W.; Eisenfeld, A.J.; Visintin, I.
1985-01-01
In the hamster flank organ, the growth of hair and growth of sebaceous glands are androgen-dependent functions. Although dihydrotestosterone (DHT) is known to be a potent stimulator of flank organ growth, there is no information about localization of DHT receptor sites in this organ. The purpose of this study was to use steroid autoradiography to localize DHT receptors in the hamster flank organ. Because steroid hormones are functional when translocated to nuclear receptors, nuclear localization by autoradiography defines receptor sites. In order to be able to visualize autoradiographic grains from radiolabeled androgens around hair follicles, albino hamsters were studied to avoid confusion between the grains and pigment granules which are abundant in the more common Golden Syrian hamster. Mature male hamsters castrated 24 hours earlier were given tritium-labeled dihydrotestosterone ( [ 3 H]DHT). Using the technique of thaw-mount steroid autoradiography, 4-micron unfixed frozen sections were mounted in the dark onto emulsion-coated glass slides and allowed to develop for 4-6 months. [ 3 H]DHT was found to be concentrated over sebocyte nuclei. The label was present peripherally as well as in differentiating sebocytes. There was no nuclear localization of [ 3 H]DHT in animals pretreated with excessive quantities of unlabeled DHT. Steroid metabolites of [ 3 H] DHT were assessed by thin-layer chromatography in paired tissue samples. Most of the label remained with DHT. Uptake was inhibited in the flank organ of hamsters pretreated with unlabeled DHT
Directory of Open Access Journals (Sweden)
Stephen N White
Full Text Available BACKGROUND: Like human immunodeficiency virus (HIV, ovine lentivirus (OvLV is macrophage-tropic and causes lifelong infection. OvLV infects one quarter of U.S. sheep and induces pneumonia and body condition wasting. There is no vaccine to prevent OvLV infection and no cost-effective treatment for infected animals. However, breed differences in prevalence and proviral concentration have indicated a genetic basis for susceptibility to OvLV. A recent study identified TMEM154 variants in OvLV susceptibility. The objective here was to identify additional loci associated with odds and/or control of OvLV infection. METHODOLOGY/PRINCIPAL FINDINGS: This genome-wide association study (GWAS included 964 sheep from Rambouillet, Polypay, and Columbia breeds with serological status and proviral concentration phenotypes. Analytic models accounted for breed and age, as well as genotype. This approach identified TMEM154 (nominal P=9.2×10(-7; empirical P=0.13, provided 12 additional genomic regions associated with odds of infection, and provided 13 regions associated with control of infection (all nominal P<1 × 10(-5. Rapid decline of linkage disequilibrium with distance suggested many regions included few genes each. Genes in regions associated with odds of infection included DPPA2/DPPA4 (empirical P=0.006, and SYTL3 (P=0.051. Genes in regions associated with control of infection included a zinc finger cluster (ZNF192, ZSCAN16, ZNF389, and ZNF165; P=0.001, C19orf42/TMEM38A (P=0.047, and DLGAP1 (P=0.092. CONCLUSIONS/SIGNIFICANCE: These associations provide targets for mutation discovery in sheep susceptibility to OvLV. Aside from TMEM154, these genes have not been associated previously with lentiviral infection in any species, to our knowledge. Further, data from other species suggest functional hypotheses for future testing of these genes in OvLV and other lentiviral infections. Specifically, SYTL3 binds and may regulate RAB27A, which is required for enveloped
Radon measurements in the SE and NE flank of Mt. Etna (Italy)
International Nuclear Information System (INIS)
La Delfa, S.; Imme, G.; Lo Nigro, S.; Morelli, D.; Patane, G.; Vizzini, F.
2007-01-01
Soil Radon has been monitored at two fixed sites located in the northeastern and southeastern flank of Mt. Etna. In this study we report the comparison between in-soil Radon concentration trend recorded in the SE flank and that one recorded in the NE one, where an in-soil Radon detection system is operating since 2001. The aim of this work was to implement the investigation area finding a suitable radon detection site, in the south-east flank of Mt. Etna, in order to better understand possible links between Radon anomalies and volcano dynamic. Radon data collected in NE and SE sites were compared with the volcanic tremor, frequency of occurrence of earthquakes and seismic strain-release recorded at a fixed 3D digital seismic station placed in the NE site. Same general in-soil Radon trends and anomalies were found in both sites. These results have confirmed the suitability of the chosen southeastern site for the in-soil Radon monitoring at Mt. Etna. The comparison of the recorded Radon concentration anomalies with seismicity and volcanic tremor trends, has also verified a possible link with the volcanic activity, as observed in our previous published studies
Multi-stage volcanic island flank collapses with coeval explosive caldera-forming eruptions.
Hunt, James E; Cassidy, Michael; Talling, Peter J
2018-01-18
Volcanic flank collapses and explosive eruptions are among the largest and most destructive processes on Earth. Events at Mount St. Helens in May 1980 demonstrated how a relatively small (300 km 3 ), but can also occur in complex multiple stages. Here, we show that multistage retrogressive landslides on Tenerife triggered explosive caldera-forming eruptions, including the Diego Hernandez, Guajara and Ucanca caldera eruptions. Geochemical analyses were performed on volcanic glasses recovered from marine sedimentary deposits, called turbidites, associated with each individual stage of each multistage landslide. These analyses indicate only the lattermost stages of subaerial flank failure contain materials originating from respective coeval explosive eruption, suggesting that initial more voluminous submarine stages of multi-stage flank collapse induce these aforementioned explosive eruption. Furthermore, there are extended time lags identified between the individual stages of multi-stage collapse, and thus an extended time lag between the initial submarine stages of failure and the onset of subsequent explosive eruption. This time lag succeeding landslide-generated static decompression has implications for the response of magmatic systems to un-roofing and poses a significant implication for ocean island volcanism and civil emergency planning.
Directory of Open Access Journals (Sweden)
Cornelia Di Gaetano
Full Text Available The peculiar position of Sardinia in the Mediterranean sea has rendered its population an interesting biogeographical isolate. The aim of this study was to investigate the genetic population structure, as well as to estimate Runs of Homozygosity and regions under positive selection, using about 1.2 million single nucleotide polymorphisms genotyped in 1077 Sardinian individuals. Using four different methods--fixation index, inflation factor, principal component analysis and ancestry estimation--we were able to highlight, as expected for a genetic isolate, the high internal homogeneity of the island. Sardinians showed a higher percentage of genome covered by RoHs>0.5 Mb (F(RoH%0.5 when compared to peninsular Italians, with the only exception of the area surrounding Alghero. We furthermore identified 9 genomic regions showing signs of positive selection and, we re-captured many previously inferred signals. Other regions harbor novel candidate genes for positive selection, like TMEM252, or regions containing long non coding RNA. With the present study we confirmed the high genetic homogeneity of Sardinia that may be explained by the shared ancestry combined with the action of evolutionary forces.
Połowniak, Piotr; Sobolak, Mariusz
2017-12-01
In this article, a mathematical description of tooth flank surface of the globoidal worm and worm wheel generated by the hourglass worm hob with straight tooth axial profile is presented. The kinematic system of globoidal worm gear is shown. The equation of globoid helix and tooth axial profile of worm is derived to determine worm tooth surface. Based on the equation of meshing the contact lines are obtained. The mathematical description of globoidal worm wheel tooth flank is performed on the basis of contact lines and generating the tooth side by the extreme cutting edge of worm hob. The presented mathematical model of tooth flank of TA worm and worm wheel can be used e.g. to analyse the contact pattern of the gear.
Directory of Open Access Journals (Sweden)
Mirte Bosse
Full Text Available Inbreeding has long been recognized as a primary cause of fitness reduction in both wild and domesticated populations. Consanguineous matings cause inheritance of haplotypes that are identical by descent (IBD and result in homozygous stretches along the genome of the offspring. Size and position of regions of homozygosity (ROHs are expected to correlate with genomic features such as GC content and recombination rate, but also direction of selection. Thus, ROHs should be non-randomly distributed across the genome. Therefore, demographic history may not fully predict the effects of inbreeding. The porcine genome has a relatively heterogeneous distribution of recombination rate, making Sus scrofa an excellent model to study the influence of both recombination landscape and demography on genomic variation. This study utilizes next-generation sequencing data for the analysis of genomic ROH patterns, using a comparative sliding window approach. We present an in-depth study of genomic variation based on three different parameters: nucleotide diversity outside ROHs, the number of ROHs in the genome, and the average ROH size. We identified an abundance of ROHs in all genomes of multiple pigs from commercial breeds and wild populations from Eurasia. Size and number of ROHs are in agreement with known demography of the populations, with population bottlenecks highly increasing ROH occurrence. Nucleotide diversity outside ROHs is high in populations derived from a large ancient population, regardless of current population size. In addition, we show an unequal genomic ROH distribution, with strong correlations of ROH size and abundance with recombination rate and GC content. Global gene content does not correlate with ROH frequency, but some ROH hotspots do contain positive selected genes in commercial lines and wild populations. This study highlights the importance of the influence of demography and recombination on homozygosity in the genome to understand
Predicting Tissue-Specific Enhancers in the Human Genome
Energy Technology Data Exchange (ETDEWEB)
Pennacchio, Len A.; Loots, Gabriela G.; Nobrega, Marcelo A.; Ovcharenko, Ivan
2006-07-01
Determining how transcriptional regulatory signals areencoded in vertebrate genomes is essential for understanding the originsof multi-cellular complexity; yet the genetic code of vertebrate generegulation remains poorly understood. In an attempt to elucidate thiscode, we synergistically combined genome-wide gene expression profiling,vertebrate genome comparisons, and transcription factor binding siteanalysis to define sequence signatures characteristic of candidatetissue-specific enhancers in the human genome. We applied this strategyto microarray-based gene expression profiles from 79 human tissues andidentified 7,187 candidate enhancers that defined their flanking geneexpression, the majority of which were located outside of knownpromoters. We cross-validated this method for its ability to de novopredict tissue-specific gene expression and confirmed its reliability in57 of the 79 available human tissues, with an average precision inenhancer recognition ranging from 32 percent to 63 percent, and asensitivity of 47 percent. We used the sequence signatures identified bythis approach to assign tissue-specific predictions to ~;328,000human-mouse conserved noncoding elements in the human genome. Byoverlapping these genome-wide predictions with a large in vivo dataset ofenhancers validated in transgenic mice, we confirmed our results with a28 percent sensitivity and 50 percent precision. These results indicatethe power of combining complementary genomic datasets as an initialcomputational foray into the global view of tissue-specific generegulation in vertebrates.
Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.
Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A
2017-11-14
The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread
Hartman, Y.
2012-01-01
The results of this thesis show that the probability of introgression of a putative transgene to wild relatives indeed depends strongly on the insertion location of the transgene. The study of genomic selection patterns can identify crop genomic regions under negative selection in multiple
Genic regions of a large salamander genome contain long introns and novel genes
Directory of Open Access Journals (Sweden)
Bryant Susan V
2009-01-01
Full Text Available Abstract Background The basis of genome size variation remains an outstanding question because DNA sequence data are lacking for organisms with large genomes. Sixteen BAC clones from the Mexican axolotl (Ambystoma mexicanum: c-value = 32 × 109 bp were isolated and sequenced to characterize the structure of genic regions. Results Annotation of genes within BACs showed that axolotl introns are on average 10× longer than orthologous vertebrate introns and they are predicted to contain more functional elements, including miRNAs and snoRNAs. Loci were discovered within BACs for two novel EST transcripts that are differentially expressed during spinal cord regeneration and skin metamorphosis. Unexpectedly, a third novel gene was also discovered while manually annotating BACs. Analysis of human-axolotl protein-coding sequences suggests there are 2% more lineage specific genes in the axolotl genome than the human genome, but the great majority (86% of genes between axolotl and human are predicted to be 1:1 orthologs. Considering that axolotl genes are on average 5× larger than human genes, the genic component of the salamander genome is estimated to be incredibly large, approximately 2.8 gigabases! Conclusion This study shows that a large salamander genome has a correspondingly large genic component, primarily because genes have incredibly long introns. These intronic sequences may harbor novel coding and non-coding sequences that regulate biological processes that are unique to salamanders.
Tsai, Kevin J; Lu, Mei-Yeh Jade; Yang, Kai-Jung; Li, Mengyun; Teng, Yuchuan; Chen, Shihmay; Ku, Maurice S B; Li, Wen-Hsiung
2016-10-13
The diploid C 4 plant foxtail millet (Setaria italica L. Beauv.) is an important crop in many parts of Africa and Asia for the vast consumption of its grain and ability to grow in harsh environments, but remains understudied in terms of complete genomic architecture. To date, there have been only two genome assembly and annotation efforts with neither assembly reaching over 86% of the estimated genome size. We have combined de novo assembly with custom reference-guided improvements on a popular cultivar of foxtail millet and have achieved a genome assembly of 477 Mbp in length, which represents over 97% of the estimated 490 Mbp. The assembly anchors over 98% of the predicted genes to the nine assembled nuclear chromosomes and contains more functional annotation gene models than previous assemblies. Our annotation has identified a large number of unique gene ontology terms related to metabolic activities, a region of chromosome 9 with several growth factor proteins, and regions syntenic with pearl millet or maize genomic regions that have been previously shown to affect growth. The new assembly and annotation for this important species can be used for detailed investigation and future innovations in growth for millet and other grains.
International Nuclear Information System (INIS)
Madu, Ikenna G.; Belouzard, Sandrine; Whittaker, Gary R.
2009-01-01
The S2 domain of the coronavirus spike (S) protein is known to be responsible for mediating membrane fusion. In addition to a well-recognized cleavage site at the S1-S2 boundary, a second proteolytic cleavage site has been identified in the severe acute respiratory syndrome coronavirus (SARS-CoV) S2 domain (R797). C-terminal to this S2 cleavage site is a conserved region flanked by cysteine residues C822 and C833. Here, we investigated the importance of this well conserved region for SARS-CoV S-mediated fusion activation. We show that the residues between C822-C833 are well conserved across all coronaviruses. Mutagenic analysis of SARS-CoV S, combined with cell-cell fusion and pseudotyped virion infectivity assays, showed a critical role for the core-conserved residues C822, D830, L831, and C833. Based on available predictive models, we propose that the conserved domain flanked by cysteines 822 and 833 forms a loop structure that interacts with components of the SARS-CoV S trimer to control the activation of membrane fusion.
Le Corvec, Nicolas
2014-07-01
Mount Etna volcano is subject to transient magmatic intrusions and flank movement. The east flank of the edifice, in particular, is moving eastward and is dissected by the Timpe Fault System. The relationship of this eastward motion with intrusions and tectonic fault motion, however, remains poorly constrained. Here we explore this relationship by using analogue experiments that are designed to simulate magmatic rift intrusion, flank movement, and fault activity before, during, and after a magmatic intrusion episode. Using particle image velocimetry allows for a precise temporal and spatial analysis of the development and activity of fault systems. The results show that the occurrence of rift intrusion episodes has a direct effect on fault activity. In such a situation, fault activity may occur or may be hindered, depending on the interplay of fault displacement and flank acceleration in response to dike intrusion. Our results demonstrate that a complex interplay may exist between an active tectonic fault system and magmatically induced flank instability. Episodes of magmatic intrusion change the intensity pattern of horizontal flank displacements and may hinder or activate associated faults. We further compare our results with the GPS data of the Mount Etna 2001 eruption and intrusion. We find that syneruptive displacement rates at the Timpe Fault System have differed from the preeruptive or posteruptive periods, which shows a good agreement of both the experimental and the GPS data. Therefore, understanding the flank instability and flank stability at Mount Etna requires consideration of both tectonic and magmatic forcing. Key Points Analyzing Mount Etna east flank dynamics during the 2001 eruption Good correlation between analogue models and GPS data Understanding the different behavior of faulting before/during/after an eruption © 2014. American Geophysical Union. All Rights Reserved.
Le Corvec, Nicolas; Walter, Thomas R.; Ruch, Joel; Bonforte, Alessandro; Puglisi, Giuseppe
2014-01-01
Mount Etna volcano is subject to transient magmatic intrusions and flank movement. The east flank of the edifice, in particular, is moving eastward and is dissected by the Timpe Fault System. The relationship of this eastward motion with intrusions and tectonic fault motion, however, remains poorly constrained. Here we explore this relationship by using analogue experiments that are designed to simulate magmatic rift intrusion, flank movement, and fault activity before, during, and after a magmatic intrusion episode. Using particle image velocimetry allows for a precise temporal and spatial analysis of the development and activity of fault systems. The results show that the occurrence of rift intrusion episodes has a direct effect on fault activity. In such a situation, fault activity may occur or may be hindered, depending on the interplay of fault displacement and flank acceleration in response to dike intrusion. Our results demonstrate that a complex interplay may exist between an active tectonic fault system and magmatically induced flank instability. Episodes of magmatic intrusion change the intensity pattern of horizontal flank displacements and may hinder or activate associated faults. We further compare our results with the GPS data of the Mount Etna 2001 eruption and intrusion. We find that syneruptive displacement rates at the Timpe Fault System have differed from the preeruptive or posteruptive periods, which shows a good agreement of both the experimental and the GPS data. Therefore, understanding the flank instability and flank stability at Mount Etna requires consideration of both tectonic and magmatic forcing. Key Points Analyzing Mount Etna east flank dynamics during the 2001 eruption Good correlation between analogue models and GPS data Understanding the different behavior of faulting before/during/after an eruption © 2014. American Geophysical Union. All Rights Reserved.
Sabin, Andrew; Blake, Kelly; Lazaro, Mike; Blankenship, Douglas; Kennedy, Mack; McCullough, Jess; DeOreo, S.B.; Hickman, Stephen H.; Glen, Jonathan; Kaven, Joern; Williams, Colin F.; Phelps, Geoffrey; Faulds, James E.; Hinz, Nicholas H.; Calvin, Wendy M.; Siler, Drew; Robertson-Tait, Ann
2017-01-01
The proposed West Flank FORGE site is within the China Lake Naval Air Weapons Station (NAWS), China Lake, CA. The West Flank is west of the Coso geothermal field, an area of China Lake NAWS dominated by the Quaternary Coso volcanic field largely comprised of rhyolite domes and their volcaniclastic and epiclastic horizons. The largest dome flow complex, Sugarloaf Mountain, marks the northwestern margin of the geothermal field. The West Flank is situated due west of Sugarloaf. The geologic setting of the West Flank was determined from one deep well (83-11) drilled as a potential production hole in 2009. The bottom-hole temperature (BHT) of well 83-11 approaches 600 oF (315˚C), but flow tests demonstrate very low, non-commercial permeabilities. With the exception of the upper 600 feet of volcaniclastic alluvium, well 83-11 is completed in granitic basement. The West Flank possesses the primary attributes of a FORGE site: non-commercial permeability (geothermal fieldThe Coso Mountains host the Coso volcanic field and are within a right-releasing stepover between the dextral Airport Lake (ALF) and Little Lake fault zones (LLFZ) and the Wild Horse Mesa and Owens Valley faults. Two distinct fault populations have been identified at Coso: WNW-trending and antithetical, NE-trending strike-slip faults and N- to NNE-trending normal faults. These faults are both high permeability drilling targets at depth within the main (productive) geothermal field and they locally segment the field into distinct hydrothermal regimes. The West Flank may be segmented from the rest of the field by one such northerly trending fault. The overall minimum principal stress orientation in the main geothermal field varies from 103˚ to 108˚; however, the minimum horizontal principal stress in 83-11 is rotated to 081˚.
Snitkin, Evan S; Won, Sarah; Pirani, Ali; Lapp, Zena; Weinstein, Robert A; Lolans, Karen; Hayden, Mary K
2017-11-22
Development of effective strategies to limit the proliferation of multidrug-resistant organisms requires a thorough understanding of how such organisms spread among health care facilities. We sought to uncover the chains of transmission underlying a 2008 U.S. regional outbreak of carbapenem-resistant Klebsiella pneumoniae by performing an integrated analysis of genomic and interfacility patient-transfer data. Genomic analysis yielded a high-resolution transmission network that assigned directionality to regional transmission events and discriminated between intra- and interfacility transmission when epidemiologic data were ambiguous or misleading. Examining the genomic transmission network in the context of interfacility patient transfers (patient-sharing networks) supported the role of patient transfers in driving the outbreak, with genomic analysis revealing that a small subset of patient-transfer events was sufficient to explain regional spread. Further integration of the genomic and patient-sharing networks identified one nursing home as an important bridge facility early in the outbreak-a role that was not apparent from analysis of genomic or patient-transfer data alone. Last, we found that when simulating a real-time regional outbreak, our methodology was able to accurately infer the facility at which patients acquired their infections. This approach has the potential to identify facilities with high rates of intra- or interfacility transmission, data that will be useful for triggering targeted interventions to prevent further spread of multidrug-resistant organisms. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Directory of Open Access Journals (Sweden)
Alexander William Eastman
2015-01-01
Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing
Directory of Open Access Journals (Sweden)
Ying-Juan LIU, Da-Wei WANG, Lixing SUN, Jin-Hua ZHANG, Jian-Xu ZHANG
2010-12-01
Full Text Available Behavioral studies have shown that flank glands are involved in chemical communication in golden hamsters Mesocricetus auratus but little chemical analysis has been conducted on volatiles arising from these glands. Using gas chromatography-mass spectrometry, we detected compounds from the flank glands of males, only eight of which were also produced in females. Based on these chemical data we performed a number of further experiments. By manipulating light we found that males exposed to short-photoperiods developed smaller flank glands than those exposed to long-photoperiods. Six flank gland volatiles reduced in relative abundance, which possibly coded for reproductive status of males of this seasonally breeding hamster species. Through dyadic encounters, we were able to induce the formation of dominant-subordinate relationships and show that two glandular compounds became high in relative abundance and may function as dominance pheromones. Castration eliminated all male-specific compounds resulting from flank glands, but bilateral ovariectomies only affected one compound in females. Once these ovariectomized females were treated with testosterone, their glandular compounds resembled those of males, suggesting these compounds are under the main control of androgen. Two female putative pheromones, tetradecanoic acid and hexadecanoic acid, were used in binary choice tests and were both found to attract males over females. Applying a solution of these pheromone compounds to adult males also suppressed their agonistic behavior [Current Zoology 56 (6: 800–812, 2010].
The role of viscous magma mush spreading in volcanic flank motion at Kīlauea Volcano, Hawai'i
Plattner, C.; Amelung, F.; Baker, S.; Govers, R.; Poland, M.
2013-01-01
Multiple mechanisms have been suggested to explain seaward motion of the south flank of Kīlauea Volcano, Hawai'i. The consistency of flank motion during both waxing and waning magmatic activity at Kīlauea suggests that a continuously acting force, like gravity body force, plays a substantial role.
Successful flank appraisal with a horizontal well: a Niger Delta example
Energy Technology Data Exchange (ETDEWEB)
Ohanele, C.; Emelumadu, U.
1998-12-31
Case study of a horizontal well successfully drilled in 1994 by Shell Oil in the Niger Delta is described. The well was drilled with the objectives of improving drainage of the major D3.1 reservoir and appraising the poorly defined eastern flank for structure and fluid content of the overlying D3.0 sand. The well was optimized by 3D reservoir and hydrocarbon modeling of these reservoirs. Combining the development and appraisal objectives in one horizontal well proved to be the optimal solution, both from a cost as well as a production consideration. The well proved up over 50 MMstb of additional reserves. The structural flank proved to be significantly shallower than previously mapped and had a positive effect not only on the D3.0 reserves, but also on the the D3.1. 6 figs.
Sequencing the CHO DXB11 genome reveals regional variations in genomic stability and haploidy
DEFF Research Database (Denmark)
Kaas, Christian Schrøder; Kristensen, Claus; Betenbaugh, Michael J.
2015-01-01
Background: The DHFR negative CHO DXB11 cell line (also known as DUX-B11 and DUKX) was historically the first CHO cell line to be used for large scale production of heterologous proteins and is still used for production of a number of complex proteins. Results: Here we present the genomic sequence...... of the CHO DXB11 genome sequenced to a depth of 33x. Overall a significant genomic drift was seen favoring GC -> AT point mutations in line with the chemical mutagenesis strategy used for generation of the cell line. The sequencing depth for each gene in the genome revealed distinct peaks at sequencing...... in eight additional analyzed CHO genomes (15-20% haploidy) but not in the genome of the Chinese hamster. The dhfr gene is confirmed to be haploid in CHO DXB11; transcriptionally active and the remaining allele contains a G410C point mutation causing a Thr137Arg missense mutation. We find similar to 2...
Evidence for magnocellular involvement in the identification of flanked letters
Omtzigt, D.; Hendriks, A.W.C.J.; Kolk, H.H.J.
2002-01-01
Little is known about the role of the magno system in reading. One important hypothesis is that this system is involved in the allocation of attention. We reasoned that the presentation of a single letter automatically draws attention to this letter, whereas in the case of a flanked letter, an
Directory of Open Access Journals (Sweden)
Yvonne Chekaluk
Full Text Available We performed a genome wide analysis of 164 urothelial carcinoma samples and 27 bladder cancer cell lines to identify copy number changes associated with disease characteristics, and examined the association of amplification events with stage and grade of disease. Multiplex inversion probe (MIP analysis, a recently developed genomic technique, was used to study 80 urothelial carcinomas to identify mutations and copy number changes. Selected amplification events were then analyzed in a validation cohort of 84 bladder cancers by multiplex ligation-dependent probe assay (MLPA. In the MIP analysis, 44 regions of significant copy number change were identified using GISTIC. Nine gene-containing regions of amplification were selected for validation in the second cohort by MLPA. Amplification events at these 9 genomic regions were found to correlate strongly with stage, being seen in only 2 of 23 (9% Ta grade 1 or 1-2 cancers, in contrast to 31 of 61 (51% Ta grade 3 and T2 grade 2 cancers, p<0.001. These observations suggest that analysis of genomic amplification of these 9 regions might help distinguish non-invasive from invasive urothelial carcinoma, although further study is required. Both MIP and MLPA methods perform well on formalin-fixed paraffin-embedded DNA, enhancing their potential clinical use. Furthermore several of the amplified genes identified here (ERBB2, MDM2, CCND1 are potential therapeutic targets.
Plasma wave profiles of Earth's bow shock at low Mach number: ISEE 3 observations on the far flank
International Nuclear Information System (INIS)
Greenstadt, E.W.; Coroniti, F.V.; Moses, S.L.; Smith, E.J.
1992-01-01
The Earth's bow shock is weak along its distant flanks where the projected component of solar wind velocity normal to the hyperboloidal surface is only a fraction of the total free stream velocity, severely reducing the local Mach number. The authors present a survey of selected crossings far downstream from the subsolar shock, delineating the overall plasma wave (pw) behavior of a selected set of nearly perpendicular crossings and another set of limited Mach number but broad geometry; they include their immediate upstream regions. The result is a generalizable pw signature, or signatures, of low Mach number shocks and some likely implications of those signatures for the weak shock's plasma physical processes on the flank. They find the data consistent with the presence of ion beam interactions producing noise ahead of the shock in the ion acoustic frequency range. One subcritical case was found whose pw noise was presumably related to a reflected ion population just as in stronger events. The presence or absence, and the amplitudes, of pw activity are explainable by the presence or absence of a population of upstream ions controlled by the component of interplanetary magnetic field normal to the solar wind flow
Directory of Open Access Journals (Sweden)
Messenger Tara
2001-08-01
Full Text Available Abstract Background Alterations in arginine vasopressin regulation and secretion have been proposed as one possible biochemical abnormality in patients with obsessive-compulsive disorder. In golden hamsters, arginine vasopressin microinjections into the anterior hypothalamus trigger robust grooming and flank marking, a stereotyped scent marking behaviors. The intensity and repetition of the behaviors induced by arginine vasopressin is somewhat reminiscent of Obsessive Compulsive Disorder in humans. The present experiments were carried out to test whether pharmacological agents used to alleviate obsessive compulsive disorder could inhibit arginine vasopressin-induced flank marking and grooming. Results Male golden hamsters were treated daily for two weeks with either vehicle, fluoxetine, clomipramine, or desipramine (an ineffective drug, before being tested for arginine vasopressin-induced flank marking and grooming. Flank marking was significantly inhibited in animals treated with fluoxetine or clomipramine but unaffected by treatment with desipramine. Grooming behavior was not affected by any treatment. Conclusion These data suggest that arginine vasopressin-induced flank marking may serve as an animal model for screening drugs used in the control of Obsessive Compulsive Disorder.
Lipman, P.W.; Coombs, M.L.
2006-01-01
The North Kona slump is an elliptical region, about 20 by 60 km (1000-km2 area), of multiple, geometrically intricate benches and scarps, mostly at water depths of 2000–4500 m, on the west flank of Hualalai Volcano. Two dives up steep scarps in the slump area were made in September 2001, using the ROV Kaiko of the Japan Marine Science and Technology Center (JAMSTEC), as part of a collaborative Japan–USA project to improve understanding of the submarine flanks of Hawaiian volcanoes. Both dives, at water depths of 2700–4000 m, encountered pillow lavas draping the scarp-and-bench slopes. Intact to only slightly broken pillow lobes and cylinders that are downward elongate dominate on the steepest mid-sections of scarps, while more equant and spherical pillow shapes are common near the tops and bases of scarps and locally protrude through cover of muddy sediment on bench flats. Notably absent are subaerially erupted Hualalai lava flows, interbedded hyaloclastite pillow breccia, and/or coastal sandy sediment that might have accumulated downslope from an active coastline. The general structure of the North Kona flank is interpreted as an intricate assemblage of downdropped lenticular blocks, bounded by steeply dipping normal faults. The undisturbed pillow-lava drape indicates that slumping occurred during shield-stage tholeiitic volcanism. All analyzed samples of the pillow-lava drape are tholeiite, similar to published analyses from the submarine northwest rift zone of Hualālai. Relatively low sulfur (330–600 ppm) and water (0.18–0.47 wt.%) contents of glass rinds suggest that the eruptive sources were in shallow water, perhaps 500–1000-m depth. In contrast, saturation pressures calculated from carbon dioxide concentrations (100–190 ppm) indicate deeper equilibration, at or near sample sites at water depths of − 3900 to − 2800 m. Either vents close to the sample sites erupted mixtures of undegassed and degassed magmas, or volatiles were resorbed from
Imaging modalities and therapy options in patients with acute flank pain
International Nuclear Information System (INIS)
Grosse, A.; Grosse, C.
2014-01-01
The objective of this article is the description of imaging techniques for the evaluation of patients with acute flank pain and suspicion of urolithiasis and the impact of these techniques in the therapy management of patients with calculi. (orig.) [de
Transcription Factors Bind Thousands of Active and InactiveRegions in the Drosophila Blastoderm
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Yong; MacArthur, Stewart; Bourgon, Richard; Nix, David; Pollard, Daniel A.; Iyer, Venky N.; Hechmer, Aaron; Simirenko, Lisa; Stapleton, Mark; Luengo Hendriks, Cris L.; Chu, Hou Cheng; Ogawa, Nobuo; Inwood, William; Sementchenko, Victor; Beaton, Amy; Weiszmann, Richard; Celniker, Susan E.; Knowles, David W.; Gingeras, Tom; Speed, Terence P.; Eisen, Michael B.; Biggin, Mark D.
2008-01-10
Identifying the genomic regions bound by sequence-specific regulatory factors is central both to deciphering the complex DNA cis-regulatory code that controls transcription in metazoans and to determining the range of genes that shape animal morphogenesis. Here, we use whole-genome tiling arrays to map sequences bound in Drosophila melanogaster embryos by the six maternal and gap transcription factors that initiate anterior-posterior patterning. We find that these sequence-specific DNA binding proteins bind with quantitatively different specificities to highly overlapping sets of several thousand genomic regions in blastoderm embryos. Specific high- and moderate-affinity in vitro recognition sequences for each factor are enriched in bound regions. This enrichment, however, is not sufficient to explain the pattern of binding in vivo and varies in a context-dependent manner, demonstrating that higher-order rules must govern targeting of transcription factors. The more highly bound regions include all of the over forty well-characterized enhancers known to respond to these factors as well as several hundred putative new cis-regulatory modules clustered near developmental regulators and other genes with patterned expression at this stage of embryogenesis. The new targets include most of the microRNAs (miRNAs) transcribed in the blastoderm, as well as all major zygotically transcribed dorsal-ventral patterning genes, whose expression we show to be quantitatively modulated by anterior-posterior factors. In addition to these highly bound regions, there are several thousand regions that are reproducibly bound at lower levels. However, these poorly bound regions are, collectively, far more distant from genes transcribed in the blastoderm than highly bound regions; are preferentially found in protein-coding sequences; and are less conserved than highly bound regions. Together these observations suggest that many of these poorly-bound regions are not involved in early
Stability analysis of Western flank of Cumbre Vieja volcano (La Palma) using numerical modelling
Bru, Guadalupe; Gonzalez, Pablo J.; Fernandez-Merodo, Jose A.; Fernandez, Jose
2016-04-01
La Palma volcanic island is one of the youngest of the Canary archipelago, being a composite volcano formed by three overlapping volcanic centers. There are clear onshore and offshore evidences of past giant landslides that have occurred during its evolution. Currently, the active Cumbre Vieja volcano is in an early development state (Carracedo et al., 2001). The study of flank instability processes aim to assess, among other hazards, catastrophic collapse and potential tsunami generation. Early studies of the potential instability of Cumbre Vieja volcano western flank have focused on the use of sparse geodetic networks (Moss et al. 1999), surface geological mapping techniques (Day et al. 1999) and offshore bathymetry (Urgeles et al. 1999). Recently, a dense GNSS network and satellite radar interferometry results indicate ground motion consistent with deep-seated creeping processes (Prieto et al. 2009, Gonzalez et al. 2010). In this work, we present a geomechanical advanced numerical model that captures the ongoing deformation processes at Cumbre Vieja. We choose the Finite Elements Method (FEM) which is based in continuum mechanics and is the most used for geotechnical applications. FEM has the ability of using arbitrary geometry, heterogeneities, irregular boundaries and different constitutive models representative of the geotechnical units involved. Our main contribution is the introduction of an inverse approach to constrain the geomechanical parameters using satellite radar interferometry displacements. This is the first application of such approach on a large volcano flank study. We suggest that the use of surface displacements and inverse methods to rigorously constrain the geomechanical model parameter space is a powerful tool to understand volcano flank instability. A particular important result of the studied case is the estimation of displaced rock volume, which is a parameter of critical importance for simulations of Cumbre Vieja tsunamigenic hazard
Directory of Open Access Journals (Sweden)
Wenqian Zhang
Full Text Available BACKGROUND: The isochore, a large DNA sequence with relatively small GC variance, is one of the most important structures in eukaryotic genomes. Although the isochore has been widely studied in humans and other species, little is known about its distribution in pigs. PRINCIPAL FINDINGS: In this paper, we construct a map of long homogeneous genome regions (LHGRs, i.e., isochores and isochore-like regions, in pigs to provide an intuitive version of GC heterogeneity in each chromosome. The LHGR pattern study not only quantifies heterogeneities, but also reveals some primary characteristics of the chromatin organization, including the followings: (1 the majority of LHGRs belong to GC-poor families and are in long length; (2 a high gene density tends to occur with the appearance of GC-rich LHGRs; and (3 the density of LINE repeats decreases with an increase in the GC content of LHGRs. Furthermore, a portion of LHGRs with particular GC ranges (50%-51% and 54%-55% tend to have abnormally high gene densities, suggesting that biased gene conversion (BGC, as well as time- and energy-saving principles, could be of importance to the formation of genome organization. CONCLUSION: This study significantly improves our knowledge of chromatin organization in the pig genome. Correlations between the different biological features (e.g., gene density and repeat density and GC content of LHGRs provide a unique glimpse of in silico gene and repeats prediction.
Ferlaino, Michael; Rogers, Mark F; Shihab, Hashem A; Mort, Matthew; Cooper, David N; Gaunt, Tom R; Campbell, Colin
2017-10-06
Small insertions and deletions (indels) have a significant influence in human disease and, in terms of frequency, they are second only to single nucleotide variants as pathogenic mutations. As the majority of mutations associated with complex traits are located outside the exome, it is crucial to investigate the potential pathogenic impact of indels in non-coding regions of the human genome. We present FATHMM-indel, an integrative approach to predict the functional effect, pathogenic or neutral, of indels in non-coding regions of the human genome. Our method exploits various genomic annotations in addition to sequence data. When validated on benchmark data, FATHMM-indel significantly outperforms CADD and GAVIN, state of the art models in assessing the pathogenic impact of non-coding variants. FATHMM-indel is available via a web server at indels.biocompute.org.uk. FATHMM-indel can accurately predict the functional impact and prioritise small indels throughout the whole non-coding genome.
Burnside, Rachel D; Pasion, Romela; Mikhail, Fady M; Carroll, Andrew J; Robin, Nathaniel H; Youngs, Erin L; Gadi, Inder K; Keitges, Elizabeth; Jaswaney, Vikram L; Papenhausen, Peter R; Potluri, Venkateswara R; Risheg, Hiba; Rush, Brooke; Smith, Janice L; Schwartz, Stuart; Tepperberg, James H; Butler, Merlin G
2011-10-01
The proximal long arm of chromosome 15 has segmental duplications located at breakpoints BP1-BP5 that mediate the generation of NAHR-related microdeletions and microduplications. The classical Prader-Willi/Angelman syndrome deletion is flanked by either of the proximal BP1 or BP2 breakpoints and the distal BP3 breakpoint. The larger Type I deletions are flanked by BP1 and BP3 in both Prader-Willi and Angelman syndrome subjects. Those with this deletion are reported to have a more severe phenotype than individuals with either Type II deletions (BP2-BP3) or uniparental disomy 15. The BP1-BP2 region spans approximately 500 kb and contains four evolutionarily conserved genes that are not imprinted. Reports of mutations or disturbed expression of these genes appear to impact behavioral and neurological function in affected individuals. Recently, reports of deletions and duplications flanked by BP1 and BP2 suggest an association with speech and motor delays, behavioral problems, seizures, and autism. We present a large cohort of subjects with copy number alteration of BP1 to BP2 with common phenotypic features. These include autism, developmental delay, motor and language delays, and behavioral problems, which were present in both cytogenetic groups. Parental studies demonstrated phenotypically normal carriers in several instances, and mildly affected carriers in others, complicating phenotypic association and/or causality. Possible explanations for these results include reduced penetrance, altered gene dosage on a particular genetic background, or a susceptibility region as reported for other areas of the genome implicated in autism and behavior disturbances.
Directory of Open Access Journals (Sweden)
Marcos De Donato
2017-06-01
Full Text Available KCNQ1OT1 is located in the region with the highest number of genes showing genomic imprinting, but the mechanisms controlling the genes under its influence have not been fully elucidated. Therefore, we conducted a comparative analysis of the KCNQ1/KCNQ1OT1-CDKN1C region to study its conservation across the best assembled eutherian mammalian genomes sequenced to date and analyzed potential elements that may be implicated in the control of genomic imprinting in this region. The genomic features in these regions from human, mouse, cattle, and dog show a higher number of genes and CpG islands (detected using cpgplot from EMBOSS, but lower number of repetitive elements (including short interspersed nuclear elements and long interspersed nuclear elements, compared with their whole chromosomes (detected by RepeatMasker. The KCNQ1OT1-CDKN1C region contains the highest number of conserved noncoding sequences (CNS among mammals, where we found 16 regions containing about 38 different highly conserved repetitive elements (using mVista, such as LINE1 elements: L1M4, L1MB7, HAL1, L1M4a, L1Med, and an LTR element: MLT1H. From these elements, we found 74 CNS showing high sequence identity (>70% between human, cattle, and mouse, from which we identified 13 motifs (using Multiple Em for Motif Elicitation/Motif Alignment and Search Tool with a significant probability of occurrence, 3 of which were the most frequent and were used to find transcription factor–binding sites. We detected several transcription factors (using JASPAR suite from the families SOX, FOX, and GATA. A phylogenetic analysis of these CNS from human, marmoset, mouse, rat, cattle, dog, horse, and elephant shows branches with high levels of support and very similar phylogenetic relationships among these groups, confirming previous reports. Our results suggest that functional DNA elements identified by comparative genomics in a region densely populated with imprinted mammalian genes may be
Directory of Open Access Journals (Sweden)
Lifan Zhang
Full Text Available Sheep are among the major economically important livestock species worldwide because the animals produce milk, wool, skin, and meat. In the present study, the Illumina OvineSNP50 BeadChip was used to investigate genetic diversity and genome selection among Suffolk, Rambouillet, Columbia, Polypay, and Targhee sheep breeds from the United States. After quality-control filtering of SNPs (single nucleotide polymorphisms, we used 48,026 SNPs, including 46,850 SNPs on autosomes that were in Hardy-Weinberg equilibrium and 1,176 SNPs on chromosome × for analysis. Phylogenetic analysis based on all 46,850 SNPs clearly separated Suffolk from Rambouillet, Columbia, Polypay, and Targhee, which was not surprising as Rambouillet contributed to the synthesis of the later three breeds. Based on pair-wise estimates of F(ST, significant genetic differentiation appeared between Suffolk and Rambouillet (F(ST = 0.1621, while Rambouillet and Targhee had the closest relationship (F(ST = 0.0681. A scan of the genome revealed 45 and 41 differentially selected regions (DSRs between Suffolk and Rambouillet and among Rambouillet-related breed populations, respectively. Our data indicated that regions 13 and 24 between Suffolk and Rambouillet might be good candidates for evaluating breed differences. Furthermore, ovine genome v3.1 assembly was used as reference to link functionally known homologous genes to economically important traits covered by these differentially selected regions. In brief, our present study provides a comprehensive genome-wide view on within- and between-breed genetic differentiation, biodiversity, and evolution among Suffolk, Rambouillet, Columbia, Polypay, and Targhee sheep breeds. These results may provide new guidance for the synthesis of new breeds with different breeding objectives.
The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.
Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M
2013-05-29
Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in
Origins of the Xylella fastidiosa prophage-like regions and their impact in genome differentiation.
Directory of Open Access Journals (Sweden)
Alessandro de Mello Varani
Full Text Available Xylella fastidiosa is a Gram negative plant pathogen causing many economically important diseases, and analyses of completely sequenced X. fastidiosa genome strains allowed the identification of many prophage-like elements and possibly phage remnants, accounting for up to 15% of the genome composition. To better evaluate the recent evolution of the X. fastidiosa chromosome backbone among distinct pathovars, the number and location of prophage-like regions on two finished genomes (9a5c and Temecula1, and in two candidate molecules (Ann1 and Dixon were assessed. Based on comparative best bidirectional hit analyses, the majority (51% of the predicted genes in the X. fastidiosa prophage-like regions are related to structural phage genes belonging to the Siphoviridae family. Electron micrograph reveals the existence of putative viral particles with similar morphology to lambda phages in the bacterial cell in planta. Moreover, analysis of microarray data indicates that 9a5c strain cultivated under stress conditions presents enhanced expression of phage anti-repressor genes, suggesting switches from lysogenic to lytic cycle of phages under stress-induced situations. Furthermore, virulence-associated proteins and toxins are found within these prophage-like elements, thus suggesting an important role in host adaptation. Finally, clustering analyses of phage integrase genes based on multiple alignment patterns reveal they group in five lineages, all possessing a tyrosine recombinase catalytic domain, and phylogenetically close to other integrases found in phages that are genetic mosaics and able to perform generalized and specialized transduction. Integration sites and tRNA association is also evidenced. In summary, we present comparative and experimental evidence supporting the association and contribution of phage activity on the differentiation of Xylella genomes.
Reverse time migration of prism waves for salt flank delineation
Dai, Wei; Schuster, Gerard T.
2013-01-01
In this paper, we present a new reverse time migration method for imaging salt flanks with prism wave reflections. It consists of four steps: (1) migrating the seismic data with conventional RTM to give the RTM image; (2) using the RTM image as a reflectivity model to simulate source-side reflections with the Born approximation; (3) zero-lag correlation of the source-side reflection wavefields and receiver-side wavefields to produce the prism wave migration image; and (4) repeating steps 2 and 3 for the receiver-side reflections. An advantage of this method is that there is no need to pick the horizontal reflectors prior to migration of the prism waves. It also separately images the vertical structures at a different step to reduce crosstalk interference. The disadvantage of prism wave migration algorithm is that its computational cost is twice that of conventional RTM. The empirical results with a salt model suggest that prism wave migration can be an effective method for salt flank delineation in the absence of diving waves.
Reverse time migration of prism waves for salt flank delineation
Dai, Wei
2013-09-22
In this paper, we present a new reverse time migration method for imaging salt flanks with prism wave reflections. It consists of four steps: (1) migrating the seismic data with conventional RTM to give the RTM image; (2) using the RTM image as a reflectivity model to simulate source-side reflections with the Born approximation; (3) zero-lag correlation of the source-side reflection wavefields and receiver-side wavefields to produce the prism wave migration image; and (4) repeating steps 2 and 3 for the receiver-side reflections. An advantage of this method is that there is no need to pick the horizontal reflectors prior to migration of the prism waves. It also separately images the vertical structures at a different step to reduce crosstalk interference. The disadvantage of prism wave migration algorithm is that its computational cost is twice that of conventional RTM. The empirical results with a salt model suggest that prism wave migration can be an effective method for salt flank delineation in the absence of diving waves.
International Nuclear Information System (INIS)
Molineris, I.; Sales, G.
2009-01-01
The amount of information about genomes, both in the form of complete sequences and annotations, has been exponentially increasing in the last few years. As a result there is the need for tools providing a graphical representation of such information that should be comprehensive and intuitive. Visual representation is especially important in the comparative genomics field since it should provide a combined view of data belonging to different genomes. We believe that existing tools are limited in this respect as they focus on a single genome at a time (conservation histograms) or compress alignment representation to a single dimension. We have therefore developed a web-based tool called Comparative Genome Viewer (Cgv): it integrates a bidimensional representation of alignments between two regions, both at small and big scales, with the richness of annotations present in other genome browsers. We give access to our system through a web-based interface that provides the user with an interactive representation that can be updated in real time using the mouse to move from region to region and to zoom in on interesting details.
Transformation of natural genetic variation into Haemophilus influenzae genomes.
Directory of Open Access Journals (Sweden)
Joshua Chang Mell
2011-07-01
Full Text Available Many bacteria are able to efficiently bind and take up double-stranded DNA fragments, and the resulting natural transformation shapes bacterial genomes, transmits antibiotic resistance, and allows escape from immune surveillance. The genomes of many competent pathogens show evidence of extensive historical recombination between lineages, but the actual recombination events have not been well characterized. We used DNA from a clinical isolate of Haemophilus influenzae to transform competent cells of a laboratory strain. To identify which of the ~40,000 polymorphic differences had recombined into the genomes of four transformed clones, their genomes and their donor and recipient parents were deep sequenced to high coverage. Each clone was found to contain ~1000 donor polymorphisms in 3-6 contiguous runs (8.1±4.5 kb in length that collectively comprised ~1-3% of each transformed chromosome. Seven donor-specific insertions and deletions were also acquired as parts of larger donor segments, but the presence of other structural variation flanking 12 of 32 recombination breakpoints suggested that these often disrupt the progress of recombination events. This is the first genome-wide analysis of chromosomes directly transformed with DNA from a divergent genotype, connecting experimental studies of transformation with the high levels of natural genetic variation found in isolates of the same species.
Forests of the tropical eastern Andean flank during the middle Pleistocene
Cárdenas, M.L.; Gosling, W.D.; Pennington, R.T.; Poole, I.; Sherlock, S.C.; Mothes, P.
2014-01-01
Inter-bedded volcanic and organic sediments from Erazo (Ecuador) indicate the presence of four different forest assemblages on the eastern Andean flank during the middle Pleistocene. Radiometric dates (40Ar-39Ar) obtained from the volcanic ash indicate that deposition occurred between 620,000 and
Directory of Open Access Journals (Sweden)
Vinod Kumar Singh
2016-09-01
Full Text Available Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS requires an essential consensus sequence (ACS for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC denoted as ORC-ACS and non-replicating ACS sequences (nrACS, that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.
Survey of protein–DNA interactions in Aspergillus oryzae on a genomic scale
Wang, Chao; Lv, Yangyong; Wang, Bin; Yin, Chao; Lin, Ying; Pan, Li
2015-01-01
The genome-scale delineation of in vivo protein–DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein–DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein–DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences. PMID:25883143
Directory of Open Access Journals (Sweden)
Chen Ming-Shun
2006-01-01
Full Text Available Abstract Background To have an insight into the Mayetiola destructor (Hessian fly genome, we performed an in silico comparative genomic analysis utilizing genetic mapping, genomic sequence and EST sequence data along with data available from public databases. Results Chromosome walking and FISH were utilized to identify a contig of 50 BAC clones near the telomere of the short arm of Hessian fly chromosome X2 and near the avirulence gene vH13. These clones enabled us to correlate physical and genetic distance in this region of the Hessian fly genome. Sequence data from these BAC ends encompassing a 760 kb region, and a fully sequenced and assembled 42.6 kb BAC clone, was utilized to perform a comparative genomic study. In silico gene prediction combined with BLAST analyses was used to determine putative orthology to the sequenced dipteran genomes of the fruit fly, Drosophila melanogaster, and the malaria mosquito, Anopheles gambiae, and to infer evolutionary relationships. Conclusion This initial effort enables us to advance our understanding of the structure, composition and evolution of the genome of this important agricultural pest and is an invaluable tool for a whole genome sequencing effort.
Evolutionary growth process of highly conserved sequences in vertebrate genomes.
Ishibashi, Minaka; Noda, Akiko Ogura; Sakate, Ryuichi; Imanishi, Tadashi
2012-08-01
Genome sequence comparison between evolutionarily distant species revealed ultraconserved elements (UCEs) among mammals under strong purifying selection. Most of them were also conserved among vertebrates. Because they tend to be located in the flanking regions of developmental genes, they would have fundamental roles in creating vertebrate body plans. However, the evolutionary origin and selection mechanism of these UCEs remain unclear. Here we report that UCEs arose in primitive vertebrates, and gradually grew in vertebrate evolution. We searched for UCEs in two teleost fishes, Tetraodon nigroviridis and Oryzias latipes, and found 554 UCEs with 100% identity over 100 bps. Comparison of teleost and mammalian UCEs revealed 43 pairs of common, jawed-vertebrate UCEs (jUCE) with high sequence identities, ranging from 83.1% to 99.2%. Ten of them retain lower similarities to the Petromyzon marinus genome, and the substitution rates of four non-exonic jUCEs were reduced after the teleost-mammal divergence, suggesting that robust conservation had been acquired in the jawed vertebrate lineage. Our results indicate that prototypical UCEs originated before the divergence of jawed and jawless vertebrates and have been frozen as perfect conserved sequences in the jawed vertebrate lineage. In addition, our comparative sequence analyses of UCEs and neighboring regions resulted in a discovery of lineage-specific conserved sequences. They were added progressively to prototypical UCEs, suggesting step-wise acquisition of novel regulatory roles. Our results indicate that conserved non-coding elements (CNEs) consist of blocks with distinct evolutionary history, each having been frozen since different evolutionary era along the vertebrate lineage. Copyright © 2012 Elsevier B.V. All rights reserved.
Outline of a genome navigation system based on the properties of GA-sequences and their flanks.
Directory of Open Access Journals (Sweden)
Guenter Albrecht-Buehler
Full Text Available Introducing a new method to visualize large stretches of genomic DNA (see Appendix S1 the article reports that most GA-sequences [1] shared chains of tetra-GA-motifs and contained upstream poly(A-segments. Although not integral parts of them, Alu-elements were found immediately upstream of all human and chimpanzee GA-sequences with an upstream poly(A-segment. The article hypothesizes that genome navigation uses these properties of GA-sequences in the following way. (1 Poly(A binding proteins interact with the upstream poly(A-segments and arrange adjacent GA-sequences side-by-side ('GA-ribbon', while folding the intervening DNA sequences between them into loops ('associated DNA-loops'. (2 Genome navigation uses the GA-ribbon as a search path for specific target genes that is up to 730-fold shorter than the full-length chromosome. (3 As to the specificity of the search, each molecule of a target protein is assumed to catalyze the formation of specific oligomers from a set of transcription factors that recognize tetra-GA-motifs. Their specific combinations of tetra-GA motifs are assumed to be present in the particular GA-sequence whose associated loop contains the gene for the target protein. As long as the target protein is abundant in the cell it produces sufficient numbers of such oligomers which bind to their specific GA-sequences and, thereby, inhibit locally the transcription of the target protein in the associated loop. However, if the amount of target protein drops below a certain threshold, the resultant reduction of specific oligomers leaves the corresponding GA-sequence 'denuded'. In response, the associated DNA-loop releases its nucleosomes and allows transcription of the target protein to proceed. (4 The Alu-transcripts may help control the general background of protein synthesis proportional to the number of transcriptionally active associated loops, especially in stressed cells. (5 The model offers a new mechanism of co-regulation of
Drosophila duplication hotspots are associated with late-replicating regions of the genome.
Directory of Open Access Journals (Sweden)
Margarida Cardoso-Moreira
2011-11-01
Full Text Available Duplications play a significant role in both extremes of the phenotypic spectrum of newly arising mutations: they can have severe deleterious effects (e.g. duplications underlie a variety of diseases but can also be highly advantageous. The phenotypic potential of newly arisen duplications has stimulated wide interest in both the mutational and selective processes shaping these variants in the genome. Here we take advantage of the Drosophila simulans-Drosophila melanogaster genetic system to further our understanding of both processes. Regarding mutational processes, the study of two closely related species allows investigation of the potential existence of shared duplication hotspots, and the similarities and differences between the two genomes can be used to dissect its underlying causes. Regarding selection, the difference in the effective population size between the two species can be leveraged to ask questions about the strength of selection acting on different classes of duplications. In this study, we conducted a survey of duplication polymorphisms in 14 different lines of D. simulans using tiling microarrays and combined it with an analogous survey for the D. melanogaster genome. By integrating the two datasets, we identified duplication hotspots conserved between the two species. However, unlike the duplication hotspots identified in mammalian genomes, Drosophila duplication hotspots are not associated with sequences of high sequence identity capable of mediating non-allelic homologous recombination. Instead, Drosophila duplication hotspots are associated with late-replicating regions of the genome, suggesting a link between DNA replication and duplication rates. We also found evidence supporting a higher effectiveness of selection on duplications in D. simulans than in D. melanogaster. This is also true for duplications segregating at high frequency, where we find evidence in D. simulans that a sizeable fraction of these mutations is
NATO’s Northeastern Flank: Emerging Opportunities for Engagement
2017-01-01
escalation concerns. Engagement should also stress the importance of Polish support for and capabilities toward addressing NATO’s southern flank...in their response to the Ukraine crisis.8 Some countries are either cowed by the Russian threat or genuinely less concerned about it than might be...no small part due to Hungary’s dependence on Russian gas exports, which heat the homes of most Hungarians. It is also, however, due to political
Stuhlmüller, M.; Schwarz-Finsterle, J.; Fey, E.; Lux, J.; Bach, M.; Cremer, C.; Hinderhofer, K.; Hausmann, M.; Hildenbrand, G.
2015-10-01
Trinucleotide repeat expansions (like (CGG)n) of chromatin in the genome of cell nuclei can cause neurological disorders such as for example the Fragile-X syndrome. Until now the mechanisms are not clearly understood as to how these expansions develop during cell proliferation. Therefore in situ investigations of chromatin structures on the nanoscale are required to better understand supra-molecular mechanisms on the single cell level. By super-resolution localization microscopy (Spectral Position Determination Microscopy; SPDM) in combination with nano-probing using COMBO-FISH (COMBinatorial Oligonucleotide FISH), novel insights into the nano-architecture of the genome will become possible. The native spatial structure of trinucleotide repeat expansion genome regions was analysed and optical sequencing of repetitive units was performed within 3D-conserved nuclei using SPDM after COMBO-FISH. We analysed a (CGG)n-expansion region inside the 5' untranslated region of the FMR1 gene. The number of CGG repeats for a full mutation causing the Fragile-X syndrome was found and also verified by Southern blot. The FMR1 promotor region was similarly condensed like a centromeric region whereas the arrangement of the probes labelling the expansion region seemed to indicate a loop-like nano-structure. These results for the first time demonstrate that in situ chromatin structure measurements on the nanoscale are feasible. Due to further methodological progress it will become possible to estimate the state of trinucleotide repeat mutations in detail and to determine the associated chromatin strand structural changes on the single cell level. In general, the application of the described approach to any genome region will lead to new insights into genome nano-architecture and open new avenues for understanding mechanisms and their relevance in the development of heredity diseases.
Human renin 5'-flanking DNA to nucleotide-2750.
Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J
1995-01-01
Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.
Directory of Open Access Journals (Sweden)
Dimos Gaidatzis
2014-02-01
Full Text Available For the most part metazoan genomes are highly methylated and harbor only small regions with low or absent methylation. In contrast, partially methylated domains (PMDs, recently discovered in a variety of cell lines and tissues, do not fit this paradigm as they show partial methylation for large portions (20%-40% of the genome. While in PMDs methylation levels are reduced on average, we found that at single CpG resolution, they show extensive variability along the genome outside of CpG islands and DNase I hypersensitive sites (DHS. Methylation levels range from 0% to 100% in a roughly uniform fashion with only little similarity between neighboring CpGs. A comparison of various PMD-containing methylomes showed that these seemingly disordered states of methylation are strongly conserved across cell types for virtually every PMD. Comparative sequence analysis suggests that DNA sequence is a major determinant of these methylation states. This is further substantiated by a purely sequence based model which can predict 31% (R(2 of the variation in methylation. The model revealed CpG density as the main driving feature promoting methylation, opposite to what has been shown for CpG islands, followed by various dinucleotides immediately flanking the CpG and a minor contribution from sequence preferences reflecting nucleosome positioning. Taken together we provide a reinterpretation for the nucleotide-specific methylation levels observed in PMDs, demonstrate their conservation across tissues and suggest that they are mainly determined by specific DNA sequence features.
Splinkerette PCR for mapping transposable elements in Drosophila.
Directory of Open Access Journals (Sweden)
Christopher J Potter
2010-04-01
Full Text Available Transposable elements (such as the P-element and piggyBac have been used to introduce thousands of transgenic constructs into the Drosophila genome. These transgenic constructs serve many roles, from assaying gene/cell function, to controlling chromosome arm rearrangement. Knowing the precise genomic insertion site for the transposable element is often desired. This enables identification of genomic enhancer regions trapped by an enhancer trap, identification of the gene mutated by a transposon insertion, or simplifying recombination experiments. The most commonly used transgene mapping method is inverse PCR (iPCR. Although usually effective, limitations with iPCR hinder its ability to isolate flanking genomic DNA in complex genomic loci, such as those that contain natural transposons. Here we report the adaptation of the splinkerette PCR (spPCR method for the isolation of flanking genomic DNA of any P-element or piggyBac. We report a simple and detailed protocol for spPCR. We use spPCR to 1 map a GAL4 enhancer trap located inside a natural transposon, pinpointing a master regulatory region for olfactory neuron expression in the brain; and 2 map all commonly used centromeric FRT insertion sites. The ease, efficiency, and efficacy of spPCR could make it a favored choice for the mapping of transposable element in Drosophila.
Focused seismicity triggered by flank instability on Kīlauea's Southwest Rift Zone
Judson, Josiah; Thelen, Weston A.; Greenfield, Tim; White, Robert S.
2018-03-01
Swarms of earthquakes at the head of the Southwest Rift Zone on Kīlauea Volcano, Hawai´i, reveal an interaction of normal and strike-slip faulting associated with movement of Kīlauea's south flank. A relocated subset of earthquakes between January 2012 and August 2014 are highly focused in space and time at depths that are coincident with the south caldera magma reservoir beneath the southern margin of Kīlauea Caldera. Newly calculated focal mechanisms are dominantly dextral shear with a north-south preferred fault orientation. Two earthquakes within this focused area of seismicity have normal faulting mechanisms, indicating two mechanisms of failure in very close proximity (10's of meters to 100 m). We suggest a model where opening along the Southwest Rift Zone caused by seaward motion of the south flank permits injection of magma and subsequent freezing of a plug, which then fails in a right-lateral strike-slip sense, consistent with the direction of movement of the south flank. The seismicity is concentrated in an area where a constriction occurs between a normal fault and the deeper magma transport system into the Southwest Rift Zone. Although in many ways the Southwest Rift Zone appears analogous to the more active East Rift Zone, the localization of the largest seismicity (>M2.5) within the swarms to a small volume necessitates a different model than has been proposed to explain the lineament outlined by earthquakes along the East Rift Zone.
Genome-Wide Expression Profiling of Complex Regional Pain Syndrome
Jin, Eun-Heui; Zhang, Enji; Ko, Youngkwon; Sim, Woo Seog; Moon, Dong Eon; Yoon, Keon Jung; Hong, Jang Hee; Lee, Won Hyung
2013-01-01
Complex regional pain syndrome (CRPS) is a chronic, progressive, and devastating pain syndrome characterized by spontaneous pain, hyperalgesia, allodynia, altered skin temperature, and motor dysfunction. Although previous gene expression profiling studies have been conducted in animal pain models, there genome-wide expression profiling in the whole blood of CRPS patients has not been reported yet. Here, we successfully identified certain pain-related genes through genome-wide expression profiling in the blood from CRPS patients. We found that 80 genes were differentially expressed between 4 CRPS patients (2 CRPS I and 2 CRPS II) and 5 controls (cut-off value: 1.5-fold change and pCRPS patients and 18 controls by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). We focused on the MMP9 gene that, by qRT-PCR, showed a statistically significant difference in expression in CRPS patients compared to controls with the highest relative fold change (4.0±1.23 times and p = 1.4×10−4). The up-regulation of MMP9 gene in the blood may be related to the pain progression in CRPS patients. Our findings, which offer a valuable contribution to the understanding of the differential gene expression in CRPS may help in the understanding of the pathophysiology of CRPS pain progression. PMID:24244504
Magnocellular involvement in flanked-letter identification relates to the allocation of attention
Omtzigt, D.; Hendriks, A.W.C.J.
2004-01-01
To verify the hypothesis that the magnocellular system is important to flanked-letter identification [Neuropsychologia 40 (2002) 1881] because it subserves attention allocation, we conducted three letter-naming experiments in which we manipulated magnocellular involvement (colour vs. luminance
Balani, Valério Américo; de Lima Neto, Quirino Alves; Takeda, Karen Izumi; Gimenes, Fabrícia; Fiorini, Adriana; Debatisse, Michelle; Fernandez, Maria Aparecida
2010-11-01
The aim of this work was to determine whether intrinsically bent DNA sites are present at, or close to, the mammalian replication origins oriGNAI3 and oriB in the Chinese hamster AMPD2 locus. Using an electrophoretic mobility shift assay and in silico analysis, we located four intrinsically bent DNA sites (b1 to b4) in a fragment that contains the oriGNAI3 and one site (b5) proximal to oriB. The helical parameters show that each bent DNA site is curved in a left-handed superhelical writhe. A 2D projection of 3D fragment trajectories revealed that oriGNAI3 is located in a relatively straight segment flanked by bent sites b1 and b2, which map in previously identified Scaffold/Matrix Attachment Region. Sites b3 and b4 are located approximately 2 kb downstream and force the fragment into a strong closed loop structure. The b5 site is also located in an S/MAR that is found just downstream of oriB.
Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M
2015-07-01
The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Taras K Oleksyk
2008-03-01
Full Text Available When a selective sweep occurs in the chromosomal region around a target gene in two populations that have recently separated, it produces three dramatic genomic consequences: 1 decreased multi-locus heterozygosity in the region; 2 elevated or diminished genetic divergence (F(ST of multiple polymorphic variants adjacent to the selected locus between the divergent populations, due to the alternative fixation of alleles; and 3 a consequent regional increase in the variance of F(ST (S(2F(ST for the same clustered variants, due to the increased alternative fixation of alleles in the loci surrounding the selection target. In the first part of our study, to search for potential targets of directional selection, we developed and validated a resampling-based computational approach; we then scanned an array of 31 different-sized moving windows of SNP variants (5-65 SNPs across the human genome in a set of European and African American population samples with 183,997 SNP loci after correcting for the recombination rate variation. The analysis revealed 180 regions of recent selection with very strong evidence in either population or both. In the second part of our study, we compared the newly discovered putative regions to those sites previously postulated in the literature, using methods based on inspecting patterns of linkage disequilibrium, population divergence and other methodologies. The newly found regions were cross-validated with those found in nine other studies that have searched for selection signals. Our study was replicated especially well in those regions confirmed by three or more studies. These validated regions were independently verified, using a combination of different methods and different databases in other studies, and should include fewer false positives. The main strength of our analysis method compared to others is that it does not require dense genotyping and therefore can be used with data from population-based genome SNP scans
Doekes, Harmen P; Veerkamp, Roel F; Bijma, Piter; Hiemstra, Sipke J; Windig, Jack J
2018-04-11
In recent decades, Holstein-Friesian (HF) selection schemes have undergone profound changes, including the introduction of optimal contribution selection (OCS; around 2000), a major shift in breeding goal composition (around 2000) and the implementation of genomic selection (GS; around 2010). These changes are expected to have influenced genetic diversity trends. Our aim was to evaluate genome-wide and region-specific diversity in HF artificial insemination (AI) bulls in the Dutch-Flemish breeding program from 1986 to 2015. Pedigree and genotype data (~ 75.5 k) of 6280 AI-bulls were used to estimate rates of genome-wide inbreeding and kinship and corresponding effective population sizes. Region-specific inbreeding trends were evaluated using regions of homozygosity (ROH). Changes in observed allele frequencies were compared to those expected under pure drift to identify putative regions under selection. We also investigated the direction of changes in allele frequency over time. Effective population size estimates for the 1986-2015 period ranged from 69 to 102. Two major breakpoints were observed in genome-wide inbreeding and kinship trends. Around 2000, inbreeding and kinship levels temporarily dropped. From 2010 onwards, they steeply increased, with pedigree-based, ROH-based and marker-based inbreeding rates as high as 1.8, 2.1 and 2.8% per generation, respectively. Accumulation of inbreeding varied substantially across the genome. A considerable fraction of markers showed changes in allele frequency that were greater than expected under pure drift. Putative selected regions harboured many quantitative trait loci (QTL) associated to a wide range of traits. In consecutive 5-year periods, allele frequencies changed more often in the same direction than in opposite directions, except when comparing the 1996-2000 and 2001-2005 periods. Genome-wide and region-specific diversity trends reflect major changes in the Dutch-Flemish HF breeding program. Introduction of
Genomic breeding value estimation using nonparametric additive regression models
Directory of Open Access Journals (Sweden)
Solberg Trygve
2009-01-01
Full Text Available Abstract Genomic selection refers to the use of genomewide dense markers for breeding value estimation and subsequently for selection. The main challenge of genomic breeding value estimation is the estimation of many effects from a limited number of observations. Bayesian methods have been proposed to successfully cope with these challenges. As an alternative class of models, non- and semiparametric models were recently introduced. The present study investigated the ability of nonparametric additive regression models to predict genomic breeding values. The genotypes were modelled for each marker or pair of flanking markers (i.e. the predictors separately. The nonparametric functions for the predictors were estimated simultaneously using additive model theory, applying a binomial kernel. The optimal degree of smoothing was determined by bootstrapping. A mutation-drift-balance simulation was carried out. The breeding values of the last generation (genotyped was predicted using data from the next last generation (genotyped and phenotyped. The results show moderate to high accuracies of the predicted breeding values. A determination of predictor specific degree of smoothing increased the accuracy.
Laffin, Jennifer J S; Raca, Gordana; Jackson, Craig A; Strand, Edythe A; Jakielski, Kathy J; Shriberg, Lawrence D
2012-11-01
The goal of this study was to identify new candidate genes and genomic copy-number variations associated with a rare, severe, and persistent speech disorder termed childhood apraxia of speech. Childhood apraxia of speech is the speech disorder segregating with a mutation in FOXP2 in a multigenerational London pedigree widely studied for its role in the development of speech-language in humans. A total of 24 participants who were suspected to have childhood apraxia of speech were assessed using a comprehensive protocol that samples speech in challenging contexts. All participants met clinical-research criteria for childhood apraxia of speech. Array comparative genomic hybridization analyses were completed using a customized 385K Nimblegen array (Roche Nimblegen, Madison, WI) with increased coverage of genes and regions previously associated with childhood apraxia of speech. A total of 16 copy-number variations with potential consequences for speech-language development were detected in 12 or half of the 24 participants. The copy-number variations occurred on 10 chromosomes, 3 of which had two to four candidate regions. Several participants were identified with copy-number variations in two to three regions. In addition, one participant had a heterozygous FOXP2 mutation and a copy-number variation on chromosome 2, and one participant had a 16p11.2 microdeletion and copy-number variations on chromosomes 13 and 14. Findings support the likelihood of heterogeneous genomic pathways associated with childhood apraxia of speech.
Gallus, Susanne; Janke, Axel
2017-01-01
Abstract Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. PMID:28985298
International Nuclear Information System (INIS)
Kahl, G.; Ramser, J.; Terauchi, R.; Lopez-Peralta, C.; Asemota, H.N.; Weising, K.
1998-01-01
A combination of PCR- and hybridization-based genome scanning techniques and sequence comparisons between non-coding chloroplast DNA flanking tRNA genes has been employed to screen Dioscorea species for intra- and interspecific genetic diversity. This methodology detected extensive polymorphisms within Dioscorea bulbifera L., and revealed taxonomic and phylogenetic relationships among cultivated Guinea yams varieties and their potential wild progenitors. Finally, screening of yam germplasm grown in Jamaica permitted reliable discrimination between all major cultivars. Genome scanning by micro satellite-primed PCR (MP-PCR) and random amplified polymorphic DNA (RAPD) analysis in combination with the novel random amplified micro satellite polymorphisms (RAMPO) hybridization technique has shown high potential for the genetic analysis of yams, and holds promise for other vegetatively propagated orphan crops. (author)
Directory of Open Access Journals (Sweden)
Jüri Reimand
2015-01-01
Full Text Available Interpreting the impact of human genome variation on phenotype is challenging. The functional effect of protein-coding variants is often predicted using sequence conservation and population frequency data, however other factors are likely relevant. We hypothesized that variants in protein post-translational modification (PTM sites contribute to phenotype variation and disease. We analyzed fraction of rare variants and non-synonymous to synonymous variant ratio (Ka/Ks in 7,500 human genomes and found a significant negative selection signal in PTM regions independent of six factors, including conservation, codon usage, and GC-content, that is widely distributed across tissue-specific genes and function classes. PTM regions are also enriched in known disease mutations, suggesting that PTM variation is more likely deleterious. PTM constraint also affects flanking sequence around modified residues and increases around clustered sites, indicating presence of functionally important short linear motifs. Using target site motifs of 124 kinases, we predict that at least ∼180,000 motif-breaker amino acid residues that disrupt PTM sites when substituted, and highlight kinase motifs that show specific negative selection and enrichment of disease mutations. We provide this dataset with corresponding hypothesized mechanisms as a community resource. As an example of our integrative approach, we propose that PTPN11 variants in Noonan syndrome aberrantly activate the protein by disrupting an uncharacterized cluster of phosphorylation sites. Further, as PTMs are molecular switches that are modulated by drugs, we study mutated binding sites of PTM enzymes in disease genes and define a drug-disease network containing 413 novel predicted disease-gene links.
Efficient CRISPR/Cas9-Mediated Genome Editing Using a Chimeric Single-Guide RNA Molecule
Butt, Haroon
2017-08-24
The CRISPR/Cas9 system has been applied in diverse eukaryotic organisms for targeted mutagenesis. However, targeted gene editing is inefficient and requires the simultaneous delivery of a DNA template for homology-directed repair (HDR). Here, we used CRISPR/Cas9 to generate targeted double-strand breaks and to deliver an RNA repair template for HDR in rice (Oryza sativa). We used chimeric single-guide RNA (cgRNA) molecules carrying both sequences for target site specificity (to generate the double-strand breaks) and repair template sequences (to direct HDR), flanked by regions of homology to the target. Gene editing was more efficient in rice protoplasts using repair templates complementary to the non-target DNA strand, rather than the target strand. We applied this cgRNA repair method to generate herbicide resistance in rice, which showed that this cgRNA repair method can be used for targeted gene editing in plants. Our findings will facilitate applications in functional genomics and targeted improvement of crop traits.
Directory of Open Access Journals (Sweden)
Arehart Eric
2009-03-01
Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in
Directory of Open Access Journals (Sweden)
You Frank M
2010-06-01
Full Text Available Abstract Background Physical maps employing libraries of bacterial artificial chromosome (BAC clones are essential for comparative genomics and sequencing of large and repetitive genomes such as those of the hexaploid bread wheat. The diploid ancestor of the D-genome of hexaploid wheat (Triticum aestivum, Aegilops tauschii, is used as a resource for wheat genomics. The barley diploid genome also provides a good model for the Triticeae and T. aestivum since it is only slightly larger than the ancestor wheat D genome. Gene co-linearity between the grasses can be exploited by extrapolating from rice and Brachypodium distachyon to Ae. tauschii or barley, and then to wheat. Results We report the use of Ae. tauschii for the construction of the physical map of a large distal region of chromosome arm 3DS. A physical map of 25.4 Mb was constructed by anchoring BAC clones of Ae. tauschii with 85 EST on the Ae. tauschii and barley genetic maps. The 24 contigs were aligned to the rice and B. distachyon genomic sequences and a high density SNP genetic map of barley. As expected, the mapped region is highly collinear to the orthologous chromosome 1 in rice, chromosome 2 in B. distachyon and chromosome 3H in barley. However, the chromosome scale of the comparative maps presented provides new insights into grass genome organization. The disruptions of the Ae. tauschii-rice and Ae. tauschii-Brachypodium syntenies were identical. We observed chromosomal rearrangements between Ae. tauschii and barley. The comparison of Ae. tauschii physical and genetic maps showed that the recombination rate across the region dropped from 2.19 cM/Mb in the distal region to 0.09 cM/Mb in the proximal region. The size of the gaps between contigs was evaluated by comparing the recombination rate along the map with the local recombination rates calculated on single contigs. Conclusions The physical map reported here is the first physical map using fingerprinting of a complete
The C-terminal domain of the Bloom syndrome DNA helicase is essential for genomic stability
Directory of Open Access Journals (Sweden)
Noonan James P
2001-07-01
Full Text Available Abstract Background Bloom syndrome is a rare cancer-prone disorder in which the cells of affected persons have a high frequency of somatic mutation and genomic instability. Bloom syndrome cells have a distinctive high frequency of sister chromatid exchange and quadriradial formation. BLM, the protein altered in BS, is a member of the RecQ DNA helicase family, whose members share an average of 40% identity in the helicase domain and have divergent N-terminal and C-terminal flanking regions of variable lengths. The BLM DNA helicase has been shown to localize to the ND10 (nuclear domain 10 or PML (promyelocytic leukemia nuclear bodies, where it associates with TOPIIIα, and to the nucleolus. Results This report demonstrates that the N-terminal domain of BLM is responsible for localization of the protein to the nuclear bodies, while the C-terminal domain directs the protein to the nucleolus. Deletions of the N-terminal domain of BLM have little effect on sister chromatid exchange frequency and chromosome stability as compared to helicase and C-terminal mutations which can increase SCE frequency and chromosome abnormalities. Conclusion The helicase activity and the C-terminal domain of BLM are critical for maintaining genomic stability as measured by the sister chromatid exchange assay. The localization of BLM into the nucleolus by the C-terminal domain appears to be more important to genomic stability than localization in the nuclear bodies.
Flank wear analysing of high speed end milling for hardened steel D2 using Taguchi Method
Hazza Faizi Al-Hazza, Muataz; Ibrahim, Nur Asmawiyah bt; Adesta, Erry T. Y.; Khan, Ahsan Ali; Abdullah Sidek, Atiah Bt.
2017-03-01
One of the main challenges for any manufacturer is how to decrease the machining cost without affecting the final quality of the product. One of the new advanced machining processes in industry is the high speed hard end milling process that merges three advanced machining processes: high speed milling, hard milling and dry milling. However, one of the most important challenges in this process is to control the flank wear rate. Therefore a analyzing the flank wear rate during machining should be investigated in order to determine the best cutting levels that will not affect the final quality of the product. In this research Taguchi method has been used to investigate the effect of cutting speed, feed rate and depth of cut and determine the best level s to minimize the flank wear rate up to total length of 0.3mm based on the ISO standard to maintain the finishing requirements.
Boschiero, Clarissa; Moreira, Gabriel Costa Monteiro; Gheyas, Almas Ara; Godoy, Thaís Fernanda; Gasparin, Gustavo; Mariani, Pilar Drummond Sampaio Corrêa; Paduan, Marcela; Cesar, Aline Silva Mello; Ledur, Mônica Corrêa; Coutinho, Luiz Lehmann
2018-01-25
Meat and egg-type chickens have been selected for several generations for different traits. Artificial and natural selection for different phenotypes can change frequency of genetic variants, leaving particular genomic footprints throghtout the genome. Thus, the aims of this study were to sequence 28 chickens from two Brazilian lines (meat and white egg-type) and use this information to characterize genome-wide genetic variations, identify putative regions under selection using Fst method, and find putative pathways under selection. A total of 13.93 million SNPs and 1.36 million INDELs were identified, with more variants detected from the broiler (meat-type) line. Although most were located in non-coding regions, we identified 7255 intolerant non-synonymous SNPs, 512 stopgain/loss SNPs, 1381 frameshift and 1094 non-frameshift INDELs that may alter protein functions. Genes harboring intolerant non-synonymous SNPs affected metabolic pathways related mainly to reproduction and endocrine systems in the white-egg layer line, and lipid metabolism and metabolic diseases in the broiler line. Fst analysis in sliding windows, using SNPs and INDELs separately, identified over 300 putative regions of selection overlapping with more than 250 genes. For the first time in chicken, INDEL variants were considered for selection signature analysis, showing high level of correlation in results between SNP and INDEL data. The putative regions of selection signatures revealed interesting candidate genes and pathways related to important phenotypic traits in chicken, such as lipid metabolism, growth, reproduction, and cardiac development. In this study, Fst method was applied to identify high confidence putative regions under selection, providing novel insights into selection footprints that can help elucidate the functional mechanisms underlying different phenotypic traits relevant to meat and egg-type chicken lines. In addition, we generated a large catalog of line-specific and common
DEFF Research Database (Denmark)
Friis, Susanne L; Buchard, Anders; Rockenbauer, Eszter
2016-01-01
This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report with the......This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report...
Gomez, Sandra; Adalid-Peralta, Laura; Palafox-Fonseca, Hector; Cantu-Robles, Vito Adrian; Soberón, Xavier; Sciutto, Edda; Fragoso, Gladis; Bobes, Raúl J; Laclette, Juan P; Yauner, Luis del Pozo; Ochoa-Leyva, Adrián
2015-05-19
Excretory/Secretory (ES) proteins play an important role in the host-parasite interactions. Experimental identification of ES proteins is time-consuming and expensive. Alternative bioinformatics approaches are cost-effective and can be used to prioritize the experimental analysis of therapeutic targets for parasitic diseases. Here we predicted and functionally annotated the ES proteins in T. solium genome using an integration of bioinformatics tools. Additionally, we developed a novel measurement to evaluate the potential antigenicity of T. solium secretome using sequence length and number of antigenic regions of ES proteins. This measurement was formalized as the Abundance of Antigenic Regions (AAR) value. AAR value for secretome showed a similar value to that obtained for a set of experimentally determined antigenic proteins and was different to the calculated value for the non-ES proteins of T. solium genome. Furthermore, we calculated the AAR values for known helminth secretomes and they were similar to that obtained for T. solium. The results reveal the utility of AAR value as a novel genomic measurement to evaluate the potential antigenicity of secretomes. This comprehensive analysis of T. solium secretome provides functional information for future experimental studies, including the identification of novel ES proteins of therapeutic, diagnosis and immunological interest.
Pancreatic Tail Cancer with Sole Manifestation of Left Flank Pain: A Very Rare Presentation
Directory of Open Access Journals (Sweden)
Hsing-Lin Lin
2008-06-01
Full Text Available Pancreatic cancer is sometimes called a “silent disease” because it often causes no symptoms in the early stage. The symptoms can be quite vague and various depending on the location of cancer in the pancreas. The anatomic site distribution is 78% in the head of the pancreas, 11% in the body, and 11% in the tail. Pancreatic cancer is rarely detected in the early stage, and it is very uncommon to diagnose pancreatic tail cancer during an emergency department visit. The manifestation of pancreatic tail cancer as left flank pain is very rare and has seldom been identified in the literature. We present a case of pancreatic tail cancer with the sole manifestation of dull left flank pain. Having negative findings on an ultrasound study initially, this female patient was misdiagnosed as having possible acute gastritis, urolithiasis or muscle strain after she received gastroendoscopy and colonofiberscopy. Her symptoms persisted for several months and she visited our emergency department due to an acute exacerbation of a persistent dull pain in the left flank area. Radiographic evaluation with computed tomography was performed, and pancreatic tail tumor with multiple metastases was found unexpectedly. We review the literature and discuss this rare presentation of pancreatic tail cancer.
St2-80: a new FISH marker for St genome and genome analysis in Triticeae.
Wang, Long; Shi, Qinghua; Su, Handong; Wang, Yi; Sha, Lina; Fan, Xing; Kang, Houyang; Zhang, Haiqin; Zhou, Yonghong
2017-07-01
The St genome is one of the most fundamental genomes in Triticeae. Repetitive sequences are widely used to distinguish different genomes or species. The primary objectives of this study were to (i) screen a new sequence that could easily distinguish the chromosome of the St genome from those of other genomes by fluorescence in situ hybridization (FISH) and (ii) investigate the genome constitution of some species that remain uncertain and controversial. We used degenerated oligonucleotide primer PCR (Dop-PCR), Dot-blot, and FISH to screen for a new marker of the St genome and to test the efficiency of this marker in the detection of the St chromosome at different ploidy levels. Signals produced by a new FISH marker (denoted St 2 -80) were present on the entire arm of chromosomes of the St genome, except in the centromeric region. On the contrary, St 2 -80 signals were present in the terminal region of chromosomes of the E, H, P, and Y genomes. No signal was detected in the A and B genomes, and only weak signals were detected in the terminal region of chromosomes of the D genome. St 2 -80 signals were obvious and stable in chromosomes of different genomes, whether diploid or polyploid. Therefore, St 2 -80 is a potential and useful FISH marker that can be used to distinguish the St genome from those of other genomes in Triticeae.
An unusual manifestation of acute appendicitis with left flank pain
Directory of Open Access Journals (Sweden)
Roland Talanow, MD, PhD
2008-08-01
Full Text Available The author presents a case with an unusual presentation of early appendicitis. The patient presented initially with left sided flank pain. Workup for nephrolithiasis, including non-contrast CT of the abdomen and pelvis was negative for renal stones or hydronephrosis. After discharge, the patient presented one week later in the ED with right lower quadrant pain. Contrast enhanced CT of the abdomen revealed perforated appendicitis.
Structured RNAs and synteny regions in the pig genome
DEFF Research Database (Denmark)
Anthon, Christian; Tafer, Hakim; Havgaard, Jakob H
2014-01-01
BACKGROUND: Annotating mammalian genomes for noncoding RNAs (ncRNAs) is nontrivial since far from all ncRNAs are known and the computational models are resource demanding. Currently, the human genome holds the best mammalian ncRNA annotation, a result of numerous efforts by several groups. However......, a more direct strategy is desired for the increasing number of sequenced mammalian genomes of which some, such as the pig, are relevant as disease models and production animals. RESULTS: We present a comprehensive annotation of structured RNAs in the pig genome. Combining sequence and structure...... lncRNA loci, 11 conflicts of annotation, and 3,183 ncRNA genes. The ncRNA genes comprise 359 miRNAs, 8 ribozymes, 185 rRNAs, 638 snoRNAs, 1,030 snRNAs, 810 tRNAs and 153 ncRNA genes not belonging to the here fore mentioned classes. When running the pipeline on a local shuffled version of the genome...
Directory of Open Access Journals (Sweden)
Zuniga Aimée
2012-08-01
Full Text Available Abstract Background Mouse limb bud is a prime model to study the regulatory interactions that control vertebrate organogenesis. Major aspects of limb bud development are controlled by feedback loops that define a self-regulatory signalling system. The SHH/GREM1/AER-FGF feedback loop forms the core of this signalling system that operates between the posterior mesenchymal organiser and the ectodermal signalling centre. The BMP antagonist Gremlin1 (GREM1 is a critical node in this system, whose dynamic expression is controlled by BMP, SHH, and FGF signalling and key to normal progression of limb bud development. Previous analysis identified a distant cis-regulatory landscape within the neighbouring Formin1 (Fmn1 locus that is required for Grem1 expression, reminiscent of the genomic landscapes controlling HoxD and Shh expression in limb buds. Results Three highly conserved regions (HMCO1-3 were identified within the previously defined critical genomic region and tested for their ability to regulate Grem1 expression in mouse limb buds. Using a combination of BAC and conventional transgenic approaches, a 9 kb region located ~70 kb downstream of the Grem1 transcription unit was identified. This region, termed Grem1 Regulatory Sequence 1 (GRS1, is able to recapitulate major aspects of Grem1 expression, as it drives expression of a LacZ reporter into the posterior and, to a lesser extent, in the distal-anterior mesenchyme. Crossing the GRS1 transgene into embryos with alterations in the SHH and BMP pathways established that GRS1 depends on SHH and is modulated by BMP signalling, i.e. integrates inputs from these pathways. Chromatin immunoprecipitation revealed interaction of endogenous GLI3 proteins with the core cis-regulatory elements in the GRS1 region. As GLI3 is a mediator of SHH signal transduction, these results indicated that SHH directly controls Grem1 expression through the GRS1 region. Finally, all cis-regulatory regions within the Grem1
International Nuclear Information System (INIS)
Agrawal, Vikash; Shahjad; Bhardwaj, Dinesh; Bhargav, Ranoo; Sharma, Gauri Datt; Bhardwaj, Ramil Kumar; Patra, Asit; Chand, Suresh
2016-01-01
Highlights: • Biselenophene-flanked 3,4-ethylenedioxythiophene polymer films were obtained by electrochemical polymerization. • Supporting electrolyte has significant effect on the doping level, whereas electropolymerized solvent has a major effect on morphology of the polymer films. • Optoelectronic properties and morphology of the electropolymerized films were studied. • Density functional theory (DFT) calculation has been made for optoelectronic properties. - Abstract: Biselenophene-flanked 3,4-ethylenedioxythiophene (EDOT) based polymer films were obtained by electrochemical polymerization. The effects of polymerization conditions such as supporting electrolytes and solvents on doping level, optical property and morphology of the polymer films were systematically studied. Interestingly, we found that polymer prepared by using different supporting electrolytes (TBAPF 6 , TBABF 4 and TBAClO 4 ) has significant effects on the doping level of the polymer films, whereas electropolymerized solvents (acetonitrile and dichloromethane) has no such effects on doping level. The polymer films show reversible dedoping and doping behavior upon treatment with hydrazine hydrate and iodine respectively. Biselenophene-flanked EDOT polymer shows a band gap of about 1.6 eV which is comparable to poly(3,4- ethylenedioxythiophene) (PEDOT) and parent polyselenophene, whereas fine-tuning of HOMO and LUMO energy levels has been found. In contrast, we observed that electropolymerized solvent has a major effect on morphology of the polymer films, while supporting electrolyte has very minor effects on the morphology. The surface morphologies of the polymer films were characterized by scanning electron microscope (SEM) and atomic force microscope (AFM) techniques. We also present an efficient synthesis of bisthiophene-flanked bridged EDOT (ETTE), and biselenophene-flanked bridged EDOT (ESeSeE), and their electrochemical polymerization, characterizations and throughout comparison
Mia, Mozammel; Al Bashir, Mahmood; Dhar, Nikhil Ranjan
2016-10-01
Hard turning is increasingly employed in machining, lately, to replace time-consuming conventional turning followed by grinding process. An excessive amount of tool wear in hard turning is one of the main hurdles to be overcome. Many researchers have developed tool wear model, but most of them developed it for a particular work-tool-environment combination. No aggregate model is developed that can be used to predict the amount of principal flank wear for specific machining time. An empirical model of principal flank wear (VB) has been developed for the different hardness of workpiece (HRC40, HRC48 and HRC56) while turning by coated carbide insert with different configurations (SNMM and SNMG) under both dry and high pressure coolant conditions. Unlike other developed model, this model includes the use of dummy variables along with the base empirical equation to entail the effect of any changes in the input conditions on the response. The base empirical equation for principal flank wear is formulated adopting the Exponential Associate Function using the experimental results. The coefficient of dummy variable reflects the shifting of the response from one set of machining condition to another set of machining condition which is determined by simple linear regression. The independent cutting parameters (speed, rate, depth of cut) are kept constant while formulating and analyzing this model. The developed model is validated with different sets of machining responses in turning hardened medium carbon steel by coated carbide inserts. For any particular set, the model can be used to predict the amount of principal flank wear for specific machining time. Since the predicted results exhibit good resemblance with experimental data and the average percentage error is <10 %, this model can be used to predict the principal flank wear for stated conditions.
Directory of Open Access Journals (Sweden)
Alexander B. Opoku-Acheampong
2016-01-01
Full Text Available Saw palmetto supplements (SPS are commonly consumed by men with prostate cancer. We investigated whether SPS fatty acids and phytosterols concentrations determine their growth-inhibitory action in androgen-sensitive LNCaP cells and hamster flank organs. High long-chain fatty acids-low phytosterols (HLLP SPS ≥ 750 nM with testosterone significantly increased and ≥500 nM with dihydrotestosterone significantly decreased LNCaP cell number. High long-chain fatty acids-high phytosterols (HLHP SPS ≥ 500 nM with dihydrotestosterone and high medium-chain fatty acids-low phytosterols (HMLP SPS ≥ 750 nM or with androgens significantly decreased LNCaP cell number (n=3; p<0.05. Five- to six-week-old, castrated male Syrian hamsters were randomized to control (n=4, HLLP, HLHP, and HMLP SPS (n=6 groups. Testosterone or dihydrotestosterone was applied topically daily for 21 days to the right flank organ; the left flank organ was treated with ethanol and served as the control. Thirty minutes later, SPS or ethanol was applied to each flank organ in treatment and control groups, respectively. SPS treatments caused a notable but nonsignificant reduction in the difference between left and right flank organ growth in testosterone-treated SPS groups compared to the control. The same level of inhibition was not seen in dihydrotestosterone-treated SPS groups (p<0.05. Results may suggest that SPS inhibit 5α-reductase thereby preventing hamster flank organ growth.
Opoku-Acheampong, Alexander B; Penugonda, Kavitha; Lindshield, Brian L
2016-01-01
Saw palmetto supplements (SPS) are commonly consumed by men with prostate cancer. We investigated whether SPS fatty acids and phytosterols concentrations determine their growth-inhibitory action in androgen-sensitive LNCaP cells and hamster flank organs. High long-chain fatty acids-low phytosterols (HLLP) SPS ≥ 750 nM with testosterone significantly increased and ≥500 nM with dihydrotestosterone significantly decreased LNCaP cell number. High long-chain fatty acids-high phytosterols (HLHP) SPS ≥ 500 nM with dihydrotestosterone and high medium-chain fatty acids-low phytosterols (HMLP) SPS ≥ 750 nM or with androgens significantly decreased LNCaP cell number (n = 3; p < 0.05). Five- to six-week-old, castrated male Syrian hamsters were randomized to control (n = 4), HLLP, HLHP, and HMLP SPS (n = 6) groups. Testosterone or dihydrotestosterone was applied topically daily for 21 days to the right flank organ; the left flank organ was treated with ethanol and served as the control. Thirty minutes later, SPS or ethanol was applied to each flank organ in treatment and control groups, respectively. SPS treatments caused a notable but nonsignificant reduction in the difference between left and right flank organ growth in testosterone-treated SPS groups compared to the control. The same level of inhibition was not seen in dihydrotestosterone-treated SPS groups (p < 0.05). Results may suggest that SPS inhibit 5α-reductase thereby preventing hamster flank organ growth.
Lawal, S. A.; Choudhury, I. A.; Nukman, Y.
2015-01-01
The understanding of cutting fluids performance in turning process is very important in order to improve the efficiency of the process. This efficiency can be determined based on certain process parameters such as flank wear, cutting forces developed, temperature developed at the tool chip interface, surface roughness on the work piece, etc. In this study, the objective is to determine the influence of cutting fluids on flank wear during turning of AISI 4340 with coated carbide inserts. The performances of three types of cutting fluids were compared using Taguchi experimental method. The results show that palm kernel oil based cutting fluids performed better than the other two cutting fluids in reducing flank wear. Mathematical models for cutting parameters such as cutting speed, feed rate, depth of cut and cutting fluids were obtained from regression analysis using MINITAB 14 software to predict flank wear. Experiments were conducted based on the optimized values to validate the regression equations for flank wear and 5.82 % error was obtained. The optimal cutting parameters for the flank wear using S/N ratio were 160 m/min of cutting speed (level 1), 0.18 mm/rev of feed (level 1), 1.75 mm of depth of cut (level 2) and 2.97 mm2/s palm kernel oil based cutting fluid (level 3). ANOVA shows cutting speed of 85.36 %; and feed rate 4.81 %) as significant factors.
A general pipeline for the development of anchor markers for comparative genomics in plants
Directory of Open Access Journals (Sweden)
Stougaard Jens
2006-08-01
Full Text Available Abstract Background Complete or near-complete genomic sequence information is presently only available for a few plant species representing a large phylogenetic diversity among plants. In order to effectively transfer this information to species lacking sequence information, comparative genomic tools need to be developed. Molecular markers permitting cross-species mapping along co-linear genomic regions are central to comparative genomics. These "anchor" markers, defining unique loci in genetic linkage maps of multiple species, are gene-based and possess a number of features that make them relatively sparse. To identify potential anchor marker sequences more efficiently, we have established an automated bioinformatic pipeline that combines multi-species Expressed Sequence Tags (EST and genome sequence data. Results Taking advantage of sequence data from related species, the pipeline identifies evolutionarily conserved sequences that are likely to define unique orthologous loci in most species of the same phylogenetic clade. The key features are the identification of evolutionarily conserved sequences followed by automated design of intron-flanking Polymerase Chain Reaction (PCR primer pairs. Polymorphisms can subsequently be identified by size- or sequence variation of PCR products, amplified from mapping parents or populations. We illustrate our procedure in legumes and grasses and exemplify its application in legumes, where model plant studies and the genome- and EST-sequence data available have a potential impact on the breeding of crop species and on our understanding of the evolution of this large and diverse family. Conclusion We provide a database of 459 candidate anchor loci which have the potential to serve as map anchors in more than 18,000 legume species, a number of which are of agricultural importance. For grasses, the database contains 1335 candidate anchor loci. Based on this database, we have evaluated 76 candidate anchor loci
Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.
Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2013-05-01
In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.
Sequencing intractable DNA to close microbial genomes.
Directory of Open Access Journals (Sweden)
Richard A Hurt
Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.
Sequencing Intractable DNA to Close Microbial Genomes
Energy Technology Data Exchange (ETDEWEB)
Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL
2012-01-01
Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.
Gog, Julia R; Lever, Andrew M L; Skittrall, Jordan P
2018-01-01
We present a fast, robust and parsimonious approach to detecting signals in an ordered sequence of numbers. Our motivation is in seeking a suitable method to take a sequence of scores corresponding to properties of positions in virus genomes, and find outlying regions of low scores. Suitable statistical methods without using complex models or making many assumptions are surprisingly lacking. We resolve this by developing a method that detects regions of low score within sequences of real numbers. The method makes no assumptions a priori about the length of such a region; it gives the explicit location of the region and scores it statistically. It does not use detailed mechanistic models so the method is fast and will be useful in a wide range of applications. We present our approach in detail, and test it on simulated sequences. We show that it is robust to a wide range of signal morphologies, and that it is able to capture multiple signals in the same sequence. Finally we apply it to viral genomic data to identify regions of evolutionary conservation within influenza and rotavirus.
Directory of Open Access Journals (Sweden)
Zhang Xiaohua
2003-11-01
Full Text Available Abstract In the search for genetic determinants of complex disease, two approaches to association analysis are most often employed, testing single loci or testing a small group of loci jointly via haplotypes for their relationship to disease status. It is still debatable which of these approaches is more favourable, and under what conditions. The former has the advantage of simplicity but suffers severely when alleles at the tested loci are not in linkage disequilibrium (LD with liability alleles; the latter should capture more of the signal encoded in LD, but is far from simple. The complexity of haplotype analysis could be especially troublesome for association scans over large genomic regions, which, in fact, is becoming the standard design. For these reasons, the authors have been evaluating statistical methods that bridge the gap between single-locus and haplotype-based tests. In this article, they present one such method, which uses non-parametric regression techniques embodied by Bayesian adaptive regression splines (BARS. For a set of markers falling within a common genomic region and a corresponding set of single-locus association statistics, the BARS procedure integrates these results into a single test by examining the class of smooth curves consistent with the data. The non-parametric BARS procedure generally finds no signal when no liability allele exists in the tested region (ie it achieves the specified size of the test and it is sensitive enough to pick up signals when a liability allele is present. The BARS procedure provides a robust and potentially powerful alternative to classical tests of association, diminishes the multiple testing problem inherent in those tests and can be applied to a wide range of data types, including genotype frequencies estimated from pooled samples.
International Nuclear Information System (INIS)
Zhou, Y.Z.; Slagle, B.L.; Donehower, L.A.; van Tuinen, P.; Ledbetter, D.H.; Butel, J.S.
1988-01-01
Hepatitis B virus (HBV) is clearly a factor in the development of hepatocellular carcinoma, but its mechanism of action remains obscure. One possibility is that the HBV integration event alters the expression of a nearby growth-regulatory cellular gene. A 9-kilobase (kb) DNA fragment containing an HBV insert plus flanking cellular sequences was cloned from a hepatoma specimen from Shanghai, People's Republic of China. Restriction mapping of the insert revealed a large inverted repeat structure consisting of both viral sequences (encompassing all of the core and pre-S regions and portions of the X and S genes) and at least 3 kb of unique cellular sequences. The virus-cell junction mapped 11 nucleotides from the DRI region, in a position within the HBV X gene and included in the cohesive overlap region. A probe generated from 1.0 kb of the flanking cellular DNA mapped the viral insert to chromosome 17 in the region designated 17p11.2-17p12, which is near the human proto-oncogene p53. Sequence data from a portion of the flanking cellular DNA revealed a stretch of approximately 70 base pairs that showed highly significant homology with a conserved region of a number of functional mammalian DNA, including the human autonomously replicating sequence 1 (ASRI)
Huang, Jinqiang; Li, Yongjuan; Shao, Changwei; Wang, Na; Chen, Songlin
2017-06-20
The nanos gene encodes an RNA-binding zinc finger protein, which is required in the development and maintenance of germ cells. However, there is very limited information about nanos in flatfish, which impedes its application in fish breeding. In this study, we report the molecular cloning, characterization and functional analysis of the 3'-untranslated region of the nanos gene (Csnanos) from half-smooth tongue sole (Cynoglossus semilaevis), which is an economically important flatfish in China. The 1233-bp cDNA sequence, 1709-bp genomic sequence and flanking sequences (2.8-kb 5'- and 1.6-kb 3'-flanking regions) of Csnanos were cloned and characterized. Sequence analysis revealed that CsNanos shares low homology with Nanos in other species, but the zinc finger domain of CsNanos is highly similar. Phylogenetic analysis indicated that CsNanos belongs to the Nanos2 subfamily. Csnanos expression was widely detected in various tissues, but the expression level was higher in testis and ovary. During early development and sex differentiation, Csnanos expression exhibited a clear sexually dimorphic pattern, suggesting its different roles in the migration and differentiation of primordial germ cells (PGCs). Higher expression levels of Csnanos mRNA in normal females and males than in neomales indicated that the nanos gene may play key roles in maintaining the differentiation of gonad. Moreover, medaka PGCs were successfully labeled by the microinjection of synthesized mRNA consisting of green fluorescence protein and the 3'-untranslated region of Csnanos. These findings provide new insights into nanos gene expression and function, and lay the foundation for further study of PGC development and applications in tongue sole breeding. Copyright © 2017 Elsevier B.V. All rights reserved.
Ruhlman, Tracey; Lee, Seung-Bum; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry
2006-08-31
Carrot (Daucus carota) is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats > or = 30 bp with a sequence identity > or = 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP) and maximum likelihood (ML) were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap) for the sister relationship of Daucus with Panax in the euasterid II clade. These
Directory of Open Access Journals (Sweden)
Ruhlman Tracey
2006-08-01
Full Text Available Abstract Background Carrot (Daucus carota is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. Results The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats ≥ 30 bp with a sequence identity ≥ 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP and maximum likelihood (ML were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. Conclusion The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap for the sister relationship of
Energy Technology Data Exchange (ETDEWEB)
Kahl, G; Ramser, J; Terauchi, R [Biocentre, University of Frankfurt, Frankfurt am Main (Germany); Lopez-Peralta, C [IRGP, Colegio de Postgraduados, Montecillo, Edo. de Mexico, Texcoco (Mexico); Asemota, H N [Biotechnology Centre, University of the West Indies, Mona, Kingston (Jamaica); Weising, K [School of Biological Sciences, University of Auckland, Auckland (New Zealand)
1998-10-01
A combination of PCR- and hybridization-based genome scanning techniques and sequence comparisons between non-coding chloroplast DNA flanking tRNA genes has been employed to screen Dioscorea species for intra- and interspecific genetic diversity. This methodology detected extensive polymorphisms within Dioscorea bulbifera L., and revealed taxonomic and phylogenetic relationships among cultivated Guinea yams varieties and their potential wild progenitors. Finally, screening of yam germplasm grown in Jamaica permitted reliable discrimination between all major cultivars. Genome scanning by micro satellite-primed PCR (MP-PCR) and random amplified polymorphic DNA (RAPD) analysis in combination with the novel random amplified micro satellite polymorphisms (RAMPO) hybridization technique has shown high potential for the genetic analysis of yams, and holds promise for other vegetatively propagated orphan crops. (author) 46 refs, 3 figs, 3 tabs
Su, He-Ling; Huang, Ri-Dong; He, Song-Qing; Xu, Qing; Zhu, Hua; Mo, Zhi-Jing; Liu, Qing-Bo; Liu, Yong-Ming
2013-03-01
Brown ducks carrying DHBV were widely used as hepatitis B animal model in the research of the activity and toxicity of anti-HBV dugs. Studies showed that the ratio of DHBV carriers in the brown ducks in Guilin region was relatively high. Nevertheless, the characters of the DHBV genome of Guilin brown duck remain unknown. Here we report the cloning of the genome of Guilin brown duck DHBV and the sequence analysis of the genome. The full length of the DHBV genome of Guilin brown duck was 3 027bp. Analysis using ORF finder found that there was an ORF for an unknown peptide other than S-ORF, PORF and C-ORF in the genome of the DHBV. Vector NTI 8. 0 analysis revealed that the unknown peptide contained a motif which binded to HLA * 0201. Aligning with the DHBV sequences from different countries and regions indicated that there were no obvious differences of regional distribution among the sequences. A fluorescence quantitative PCR for detecting DHBV was establishment based on the recombinant plasmid pGEM-DHBV-S constructed. This study laid the groundwork for using Guilin brown duck as a hepatitis B animal model.
Directory of Open Access Journals (Sweden)
Rahul Bhowmick
2017-05-01
Full Text Available An unusual feature of many eukaryotic genomes is the presence of regions that appear intrinsically difficult to copy during the process of DNA replication. Curiously, the location of these difficult-to-replicate regions is often conserved between species, implying a valuable role in some aspect of genome organization or maintenance. The most prominent class of these regions in mammalian cells is defined as chromosome fragile sites, which acquired their name because of a propensity to form visible gaps/breaks on otherwise-condensed chromosomes in mitosis. This fragility is particularly apparent following perturbation of DNA replication—a phenomenon often referred to as “replication stress”. Here, we review recent data on the molecular basis for chromosome fragility and the role of fragile sites in the etiology of cancer. In particular, we highlight how studies on fragile sites have provided unexpected insights into how the DNA repair machinery assists in the completion of DNA replication.
Directory of Open Access Journals (Sweden)
Lucie Šedová
Full Text Available Metabolic syndrome is a highly prevalent human disease with substantial genomic and environmental components. Previous studies indicate the presence of significant genetic determinants of several features of metabolic syndrome on rat chromosome 16 (RNO16 and the syntenic regions of human genome. We derived the SHR.BN16 congenic strain by introgression of a limited RNO16 region from the Brown Norway congenic strain (BN-Lx into the genomic background of the spontaneously hypertensive rat (SHR strain. We compared the morphometric, metabolic, and hemodynamic profiles of adult male SHR and SHR.BN16 rats. We also compared in silico the DNA sequences for the differential segment in the BN-Lx and SHR parental strains. SHR.BN16 congenic rats had significantly lower weight, decreased concentrations of total triglycerides and cholesterol, and improved glucose tolerance compared with SHR rats. The concentrations of insulin, free fatty acids, and adiponectin were comparable between the two strains. SHR.BN16 rats had significantly lower systolic (18-28 mmHg difference and diastolic (10-15 mmHg difference blood pressure throughout the experiment (repeated-measures ANOVA, P < 0.001. The differential segment spans approximately 22 Mb of the telomeric part of the short arm of RNO16. The in silico analyses revealed over 1200 DNA variants between the BN-Lx and SHR genomes in the SHR.BN16 differential segment, 44 of which lead to missense mutations, and only eight of which (in Asb14, Il17rd, Itih1, Syt15, Ercc6, RGD1564958, Tmem161a, and Gatad2a genes are predicted to be damaging to the protein product. Furthermore, a number of genes within the RNO16 differential segment associated with metabolic syndrome components in human studies showed polymorphisms between SHR and BN-Lx (including Lpl, Nrg3, Pbx4, Cilp2, and Stab1. Our novel congenic rat model demonstrates that a limited genomic region on RNO16 in the SHR significantly affects many of the features of metabolic
PSAT: A web tool to compare genomic neighborhoods of multiple prokaryotic genomes
Directory of Open Access Journals (Sweden)
Wasnick Michael
2008-03-01
Full Text Available Abstract Background The conservation of gene order among prokaryotic genomes can provide valuable insight into gene function, protein interactions, or events by which genomes have evolved. Although some tools are available for visualizing and comparing the order of genes between genomes of study, few support an efficient and organized analysis between large numbers of genomes. The Prokaryotic Sequence homology Analysis Tool (PSAT is a web tool for comparing gene neighborhoods among multiple prokaryotic genomes. Results PSAT utilizes a database that is preloaded with gene annotation, BLAST hit results, and gene-clustering scores designed to help identify regions of conserved gene order. Researchers use the PSAT web interface to find a gene of interest in a reference genome and efficiently retrieve the sequence homologs found in other bacterial genomes. The tool generates a graphic of the genomic neighborhood surrounding the selected gene and the corresponding regions for its homologs in each comparison genome. Homologs in each region are color coded to assist users with analyzing gene order among various genomes. In contrast to common comparative analysis methods that filter sequence homolog data based on alignment score cutoffs, PSAT leverages gene context information for homologs, including those with weak alignment scores, enabling a more sensitive analysis. Features for constraining or ordering results are designed to help researchers browse results from large numbers of comparison genomes in an organized manner. PSAT has been demonstrated to be useful for helping to identify gene orthologs and potential functional gene clusters, and detecting genome modifications that may result in loss of function. Conclusion PSAT allows researchers to investigate the order of genes within local genomic neighborhoods of multiple genomes. A PSAT web server for public use is available for performing analyses on a growing set of reference genomes through any
Li, Teng; Yang, Jie; Li, Yinwan; Cui, Ying; Xie, Qiang; Bu, Wenjun; Hillis, David M
2016-10-19
The Rhyparochromidae, the largest family of Lygaeoidea, encompasses more than 1,850 described species, but no mitochondrial genome has been sequenced to date. Here we describe the first mitochondrial genome for Rhyparochromidae: a complete mitochondrial genome of Panaorus albomaculatus (Scott, 1874). This mitochondrial genome is comprised of 16,345 bp, and contains the expected 37 genes and control region. The majority of the control region is made up of a large tandem-repeat region, which has a novel pattern not previously observed in other insects. The tandem-repeats region of P. albomaculatus consists of 53 tandem duplications (including one partial repeat), which is the largest number of tandem repeats among all the known insect mitochondrial genomes. Slipped-strand mispairing during replication is likely to have generated this novel pattern of tandem repeats. Comparative analysis of tRNA gene families in sequenced Pentatomomorpha and Lygaeoidea species shows that the pattern of nucleotide conservation is markedly higher on the J-strand. Phylogenetic reconstruction based on mitochondrial genomes suggests that Rhyparochromidae is not the sister group to all the remaining Lygaeoidea, and supports the monophyly of Lygaeoidea.
Energy Technology Data Exchange (ETDEWEB)
Das, Sudhansu Ranjan; Kuma, Amaresh [National Institute of Technology, Jamshedpur (India); Dhupal, Debabrata [Veer Surendra Sai University of Technology, Burla (India)
2015-10-15
This experimental investigation deals with dry hard turning of AISI 4140 steel using PVD-TiN coated Al{sub 2}O{sub 3}+TiCN mixed ceramic inserts. The combined effect of cutting parameters (cutting speed, feed and depth of cut) on performance characteristics such as surface roughness and flank wear is explored by Full factorial design (FFD) and analysis of variance (ANOVA). The results show that feed is the principal cutting parameter influencing surface roughness, followed by cutting speed. However, flank wear is affected by the cutting speed and interaction of feed-depth of cut, although depth of cut has not been found statistically significant, but flank wear is an increasing function of depth of cut. Observations are made on the machined surface, and worn tool by Scanning electron microscope (SEM) to establish the process. Abrasion was the major wear mechanism found during hard turning within the studied range. The effect of tool wear on surface roughness was also studied. The experimental data were analyzed to predict the optimal range of surface roughness and flank wear. Based on Response surface methodology (RSM), mathematical models were developed for surface roughness (Ra) and flank wear (VB) with 95% confidence level. Finally, under optimum cutting conditions (obtained by response optimization technique), tool life was evaluated to perform cost analysis for justifying the economic viability of coated ceramic inserts in hard turning. The estimated machining cost per part for TiN coated ceramic was found to be lower (Rs. 12.31) because of higher tool life (51 min), which results in the reduction of downtime and increase in savings.
International Nuclear Information System (INIS)
Das, Sudhansu Ranjan; Kuma, Amaresh; Dhupal, Debabrata
2015-01-01
This experimental investigation deals with dry hard turning of AISI 4140 steel using PVD-TiN coated Al_2O_3+TiCN mixed ceramic inserts. The combined effect of cutting parameters (cutting speed, feed and depth of cut) on performance characteristics such as surface roughness and flank wear is explored by Full factorial design (FFD) and analysis of variance (ANOVA). The results show that feed is the principal cutting parameter influencing surface roughness, followed by cutting speed. However, flank wear is affected by the cutting speed and interaction of feed-depth of cut, although depth of cut has not been found statistically significant, but flank wear is an increasing function of depth of cut. Observations are made on the machined surface, and worn tool by Scanning electron microscope (SEM) to establish the process. Abrasion was the major wear mechanism found during hard turning within the studied range. The effect of tool wear on surface roughness was also studied. The experimental data were analyzed to predict the optimal range of surface roughness and flank wear. Based on Response surface methodology (RSM), mathematical models were developed for surface roughness (Ra) and flank wear (VB) with 95% confidence level. Finally, under optimum cutting conditions (obtained by response optimization technique), tool life was evaluated to perform cost analysis for justifying the economic viability of coated ceramic inserts in hard turning. The estimated machining cost per part for TiN coated ceramic was found to be lower (Rs. 12.31) because of higher tool life (51 min), which results in the reduction of downtime and increase in savings.
Kato, Karin; Matsumura, Yasufumi; Yamamoto, Masaki; Nagao, Miki; Takakura, Shunji; Ichiyama, Satoshi
2017-07-01
In this study, we analyzed the molecular epidemiology of extended-spectrum β-lactamase (ESBL)-producing Proteus mirabilis isolates collected from the central region of Japan. Between 2005 and 2012, 820 clinical P. mirabilis isolates were obtained from ten acute care hospitals in Japan. We characterized ESBL confirmatory test-positive isolates by sequencing the ESBL genes and their flanking regions, detecting plasmid replicons, and performing pulsed-field gel electrophoresis (PFGE). Ninety-six isolates (12%) were positive according to the ESBL confirmatory test; all these isolates possessed bla CTX-M-2 with the same flanking structure of upstream ΔISEcp1 and a downstream region identical to downstream bla KLUA-1 . IncT was the prevalent, and only, replicon found in 63 isolates. PFGE analysis detected eight clusters with more than one isolate, among which three included 56 isolates and six included isolates from multiple hospitals. CTX-M-2-producing P. mirabilis with an identical genetic structure flanking bla CTX-M-2 is dominant in this Japanese region, and there is evidence for the clonal spread of isolates.
Directory of Open Access Journals (Sweden)
Nagib eAhsan
2012-07-01
Full Text Available The mitochondrial pyruvate dehydrogenase complex is regulated by reversible seryl-phosphorylation of the E1α subunit by a dedicated, intrinsic kinase. The phospho-complex is reactivated when dephosphorylated by an intrinsic PP2C-type protein phosphatase. Both the position of the phosphorylated Ser-residue and the sequences of the flanking amino acids are highly conserved. We have used the synthetic peptide-based kinase client assay plus recombinant pyruvate dehydrogenase E1α and E1α-kinase to perform scanning mutagenesis of the residues flanking the site of phosphorylation. Consistent with the results from phylogenetic analysis of the flanking sequences, the direct peptide-based kinase assays tolerated very few changes. Even conservative changes such as Leu, Ile, or Val for Met, or Glu for Asp, gave very marked reductions in phosphorylation. Overall the results indicate that regulation of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation is an extreme example of multiple, interdependent instances of co-evolution.
Directory of Open Access Journals (Sweden)
Madajewski Marek
2017-01-01
Full Text Available This paper presents analysis of flank wear influence on forces in orthogonal turning of 42CrMo4 steel and evaluates capacity of finite element model to provide such force values. Data about magnitude of feed and cutting force were obtained from measurements with force tensiometer in experimental test as well as from finite element analysis of chip formation process in ABAQUS/Explicit software. For studies an insert with complex rake face was selected and flank wear was simulated by grinding operation on its flank face. The aim of grinding inset surface was to obtain even flat wear along cutting edge, which after the measurement could be modeled with CAD program and applied in FE analysis for selected range of wear width. By comparing both sets of force values as function of flank wear in given cutting conditions FEA model was validated and it was established that it can be applied to analyze other physical aspects of machining. Force analysis found that progression of wear causes increase in cutting force magnitude and steep boost to feed force magnitude. Analysis of Fc/Ff force ratio revealed that flank wear has significant impact on resultant force in orthogonal cutting and magnitude of this force components in cutting and feed direction. Surge in force values can result in transfer of substantial loads to machine-tool interface.
Madajewski, Marek; Nowakowski, Zbigniew
2017-01-01
This paper presents analysis of flank wear influence on forces in orthogonal turning of 42CrMo4 steel and evaluates capacity of finite element model to provide such force values. Data about magnitude of feed and cutting force were obtained from measurements with force tensiometer in experimental test as well as from finite element analysis of chip formation process in ABAQUS/Explicit software. For studies an insert with complex rake face was selected and flank wear was simulated by grinding operation on its flank face. The aim of grinding inset surface was to obtain even flat wear along cutting edge, which after the measurement could be modeled with CAD program and applied in FE analysis for selected range of wear width. By comparing both sets of force values as function of flank wear in given cutting conditions FEA model was validated and it was established that it can be applied to analyze other physical aspects of machining. Force analysis found that progression of wear causes increase in cutting force magnitude and steep boost to feed force magnitude. Analysis of Fc/Ff force ratio revealed that flank wear has significant impact on resultant force in orthogonal cutting and magnitude of this force components in cutting and feed direction. Surge in force values can result in transfer of substantial loads to machine-tool interface.
DEFF Research Database (Denmark)
Cao, Hongzhi; Hastie, Alex R.; Cao, Dandan
2014-01-01
mutations; however, none of the current detection methods are comprehensive, and currently available methodologies are incapable of providing sufficient resolution and unambiguous information across complex regions in the human genome. To address these challenges, we applied a high-throughput, cost......-effective genome mapping technology to comprehensively discover genome-wide SVs and characterize complex regions of the YH genome using long single molecules (>150 kb) in a global fashion. RESULTS: Utilizing nanochannel-based genome mapping technology, we obtained 708 insertions/deletions and 17 inversions larger...... fosmid data. Of the remaining 270 SVs, 260 are insertions and 213 overlap known SVs in the Database of Genomic Variants. Overall, 609 out of 666 (90%) variants were supported by experimental orthogonal methods or historical evidence in public databases. At the same time, genome mapping also provides...
Directory of Open Access Journals (Sweden)
Guo Xiang
2008-12-01
Full Text Available Abstract Background Parasites in the genus Theileria cause lymphoproliferative diseases in cattle, resulting in enormous socio-economic losses. The availability of the genome sequences and annotation for T. parva and T. annulata has facilitated the study of parasite biology and their relationship with host cell transformation and tropism. However, the mechanism of transcriptional regulation in this genus, which may be key to understanding fundamental aspects of its parasitology, remains poorly understood. In this study, we analyze the evolution of non-coding sequences in the Theileria genome and identify conserved sequence elements that may be involved in gene regulation of these parasitic species. Results Intergenic regions and introns in Theileria are short, and their length distributions are considerably right-skewed. Intergenic regions flanked by genes in 5'-5' orientation tend to be longer and slightly more AT-rich than those flanked by two stop codons; intergenic regions flanked by genes in 3'-5' orientation have intermediate values of length and AT composition. Intron position is negatively correlated with intron length, and positively correlated with GC content. Using stringent criteria, we identified a set of high-quality orthologous non-coding sequences between T. parva and T. annulata, and determined the distribution of selective constraints across regions, which are shown to be higher close to translation start sites. A positive correlation between constraint and length in both intergenic regions and introns suggests a tight control over length expansion of non-coding regions. Genome-wide searches for functional elements revealed several conserved motifs in intergenic regions of Theileria genomes. Two such motifs are preferentially located within the first 60 base pairs upstream of transcription start sites in T. parva, are preferentially associated with specific protein functional categories, and have significant similarity to know
A genomic region involved in the formation of adhesin fibers in Bacillus cereus biofilms
Directory of Open Access Journals (Sweden)
Joaquín eCaro-Astorga
2015-01-01
Full Text Available Bacillus cereus is a bacterial pathogen that is responsible for many recurrent disease outbreaks due to food contamination. Spores and biofilms are considered the most important reservoirs of B. cereus in contaminated fresh vegetables and fruits. Biofilms are bacterial communities that are difficult to eradicate from biotic and abiotic surfaces because of their stable and extremely strong extracellular matrix. These extracellular matrixes contain exopolysaccharides, proteins, extracellular DNA, and other minor components. Although B. cereus can form biofilms, the bacterial features governing assembly of the protective extracellular matrix are not known. Using the well-studied bacterium B. subtilis as a model, we identified two genomic loci in B. cereus, which encodes two orthologs of the amyloid-like protein TasA of B. subtilis and a SipW signal peptidase. Deletion of this genomic region in B. cereus inhibited biofilm assembly; notably, mutation of the putative signal peptidase SipW caused the same phenotype. However, mutations in tasA or calY did not completely prevent biofilm formation; strains that were mutated for either of these genes formed phenotypically different surface attached biofilms. Electron microscopy studies revealed that TasA polymerizes to form long and abundant fibers on cell surfaces, whereas CalY does not aggregate similarly. Heterologous expression of this amyloid-like cassette in a B. subtilis strain lacking the factors required for the assembly of TasA amyloid-like fibers revealed i the involvement of this B. cereus genomic region in formation of the air-liquid interphase pellicles and ii the intrinsic ability of TasA to form fibers similar to the amyloid-like fibers produced by its B. subtilis ortholog.
Lammers, Fritjof; Gallus, Susanne; Janke, Axel; Nilsson, Maria A
2017-10-01
Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Energy Technology Data Exchange (ETDEWEB)
Kao, F.T.
1994-04-01
The objectives of this grant proposal include (1) development of a chromosome microdissection and PCR-mediated microcloning technology, (2) application of this microtechnology to the construction of region-specific libraries for human genome analysis. During this grant period, the authors have successfully developed this microtechnology and have applied it to the construction of microdissection libraries for the following chromosome regions: a whole chromosome 21 (21E), 2 region-specific libraries for the long arm of chromosome 2, 2q35-q37 (2Q1) and 2q33-q35 (2Q2), and 4 region-specific libraries for the entire short arm of chromosome 2, 2p23-p25 (2P1), 2p21-p23 (2P2), 2p14-p16 (wP3) and 2p11-p13 (2P4). In addition, 20--40 unique sequence microclones have been isolated and characterized for genomic studies. These region-specific libraries and the single-copy microclones from the library have been used as valuable resources for (1) isolating microsatellite probes in linkage analysis to further refine the disease locus; (2) isolating corresponding clones with large inserts, e.g. YAC, BAC, P1, cosmid and phage, to facilitate construction of contigs for high resolution physical mapping; and (3) isolating region-specific cDNA clones for use as candidate genes. These libraries are being deposited in the American Type Culture Collection (ATCC) for general distribution.
Directory of Open Access Journals (Sweden)
Gregory E. Perry
2013-08-01
Full Text Available Resistance to common bacterial blight, caused by Xanthomonas axonopodis pv. phaseoli, in Phaseolus vulgaris is conditioned by several loci on different chromosomes. Previous studies with OAC-Rex, a CBB-resistant, white bean variety of Mesoamerican origin, identified two resistance loci associated with the molecular markers Pv-CTT001 and SU91, on chromosome 4 and 8, respectively. Resistance to CBB is assumed to be derived from an interspecific cross with Phaseolus acutifolius in the pedigree of OAC-Rex. Our current whole genome sequencing effort with OAC-Rex provided the opportunity to compare its genome in the regions associated with CBB resistance with the v1.0 release of the P. vulgaris line G19833, which is a large seeded bean of Andean origin, and (assumed to be CBB susceptible.. In addition, the genomic regions containing SAP6, a marker associated with P. vulgaris-derived CBB-resistance on chromosome 10, were compared. These analyses indicated that gene content was highly conserved between G19833 and OAC-Rex across the regions examined (>80%. However, fifty-nine genes unique to OAC Rex were identified, with resistance gene homologues making up the largest category (10 genes identified. Two unique genes in OAC-Rex located within the SU91 resistance QTL have homology to P. acutifolius ESTs and may be potential sources of CBB resistance. As the genomic sequence assembly of OAC-Rex is completed, we expect that further comparisons between it and the G19833 genome will lead to a greater understanding of CBB resistance in bean.
Kim, Sangkyu; Welsh, David A; Myers, Leann; Cherry, Katie E; Wyckoff, Jennifer; Jazwinski, S Michal
2015-02-28
We have completed a genome-wide linkage scan for healthy aging using data collected from a family study, followed by fine-mapping by association in a separate population, the first such attempt reported. The family cohort consisted of parents of age 90 or above and their children ranging in age from 50 to 80. As a quantitative measure of healthy aging, we used a frailty index, called FI34, based on 34 health and function variables. The linkage scan found a single significant linkage peak on chromosome 12. Using an independent cohort of unrelated nonagenarians, we carried out a fine-scale association mapping of the region suggestive of linkage and identified three sites associated with healthy aging. These healthy-aging sites (HASs) are located in intergenic regions at 12q13-14. HAS-1 has been previously associated with multiple diseases, and an enhancer was recently mapped and experimentally validated within the site. HAS-2 is a previously uncharacterized site possessing genomic features suggestive of enhancer activity. HAS-3 contains features associated with Polycomb repression. The HASs also contain variants associated with exceptional longevity, based on a separate analysis. Our results provide insight into functional genomic networks involving non-coding regulatory elements that are involved in healthy aging and longevity.
Li, Zhengcao; Chen, Jiucheng; Wang, Zhen; Pan, Yuchun; Wang, Qishan; Xu, Ningying; Wang, Zhengguang
2016-12-01
Chinese pigs have been undergoing both natural and artificial selection for thousands of years. Jinhua pigs are of great importance, as they can be a valuable model for exploring the genetic mechanisms linked to meat quality and other traits such as disease resistance, reproduction and production. The purpose of this study was to identify distinctive footprints of selection between Jinhua pigs and other breeds utilizing genome-wide SNP data. Genotyping by genome reducing and sequencing was implemented in order to perform cross-population extended haplotype homozygosity to reveal strong signatures of selection for those economically important traits. This work was performed at a 2% genome level, which comprised 152 006 SNPs genotyped in a total of 517 individuals. Population-specific footprints of selective sweeps were searched for in the genome of Jinhua pigs using six native breeds and three European breeds as reference groups. Several candidate genes associated with meat quality, health and reproduction, such as GH1, CRHR2, TRAF4 and CCK, were found to be overlapping with the significantly positive outliers. Additionally, the results revealed that some genomic regions associated with meat quality, immune response and reproduction in Jinhua pigs have evolved directionally under domestication and subsequent selections. The identified genes and biological pathways in Jinhua pigs showed different selection patterns in comparison with the Chinese and European breeds. © 2016 Stichting International Foundation for Animal Genetics.
Kunrat, S. L.; Schwandner, F. M.
2013-12-01
Gede Volcano (West Java) is part of an andesitic stratovolcano complex consisting of Pangrango in the north-west and Gede in the south-east. The last recorded eruptive activity was a phreatic subvolcanian ash eruption in 1957. Current activity is characterized by episodic swarms at 2-4 km depth, and low-temperature (~160°C) crater degassing in two distinct summit crater fumarolic areas. Hot springs occur in the saddle between the Gede and Pangrango edifice, as well as on the NE flank base. The most recent eruptive events produced pyroclastic material, their flow deposits concentrate toward the NE. A collaborative effort between the Center for Volcanology and Geological Hazard Mitigation (CVGHM), Geological Agency and the Earth Observatory of Singapore (EOS) is since 2010 aimed at upgrading the geophysical and geochemical monitoring network at Gede Volcano. To support the monitoring instrumentation upgrades under way, surveys of soil CO2 degassing have been performed on the flanks of Gede, in circular and radial traverses.The goal was to establish a spatial distribution of flank CO2 fluxes, and to allow smart siting for continuous gas monitoring stations. Crater fluxes were not surveyed, as its low-temperature hydrothermal system is likely prone to large hydraulic changes in this tropical environment, resulting in variable permeability effects that might mask signals from deeper reservoir or conduit degassing. The high precipitation intensity in the mountains of tropical Java pose challenges to this method, since soil gas permeability is largely controlled by soil moisture content. Simultaneous soil moisture measurements were undertaken. The soil CO2 surveys were carried out using a LI-8100A campaign flux chamber instrument (LICOR Biosciences, Lincoln, Nebraska). This instrument has a very precise and highly stable sensor and an atmospheric pressure equilibrator, making it highly sensitive to low fluxes. It is the far superior choice for higher precision low
Directory of Open Access Journals (Sweden)
Bo Pang
Full Text Available Vibrio cholerae is commonly found in estuarine water systems. Toxigenic O1 and O139 V. cholerae strains have caused cholera epidemics and pandemics, whereas the nontoxigenic strains within these serogroups only occasionally lead to disease. To understand the differences in the genome and clonality between the toxigenic and nontoxigenic strains of V. cholerae serogroups O1 and O139, we employed a whole genome PCR scanning (WGPScanning method, an rrn operon-mediated fragment rearrangement analysis and comparative genomic hybridization (CGH to analyze the genome structure of different strains. WGPScanning in conjunction with CGH revealed that the genomic contents of the toxigenic strains were conservative, except for a few indels located mainly in mobile elements. Minor nucleotide variation in orthologous genes appeared to be the major difference between the toxigenic strains. rrn operon-mediated rearrangements were infrequent in El Tor toxigenic strains tested using I-CeuI digested pulsed-field gel electrophoresis (PFGE analysis and PCR analysis based on flanking sequence of rrn operons. Using these methods, we found that the genomic structures of toxigenic El Tor and O139 strains were syntenic. The nontoxigenic strains exhibited more extensive sequence variations, but toxin coregulated pilus positive (TCP+ strains had a similar structure. TCP+ nontoxigenic strains could be subdivided into multiple lineages according to the TCP type, suggesting the existence of complex intermediates in the evolution of toxigenic strains. The data indicate that toxigenic O1 El Tor and O139 strains were derived from a single lineage of intermediates from complex clones in the environment. The nontoxigenic strains with non-El Tor type TCP may yet evolve into new epidemic clones after attaining toxigenic attributes.
Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean
2003-08-01
A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.
Modeling the integration of bacterial rRNA fragments into the human cancer genome.
Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C
2016-03-21
Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.
Forces shaping the fastest evolving regions in the human genome
DEFF Research Database (Denmark)
Pollard, Katherine S; Salama, Sofie R; King, Bryan
2006-01-01
Comparative genomics allow us to search the human genome for segments that were extensively changed in the last approximately 5 million years since divergence from our common ancestor with chimpanzee, but are highly conserved in other species and thus are likely to be functional. We found 202...... genomic elements that are highly conserved in vertebrates but show evidence of significantly accelerated substitution rates in human. These are mostly in non-coding DNA, often near genes associated with transcription and DNA binding. Resequencing confirmed that the five most accelerated elements...... contributed to accelerated evolution of the fastest evolving elements in the human genome....
Links between DNA methylation and nucleosome occupancy in the human genome.
Collings, Clayton K; Anderson, John N
2017-01-01
DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.
Genomic characterization of large heterochromatic gaps in the human genome assembly.
Directory of Open Access Journals (Sweden)
Nicolas Altemose
2014-05-01
Full Text Available The largest gaps in the human genome assembly correspond to multi-megabase heterochromatic regions composed primarily of two related families of tandem repeats, Human Satellites 2 and 3 (HSat2,3. The abundance of repetitive DNA in these regions challenges standard mapping and assembly algorithms, and as a result, the sequence composition and potential biological functions of these regions remain largely unexplored. Furthermore, existing genomic tools designed to predict consensus-based descriptions of repeat families cannot be readily applied to complex satellite repeats such as HSat2,3, which lack a consistent repeat unit reference sequence. Here we present an alignment-free method to characterize complex satellites using whole-genome shotgun read datasets. Utilizing this approach, we classify HSat2,3 sequences into fourteen subfamilies and predict their chromosomal distributions, resulting in a comprehensive satellite reference database to further enable genomic studies of heterochromatic regions. We also identify 1.3 Mb of non-repetitive sequence interspersed with HSat2,3 across 17 unmapped assembly scaffolds, including eight annotated gene predictions. Finally, we apply our satellite reference database to high-throughput sequence data from 396 males to estimate array size variation of the predominant HSat3 array on the Y chromosome, confirming that satellite array sizes can vary between individuals over an order of magnitude (7 to 98 Mb and further demonstrating that array sizes are distributed differently within distinct Y haplogroups. In summary, we present a novel framework for generating initial reference databases for unassembled genomic regions enriched with complex satellite DNA, and we further demonstrate the utility of these reference databases for studying patterns of sequence variation within human populations.
Urasaki, Naoya; Takagi, Hiroki; Natsume, Satoshi; Uemura, Aiko; Taniai, Naoki; Miyagi, Norimichi; Fukushima, Mai; Suzuki, Shouta; Tarora, Kazuhiko; Tamaki, Moritoshi; Sakamoto, Moriaki; Terauchi, Ryohei; Matsumura, Hideo
2017-02-01
Bitter gourd (Momordica charantia) is an important vegetable and medicinal plant in tropical and subtropical regions globally. In this study, the draft genome sequence of a monoecious bitter gourd inbred line, OHB3-1, was analyzed. Through Illumina sequencing and de novo assembly, scaffolds of 285.5 Mb in length were generated, corresponding to ∼84% of the estimated genome size of bitter gourd (339 Mb). In this draft genome sequence, 45,859 protein-coding gene loci were identified, and transposable elements accounted for 15.3% of the whole genome. According to synteny mapping and phylogenetic analysis of conserved genes, bitter gourd was more related to watermelon (Citrullus lanatus) than to cucumber (Cucumis sativus) or melon (C. melo). Using RAD-seq analysis, 1507 marker loci were genotyped in an F2 progeny of two bitter gourd lines, resulting in an improved linkage map, comprising 11 linkage groups. By anchoring RAD tag markers, 255 scaffolds were assigned to the linkage map. Comparative analysis of genome sequences and predicted genes determined that putative trypsin-inhibitor and ribosome-inactivating genes were distinctive in the bitter gourd genome. These genes could characterize the bitter gourd as a medicinal plant. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Compartmentalization of the Coso East Flank geothermal field imaged by 3-D full-tensor MT inversion
Lindsey, Nathaniel J.; Kaven, Joern; Davatzes, Nicholas C.; Newman, Gregory A.
2017-01-01
Previous magnetotelluric (MT) studies of the high-temperature Coso geothermal system in California identified a subvertical feature of low resistivity (2–5 Ohm m) and appreciable lateral extent (>1 km) in the producing zone of the East Flank field. However, these models could not reproduce gross 3-D effects in the recorded data. We perform 3-D full-tensor inversion and retrieve a resistivity model that out-performs previous 2-D and 3-D off-diagonal models in terms of its fit to the complete 3-D MT data set as well as the degree of modelling bias. Inclusion of secondary Zxx and Zyy data components leads to a robust east-dip (60†) to the previously identified conductive East Flank reservoir feature, which correlates strongly with recently mapped surface faults, downhole well temperatures, 3-D seismic reflection data, and local microseismicity. We perform synthetic forward modelling to test the best-fit dip of this conductor using the response at a nearby MT station. We interpret the dipping conductor as a fractured and fluidized compartment, which is structurally controlled by an unmapped blind East Flank fault zone.
Directory of Open Access Journals (Sweden)
Christine Pourcel
Full Text Available Bacteriophage vB_PaeP_PAO1_phiC725A (short name phiC725A was isolated following mitomycin C induction of C7-25, a clinical Pseudomonas aeruginosa strain carrying phiC725A as a prophage. The phiC725A genome sequence shows similarity to F116, a P. aeruginosa podovirus capable of generalized transduction. Likewise, phiC725A is a podovirus with long tail fibers. PhiC725A was able to lysogenize two additional P. aeruginosa strains in which it was maintained both as a prophage and in an episomal state. Investigation by deep sequencing showed that bacterial DNA carried inside phage particles originated predominantly from a 700-800kb region, immediately flanking the attL prophage insertion site, whether the phages were induced from a lysogen or recovered after infection. This indicates that during productive replication, recombination of phage genomes with the bacterial chromosome at the att site occurs occasionally, allowing packaging of adjacent bacterial DNA.
Amyloidosis of the renal pelvis presenting as flank pain
Directory of Open Access Journals (Sweden)
Rachel Shikhman, D.O.
2018-02-01
Full Text Available Amyloidosis is a rare disease defined by accumulation of extracellular amyloid systemically or within a specific organ. Localized amyloidosis of the genitourinary system is extremely rare, with the predominate location being the bladder. The imaging findings are often nonspecific and mimic urothelial carcinoma. We present a 49-year-old woman with a chief complaint of flank pain. A filling defect was discovered on radiological imaging. The defect was subsequently biopsied and proven to be a primary amyloidosis of the renal pelvis. We then review the radiological findings of amyloidosis of the genitourinary system.
Gualtieri, Gustavo; Conner, Joann A; Morishige, Daryl T; Moore, L David; Mullet, John E; Ozias-Akins, Peggy
2006-03-01
Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory.
Directory of Open Access Journals (Sweden)
Ashok Kumar Sahoo
2013-10-01
Full Text Available The paper presents the development of flank wear model in turning hardened EN 24 steel with PVD TiN coated mixed ceramic insert under dry environment. The paper also investigates the effect of process parameter on flank wear (VBc. The experiments have been conducted using three level full factorial design techniques. The machinability model has been developed in terms of cutting speed (v, feed (f and machining time (t as input variable using response surface methodology. The adequacy of model has been checked using correlation coefficients. As the determination coefficient, R2 (98% is higher for the model developed; the better is the response model fits the actual data. In addition, residuals of the normal probability plot lie reasonably close to a straight line showing that the terms mentioned in the model are statistically significant. The predicted flank wear has been found to lie close to the experimental value. This indicates that the developed model can be effectively used to predict the flank wear in the hard turning. Abrasion and diffusion has been found to be the dominant wear mechanism in machining hardened steel from SEM micrographs at highest parametric range. Machining time has been found to be the most significant parameter on flank wear followed by cutting speed and feed as observed from main effect plot and ANOVA study.
Phylogenetic distribution of large-scale genome patchiness
Directory of Open Access Journals (Sweden)
Hackenberg Michael
2008-04-01
Full Text Available Abstract Background The phylogenetic distribution of large-scale genome structure (i.e. mosaic compositional patchiness has been explored mainly by analytical ultracentrifugation of bulk DNA. However, with the availability of large, good-quality chromosome sequences, and the recently developed computational methods to directly analyze patchiness on the genome sequence, an evolutionary comparative analysis can be carried out at the sequence level. Results The local variations in the scaling exponent of the Detrended Fluctuation Analysis are used here to analyze large-scale genome structure and directly uncover the characteristic scales present in genome sequences. Furthermore, through shuffling experiments of selected genome regions, computationally-identified, isochore-like regions were identified as the biological source for the uncovered large-scale genome structure. The phylogenetic distribution of short- and large-scale patchiness was determined in the best-sequenced genome assemblies from eleven eukaryotic genomes: mammals (Homo sapiens, Pan troglodytes, Mus musculus, Rattus norvegicus, and Canis familiaris, birds (Gallus gallus, fishes (Danio rerio, invertebrates (Drosophila melanogaster and Caenorhabditis elegans, plants (Arabidopsis thaliana and yeasts (Saccharomyces cerevisiae. We found large-scale patchiness of genome structure, associated with in silico determined, isochore-like regions, throughout this wide phylogenetic range. Conclusion Large-scale genome structure is detected by directly analyzing DNA sequences in a wide range of eukaryotic chromosome sequences, from human to yeast. In all these genomes, large-scale patchiness can be associated with the isochore-like regions, as directly detected in silico at the sequence level.
Kanhayuwa, Lakkhana; Coutts, Robert H A
2016-01-01
Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
A Thousand Fly Genomes: An Expanded Drosophila Genome Nexus.
Lack, Justin B; Lange, Jeremy D; Tang, Alison D; Corbett-Detig, Russell B; Pool, John E
2016-12-01
The Drosophila Genome Nexus is a population genomic resource that provides D. melanogaster genomes from multiple sources. To facilitate comparisons across data sets, genomes are aligned using a common reference alignment pipeline which involves two rounds of mapping. Regions of residual heterozygosity, identity-by-descent, and recent population admixture are annotated to enable data filtering based on the user's needs. Here, we present a significant expansion of the Drosophila Genome Nexus, which brings the current data object to a total of 1,121 wild-derived genomes. New additions include 305 previously unpublished genomes from inbred lines representing six population samples in Egypt, Ethiopia, France, and South Africa, along with another 193 genomes added from recently-published data sets. We also provide an aligned D. simulans genome to facilitate divergence comparisons. This improved resource will broaden the range of population genomic questions that can addressed from multi-population allele frequencies and haplotypes in this model species. The larger set of genomes will also enhance the discovery of functionally relevant natural variation that exists within and between populations. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Jiabing Ji
Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.
The bonobo genome compared with the chimpanzee and human genomes
Prüfer, Kay; Munch, Kasper; Hellmann, Ines; Akagi, Keiko; Miller, Jason R.; Walenz, Brian; Koren, Sergey; Sutton, Granger; Kodira, Chinnappa; Winer, Roger; Knight, James R.; Mullikin, James C.; Meader, Stephen J.; Ponting, Chris P.; Lunter, Gerton; Higashino, Saneyuki; Hobolth, Asger; Dutheil, Julien; Karakoç, Emre; Alkan, Can; Sajjadian, Saba; Catacchio, Claudia Rita; Ventura, Mario; Marques-Bonet, Tomas; Eichler, Evan E.; André, Claudine; Atencia, Rebeca; Mugisha, Lawrence; Junhold, Jörg; Patterson, Nick; Siebauer, Michael; Good, Jeffrey M.; Fischer, Anne; Ptak, Susan E.; Lachmann, Michael; Symer, David E.; Mailund, Thomas; Schierup, Mikkel H.; Andrés, Aida M.; Kelso, Janet; Pääbo, Svante
2012-01-01
Two African apes are the closest living relatives of humans: the chimpanzee (Pan troglodytes) and the bonobo (Pan paniscus). Although they are similar in many respects, bonobos and chimpanzees differ strikingly in key social and sexual behaviours1–4, and for some of these traits they show more similarity with humans than with each other. Here we report the sequencing and assembly of the bonobo genome to study its evolutionary relationship with the chimpanzee and human genomes. We find that more than three per cent of the human genome is more closely related to either the bonobo or the chimpanzee genome than these are to each other. These regions allow various aspects of the ancestry of the two ape species to be reconstructed. In addition, many of the regions that overlap genes may eventually help us understand the genetic basis of phenotypes that humans share with one of the two apes to the exclusion of the other. PMID:22722832
Deep whole-genome sequencing of 90 Han Chinese genomes.
Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen
2017-09-01
Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000
Civaň, Peter; Foster, Peter G; Embley, Martin T; Séneca, Ana; Cox, Cymon J
2014-04-01
Despite the significance of the relationships between embryophytes and their charophyte algal ancestors in deciphering the origin and evolutionary success of land plants, few chloroplast genomes of the charophyte algae have been reconstructed to date. Here, we present new data for three chloroplast genomes of the freshwater charophytes Klebsormidium flaccidum (Klebsormidiophyceae), Mesotaenium endlicherianum (Zygnematophyceae), and Roya anglica (Zygnematophyceae). The chloroplast genome of Klebsormidium has a quadripartite organization with exceptionally large inverted repeat (IR) regions and, uniquely among streptophytes, has lost the rrn5 and rrn4.5 genes from the ribosomal RNA (rRNA) gene cluster operon. The chloroplast genome of Roya differs from other zygnematophycean chloroplasts, including the newly sequenced Mesotaenium, by having a quadripartite structure that is typical of other streptophytes. On the basis of the improbability of the novel gain of IR regions, we infer that the quadripartite structure has likely been lost independently in at least three zygnematophycean lineages, although the absence of the usual rRNA operonic synteny in the IR regions of Roya may indicate their de novo origin. Significantly, all zygnematophycean chloroplast genomes have undergone substantial genomic rearrangement, which may be the result of ancient retroelement activity evidenced by the presence of integrase-like and reverse transcriptase-like elements in the Roya chloroplast genome. Our results corroborate the close phylogenetic relationship between Zygnematophyceae and land plants and identify 89 protein-coding genes and 22 introns present in the chloroplast genome at the time of the evolutionary transition of plants to land, all of which can be found in the chloroplast genomes of extant charophytes.
Genomic rearrangements of PTEN in prostate cancer
Directory of Open Access Journals (Sweden)
Sopheap ePhin
2013-09-01
Full Text Available The phosphatase and tensin homolog gene on chromosome 10q23.3 (PTEN is a negative regulator of the PIK3/Akt survival pathway and is the most frequently deleted tumor suppressor gene in prostate cancer. Monoallelic loss of PTEN is present in up to 60% of localized prostate cancers and complete loss of PTEN in prostate cancer is linked to metastasis and androgen independent progression. Studies on the genomic status of PTEN in prostate cancer initially used a two-color fluorescence in-situ hybridization (FISH assay for PTEN copy number detection in formalin fixed paraffin embedded tissue preparations. More recently, a four-color FISH assay containing two additional control probes flanking the PTEN locus with a lower false-positive rate was reported. Combined with the detection of other critical genomic biomarkers for prostate cancer such as ERG, AR, and MYC, the evaluation of PTEN genomic status has proven to be invaluable for patient stratification and management. Although less frequent than allelic deletions, point mutations in the gene and epigenetic silencing are also known to contribute to loss of PTEN function, and ultimately to prostate cancer initiation. Overall, it is clear that PTEN is a powerful biomarker for prostate cancer. Used as a companion diagnostic for emerging therapeutic drugs, FISH analysis of PTEN is promisingly moving human prostate cancer closer to more effective cancer management and therapies.
Oyebola, Kolapo M; Idowu, Emmanuel T; Olukosi, Yetunde A; Awolola, Taiwo S; Amambua-Ngwa, Alfred
2017-06-29
The burden of falciparum malaria is especially high in sub-Saharan Africa. Differences in pressure from host immunity and antimalarial drugs lead to adaptive changes responsible for high level of genetic variations within and between the parasite populations. Population-specific genetic studies to survey for genes under positive or balancing selection resulting from drug pressure or host immunity will allow for refinement of interventions. We performed a pooled sequencing (pool-seq) of the genomes of 100 Plasmodium falciparum isolates from Nigeria. We explored allele-frequency based neutrality test (Tajima's D) and integrated haplotype score (iHS) to identify genes under selection. Fourteen shared iHS regions that had at least 2 SNPs with a score > 2.5 were identified. These regions code for genes that were likely to have been under strong directional selection. Two of these genes were the chloroquine resistance transporter (CRT) on chromosome 7 and the multidrug resistance 1 (MDR1) on chromosome 5. There was a weak signature of selection in the dihydrofolate reductase (DHFR) gene on chromosome 4 and MDR5 genes on chromosome 13, with only 2 and 3 SNPs respectively identified within the iHS window. We observed strong selection pressure attributable to continued chloroquine and sulfadoxine-pyrimethamine use despite their official proscription for the treatment of uncomplicated malaria. There was also a major selective sweep on chromosome 6 which had 32 SNPs within the shared iHS region. Tajima's D of circumsporozoite protein (CSP), erythrocyte-binding antigen (EBA-175), merozoite surface proteins - MSP3 and MSP7, merozoite surface protein duffy binding-like (MSPDBL2) and serine repeat antigen (SERA-5) were 1.38, 1.29, 0.73, 0.84 and 0.21, respectively. We have demonstrated the use of pool-seq to understand genomic patterns of selection and variability in P. falciparum from Nigeria, which bears the highest burden of infections. This investigation identified known
Ceapa, Corina; Davids, Mark; Ritari, Jarmo; Lambert, Jolanda; Wels, Michiel; Douillard, François P; Smokvina, Tamara; de Vos, Willem M; Knol, Jan; Kleerebezem, Michiel
2016-07-02
Lactobacillus rhamnosus is a diverse Gram-positive species with strains isolated from different ecological niches. Here, we report the genome sequence analysis of 40 diverse strains of L. rhamnosus and their genomic comparison, with a focus on the variable genome. Genomic comparison of 40 L. rhamnosus strains discriminated the conserved genes (core genome) and regions of plasticity involving frequent rearrangements and horizontal transfer (variome). The L. rhamnosus core genome encompasses 2,164 genes, out of 4,711 genes in total (the pan-genome). The accessory genome is dominated by genes encoding carbohydrate transport and metabolism, extracellular polysaccharides (EPS) biosynthesis, bacteriocin production, pili production, the cas system, and the associated clustered regularly interspaced short palindromic repeat (CRISPR) loci, and more than 100 transporter functions and mobile genetic elements like phages, plasmid genes, and transposons. A clade distribution based on amino acid differences between core (shared) proteins matched with the clade distribution obtained from the presence-absence of variable genes. The phylogenetic and variome tree overlap indicated that frequent events of gene acquisition and loss dominated the evolutionary segregation of the strains within this species, which is paralleled by evolutionary diversification of core gene functions. The CRISPR-Cas system could have contributed to this evolutionary segregation. Lactobacillus rhamnosus strains contain the genetic and metabolic machinery with strain-specific gene functions required to adapt to a large range of environments. A remarkable congruency of the evolutionary relatedness of the strains' core and variome functions, possibly favoring interspecies genetic exchanges, underlines the importance of gene-acquisition and loss within the L. rhamnosus strain diversification. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Yin-Ping Zhang
Full Text Available Human height is a highly heritable trait considered as an important factor for health. There has been limited success in identifying the genetic factors underlying height variation. We aim to identify sequence variants associated with adult height by a genome-wide association study of copy number variants (CNVs in Chinese.Genome-wide CNV association analyses were conducted in 1,625 unrelated Chinese adults and sex specific subgroup for height variation, respectively. Height was measured with a stadiometer. Affymetrix SNP6.0 genotyping platform was used to identify copy number polymorphisms (CNPs. We constructed a genomic map containing 1,009 CNPs in Chinese individuals and performed a genome-wide association study of CNPs with height.We detected 10 significant association signals for height (p<0.05 in the whole population, 9 and 11 association signals for Chinese female and male population, respectively. A copy number polymorphism (CNP12587, chr18:54081842-54086942, p = 2.41 × 10(-4 was found to be significantly associated with height variation in Chinese females even after strict Bonferroni correction (p = 0.048. Confirmatory real time PCR experiments lent further support for CNV validation. Compared to female subjects with two copies of the CNP, carriers of three copies had an average of 8.1% decrease in height. An important candidate gene, ubiquitin-protein ligase NEDD4-like (NEDD4L, was detected at this region, which plays important roles in bone metabolism by binding to bone formation regulators.Our findings suggest the important genetic variants underlying height variation in Chinese.
VOLCANIC TSUNAMI GENERATING SOURCE MECHANISMS IN THE EASTERN CARIBBEAN REGION
Directory of Open Access Journals (Sweden)
George Pararas-Carayannis
2004-01-01
Full Text Available Earthquakes, volcanic eruptions, volcanic island flank failures and underwater slides have generated numerous destructive tsunamis in the Caribbean region. Convergent, compressional and collisional tectonic activity caused primarily from the eastward movement of the Caribbean Plate in relation to the North American, Atlantic and South American Plates, is responsible for zones of subduction in the region, the formation of island arcs and the evolution of particular volcanic centers on the overlying plate. The inter-plate tectonic interaction and deformation along these marginal boundaries result in moderate seismic and volcanic events that can generate tsunamis by a number of different mechanisms. The active geo-dynamic processes have created the Lesser Antilles, an arc of small islands with volcanoes characterized by both effusive and explosive activity. Eruption mechanisms of these Caribbean volcanoes are complex and often anomalous. Collapses of lava domes often precede major eruptions, which may vary in intensity from Strombolian to Plinian. Locally catastrophic, short-period tsunami-like waves can be generated directly by lateral, direct or channelized volcanic blast episodes, or in combination with collateral air pressure perturbations, nuéss ardentes, pyroclastic flows, lahars, or cascading debris avalanches. Submarine volcanic caldera collapses can also generate locally destructive tsunami waves. Volcanoes in the Eastern Caribbean Region have unstable flanks. Destructive local tsunamis may be generated from aerial and submarine volcanic edifice mass edifice flank failures, which may be triggered by volcanic episodes, lava dome collapses, or simply by gravitational instabilities. The present report evaluates volcanic mechanisms, resulting flank failure processes and their potential for tsunami generation. More specifically, the report evaluates recent volcanic eruption mechanisms of the Soufriere Hills volcano on Montserrat, of Mt. Pel
Kempter, K.A.; Rowe, G.L.
2000-01-01
The Active Crater at Rincon de la Vieja volcano, Costa Rica, reaches an elevation of 1750 m and contains a warm, hyper-acidic crater lake that probably formed soon after the eruption of the Rio Blanco tephra deposit approximately 3500 years before present. The Active Crater is buttressed by volcanic ridges and older craters on all sides except the north, which dips steeply toward the Caribbean coastal plains. Acidic, above-ambient-temperature streams are found along the Active Crater's north flank at elevations between 800 and 1000 m. A geochemical survey of thermal and non-thermal waters at Rincon de la Vieja was done in 1989 to determine whether hyper-acidic fluids are leaking from the Active Crater through the north flank, affecting the composition of north-flank streams. Results of the water-chemistry survey reveal that three distinct thermal waters are found on the flanks of Rincon de la Vieja volcano: acid chloride-sulfate (ACS), acid sulfate (AS), and neutral chloride (NC) waters. The most extreme ACS water was collected from the crater lake that fills the Active Crater. Chemical analyses of the lake water reveal a hyper-acidic (pH ~ 0) chloride-sulfate brine with elevated concentrations of calcium, magnesium, aluminum, iron, manganese, copper, zinc, fluorine, and boron. The composition of the brine reflects the combined effects of magmatic degassing from a shallow magma body beneath the Active Crater, dissolution of andesitic volcanic rock, and evaporative concentration of dissolved constituents at above-ambient temperatures. Similar cation and anion enrichments are found in the above-ambient-temperature streams draining the north flank of the Active Crater. The pH of north-flank thermal waters range from 3.6 to 4.1 and chloride:sulfate ratios (1.2-1.4) that are a factor of two greater than that of the lake brine (0.60). The waters have an ACS composition that is quite different from the AS and NC thermal waters that occur along the southern flank of Rincon
Tong, Chaobo; Guo, Baocheng; He, Shunping
2009-01-01
Background Short and long interspersed elements (SINEs and LINEs, respectively), two types of retroposons, are active in shaping the architecture of genomes and powerful tools for studies of phylogeny and population biology. Here we developed special protocol to apply biotin-streptavidin bead system into isolation of interspersed repeated sequences rapidly and efficiently, in which SINEs and LINEs were captured directly from digested genomic DNA by hybridization to bead-probe complex in solution instead of traditional strategy including genomic library construction and screening. Results A new couple of SINEs and LINEs that shared an almost identical 3'tail was isolated and characterized in silver carp and bighead carp of two closely related species. These SINEs (34 members), designated HAmo SINE family, were little divergent in sequence and flanked by obvious TSD indicated that HAmo SINE was very young family. The copy numbers of this family was estimated to 2 × 105 and 1.7 × 105 per haploid genome by Real-Time qPCR, respectively. The LINEs, identified as the homologs of LINE2 in other fishes, had a conserved primary sequence and secondary structures of the 3'tail region that was almost identical to that of HAmo SINE. These evidences suggest that HAmo SINEs are active and amplified recently utilizing the enzymatic machinery for retroposition of HAmoL2 through the recognition of higher-order structures of the conserved 42-tail region. We analyzed the possible structures of HAmo SINE that lead to successful amplification in genome and then deduced that HAmo SINE, SmaI SINE and FokI SINE that were similar in sequence each other, were probably generated independently and created by LINE family within the same lineage of a LINE phylogeny in the genomes of different hosts. Conclusion The presented results show the advantage of the novel method for retroposons isolation and a pair of young SINE family and its partner LINE family in two carp fishes, which strengthened
Directory of Open Access Journals (Sweden)
Guo Baocheng
2009-02-01
Full Text Available Abstract Background Short and long interspersed elements (SINEs and LINEs, respectively, two types of retroposons, are active in shaping the architecture of genomes and powerful tools for studies of phylogeny and population biology. Here we developed special protocol to apply biotin-streptavidin bead system into isolation of interspersed repeated sequences rapidly and efficiently, in which SINEs and LINEs were captured directly from digested genomic DNA by hybridization to bead-probe complex in solution instead of traditional strategy including genomic library construction and screening. Results A new couple of SINEs and LINEs that shared an almost identical 3'tail was isolated and characterized in silver carp and bighead carp of two closely related species. These SINEs (34 members, designated HAmo SINE family, were little divergent in sequence and flanked by obvious TSD indicated that HAmo SINE was very young family. The copy numbers of this family was estimated to 2 × 105 and 1.7 × 105 per haploid genome by Real-Time qPCR, respectively. The LINEs, identified as the homologs of LINE2 in other fishes, had a conserved primary sequence and secondary structures of the 3'tail region that was almost identical to that of HAmo SINE. These evidences suggest that HAmo SINEs are active and amplified recently utilizing the enzymatic machinery for retroposition of HAmoL2 through the recognition of higher-order structures of the conserved 42-tail region. We analyzed the possible structures of HAmo SINE that lead to successful amplification in genome and then deduced that HAmo SINE, SmaI SINE and FokI SINE that were similar in sequence each other, were probably generated independently and created by LINE family within the same lineage of a LINE phylogeny in the genomes of different hosts. Conclusion The presented results show the advantage of the novel method for retroposons isolation and a pair of young SINE family and its partner LINE family in two carp
Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A
2016-01-01
The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.
Southward flow on the western flank of the Florida Current
Soloviev, Alexander V.; Hirons, Amy; Maingot, Christopher; Dean, Cayla W.; Dodge, Richard E.; Yankovsky, Alexander E.; Wood, Jon; Weisberg, Robert H.; Luther, Mark E.; McCreary, Julian P.
2017-07-01
A suite of long-term in situ measurements in the Straits of Florida, including the ADCP bottom moorings at an 11-m isobath and 244-m isobath (Miami Terrace) and several ADCP ship transects, have revealed a remarkable feature of the ocean circulation - southward flow on the western, coastal flank of the Florida Current. We have observed three forms of the southward flow - a seasonally varying coastal countercurrent, an undercurrent jet attached to the Florida shelf, and an intermittent undercurrent on the Miami Terrace. According to a 13-year monthly climatology obtained from the near-shore mooring, the coastal countercurrent is a persistent feature from October through January. The southward flow in the form of an undercurrent jet attached to the continental slope was observed during five ship transects from April through September but was not observed during three transects in February, March, and November. This undercurrent jet is well mixed due to strong shear at its top associated with the northward direction of the surface flow (Florida Current) and friction at the bottom. At the same time, no statistically significant seasonal cycle has been observed in the undercurrent flow on the Miami Terrace. Theoretical considerations suggest that several processes could drive the southward current, including interaction between the Florida Current and the shelf, as well as forcing that is independent of the Florida Current. The exact nature of the southward flow on the western flank of the Florida Current is, however, unknown.
Characterization of the past and current duplication activities in the human 22q11.2 region
Directory of Open Access Journals (Sweden)
Morrow Bernice
2011-01-01
Full Text Available Abstract Background Segmental duplications (SDs on 22q11.2 (LCR22, serve as substrates for meiotic non-allelic homologous recombination (NAHR events resulting in several clinically significant genomic disorders. Results To understand the duplication activity leading to the complicated SD structure of this region, we have applied the A-Bruijn graph algorithm to decompose the 22q11.2 SDs to 523 fundamental duplication sequences, termed subunits. Cross-species syntenic analysis of primate genomes demonstrates that many of these LCR22 subunits emerged very recently, especially those implicated in human genomic disorders. Some subunits have expanded more actively than others, and young Alu SINEs, are associated much more frequently with duplicated sequences that have undergone active expansion, confirming their role in mediating recombination events. Many copy number variations (CNVs exist on 22q11.2, some flanked by SDs. Interestingly, two chromosome breakpoints for 13 CNVs (mean length 65 kb are located in paralogous subunits, providing direct evidence that SD subunits could contribute to CNV formation. Sequence analysis of PACs or BACs identified extra CNVs, specifically, 10 insertions and 18 deletions within 22q11.2; four were more than 10 kb in size and most contained young AluYs at their breakpoints. Conclusions Our study indicates that AluYs are implicated in the past and current duplication events, and moreover suggests that DNA rearrangements in 22q11.2 genomic disorders perhaps do not occur randomly but involve both actively expanded duplication subunits and Alu elements.
Directory of Open Access Journals (Sweden)
Len J Wade
Full Text Available The rapid progress in rice genotyping must be matched by advances in phenotyping. A better understanding of genetic variation in rice for drought response, root traits, and practical methods for studying them are needed. In this study, the OryzaSNP set (20 diverse genotypes that have been genotyped for SNP markers was phenotyped in a range of field and container studies to study the diversity of rice root growth and response to drought. Of the root traits measured across more than 20 root experiments, root dry weight showed the most stable genotypic performance across studies. The environment (E component had the strongest effect on yield and root traits. We identified genomic regions correlated with root dry weight, percent deep roots, maximum root depth, and grain yield based on a correlation analysis with the phenotypes and aus, indica, or japonica introgression regions using the SNP data. Two genomic regions were identified as hot spots in which root traits and grain yield were co-located; on chromosome 1 (39.7-40.7 Mb and on chromosome 8 (20.3-21.9 Mb. Across experiments, the soil type/ growth medium showed more correlations with plant growth than the container dimensions. Although the correlations among studies and genetic co-location of root traits from a range of study systems points to their potential utility to represent responses in field studies, the best correlations were observed when the two setups had some similar properties. Due to the co-location of the identified genomic regions (from introgression block analysis with QTL for a number of previously reported root and drought traits, these regions are good candidates for detailed characterization to contribute to understanding rice improvement for response to drought. This study also highlights the utility of characterizing a small set of 20 genotypes for root growth, drought response, and related genomic regions.
Ou, Hong-Yu; He, Xinyi; Harrison, Ewan M.; Kulasekara, Bridget R.; Thani, Ali Bin; Kadioglu, Aras; Lory, Stephen; Hinton, Jay C. D.; Barer, Michael R.; Rajakumar, Kumar
2007-01-01
MobilomeFINDER (http://mml.sjtu.edu.cn/MobilomeFINDER) is an interactive online tool that facilitates bacterial genomic island or ‘mobile genome’ (mobilome) discovery; it integrates the ArrayOme and tRNAcc software packages. ArrayOme utilizes a microarray-derived comparative genomic hybridization input data set to generate ‘inferred contigs’ produced by merging adjacent genes classified as ‘present’. Collectively these ‘fragments’ represent a hypothetical ‘microarray-visualized genome (MVG)’. ArrayOme permits recognition of discordances between physical genome and MVG sizes, thereby enabling identification of strains rich in microarray-elusive novel genes. Individual tRNAcc tools facilitate automated identification of genomic islands by comparative analysis of the contents and contexts of tRNA sites and other integration hotspots in closely related sequenced genomes. Accessory tools facilitate design of hotspot-flanking primers for in silico and/or wet-science-based interrogation of cognate loci in unsequenced strains and analysis of islands for features suggestive of foreign origins; island-specific and genome-contextual features are tabulated and represented in schematic and graphical forms. To date we have used MobilomeFINDER to analyse several Enterobacteriaceae, Pseudomonas aeruginosa and Streptococcus suis genomes. MobilomeFINDER enables high-throughput island identification and characterization through increased exploitation of emerging sequence data and PCR-based profiling of unsequenced test strains; subsequent targeted yeast recombination-based capture permits full-length sequencing and detailed functional studies of novel genomic islands. PMID:17537813
Unenhanced helical CT in the investigation of acute flank pain
International Nuclear Information System (INIS)
Colistro, Robert; Torreggiani, William C.; Lyburn, Iain D.; Harris, Alison C.; Al-Nakshabandi, Nizar A.; Nicolaou, Savvas; Munk, Peter L.
2002-01-01
Unenhanced helical CT has emerged as the imaging technique of choice for the investigation of patients presenting with acute flank pain and suspected nephroureteric stone disease. There are several signs identifiable on unenhanced CT that support a diagnosis of stone disease. However, there are many pitfalls, that may confound a correct diagnosis. Some of the common pitfalls, together with methods to avoid such occurrences, will be discussed. A review of some of the common alternative diagnoses that may mimic the symptoms of nephroureteric stone disease is illustrated. Colistro, R. et al (2002)
Naparstek, Sharon; Safadi, Ziad; Lichtenstein-Vidne, Limor; Henik, Avishai
2015-01-01
The current research examined whether peripherally presented numerical information can affect the speed of number processing. In 2 experiments, participants were presented with a target matrix flanked by a distractor matrix and were asked to perform a comparative judgment (i.e., decide whether the target was larger or smaller than the reference…
Genome-wide expression profiling of complex regional pain syndrome.
Directory of Open Access Journals (Sweden)
Eun-Heui Jin
Full Text Available Complex regional pain syndrome (CRPS is a chronic, progressive, and devastating pain syndrome characterized by spontaneous pain, hyperalgesia, allodynia, altered skin temperature, and motor dysfunction. Although previous gene expression profiling studies have been conducted in animal pain models, there genome-wide expression profiling in the whole blood of CRPS patients has not been reported yet. Here, we successfully identified certain pain-related genes through genome-wide expression profiling in the blood from CRPS patients. We found that 80 genes were differentially expressed between 4 CRPS patients (2 CRPS I and 2 CRPS II and 5 controls (cut-off value: 1.5-fold change and p<0.05. Most of those genes were associated with signal transduction, developmental processes, cell structure and motility, and immunity and defense. The expression levels of major histocompatibility complex class I A subtype (HLA-A29.1, matrix metalloproteinase 9 (MMP9, alanine aminopeptidase N (ANPEP, l-histidine decarboxylase (HDC, granulocyte colony-stimulating factor 3 receptor (G-CSF3R, and signal transducer and activator of transcription 3 (STAT3 genes selected from the microarray were confirmed in 24 CRPS patients and 18 controls by quantitative reverse transcription-polymerase chain reaction (qRT-PCR. We focused on the MMP9 gene that, by qRT-PCR, showed a statistically significant difference in expression in CRPS patients compared to controls with the highest relative fold change (4.0±1.23 times and p = 1.4×10(-4. The up-regulation of MMP9 gene in the blood may be related to the pain progression in CRPS patients. Our findings, which offer a valuable contribution to the understanding of the differential gene expression in CRPS may help in the understanding of the pathophysiology of CRPS pain progression.
Kuleshov, K V; Markelov, M L; Dedkov, V G; Vodop'ianov, A S; Kermanov, A V; Pisanov, R V; Kruglikov, V D; Mazrukho, A B; Maleev, V V; Shipulin, G A
2013-01-01
Determination of origin of 2 Vibrio cholerae strains isolated on the territory of Rostov region by using full genome sequencing data. Toxigenic strain 2011 EL- 301 V. cholerae 01 El Tor Inaba No. 301 (ctxAB+, tcpA+) and nontoxigenic strain V. cholerae O1 Ogawa P- 18785 (ctxAB-, tcpA+) were studied. Sequencing was carried out on the MiSeq platform. Phylogenetic analysis of the genomes obtained was carried out based on comparison of conservative part of the studied and 54 previously sequenced genomes. 2011EL-301 strain genome was presented by 164 contigs with an average coverage of 100, N50 parameter was 132 kb, for strain P- 18785 - 159 contigs with a coverage of69, N50 - 83 kb. The contigs obtained for strain 2011 EL-301 were deposited in DDBJ/EMBL/GenBank databases with access code AJFN02000000, for strain P-18785 - ANHS00000000. 716 protein-coding orthologous genes were detected. Based on phylogenetic analysis strain P- 18785 belongs to PG-1 subgroup (a group of predecessor strains of the 7th pandemic). Strain 2011EL-301 belongs to groups of strains of the 7th pandemic and is included into the cluster with later isolates that are associated with cases of cholera in South Africa and cases of import of cholera to the USA from Pakistan. The data obtained allows to establish phylogenetic connections with V cholerae strains isolated earlier.
Recurrent DNA inversion rearrangements in the human genome
DEFF Research Database (Denmark)
Flores, Margarita; Morales, Lucía; Gonzaga-Jauregui, Claudia
2007-01-01
Several lines of evidence suggest that reiterated sequences in the human genome are targets for nonallelic homologous recombination (NAHR), which facilitates genomic rearrangements. We have used a PCR-based approach to identify breakpoint regions of rearranged structures in the human genome...... to human genomic variation is discussed........ In particular, we have identified intrachromosomal identical repeats that are located in reverse orientation, which may lead to chromosomal inversions. A bioinformatic workflow pathway to select appropriate regions for analysis was developed. Three such regions overlapping with known human genes, located...
Fu, Jianmin; Liu, Huimin; Hu, Jingjing; Liang, Yuqin; Liang, Jinjun; Wuyun, Tana; Tan, Xiaofeng
2016-01-01
Diospyros is the largest genus in Ebenaceae, comprising more than 500 species with remarkable economic value, especially Diospyros kaki Thunb., which has traditionally been an important food resource in China, Korea, and Japan. Complete chloroplast (cp) genomes from D. kaki, D. lotus L., D. oleifera Cheng., D. glaucifolia Metc., and Diospyros 'Jinzaoshi' were sequenced using Illumina sequencing technology. This is the first cp genome reported in Ebenaceae. The cp genome sequences of Diospyros ranged from 157,300 to 157,784 bp in length, presenting a typical quadripartite structure with two inverted repeats each separated by one large and one small single-copy region. For each cp genome, 134 genes were annotated, including 80 protein-coding, 31 tRNA, and 4 rRNA unique genes. In all, 179 repeats and 283 single sequence repeats were identified. Four hypervariable regions, namely, intergenic region of trnQ_rps16, trnV_ndhC, and psbD_trnT, and intron of ndhA, were identified in the Diospyros genomes. Phylogenetic analyses based on the whole cp genome, protein-coding, and intergenic and intron sequences indicated that D. oleifera is closely related to D. kaki and could be used as a model plant for future research on D. kaki; to our knowledge, this is proposed for the first time. Further, these analyses together with two large deletions (301 and 140 bp) in the cp genome of D. 'Jinzaoshi', support its placement as a new species in Diospyros. Both maximum parsimony and likelihood analyses for 19 taxa indicated the basal position of Ericales in asterids and suggested that Ebenaceae is monophyletic in Ericales.
Directory of Open Access Journals (Sweden)
Jianmin Fu
Full Text Available Diospyros is the largest genus in Ebenaceae, comprising more than 500 species with remarkable economic value, especially Diospyros kaki Thunb., which has traditionally been an important food resource in China, Korea, and Japan. Complete chloroplast (cp genomes from D. kaki, D. lotus L., D. oleifera Cheng., D. glaucifolia Metc., and Diospyros 'Jinzaoshi' were sequenced using Illumina sequencing technology. This is the first cp genome reported in Ebenaceae. The cp genome sequences of Diospyros ranged from 157,300 to 157,784 bp in length, presenting a typical quadripartite structure with two inverted repeats each separated by one large and one small single-copy region. For each cp genome, 134 genes were annotated, including 80 protein-coding, 31 tRNA, and 4 rRNA unique genes. In all, 179 repeats and 283 single sequence repeats were identified. Four hypervariable regions, namely, intergenic region of trnQ_rps16, trnV_ndhC, and psbD_trnT, and intron of ndhA, were identified in the Diospyros genomes. Phylogenetic analyses based on the whole cp genome, protein-coding, and intergenic and intron sequences indicated that D. oleifera is closely related to D. kaki and could be used as a model plant for future research on D. kaki; to our knowledge, this is proposed for the first time. Further, these analyses together with two large deletions (301 and 140 bp in the cp genome of D. 'Jinzaoshi', support its placement as a new species in Diospyros. Both maximum parsimony and likelihood analyses for 19 taxa indicated the basal position of Ericales in asterids and suggested that Ebenaceae is monophyletic in Ericales.
Directory of Open Access Journals (Sweden)
Shade Larry L
2006-06-01
Full Text Available Abstract Background Approximately 11 Mb of finished high quality genomic sequences were sampled from cattle, dog and human to estimate genomic divergences and their regional variation among these lineages. Results Optimal three-way multi-species global sequence alignments for 84 cattle clones or loci (each >50 kb of genomic sequence were constructed using the human and dog genome assemblies as references. Genomic divergences and substitution rates were examined for each clone and for various sequence classes under different functional constraints. Analysis of these alignments revealed that the overall genomic divergences are relatively constant (0.32–0.37 change/site for pairwise comparisons among cattle, dog and human; however substitution rates vary across genomic regions and among different sequence classes. A neutral mutation rate (2.0–2.2 × 10(-9 change/site/year was derived from ancestral repetitive sequences, whereas the substitution rate in coding sequences (1.1 × 10(-9 change/site/year was approximately half of the overall rate (1.9–2.0 × 10(-9 change/site/year. Relative rate tests also indicated that cattle have a significantly faster rate of substitution as compared to dog and that this difference is about 6%. Conclusion This analysis provides a large-scale and unbiased assessment of genomic divergences and regional variation of substitution rates among cattle, dog and human. It is expected that these data will serve as a baseline for future mammalian molecular evolution studies.
Chung, Dongjun; Kuan, Pei Fen; Li, Bo; Sanalkumar, Rajendran; Liang, Kun; Bresnick, Emery H; Dewey, Colin; Keleş, Sündüz
2011-07-01
Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) is rapidly replacing chromatin immunoprecipitation combined with genome-wide tiling array analysis (ChIP-chip) as the preferred approach for mapping transcription-factor binding sites and chromatin modifications. The state of the art for analyzing ChIP-seq data relies on using only reads that map uniquely to a relevant reference genome (uni-reads). This can lead to the omission of up to 30% of alignable reads. We describe a general approach for utilizing reads that map to multiple locations on the reference genome (multi-reads). Our approach is based on allocating multi-reads as fractional counts using a weighted alignment scheme. Using human STAT1 and mouse GATA1 ChIP-seq datasets, we illustrate that incorporation of multi-reads significantly increases sequencing depths, leads to detection of novel peaks that are not otherwise identifiable with uni-reads, and improves detection of peaks in mappable regions. We investigate various genome-wide characteristics of peaks detected only by utilization of multi-reads via computational experiments. Overall, peaks from multi-read analysis have similar characteristics to peaks that are identified by uni-reads except that the majority of them reside in segmental duplications. We further validate a number of GATA1 multi-read only peaks by independent quantitative real-time ChIP analysis and identify novel target genes of GATA1. These computational and experimental results establish that multi-reads can be of critical importance for studying transcription factor binding in highly repetitive regions of genomes with ChIP-seq experiments.
Directory of Open Access Journals (Sweden)
Dongjun Chung
2011-07-01
Full Text Available Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq is rapidly replacing chromatin immunoprecipitation combined with genome-wide tiling array analysis (ChIP-chip as the preferred approach for mapping transcription-factor binding sites and chromatin modifications. The state of the art for analyzing ChIP-seq data relies on using only reads that map uniquely to a relevant reference genome (uni-reads. This can lead to the omission of up to 30% of alignable reads. We describe a general approach for utilizing reads that map to multiple locations on the reference genome (multi-reads. Our approach is based on allocating multi-reads as fractional counts using a weighted alignment scheme. Using human STAT1 and mouse GATA1 ChIP-seq datasets, we illustrate that incorporation of multi-reads significantly increases sequencing depths, leads to detection of novel peaks that are not otherwise identifiable with uni-reads, and improves detection of peaks in mappable regions. We investigate various genome-wide characteristics of peaks detected only by utilization of multi-reads via computational experiments. Overall, peaks from multi-read analysis have similar characteristics to peaks that are identified by uni-reads except that the majority of them reside in segmental duplications. We further validate a number of GATA1 multi-read only peaks by independent quantitative real-time ChIP analysis and identify novel target genes of GATA1. These computational and experimental results establish that multi-reads can be of critical importance for studying transcription factor binding in highly repetitive regions of genomes with ChIP-seq experiments.
Ebolavirus comparative genomics
Jun, Se-Ran; Leuze, Michael R.; Nookaew, Intawat; Uberbacher, Edward C.; Land, Miriam; Zhang, Qian; Wanchai, Visanu; Chai, Juanjuan; Nielsen, Morten; Trolle, Thomas; Lund, Ole; Buzard, Gregory S.; Pedersen, Thomas D.; Wassenaar, Trudy M.; Ussery, David W.
2015-01-01
The 2014 Ebola outbreak in West Africa is the largest documented for this virus. To examine the dynamics of this genome, we compare more than 100 currently available ebolavirus genomes to each other and to other viral genomes. Based on oligomer frequency analysis, the family Filoviridae forms a distinct group from all other sequenced viral genomes. All filovirus genomes sequenced to date encode proteins with similar functions and gene order, although there is considerable divergence in sequences between the three genera Ebolavirus, Cuevavirus and Marburgvirus within the family Filoviridae. Whereas all ebolavirus genomes are quite similar (multiple sequences of the same strain are often identical), variation is most common in the intergenic regions and within specific areas of the genes encoding the glycoprotein (GP), nucleoprotein (NP) and polymerase (L). We predict regions that could contain epitope-binding sites, which might be good vaccine targets. This information, combined with glycosylation sites and experimentally determined epitopes, can identify the most promising regions for the development of therapeutic strategies. This manuscript has been authored by UT-Battelle, LLC under Contract No. DE-AC05-00OR22725 with the U.S. Department of Energy. The United States Government retains and the publisher, by accepting the article for publication, acknowledges that the United States Government retains a non-exclusive, paid-up, irrevocable, world-wide license to publish or reproduce the published form of this manuscript, or allow others to do so, for United States Government purposes. The Department of Energy will provide public access to these results of federally sponsored research in accordance with the DOE Public Access Plan (http://energy.gov/downloads/doe-public-access-plan). PMID:26175035
Evolution of the NANOG pseudogene family in the human and chimpanzee genomes
Directory of Open Access Journals (Sweden)
Maughan Peter J
2006-02-01
Full Text Available Abstract Background The NANOG gene is expressed in mammalian embryonic stem cells where it maintains cellular pluripotency. An unusually large family of pseudogenes arose from it with one unprocessed and ten processed pseudogenes in the human genome. This article compares the NANOG gene and its pseudogenes in the human and chimpanzee genomes and derives an evolutionary history of this pseudogene family. Results The NANOG gene and all pseudogenes except NANOGP8 are present at their expected orthologous chromosomal positions in the chimpanzee genome when compared to the human genome, indicating that their origins predate the human-chimpanzee divergence. Analysis of flanking DNA sequences demonstrates that NANOGP8 is absent from the chimpanzee genome. Conclusion Based on the most parsimonious ordering of inferred source-gene mutations, the deduced evolutionary origins for the NANOG pseudogene family in the human and chimpanzee genomes, in order of most ancient to most recent, are NANOGP6, NANOGP5, NANOGP3, NANOGP10, NANOGP2, NANOGP9, NANOGP7, NANOGP1, and NANOGP4. All of these pseudogenes were fixed in the genome of the human-chimpanzee common ancestor. NANOGP8 is the most recent pseudogene and it originated exclusively in the human lineage after the human-chimpanzee divergence. NANOGP1 is apparently an unprocessed pseudogene. Comparison of its sequence to the functional NANOG gene's reading frame suggests that this apparent pseudogene remained functional after duplication and, therefore, was subject to selection-driven conservation of its reading frame, and that it may retain some functionality or that its loss of function may be evolutionarily recent.
Genome-wide DNA polymorphism analyses using VariScan
Directory of Open Access Journals (Sweden)
Vilella Albert J
2006-09-01
Full Text Available Abstract Background DNA sequence polymorphisms analysis can provide valuable information on the evolutionary forces shaping nucleotide variation, and provides an insight into the functional significance of genomic regions. The recent ongoing genome projects will radically improve our capabilities to detect specific genomic regions shaped by natural selection. Current available methods and software, however, are unsatisfactory for such genome-wide analysis. Results We have developed methods for the analysis of DNA sequence polymorphisms at the genome-wide scale. These methods, which have been tested on a coalescent-simulated and actual data files from mouse and human, have been implemented in the VariScan software package version 2.0. Additionally, we have also incorporated a graphical-user interface. The main features of this software are: i exhaustive population-genetic analyses including those based on the coalescent theory; ii analysis adapted to the shallow data generated by the high-throughput genome projects; iii use of genome annotations to conduct a comprehensive analyses separately for different functional regions; iv identification of relevant genomic regions by the sliding-window and wavelet-multiresolution approaches; v visualization of the results integrated with current genome annotations in commonly available genome browsers. Conclusion VariScan is a powerful and flexible suite of software for the analysis of DNA polymorphisms. The current version implements new algorithms, methods, and capabilities, providing an important tool for an exhaustive exploratory analysis of genome-wide DNA polymorphism data.
Odedeyi, P. B.; Abou-El-Hossein, K.; Liman, M.
2017-05-01
Stainless steel 316 is a difficult-to-machine iron-based alloys that contain minimum of about 12% of chromium commonly used in marine and aerospace industry. This paper presents an experimental study of the tool wear propagation variations in the end milling of stainless steel 316 with coated carbide inserts. The milling tests were conducted at three different cutting speeds while feed rate and depth of cut were at (0.02, 0.06 and 01) mm/rev and (1, 2 and 3) mm, respectively. The cutting tool used was TiAlN-PVD-multi-layered coated carbides. The effects of cutting speed, cutting tool coating top layer and workpiece material were investigated on the tool life. The results showed that cutting speed significantly affected the machined flank wears values. With increasing cutting speed, the flank wear values decreased. The experimental results showed that significant flank wear was the major and predominant failure mode affecting the tool life.
Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K
2017-08-01
Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Mitochondrial genome evolution in the Saccharomyces sensu stricto complex.
Ruan, Jiangxing; Cheng, Jian; Zhang, Tongcun; Jiang, Huifeng
2017-01-01
Exploring the evolutionary patterns of mitochondrial genomes is important for our understanding of the Saccharomyces sensu stricto (SSS) group, which is a model system for genomic evolution and ecological analysis. In this study, we first obtained the complete mitochondrial sequences of two important species, Saccharomyces mikatae and Saccharomyces kudriavzevii. We then compared the mitochondrial genomes in the SSS group with those of close relatives, and found that the non-coding regions evolved rapidly, including dramatic expansion of intergenic regions, fast evolution of introns and almost 20-fold higher rearrangement rates than those of the nuclear genomes. However, the coding regions, and especially the protein-coding genes, are more conserved than those in the nuclear genomes of the SSS group. The different evolutionary patterns of coding and non-coding regions in the mitochondrial and nuclear genomes may be related to the origin of the aerobic fermentation lifestyle in this group. Our analysis thus provides novel insights into the evolution of mitochondrial genomes.
The size and repetitive nature of the Rhipicephalus microplus genome makes obtaining a full genome sequence difficult. Cot filtration/selection techniques were used to reduce the repetitive fraction of the tick genome and enrich for the fraction of DNA with gene-containing regions. The Cot-selected ...
Widespread of horizontal gene transfer in the human genome.
Huang, Wenze; Tsai, Lillian; Li, Yulong; Hua, Nan; Sun, Chen; Wei, Chaochun
2017-04-04
A fundamental concept in biology is that heritable material is passed from parents to offspring, a process called vertical gene transfer. An alternative mechanism of gene acquisition is through horizontal gene transfer (HGT), which involves movement of genetic materials between different species. Horizontal gene transfer has been found prevalent in prokaryotes but very rare in eukaryote. In this paper, we investigate horizontal gene transfer in the human genome. From the pair-wise alignments between human genome and 53 vertebrate genomes, 1,467 human genome regions (2.6 M bases) from all chromosomes were found to be more conserved with non-mammals than with most mammals. These human genome regions involve 642 known genes, which are enriched with ion binding. Compared to known horizontal gene transfer regions in the human genome, there were few overlapping regions, which indicated horizontal gene transfer is more common than we expected in the human genome. Horizontal gene transfer impacts hundreds of human genes and this study provided insight into potential mechanisms of HGT in the human genome.
Directory of Open Access Journals (Sweden)
M. G. G. T. Taylor
2012-06-01
Full Text Available The Kelvin-Helmholtz Instability (KHI can drive waves at the magnetopause. These waves can grow to form rolled-up vortices and facilitate transfer of plasma into the magnetosphere. To investigate the persistence and frequency of such waves at the magnetopause we have carried out a survey of all Double Star 1 magnetopause crossings, using a combination of ion and magnetic field measurements. Using criteria originally used in a Geotail study made by Hasegawa et al. (2006 (forthwith referred to as H2006, 17 candidate events were identified from the entire TC-1 mission (covering ~623 orbits where the magnetopause was sampled, a majority of which were on the dayside of the terminator. The relationship between density and shear velocity was then investigated, to identify the predicted signature of a rolled up vortex from H2006 and all 17 events exhibited some level of rolled up behavior. The location of the events had a clear dawn-dusk asymmetry, with 12 (71% on the post noon, dusk flank suggesting preferential growth in this region.
Complete nucleotide sequences of avian metapneumovirus subtype B genome.
Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro
2010-12-01
Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.
Chen, Hao; Yang, Peng; Guo, Jing; Kwoh, Chee Keong; Przytycka, Teresa M; Zheng, Jie
2015-01-01
Meiotic recombination hotspots play important roles in various aspects of genomics, but the underlying mechanisms for regulating the locations and strengths of recombination hotspots are not yet fully revealed. Most existing algorithms for estimating recombination rates from sequence polymorphism data can only output average recombination rates of a population, although there is evidence for the heterogeneity in recombination rates among individuals. For genome-wide association studies (GWAS) of recombination hotspots, an efficient algorithm that estimates the individualized strengths of recombination hotspots is highly desirable. In this work, we propose a novel graph mining algorithm named ARG-walker, based on random walks on ancestral recombination graphs (ARG), to estimate individual-specific recombination hotspot strengths. Extensive simulations demonstrate that ARG-walker is able to distinguish the hot allele of a recombination hotspot from the cold allele. Integrated with output of ARG-walker, we performed GWAS on the phased haplotype data of the 22 autosome chromosomes of the HapMap Asian population samples of Chinese and Japanese (JPT+CHB). Significant cis-regulatory signals have been detected, which is corroborated by the enrichment of the well-known 13-mer motif CCNCCNTNNCCNC of PRDM9 protein. Moreover, two new DNA motifs have been identified in the flanking regions of the significantly associated SNPs (single nucleotide polymorphisms), which are likely to be new cis-regulatory elements of meiotic recombination hotspots of the human genome. Our results on both simulated and real data suggest that ARG-walker is a promising new method for estimating the individual recombination variations. In the future, it could be used to uncover the mechanisms of recombination regulation and human diseases related with recombination hotspots.
Gualtieri, Gustavo; Conner, Joann A.; Morishige, Daryl T.; Moore, L. David; Mullet, John E.; Ozias-Akins, Peggy
2006-01-01
Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory. PMID:16415213
Organizational heterogeneity of vertebrate genomes.
Frenkel, Svetlana; Kirzhner, Valery; Korol, Abraham
2012-01-01
Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS) analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers) in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM) allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.
Organizational heterogeneity of vertebrate genomes.
Directory of Open Access Journals (Sweden)
Svetlana Frenkel
Full Text Available Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.
Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T
1993-12-01
CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.
Oshima, Masao; Kikuchi, Rie; Imamura, Jun; Handa, Hirokazu
2010-01-01
CMS (cytoplasmic male sterile) rapeseed is produced by asymmetrical somatic cell fusion between the Brassica napus cv. Westar and the Raphanus sativus Kosena CMS line (Kosena radish). The CMS rapeseed contains a CMS gene, orf125, which is derived from Kosena radish. Our sequence analyses revealed that the orf125 region in CMS rapeseed originated from recombination between the orf125/orfB region and the nad1C/ccmFN1 region by way of a 63 bp repeat. A precise sequence comparison among the related sequences in CMS rapeseed, Kosena radish and normal rapeseed showed that the orf125 region in CMS rapeseed consisted of the Kosena orf125/orfB region and the rapeseed nad1C/ccmFN1 region, even though Kosena radish had both the orf125/orfB region and the nad1C/ccmFN1 region in its mitochondrial genome. We also identified three tandem repeat sequences in the regions surrounding orf125, including a 63 bp repeat, which were involved in several recombination events. Interestingly, differences in the recombination activity for each repeat sequence were observed, even though these sequences were located adjacent to each other in the mitochondrial genome. We report results indicating that recombination events within the mitochondrial genomes are regulated at the level of specific repeat sequences depending on the cellular environment.
Flanking signal and mature peptide residues influence signal peptide cleavage
Directory of Open Access Journals (Sweden)
Ranganathan Shoba
2008-12-01
Full Text Available Abstract Background Signal peptides (SPs mediate the targeting of secretory precursor proteins to the correct subcellular compartments in prokaryotes and eukaryotes. Identifying these transient peptides is crucial to the medical, food and beverage and biotechnology industries yet our understanding of these peptides remains limited. This paper examines the most common type of signal peptides cleavable by the endoprotease signal peptidase I (SPase I, and the residues flanking the cleavage sites of three groups of signal peptide sequences, namely (i eukaryotes (Euk (ii Gram-positive (Gram+ bacteria, and (iii Gram-negative (Gram- bacteria. Results In this study, 2352 secretory peptide sequences from a variety of organisms with amino-terminal SPs are extracted from the manually curated SPdb database for analysis based on physicochemical properties such as pI, aliphatic index, GRAVY score, hydrophobicity, net charge and position-specific residue preferences. Our findings show that the three groups share several similarities in general, but they display distinctive features upon examination in terms of their amino acid compositions and frequencies, and various physico-chemical properties. Thus, analysis or prediction of their sequences should be separated and treated as distinct groups. Conclusion We conclude that the peptide segment recognized by SPase I extends to the start of the mature protein to a limited extent, upon our survey of the amino acid residues surrounding the cleavage processing site. These flanking residues possibly influence the cleavage processing and contribute to non-canonical cleavage sites. Our findings are applicable in defining more accurate prediction tools for recognition and identification of cleavage site of SPs.
International Nuclear Information System (INIS)
Breslow, Norman E.; Beckwith, J. Bruce; Haase, Gerald M.; Kalapurakal, John A.; Ritchey, Michael L.; Shamberger, Robert C.; Thomas, Patrick; D'Angio, Giulio J.; Green, Daniel M.
2006-01-01
Purpose: To determine whether radiation therapy (RT) of patients with Wilms tumor of favorable histology prevented flank recurrence and thereby improved the survival outcomes. Methods and Materials: Recurrence and mortality risks were compared among groups of patients with Stage I-IV/favorable histology Wilms tumor enrolled in the third (n = 1,640) and fourth (n = 2,066) National Wilms Tumor Study Group studies. Results: Proportions of patients with flank recurrence were 0 of 513 = 0.0% for 20 Gy, 12 of 805 = 1.5% for 10 Gy, and 44 of 2,388 = 1.8% for no flank RT (p trend 0.001 adjusted for stage and doxorubicin); for intra-abdominal (including flank) recurrence they were 5 of 513 = 1.0%, 30 of 805 = 3.7%, and 58 of 2,388 = 2.4%, respectively (p trend = 0.02 adjusted). Survival percentages at 8 years after intra-abdominal recurrence were 0 of 5 = 0% for 20 Gy, 10 of 30 = 33% for 10 Gy, and 34 of 58 = 56% for no RT (p trend = 0.0001). NWTS-4 discontinued use of 20 Gy RT, and the 8-year flank recurrence risk increased to 2.1% from 1.0% on NWTS-3 (p = 0.013). However, event-free survival was unaltered (88% vs. 86%, p = 0.39), and overall survival was better (93.8% vs. 90.8%, p = 0.036) on NWTS-4. Conclusions: Partly because of lower postrecurrence mortality among nonirradiated patients, prevention of flank recurrence by RT did not improve survival. It is important to evaluate entire treatment policies with regard to long-term outcomes
Reddy, Kondreddy Eswar; Thu, Ha Thi; Yoo, Mi Sun; Ramya, Mummadireddy; Reddy, Bheemireddy Anjana; Lien, Nguyen Thi Kim; Trang, Nguyen Thi Phuong; Duong, Bui Thi Thuy; Lee, Hyun-Jeong; Kang, Seung-Won; Quyen, Dong Van
2017-09-01
Sacbrood virus (SBV) is one of the most common viral infections of honeybees. The entire genome sequence for nine SBV infecting honeybees, Apis cerana and Apis mellifera, in Vietnam, namely AcSBV-Viet1, AcSBV-Viet2, AcSBV-Viet3, AmSBV-Viet4, AcSBV-Viet5, AmSBV-Viet6, AcSBV-Viet7, AcSBV-Viet8, and AcSBV-Viet9, was determined. These sequences were aligned with seven previously reported complete genome sequences of SBV from other countries, and various genomic regions were compared. The Vietnamese SBVs (VN-SBVs) shared 91-99% identity with each other, and shared 89-94% identity with strains from other countries. The open reading frames (ORFs) of the VN-SBV genomes differed greatly from those of SBVs from other countries, especially in their VP1 sequences. The AmSBV-Viet6 and AcSBV-Viet9 genome encodes 17 more amino acids within this region than the other VN-SBVs. In a phylogenetic analysis, the strains AmSBV-Viet4, AcSBV-Viet2, and AcSBV-Viet3 were clustered in group with AmSBV-UK, AmSBV-Kor21, and AmSBV-Kor19 strains. Whereas, the strains AmSBV-Viet6 and AcSBV-Viet7 clustered separately with the AcSBV strains from Korea and AcSBV-VietSBM2. And the strains AcSBV-Viet8, AcSBV-Viet1, AcSBV-Viet5, and AcSBV-Viet9 clustered with the AcSBV-India, AcSBV-Kor and AcSBV-VietSBM2. In a Simplot graph, the VN-SBVs diverged stronger in their ORF regions than in their 5' or 3' untranslated regions. The VN-SBVs possess genetic characteristics which are more similar to the Asian AcSBV strains than to AmSBV-UK strain. Taken together, our data indicate that host specificity, geographic distance, and viral cross-infections between different bee species may explain the genetic diversity among the VN-SBVs in A. cerana and A. mellifera and other SBV strains. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.
Zhu, Huayu; Song, Pengyao; Koo, Dal-Hoe; Guo, Luqin; Li, Yanman; Sun, Shouru; Weng, Yiqun; Yang, Luming
2016-08-05
Microsatellite markers are one of the most informative and versatile DNA-based markers used in plant genetic research, but their development has traditionally been difficult and costly. The whole genome sequencing with next-generation sequencing (NGS) technologies provides large amounts of sequence data to develop numerous microsatellite markers at whole genome scale. SSR markers have great advantage in cross-species comparisons and allow investigation of karyotype and genome evolution through highly efficient computation approaches such as in silico PCR. Here we described genome wide development and characterization of SSR markers in the watermelon (Citrullus lanatus) genome, which were then use in comparative analysis with two other important crop species in the Cucurbitaceae family: cucumber (Cucumis sativus L.) and melon (Cucumis melo L.). We further applied these markers in evaluating the genetic diversity and population structure in watermelon germplasm collections. A total of 39,523 microsatellite loci were identified from the watermelon draft genome with an overall density of 111 SSRs/Mbp, and 32,869 SSR primers were designed with suitable flanking sequences. The dinucleotide SSRs were the most common type representing 34.09 % of the total SSR loci and the AT-rich motifs were the most abundant in all nucleotide repeat types. In silico PCR analysis identified 832 and 925 SSR markers with each having a single amplicon in the cucumber and melon draft genome, respectively. Comparative analysis with these cross-species SSR markers revealed complicated mosaic patterns of syntenic blocks among the genomes of three species. In addition, genetic diversity analysis of 134 watermelon accessions with 32 highly informative SSR loci placed these lines into two groups with all accessions of C.lanatus var. citorides and three accessions of C. colocynthis clustered in one group and all accessions of C. lanatus var. lanatus and the remaining accessions of C. colocynthis
Directory of Open Access Journals (Sweden)
Manqiong Yuan
Full Text Available Considerable progress has been made in the HCV evolutionary analysis, since the software BEAST was released. However, prior information, especially the prior evolutionary rate, which plays a critical role in BEAST analysis, is always difficult to ascertain due to various uncertainties. Providing a proper prior HCV evolutionary rate is thus of great importance.176 full-length sequences of HCV subtype 1a and 144 of 1b were assembled by taking into consideration the balance of the sampling dates and the even dispersion in phylogenetic trees. According to the HCV genomic organization and biological functions, each dataset was partitioned into nine genomic regions and two routinely amplified regions. A uniform prior rate was applied to the BEAST analysis for each region and also the entire ORF. All the obtained posterior rates for 1a are of a magnitude of 10(-3 substitutions/site/year and in a bell-shaped distribution. Significantly lower rates were estimated for 1b and some of the rate distribution curves resulted in a one-sided truncation, particularly under the exponential model. This indicates that some of the rates for subtype 1b are less accurate, so they were adjusted by including more sequences to improve the temporal structure.Among the various HCV subtypes and genomic regions, the evolutionary patterns are dissimilar. Therefore, an applied estimation of the HCV epidemic history requires the proper selection of the rate priors, which should match the actual dataset so that they can fit for the subtype, the genomic region and even the length. By referencing the findings here, future evolutionary analysis of the HCV subtype 1a and 1b datasets may become more accurate and hence prove useful for tracing their patterns.
Annotation of the protein coding regions of the equine genome
DEFF Research Database (Denmark)
Hestand, Matthew S.; Kalbfleisch, Theodore S.; Coleman, Stephen J.
2015-01-01
Current gene annotation of the horse genome is largely derived from in silico predictions and cross-species alignments. Only a small number of genes are annotated based on equine EST and mRNA sequences. To expand the number of equine genes annotated from equine experimental evidence, we sequenced m...... and appear to be small errors in the equine reference genome, since they are also identified as homozygous variants by genomic DNA resequencing of the reference horse. Taken together, we provide a resource of equine mRNA structures and protein coding variants that will enhance equine and cross...
The human noncoding genome defined by genetic diversity.
di Iulio, Julia; Bartha, Istvan; Wong, Emily H M; Yu, Hung-Chun; Lavrenko, Victor; Yang, Dongchan; Jung, Inkyung; Hicks, Michael A; Shah, Naisha; Kirkness, Ewen F; Fabani, Martin M; Biggs, William H; Ren, Bing; Venter, J Craig; Telenti, Amalio
2018-03-01
Understanding the significance of genetic variants in the noncoding genome is emerging as the next challenge in human genomics. We used the power of 11,257 whole-genome sequences and 16,384 heptamers (7-nt motifs) to build a map of sequence constraint for the human species. This build differed substantially from traditional maps of interspecies conservation and identified regulatory elements among the most constrained regions of the genome. Using new Hi-C experimental data, we describe a strong pattern of coordination over 2 Mb where the most constrained regulatory elements associate with the most essential genes. Constrained regions of the noncoding genome are up to 52-fold enriched for known pathogenic variants as compared to unconstrained regions (21-fold when compared to the genome average). This map of sequence constraint across thousands of individuals is an asset to help interpret noncoding elements in the human genome, prioritize variants and reconsider gene units at a larger scale.
Lee, K-E; Lee, E-J; Park, H-S
2016-08-30
Recent advances in computational epigenetics have provided new opportunities to evaluate n-gram probabilistic language models. In this paper, we describe a systematic genome-wide approach for predicting functional roles in inactive chromatin regions by using a sequence-based Markovian chromatin map of the human genome. We demonstrate that Markov chains of sequences can be used as a precursor to predict functional roles in heterochromatin regions and provide an example comparing two publicly available chromatin annotations of large-scale epigenomics projects: ENCODE project consortium and Roadmap Epigenomics consortium.
Mitochondrial genome sequences and comparative genomics ofPhytophthora ramorum and P. sojae
Energy Technology Data Exchange (ETDEWEB)
Martin, Frank N.; Douda, Bensasson; Tyler, Brett M.; Boore,Jeffrey L.
2007-01-01
The complete sequences of the mitochondrial genomes of theoomycetes of Phytophthora ramorum and P. sojae were determined during thecourse of their complete nuclear genome sequencing (Tyler, et al. 2006).Both are circular, with sizes of 39,314 bp for P. ramorum and 42,975 bpfor P. sojae. Each contains a total of 37 identifiable protein-encodinggenes, 25 or 26 tRNAs (P. sojae and P. ramorum, respectively)specifying19 amino acids, and a variable number of ORFs (7 for P. ramorum and 12for P. sojae) which are potentially additional functional genes.Non-coding regions comprise approximately 11.5 percent and 18.4 percentof the genomes of P. ramorum and P. sojae, respectively. Relative to P.sojae, there is an inverted repeat of 1,150 bp in P. ramorum thatincludes an unassigned unique ORF, a tRNA gene, and adjacent non-codingsequences, but otherwise the gene order in both species is identical.Comparisons of these genomes with published sequences of the P. infestansmitochondrial genome reveals a number of similarities, but the gene orderin P. infestans differs in two adjacent locations due to inversions.Sequence alignments of the three genomes indicated sequence conservationranging from 75 to 85 percent and that specific regions were morevariable than others.
Chen, Jie-Yin; Liu, Chun; Gui, Yue-Jing; Si, Kai-Wei; Zhang, Dan-Dan; Wang, Jie; Short, Dylan P G; Huang, Jin-Qun; Li, Nan-Yang; Liang, Yong; Zhang, Wen-Qi; Yang, Lin; Ma, Xue-Feng; Li, Ting-Gang; Zhou, Lei; Wang, Bao-Li; Bao, Yu-Ming; Subbarao, Krishna V; Zhang, Geng-Yun; Dai, Xiao-Feng
2018-01-01
Verticillium dahliae isolates are most virulent on the host from which they were originally isolated. Mechanisms underlying these dominant host adaptations are currently unknown. We sequenced the genome of V. dahliae Vd991, which is highly virulent on its original host, cotton, and performed comparisons with the reference genomes of JR2 (from tomato) and VdLs.17 (from lettuce). Pathogenicity-related factor prediction, orthology and multigene family classification, transcriptome analyses, phylogenetic analyses, and pathogenicity experiments were performed. The Vd991 genome harbored several exclusive, lineage-specific (LS) genes within LS regions (LSRs). Deletion mutants of the seven genes within one LSR (G-LSR2) in Vd991 were less virulent only on cotton. Integration of G-LSR2 genes individually into JR2 and VdLs.17 resulted in significantly enhanced virulence on cotton but did not affect virulence on tomato or lettuce. Transcription levels of the seven LS genes in Vd991 were higher during the early stages of cotton infection, as compared with other hosts. Phylogenetic analyses suggested that G-LSR2 was acquired from Fusarium oxysporum f. sp. vasinfectum through horizontal gene transfer. Our results provide evidence that horizontal gene transfer from Fusarium to Vd991 contributed significantly to its adaptation to cotton and may represent a significant mechanism in the evolution of an asexual plant pathogen. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Vaandrager, J W; Schuuring, E; Raap, T; Philippo, K; Kleiverda, K; Kluin, P
Rearrangement of the BCL2 gene is an important parameter for the differential diagnosis of non-Hodgkin lymphomas. Although a relatively large proportion of breakpoints is clustered, many are missed by standard PCR. A FISH assay is therefore desired. Up to now, a lack of probes flanking the BCL2 gene
Directory of Open Access Journals (Sweden)
Syahrul Azwan Sundi
2017-01-01
Full Text Available This paper is a study on full flute (extra-long tool and ground shank end mill wear analysis by utilizing five-axis CNC to implement flank milling strategy on curved shape part. Five-axis machining eases the user to implement variations of strategy such as flank milling. Flank milling is different from point milling. Point milling cuts materials by using the tip of the tool whereas the flank milling uses the cutting tool body to cut material. The type of cutting tool used was end mill 10 mm diameter with High Speed Steel (HSS material. One factor at a time was utilized to analyze the overall data. Feed rate and spindle speed were the two main factors that been set up equally for both full flute and ground shank end mill. At the end of this research, the qualitative analysis based on tool wear between full flute and ground shank end mill is observed. Generally, both types of cutting tools showed almost the same failure indication such as broken edge or chipped off edge, formation of pinned hole on the surface and serration formation or built-up edge (BUE on the primary flute. However, the results obtained from the enlarged images which were captured by Optical Microscope indicated that, the ground shank end mill is better than the full flute end mill.
National Research Council Canada - National Science Library
Werner, Sandra
1999-01-01
The thesis investigates the circulation at a 75-meter deep study site on the southern flank of Georges Bank, a shallow submarine bank located between the deeper Gulf of Maine and the continental slope...
Eoche-Bosy, D; Gautier, M; Esquibet, M; Legeai, F; Bretaudeau, A; Bouchez, O; Fournet, S; Grenier, E; Montarry, J
2017-09-01
Improving resistance durability involves to be able to predict the adaptation speed of pathogen populations. Identifying the genetic bases of pathogen adaptation to plant resistances is a useful step to better understand and anticipate this phenomenon. Globodera pallida is a major pest of potato crop for which a resistance QTL, GpaV vrn , has been identified in Solanum vernei. However, its durability is threatened as G. pallida populations are able to adapt to the resistance in few generations. The aim of this study was to investigate the genomic regions involved in the resistance breakdown by coupling experimental evolution and high-density genome scan. We performed a whole-genome resequencing of pools of individuals (Pool-Seq) belonging to G. pallida lineages derived from two independent populations having experimentally evolved on susceptible and resistant potato cultivars. About 1.6 million SNPs were used to perform the genome scan using a recent model testing for adaptive differentiation and association to population-specific covariables. We identified 275 outliers and 31 of them, which also showed a significant reduction in diversity in adapted lineages, were investigated for their genic environment. Some candidate genomic regions contained genes putatively encoding effectors and were enriched in SPRYSECs, known in cyst nematodes to be involved in pathogenicity and in (a)virulence. Validated candidate SNPs will provide a useful molecular tool to follow frequencies of virulence alleles in natural G. pallida populations and define efficient strategies of use of potato resistances maximizing their durability. © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Christian eCantos
2014-06-01
Full Text Available Zinc-finger nucleases (ZFNs have proved to be successful tools for targeted genome manipulation in several organisms. Their main property is the induction of double-strand breaks (DSBs at specific sites, which are further repaired through homologous recombination (HR or non-homologous end joining (NHEJ. However, for the appropriate integration of genes at specific chromosomal locations, proper sites for gene integration need to be identified. These regions, hereby named safe harbor loci, must be localized in non-coding regions and possess high gene expression. In the present study, three different ZFN constructs (pZFN1, pZFN2, pZFN3, harboring β-glucuronidase (GUS as a reporter gene, were used to identify safe harbor loci regions on rice chromosomes. The constructs were delivered into IR64 rice by using an improved Agrobacterium-mediated transformation protocol, based on the use of immature embryos. Gene expression was measured by histochemical GUS activity and the flanking regions were determined through thermal-asymmetric interlaced polymerase chain reaction (TAIL PCR. Following sequencing, 28 regions were identified as putative sites for safe integration, but only one was localized in a non-coding region and it also possessed high GUS expression. These findings have significant applicability to create crops with new and valuable traits, since the site can be subsequently used to stably introduce one or more genes in a targeted manner.
Muino, J.M.; Kaufmann, K.; Ham, van R.C.H.J.; Angenent, G.C.; Krajewski, P.
2011-01-01
Background In vivo detection of protein-bound genomic regions can be achieved by combining chromatin-immunoprecipitation with next-generation sequencing technology (ChIP-seq). The large amount of sequence data produced by this method needs to be analyzed in a statistically proper and computationally
Genome-scale prediction of proteins with long intrinsically disordered regions.
Peng, Zhenling; Mizianty, Marcin J; Kurgan, Lukasz
2014-01-01
Proteins with long disordered regions (LDRs), defined as having 30 or more consecutive disordered residues, are abundant in eukaryotes, and these regions are recognized as a distinct class of biologically functional domains. LDRs facilitate various cellular functions and are important for target selection in structural genomics. Motivated by the lack of methods that directly predict proteins with LDRs, we designed Super-fast predictor of proteins with Long Intrinsically DisordERed regions (SLIDER). SLIDER utilizes logistic regression that takes an empirically chosen set of numerical features, which consider selected physicochemical properties of amino acids, sequence complexity, and amino acid composition, as its inputs. Empirical tests show that SLIDER offers competitive predictive performance combined with low computational cost. It outperforms, by at least a modest margin, a comprehensive set of modern disorder predictors (that can indirectly predict LDRs) and is 16 times faster compared to the best currently available disorder predictor. Utilizing our time-efficient predictor, we characterized abundance and functional roles of proteins with LDRs over 110 eukaryotic proteomes. Similar to related studies, we found that eukaryotes have many (on average 30.3%) proteins with LDRs with majority of proteomes having between 25 and 40%, where higher abundance is characteristic to proteomes that have larger proteins. Our first-of-its-kind large-scale functional analysis shows that these proteins are enriched in a number of cellular functions and processes including certain binding events, regulation of catalytic activities, cellular component organization, biogenesis, biological regulation, and some metabolic and developmental processes. A webserver that implements SLIDER is available at http://biomine.ece.ualberta.ca/SLIDER/. Copyright © 2013 Wiley Periodicals, Inc.
Liu, Jiaxuan; Zhao, Wei; Ware, Erin B; Turner, Stephen T; Mosley, Thomas H; Smith, Jennifer A
2018-05-08
Genetic variations in apolipoprotein E (APOE) and proximal genes (PVRL2, TOMM40, and APOC1) are associated with cognitive function and dementia, particularly Alzheimer's disease. Epigenetic mechanisms such as DNA methylation play a central role in the regulation of gene expression. Recent studies have found evidence that DNA methylation may contribute to the pathogenesis of dementia, but its association with cognitive function in populations without dementia remains unclear. We assessed DNA methylation levels of 48 CpG sites in the APOE genomic region in peripheral blood leukocytes collected from 289 African Americans (mean age = 67 years) from the Genetic Epidemiology Network of Arteriopathy (GENOA) study. Using linear regression, we examined the relationship between methylation in the APOE genomic region and multiple cognitive measures including learning, memory, processing speed, concentration, language and global cognitive function. We identified eight CpG sites in three genes (PVRL2, TOMM40, and APOE) that showed an inverse association between methylation level and delayed recall, a measure of memory, after adjusting for age and sex (False Discovery Rate q-value accounting for known genetic predictors for cognition. Our findings highlight the important role of epigenetic mechanisms in influencing cognitive performance, and suggest that changes in blood methylation may be an early indicator of individuals at risk for dementia as well as potential targets for intervention in asymptomatic populations.
Lava-flow hazard on the SE flank of Mt. Etna (Southern Italy)
Crisci, G. M.; Iovine, G.; Di Gregorio, S.; Lupiano, V.
2008-11-01
A method for mapping lava-flow hazard on the SE flank of Mt. Etna (Sicily, Southern Italy) by applying the Cellular Automata model SCIARA -fv is described, together with employed techniques of calibration and validation through a parallel Genetic Algorithm. The study area is partly urbanised; it has repeatedly been affected by lava flows from flank eruptions in historical time, and shows evidence of a dominant SSE-trending fracture system. Moreover, a dormant deep-seated gravitational deformation, associated with a larger volcano-tectonic phenomenon, affects the whole south-eastern flank of the volcano. The Etnean 2001 Mt. Calcarazzi lava-flow event has been selected for model calibration, while validation has been performed by considering the 2002 Linguaglossa and the 1991-93 Valle del Bove events — suitable data for back analysis being available for these recent eruptions. Quantitative evaluation of the simulations, with respect to the real events, has been performed by means of a couple of fitness functions, which consider either the areas affected by the lava flows, or areas and eruption duration. Sensitivity analyses are in progress for thoroughly evaluating the role of parameters, topographic input data, and mesh geometry on model performance; though, preliminary results have already given encouraging responses on model robustness. In order to evaluate lava-flow hazard in the study area, a regular grid of n.340 possible vents, uniformly covering the study area and located at 500 m intervals, has been hypothesised. For each vent, a statistically-significant number of simulations has been planned, by adopting combinations of durations, lava volumes, and effusion-rate functions, selected by considering available volcanological data. Performed simulations have been stored in a GIS environment for successive analyses and map elaboration. Probabilities of activation, empirically based on past behaviour of the volcano, can be assigned to each vent of the grid, by
Yao, Xiaohong; Tang, Ping; Li, Zuozhou; Li, Dawei; Liu, Yifei; Huang, Hongwen
2015-01-01
Actinidia chinensis is an important economic plant belonging to the basal lineage of the asterids. Availability of a complete Actinidia chloroplast genome sequence is crucial to understanding phylogenetic relationships among major lineages of angiosperms and facilitates kiwifruit genetic improvement. We report here the complete nucleotide sequences of the chloroplast genomes for Actinidia chinensis and A. chinensis var deliciosa obtained through de novo assembly of Illumina paired-end reads produced by total DNA sequencing. The total genome size ranges from 155,446 to 157,557 bp, with an inverted repeat (IR) of 24,013 to 24,391 bp, a large single copy region (LSC) of 87,984 to 88,337 bp and a small single copy region (SSC) of 20,332 to 20,336 bp. The genome encodes 113 different genes, including 79 unique protein-coding genes, 30 tRNA genes and 4 ribosomal RNA genes, with 16 duplicated in the inverted repeats, and a tRNA gene (trnfM-CAU) duplicated once in the LSC region. Comparisons of IR boundaries among four asterid species showed that IR/LSC borders were extended into the 5' portion of the psbA gene and IR contraction occurred in Actinidia. The clap gene has been lost from the chloroplast genome in Actinidia, and may have been transferred to the nucleus during chloroplast evolution. Twenty-seven polymorphic simple sequence repeat (SSR) loci were identified in the Actinidia chloroplast genome. Maximum parsimony analyses of a 72-gene, 16 taxa angiosperm dataset strongly support the placement of Actinidiaceae in Ericales within the basal asterids.
The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.
Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha
2005-07-01
Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.
An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo
DEFF Research Database (Denmark)
Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas
2004-01-01
Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...
The complete chloroplast genome of Sinopodophyllum hexandrum (Berberidaceae).
Li, Huie; Guo, Qiqiang
2016-07-01
The complete chloroplast (cp) genome of the Sinopodophyllum hexandrum (Berberidaceae) was determined in this study. The circular genome is 157,940 bp in size, and comprises a pair of inverted repeat (IR) regions of 26,077 bp each, a large single-copy (LSC) region of 86,460 bp and a small single-copy (SSC) region of 19,326 bp. The GC content of the whole cp genome was 38.5%. A total of 133 genes were identified, including 88 protein-coding genes, 37 tRNA genes and eight rRNA genes. The whole cp genome consists of 114 unique genes, and 19 genes are duplicated in the IR regions. The phylogenetic analysis revealed that S. hexandrum is closely related to Nandina domestica within the family Berberidaceae.
Liu, Xiaohua; Kelsoe, John R; Greenwood, Tiffany A
2016-01-01
Bipolar disorder is a heterogeneous mood disorder associated with several important clinical comorbidities, such as eating disorders. This clinical heterogeneity complicates the identification of genetic variants contributing to bipolar susceptibility. Here we investigate comorbidity of eating disorders as a subphenotype of bipolar disorder to identify genetic variation that is common and unique to both disorders. We performed a genome-wide association analysis contrasting 184 bipolar subjects with eating disorder comorbidity against both 1370 controls and 2006 subjects with bipolar disorder only from the Bipolar Genome Study (BiGS). The most significant genome-wide finding was observed bipolar with comorbid eating disorder vs. controls within SOX2-OT (p=8.9×10(-8) for rs4854912) with a secondary peak in the adjacent FXR1 gene (p=1.2×10(-6) for rs1805576) on chromosome 3q26.33. This region was also the most prominent finding in the case-only analysis (p=3.5×10(-7) and 4.3×10(-6), respectively). Several regions of interest containing genes involved in neurodevelopment and neuroprotection processes were also identified. While our primary finding did not quite reach genome-wide significance, likely due to the relatively limited sample size, these results can be viewed as a replication of a recent study of eating disorders in a large cohort. These findings replicate the prior association of SOX2-OT with eating disorders and broadly support the involvement of neurodevelopmental/neuroprotective mechanisms in the pathophysiology of both disorders. They further suggest that different clinical manifestations of bipolar disorder may reflect differential genetic contributions and argue for the utility of clinical subphenotypes in identifying additional molecular pathways leading to illness. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Pazos-Navarro María
2011-12-01
Full Text Available Abstract Background Bituminaria bituminosa is a perennial legume species from the Canary Islands and Mediterranean region that has potential as a drought-tolerant pasture species and as a source of pharmaceutical compounds. Three botanical varieties have previously been identified in this species: albomarginata, bituminosa and crassiuscula. B. bituminosa can be considered a genomic 'orphan' species with very few genomic resources available. New DNA sequencing technologies provide an opportunity to develop high quality molecular markers for such orphan species. Results 432,306 mRNA molecules were sampled from a leaf transcriptome of a single B. bituminosa plant using Roche 454 pyrosequencing, resulting in an average read length of 345 bp (149.1 Mbp in total. Sequences were assembled into 3,838 isotigs/contigs representing putatively unique gene transcripts. Gene ontology descriptors were identified for 3,419 sequences. Raw sequence reads containing simple sequence repeat (SSR motifs were identified, and 240 primer pairs flanking these motifs were designed. Of 87 primer pairs developed this way, 75 (86.2% successfully amplified primarily single fragments by PCR. Fragment analysis using 20 primer pairs in 79 accessions of B. bituminosa detected 130 alleles at 21 SSR loci. Genetic diversity analyses confirmed that variation at these SSR loci accurately reflected known taxonomic relationships in original collections of B. bituminosa and provided additional evidence that a division of the botanical variety bituminosa into two according to geographical origin (Mediterranean region and Canary Islands may be appropriate. Evidence of cross-pollination was also found between botanical varieties within a B. bituminosa breeding programme. Conclusions B. bituminosa can no longer be considered a genomic orphan species, having now a large (albeit incomplete repertoire of expressed gene sequences that can serve as a resource for future genetic studies. This
Long- and short-term selective forces on malaria parasite genomes
Nygaard, Sanne
2010-09-09
Plasmodium parasites, the causal agents of malaria, result in more than 1 million deaths annually. Plasmodium are unicellular eukaryotes with small ~23 Mb genomes encoding ~5200 protein-coding genes. The protein-coding genes comprise about half of these genomes. Although evolutionary processes have a significant impact on malaria control, the selective pressures within Plasmodium genomes are poorly understood, particularly in the non-protein-coding portion of the genome. We use evolutionary methods to describe selective processes in both the coding and non-coding regions of these genomes. Based on genome alignments of seven Plasmodium species, we show that protein-coding, intergenic and intronic regions are all subject to purifying selection and we identify 670 conserved non-genic elements. We then use genome-wide polymorphism data from P. falciparum to describe short-term selective processes in this species and identify some candidate genes for balancing (diversifying) selection. Our analyses suggest that there are many functional elements in the non-genic regions of these genomes and that adaptive evolution has occurred more frequently in the protein-coding regions of the genome. © 2010 Nygaard et al.
Soil radon monitoring in the NE flank of Mt. Etna (Sicily)
International Nuclear Information System (INIS)
Imme, G.; La Delfa, S.; Lo Nigro, S.; Morelli, D.; Patane, G.
2006-01-01
Soil radon has been monitored at a fixed location on the northeastern flank of Mt. Etna, a high-risk volcano in Sicily. The aim of this study was to evaluate the effects of the recent volcanic activity on soil radon concentration. Continuous radon measurements have been performed since July 2001. While comparison between the trend in in-soil radon concentration and the acquired meteorological series (temperature, humidity and pressure) appear to confirm a general seasonal correlation, nevertheless particular anomalies suggest a possible dependence of the radon concentration on volcanic dynamics
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Directory of Open Access Journals (Sweden)
M. F. Ulum
2014-12-01
Full Text Available The aim of this study was to describe the sonographic appearance of abdominal wall at the left flank of laparotomy incision site in 11 mated Ettawah grade does. Brightness-mode ultrasound examination by using transducer with frequency of 5.0-6.0 MHz was conducted to grouping the does based on their pregnancy statuses. The incision site of the abdominal wall at left flank laparotomy was transcutaneous-scanned as long as 8 cm vertically. The sonographic appearance of the laparotomy wall thickness showed that in all groups of does were similar and not different statistically. The thickness of oblique external and oblique internal abdominal muscles increased in the pregnant does as compared to non-pregnant does (P<0.05.
Directory of Open Access Journals (Sweden)
Javed Iqbal Wattoo
2016-11-01
Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.
Short template switch events explain mutation clusters in the human genome.
Löytynoja, Ari; Goldman, Nick
2017-06-01
Resequencing efforts are uncovering the extent of genetic variation in humans and provide data to study the evolutionary processes shaping our genome. One recurring puzzle in both intra- and inter-species studies is the high frequency of complex mutations comprising multiple nearby base substitutions or insertion-deletions. We devised a generalized mutation model of template switching during replication that extends existing models of genome rearrangement and used this to study the role of template switch events in the origin of short mutation clusters. Applied to the human genome, our model detects thousands of template switch events during the evolution of human and chimp from their common ancestor and hundreds of events between two independently sequenced human genomes. Although many of these are consistent with a template switch mechanism previously proposed for bacteria, our model also identifies new types of mutations that create short inversions, some flanked by paired inverted repeats. The local template switch process can create numerous complex mutation patterns, including hairpin loop structures, and explains multinucleotide mutations and compensatory substitutions without invoking positive selection, speculative mechanisms, or implausible coincidence. Clustered sequence differences are challenging for current mapping and variant calling methods, and we show that many erroneous variant annotations exist in human reference data. Local template switch events may have been neglected as an explanation for complex mutations because of biases in commonly used analyses. Incorporation of our model into reference-based analysis pipelines and comparisons of de novo assembled genomes will lead to improved understanding of genome variation and evolution. © 2017 Löytynoja and Goldman; Published by Cold Spring Harbor Laboratory Press.
International Nuclear Information System (INIS)
Anon.
1989-01-01
An international conference, Human Genome I, was held Oct. 2-4, 1989 in San Diego, Calif. Selected speakers discussed: Current Status of the Genome Project; Technique Innovations; Interesting regions; Applications; and Organization - Different Views of Current and Future Science and Procedures. Posters, consisting of 119 presentations, were displayed during the sessions. 119 were indexed for inclusion to the Energy Data Base
Fang, Lingzhao; Sahana, Goutam; Ma, Peipei; Su, Guosheng; Yu, Ying; Zhang, Shengli; Lund, Mogens Sandø; Sørensen, Peter
2017-05-12
A better understanding of the genetic architecture of complex traits can contribute to improve genomic prediction. We hypothesized that genomic variants associated with mastitis and milk production traits in dairy cattle are enriched in hepatic transcriptomic regions that are responsive to intra-mammary infection (IMI). Genomic markers [e.g. single nucleotide polymorphisms (SNPs)] from those regions, if included, may improve the predictive ability of a genomic model. We applied a genomic feature best linear unbiased prediction model (GFBLUP) to implement the above strategy by considering the hepatic transcriptomic regions responsive to IMI as genomic features. GFBLUP, an extension of GBLUP, includes a separate genomic effect of SNPs within a genomic feature, and allows differential weighting of the individual marker relationships in the prediction equation. Since GFBLUP is computationally intensive, we investigated whether a SNP set test could be a computationally fast way to preselect predictive genomic features. The SNP set test assesses the association between a genomic feature and a trait based on single-SNP genome-wide association studies. We applied these two approaches to mastitis and milk production traits (milk, fat and protein yield) in Holstein (HOL, n = 5056) and Jersey (JER, n = 1231) cattle. We observed that a majority of genomic features were enriched in genomic variants that were associated with mastitis and milk production traits. Compared to GBLUP, the accuracy of genomic prediction with GFBLUP was marginally improved (3.2 to 3.9%) in within-breed prediction. The highest increase (164.4%) in prediction accuracy was observed in across-breed prediction. The significance of genomic features based on the SNP set test were correlated with changes in prediction accuracy of GFBLUP (P layers of biological knowledge to provide novel insights into the biological basis of complex traits, and to improve the accuracy of genomic prediction. The SNP set
Comparative genomics reveals insights into avian genome evolution and adaptation
Zhang, Guojie; Li, Cai; Li, Qiye; Li, Bo; Larkin, Denis M.; Lee, Chul; Storz, Jay F.; Antunes, Agostinho; Greenwold, Matthew J.; Meredith, Robert W.; Ödeen, Anders; Cui, Jie; Zhou, Qi; Xu, Luohao; Pan, Hailin; Wang, Zongji; Jin, Lijun; Zhang, Pei; Hu, Haofu; Yang, Wei; Hu, Jiang; Xiao, Jin; Yang, Zhikai; Liu, Yang; Xie, Qiaolin; Yu, Hao; Lian, Jinmin; Wen, Ping; Zhang, Fang; Li, Hui; Zeng, Yongli; Xiong, Zijun; Liu, Shiping; Zhou, Long; Huang, Zhiyong; An, Na; Wang, Jie; Zheng, Qiumei; Xiong, Yingqi; Wang, Guangbiao; Wang, Bo; Wang, Jingjing; Fan, Yu; da Fonseca, Rute R.; Alfaro-Núñez, Alonzo; Schubert, Mikkel; Orlando, Ludovic; Mourier, Tobias; Howard, Jason T.; Ganapathy, Ganeshkumar; Pfenning, Andreas; Whitney, Osceola; Rivas, Miriam V.; Hara, Erina; Smith, Julia; Farré, Marta; Narayan, Jitendra; Slavov, Gancho; Romanov, Michael N; Borges, Rui; Machado, João Paulo; Khan, Imran; Springer, Mark S.; Gatesy, John; Hoffmann, Federico G.; Opazo, Juan C.; Håstad, Olle; Sawyer, Roger H.; Kim, Heebal; Kim, Kyu-Won; Kim, Hyeon Jeong; Cho, Seoae; Li, Ning; Huang, Yinhua; Bruford, Michael W.; Zhan, Xiangjiang; Dixon, Andrew; Bertelsen, Mads F.; Derryberry, Elizabeth; Warren, Wesley; Wilson, Richard K; Li, Shengbin; Ray, David A.; Green, Richard E.; O’Brien, Stephen J.; Griffin, Darren; Johnson, Warren E.; Haussler, David; Ryder, Oliver A.; Willerslev, Eske; Graves, Gary R.; Alström, Per; Fjeldså, Jon; Mindell, David P.; Edwards, Scott V.; Braun, Edward L.; Rahbek, Carsten; Burt, David W.; Houde, Peter; Zhang, Yong; Yang, Huanming; Wang, Jian; Jarvis, Erich D.; Gilbert, M. Thomas P.; Wang, Jun
2015-01-01
Birds are the most species-rich class of tetrapod vertebrates and have wide relevance across many research fields. We explored bird macroevolution using full genomes from 48 avian species representing all major extant clades. The avian genome is principally characterized by its constrained size, which predominantly arose because of lineage-specific erosion of repetitive elements, large segmental deletions, and gene loss. Avian genomes furthermore show a remarkably high degree of evolutionary stasis at the levels of nucleotide sequence, gene synteny, and chromosomal structure. Despite this pattern of conservation, we detected many non-neutral evolutionary changes in protein-coding genes and noncoding regions. These analyses reveal that pan-avian genomic diversity covaries with adaptations to different lifestyles and convergent evolution of traits. PMID:25504712
Lee, Hayan; Schatz, Michael C
2012-08-15
Genome resequencing and short read mapping are two of the primary tools of genomics and are used for many important applications. The current state-of-the-art in mapping uses the quality values and mapping quality scores to evaluate the reliability of the mapping. These attributes, however, are assigned to individual reads and do not directly measure the problematic repeats across the genome. Here, we present the Genome Mappability Score (GMS) as a novel measure of the complexity of resequencing a genome. The GMS is a weighted probability that any read could be unambiguously mapped to a given position and thus measures the overall composition of the genome itself. We have developed the Genome Mappability Analyzer to compute the GMS of every position in a genome. It leverages the parallelism of cloud computing to analyze large genomes, and enabled us to identify the 5-14% of the human, mouse, fly and yeast genomes that are difficult to analyze with short reads. We examined the accuracy of the widely used BWA/SAMtools polymorphism discovery pipeline in the context of the GMS, and found discovery errors are dominated by false negatives, especially in regions with poor GMS. These errors are fundamental to the mapping process and cannot be overcome by increasing coverage. As such, the GMS should be considered in every resequencing project to pinpoint the 'dark matter' of the genome, including of known clinically relevant variations in these regions. The source code and profiles of several model organisms are available at http://gma-bio.sourceforge.net
Directory of Open Access Journals (Sweden)
Jenson A Bennett
2002-07-01
Full Text Available Abstract Background An avian papillomavirus genome has been cloned from a cutaneous exophytic papilloma from an African grey parrot (Psittacus erithacus. The nucleotide sequence, genome organization, and phylogenetic position of the Psittacus erithacus papillomavirus (PePV were determined. This PePV sequence represents the first complete avian papillomavirus genome defined. Results The PePV genome (7304 basepairs differs from other papillomaviruses, in that it has a unique organization of the early protein region lacking classical E6 and E7 open reading frames. Phylogenetic comparison of the PePV sequence with partial E1 and L1 sequences of the chaffinch (Fringilla coelebs papillomavirus (FPV reveals that these two avian papillomaviruses form a monophyletic cluster with a common branch that originates near the unresolved center of the papillomavirus evolutionary tree. Conclusions The PePV genome has a unique layout of the early protein region which represents a novel prototypic genomic organization for avian papillomaviruses. The close relationship between PePV and FPV, and between their Psittaciformes and Passeriformes hosts, supports the hypothesis that papillomaviruses have co-evolved and speciated together with their host species throughout evolution.
Directory of Open Access Journals (Sweden)
Balding David J
2008-12-01
Full Text Available Abstract Background The power of haplotype-based methods for association studies, identification of regions under selection, and ancestral inference, is well-established for diploid organisms. For polyploids, however, the difficulty of determining phase has limited such approaches. Polyploidy is common in plants and is also observed in animals. Partial polyploidy is sometimes observed in humans (e.g. trisomy 21; Down's syndrome, and it arises more frequently in some human tissues. Local changes in ploidy, known as copy number variations (CNV, arise throughout the genome. Here we present a method, implemented in the software polyHap, for the inference of haplotype phase and missing observations from polyploid genotypes. PolyHap allows each individual to have a different ploidy, but ploidy cannot vary over the genomic region analysed. It employs a hidden Markov model (HMM and a sampling algorithm to infer haplotypes jointly in multiple individuals and to obtain a measure of uncertainty in its inferences. Results In the simulation study, we combine real haplotype data to create artificial diploid, triploid, and tetraploid genotypes, and use these to demonstrate that polyHap performs well, in terms of both switch error rate in recovering phase and imputation error rate for missing genotypes. To our knowledge, there is no comparable software for phasing a large, densely genotyped region of chromosome from triploids and tetraploids, while for diploids we found polyHap to be more accurate than fastPhase. We also compare the results of polyHap to SATlotyper on an experimentally haplotyped tetraploid dataset of 12 SNPs, and show that polyHap is more accurate. Conclusion With the availability of large SNP data in polyploids and CNV regions, we believe that polyHap, our proposed method for inferring haplotypic phase from genotype data, will be useful in enabling researchers analysing such data to exploit the power of haplotype-based analyses.
Accounting for discovery bias in genomic prediction
Our objective was to evaluate an approach to mitigating discovery bias in genomic prediction. Accuracy may be improved by placing greater emphasis on regions of the genome expected to be more influential on a trait. Methods emphasizing regions result in a phenomenon known as “discovery bias” if info...
Directory of Open Access Journals (Sweden)
De-Min Cao
2016-01-01
Full Text Available The genus Helicobacter is a group of Gram-negative, helical-shaped pathogens consisting of at least 36 bacterial species. Helicobacter pylori (H. pylori, infecting more than 50% of the human population, is considered as the major cause of gastritis, peptic ulcer, and gastric cancer. However, the genetic underpinnings of H. pylori that are responsible for its large scale epidemic and gastrointestinal environment adaption within human beings remain unclear. Core-pan genome analysis was performed among 75 representative H. pylori and 24 non-pylori Helicobacter genomes. There were 1173 conserved protein families of H. pylori and 673 of all 99 Helicobacter genus strains. We found 79 genome unique regions, a total of 202,359bp, shared by at least 80% of the H. pylori but lacked in non-pylori Helicobacter species. The operons, genes, and sRNAs within the H. pylori unique regions were considered as potential ones associated with its pathogenicity and adaptability, and the relativity among them has been partially confirmed by functional annotation analysis. However, functions of at least 54 genes and 10 sRNAs were still unclear. Our analysis of protein-protein interaction showed that 30 genes within them may have the cooperation relationship.
Bourras, Salim; Meyer, Michel; Grandaubert, Jonathan; Lapalu, Nicolas; Fudal, Isabelle; Linglin, Juliette; Ollivier, Benedicte; Blaise, Françoise; Balesdent, Marie-Hélène; Rouxel, Thierry
2012-08-01
The ever-increasing generation of sequence data is accompanied by unsatisfactory functional annotation, and complex genomes, such as those of plants and filamentous fungi, show a large number of genes with no predicted or known function. For functional annotation of unknown or hypothetical genes, the production of collections of mutants using Agrobacterium tumefaciens-mediated transformation (ATMT) associated with genotyping and phenotyping has gained wide acceptance. ATMT is also widely used to identify pathogenicity determinants in pathogenic fungi. A systematic analysis of T-DNA borders was performed in an ATMT-mutagenized collection of the phytopathogenic fungus Leptosphaeria maculans to evaluate the features of T-DNA integration in its particular transposable element-rich compartmentalized genome. A total of 318 T-DNA tags were recovered and analyzed for biases in chromosome and genic compartments, existence of CG/AT skews at the insertion site, and occurrence of microhomologies between the T-DNA left border (LB) and the target sequence. Functional annotation of targeted genes was done using the Gene Ontology annotation. The T-DNA integration mainly targeted gene-rich, transcriptionally active regions, and it favored biological processes consistent with the physiological status of a germinating spore. T-DNA integration was strongly biased toward regulatory regions, and mainly promoters. Consistent with the T-DNA intranuclear-targeting model, the density of T-DNA insertion correlated with CG skew near the transcription initiation site. The existence of microhomologies between promoter sequences and the T-DNA LB flanking sequence was also consistent with T-DNA integration to host DNA mediated by homologous recombination based on the microhomology-mediated end-joining pathway.
Identification of coding and non-coding mutational hotspots in cancer genomes.
Piraino, Scott W; Furney, Simon J
2017-01-05
The identification of mutations that play a causal role in tumour development, so called "driver" mutations, is of critical importance for understanding how cancers form and how they might be treated. Several large cancer sequencing projects have identified genes that are recurrently mutated in cancer patients, suggesting a role in tumourigenesis. While the landscape of coding drivers has been extensively studied and many of the most prominent driver genes are well characterised, comparatively less is known about the role of mutations in the non-coding regions of the genome in cancer development. The continuing fall in genome sequencing costs has resulted in a concomitant increase in the number of cancer whole genome sequences being produced, facilitating systematic interrogation of both the coding and non-coding regions of cancer genomes. To examine the mutational landscapes of tumour genomes we have developed a novel method to identify mutational hotspots in tumour genomes using both mutational data and information on evolutionary conservation. We have applied our methodology to over 1300 whole cancer genomes and show that it identifies prominent coding and non-coding regions that are known or highly suspected to play a role in cancer. Importantly, we applied our method to the entire genome, rather than relying on predefined annotations (e.g. promoter regions) and we highlight recurrently mutated regions that may have resulted from increased exposure to mutational processes rather than selection, some of which have been identified previously as targets of selection. Finally, we implicate several pan-cancer and cancer-specific candidate non-coding regions, which could be involved in tumourigenesis. We have developed a framework to identify mutational hotspots in cancer genomes, which is applicable to the entire genome. This framework identifies known and novel coding and non-coding mutional hotspots and can be used to differentiate candidate driver regions from
Franco, A.C.; Rijsewijk, F.A.M.; Flores, E.F.; Weiblen, R.; Roehe, P.M.
2002-01-01
This paper describes the construction and characterization of a Brazilian strain of bovine herpesvirus type 1.2a (BoHV-1.2a) with a deletion of the glycoprotein E (gE) gene. The deletion was introduced by co-transfection of a deletion fragment containing the 5´and 3´gE flanking regions and genomic
Unleashing the genome of Brassica rapa
Directory of Open Access Journals (Sweden)
Haibao eTang
2012-07-01
Full Text Available The completion and release of the Brassica rapa genome is of great benefit to researchers of the Brassicas, Arabidopsis, and genome evolution. While its lineage is closely related to the model organism Arabidopsis thaliana, the Brassicas experienced a whole genome triplication subsequent to their divergence. This event contemporaneously created three copies of its ancestral genome, which had diploidized through the process of homeologous gene loss known as fractionation. By the fractionation of homeologous gene content and genetic regulatory binding sites, Brassica’s genome is well placed to use comparative genomic techniques to identify syntenic regions, homeologous gene duplications, and putative regulatory sequences. Here, we use the comparative genomics platform CoGe to perform several different genomic analyses with which to study structural changes of its genome and dynamics of various genetic elements. Starting with whole genome comparisons, the Brassica paleohexaploidy is characterized, syntenic regions with Arabidopsis thaliana are identified, and the TOC1 gene in the circadian rhythm pathway from Arabidopsis thaliana is used to find duplicated orthologs in Brassica rapa. These TOC1 genes are further analyzed to identify conserved noncoding sequences that contain cis-acting regulatory elements and promoter sequences previously implicated in circadian rhythmicity. Each 'cookbook style' analysis includes a step-by-step walkthrough with links to CoGe to quickly reproduce each step of the analytical process.
Genomic consequences of selection and genome-wide association mapping in soybean.
Wen, Zixiang; Boyse, John F; Song, Qijian; Cregan, Perry B; Wang, Dechun
2015-09-03
Crop improvement always involves selection of specific alleles at genes controlling traits of agronomic importance, likely resulting in detectable signatures of selection within the genome of modern soybean (Glycine max L. Merr.). The identification of these signatures of selection is meaningful from the perspective of evolutionary biology and for uncovering the genetic architecture of agronomic traits. To this end, two populations of soybean, consisting of 342 landraces and 1062 improved lines, were genotyped with the SoySNP50K Illumina BeadChip containing 52,041 single nucleotide polymorphisms (SNPs), and systematically phenotyped for 9 agronomic traits. A cross-population composite likelihood ratio (XP-CLR) method was used to screen the signals of selective sweeps. A total of 125 candidate selection regions were identified, many of which harbored genes potentially involved in crop improvement. To further investigate whether these candidate regions were in fact enriched for genes affected by selection, genome-wide association studies (GWAS) were conducted on 7 selection traits targeted in soybean breeding (grain yield, plant height, lodging, maturity date, seed coat color, seed protein and oil content) and 2 non-selection traits (pubescence and flower color). Major genomic regions associated with selection traits overlapped with candidate selection regions, whereas no overlap of this kind occurred for the non-selection traits, suggesting that the selection sweeps identified are associated with traits of agronomic importance. Multiple novel loci and refined map locations of known loci related to these traits were also identified. These findings illustrate that comparative genomic analyses, especially when combined with GWAS, are a promising approach to dissect the genetic architecture of complex traits.
Comparative genomic in situ hybridization analysis on the ...
African Journals Online (AJOL)
The nucleolar organizing regions (NORs), a few telomeres, most centromeric regions and numerous interstitial sites were detected. The signals in small genomes were relatively sparse and unevenly distributed along chromosomes, whereas those in large genomes were dense and basically evenly distributed.
TOZAKI, Teruaki; KIKUCHI, Mio; KAKOI, Hironaga; HIROTA, Kei-ichi; NAGATA, Shun-ichi
2017-01-01
ABSTRACT Body weight is an important trait to confirm growth and development in humans and animals. In Thoroughbred racehorses, it is measured in the postnatal, training, and racing periods to evaluate growth and training degrees. The body weight of mature Thoroughbred racehorses generally ranges from 400 to 600 kg, and this broad range is likely influenced by environmental and genetic factors. Therefore, a genome-wide association study (GWAS) using the Equine SNP70 BeadChip was performed to identify the genomic regions associated with body weight in Japanese Thoroughbred racehorses using 851 individuals. The average body weight of these horses was 473.9 kg (standard deviation: 28.0) at the age of 3, and GWAS identified statistically significant SNPs on chromosomes 3 (BIEC2_808466, P=2.32E-14), 9 (BIEC2_1105503, P=1.03E-7), 15 (BIEC2_322669, P=9.50E-6), and 18 (BIEC2_417274, P=1.44E-14), which were associated with body weight as a quantitative trait. The genomic regions on chromosomes 3, 9, 15, and 18 included ligand-dependent nuclear receptor compressor-like protein (LCORL), zinc finger and AT hook domain containing (ZFAT), tribbles pseudokinase 2 (TRIB2), and myostatin (MSTN), respectively, as candidate genes. LCORL and ZFAT are associated with withers height in horses, whereas MSTN affects muscle mass. Thus, the genomic regions identified in this study seem to affect the body weight of Thoroughbred racehorses. Although this information is useful for breeding and growth management of the horses, the production of genetically modified animals and gene doping (abuse/misuse of gene therapy) should be prohibited to maintain horse racing integrity. PMID:29270069
DDC and COBL, flanking the imprinted GRB10 gene on 7p12, are biallelically expressed.
Hitchins, Megan P; Bentley, Louise; Monk, David; Beechey, Colin; Peters, Jo; Kelsey, Gavin; Ishino, Fumitoshi; Preece, Michael A; Stanier, Philip; Moore, Gudrun E
2002-12-01
Maternal duplication of human 7p11.2-p13 has been associated with Silver-Russell syndrome (SRS) in two familial cases. GRB10 is the only imprinted gene identified within this region to date. GRB10 demonstrates an intricate tissue- and isoform-specific imprinting profile in humans, with paternal expression in fetal brain and maternal expression of one isoform in skeletal muscle. The mouse homolog is maternally transcribed. The GRB10 protein is a potent growth inhibitor and represents a candidate for SRS, which is characterized by pre- and postnatal growth retardation and a spectrum of additional dysmorphic features. Since imprinted genes tend to be grouped in clusters, we investigated the imprinting status of the dopa-decarboxylase gene (DDC) and the Cordon-bleu gene (COBL) which flank GRB10 within the 7p11.2-p13 SRS duplicated region. Although both genes were found to replicate asynchronously, suggestive of imprinting, SNP expression analyses showed that neither gene was imprinted in multiple human fetal tissues. The mouse homologues, Ddc and Cobl, which map to the homologous imprinted region on proximal Chr 11, were also biallelically expressed in mice with uniparental maternal or paternal inheritance of this region. With the intent of using mouse Grb10 as an imprinted control, biallelic expression was consistently observed in fetal, postnatal, and adult brain of these mice, in contrast to the maternal-specific transcription previously demonstrated in brain in inter-specific F1 progeny. This may be a further example of over-expression of maternally derived transcripts in inter-specific mouse crosses. GRB10 remains the only imprinted gene identified within 7p11.2-p13.
Amin, N; Byrne, E; Johnson, J; Chenevix-Trench, G; Walter, S; Nolte, I M; Vink, J M; Rawal, R; Mangino, M; Teumer, A; Keers, J C; Verwoert, G; Baumeister, S; Biffar, R; Petersmann, A; Dahmen, N; Doering, A; Isaacs, A; Broer, L; Wray, N R; Montgomery, G W; Levy, D; Psaty, B M; Gudnason, V; Chakravarti, A; Sulem, P; Gudbjartsson, D F; Kiemeney, L A; Thorsteinsdottir, U; Stefansson, K; van Rooij, F J A; Aulchenko, Y S; Hottenga, J J; Rivadeneira, F R; Hofman, A; Uitterlinden, A G; Hammond, C J; Shin, S-Y; Ikram, A; Witteman, J C M; Janssens, A C J W; Snieder, H; Tiemeier, H; Wolfenbuttel, B H R; Oostra, B A; Heath, A C; Wichmann, E; Spector, T D; Grabe, H J; Boomsma, D I; Martin, N G; van Duijn, C M
2012-11-01
Coffee consumption is a model for addictive behavior. We performed a meta-analysis of genome-wide association studies (GWASs) on coffee intake from 8 Caucasian cohorts (N=18 176) and sought replication of our top findings in a further 7929 individuals. We also performed a gene expression analysis treating different cell lines with caffeine. Genome-wide significant association was observed for two single-nucleotide polymorphisms (SNPs) in the 15q24 region. The two SNPs rs2470893 and rs2472297 (P-values=1.6 × 10(-11) and 2.7 × 10(-11)), which were also in strong linkage disequilibrium (r(2)=0.7) with each other, lie in the 23-kb long commonly shared 5' flanking region between CYP1A1 and CYP1A2 genes. CYP1A1 was found to be downregulated in lymphoblastoid cell lines treated with caffeine. CYP1A1 is known to metabolize polycyclic aromatic hydrocarbons, which are important constituents of coffee, whereas CYP1A2 is involved in the primary metabolism of caffeine. Significant evidence of association was also detected at rs382140 (P-value=3.9 × 10(-09)) near NRCAM-a gene implicated in vulnerability to addiction, and at another independent hit rs6495122 (P-value=7.1 × 10(-09))-an SNP associated with blood pressure-in the 15q24 region near the gene ULK3, in the meta-analysis of discovery and replication cohorts. Our results from GWASs and expression analysis also strongly implicate CAB39L in coffee drinking. Pathway analysis of differentially expressed genes revealed significantly enriched ubiquitin proteasome (P-value=2.2 × 10(-05)) and Parkinson's disease pathways (P-value=3.6 × 10(-05)).
Weathers, T. S.; Fisher, A. T.; Winslow, D. M.; Stauffer, P. H.; Gable, C. W.
2017-12-01
The flanks of mid-ocean ridges experience coupled flows of fluid, heat, and solutes that are critical for a wide range of global processes, including the cycling of carbon and nutrients, which supports a vast crustal biosphere. Only a few ridge-flank sites have been studied in detail; hydrogeologic conditions and processes in the volcanic crust are best understood on the eastern flank of the Juan de Fuca Ridge. This area has been extensively explored with decades of drilling, submersible, observatory, and survey expeditions and experiments, including the first hole-to-hole tracer injection experiment in the ocean crust. This study describes the development of reactive transport simulations for this ridge-flank setting using three-dimensional coupled (thermal-hydrological) models of crustal-scale circulation, beginning with the exploration of tracer transport. The prevailing flow direction is roughly south to north as a result of outcrop-to-outcrop flow, with a bulk flow rate in the range of meters/year. However, tracer was detected 500 m south ("upstream") from the injection borehole during the first year following injection. This may be explained by local mixing and/or formation fluid discharge from the southern borehole during and after injection. The constraints and parameters required to fit the observed tracer behavior can be used as a basis for modeling reactive transport processes such as nutrient delivery or microbial community evolution as a function of fluid flow. For example, the sulfate concentration in fluid samples from Baby Bare outcrop ( 8 km south of the tracer transport experiment) was 17.8 mmol/kg, whereas at Mama Bare outcrop ( 8 km to north of the tracer transport experiment) the sulfate concentration was 16.3 mmol/mg. By integrating laboratory-derived sulfate reduction rates from microbial samples originating from Juan de Fuca borehole observatories into reactive transport models, we can explore the range of microbial activity that supports
Directory of Open Access Journals (Sweden)
Wu Yu-Ren
2016-01-01
Full Text Available In this paper, a novel longitudinal tooth flank crowning method is proposed by setting the crossed angle between the hob cutter and work gear as a linear function of hob’s traverse feed movement in the gear hobbing process. However, this method makes twisted tooth flanks on the hobbed work gear. Therefore, a variable pressure angle hob cutter is applied to obtain an anti-twist tooth flank of hobbed work gear. A computer simulation example is performed to verify the superiority of the proposed novel hobbing method by comparing topographies of the crowned work gear surfaces hobbed by a standard hob cutter and a variable pressure angle hob cutter.
Directory of Open Access Journals (Sweden)
J Stephen Dumler
2016-09-01
Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.
Logan, Grace; Freimanis, Graham L; King, David J; Valdazo-González, Begoña; Bachanek-Bankowska, Katarzyna; Sanderson, Nicholas D; Knowles, Nick J; King, Donald P; Cottam, Eleanor M
2014-09-30
Next-Generation Sequencing (NGS) is revolutionizing molecular epidemiology by providing new approaches to undertake whole genome sequencing (WGS) in diagnostic settings for a variety of human and veterinary pathogens. Previous sequencing protocols have been subject to biases such as those encountered during PCR amplification and cell culture, or are restricted by the need for large quantities of starting material. We describe here a simple and robust methodology for the generation of whole genome sequences on the Illumina MiSeq. This protocol is specific for foot-and-mouth disease virus (FMDV) or other polyadenylated RNA viruses and circumvents both the use of PCR and the requirement for large amounts of initial template. The protocol was successfully validated using five FMDV positive clinical samples from the 2001 epidemic in the United Kingdom, as well as a panel of representative viruses from all seven serotypes. In addition, this protocol was successfully used to recover 94% of an FMDV genome that had previously been identified as cell culture negative. Genome sequences from three other non-FMDV polyadenylated RNA viruses (EMCV, ERAV, VESV) were also obtained with minor protocol amendments. We calculated that a minimum coverage depth of 22 reads was required to produce an accurate consensus sequence for FMDV O. This was achieved in 5 FMDV/O/UKG isolates and the type O FMDV from the serotype panel with the exception of the 5' genomic termini and area immediately flanking the poly(C) region. We have developed a universal WGS method for FMDV and other polyadenylated RNA viruses. This method works successfully from a limited quantity of starting material and eliminates the requirement for genome-specific PCR amplification. This protocol has the potential to generate consensus-level sequences within a routine high-throughput diagnostic environment.
Directory of Open Access Journals (Sweden)
Lakkhana Kanhayuwa
Full Text Available Novel families of short interspersed nuclear element (SINE sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
Physical and genetic map of the major nif gene cluster from Azotobacter vinelandii.
Jacobson, M R; Brigle, K E; Bennett, L T; Setterquist, R A; Wilson, M S; Cash, V L; Beynon, J; Newton, W E; Dean, D R
1989-01-01
Determination of a 28,793-base-pair DNA sequence of a region from the Azotobacter vinelandii genome that includes and flanks the nitrogenase structural gene region was completed. This information was used to revise the previously proposed organization of the major nif cluster. The major nif cluster from A. vinelandii encodes 15 nif-specific genes whose products bear significant structural identity to the corresponding nif-specific gene products from Klebsiella pneumoniae. These genes include ...
DEFF Research Database (Denmark)
Duarte, Vinícius da Silva; Giaretta, Sabrina; Treu, Laura
2018-01-01
Streptococcus thermophilus, a very important dairy species, is constantly threatened by phage infection. We report the genome sequences of three S. thermophilus bacteriophages isolated from a dairy environment in the Veneto region of Italy. These sequences will be used for the development of new ...
Defining functional DNA elements in the human genome
Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.
2014-01-01
With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594
Cluster observations of surface waves on the dawn flank magnetopause
Directory of Open Access Journals (Sweden)
C. J. Owen
2004-03-01
Full Text Available On 14 June 2001 the four Cluster spacecraft recorded multiple encounters of the dawn-side flank magnetopause. The characteristics of the observed electron populations varied between a cold, dense magnetosheath population and warmer, more rarified boundary layer population on a quasi-periodic basis. The demarcation between these two populations can be readily identified by gradients in the scalar temperature of the electrons. An analysis of the differences in the observed timings of the boundary at each spacecraft indicates that these magnetopause crossings are consistent with a surface wave moving across the flank magnetopause. When compared to the orientation of the magnetopause expected from models, we find that the leading edges of these waves are approximately 45° steeper than the trailing edges, consistent with the Kelvin-Helmholtz (KH driving mechanism. A stability analysis of this interval suggests that the magnetopause is marginally stable to this mechanism during this event. Periods in which the analysis predicts that the magnetopause is unstable correspond to observations of greater wave steepening. Analysis of the pulses suggests that the waves have an average wavelength of approximately 3.4 RE and move at an average speed of ~65km s-1 in an anti-sunward and northward direction, despite the spacecraft location somewhat south of the GSE Z=0 plane. This wave propagation direction lies close to perpendicular to the average magnetic field direction in the external magnetosheath, suggesting that these waves may preferentially propagate in the direction that requires no bending of these external field lines
Key words. Magnetospheric physics (magnetospheric configuration and dynamics; MHD waves and unstabilities; solar wind-magnetosphere interactions
Whole genomes of Chandipura virus isolates and comparative analysis with other rhabdoviruses.
Cherian, Sarah S; Gunjikar, Rashmi S; Banerjee, Arpita; Kumar, Satyendra; Arankalle, Vidya A
2012-01-01
The Chandipura virus (CHPV) belonging to the Vesiculovirus genus and Rhabdoviridae family, has recently been associated with a number of encephalitis epidemics, with high mortality in children, in different parts of India. No full length genome sequences of CHPV isolates were available in GenBank and little is known about the molecular markers for pathogenesis. In the present study, we provide the complete genomic sequences of four isolates from epidemics during 2003-2007. These sequences along with the deduced sequence of the prototype isolate of 1965 were analysed using phylogeny, motif search, homology modeling and epitope prediction methods. Comparison with other rhaboviruses was also done for functional extrapolations. All CHPV isolates clustered with the Isfahan virus and maintained several functional motifs of other rhabdoviruses. A notable difference with the prototype vesiculovirus, Vesicular Stomatitis Virus was in the L-domain flanking sequences of the M protein that are known to be crucial for interaction with host proteins. With respect to the prototype isolate, significant additional mutations were acquired in the 2003-2007 isolates. Several mutations in G mapped onto probable antigenic sites. A mutation in N mapped onto regions crucial for N-N interaction and a putative T-cell epitope. A mutation in the Casein kinase II phosphorylation site in P may attribute to increased rates of phosphorylation. Gene junction comparison revealed changes in the M-G junction of all the epidemic isolates that may have implications on read-through and gene transcription levels. The study can form the basis for further experimental verification and provide additional insights into the virulence determinants of the CHPV.
Whole genomes of Chandipura virus isolates and comparative analysis with other rhabdoviruses.
Directory of Open Access Journals (Sweden)
Sarah S Cherian
Full Text Available The Chandipura virus (CHPV belonging to the Vesiculovirus genus and Rhabdoviridae family, has recently been associated with a number of encephalitis epidemics, with high mortality in children, in different parts of India. No full length genome sequences of CHPV isolates were available in GenBank and little is known about the molecular markers for pathogenesis. In the present study, we provide the complete genomic sequences of four isolates from epidemics during 2003-2007. These sequences along with the deduced sequence of the prototype isolate of 1965 were analysed using phylogeny, motif search, homology modeling and epitope prediction methods. Comparison with other rhaboviruses was also done for functional extrapolations. All CHPV isolates clustered with the Isfahan virus and maintained several functional motifs of other rhabdoviruses. A notable difference with the prototype vesiculovirus, Vesicular Stomatitis Virus was in the L-domain flanking sequences of the M protein that are known to be crucial for interaction with host proteins. With respect to the prototype isolate, significant additional mutations were acquired in the 2003-2007 isolates. Several mutations in G mapped onto probable antigenic sites. A mutation in N mapped onto regions crucial for N-N interaction and a putative T-cell epitope. A mutation in the Casein kinase II phosphorylation site in P may attribute to increased rates of phosphorylation. Gene junction comparison revealed changes in the M-G junction of all the epidemic isolates that may have implications on read-through and gene transcription levels. The study can form the basis for further experimental verification and provide additional insights into the virulence determinants of the CHPV.
Whole Genomes of Chandipura Virus Isolates and Comparative Analysis with Other Rhabdoviruses
Cherian, Sarah S.; Kumar, Satyendra; Arankalle, Vidya A.
2012-01-01
The Chandipura virus (CHPV) belonging to the Vesiculovirus genus and Rhabdoviridae family, has recently been associated with a number of encephalitis epidemics, with high mortality in children, in different parts of India. No full length genome sequences of CHPV isolates were available in GenBank and little is known about the molecular markers for pathogenesis. In the present study, we provide the complete genomic sequences of four isolates from epidemics during 2003–2007. These sequences along with the deduced sequence of the prototype isolate of 1965 were analysed using phylogeny, motif search, homology modeling and epitope prediction methods. Comparison with other rhaboviruses was also done for functional extrapolations. All CHPV isolates clustered with the Isfahan virus and maintained several functional motifs of other rhabdoviruses. A notable difference with the prototype vesiculovirus, Vesicular Stomatitis Virus was in the L-domain flanking sequences of the M protein that are known to be crucial for interaction with host proteins. With respect to the prototype isolate, significant additional mutations were acquired in the 2003–2007 isolates. Several mutations in G mapped onto probable antigenic sites. A mutation in N mapped onto regions crucial for N-N interaction and a putative T-cell epitope. A mutation in the Casein kinase II phosphorylation site in P may attribute to increased rates of phosphorylation. Gene junction comparison revealed changes in the M-G junction of all the epidemic isolates that may have implications on read-through and gene transcription levels. The study can form the basis for further experimental verification and provide additional insights into the virulence determinants of the CHPV. PMID:22272333
Tran Thi Tuyet, H.; Zwart, M.P.; Phuong, N.T.; Oanh, D.T.H.; Jong, de M.C.M.; Vlak, J.M.
2012-01-01
Sequence comparisons of the genomes of white spot syndrome virus (WSSV) strains have identified regions containing variable-length insertions/deletions (i.e. indels). Indel-I and Indel-II, positioned between open reading frames (ORFs) 14/15 and 23/24, respectively, are the largest and the most
Directory of Open Access Journals (Sweden)
Sophie Bouchet
Full Text Available The migration of maize from tropical to temperate climates was accompanied by a dramatic evolution in flowering time. To gain insight into the genetic architecture of this adaptive trait, we conducted a 50K SNP-based genome-wide association and diversity investigation on a panel of tropical and temperate American and European representatives. Eighteen genomic regions were associated with flowering time. The number of early alleles cumulated along these regions was highly correlated with flowering time. Polymorphism in the vicinity of the ZCN8 gene, which is the closest maize homologue to Arabidopsis major flowering time (FT gene, had the strongest effect. This polymorphism is in the vicinity of the causal factor of Vgt2 QTL. Diversity was lower, whereas differentiation and LD were higher for associated loci compared to the rest of the genome, which is consistent with selection acting on flowering time during maize migration. Selection tests also revealed supplementary loci that were highly differentiated among groups and not associated with flowering time in our panel, whereas they were in other linkage-based studies. This suggests that allele fixation led to a lack of statistical power when structure and relatedness were taken into account in a linear mixed model. Complementary designs and analysis methods are necessary to unravel the architecture of complex traits. Based on linkage disequilibrium (LD estimates corrected for population structure, we concluded that the number of SNPs genotyped should be at least doubled to capture all QTLs contributing to the genetic architecture of polygenic traits in this panel. These results show that maize flowering time is controlled by numerous QTLs of small additive effect and that strong polygenic selection occurred under cool climatic conditions. They should contribute to more efficient genomic predictions of flowering time and facilitate the dissemination of diverse maize genetic resources under a wide
Deleterious mutation accumulation in organelle genomes.
Lynch, M; Blanchard, J L
1998-01-01
It is well established on theoretical grounds that the accumulation of mildly deleterious mutations in nonrecombining genomes is a major extinction risk in obligately asexual populations. Sexual populations can also incur mutational deterioration in genomic regions that experience little or no recombination, i.e., autosomal regions near centromeres, Y chromosomes, and organelle genomes. Our results suggest, for a wide array of genes (transfer RNAs, ribosomal RNAs, and proteins) in a diverse collection of species (animals, plants, and fungi), an almost universal increase in the fixation probabilities of mildly deleterious mutations arising in mitochondrial and chloroplast genomes relative to those arising in the recombining nuclear genome. This enhanced width of the selective sieve in organelle genomes does not appear to be a consequence of relaxed selection, but can be explained by the decline in the efficiency of selection that results from the reduction of effective population size induced by uniparental inheritance. Because of the very low mutation rates of organelle genomes (on the order of 10(-4) per genome per year), the reduction in fitness resulting from mutation accumulation in such genomes is a very long-term process, not likely to imperil many species on time scales of less than a million years, but perhaps playing some role in phylogenetic lineage sorting on time scales of 10 to 100 million years.
A decade of human genome project conclusion: Scientific diffusion about our genome knowledge.
Moraes, Fernanda; Góes, Andréa
2016-05-06
The Human Genome Project (HGP) was initiated in 1990 and completed in 2003. It aimed to sequence the whole human genome. Although it represented an advance in understanding the human genome and its complexity, many questions remained unanswered. Other projects were launched in order to unravel the mysteries of our genome, including the ENCyclopedia of DNA Elements (ENCODE). This review aims to analyze the evolution of scientific knowledge related to both the HGP and ENCODE projects. Data were retrieved from scientific articles published in 1990-2014, a period comprising the development and the 10 years following the HGP completion. The fact that only 20,000 genes are protein and RNA-coding is one of the most striking HGP results. A new concept about the organization of genome arose. The ENCODE project was initiated in 2003 and targeted to map the functional elements of the human genome. This project revealed that the human genome is pervasively transcribed. Therefore, it was determined that a large part of the non-protein coding regions are functional. Finally, a more sophisticated view of chromatin structure emerged. The mechanistic functioning of the genome has been redrafted, revealing a much more complex picture. Besides, a gene-centric conception of the organism has to be reviewed. A number of criticisms have emerged against the ENCODE project approaches, raising the question of whether non-conserved but biochemically active regions are truly functional. Thus, HGP and ENCODE projects accomplished a great map of the human genome, but the data generated still requires further in depth analysis. © 2016 by The International Union of Biochemistry and Molecular Biology, 44:215-223, 2016. © 2016 The International Union of Biochemistry and Molecular Biology.
Wang, Yajie; Wu, Fengyi; Pan, Haining; Zheng, Wenzhong; Feng, Chi; Wang, Yunfu; Deng, Zixin; Wang, Lianrong; Luo, Jie; Chen, Shi
2016-02-29
Alzheimer's disease (AD) is characterized by amyloid-β (Aβ) deposition in the brain. Aβ plaques are produced through sequential β/γ cleavage of amyloid precursor protein (APP), of which there are three main APP isoforms: APP695, APP751 and APP770. KPI-APPs (APP751 and APP770) are known to be elevated in AD, but the reason remains unclear. Transcription activator-like (TAL) effector nucleases (TALENs) induce mutations with high efficiency at specific genomic loci, and it is thus possible to knock out specific regions using TALENs. In this study, we designed and expressed TALENs specific for the C-terminus of APP in HeLa cells, in which KPI-APPs are predominantly expressed. The KPI-APP mutants lack a 12-aa region that encompasses a 5-aa trans-membrane (TM) region and 7-aa juxta-membrane (JM) region. The mutated KPI-APPs exhibited decreased mitochondrial localization. In addition, mitochondrial morphology was altered, resulting in an increase in spherical mitochondria in the mutant cells through the disruption of the balance between fission and fusion. Mitochondrial dysfunction, including decreased ATP levels, disrupted mitochondrial membrane potential, increased ROS generation and impaired mitochondrial dehydrogenase activity, was also found. These results suggest that specific regions of KPI-APPs are important for mitochondrial localization and function.
Simulation of flanking transmission in super-light structures for airborne and impact sound
DEFF Research Database (Denmark)
Christensen, Jacob Ellehauge; Hertz, Kristian Dahl; Brunskog, Jonas
2012-01-01
. Previously the airborne and impact sound insulation has been measured for a super-light deck element in a laboratory. This paper presents a flanking transmission analysis based on the measured results and are carried out for the Super-light deck elements by means of the acoustical software Bastian...... to design buildings with super-light deck elements while achieving a good acoustical environment in the building, fulfilling various acoustical requirements from the building regulations....
Sang, Helen; Whitehouse, Harold L K
1983-01-01
Aberrant asci containing one or more wild-type spores were selected from crosses between pairs of alleles of the buff locus in the presence of closely linked flanking markers. Data were obtained relating to the site of aberrant segregation and the position of any associated crossover giving recombination of flanking markers. Aberrant segregation at a proximal site within the buff gene may be associated with a crossover proximal to the site of aberrant segregation or, with equal frequency, wit...
Genome-association analysis of Korean Holstein milk traits using genomic estimated breeding value
Directory of Open Access Journals (Sweden)
Donghyun Shin
2017-03-01
Full Text Available Objective Holsteins are known as the world’s highest-milk producing dairy cattle. The purpose of this study was to identify genetic regions strongly associated with milk traits (milk production, fat, and protein using Korean Holstein data. Methods This study was performed using single nucleotide polymorphism (SNP chip data (Illumina BovineSNP50 Beadchip of 911 Korean Holstein individuals. We inferred each genomic estimated breeding values based on best linear unbiased prediction (BLUP and ridge regression using BLUPF90 and R. We then performed a genome-wide association study and identified genetic regions related to milk traits. Results We identified 9, 6, and 17 significant genetic regions related to milk production, fat and protein, respectively. These genes are newly reported in the genetic association with milk traits of Holstein. Conclusion This study complements a recent Holstein genome-wide association studies that identified other SNPs and genes as the most significant variants. These results will help to expand the knowledge of the polygenic nature of milk production in Holsteins.
Directory of Open Access Journals (Sweden)
Collins Peter L
2008-10-01
Full Text Available Abstract Background Avian paramyxoviruses (APMVs are frequently isolated from domestic and wild birds throughout the world. All APMVs, except avian metapneumovirus, are classified in the genus Avulavirus of the family Paramyxoviridae. At present, the APMVs of genus Avulavirus are divided into nine serological types (APMV 1–9. Newcastle disease virus represents APMV-1 and is the most characterized among all APMV types. Very little is known about the molecular characteristics and pathogenicity of APMV 2–9. Results As a first step towards understanding the molecular genetics and pathogenicity of APMV-4, we have sequenced the complete genome of APMV-4 strain duck/Hong Kong/D3/75 and determined its pathogenicity in embryonated chicken eggs. The genome of APMV-4 is 15,054 nucleotides (nt in length, which is consistent with the "rule of six". The genome contains six non-overlapping genes in the order 3'-N-P/V-M-F-HN-L-5'. The genes are flanked on either side by highly conserved transcription start and stop signals and have intergenic sequences varying in length from 9 to 42 nt. The genome contains a 55 nt leader region at 3' end. The 5' trailer region is 17 nt, which is the shortest in the family Paramyxoviridae. Analysis of mRNAs transcribed from the P gene showed that 35% of the transcripts were edited by insertion of one non-templated G residue at an editing site leading to production of V mRNAs. No message was detected that contained insertion of two non-templated G residues, indicating that the W mRNAs are inefficiently produced in APMV-4 infected cells. The cleavage site of the F protein (DIPQR↓F does not conform to the preferred cleavage site of the ubiquitous intracellular protease furin. However, exogenous proteases were not required for the growth of APMV-4 in cell culture, indicating that the cleavage does not depend on a furin site. Conclusion Phylogenic analysis of the nucleotide sequences of viruses of all five genera of the family
Genome-wide function of H2B ubiquitylation in promoter and genic regions.
Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin
2011-11-01
Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
Relevance of sodium/glucose cotransporter-1 (SGLT1) to diabetes mellitus and obesity in dogs.
Batchelor, D J; German, A J; Shirazi-Beechey, S P
2013-04-01
Glucose transport across the enterocyte brush border membrane by sodium/glucose cotransporter-1 (SGLT1, coded by Slc5a1) is the rate-limiting step for intestinal glucose transport. The relevance of SGLT1 expression in predisposition to diabetes mellitus and to obesity was investigated in dogs. Cultured Caco-2/TC7 cells were shown to express SGLT1 in vitro. A 2-kbp fragment of the Slc5a1 5' flanking region was cloned from canine genomic DNA, ligated into reporter gene plasmids, and shown to drive reporter gene expression in these cells above control (P obesity (Labrador retriever and cocker spaniel). The Slc5a1 5' flanking region was amplified from 10 healthy individuals of each of these breeds by high-fidelity PCR with the use of breed-labeled primers and sequenced by pyrosequencing. The sequence of the Slc5a1 5' flanking region in all individuals of all breeds tested was identical. On this evidence, variations in Slc5a1 promoter sequence between dogs do not influence the pathogenesis of diabetes mellitus or obesity in these breeds. Copyright © 2013 Elsevier Inc. All rights reserved.
PCR detection of a Maell polymorphism in the human major breakpoint cluster region (BCR)
Energy Technology Data Exchange (ETDEWEB)
McClure, J.S.; Litz, C.E. (Medical School, Minneapolis, MN (United States))
1991-09-25
Nested primer pairs flanking the second intron of the breakpoint cluster region were constructed from the published cDNA sequence. The outer primer pair 5{prime}BCR Exon 2 (5{prime}-GTT TCA GAA GCT TCT CCC TG-3{prime}) and 3{prime}BCR Exon 3 (5{prime}-ACT CTG CTT AAA TCC AGT GG-3{prime}), amplified a fragment of genomic DNA approximately 810 bp in length. The inner primer pair, 3{prime}BCR Exon 2(5{prime}-CGC TGA CCA TCA ATA AGG AA-3{prime}) and 5{prime}BCR Exon 3 (5{prime}-AGA AAC CCA TAG AGC CCC GG-3{prime}), amplified a fragment approximately 730 bp in length. Double stranded DNA amplified with the outer primer pair was subjected to asymmetric PCR using the inner primer pair. Sequencing reactions were performed using the Sequenase dideoxy sequencing kit with S{sup 35}-dATP. Sequences in homozygotes revealed either an A or a G 85 bp 5{prime} of the BCR BamHI site. Heterozygotes demonstrated both bands at the corresponding position.
Benchmarking database performance for genomic data.
Khushi, Matloob
2015-06-01
Genomic regions represent features such as gene annotations, transcription factor binding sites and epigenetic modifications. Performing various genomic operations such as identifying overlapping/non-overlapping regions or nearest gene annotations are common research needs. The data can be saved in a database system for easy management, however, there is no comprehensive database built-in algorithm at present to identify overlapping regions. Therefore I have developed a novel region-mapping (RegMap) SQL-based algorithm to perform genomic operations and have benchmarked the performance of different databases. Benchmarking identified that PostgreSQL extracts overlapping regions much faster than MySQL. Insertion and data uploads in PostgreSQL were also better, although general searching capability of both databases was almost equivalent. In addition, using the algorithm pair-wise, overlaps of >1000 datasets of transcription factor binding sites and histone marks, collected from previous publications, were reported and it was found that HNF4G significantly co-locates with cohesin subunit STAG1 (SA1).Inc. © 2015 Wiley Periodicals, Inc.
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
Chromatin dynamics in genome stability
DEFF Research Database (Denmark)
Nair, Nidhi; Shoaib, Muhammad; Sørensen, Claus Storgaard
2017-01-01
Genomic DNA is compacted into chromatin through packaging with histone and non-histone proteins. Importantly, DNA accessibility is dynamically regulated to ensure genome stability. This is exemplified in the response to DNA damage where chromatin relaxation near genomic lesions serves to promote...... access of relevant enzymes to specific DNA regions for signaling and repair. Furthermore, recent data highlight genome maintenance roles of chromatin through the regulation of endogenous DNA-templated processes including transcription and replication. Here, we review research that shows the importance...... of chromatin structure regulation in maintaining genome integrity by multiple mechanisms including facilitating DNA repair and directly suppressing endogenous DNA damage....
Ogedengbe, Mosun E; Qvarnstrom, Yvonne; da Silva, Alexandre J; Arrowood, Michael J; Barta, John R
2015-05-01
The near complete mitochondrial genome for Cyclospora cayetanensis is 6184 bp in length with three protein-coding genes (Cox1, Cox3, CytB) and numerous lsrDNA and ssrDNA fragments. Gene arrangements were conserved with other coccidia in the Eimeriidae, but the C. cayetanensis mitochondrial genome is not circular-mapping. Terminal transferase tailing and nested PCR completed the 5'-terminus of the genome starting with a 21 bp A/T-only region that forms a potential stem-loop. Regions homologous to the C. cayetanensis mitochondrial genome 5'-terminus are found in all eimeriid mitochondrial genomes available and suggest this may be the ancestral start of eimeriid mitochondrial genomes. Copyright © 2015 Australian Society for Parasitology Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Joergen B. Kjaer
2016-10-01
Full Text Available The serotonergic system has been shown to be implicated in the regulation of mood and feeding behavior. Previous studies have identified a polymorphism in the 5′-flanking region of the serotonin transporter ( 5 - HTT gene of Lohmann Brown (LB laying hens. The deleted variant D was found to be associated with increased body weight. The objective of this study was to address whether the increased body weight may be due to an increased feed intake. After hatching, hens were kept under ad libitum feeding conditions, and their body weight and feed intake were weekly determined. From 5 weeks of age, the body weight of hens with the D/D and W/D genotypes was significantly greater than that of W/W carrying hens. Interestingly, we found that the feed intake of D/D carrying hens, relative to body weight, was transiently increased only between 4 and 7 weeks of age ( p < 0.05, leading to a higher growth rate ( p < 0.05, compared with that of W/W carrying hens. These results suggest that the presence of variant D may be correlated with a transiently increased appetite of D/D carrying hens.
Suicidal function of DNA methylation in age-related genome disintegration.
Mazin, Alexander L
2009-10-01
This article is dedicated to the 60th anniversary of 5-methylcytosine discovery in DNA. Cytosine methylation can affect genetic and epigenetic processes, works as a part of the genome-defense system and has mutagenic activity; however, the biological functions of this enzymatic modification are not well understood. This review will put forward the hypothesis that the host-defense role of DNA methylation in silencing and mutational destroying of retroviruses and other intragenomic parasites was extended during evolution to most host genes that have to be inactivated in differentiated somatic cells, where it acquired a new function in age-related self-destruction of the genome. The proposed model considers DNA methylation as the generator of 5mC>T transitions that induce 40-70% of all spontaneous somatic mutations of the multiple classes at CpG and CpNpG sites and flanking nucleotides in the p53, FIX, hprt, gpt human genes and some transgenes. The accumulation of 5mC-dependent mutations explains: global changes in the structure of the vertebrate genome throughout evolution; the loss of most 5mC from the DNA of various species over their lifespan and the Hayflick limit of normal cells; the polymorphism of methylation sites, including asymmetric mCpNpN sites; cyclical changes of methylation and demethylation in genes. The suicidal function of methylation may be a special genetic mechanism for increasing DNA damage and the programmed genome disintegration responsible for cell apoptosis and organism aging and death.
Contributions to In Silico Genome Annotation
Kalkatawi, Manal M.
2017-11-30
Genome annotation is an important topic since it provides information for the foundation of downstream genomic and biological research. It is considered as a way of summarizing part of existing knowledge about the genomic characteristics of an organism. Annotating different regions of a genome sequence is known as structural annotation, while identifying functions of these regions is considered as a functional annotation. In silico approaches can facilitate both tasks that otherwise would be difficult and timeconsuming. This study contributes to genome annotation by introducing several novel bioinformatics methods, some based on machine learning (ML) approaches. First, we present Dragon PolyA Spotter (DPS), a method for accurate identification of the polyadenylation signals (PAS) within human genomic DNA sequences. For this, we derived a novel feature-set able to characterize properties of the genomic region surrounding the PAS, enabling development of high accuracy optimized ML predictive models. DPS considerably outperformed the state-of-the-art results. The second contribution concerns developing generic models for structural annotation, i.e., the recognition of different genomic signals and regions (GSR) within eukaryotic DNA. We developed DeepGSR, a systematic framework that facilitates generating ML models to predict GSR with high accuracy. To the best of our knowledge, no available generic and automated method exists for such task that could facilitate the studies of newly sequenced organisms. The prediction module of DeepGSR uses deep learning algorithms to derive highly abstract features that depend mainly on proper data representation and hyperparameters calibration. DeepGSR, which was evaluated on recognition of PAS and translation initiation sites (TIS) in different organisms, yields a simpler and more precise representation of the problem under study, compared to some other hand-tailored models, while producing high accuracy prediction results. Finally
Fu, Songzhe; Octavia, Sophie; Tanaka, Mark M.; Sintchenko, Vitali
2015-01-01
Salmonella enterica serovar Typhimurium is the most common Salmonella serovar causing foodborne infections in Australia and many other countries. Twenty-one S. Typhimurium strains from Salmonella reference collection A (SARA) were analyzed using Illumina high-throughput genome sequencing. Single nucleotide polymorphisms (SNPs) in 21 SARA strains ranged from 46 to 11,916 SNPs, with an average of 1,577 SNPs per strain. Together with 47 strains selected from publicly available S. Typhimurium genomes, the S. Typhimurium core genes (STCG) were determined. The STCG consist of 3,846 genes, a set that is much larger than that of the 2,882 Salmonella core genes (SCG) found previously. The STCG together with 1,576 core intergenic regions (IGRs) were defined as the S. Typhimurium core genome. Using 93 S. Typhimurium genomes from 13 epidemiologically confirmed community outbreaks, we demonstrated that typing based on the S. Typhimurium core genome (STCG plus core IGRs) provides superior resolution and higher discriminatory power than that based on SCG for outbreak investigation and molecular epidemiology of S. Typhimurium. STCG and STCG plus core IGR typing achieved 100% separation of all outbreaks compared to that of SCG typing, which failed to separate isolates from two outbreaks from background isolates. Defining the S. Typhimurium core genome allows standardization of genes/regions to be used for high-resolution epidemiological typing and genomic surveillance of S. Typhimurium. PMID:26019201
Large scale genomic reorganization of topological domains at the HoxD locus.
Fabre, Pierre J; Leleu, Marion; Mormann, Benjamin H; Lopez-Delisle, Lucille; Noordermeer, Daan; Beccari, Leonardo; Duboule, Denis
2017-08-07
The transcriptional activation of HoxD genes during mammalian limb development involves dynamic interactions with two topologically associating domains (TADs) flanking the HoxD cluster. In particular, the activation of the most posterior HoxD genes in developing digits is controlled by regulatory elements located in the centromeric TAD (C-DOM) through long-range contacts. To assess the structure-function relationships underlying such interactions, we measured compaction levels and TAD discreteness using a combination of chromosome conformation capture (4C-seq) and DNA FISH. We assessed the robustness of the TAD architecture by using a series of genomic deletions and inversions that impact the integrity of this chromatin domain and that remodel long-range contacts. We report multi-partite associations between HoxD genes and up to three enhancers. We find that the loss of native chromatin topology leads to the remodeling of TAD structure following distinct parameters. Our results reveal that the recomposition of TAD architectures after large genomic re-arrangements is dependent on a boundary-selection mechanism in which CTCF mediates the gating of long-range contacts in combination with genomic distance and sequence specificity. Accordingly, the building of a recomposed TAD at this locus depends on distinct functional and constitutive parameters.
The Arabidopsis lyrata genome sequence and the basis of rapid genome size change
Energy Technology Data Exchange (ETDEWEB)
Hu, Tina T.; Pattyn, Pedro; Bakker, Erica G.; Cao, Jun; Cheng, Jan-Fang; Clark, Richard M.; Fahlgren, Noah; Fawcett, Jeffrey A.; Grimwood, Jane; Gundlach, Heidrun; Haberer, Georg; Hollister, Jesse D.; Ossowski, Stephan; Ottilar, Robert P.; Salamov, Asaf A.; Schneeberger, Korbinian; Spannagl, Manuel; Wang, Xi; Yang, Liang; Nasrallah, Mikhail E.; Bergelson, Joy; Carrington, James C.; Gaut, Brandon S.; Schmutz, Jeremy; Mayer, Klaus F. X.; Van de Peer, Yves; Grigoriev, Igor V.; Nordborg, Magnus; Weigel, Detlef; Guo, Ya-Long
2011-04-29
In our manuscript, we present a high-quality genome sequence of the Arabidopsis thaliana relative, Arabidopsis lyrata, produced by dideoxy sequencing. We have performed the usual types of genome analysis (gene annotation, dN/dS studies etc. etc.), but this is relegated to the Supporting Information. Instead, we focus on what was a major motivation for sequencing this genome, namely to understand how A. thaliana lost half its genome in a few million years and lived to tell the tale. The rather surprising conclusion is that there is not a single genomic feature that accounts for the reduced genome, but that every aspect centromeres, intergenic regions, transposable elements, gene family number is affected through hundreds of thousands of cuts. This strongly suggests that overall genome size in itself is what has been under selection, a suggestion that is strongly supported by our demonstration (using population genetics data from A. thaliana) that new deletions seem to be driven to fixation.
Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene
International Nuclear Information System (INIS)
Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.
1988-01-01
The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region
Determining injuries from posterior and flank stab wounds using computed tomography tractography.
Bansal, Vishal; Reid, Chris M; Fortlage, Dale; Lee, Jeanne; Kobayashi, Leslie; Doucet, Jay; Coimbra, Raul
2014-04-01
Unlike anterior stab wounds (SW), in which local exploration may direct management, posterior SW can be challenging to evaluate. Traditional triple contrast computed tomography (CT) imaging is cumbersome and technician-dependent. The present study examines the role of CT tractography as a strategy to manage select patients with back and flank SW. Hemodynamically stable patients with back and flank SW were studied. After resuscitation, Betadine- or Visipaque®-soaked sterile sponges were inserted into each SW for the estimated depth of the wound. Patients underwent abdominal helical CT scanning, including intravenous contrast, as the sole abdominal imaging study. Images were reviewed by an attending radiologist and trauma surgeon. The tractogram was evaluated to determine SW trajectory and injury to intra- or retroperitoneal organs, vascular structures, the diaphragm, and the urinary tract. Complete patient demographics including operative management and injuries were collected. Forty-one patients underwent CT tractography. In 11 patients, tractography detected violation of the intra- or retroperitoneal cavity leading to operative exploration. Injuries detected included: the spleen (two), colon (one), colonic mesentery (one), kidney (kidney), diaphragm (kidney), pneumothorax (seven), hemothorax (two), iliac artery (one), and traumatic abdominal wall hernia (two). In all patients, none had negative CT findings that failed observation. In this series, CT tractography is a safe and effective imaging strategy to evaluate posterior torso SW. It is unknown whether CT tractography is superior to traditional imaging modalities. Other uses for CT tractography may include determining trajectory from missile wounds and tangential penetrating injuries.
Misas, Elizabeth; Muñoz, José Fernando; Gallo, Juan Esteban; McEwen, Juan Guillermo; Clay, Oliver Keatinge
2016-04-01
The presence of repetitive or non-unique DNA persisting over sizable regions of a eukaryotic genome can hinder the genome's successful de novo assembly from short reads: ambiguities in assigning genome locations to the non-unique subsequences can result in premature termination of contigs and thus overfragmented assemblies. Fungal mitochondrial (mtDNA) genomes are compact (typically less than 100 kb), yet often contain short non-unique sequences that can be shown to impede their successful de novo assembly in silico. Such repeats can also confuse processes in the cell in vivo. A well-studied example is ectopic (out-of-register, illegitimate) recombination associated with repeat pairs, which can lead to deletion of functionally important genes that are located between the repeats. Repeats that remain conserved over micro- or macroevolutionary timescales despite such risks may indicate functionally or structurally (e.g., for replication) important regions. This principle could form the basis of a mining strategy for accelerating discovery of function in genome sequences. We present here our screening of a sample of 11 fully sequenced fungal mitochondrial genomes by observing where exact k-mer repeats occurred several times; initial analyses motivated us to focus on 17-mers occurring more than three times. Based on the diverse repeats we observe, we propose that such screening may serve as an efficient expedient for gaining a rapid but representative first insight into the repeat landscapes of sparsely characterized mitochondrial chromosomes. Our matching of the flagged repeats to previously reported regions of interest supports the idea that systems of persisting, non-trivial repeats in genomes can often highlight features meriting further attention. Copyright © 2016 Elsevier Ltd. All rights reserved.
Demographically-Based Evaluation of Genomic Regions under Selection in Domestic Dogs.
Directory of Open Access Journals (Sweden)
Adam H Freedman
2016-03-01
Full Text Available Controlling for background demographic effects is important for accurately identifying loci that have recently undergone positive selection. To date, the effects of demography have not yet been explicitly considered when identifying loci under selection during dog domestication. To investigate positive selection on the dog lineage early in the domestication, we examined patterns of polymorphism in six canid genomes that were previously used to infer a demographic model of dog domestication. Using an inferred demographic model, we computed false discovery rates (FDR and identified 349 outlier regions consistent with positive selection at a low FDR. The signals in the top 100 regions were frequently centered on candidate genes related to brain function and behavior, including LHFPL3, CADM2, GRIK3, SH3GL2, MBP, PDE7B, NTAN1, and GLRA1. These regions contained significant enrichments in behavioral ontology categories. The 3rd top hit, CCRN4L, plays a major role in lipid metabolism, that is supported by additional metabolism related candidates revealed in our scan, including SCP2D1 and PDXC1. Comparing our method to an empirical outlier approach that does not directly account for demography, we found only modest overlaps between the two methods, with 60% of empirical outliers having no overlap with our demography-based outlier detection approach. Demography-aware approaches have lower-rates of false discovery. Our top candidates for selection, in addition to expanding the set of neurobehavioral candidate genes, include genes related to lipid metabolism, suggesting a dietary target of selection that was important during the period when proto-dogs hunted and fed alongside hunter-gatherers.
Population genomics of parallel adaptation in threespine stickleback using sequenced RAD tags.
Directory of Open Access Journals (Sweden)
Paul A Hohenlohe
2010-02-01
Full Text Available Next-generation sequencing technology provides novel opportunities for gathering genome-scale sequence data in natural populations, laying the empirical foundation for the evolving field of population genomics. Here we conducted a genome scan of nucleotide diversity and differentiation in natural populations of threespine stickleback (Gasterosteus aculeatus. We used Illumina-sequenced RAD tags to identify and type over 45,000 single nucleotide polymorphisms (SNPs in each of 100 individuals from two oceanic and three freshwater populations. Overall estimates of genetic diversity and differentiation among populations confirm the biogeographic hypothesis that large panmictic oceanic populations have repeatedly given rise to phenotypically divergent freshwater populations. Genomic regions exhibiting signatures of both balancing and divergent selection were remarkably consistent across multiple, independently derived populations, indicating that replicate parallel phenotypic evolution in stickleback may be occurring through extensive, parallel genetic evolution at a genome-wide scale. Some of these genomic regions co-localize with previously identified QTL for stickleback phenotypic variation identified using laboratory mapping crosses. In addition, we have identified several novel regions showing parallel differentiation across independent populations. Annotation of these regions revealed numerous genes that are candidates for stickleback phenotypic evolution and will form the basis of future genetic analyses in this and other organisms. This study represents the first high-density SNP-based genome scan of genetic diversity and differentiation for populations of threespine stickleback in the wild. These data illustrate the complementary nature of laboratory crosses and population genomic scans by confirming the adaptive significance of previously identified genomic regions, elucidating the particular evolutionary and demographic history of such
Chromatin structure and evolution in the human genome
Directory of Open Access Journals (Sweden)
Dunlop Malcolm G
2007-05-01
Full Text Available Abstract Background Evolutionary rates are not constant across the human genome but genes in close proximity have been shown to experience similar levels of divergence and selection. The higher-order organisation of chromosomes has often been invoked to explain such phenomena but previously there has been insufficient data on chromosome structure to investigate this rigorously. Using the results of a recent genome-wide analysis of open and closed human chromatin structures we have investigated the global association between divergence, selection and chromatin structure for the first time. Results In this study we have shown that, paradoxically, synonymous site divergence (dS at non-CpG sites is highest in regions of open chromatin, primarily as a result of an increased number of transitions, while the rates of other traditional measures of mutation (intergenic, intronic and ancient repeat divergence as well as SNP density are highest in closed regions of the genome. Analysis of human-chimpanzee divergence across intron-exon boundaries indicates that although genes in relatively open chromatin generally display little selection at their synonymous sites, those in closed regions show markedly lower divergence at their fourfold degenerate sites than in neighbouring introns and intergenic regions. Exclusion of known Exonic Splice Enhancer hexamers has little affect on the divergence observed at fourfold degenerate sites across chromatin categories; however, we show that closed chromatin is enriched with certain classes of ncRNA genes whose RNA secondary structure may be particularly important. Conclusion We conclude that, overall, non-CpG mutation rates are lowest in open regions of the genome and that regions of the genome with a closed chromatin structure have the highest background mutation rate. This might reflect lower rates of DNA damage or enhanced DNA repair processes in regions of open chromatin. Our results also indicate that dS is a poor
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Automatic fitting of conical envelopes to free-form surfaces for flank CNC machining
Bo P.; Bartoň M.; Pottmann H.
2017-01-01
We propose a new algorithm to detect patches of free-form surfaces that can be well approximated by envelopes of a rotational cone under a rigid body motion. These conical envelopes are a preferable choice from the manufacturing point of view as they are, by-definition, manufacturable by computer numerically controlled (CNC) machining using the efficient flank (peripheral) method with standard conical tools. Our geometric approach exploits multi-valued vector fields that consist of vectors in...
Airborne sound insulation evaluation and flanking path prediction of coupled room
Tassia, R. D.; Asmoro, W. A.; Arifianto, D.
2016-11-01
One of the parameters to review the acoustic comfort is based on the value of the insulation partition in the classroom. The insulation value can be expressed by the sound transmission loss which converted into a single value as weighted sound reduction index (Rw, DnTw) and also have an additional sound correction factor in low frequency (C, Ctr) .In this study, the measurements were performed in two positions at each point using BSWA microphone and dodecahedron speaker as the sound source. The results of field measurements indicate the acoustic insulation values (DnT w + C) is 19.6 dB. It is noted that the partition wall not according to the standard which the DnTw + C> 51 dB. Hence the partition wall need to be redesign to improve acoustic insulation in the classroom. The design used gypsum board, plasterboard, cement board, and PVC as the replacement material. Based on the results, all the material is simulated in accordance with established standards. Best insulation is cement board with the insulation value is 69dB, the thickness of 12.5 mm on each side and the absorber material is 50 mm. Many factors lead to increase the value of acoustic insulation, such as the thickness of the panel, the addition of absorber material, density, and Poisson's ratio of a material. The prediction of flanking path can be estimated from noise reduction values at each measurement point in the class room. Based on data obtained, there is no significant change in noise reduction from each point so that the pathway of flanking is not affect the sound transmission in the classroom.
Audit, Benjamin; Zaghloul, Lamia; Baker, Antoine; Arneodo, Alain; Chen, Chun-Long; d'Aubenton-Carafa, Yves; Thermes, Claude
2013-01-01
In higher eukaryotes, the absence of specific sequence motifs, marking the origins of replication has been a serious hindrance to the understanding of (i) the mechanisms that regulate the spatio-temporal replication program, and (ii) the links between origins activation, chromatin structure and transcription. In this chapter, we review the partitioning of the human genome into megabased-size replication domains delineated as N-shaped motifs in the strand compositional asymmetry profiles. They collectively span 28.3% of the genome and are bordered by more than 1,000 putative replication origins. We recapitulate the comparison of this partition of the human genome with high-resolution experimental data that confirms that replication domain borders are likely to be preferential replication initiation zones in the germline. In addition, we highlight the specific distribution of experimental and numerical chromatin marks along replication domains. Domain borders correspond to particular open chromatin regions, possibly encoded in the DNA sequence, and around which replication and transcription are highly coordinated. These regions also present a high evolutionary breakpoint density, suggesting that susceptibility to breakage might be linked to local open chromatin fiber state. Altogether, this chapter presents a compartmentalization of the human genome into replication domains that are landmarks of the human genome organization and are likely to play a key role in genome dynamics during evolution and in pathological situations.
The complete chloroplast genome sequence of Dendrobium nobile.
Yan, Wenjin; Niu, Zhitao; Zhu, Shuying; Ye, Meirong; Ding, Xiaoyu
2016-11-01
The complete chloroplast (cp) genome sequence of Dendrobium nobile, an endangered and traditional Chinese medicine with important economic value, is presented in this article. The total genome size is 150,793 bp, containing a large single copy (LSC) region (84,939 bp) and a small single copy region (SSC) (13,310 bp) which were separated by two inverted repeat (IRs) regions (26,272 bp). The overall GC contents of the plastid genome were 38.8%. In total, 130 unique genes were annotated and they were consisted of 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. Fourteen genes contained one or two introns.
DEFF Research Database (Denmark)
Ebert, Grit; Steininger, Anne; Weißmann, Robert
2014-01-01
of the Williams-Beuren syndrome locus we demonstrate by cross-species comparison that these SDs have inserted at the borders of a topological domain and that they flank regions with distinct DNA conformation. CONCLUSIONS: Our study suggests a link of nuclear architecture and the propagation of SDs across......BACKGROUND: Segmental duplications (SDs) are not evenly distributed along chromosomes. The reasons for this biased susceptibility to SD insertion are poorly understood. Accumulation of SDs is associated with increased genomic instability, which can lead to structural variants and genomic disorders...... chromosome 7, either by promoting regional SD insertion or by contributing to the establishment of higher order chromatin organisation themselves. The latter could compensate for the high risk of structural rearrangements and thus may have contributed to their evolutionary fixation in the human genome....
Urantowka, Adam Dawid; Hajduk, Kacper; Kosowska, Barbara
2013-08-01
Amazona barbadensis is an endangered species of parrot living in northern coastal Venezuela and in several Caribbean islands. In this study, we sequenced full mitochondrial genome of the considered species. The total length of the mitogenome was 18,983 bp and contained 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, duplicated control region, and degenerate copies of ND6 and tRNA (Glu) genes. High degree of identity between two copies of control region suggests their coincident evolution and functionality. Comparative analysis of both the control region sequences from four Amazona species revealed their 89.1% identity over a region of 1300 bp and indicates the presence of distinctive parts of two control region copies.
Population Genomics of Infectious and Integrated Wolbachia pipientis Genomes in Drosophila ananassae
Choi, Jae Young; Bubnell, Jaclyn E.; Aquadro, Charles F.
2015-01-01
Coevolution between Drosophila and its endosymbiont Wolbachia pipientis has many intriguing aspects. For example, Drosophila ananassae hosts two forms of W. pipientis genomes: One being the infectious bacterial genome and the other integrated into the host nuclear genome. Here, we characterize the infectious and integrated genomes of W. pipientis infecting D. ananassae (wAna), by genome sequencing 15 strains of D. ananassae that have either the infectious or integrated wAna genomes. Results indicate evolutionarily stable maternal transmission for the infectious wAna genome suggesting a relatively long-term coevolution with its host. In contrast, the integrated wAna genome showed pseudogene-like characteristics accumulating many variants that are predicted to have deleterious effects if present in an infectious bacterial genome. Phylogenomic analysis of sequence variation together with genotyping by polymerase chain reaction of large structural variations indicated several wAna variants among the eight infectious wAna genomes. In contrast, only a single wAna variant was found among the seven integrated wAna genomes examined in lines from Africa, south Asia, and south Pacific islands suggesting that the integration occurred once from a single infectious wAna genome and then spread geographically. Further analysis revealed that for all D. ananassae we examined with the integrated wAna genomes, the majority of the integrated wAna genomic regions is represented in at least two copies suggesting a double integration or single integration followed by an integrated genome duplication. The possible evolutionary mechanism underlying the widespread geographical presence of the duplicate integration of the wAna genome is an intriguing question remaining to be answered. PMID:26254486
Surface waves on the tailward flanks of the Earth's magnetopause
Seon, J.; Frank, L. A.; Lazarus, A. J.; Lepping, R. P.
1995-01-01
Forty-three examples of ISEE 1 tailward flank side magnetopause crossings are examined and directly compared with upstream solar wind parameters. The crossings are classified into two groups. In the first group, a few sudden magnetopause crossings are observed, whereas repeated magnetopause crossings and oscillatory motions, often with boundary layer signatures, are observed in the second group. These distinctive characteristics of the two groups are interpreted in terms of the surface waves due to the Kelvin-Helmholtz instability. It is found that low solar wind speed tends to favor characteristics of the first group, whereas high solar wind speed yields those of the second group. However, no evident correlations between the groups and the interplanetary magnetic field directions are found.
Tabas-Madrid, Daniel; Méndez-Vigo, Belén; Arteaga, Noelia; Marcer, Arnald; Pascual-Montano, Alberto; Weigel, Detlef; Xavier Picó, F; Alonso-Blanco, Carlos
2018-03-08
Current global change is fueling an interest to understand the genetic and molecular mechanisms of plant adaptation to climate. In particular, altered flowering time is a common strategy for escape from unfavourable climate temperature. In order to determine the genomic bases underlying flowering time adaptation to this climatic factor, we have systematically analysed a collection of 174 highly diverse Arabidopsis thaliana accessions from the Iberian Peninsula. Analyses of 1.88 million single nucleotide polymorphisms provide evidence for a spatially heterogeneous contribution of demographic and adaptive processes to geographic patterns of genetic variation. Mountains appear to be allele dispersal barriers, whereas the relationship between flowering time and temperature depended on the precise temperature range. Environmental genome-wide associations supported an overall genome adaptation to temperature, with 9.4% of the genes showing significant associations. Furthermore, phenotypic genome-wide associations provided a catalogue of candidate genes underlying flowering time variation. Finally, comparison of environmental and phenotypic genome-wide associations identified known (Twin Sister of FT, FRIGIDA-like 1, and Casein Kinase II Beta chain 1) and new (Epithiospecifer Modifier 1 and Voltage-Dependent Anion Channel 5) genes as candidates for adaptation to climate temperature by altered flowering time. Thus, this regional collection provides an excellent resource to address the spatial complexity of climate adaptation in annual plants. © 2018 John Wiley & Sons Ltd.
Savvateeva-Popova, E V; Peresleni, A I; Sharagina, L M; Medvedeva, A V; Korochkina, S E; Grigor'eva, I V; Diuzhikova, N A; Popov, A V; Baricheva, E M; Karagodin, D; Heisenberg, M
2004-06-01
As the Human Genome and Drosophila Genome Projects were completed, it became clear that functions of human disease-associated genes may be elucidated by studying the phenotypic expression of mutations affecting their structural or functional homologs in Drosophila. Genomic diseases were identified as a new class of human disorders. Their cause is recombination, which takes place at gene-flanking duplicons to generate chromosome aberrations such as deletions, duplications, inversions, and translocations. The resulting imbalance of the dosage of developmentally important genes arises at a frequency of 10(-3) (higher than the mutation rate of individual genes) and leads to syndromes with multiple manifestations, including cognitive defects. Genomic DNA fragments were cloned from the Drosophila melanogaster agnostic locus, whose mutations impair learning ability and memory. As a result, the locus was exactly localized in X-chromosome region 11A containing the LIM kinase 1 (LIMK1) gene (CG1848), which is conserved among many species. Hemizygosity for the LIMK1 gene, which is caused by recombination at neighboring extended repeats, underlies cognitive disorders in human Williams syndrome. LIMK1 is a component of the integrin signaling cascade, which regulates the functions of the actin cytoskeleton, synaptogenesis, and morphogenesis in the developing brain. Immunofluorescence analysis revealed LIMK1 in all subdomains of the central complex and the visual system of Drosophila melanogaster. Like in the human genome, the D. melanogaster region is flanked by numerous repeats, which were detected by molecular genetic methods and analysis of ectopic chromosome pairing. The repeats determined a higher rate of spontaneous and induced recombination. including unequal crossing over, in the agnostic gene region. Hence, the agnostic locus was considered as the first D. melanogaster model suitable for studying the genetic defect associated with Williams syndrome in human.