WorldWideScience

Sample records for genome sequences differs

  1. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  2. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  3. Whole Genome Sequences of Three Treponema pallidum ssp. pertenue Strains: Yaws and Syphilis Treponemes Differ in Less than 0.2% of the Genome Sequence

    Science.gov (United States)

    Chen, Lei; Pospíšilová, Petra; Strouhal, Michal; Qin, Xiang; Mikalová, Lenka; Norris, Steven J.; Muzny, Donna M.; Gibbs, Richard A.; Fulton, Lucinda L.; Sodergren, Erica; Weinstock, George M.; Šmajs, David

    2012-01-01

    Background The yaws treponemes, Treponema pallidum ssp. pertenue (TPE) strains, are closely related to syphilis causing strains of Treponema pallidum ssp. pallidum (TPA). Both yaws and syphilis are distinguished on the basis of epidemiological characteristics, clinical symptoms, and several genetic signatures of the corresponding causative agents. Methodology/Principal Findings To precisely define genetic differences between TPA and TPE, high-quality whole genome sequences of three TPE strains (Samoa D, CDC-2, Gauthier) were determined using next-generation sequencing techniques. TPE genome sequences were compared to four genomes of TPA strains (Nichols, DAL-1, SS14, Chicago). The genome structure was identical in all three TPE strains with similar length ranging between 1,139,330 bp and 1,139,744 bp. No major genome rearrangements were found when compared to the four TPA genomes. The whole genome nucleotide divergence (dA) between TPA and TPE subspecies was 4.7 and 4.8 times higher than the observed nucleotide diversity (π) among TPA and TPE strains, respectively, corresponding to 99.8% identity between TPA and TPE genomes. A set of 97 (9.9%) TPE genes encoded proteins containing two or more amino acid replacements or other major sequence changes. The TPE divergent genes were mostly from the group encoding potential virulence factors and genes encoding proteins with unknown function. Conclusions/Significance Hypothetical genes, with genetic differences, consistently found between TPE and TPA strains are candidates for syphilitic treponemes virulence factors. Seventeen TPE genes were predicted under positive selection, and eleven of them coded either for predicted exported proteins or membrane proteins suggesting their possible association with the cell surface. Sequence changes between TPE and TPA strains and changes specific to individual strains represent suitable targets for subspecies- and strain-specific molecular diagnostics. PMID:22292095

  4. Comparative analysis of full genomic sequences among different genotypes of dengue virus type 3

    Directory of Open Access Journals (Sweden)

    Lin Ting-Hsiang

    2008-05-01

    Full Text Available Abstract Background Although the previous study demonstrated the envelope protein of dengue viruses is under purifying selection pressure, little is known about the genetic differences of full-length viral genomes of DENV-3. In our study, complete genomic sequencing of DENV-3 strains collected from different geographical locations and isolation years were determined and the sequence diversity as well as selection pressure sites in the DENV genome other than within the E gene were also analyzed. Results Using maximum likelihood and Bayesian approaches, our phylogenetic analysis revealed that the Taiwan's indigenous DENV-3 isolated from 1994 and 1998 dengue/DHF epidemics and one 1999 sporadic case were of the three different genotypes – I, II, and III, each associated with DENV-3 circulating in Indonesia, Thailand and Sri Lanka, respectively. Sequence diversity and selection pressure of different genomic regions among DENV-3 different genotypes was further examined to understand the global DENV-3 evolution. The highest nucleotide sequence diversity among the fully sequenced DENV-3 strains was found in the nonstructural protein 2A (mean ± SD: 5.84 ± 0.54 and envelope protein gene regions (mean ± SD: 5.04 ± 0.32. Further analysis found that positive selection pressure of DENV-3 may occur in the non-structural protein 1 gene region and the positive selection site was detected at position 178 of the NS1 gene. Conclusion Our study confirmed that the envelope protein is under purifying selection pressure although it presented higher sequence diversity. The detection of positive selection pressure in the non-structural protein along genotype II indicated that DENV-3 originated from Southeast Asia needs to monitor the emergence of DENV strains with epidemic potential for better epidemic prevention and vaccine development.

  5. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko; Tanaka, Tsuyoshi; Ohyanagi, Hajime; Hsing, Yue-Ie C.; Itoh, Takeshi

    2018-01-01

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  6. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko

    2018-02-14

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  7. Genome Sequence Databases (Overview): Sequencing and Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  8. Whole-genome sequencing reveals mutational landscape underlying phenotypic differences between two widespread Chinese cattle breeds

    OpenAIRE

    Xu, Yao; Jiang, Yu; Shi, Tao; Cai, Hanfang; Lan, Xianyong; Zhao, Xin; Plath, Martin; Chen, Hong

    2017-01-01

    Whole-genome sequencing provides a powerful tool to obtain more genetic variability that could produce a range of benefits for cattle breeding industry. Nanyang (Bos indicus) and Qinchuan (Bos taurus) are two important Chinese indigenous cattle breeds with distinct phenotypes. To identify the genetic characteristics responsible for variation in phenotypes between the two breeds, in the present study, we for the first time sequenced the genomes of four Nanyang and four Qinchuan cattle with 10 ...

  9. The complete genome sequence of Staphylothermus marinus reveals differences in sulfur metabolism among heterotrophic Crenarchaeota

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, iain J.; Dharmarajan, Lakshmi; Rodriguez, Jason; Hooper, Sean; Porat, Iris; Ulrich, Luke E.; Elkins, James G.; Mavromatis, Kostas; Sun, Hui; Land, Miriam; Lapidus, Alla; Lucas, Susan; Barry, Kerrie; Huber, Harald; Zhulin, Igor B.; Whitman, William B.; Mukhopadhyay, Biswarup; Woese, Carl; Bristow, James; Kyrpides, Nikos

    2008-09-05

    Staphylothermus marinus is an anaerobic, sulfur-reducing peptide fermenter of the archaeal phylum Crenarchaeota. It is the third heterotrophic, obligate sulfur reducing crenarchaeote to be sequenced and provides an opportunity for comparative analysis of the three genomes. The 1.57 Mbp genome of the hyperthermophilic crenarchaeote Staphylothermus marinus has been completely sequenced. The main energy generating pathways likely involve 2-oxoacid:ferredoxin oxidoreductases and ADP-forming acetyl-CoA synthases. S. marinus possesses several enzymes not present in other crenarchaeotes including a sodium ion-translocating decarboxylase likely to be involved in amino acid degradation. S. marinus lacks sulfur-reducing enzymes present in the other two sulfur-reducing crenarchaeotes that have been sequenced - Thermofilum pendens and Hyperthermus butylicus. Instead it has three operons similar to the mbh and mbx operons of Pyrococcus furiosus, which may play a role in sulfur reduction and/or hydrogen production. The two marine organisms, S. marinus and H. butylicus, possess more sodium-dependent transporters than T. pendens and use symporters for potassium uptake while T. pendens uses an ATP-dependent potassium transporter. T. pendens has adapted to a nutrient-rich environment while H. butylicus is adapted to a nutrient-poor environment, and S. marinus lies between these two extremes. The three heterotrophic sulfur-reducing crenarchaeotes have adapted to their habitats, terrestrial vs. marine, via their transporter content, and they have also adapted to environments with differing levels of nutrients. Despite the fact that they all use sulfur as an electron acceptor, they are likely to have different pathways for sulfur reduction.

  10. Whole-genome sequencing reveals mutational landscape underlying phenotypic differences between two widespread Chinese cattle breeds.

    Directory of Open Access Journals (Sweden)

    Yao Xu

    Full Text Available Whole-genome sequencing provides a powerful tool to obtain more genetic variability that could produce a range of benefits for cattle breeding industry. Nanyang (Bos indicus and Qinchuan (Bos taurus are two important Chinese indigenous cattle breeds with distinct phenotypes. To identify the genetic characteristics responsible for variation in phenotypes between the two breeds, in the present study, we for the first time sequenced the genomes of four Nanyang and four Qinchuan cattle with 10 to 12 fold on average of 97.86% and 98.98% coverage of genomes, respectively. Comparison with the Bos_taurus_UMD_3.1 reference assembly yielded 9,010,096 SNPs for Nanyang, and 6,965,062 for Qinchuan cattle, 51% and 29% of which were novel SNPs, respectively. A total of 154,934 and 115,032 small indels (1 to 3 bp were found in the Nanyang and Qinchuan genomes, respectively. The SNP and indel distribution revealed that Nanyang showed a genetically high diversity as compared to Qinchuan cattle. Furthermore, a total of 2,907 putative cases of copy number variation (CNV were identified by aligning Nanyang to Qinchuan genome, 783 of which (27% encompassed the coding regions of 495 functional genes. The gene ontology (GO analysis revealed that many CNV genes were enriched in the immune system and environment adaptability. Among several CNV genes related to lipid transport and fat metabolism, Lepin receptor gene (LEPR overlapping with CNV_1815 showed remarkably higher copy number in Qinchuan than Nanyang (log2 (ratio = -2.34988; P value = 1.53E-102. Further qPCR and association analysis investigated that the copy number of the LEPR gene presented positive correlations with transcriptional expression and phenotypic traits, suggesting the LEPR CNV may contribute to the higher fat deposition in muscles of Qinchuan cattle. Our findings provide evidence that the distinct phenotypes of Nanyang and Qinchuan breeds may be due to the different genetic variations including SNPs

  11. Whole-genome sequences of DA and F344 rats with different susceptibilities to arthritis, autoimmunity, inflammation and cancer.

    Science.gov (United States)

    Guo, Xiaosen; Brenner, Max; Zhang, Xuemei; Laragione, Teresina; Tai, Shuaishuai; Li, Yanhong; Bu, Junjie; Yin, Ye; Shah, Anish A; Kwan, Kevin; Li, Yingrui; Jun, Wang; Gulko, Pércio S

    2013-08-01

    DA (D-blood group of Palm and Agouti, also known as Dark Agouti) and F344 (Fischer) are two inbred rat strains with differences in several phenotypes, including susceptibility to autoimmune disease models and inflammatory responses. While these strains have been extensively studied, little information is available about the DA and F344 genomes, as only the Brown Norway (BN) and spontaneously hypertensive rat strains have been sequenced to date. Here we report the sequencing of the DA and F344 genomes using next-generation Illumina paired-end read technology and the first de novo assembly of a rat genome. DA and F344 were sequenced with an average depth of 32-fold, covered 98.9% of the BN reference genome, and included 97.97% of known rat ESTs. New sequences could be assigned to 59 million positions with previously unknown data in the BN reference genome. Differences between DA, F344, and BN included 19 million positions in novel scaffolds, 4.09 million single nucleotide polymorphisms (SNPs) (including 1.37 million new SNPs), 458,224 short insertions and deletions, and 58,174 structural variants. Genetic differences between DA, F344, and BN, including high-impact SNPs and short insertions and deletions affecting >2500 genes, are likely to account for most of the phenotypic variation between these strains. The new DA and F344 genome sequencing data should facilitate gene discovery efforts in rat models of human disease.

  12. Whole-Genome Sequences of DA and F344 Rats with Different Susceptibilities to Arthritis, Autoimmunity, Inflammation and Cancer

    Science.gov (United States)

    Guo, Xiaosen; Brenner, Max; Zhang, Xuemei; Laragione, Teresina; Tai, Shuaishuai; Li, Yanhong; Bu, Junjie; Yin, Ye; Shah, Anish A.; Kwan, Kevin; Li, Yingrui; Jun, Wang; Gulko, Pércio S.

    2013-01-01

    DA (D-blood group of Palm and Agouti, also known as Dark Agouti) and F344 (Fischer) are two inbred rat strains with differences in several phenotypes, including susceptibility to autoimmune disease models and inflammatory responses. While these strains have been extensively studied, little information is available about the DA and F344 genomes, as only the Brown Norway (BN) and spontaneously hypertensive rat strains have been sequenced to date. Here we report the sequencing of the DA and F344 genomes using next-generation Illumina paired-end read technology and the first de novo assembly of a rat genome. DA and F344 were sequenced with an average depth of 32-fold, covered 98.9% of the BN reference genome, and included 97.97% of known rat ESTs. New sequences could be assigned to 59 million positions with previously unknown data in the BN reference genome. Differences between DA, F344, and BN included 19 million positions in novel scaffolds, 4.09 million single nucleotide polymorphisms (SNPs) (including 1.37 million new SNPs), 458,224 short insertions and deletions, and 58,174 structural variants. Genetic differences between DA, F344, and BN, including high-impact SNPs and short insertions and deletions affecting >2500 genes, are likely to account for most of the phenotypic variation between these strains. The new DA and F344 genome sequencing data should facilitate gene discovery efforts in rat models of human disease. PMID:23695301

  13. Preferences for learning different types of genome sequencing results among young breast cancer patients: Role of psychological and clinical factors.

    Science.gov (United States)

    Kaphingst, Kimberly A; Ivanovich, Jennifer; Lyons, Sarah; Biesecker, Barbara; Dresser, Rebecca; Elrick, Ashley; Matsen, Cindy; Goodman, Melody

    2018-01-29

    The growing importance of genome sequencing means that patients will increasingly face decisions regarding what results they would like to learn. The present study examined psychological and clinical factors that might affect these preferences. 1,080 women diagnosed with breast cancer at age 40 or younger completed an online survey. We assessed their interest in learning various types of genome sequencing results: risk of preventable disease or unpreventable disease, cancer treatment response, uncertain meaning, risk to relatives' health, and ancestry/physical traits. Multivariable logistic regression was used to examine whether being "very" interested in each result type was associated with clinical factors: BRCA1/2 mutation status, prior genetic testing, family history of breast cancer, and psychological factors: cancer recurrence worry, genetic risk worry, future orientation, health information orientation, and genome sequencing knowledge. The proportion of respondents who were very interested in learning each type of result ranged from 16% to 77%. In all multivariable models, those who were very interested in learning a result type had significantly higher knowledge about sequencing benefits, greater genetic risks worry, and stronger health information orientation compared to those with less interest (p-values psychological factors. Shared decision-making approaches that increase knowledge about genome sequencing and incorporate patient preferences for health information and learning about genetic risks may help support patients' informed choices about learning different types of sequencing results. © Society of Behavioral Medicine 2018.

  14. Draft genome sequencing of giardia intestinalis assemblage B isolate GS: is human giardiasis caused by two different species?

    Directory of Open Access Journals (Sweden)

    Oscar Franzén

    2009-08-01

    Full Text Available Giardia intestinalis is a major cause of diarrheal disease worldwide and two major Giardia genotypes, assemblages A and B, infect humans. The genome of assemblage A parasite WB was recently sequenced, and the structurally compact 11.7 Mbp genome contains simplified basic cellular machineries and metabolism. We here performed 454 sequencing to 16x coverage of the assemblage B isolate GS, the only Giardia isolate successfully used to experimentally infect animals and humans. The two genomes show 77% nucleotide and 78% amino-acid identity in protein coding regions. Comparative analysis identified 28 unique GS and 3 unique WB protein coding genes, and the variable surface protein (VSP repertoires of the two isolates are completely different. The promoters of several enzymes involved in the synthesis of the cyst-wall lack binding sites for encystation-specific transcription factors in GS. Several synteny-breaks were detected and verified. The tetraploid GS genome shows higher levels of overall allelic sequence polymorphism (0.5 versus <0.01% in WB. The genomic differences between WB and GS may explain some of the observed biological and clinical differences between the two isolates, and it suggests that assemblage A and B Giardia can be two different species.

  15. Draft Genome Sequence of Lactobacillus rhamnosus 2166.

    OpenAIRE

    Karlyshev, Andrey V.; Melnikov, Vyacheslav G.; Kosarev, Igor V.; Abramov, Vyacheslav M.

    2014-01-01

    In this report, we present a draft sequence of the genome of Lactobacillus rhamnosus strain 2166, a potential novel probiotic. Genome annotation and read mapping onto a reference genome of L. rhamnosus strain GG allowed for the identification of the differences and similarities in the genomic contents and gene arrangements of these strains.

  16. Genomic sequencing in clinical trials

    OpenAIRE

    Mestan, Karen K; Ilkhanoff, Leonard; Mouli, Samdeep; Lin, Simon

    2011-01-01

    Abstract Human genome sequencing is the process by which the exact order of nucleic acid base pairs in the 24 human chromosomes is determined. Since the completion of the Human Genome Project in 2003, genomic sequencing is rapidly becoming a major part of our translational research efforts to understand and improve human health and disease. This article reviews the current and future directions of clinical research with respect to genomic sequencing, a technology that is just beginning to fin...

  17. Genomic Selection Using Genotyping-By-Sequencing Data with Different Coverage Depth in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Cericola, Fabio; Fé, Dario; Janss, Luc

    2015-01-01

    the diagonal elements by estimating the amount of genetic variance caused by the reduction of the coverage depth. Secondly we developed a method to scale the relationship matrix by taking into account the overall amount of pairwise non-missing loci between all families. Rust resistance and heading date were......Genotyping by sequencing (GBS) allows generating up to millions of molecular markers with a cost per sample which is proportional to the level of multiplexing. Increasing the sample multiplexing decreases the genotyping price but also reduces the numbers of reads per marker. In this work we...... investigated how this reduction of the coverage depth affects the genomic relationship matrices used to estimated breeding value of F2 family pools in perennial ryegrass. A total of 995 families were genotyped via GBS providing more than 1.8M allele frequency estimates for each family with an average coverage...

  18. Targeted sequencing of plant genomes

    Science.gov (United States)

    Mark D. Huynh

    2014-01-01

    Next-generation sequencing (NGS) has revolutionized the field of genetics by providing a means for fast and relatively affordable sequencing. With the advancement of NGS, wholegenome sequencing (WGS) has become more commonplace. However, sequencing an entire genome is still not cost effective or even beneficial in all cases. In studies that do not require a whole-...

  19. Plantagora: modeling whole genome sequencing and assembly of plant genomes.

    Directory of Open Access Journals (Sweden)

    Roger Barthelson

    Full Text Available BACKGROUND: Genomics studies are being revolutionized by the next generation sequencing technologies, which have made whole genome sequencing much more accessible to the average researcher. Whole genome sequencing with the new technologies is a developing art that, despite the large volumes of data that can be produced, may still fail to provide a clear and thorough map of a genome. The Plantagora project was conceived to address specifically the gap between having the technical tools for genome sequencing and knowing precisely the best way to use them. METHODOLOGY/PRINCIPAL FINDINGS: For Plantagora, a platform was created for generating simulated reads from several different plant genomes of different sizes. The resulting read files mimicked either 454 or Illumina reads, with varying paired end spacing. Thousands of datasets of reads were created, most derived from our primary model genome, rice chromosome one. All reads were assembled with different software assemblers, including Newbler, Abyss, and SOAPdenovo, and the resulting assemblies were evaluated by an extensive battery of metrics chosen for these studies. The metrics included both statistics of the assembly sequences and fidelity-related measures derived by alignment of the assemblies to the original genome source for the reads. The results were presented in a website, which includes a data graphing tool, all created to help the user compare rapidly the feasibility and effectiveness of different sequencing and assembly strategies prior to testing an approach in the lab. Some of our own conclusions regarding the different strategies were also recorded on the website. CONCLUSIONS/SIGNIFICANCE: Plantagora provides a substantial body of information for comparing different approaches to sequencing a plant genome, and some conclusions regarding some of the specific approaches. Plantagora also provides a platform of metrics and tools for studying the process of sequencing and assembly

  20. Genomic Variance Estimation Based on Genotyping-by-Sequencing with Different Coverage in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Ashraf, Bilal; Fé, Dario; Jensen, Just

    2014-01-01

    at each SNP in family pools or polyploids. There are, however, several statistical challenges associated with this method, including low sequencing depth and missing values. Low sequencing depth results in inaccuracies in estimates of allele frequencies for each SNP. In this work we have focused...

  1. The Sequenced Angiosperm Genomes and Genome Databases.

    Science.gov (United States)

    Chen, Fei; Dong, Wei; Zhang, Jiawei; Guo, Xinyue; Chen, Junhao; Wang, Zhengjia; Lin, Zhenguo; Tang, Haibao; Zhang, Liangsheng

    2018-01-01

    Angiosperms, the flowering plants, provide the essential resources for human life, such as food, energy, oxygen, and materials. They also promoted the evolution of human, animals, and the planet earth. Despite the numerous advances in genome reports or sequencing technologies, no review covers all the released angiosperm genomes and the genome databases for data sharing. Based on the rapid advances and innovations in the database reconstruction in the last few years, here we provide a comprehensive review for three major types of angiosperm genome databases, including databases for a single species, for a specific angiosperm clade, and for multiple angiosperm species. The scope, tools, and data of each type of databases and their features are concisely discussed. The genome databases for a single species or a clade of species are especially popular for specific group of researchers, while a timely-updated comprehensive database is more powerful for address of major scientific mysteries at the genome scale. Considering the low coverage of flowering plants in any available database, we propose construction of a comprehensive database to facilitate large-scale comparative studies of angiosperm genomes and to promote the collaborative studies of important questions in plant biology.

  2. Assembly of the Lactuca sativa, L. cv. Tizian draft genome sequence reveals differences within major resistance complex 1 as compared to the cv. Salinas reference genome.

    Science.gov (United States)

    Verwaaijen, Bart; Wibberg, Daniel; Nelkner, Johanna; Gordin, Miriam; Rupp, Oliver; Winkler, Anika; Bremges, Andreas; Blom, Jochen; Grosch, Rita; Pühler, Alfred; Schlüter, Andreas

    2018-02-10

    Lettuce (Lactuca sativa, L.) is an important annual plant of the family Asteraceae (Compositae). The commercial lettuce cultivar Tizian has been used in various scientific studies investigating the interaction of the plant with phytopathogens or biological control agents. Here, we present the de novo draft genome sequencing and gene prediction for this specific cultivar derived from transcriptome sequence data. The assembled scaffolds amount to a size of 2.22 Gb. Based on RNAseq data, 31,112 transcript isoforms were identified. Functional predictions for these transcripts were determined within the GenDBE annotation platform. Comparison with the cv. Salinas reference genome revealed a high degree of sequence similarity on genome and transcriptome levels, with an average amino acid identity of 99%. Furthermore, it was observed that two large regions are either missing or are highly divergent within the cv. Tizian genome compared to cv. Salinas. One of these regions covers the major resistance complex 1 region of cv. Salinas. The cv. Tizian draft genome sequence provides a valuable resource for future functional and transcriptome analyses focused on this lettuce cultivar. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Solving the Problem of Comparing Whole Bacterial Genomes across Different Sequencing Platforms

    DEFF Research Database (Denmark)

    Kaas, Rolf Sommer; Leekitcharoenphon, Pimlapas; Aarestrup, Frank Møller

    2014-01-01

    technology because each technology has a systematic bias making integration of data generated from different platforms difficult. We developed two different procedures for identifying variable sites and inferring phylogenies in WGS data across multiple platforms. The methods were evaluated on three bacterial...

  4. Region-wide and ecotype-specific differences in demographic histories of threespine stickleback populations, estimated from whole genome sequences.

    Science.gov (United States)

    Liu, Shenglin; Hansen, Michael M; Jacobsen, Magnus W

    2016-10-01

    We analysed 81 whole genome sequences of threespine sticklebacks from Pacific North America, Greenland and Northern Europe, representing 16 populations. Principal component analysis of nuclear SNPs grouped populations according to geographical location, with Pacific populations being more divergent from each other relative to European and Greenlandic populations. Analysis of mitogenome sequences showed Northern European populations to represent a single phylogeographical lineage, whereas Greenlandic and particularly Pacific populations showed admixture between lineages. We estimated demographic history using a genomewide coalescence with recombination approach. The Pacific populations showed gradual population expansion starting >100 Kya, possibly reflecting persistence in cryptic refuges near the present distributional range, although we do not rule out possible influence of ancient admixture. Sharp population declines ca. 14-15 Kya were suggested to reflect founding of freshwater populations by marine ancestors. In Greenland and Northern Europe, demographic expansion started ca. 20-25 Kya coinciding with the end of the Last Glacial Maximum. In both regions, marine and freshwater populations started to show different demographic trajectories ca. 8-9 Kya, suggesting that this was the time of recolonization. In Northern Europe, this estimate was surprisingly late, but found support in subfossil evidence for presence of several freshwater fish species but not sticklebacks 12 Kya. The results demonstrate distinctly different demographic histories across geographical regions with potential consequences for adaptive processes. They also provide empirical support for previous assumptions about freshwater populations being founded independently from large, coherent marine populations, a key element in the Transporter Hypothesis invoked to explain the widespread occurrence of parallel evolution across freshwater stickleback populations. © 2016 John Wiley & Sons Ltd.

  5. Insights from 20 years of bacterial genome sequencing

    DEFF Research Database (Denmark)

    Land, Miriam; Hauser, Loren; Jun, Se-Ran

    2015-01-01

    Since the first two complete bacterial genome sequences were published in 1995, the science of bacteria has dramatically changed. Using third-generation DNA sequencing, it is possible to completely sequence a bacterial genome in a few hours and identify some types of methylation sites along...... the genome as well. Sequencing of bacterial genome sequences is now a standard procedure, and the information from tens of thousands of bacterial genomes has had a major impact on our views of the bacterial world. In this review, we explore a series of questions to highlight some insights that comparative...... genomics has produced. To date, there are genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. However, the distribution is quite skewed towards a few phyla that contain model organisms. But the breadth is continuing to improve, with projects dedicated to filling...

  6. Genome Sequencing Identifies Two Nearly Unchanged Strains of Persistent Listeria monocytogenes Isolated at Two Different Fish Processing Plants Sampled 6 Years Apart

    DEFF Research Database (Denmark)

    Holch, Anne; Webb, Kristen; Lukjancenko, Oksana

    2013-01-01

    Listeria monocytogenes is a food-borne human-pathogenic bacterium that can cause infections with a high mortality rate. It has a remarkable ability to persist in food processing facilities. Here we report the genome sequences for two L. monocytogenes strains (N53-1 and La111) that were isolated 6...... that has been isolated as a persistent subtype in several European countries. The purpose of this study was to use genome analyses to identify genes or proteins that could contribute to persistence. In a genome comparison, the two persistent strains were extremely similar and collectively differed from...... are required to determine if the absence of these genes promotes persistence. While the genome comparison did not point to a clear physiological explanation of the persistent phenotype, the remarkable similarity between the two strains indicates that subtypes with specific traits are selected for in the food...

  7. Sequencing intractable DNA to close microbial genomes.

    Directory of Open Access Journals (Sweden)

    Richard A Hurt

    Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  8. Sequencing Intractable DNA to Close Microbial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL

    2012-01-01

    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  9. Snake Genome Sequencing: Results and Future Prospects.

    Science.gov (United States)

    Kerkkamp, Harald M I; Kini, R Manjunatha; Pospelov, Alexey S; Vonk, Freek J; Henkel, Christiaan V; Richardson, Michael K

    2016-12-01

    Snake genome sequencing is in its infancy-very much behind the progress made in sequencing the genomes of humans, model organisms and pathogens relevant to biomedical research, and agricultural species. We provide here an overview of some of the snake genome projects in progress, and discuss the biological findings, with special emphasis on toxinology, from the small number of draft snake genomes already published. We discuss the future of snake genomics, pointing out that new sequencing technologies will help overcome the problem of repetitive sequences in assembling snake genomes. Genome sequences are also likely to be valuable in examining the clustering of toxin genes on the chromosomes, in designing recombinant antivenoms and in studying the epigenetic regulation of toxin gene expression.

  10. Snake Genome Sequencing: Results and Future Prospects

    Directory of Open Access Journals (Sweden)

    Harald M. I. Kerkkamp

    2016-12-01

    Full Text Available Snake genome sequencing is in its infancy—very much behind the progress made in sequencing the genomes of humans, model organisms and pathogens relevant to biomedical research, and agricultural species. We provide here an overview of some of the snake genome projects in progress, and discuss the biological findings, with special emphasis on toxinology, from the small number of draft snake genomes already published. We discuss the future of snake genomics, pointing out that new sequencing technologies will help overcome the problem of repetitive sequences in assembling snake genomes. Genome sequences are also likely to be valuable in examining the clustering of toxin genes on the chromosomes, in designing recombinant antivenoms and in studying the epigenetic regulation of toxin gene expression.

  11. Synaptotagmin gene content of the sequenced genomes

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2004-07-01

    Full Text Available Abstract Background Synaptotagmins exist as a large gene family in mammals. There is much interest in the function of certain family members which act crucially in the regulated synaptic vesicle exocytosis required for efficient neurotransmission. Knowledge of the functions of other family members is relatively poor and the presence of Synaptotagmin genes in plants indicates a role for the family as a whole which is wider than neurotransmission. Identification of the Synaptotagmin genes within completely sequenced genomes can provide the entire Synaptotagmin gene complement of each sequenced organism. Defining the detailed structures of all the Synaptotagmin genes and their encoded products can provide a useful resource for functional studies and a deeper understanding of the evolution of the gene family. The current rapid increase in the number of sequenced genomes from different branches of the tree of life, together with the public deposition of evolutionarily diverse transcript sequences make such studies worthwhile. Results I have compiled a detailed list of the Synaptotagmin genes of Caenorhabditis, Anopheles, Drosophila, Ciona, Danio, Fugu, Mus, Homo, Arabidopsis and Oryza by examining genomic and transcript sequences from public sequence databases together with some transcript sequences obtained by cDNA library screening and RT-PCR. I have compared all of the genes and investigated the relationship between plant Synaptotagmins and their non-Synaptotagmin counterparts. Conclusions I have identified and compared 98 Synaptotagmin genes from 10 sequenced genomes. Detailed comparison of transcript sequences reveals abundant and complex variation in Synaptotagmin gene expression and indicates the presence of Synaptotagmin genes in all animals and land plants. Amino acid sequence comparisons indicate patterns of conservation and diversity in function. Phylogenetic analysis shows the origin of Synaptotagmins in multicellular eukaryotes and their

  12. Whole genome sequence analysis of Mycobacterium suricattae

    KAUST Repository

    Dippenaar, Anzaan; Parsons, Sven David Charles; Sampson, Samantha Leigh; Van Der Merwe, Ruben Gerhard; Drewe, Julian Ashley; Abdallah, Abdallah; Siame, Kabengele Keith; Gey Van Pittius, Nicolaas Claudius; Van Helden, Paul David; Pain, Arnab; Warren, Robin Mark

    2015-01-01

    Tuberculosis occurs in various mammalian hosts and is caused by a range of different lineages of the Mycobacterium tuberculosis complex (MTBC). A recently described member, Mycobacterium suricattae, causes tuberculosis in meerkats (Suricata suricatta) in Southern Africa and preliminary genetic analysis showed this organism to be closely related to an MTBC pathogen of rock hyraxes (Procavia capensis), the dassie bacillus. Here we make use of whole genome sequencing to describe the evolution of the genome of M. suricattae, including known and novel regions of difference, SNPs and IS6110 insertion sites. We used genome-wide phylogenetic analysis to show that M. suricattae clusters with the chimpanzee bacillus, previously isolated from a chimpanzee (Pan troglodytes) in West Africa. We propose an evolutionary scenario for the Mycobacterium africanum lineage 6 complex, showing the evolutionary relationship of M. africanum and chimpanzee bacillus, and the closely related members M. suricattae, dassie bacillus and Mycobacterium mungi.

  13. Whole genome sequence analysis of Mycobacterium suricattae

    KAUST Repository

    Dippenaar, Anzaan

    2015-10-21

    Tuberculosis occurs in various mammalian hosts and is caused by a range of different lineages of the Mycobacterium tuberculosis complex (MTBC). A recently described member, Mycobacterium suricattae, causes tuberculosis in meerkats (Suricata suricatta) in Southern Africa and preliminary genetic analysis showed this organism to be closely related to an MTBC pathogen of rock hyraxes (Procavia capensis), the dassie bacillus. Here we make use of whole genome sequencing to describe the evolution of the genome of M. suricattae, including known and novel regions of difference, SNPs and IS6110 insertion sites. We used genome-wide phylogenetic analysis to show that M. suricattae clusters with the chimpanzee bacillus, previously isolated from a chimpanzee (Pan troglodytes) in West Africa. We propose an evolutionary scenario for the Mycobacterium africanum lineage 6 complex, showing the evolutionary relationship of M. africanum and chimpanzee bacillus, and the closely related members M. suricattae, dassie bacillus and Mycobacterium mungi.

  14. Structural variation and rates of genome evolution in the grass family seen through comparison of sequences of genomes greatly differing in size.

    Science.gov (United States)

    Dvorak, Jan; Wang, Le; Zhu, Tingting; Jorgensen, Chad M; Deal, Karin R; Dai, Xiongtao; Dawson, Matthew W; Müller, Hans-Georg; Luo, Ming-Cheng; Ramasamy, Ramesh K; Dehghani, Hamid; Gu, Yong Q; Gill, Bikram S; Distelfeld, Assaf; Devos, Katrien M; Qi, Peng; You, Frank M; Gulick, Patrick J; McGuire, Patrick E

    2018-05-16

    Homology was searched with genes annotated in the Aegilops tauschii pseudomolecules against genes annotated in the pseudomolecules of tetraploid wild emmer wheat, Brachypodium distachyon, sorghum, and rice. Similar searches were initiated with genes annotated in the rice pseudomolecules. Matrices of colinear genes and rearrangements in their order were constructed. Optical Bionano genome maps were constructed and used to validate rearrangements unique to the wild emmer and Ae. tauschii genomes. Most common rearrangements were short paracentric inversions and short intrachromosomal translocations. Intrachromosomal translocations outnumbered segmental intrachromosomal duplications. The densities of paracentric inversion lengths were approximated by exponential distributions in all six genomes. Densities of colinear genes along the Ae. tauschii chromosomes were highly correlated with meiotic recombination rates but those of rearrangements were not, suggesting different causes of the erosion of gene colinearity and evolution of major chromosome rearrangements. Frequent rearrangements sharing breakpoints suggested that chromosomes have been rearranged recurrently at some sites. The distal 4 Mb of the short arms of rice chromosomes Os11 and Os12 and corresponding regions in the sorghum, B. distachyon, and Triticeae genomes contain clusters of interstitial translocations including from 1 to 7 colinear genes. The rates of acquisition of major rearrangements were greater in the wild emmer wheat and Ae. tauschii genomes than in the lineage preceding their divergence or in the B. distachyon, rice, and sorghum lineages. It is suggested that synergy between large quantities of dynamic transposable elements and annual growth habit caused the fast evolution of the Triticeae genomes. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  15. The Genome Sequence of Methanohalophilus mahii SLPT Reveals Differences in the Energy Metabolism among Members of the Methanosarcinaceae Inhabiting Freshwater and Saline Environments

    Directory of Open Access Journals (Sweden)

    Stefan Spring

    2010-01-01

    Full Text Available Methanohalophilus mahii is the type species of the genus Methanohalophilus, which currently comprises three distinct species with validly published names. Mhp. mahii represents moderately halophilic methanogenic archaea with a strictly methylotrophic metabolism. The type strain SLPT was isolated from hypersaline sediments collected from the southern arm of Great Salt Lake, Utah. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,012,424 bp genome is a single replicon with 2032 protein-coding and 63 RNA genes and part of the Genomic Encyclopedia of Bacteria and Archaea project. A comparison of the reconstructed energy metabolism in the halophilic species Mhp. mahii with other representatives of the Methanosarcinaceae reveals some interesting differences to freshwater species.

  16. The Genome Sequence of Methanohalophilus mahii SLPT Reveals Differences in the Energy Metabolism among Members of the Methanosarcinaceae Inhabiting Freshwater and Saline Environments

    Energy Technology Data Exchange (ETDEWEB)

    Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Scheuner, Carmen [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Chen, Feng [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Lykidis, A [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Brettin, Thomas S [ORNL; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2010-01-01

    Methanohalophilus mahii is the type species of the genus Methanohalophilus, which currently comprises three distinct species with validly published names. Mhp. mahii represents moderately halophilic methanogenic archaea with a strictly methylotrophic metabolism. The type strain SLPT was isolated from hypersaline sediments collected from the southern arm of Great Salt Lake, Utah. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,012,424 bp genome is a single replicon with 2032 protein-coding and 63 RNA genes and part of the Genomic Encyclopedia of Bacteria and Archaea project. A comparison of the reconstructed energy metabolism in the halophilic species Mhp. mahii with other representatives of the Methanosarcinaceae reveals some interesting differences to freshwater species.

  17. The Genome Sequence of Methanohalophilus mahii SLPT Reveals Differences in the Energy Metabolism among Members of the Methanosarcinaceae Inhabiting Freshwater and Saline Environments

    Energy Technology Data Exchange (ETDEWEB)

    Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Scheuner, Carmen [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [Joint Genome Institute, Walnut Creek, California; Lucas, Susan [Joint Genome Institute, Walnut Creek, California; Glavina Del Rio, Tijana [Joint Genome Institute, Walnut Creek, California; Tice, Hope [Joint Genome Institute, Walnut Creek, California; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [Joint Genome Institute, Walnut Creek, California; Chen, Feng [Joint Genome Institute, Walnut Creek, California; Nolan, Matt [Joint Genome Institute, Walnut Creek, California; Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Pitluck, Samuel [ORNL; Liolios, Konstantinos [Joint Genome Institute, Walnut Creek, California; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Lykidis, A [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [Joint Genome Institute, Walnut Creek, California; Palaniappan, Krishna [Joint Genome Institute, Walnut Creek, California; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia D [ORNL; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Detter, J. Chris [Joint Genome Institute, Walnut Creek, California; Brettin, Thomas S [ORNL; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [ORNL; Bristow, James [Joint Genome Institute, Walnut Creek, California; Eisen, Jonathan [Joint Genome Institute, Walnut Creek, California; Markowitz, Victor [Joint Genome Institute, Walnut Creek, California; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpidis, Nikos C [ORNL; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2010-12-01

    Methanohalophilus mahii is the type species of the genus Methanohalophilus, which currently comprises three distinct species with validly published names. Mhp. mahii represents moderately halophilic methanogenic archaea with a strictly methylotrophic metabolism. The type strain SLPT was isolated from hypersaline sediments collected from the southern arm of Great Salt Lake, Utah. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,012,424 bp genome is a single replicon with 2032 protein-coding and 63 RNA genes and part of the Genomic Encyclopedia of Bacteria and Archaea project. A comparison of the reconstructed energy metabolism in the halophilic species Mhp. mahii with other representatives of the Methanosarcinaceae reveals some interesting differences to freshwater species.

  18. An evaluation of Comparative Genome Sequencing (CGS by comparing two previously-sequenced bacterial genomes

    Directory of Open Access Journals (Sweden)

    Herring Christopher D

    2007-08-01

    Full Text Available Abstract Background With the development of new technology, it has recently become practical to resequence the genome of a bacterium after experimental manipulation. It is critical though to know the accuracy of the technique used, and to establish confidence that all of the mutations were detected. Results In order to evaluate the accuracy of genome resequencing using the microarray-based Comparative Genome Sequencing service provided by Nimblegen Systems Inc., we resequenced the E. coli strain W3110 Kohara using MG1655 as a reference, both of which have been completely sequenced using traditional sequencing methods. CGS detected 7 of 8 small sequence differences, one large deletion, and 9 of 12 IS element insertions present in W3110, but did not detect a large chromosomal inversion. In addition, we confirmed that CGS also detected 2 SNPs, one deletion and 7 IS element insertions that are not present in the genome sequence, which we attribute to changes that occurred after the creation of the W3110 lambda clone library. The false positive rate for SNPs was one per 244 Kb of genome sequence. Conclusion CGS is an effective way to detect multiple mutations present in one bacterium relative to another, and while highly cost-effective, is prone to certain errors. Mutations occurring in repeated sequences or in sequences with a high degree of secondary structure may go undetected. It is also critical to follow up on regions of interest in which SNPs were not called because they often indicate deletions or IS element insertions.

  19. Genome sequence of Lactobacillus rhamnosus ATCC 8530.

    Science.gov (United States)

    Pittet, Vanessa; Ewen, Emily; Bushell, Barry R; Ziola, Barry

    2012-02-01

    Lactobacillus rhamnosus is found in the human gastrointestinal tract and is important for probiotics. We became interested in L. rhamnosus isolate ATCC 8530 in relation to beer spoilage and hops resistance. We report here the genome sequence of this isolate, along with a brief comparison to other available L. rhamnosus genome sequences.

  20. Genome Sequence of Lactobacillus rhamnosus ATCC 8530

    OpenAIRE

    Pittet, Vanessa; Ewen, Emily; Bushell, Barry R.; Ziola, Barry

    2012-01-01

    Lactobacillus rhamnosus is found in the human gastrointestinal tract and is important for probiotics. We became interested in L. rhamnosus isolate ATCC 8530 in relation to beer spoilage and hops resistance. We report here the genome sequence of this isolate, along with a brief comparison to other available L. rhamnosus genome sequences.

  1. A plant pathology perspective of fungal genome sequencing.

    Science.gov (United States)

    Aylward, Janneke; Steenkamp, Emma T; Dreyer, Léanne L; Roets, Francois; Wingfield, Brenda D; Wingfield, Michael J

    2017-06-01

    The majority of plant pathogens are fungi and many of these adversely affect food security. This mini-review aims to provide an analysis of the plant pathogenic fungi for which genome sequences are publically available, to assess their general genome characteristics, and to consider how genomics has impacted plant pathology. A list of sequenced fungal species was assembled, the taxonomy of all species verified, and the potential reason for sequencing each of the species considered. The genomes of 1090 fungal species are currently (October 2016) in the public domain and this number is rapidly rising. Pathogenic species comprised the largest category (35.5 %) and, amongst these, plant pathogens are predominant. Of the 191 plant pathogenic fungal species with available genomes, 61.3 % cause diseases on food crops, more than half of which are staple crops. The genomes of plant pathogens are slightly larger than those of other fungal species sequenced to date and they contain fewer coding sequences in relation to their genome size. Both of these factors can be attributed to the expansion of repeat elements. Sequenced genomes of plant pathogens provide blueprints from which potential virulence factors were identified and from which genes associated with different pathogenic strategies could be predicted. Genome sequences have also made it possible to evaluate adaptability of pathogen genomes and genomic regions that experience selection pressures. Some genomic patterns, however, remain poorly understood and plant pathogen genomes alone are not sufficient to unravel complex pathogen-host interactions. Genomes, therefore, cannot replace experimental studies that can be complex and tedious. Ultimately, the most promising application lies in using fungal plant pathogen genomics to inform disease management and risk assessment strategies. This will ultimately minimize the risks of future disease outbreaks and assist in preparation for emerging pathogen outbreaks.

  2. Value of a newly sequenced bacterial genome

    DEFF Research Database (Denmark)

    Barbosa, Eudes; Aburjaile, Flavia F; Ramos, Rommel Tj

    2014-01-01

    and annotation will not be undertaken. It is important to know what is lost when we settle for a draft genome and to determine the "scientific value" of a newly sequenced genome. This review addresses the expected impact of newly sequenced genomes on antibacterial discovery and vaccinology. Also, it discusses...... heightened expectations that NGS would boost antibacterial discovery and vaccine development. Although many possible drug and vaccine targets have been discovered, the success rate of genome-based analysis has remained below expectations. Furthermore, NGS has had consequences for genome quality, resulting...

  3. Human Genome Sequencing in Health and Disease

    Science.gov (United States)

    Gonzaga-Jauregui, Claudia; Lupski, James R.; Gibbs, Richard A.

    2013-01-01

    Following the “finished,” euchromatic, haploid human reference genome sequence, the rapid development of novel, faster, and cheaper sequencing technologies is making possible the era of personalized human genomics. Personal diploid human genome sequences have been generated, and each has contributed to our better understanding of variation in the human genome. We have consequently begun to appreciate the vastness of individual genetic variation from single nucleotide to structural variants. Translation of genome-scale variation into medically useful information is, however, in its infancy. This review summarizes the initial steps undertaken in clinical implementation of personal genome information, and describes the application of whole-genome and exome sequencing to identify the cause of genetic diseases and to suggest adjuvant therapies. Better analysis tools and a deeper understanding of the biology of our genome are necessary in order to decipher, interpret, and optimize clinical utility of what the variation in the human genome can teach us. Personal genome sequencing may eventually become an instrument of common medical practice, providing information that assists in the formulation of a differential diagnosis. We outline herein some of the remaining challenges. PMID:22248320

  4. Genome Sequencing and Analysis Conference IV

    Energy Technology Data Exchange (ETDEWEB)

    1993-12-31

    J. Craig Venter and C. Thomas Caskey co-chaired Genome Sequencing and Analysis Conference IV held at Hilton Head, South Carolina from September 26--30, 1992. Venter opened the conference by noting that approximately 400 researchers from 16 nations were present four times as many participants as at Genome Sequencing Conference I in 1989. Venter also introduced the Data Fair, a new component of the conference allowing exchange and on-site computer analysis of unpublished sequence data.

  5. Validation of rice genome sequence by optical mapping

    Directory of Open Access Journals (Sweden)

    Pape Louise

    2007-08-01

    Full Text Available Abstract Background Rice feeds much of the world, and possesses the simplest genome analyzed to date within the grass family, making it an economically relevant model system for other cereal crops. Although the rice genome is sequenced, validation and gap closing efforts require purely independent means for accurate finishing of sequence build data. Results To facilitate ongoing sequencing finishing and validation efforts, we have constructed a whole-genome SwaI optical restriction map of the rice genome. The physical map consists of 14 contigs, covering 12 chromosomes, with a total genome size of 382.17 Mb; this value is about 11% smaller than original estimates. 9 of the 14 optical map contigs are without gaps, covering chromosomes 1, 2, 3, 4, 5, 7, 8 10, and 12 in their entirety – including centromeres and telomeres. Alignments between optical and in silico restriction maps constructed from IRGSP (International Rice Genome Sequencing Project and TIGR (The Institute for Genomic Research genome sequence sources are comprehensive and informative, evidenced by map coverage across virtually all published gaps, discovery of new ones, and characterization of sequence misassemblies; all totalling ~14 Mb. Furthermore, since optical maps are ordered restriction maps, identified discordances are pinpointed on a reliable physical scaffold providing an independent resource for closure of gaps and rectification of misassemblies. Conclusion Analysis of sequence and optical mapping data effectively validates genome sequence assemblies constructed from large, repeat-rich genomes. Given this conclusion we envision new applications of such single molecule analysis that will merge advantages offered by high-resolution optical maps with inexpensive, but short sequence reads generated by emerging sequencing platforms. Lastly, map construction techniques presented here points the way to new types of comparative genome analysis that would focus on discernment of

  6. Genomic sequencing of Pleistocene cave bears

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, James P.; Hofreiter, Michael; Smith, Doug; Priest, JamesR.; Rohland, Nadin; Rabeder, Gernot; Krause, Johannes; Detter, J. Chris; Paabo, Svante; Rubin, Edward M.

    2005-04-01

    Despite the information content of genomic DNA, ancient DNA studies to date have largely been limited to amplification of mitochondrial DNA due to technical hurdles such as contamination and degradation of ancient DNAs. In this study, we describe two metagenomic libraries constructed using unamplified DNA extracted from the bones of two 40,000-year-old extinct cave bears. Analysis of {approx}1 Mb of sequence from each library showed that, despite significant microbial contamination, 5.8 percent and 1.1 percent of clones in the libraries contain cave bear inserts, yielding 26,861 bp of cave bear genome sequence. Alignment of this sequence to the dog genome, the closest sequenced genome to cave bear in terms of evolutionary distance, revealed roughly the expected ratio of cave bear exons, repeats and conserved noncoding sequences. Only 0.04 percent of all clones sequenced were derived from contamination with modern human DNA. Comparison of cave bear with orthologous sequences from several modern bear species revealed the evolutionary relationship of these lineages. Using the metagenomic approach described here, we have recovered substantial quantities of mammalian genomic sequence more than twice as old as any previously reported, establishing the feasibility of ancient DNA genomic sequencing programs.

  7. Draft Genome Sequence of Mycobacterium chimaera Type ...

    Science.gov (United States)

    We report the draft genome sequence of the type strain Mycobacterium chimaera Fl-0169T, a member of the Mycobacterium avium complex (MAC). M. chimaera Fl-0169T was isolated from a patient in Italy and is highly similar to strains of M. chimaera isolated in Ireland, though Fl-0169T possesses unique virulence genes. Evidence suggests that M. avium, M. intracellulare, and M. chimaera are differently virulent and a comparative genomic analysis is critically needed to identify diagnostic targets that reliably differentiate species of MAC. With treatment costs for Mycobacterium infections estimated to be >$1.8 B annually in the U.S., correct species identification will result in improved treatment selection, lower costs, and improved patient outcomes.

  8. RESEARCH NOTE Genome-based exome-sequencing analysis ...

    Indian Academy of Sciences (India)

    Navya

    2017-02-22

    Feb 22, 2017 ... Genome-based exome-sequencing analysis identifies GYG1, DIS3L, DDRGK1 genes ... Cardiology Division, Department of Internal Medicine, Severance .... with p values of <0.05 byanalyzing differences in allele distribution.

  9. Complete genome sequences of six strains of the genus methylobacterium

    Energy Technology Data Exchange (ETDEWEB)

    Marx, Christopher J [Harvard University; Bringel, Francoise O. [University of Strasbourg; Christoserdova, Ludmila [University of Washington, Seattle; Moulin, Lionel [UMR, France; Farhan Ul Haque, Muhammad [CNRS, Strasbourg, France; Fleischman, Darrell E. [Wright State University, Dayton, OH; Gruffaz, Christelle [CNRS, Strasbourg, France; Jourand, Philippe [UMR, France; Knief, Claudia [ETH Zurich, Switzerland; Lee, Ming-Chun [Harvard University; Muller, Emilie E. L. [CNRS, Strasbourg, France; Nadalig, Thierry [CNRS, Strasbourg, France; Peyraud, Remi [ETH Zurich, Switzerland; Roselli, Sandro [CNRS, Strasbourg, France; Russ, Lina [ETH Zurich, Switzerland; Aguero, Fernan [Universidad Nacional de General San Martin; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lajus, Aurelie [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Land, Miriam L [ORNL; Medigue, Claudine [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Stolyar, Sergey [University of Washington; Vorholt, Julia A. [ETH Zurich, Switzerland; Vuilleumier, Stephane [University of Strasbourg

    2012-01-01

    The complete and assembled genome sequences were determined for six strains of the alphaproteobacterial genus Methylobacterium, chosen for their key adaptations to different plant-associated niches and environmental constraints.

  10. Complete Genome Sequences of Six Strains of the Genus Methylobacterium

    Energy Technology Data Exchange (ETDEWEB)

    Marx, Christopher J [Harvard University; Bringel, Francoise O. [University of Strasbourg; Christoserdova, Ludmila [University of Washington, Seattle; Moulin, Lionel [UMR, France; UI Hague, Muhammad Farhan [University of Strasbourg; Fleischman, Darrell E. [Wright State University, Dayton, OH; Gruffaz, Christelle [CNRS, Strasbourg, France; Jourand, Philippe [UMR, France; Knief, Claudia [ETH Zurich, Switzerland; Lee, Ming-Chun [Harvard University; Muller, Emilie E. L. [CNRS, Strasbourg, France; Nadalig, Thierry [CNRS, Strasbourg, France; Peyraud, Remi [ETH Zurich, Switzerland; Roselli, Sandro [CNRS, Strasbourg, France; Russ, Lina [ETH Zurich, Switzerland; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Ivanov, Pavel S. [University of Wyoming, Laramie; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lajus, Aurelie [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Land, Miriam L [ORNL; Medigue, Claudine [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Stolyar, Sergey [University of Washington; Vorholt, Julia A. [ETH Zurich, Switzerland; Vuilleumier, Stephane [University of Strasbourg

    2012-01-01

    The complete and assembled genome sequences were determined for six strains of the alphaproteobacterial genus Methylobacterium, chosen for their key adaptations to different plant-associated niches and environmental constraints.

  11. Whole-genome comparison of two Campylobacter jejuni isolates of the same sequence type reveals multiple loci of different ancestral lineage.

    Directory of Open Access Journals (Sweden)

    Patrick J Biggs

    Full Text Available Campylobacter jejuni ST-474 is the most important human enteric pathogen in New Zealand, and yet this genotype is rarely found elsewhere in the world. Insight into the evolution of this organism was gained by a whole genome comparison of two ST-474, flaA SVR-14 isolates and other available C. jejuni isolates and genomes. The two isolates were collected from different sources, human (H22082 and retail poultry (P110b, at the same time and from the same geographical location. Solexa sequencing of each isolate resulted in ~1.659 Mb (H22082 and ~1.656 Mb (P110b of assembled sequences within 28 (H22082 and 29 (P110b contigs. We analysed 1502 genes for which we had sequences within both ST-474 isolates and within at least one of 11 C. jejuni reference genomes. Although 94.5% of genes were identical between the two ST-474 isolates, we identified 83 genes that differed by at least one nucleotide, including 55 genes with non-synonymous substitutions. These covered 101 kb and contained 672 point differences. We inferred that 22 (3.3% of these differences were due to mutation and 650 (96.7% were imported via recombination. Our analysis estimated 38 recombinant breakpoints within these 83 genes, which correspond to recombination events affecting at least 19 loci regions and gives a tract length estimate of ~2 kb. This includes a ~12 kb region displaying non-homologous recombination in one of the ST-474 genomes, with the insertion of two genes, including ykgC, a putative oxidoreductase, and a conserved hypothetical protein of unknown function. Furthermore, our analysis indicates that the source of this recombined DNA is more likely to have come from C. jejuni strains that are more closely related to ST-474. This suggests that the rates of recombination and mutation are similar in order of magnitude, but that recombination has been much more important for generating divergence between the two ST-474 isolates.

  12. Identification of optimum sequencing depth especially for de novo genome assembly of small genomes using next generation sequencing data.

    Science.gov (United States)

    Desai, Aarti; Marwah, Veer Singh; Yadav, Akshay; Jha, Vineet; Dhaygude, Kishor; Bangar, Ujwala; Kulkarni, Vivek; Jere, Abhay

    2013-01-01

    Next Generation Sequencing (NGS) is a disruptive technology that has found widespread acceptance in the life sciences research community. The high throughput and low cost of sequencing has encouraged researchers to undertake ambitious genomic projects, especially in de novo genome sequencing. Currently, NGS systems generate sequence data as short reads and de novo genome assembly using these short reads is computationally very intensive. Due to lower cost of sequencing and higher throughput, NGS systems now provide the ability to sequence genomes at high depth. However, currently no report is available highlighting the impact of high sequence depth on genome assembly using real data sets and multiple assembly algorithms. Recently, some studies have evaluated the impact of sequence coverage, error rate and average read length on genome assembly using multiple assembly algorithms, however, these evaluations were performed using simulated datasets. One limitation of using simulated datasets is that variables such as error rates, read length and coverage which are known to impact genome assembly are carefully controlled. Hence, this study was undertaken to identify the minimum depth of sequencing required for de novo assembly for different sized genomes using graph based assembly algorithms and real datasets. Illumina reads for E.coli (4.6 MB) S.kudriavzevii (11.18 MB) and C.elegans (100 MB) were assembled using SOAPdenovo, Velvet, ABySS, Meraculous and IDBA-UD. Our analysis shows that 50X is the optimum read depth for assembling these genomes using all assemblers except Meraculous which requires 100X read depth. Moreover, our analysis shows that de novo assembly from 50X read data requires only 6-40 GB RAM depending on the genome size and assembly algorithm used. We believe that this information can be extremely valuable for researchers in designing experiments and multiplexing which will enable optimum utilization of sequencing as well as analysis resources.

  13. The characterization of twenty sequenced human genomes.

    Directory of Open Access Journals (Sweden)

    Kimberly Pelak

    2010-09-01

    Full Text Available We present the analysis of twenty human genomes to evaluate the prospects for identifying rare functional variants that contribute to a phenotype of interest. We sequenced at high coverage ten "case" genomes from individuals with severe hemophilia A and ten "control" genomes. We summarize the number of genetic variants emerging from a study of this magnitude, and provide a proof of concept for the identification of rare and highly-penetrant functional variants by confirming that the cause of hemophilia A is easily recognizable in this data set. We also show that the number of novel single nucleotide variants (SNVs discovered per genome seems to stabilize at about 144,000 new variants per genome, after the first 15 individuals have been sequenced. Finally, we find that, on average, each genome carries 165 homozygous protein-truncating or stop loss variants in genes representing a diverse set of pathways.

  14. Multiple Genome Sequences of Lactobacillus plantarum Strains

    OpenAIRE

    Kafka, Thomas A.; Geissler, Andreas J.; Vogel, Rudi F.

    2017-01-01

    ABSTRACT We report here the genome sequences of four Lactobacillus plantarum strains which vary in surface hydrophobicity. Bioinformatic analysis, using additional genomes of Lactobacillus plantarum strains, revealed a possible correlation between the cell wall teichoic acid-type and cell surface hydrophobicity and provide the basis for consecutive analyses.

  15. Complete Genome Sequence of Staphylococcus epidermidis 1457.

    Science.gov (United States)

    Galac, Madeline R; Stam, Jason; Maybank, Rosslyn; Hinkle, Mary; Mack, Dietrich; Rohde, Holger; Roth, Amanda L; Fey, Paul D

    2017-06-01

    Staphylococcus epidermidis 1457 is a frequently utilized strain that is amenable to genetic manipulation and has been widely used for biofilm-related research. We report here the whole-genome sequence of this strain, which encodes 2,277 protein-coding genes and 81 RNAs within its 2.4-Mb genome and plasmid. Copyright © 2017 Galac et al.

  16. Comparison of 61 Sequenced Escherichia coli Genomes

    DEFF Research Database (Denmark)

    Lukjancenko, Oksana; Wassenaar, T. M.; Ussery, David

    2010-01-01

    Escherichia coli is an important component of the biosphere and is an ideal model for studies of processes involved in bacterial genome evolution. Sixty-one publically available E. coli and Shigella spp. sequenced genomes are compared, using basic methods to produce phylogenetic and proteomics...

  17. Multilocus Sequence Typing of Total-Genome-Sequenced Bacteria

    DEFF Research Database (Denmark)

    Larsen, Mette Voldby; Cosentino, Salvatore; Rasmussen, Simon

    2012-01-01

    Accurate strain identification is essential for anyone working with bacteria. For many species, multilocus sequence typing (MLST) is considered the "gold standard" of typing, but it is traditionally performed in an expensive and time-consuming manner. As the costs of whole-genome sequencing (WGS...

  18. Sequencing and comparing whole mitochondrial genomes ofanimals

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.; Macey, J. Robert; Medina, Monica

    2005-04-22

    Comparing complete animal mitochondrial genome sequences is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. Not only are they much more informative than shorter sequences of individual genes for inferring evolutionary relatedness, but these data also provide sets of genome-level characters, such as the relative arrangements of genes, that can be especially powerful. We describe here the protocols commonly used for physically isolating mtDNA, for amplifying these by PCR or RCA, for cloning,sequencing, assembly, validation, and gene annotation, and for comparing both sequences and gene arrangements. On several topics, we offer general observations based on our experiences to date with determining and comparing complete mtDNA sequences.

  19. Similar Ratios of Introns to Intergenic Sequence across Animal Genomes.

    Science.gov (United States)

    Francis, Warren R; Wörheide, Gert

    2017-06-01

    One central goal of genome biology is to understand how the usage of the genome differs between organisms. Our knowledge of genome composition, needed for downstream inferences, is critically dependent on gene annotations, yet problems associated with gene annotation and assembly errors are usually ignored in comparative genomics. Here, we analyze the genomes of 68 species across 12 animal phyla and some single-cell eukaryotes for general trends in genome composition and transcription, taking into account problems of gene annotation. We show that, regardless of genome size, the ratio of introns to intergenic sequence is comparable across essentially all animals, with nearly all deviations dominated by increased intergenic sequence. Genomes of model organisms have ratios much closer to 1:1, suggesting that the majority of published genomes of nonmodel organisms are underannotated and consequently omit substantial numbers of genes, with likely negative impact on evolutionary interpretations. Finally, our results also indicate that most animals transcribe half or more of their genomes arguing against differences in genome usage between animal groups, and also suggesting that the transcribed portion is more dependent on genome size than previously thought. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. [Complete genome sequencing and sequence analysis of BCG Tice].

    Science.gov (United States)

    Wang, Zhiming; Pan, Yuanlong; Wu, Jun; Zhu, Baoli

    2012-10-04

    The objective of this study is to obtain the complete genome sequence of Bacillus Calmette-Guerin Tice (BCG Tice), in order to provide more information about the molecular biology of BCG Tice and design more reasonable vaccines to prevent tuberculosis. We assembled the data from high-throughput sequencing with SOAPdenovo software, with many contigs and scaffolds obtained. There are many sequence gaps and physical gaps remained as a result of regional low coverage and low quality. We designed primers at the end of contigs and performed PCR amplification in order to link these contigs and scaffolds. With various enzymes to perform PCR amplification, adjustment of PCR reaction conditions, and combined with clone construction to sequence, all the gaps were finished. We obtained the complete genome sequence of BCG Tice and submitted it to GenBank of National Center for Biotechnology Information (NCBI). The genome of BCG Tice is 4334064 base pairs in length, with GC content 65.65%. The problems and strategies during the finishing step of BCG Tice sequencing are illuminated here, with the hope of affording some experience to those who are involved in the finishing step of genome sequencing. The microarray data were verified by our results.

  1. Cyprinus carpio Genome sequencing and assembly

    NARCIS (Netherlands)

    Kolder, I.C.R.M.; Plas-Duivesteijn, van der Suzanne J.; Tan, G.; Wiegertjes, G.; Forlenza, M.; Guler, A.T.; Travin, D.Y.; Nakao, M.; Moritomo, T.; Irnazarow, I.; Jansen, H.J.

    2013-01-01

    Sequencing of the common carp (Cyprinus carpio carpio Linnaeus, 1758) genome, with the objective of establishing carp as a model organism to supplement the closely related zebrafish (Danio rerio). The sequenced individual is a homozygous female (by gynogenesis) of R3 x R8 carp, the heterozygous

  2. Harnessing Whole Genome Sequencing in Medical Mycology.

    Science.gov (United States)

    Cuomo, Christina A

    2017-01-01

    Comparative genome sequencing studies of human fungal pathogens enable identification of genes and variants associated with virulence and drug resistance. This review describes current approaches, resources, and advances in applying whole genome sequencing to study clinically important fungal pathogens. Genomes for some important fungal pathogens were only recently assembled, revealing gene family expansions in many species and extreme gene loss in one obligate species. The scale and scope of species sequenced is rapidly expanding, leveraging technological advances to assemble and annotate genomes with higher precision. By using iteratively improved reference assemblies or those generated de novo for new species, recent studies have compared the sequence of isolates representing populations or clinical cohorts. Whole genome approaches provide the resolution necessary for comparison of closely related isolates, for example, in the analysis of outbreaks or sampled across time within a single host. Genomic analysis of fungal pathogens has enabled both basic research and diagnostic studies. The increased scale of sequencing can be applied across populations, and new metagenomic methods allow direct analysis of complex samples.

  3. 10KP: A phylodiverse genome sequencing plan

    Science.gov (United States)

    Cheng, Shifeng; Melkonian, Michael; Brockington, Samuel; Archibald, John M; Delaux, Pierre-Marc; Melkonian, Barbara; Mavrodiev, Evgeny V; Sun, Wenjing; Fu, Yuan; Yang, Huanming; Soltis, Douglas E; Graham, Sean W; Soltis, Pamela S; Liu, Xin; Xu, Xun

    2018-01-01

    Abstract Understanding plant evolution and diversity in a phylogenomic context is an enormous challenge due, in part, to limited availability of genome-scale data across phylodiverse species. The 10KP (10,000 Plants) Genome Sequencing Project will sequence and characterize representative genomes from every major clade of embryophytes, green algae, and protists (excluding fungi) within the next 5 years. By implementing and continuously improving leading-edge sequencing technologies and bioinformatics tools, 10KP will catalogue the genome content of plant and protist diversity and make these data freely available as an enduring foundation for future scientific discoveries and applications. 10KP is structured as an international consortium, open to the global community, including botanical gardens, plant research institutes, universities, and private industry. Our immediate goal is to establish a policy framework for this endeavor, the principles of which are outlined here. PMID:29618049

  4. 10KP: A phylodiverse genome sequencing plan.

    Science.gov (United States)

    Cheng, Shifeng; Melkonian, Michael; Smith, Stephen A; Brockington, Samuel; Archibald, John M; Delaux, Pierre-Marc; Li, Fay-Wei; Melkonian, Barbara; Mavrodiev, Evgeny V; Sun, Wenjing; Fu, Yuan; Yang, Huanming; Soltis, Douglas E; Graham, Sean W; Soltis, Pamela S; Liu, Xin; Xu, Xun; Wong, Gane Ka-Shu

    2018-03-01

    Understanding plant evolution and diversity in a phylogenomic context is an enormous challenge due, in part, to limited availability of genome-scale data across phylodiverse species. The 10KP (10,000 Plants) Genome Sequencing Project will sequence and characterize representative genomes from every major clade of embryophytes, green algae, and protists (excluding fungi) within the next 5 years. By implementing and continuously improving leading-edge sequencing technologies and bioinformatics tools, 10KP will catalogue the genome content of plant and protist diversity and make these data freely available as an enduring foundation for future scientific discoveries and applications. 10KP is structured as an international consortium, open to the global community, including botanical gardens, plant research institutes, universities, and private industry. Our immediate goal is to establish a policy framework for this endeavor, the principles of which are outlined here.

  5. Deep whole-genome sequencing of 90 Han Chinese genomes.

    Science.gov (United States)

    Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

    2017-09-01

    Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000

  6. Getting complete genomes from complex samples using nanopore sequencing

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Albertsen, Mads

    Background Short read DNA sequencing and metagenomic binning workflows have made it possible to extract bacterial genome bins from environmental microbial samples containing hundreds to thousands of different species. However, these genome bins often do not represent complete genomes......, as they are mostly fragmented, incomplete and often contaminated with foreign DNA. The value of these `draft genomes` have limited, lasting value to the scientific community, as gene synteny is broken and there is some uncertainty of what is missing1. The genetic material most often missed is important multi......-copy and/or conserved marker genes such as the 16S rRNA gene, as sequence micro-heterogeneity prevents assembly of these genes in the de novo assembly. However, long read sequencing technologies are emerging promising an end to fragmented genome assemblies2. Experimental design We extracted DNA from a full...

  7. Determining and comparing protein function in Bacterial genome sequences

    DEFF Research Database (Denmark)

    Vesth, Tammi Camilla

    of this class have very little homology to other known genomes making functional annotation based on sequence similarity very difficult. Inspired in part by this analysis, an approach for comparative functional annotation was created based public sequenced genomes, CMGfunc. Functionally related groups......In November 2013, there was around 21.000 different prokaryotic genomes sequenced and publicly available, and the number is growing daily with another 20.000 or more genomes expected to be sequenced and deposited by the end of 2014. An important part of the analysis of this data is the functional...... annotation of genes – the descriptions assigned to genes that describe the likely function of the encoded proteins. This process is limited by several factors, including the definition of a function which can be more or less specific as well as how many genes can actually be assigned a function based...

  8. Genome sequence of the olive tree, Olea europaea.

    Science.gov (United States)

    Cruz, Fernando; Julca, Irene; Gómez-Garrido, Jèssica; Loska, Damian; Marcet-Houben, Marina; Cano, Emilio; Galán, Beatriz; Frias, Leonor; Ribeca, Paolo; Derdak, Sophia; Gut, Marta; Sánchez-Fernández, Manuel; García, Jose Luis; Gut, Ivo G; Vargas, Pablo; Alioto, Tyler S; Gabaldón, Toni

    2016-06-27

    The Mediterranean olive tree (Olea europaea subsp. europaea) was one of the first trees to be domesticated and is currently of major agricultural importance in the Mediterranean region as the source of olive oil. The molecular bases underlying the phenotypic differences among domesticated cultivars, or between domesticated olive trees and their wild relatives, remain poorly understood. Both wild and cultivated olive trees have 46 chromosomes (2n). A total of 543 Gb of raw DNA sequence from whole genome shotgun sequencing, and a fosmid library containing 155,000 clones from a 1,000+ year-old olive tree (cv. Farga) were generated by Illumina sequencing using different combinations of mate-pair and pair-end libraries. Assembly gave a final genome with a scaffold N50 of 443 kb, and a total length of 1.31 Gb, which represents 95 % of the estimated genome length (1.38 Gb). In addition, the associated fungus Aureobasidium pullulans was partially sequenced. Genome annotation, assisted by RNA sequencing from leaf, root, and fruit tissues at various stages, resulted in 56,349 unique protein coding genes, suggesting recent genomic expansion. Genome completeness, as estimated using the CEGMA pipeline, reached 98.79 %. The assembled draft genome of O. europaea will provide a valuable resource for the study of the evolution and domestication processes of this important tree, and allow determination of the genetic bases of key phenotypic traits. Moreover, it will enhance breeding programs and the formation of new varieties.

  9. Genome Sequence of the Palaeopolyploid soybean

    Energy Technology Data Exchange (ETDEWEB)

    Schmutz, Jeremy; Cannon, Steven B.; Schlueter, Jessica; Ma, Jianxin; Mitros, Therese; Nelson, William; Hyten, David L.; Song, Qijian; Thelen, Jay J.; Cheng, Jianlin; Xu, Dong; Hellsten, Uffe; May, Gregory D.; Yu, Yeisoo; Sakura, Tetsuya; Umezawa, Taishi; Bhattacharyya, Madan K.; Sandhu, Devinder; Valliyodan, Babu; Lindquist, Erika; Peto, Myron; Grant, David; Shu, Shengqiang; Goodstein, David; Barry, Kerrie; Futrell-Griggs, Montona; Abernathy, Brian; Du, Jianchang; Tian, Zhixi; Zhu, Liucun; Gill, Navdeep; Joshi, Trupti; Libault, Marc; Sethuraman, Anand; Zhang, Xue-Cheng; Shinozaki, Kazuo; Nguyen, Henry T.; Wing, Rod A.; Cregan, Perry; Specht, James; Grimwood, Jane; Rokhsar, Dan; Stacey, Gary; Shoemaker, Randy C.; Jackson, Scott A.

    2009-08-03

    Soybean (Glycine max) is one of the most important crop plants for seed protein and oil content, and for its capacity to fix atmospheric nitrogen through symbioses with soil-borne microorganisms. We sequenced the 1.1-gigabase genome by a whole-genome shotgun approach and integrated it with physical and high-density genetic maps to create a chromosome-scale draft sequence assembly. We predict 46,430 protein-coding genes, 70percent more than Arabidopsis and similar to the poplar genome which, like soybean, is an ancient polyploid (palaeopolyploid). About 78percent of the predicted genes occur in chromosome ends, which comprise less than one-half of the genome but account for nearly all of the genetic recombination. Genome duplications occurred at approximately 59 and 13 million years ago, resulting in a highly duplicated genome with nearly 75percent of the genes present in multiple copies. The two duplication events were followed by gene diversification and loss, and numerous chromosome rearrangements. An accurate soybean genome sequence will facilitate the identification of the genetic basis of many soybean traits, and accelerate the creation of improved soybean varieties.

  10. Rhipicephalus (Boophilus) microplus strain Deutsch, whole genome shotgun sequencing project first submission of genome sequence

    Science.gov (United States)

    The size and repetitive nature of the Rhipicephalus microplus genome makes obtaining a full genome sequence difficult. Cot filtration/selection techniques were used to reduce the repetitive fraction of the tick genome and enrich for the fraction of DNA with gene-containing regions. The Cot-selected ...

  11. Complete genome sequences of six measles virus strains

    NARCIS (Netherlands)

    Phan, M.V.T. (My V.T.); C.M.E. Schapendonk (Claudia); B.B. Oude Munnink (Bas B.); M.P.G. Koopmans D.V.M. (Marion); R.L. de Swart (Rik); Cotten, M. (Matthew)

    2018-01-01

    textabstractGenetic characterization of wild-type measles virus (MV) strains is a critical component of measles surveillance and molecular epidemiology. We have obtained complete genome sequences of six MV strains belonging to different genotypes, using random-primed next generation sequencing.

  12. Genomic Prediction from Whole Genome Sequence in Livestock: The 1000 Bull Genomes Project

    DEFF Research Database (Denmark)

    Hayes, Benjamin J; MacLeod, Iona M; Daetwyler, Hans D

    Advantages of using whole genome sequence data to predict genomic estimated breeding values (GEBV) include better persistence of accuracy of GEBV across generations and more accurate GEBV across breeds. The 1000 Bull Genomes Project provides a database of whole genome sequenced key ancestor bulls....... In a dairy data set, predictions using BayesRC and imputed sequence data from 1000 Bull Genomes were 2% more accurate than with 800k data. We could demonstrate the method identified causal mutations in some cases. Further improvements will come from more accurate imputation of sequence variant genotypes...

  13. Protecting genomic sequence anonymity with generalization lattices.

    Science.gov (United States)

    Malin, B A

    2005-01-01

    Current genomic privacy technologies assume the identity of genomic sequence data is protected if personal information, such as demographics, are obscured, removed, or encrypted. While demographic features can directly compromise an individual's identity, recent research demonstrates such protections are insufficient because sequence data itself is susceptible to re-identification. To counteract this problem, we introduce an algorithm for anonymizing a collection of person-specific DNA sequences. The technique is termed DNA lattice anonymization (DNALA), and is based upon the formal privacy protection schema of k -anonymity. Under this model, it is impossible to observe or learn features that distinguish one genetic sequence from k-1 other entries in a collection. To maximize information retained in protected sequences, we incorporate a concept generalization lattice to learn the distance between two residues in a single nucleotide region. The lattice provides the most similar generalized concept for two residues (e.g. adenine and guanine are both purines). The method is tested and evaluated with several publicly available human population datasets ranging in size from 30 to 400 sequences. Our findings imply the anonymization schema is feasible for the protection of sequences privacy. The DNALA method is the first computational disclosure control technique for general DNA sequences. Given the computational nature of the method, guarantees of anonymity can be formally proven. There is room for improvement and validation, though this research provides the groundwork from which future researchers can construct genomics anonymization schemas tailored to specific datasharing scenarios.

  14. Complete Genome Sequences of 44 Arthrobacter Phages.

    Science.gov (United States)

    Klyczek, Karen K; Jacobs-Sera, Deborah; Adair, Tamarah L; Adams, Sandra D; Ball, Sarah L; Benjamin, Robert C; Bonilla, J Alfred; Breitenberger, Caroline A; Daniels, Charles J; Gaffney, Bobby L; Harrison, Melinda; Hughes, Lee E; King, Rodney A; Krukonis, Gregory P; Lopez, A Javier; Monsen-Collar, Kirsten; Pizzorno, Marie C; Rinehart, Claire A; Staples, Amanda K; Stowe, Emily L; Garlena, Rebecca A; Russell, Daniel A; Cresawn, Steven G; Pope, Welkin H; Hatfull, Graham F

    2018-02-01

    We report here the complete genome sequences of 44 phages infecting Arthrobacter sp. strain ATCC 21022. These phages have double-stranded DNA genomes with sizes ranging from 15,680 to 70,707 bp and G+C contents from 45.1% to 68.5%. All three tail types (belonging to the families Siphoviridae , Myoviridae , and Podoviridae ) are represented. Copyright © 2018 Klyczek et al.

  15. Analysing human genomes at different scales

    DEFF Research Database (Denmark)

    Liu, Siyang

    The thriving of the Next-Generation sequencing (NGS) technologies in the past decade has dramatically revolutionized the field of human genetics. We are experiencing a wave of several large-scale whole genome sequencing studies of humans in the world. Those studies vary greatly regarding cohort...... will be reflected by the analysis of real data. This thesis covers studies in two human genome sequencing projects that distinctly differ in terms of studied population, sample size and sequencing depth. In the first project, we sequenced 150 Danish individuals from 50 trio families to 78x coverage....... The sophisticated experimental design enables high-quality de novo assembly of the genomes and provides a good opportunity for mapping the structural variations in the human population. We developed the AsmVar approach to discover, genotype and characterize the structural variations from the assemblies. Our...

  16. Microbial species delineation using whole genome sequences.

    Science.gov (United States)

    Varghese, Neha J; Mukherjee, Supratim; Ivanova, Natalia; Konstantinidis, Konstantinos T; Mavrommatis, Kostas; Kyrpides, Nikos C; Pati, Amrita

    2015-08-18

    Increased sequencing of microbial genomes has revealed that prevailing prokaryotic species assignments can be inconsistent with whole genome information for a significant number of species. The long-standing need for a systematic and scalable species assignment technique can be met by the genome-wide Average Nucleotide Identity (gANI) metric, which is widely acknowledged as a robust measure of genomic relatedness. In this work, we demonstrate that the combination of gANI and the alignment fraction (AF) between two genomes accurately reflects their genomic relatedness. We introduce an efficient implementation of AF,gANI and discuss its successful application to 86.5M genome pairs between 13,151 prokaryotic genomes assigned to 3032 species. Subsequently, by comparing the genome clusters obtained from complete linkage clustering of these pairs to existing taxonomy, we observed that nearly 18% of all prokaryotic species suffer from anomalies in species definition. Our results can be used to explore central questions such as whether microorganisms form a continuum of genetic diversity or distinct species represented by distinct genetic signatures. We propose that this precise and objective AF,gANI-based species definition: the MiSI (Microbial Species Identifier) method, be used to address previous inconsistencies in species classification and as the primary guide for new taxonomic species assignment, supplemented by the traditional polyphasic approach, as required. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Genomic Sequence Variation Markup Language (GSVML).

    Science.gov (United States)

    Nakaya, Jun; Kimura, Michio; Hiroi, Kaei; Ido, Keisuke; Yang, Woosung; Tanaka, Hiroshi

    2010-02-01

    With the aim of making good use of internationally accumulated genomic sequence variation data, which is increasing rapidly due to the explosive amount of genomic research at present, the development of an interoperable data exchange format and its international standardization are necessary. Genomic Sequence Variation Markup Language (GSVML) will focus on genomic sequence variation data and human health applications, such as gene based medicine or pharmacogenomics. We developed GSVML through eight steps, based on case analysis and domain investigations. By focusing on the design scope to human health applications and genomic sequence variation, we attempted to eliminate ambiguity and to ensure practicability. We intended to satisfy the requirements derived from the use case analysis of human-based clinical genomic applications. Based on database investigations, we attempted to minimize the redundancy of the data format, while maximizing the data covering range. We also attempted to ensure communication and interface ability with other Markup Languages, for exchange of omics data among various omics researchers or facilities. The interface ability with developing clinical standards, such as the Health Level Seven Genotype Information model, was analyzed. We developed the human health-oriented GSVML comprising variation data, direct annotation, and indirect annotation categories; the variation data category is required, while the direct and indirect annotation categories are optional. The annotation categories contain omics and clinical information, and have internal relationships. For designing, we examined 6 cases for three criteria as human health application and 15 data elements for three criteria as data formats for genomic sequence variation data exchange. The data format of five international SNP databases and six Markup Languages and the interface ability to the Health Level Seven Genotype Model in terms of 317 items were investigated. GSVML was developed as

  18. Complete genome sequence of Ikoma lyssavirus.

    Science.gov (United States)

    Marston, Denise A; Ellis, Richard J; Horton, Daniel L; Kuzmin, Ivan V; Wise, Emma L; McElhinney, Lorraine M; Banyard, Ashley C; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E; Fooks, Anthony R

    2012-09-01

    Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isolated from an African civet in Tanzania displaying clinical signs of rabies. Genetically, this virus is the most divergent within the genus Lyssavirus. Characterization of the genome will help to improve our understanding of lyssavirus diversity and enable investigation into vaccine-induced immunity and protection.

  19. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Science.gov (United States)

    Ping, Zheng; Siegal, Gene P.; Almeida, Jonas S.; Schnitt, Stuart J.; Shen, Dejun

    2014-01-01

    Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA) is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer. PMID:24672738

  20. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Directory of Open Access Journals (Sweden)

    Zheng Ping

    2014-01-01

    Full Text Available Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer.

  1. Draft Genome Sequences of Three Escherichia coli Strains with Different In Vivo Pathogenicities in an Avian (Ascending) Infection Model of the Oviduct.

    Science.gov (United States)

    Olsen, Rikke Heidemann; Thøfner, Ida Cecilie Naundrup; Pors, Susanne Elisabeth; Christensen, Henrik; Bisgaard, Magne; Christensen, Jens Peter

    2015-05-07

    Here, we present three draft genome sequences of Escherichia coli strains that experimentally were proven to possess low (strain D2-2), intermediate (Chronic_salp), or high virulence (Cp6salp3) in an avian (ascending) infection model of the oviduct. Copyright © 2015 Olsen et al.

  2. Complete Genome Sequence of Ikoma Lyssavirus

    OpenAIRE

    Marston, Denise A.; Ellis, Richard J.; Horton, Daniel L.; Kuzmin, Ivan V.; Wise, Emma L.; McElhinney, Lorraine M.; Banyard, Ashley C.; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E.; Fooks, Anthony R.

    2012-01-01

    Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isol...

  3. Getting complete genomes from complex samples using nanopore sequencing

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Albertsen, Mads

    Short read sequencing and metagenomic binning workflows have made it possible to extract bacterial genome bins from environmental microbial samples containing hundreds to thousands of different species. However, these genome bins often do not represent complete genomes, as they are mostly...... fragmented, incomplete and often contaminated with foreign DNA and with no robust strategies to validate the quality. The value of these `draft genomes` have limited, lasting value to the scientific community, as gene synteny is broken and the uncertainty of what is missing. The genetic material most often...... missed is important multi-copy and/or conserved marker genes such as the 16S rRNA gene, as sequence micro-heterogeneity prevents assembly of these genes in the de novo assembly. We demonstrate that using nanopore long reads it is now possible to overcome these issues and make complete genomes from...

  4. Whole genome sequencing and bioinformatics analysis of two Egyptian genomes.

    Science.gov (United States)

    ElHefnawi, Mahmoud; Jeon, Sungwon; Bhak, Youngjune; ElFiky, Asmaa; Horaiz, Ahmed; Jun, JeHoon; Kim, Hyunho; Bhak, Jong

    2018-05-15

    We report two Egyptian male genomes (EGP1 and EGP2) sequenced at ~ 30× sequencing depths. EGP1 had 4.7 million variants, where 198,877 were novel variants while EGP2 had 209,109 novel variants out of 4.8 million variants. The mitochondrial haplogroup of the two individuals were identified to be H7b1 and L2a1c, respectively. We also identified the Y haplogroup of EGP1 (R1b) and EGP2 (J1a2a1a2 > P58 > FGC11). EGP1 had a mutation in the NADH gene of the mitochondrial genome ND4 (m.11778 G > A) that causes Leber's hereditary optic neuropathy. Some SNPs shared by the two genomes were associated with an increased level of cholesterol and triglycerides, probably related with Egyptians obesity. Comparison of these genomes with African and Western-Asian genomes can provide insights on Egyptian ancestry and genetic history. This resource can be used to further understand genomic diversity and functional classification of variants as well as human migration and evolution across Africa and Western-Asia. Copyright © 2017. Published by Elsevier B.V.

  5. Specialized microbial databases for inductive exploration of microbial genome sequences

    Directory of Open Access Journals (Sweden)

    Cabau Cédric

    2005-02-01

    Full Text Available Abstract Background The enormous amount of genome sequence data asks for user-oriented databases to manage sequences and annotations. Queries must include search tools permitting function identification through exploration of related objects. Methods The GenoList package for collecting and mining microbial genome databases has been rewritten using MySQL as the database management system. Functions that were not available in MySQL, such as nested subquery, have been implemented. Results Inductive reasoning in the study of genomes starts from "islands of knowledge", centered around genes with some known background. With this concept of "neighborhood" in mind, a modified version of the GenoList structure has been used for organizing sequence data from prokaryotic genomes of particular interest in China. GenoChore http://bioinfo.hku.hk/genochore.html, a set of 17 specialized end-user-oriented microbial databases (including one instance of Microsporidia, Encephalitozoon cuniculi, a member of Eukarya has been made publicly available. These databases allow the user to browse genome sequence and annotation data using standard queries. In addition they provide a weekly update of searches against the world-wide protein sequences data libraries, allowing one to monitor annotation updates on genes of interest. Finally, they allow users to search for patterns in DNA or protein sequences, taking into account a clustering of genes into formal operons, as well as providing extra facilities to query sequences using predefined sequence patterns. Conclusion This growing set of specialized microbial databases organize data created by the first Chinese bacterial genome programs (ThermaList, Thermoanaerobacter tencongensis, LeptoList, with two different genomes of Leptospira interrogans and SepiList, Staphylococcus epidermidis associated to related organisms for comparison.

  6. Genome sequencing for obstetricians & gynaecologists | Kent ...

    African Journals Online (AJOL)

    The medical profession has been waiting for a decade to be invigorated by the sequencing of the human genome, arguably the greatest scientific project ever. The technology has been spectacular but the results of the project have yielded more unexpected results than definitive answers – many about the very nature of our ...

  7. Genome shotgun sequencing and development of microsatellite ...

    African Journals Online (AJOL)

    Analysis of the gerbera genome DNA ('Raon') general library showed that sequences of (AT), (AG), (AAG) and (AAT) repeats appeared most often, whereas (AC), (AAC) and (ACC) were the least frequent. Primer pairs were designed for 80 loci. Only eight primer pairs produced reproducible polymorphic bands in the 28 ...

  8. Genomic multiple sequence alignments: refinement using a genetic algorithm

    Directory of Open Access Journals (Sweden)

    Lefkowitz Elliot J

    2005-08-01

    Full Text Available Abstract Background Genomic sequence data cannot be fully appreciated in isolation. Comparative genomics – the practice of comparing genomic sequences from different species – plays an increasingly important role in understanding the genotypic differences between species that result in phenotypic differences as well as in revealing patterns of evolutionary relationships. One of the major challenges in comparative genomics is producing a high-quality alignment between two or more related genomic sequences. In recent years, a number of tools have been developed for aligning large genomic sequences. Most utilize heuristic strategies to identify a series of strong sequence similarities, which are then used as anchors to align the regions between the anchor points. The resulting alignment is globally correct, but in many cases is suboptimal locally. We describe a new program, GenAlignRefine, which improves the overall quality of global multiple alignments by using a genetic algorithm to improve local regions of alignment. Regions of low quality are identified, realigned using the program T-Coffee, and then refined using a genetic algorithm. Because a better COFFEE (Consistency based Objective Function For alignmEnt Evaluation score generally reflects greater alignment quality, the algorithm searches for an alignment that yields a better COFFEE score. To improve the intrinsic slowness of the genetic algorithm, GenAlignRefine was implemented as a parallel, cluster-based program. Results We tested the GenAlignRefine algorithm by running it on a Linux cluster to refine sequences from a simulation, as well as refine a multiple alignment of 15 Orthopoxvirus genomic sequences approximately 260,000 nucleotides in length that initially had been aligned by Multi-LAGAN. It took approximately 150 minutes for a 40-processor Linux cluster to optimize some 200 fuzzy (poorly aligned regions of the orthopoxvirus alignment. Overall sequence identity increased only

  9. IDENTIFICATION OF AVIAN-SPECIFIC FECAL METAGENOMIC SEQUENCES USING GENOME FRAGMENT ENRICHMENTS

    Science.gov (United States)

    Sequence analysis of microbial genomes has provided biologists the opportunity to compare genetic differences between closely related microorganisms. While random sequencing has also been used to study natural microbial communities, metagenomic comparisons via sequencing analysis...

  10. Whole-genome sequencing of veterinary pathogens

    DEFF Research Database (Denmark)

    Ronco, Troels

    -electrophoresis and single-locus sequencing has been widely used to characterize such types of veterinary pathogens. However, DNA sequencing techniques have become fast and cost effective in recent years and whole-genome sequencing data provide a much higher discriminative power and reproducibility than any...... genetic background. This indicates that dairy cows can be natural carriers of S. aureus subtypes that in certain cases lead to CM. A group of isolates that mostly belonged to ST151 carried three pathogenicity islands that were primarily found in this group. The prevalence of resistance genes was generally...

  11. Sequence analysis of the genome of carnation (Dianthus caryophyllus L.).

    Science.gov (United States)

    Yagi, Masafumi; Kosugi, Shunichi; Hirakawa, Hideki; Ohmiya, Akemi; Tanase, Koji; Harada, Taro; Kishimoto, Kyutaro; Nakayama, Masayoshi; Ichimura, Kazuo; Onozaki, Takashi; Yamaguchi, Hiroyasu; Sasaki, Nobuhiro; Miyahara, Taira; Nishizaki, Yuzo; Ozeki, Yoshihiro; Nakamura, Noriko; Suzuki, Takamasa; Tanaka, Yoshikazu; Sato, Shusei; Shirasawa, Kenta; Isobe, Sachiko; Miyamura, Yoshinori; Watanabe, Akiko; Nakayama, Shinobu; Kishida, Yoshie; Kohara, Mitsuyo; Tabata, Satoshi

    2014-06-01

    The whole-genome sequence of carnation (Dianthus caryophyllus L.) cv. 'Francesco' was determined using a combination of different new-generation multiplex sequencing platforms. The total length of the non-redundant sequences was 568,887,315 bp, consisting of 45,088 scaffolds, which covered 91% of the 622 Mb carnation genome estimated by k-mer analysis. The N50 values of contigs and scaffolds were 16,644 bp and 60,737 bp, respectively, and the longest scaffold was 1,287,144 bp. The average GC content of the contig sequences was 36%. A total of 1050, 13, 92 and 143 genes for tRNAs, rRNAs, snoRNA and miRNA, respectively, were identified in the assembled genomic sequences. For protein-encoding genes, 43 266 complete and partial gene structures excluding those in transposable elements were deduced. Gene coverage was ∼ 98%, as deduced from the coverage of the core eukaryotic genes. Intensive characterization of the assigned carnation genes and comparison with those of other plant species revealed characteristic features of the carnation genome. The results of this study will serve as a valuable resource for fundamental and applied research of carnation, especially for breeding new carnation varieties. Further information on the genomic sequences is available at http://carnation.kazusa.or.jp. © The Author 2013. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  12. Comparison of methods for genomic localization of gene trap sequences

    Directory of Open Access Journals (Sweden)

    Ferrin Thomas E

    2006-09-01

    Full Text Available Abstract Background Gene knockouts in a model organism such as mouse provide a valuable resource for the study of basic biology and human disease. Determining which gene has been inactivated by an untargeted gene trapping event poses a challenging annotation problem because gene trap sequence tags, which represent sequence near the vector insertion site of a trapped gene, are typically short and often contain unresolved residues. To understand better the localization of these sequences on the mouse genome, we compared stand-alone versions of the alignment programs BLAT, SSAHA, and MegaBLAST. A set of 3,369 sequence tags was aligned to build 34 of the mouse genome using default parameters for each algorithm. Known genome coordinates for the cognate set of full-length genes (1,659 sequences were used to evaluate localization results. Results In general, all three programs performed well in terms of localizing sequences to a general region of the genome, with only relatively subtle errors identified for a small proportion of the sequence tags. However, large differences in performance were noted with regard to correctly identifying exon boundaries. BLAT correctly identified the vast majority of exon boundaries, while SSAHA and MegaBLAST missed the majority of exon boundaries. SSAHA consistently reported the fewest false positives and is the fastest algorithm. MegaBLAST was comparable to BLAT in speed, but was the most susceptible to localizing sequence tags incorrectly to pseudogenes. Conclusion The differences in performance for sequence tags and full-length reference sequences were surprisingly small. Characteristic variations in localization results for each program were noted that affect the localization of sequence at exon boundaries, in particular.

  13. Agaricus bisporus genome sequence: a commentary.

    Science.gov (United States)

    Kerrigan, Richard W; Challen, Michael P; Burton, Kerry S

    2013-06-01

    The genomes of two isolates of Agaricus bisporus have been sequenced recently. This soil-inhabiting fungus has a wide geographical distribution in nature and it is also cultivated in an industrialized indoor process ($4.7bn annual worldwide value) to produce edible mushrooms. Previously this lignocellulosic fungus has resisted precise econutritional classification, i.e. into white- or brown-rot decomposers. The generation of the genome sequence and transcriptomic analyses has revealed a new classification, 'humicolous', for species adapted to grow in humic-rich, partially decomposed leaf material. The Agaricus biporus genomes contain a collection of polysaccharide and lignin-degrading genes and more interestingly an expanded number of genes (relative to other lignocellulosic fungi) that enhance degradation of lignin derivatives, i.e. heme-thiolate peroxidases and β-etherases. A motif that is hypothesized to be a promoter element in the humicolous adaptation suite is present in a large number of genes specifically up-regulated when the mycelium is grown on humic-rich substrate. The genome sequence of A. bisporus offers a platform to explore fungal biology in carbon-rich soil environments and terrestrial cycling of carbon, nitrogen, phosphorus and potassium. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Genome sequence of Aspergillus luchuensis NBRC 4314

    Science.gov (United States)

    Yamada, Osamu; Machida, Masayuki; Hosoyama, Akira; Goto, Masatoshi; Takahashi, Toru; Futagami, Taiki; Yamagata, Youhei; Takeuchi, Michio; Kobayashi, Tetsuo; Koike, Hideaki; Abe, Keietsu; Asai, Kiyoshi; Arita, Masanori; Fujita, Nobuyuki; Fukuda, Kazuro; Higa, Ken-ichi; Horikawa, Hiroshi; Ishikawa, Takeaki; Jinno, Koji; Kato, Yumiko; Kirimura, Kohtaro; Mizutani, Osamu; Nakasone, Kaoru; Sano, Motoaki; Shiraishi, Yohei; Tsukahara, Masatoshi; Gomi, Katsuya

    2016-01-01

    Awamori is a traditional distilled beverage made from steamed Thai-Indica rice in Okinawa, Japan. For brewing the liquor, two microbes, local kuro (black) koji mold Aspergillus luchuensis and awamori yeast Saccharomyces cerevisiae are involved. In contrast, that yeasts are used for ethanol fermentation throughout the world, a characteristic of Japanese fermentation industries is the use of Aspergillus molds as a source of enzymes for the maceration and saccharification of raw materials. Here we report the draft genome of a kuro (black) koji mold, A. luchuensis NBRC 4314 (RIB 2604). The total length of nonredundant sequences was nearly 34.7 Mb, comprising approximately 2,300 contigs with 16 telomere-like sequences. In total, 11,691 genes were predicted to encode proteins. Most of the housekeeping genes, such as transcription factors and N-and O-glycosylation system, were conserved with respect to Aspergillus niger and Aspergillus oryzae. An alternative oxidase and acid-stable α-amylase regarding citric acid production and fermentation at a low pH as well as a unique glutamic peptidase were also found in the genome. Furthermore, key biosynthetic gene clusters of ochratoxin A and fumonisin B were absent when compared with A. niger genome, showing the safety of A. luchuensis for food and beverage production. This genome information will facilitate not only comparative genomics with industrial kuro-koji molds, but also molecular breeding of the molds in improvements of awamori fermentation. PMID:27651094

  15. Draft Genome Sequences of Actinobacillus pleuropneumoniae Serotypes 2 and 6

    DEFF Research Database (Denmark)

    Zhan, Bujie; Angen, Øystein; Hedegaard, Jakob

    2010-01-01

    Actinobacillus pleuropneumoniae is a bacterial pathogen that causes highly contagious respiratory infection in pigs and has a serious impact on the production economy and animal welfare. As clear differences in virulence between serotypes have been observed, the genetic basis should be investigat...... at the genomic level. Here, we present the draft genome sequences of the A. pleuropneumoniae serotypes 2 (strain 4226) and 6 (strain Femo)....

  16. Genomic divergences among cattle, dog and human estimated from large-scale alignments of genomic sequences

    Directory of Open Access Journals (Sweden)

    Shade Larry L

    2006-06-01

    Full Text Available Abstract Background Approximately 11 Mb of finished high quality genomic sequences were sampled from cattle, dog and human to estimate genomic divergences and their regional variation among these lineages. Results Optimal three-way multi-species global sequence alignments for 84 cattle clones or loci (each >50 kb of genomic sequence were constructed using the human and dog genome assemblies as references. Genomic divergences and substitution rates were examined for each clone and for various sequence classes under different functional constraints. Analysis of these alignments revealed that the overall genomic divergences are relatively constant (0.32–0.37 change/site for pairwise comparisons among cattle, dog and human; however substitution rates vary across genomic regions and among different sequence classes. A neutral mutation rate (2.0–2.2 × 10(-9 change/site/year was derived from ancestral repetitive sequences, whereas the substitution rate in coding sequences (1.1 × 10(-9 change/site/year was approximately half of the overall rate (1.9–2.0 × 10(-9 change/site/year. Relative rate tests also indicated that cattle have a significantly faster rate of substitution as compared to dog and that this difference is about 6%. Conclusion This analysis provides a large-scale and unbiased assessment of genomic divergences and regional variation of substitution rates among cattle, dog and human. It is expected that these data will serve as a baseline for future mammalian molecular evolution studies.

  17. Draft genome sequence of ramie, Boehmeria nivea (L.) Gaudich.

    Science.gov (United States)

    Luan, Ming-Bao; Jian, Jian-Bo; Chen, Ping; Chen, Jun-Hui; Chen, Jian-Hua; Gao, Qiang; Gao, Gang; Zhou, Ju-Hong; Chen, Kun-Mei; Guang, Xuan-Min; Chen, Ji-Kang; Zhang, Qian-Qian; Wang, Xiao-Fei; Fang, Long; Sun, Zhi-Min; Bai, Ming-Zhou; Fang, Xiao-Dong; Zhao, Shan-Cen; Xiong, He-Ping; Yu, Chun-Ming; Zhu, Ai-Guo

    2018-05-01

    Ramie, Boehmeria nivea (L.) Gaudich, family Urticaceae, is a plant native to eastern Asia, and one of the world's oldest fibre crops. It is also used as animal feed and for the phytoremediation of heavy metal-contaminated farmlands. Thus, the genome sequence of ramie was determined to explore the molecular basis of its fibre quality, protein content and phytoremediation. For further understanding ramie genome, different paired-end and mate-pair libraries were combined to generate 134.31 Gb of raw DNA sequences using the Illumina whole-genome shotgun sequencing approach. The highly heterozygous B. nivea genome was assembled using the Platanus Genome Assembler, which is an effective tool for the assembly of highly heterozygous genome sequences. The final length of the draft genome of this species was approximately 341.9 Mb (contig N50 = 22.62 kb, scaffold N50 = 1,126.36 kb). Based on ramie genome annotations, 30,237 protein-coding genes were predicted, and the repetitive element content was 46.3%. The completeness of the final assembly was evaluated by benchmarking universal single-copy orthologous genes (BUSCO); 90.5% of the 1,440 expected embryophytic genes were identified as complete, and 4.9% were identified as fragmented. Phylogenetic analysis based on single-copy gene families and one-to-one orthologous genes placed ramie with mulberry and cannabis, within the clade of urticalean rosids. Genome information of ramie will be a valuable resource for the conservation of endangered Boehmeria species and for future studies on the biogeography and characteristic evolution of members of Urticaceae. © 2018 John Wiley & Sons Ltd.

  18. Mapping copy number variation by population-scale genome sequencing

    DEFF Research Database (Denmark)

    Mills, Ryan E.; Walter, Klaudia; Stewart, Chip

    2011-01-01

    Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is......, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications...

  19. Chemical rationale for selection of isolates for genome sequencing

    DEFF Research Database (Denmark)

    Rank, Christian; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    The advances in gene sequencing will in the near future enable researchers to affordably acquire the full genomes of handpicked isolates. We here present a method to evaluate the chemical potential of an entire species and select representatives for genome sequencing. The selection criteria for new...... strains to be sequenced can be manifold, but for studying the functional phenotype, using a metabolome based approach offers a cheap and rapid assessment of critical strains to cover the chemical diversity. We have applied this methodology on the complex A. flavus/A. oryzae group. Though these two species...... are in principal identical, they represent two different phenotypes. This is clearly presented through a correspondence analysis of selected extrolites, in which the subtle chemical differences are visually dispersed. The results points to a handful of strains, which, if sequenced, will likely enhance our...

  20. Complete genome sequence of the European sheatfish virus.

    Science.gov (United States)

    Mavian, Carla; López-Bueno, Alberto; Fernández Somalo, María Pilar; Alcamí, Antonio; Alejo, Alí

    2012-06-01

    Viral diseases are an increasing threat to the thriving aquaculture industry worldwide. An emerging group of fish pathogens is formed by several ranaviruses, which have been isolated at different locations from freshwater and seawater fish species since 1985. We report the complete genome sequence of European sheatfish ranavirus (ESV), the first ranavirus isolated in Europe, which causes high mortality rates in infected sheatfish (Silurus glanis) and in other species. Analysis of the genome sequence shows that ESV belongs to the amphibian-like ranaviruses and is closely related to the epizootic hematopoietic necrosis virus (EHNV), a disease agent geographically confined to the Australian continent and notifiable to the World Organization for Animal Health.

  1. Sequencing of a Cultivated Diploid Cotton Genome-Gossypium arboreum

    Institute of Scientific and Technical Information of China (English)

    WILKINS; Thea; A

    2008-01-01

    Sequencing the genomes of crop species and model systems contributes significantly to our understanding of the organization,structure and function of plant genomes.In a `white paper' published in 2007,the cotton community set forth a strategic plan for sequencing the AD genome of cultivated upland cotton that initially targets less complex diploid genomes.This strategy banks on the high degree

  2. Draft Genome Sequences of Sanguibacteroides justesenii, gen. nov., sp. nov., Strains OUH 308042T (= ATCC BAA-2681T) and OUH 334697 (= ATCC BAA-2682), Isolated from Blood Cultures from Two Different Patients

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Hasman, Henrik; Justesen, Ulrik Stenz

    2015-01-01

    We announce here the draft genome sequences of Sanguibacteroides justesenii, gen. nov., sp. nov., strains OUH 308042T (= DSM 28342T = ATCC BAA-2681T) and OUH 334697 (= DSM 28341 = ATCC BAA-2682), isolated from blood cultures from two different patients and composed of 51 and 39 contigs for totals...

  3. From Genome Sequence to Taxonomy - A Skeptic’s View

    DEFF Research Database (Denmark)

    Özen, Asli Ismihan; Vesth, Tammi Camilla; Ussery, David

    2012-01-01

    The relative ease of sequencing bacterial genomes has resulted in thousands of sequenced bacterial genomes available in the public databases. This same technology now allows for using the entire genome sequence as an identifier for an organism. There are many methods available which attempt to us...

  4. Mitochondrial genome sequences and comparative genomics ofPhytophthora ramorum and P. sojae

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Frank N.; Douda, Bensasson; Tyler, Brett M.; Boore,Jeffrey L.

    2007-01-01

    The complete sequences of the mitochondrial genomes of theoomycetes of Phytophthora ramorum and P. sojae were determined during thecourse of their complete nuclear genome sequencing (Tyler, et al. 2006).Both are circular, with sizes of 39,314 bp for P. ramorum and 42,975 bpfor P. sojae. Each contains a total of 37 identifiable protein-encodinggenes, 25 or 26 tRNAs (P. sojae and P. ramorum, respectively)specifying19 amino acids, and a variable number of ORFs (7 for P. ramorum and 12for P. sojae) which are potentially additional functional genes.Non-coding regions comprise approximately 11.5 percent and 18.4 percentof the genomes of P. ramorum and P. sojae, respectively. Relative to P.sojae, there is an inverted repeat of 1,150 bp in P. ramorum thatincludes an unassigned unique ORF, a tRNA gene, and adjacent non-codingsequences, but otherwise the gene order in both species is identical.Comparisons of these genomes with published sequences of the P. infestansmitochondrial genome reveals a number of similarities, but the gene orderin P. infestans differs in two adjacent locations due to inversions.Sequence alignments of the three genomes indicated sequence conservationranging from 75 to 85 percent and that specific regions were morevariable than others.

  5. Next Generation DNA Sequencing and the Future of Genomic Medicine

    OpenAIRE

    Anderson, Matthew W.; Schrijver, Iris

    2010-01-01

    In the years since the first complete human genome sequence was reported, there has been a rapid development of technologies to facilitate high-throughput sequence analysis of DNA (termed “next-generation” sequencing). These novel approaches to DNA sequencing offer the promise of complete genomic analysis at a cost feasible for routine clinical diagnostics. However, the ability to more thoroughly interrogate genomic sequence raises a number of important issues with regard to result interpreta...

  6. Transforming clinical microbiology with bacterial genome sequencing.

    Science.gov (United States)

    Didelot, Xavier; Bowden, Rory; Wilson, Daniel J; Peto, Tim E A; Crook, Derrick W

    2012-09-01

    Whole-genome sequencing of bacteria has recently emerged as a cost-effective and convenient approach for addressing many microbiological questions. Here, we review the current status of clinical microbiology and how it has already begun to be transformed by using next-generation sequencing. We focus on three essential tasks: identifying the species of an isolate, testing its properties, such as resistance to antibiotics and virulence, and monitoring the emergence and spread of bacterial pathogens. We predict that the application of next-generation sequencing will soon be sufficiently fast, accurate and cheap to be used in routine clinical microbiology practice, where it could replace many complex current techniques with a single, more efficient workflow.

  7. Low-pass sequencing for microbial comparative genomics

    Directory of Open Access Journals (Sweden)

    Kennedy Sean

    2004-01-01

    IS-element rich genome of H. sp. NRC-1. Identification of multiple TBP and TFB homologs in these four halophiles are consistent with the hypothesis that different types of complex transcriptional regulation may occur through multiple TBP-TFB combinations in response to rapidly changing environmental conditions. Low-pass shotgun sequence analyses of genomes permit extensive and diverse analyses, and should be generally useful for comparative microbial genomics.

  8. The evolutionary rates of HCV estimated with subtype 1a and 1b sequences over the ORF length and in different genomic regions.

    Directory of Open Access Journals (Sweden)

    Manqiong Yuan

    Full Text Available Considerable progress has been made in the HCV evolutionary analysis, since the software BEAST was released. However, prior information, especially the prior evolutionary rate, which plays a critical role in BEAST analysis, is always difficult to ascertain due to various uncertainties. Providing a proper prior HCV evolutionary rate is thus of great importance.176 full-length sequences of HCV subtype 1a and 144 of 1b were assembled by taking into consideration the balance of the sampling dates and the even dispersion in phylogenetic trees. According to the HCV genomic organization and biological functions, each dataset was partitioned into nine genomic regions and two routinely amplified regions. A uniform prior rate was applied to the BEAST analysis for each region and also the entire ORF. All the obtained posterior rates for 1a are of a magnitude of 10(-3 substitutions/site/year and in a bell-shaped distribution. Significantly lower rates were estimated for 1b and some of the rate distribution curves resulted in a one-sided truncation, particularly under the exponential model. This indicates that some of the rates for subtype 1b are less accurate, so they were adjusted by including more sequences to improve the temporal structure.Among the various HCV subtypes and genomic regions, the evolutionary patterns are dissimilar. Therefore, an applied estimation of the HCV epidemic history requires the proper selection of the rate priors, which should match the actual dataset so that they can fit for the subtype, the genomic region and even the length. By referencing the findings here, future evolutionary analysis of the HCV subtype 1a and 1b datasets may become more accurate and hence prove useful for tracing their patterns.

  9. An automated annotation tool for genomic DNA sequences using

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  10. Approaches for in silico finishing of microbial genome sequences

    Directory of Open Access Journals (Sweden)

    Frederico Schmitt Kremer

    Full Text Available Abstract The introduction of next-generation sequencing (NGS had a significant effect on the availability of genomic information, leading to an increase in the number of sequenced genomes from a large spectrum of organisms. Unfortunately, due to the limitations implied by the short-read sequencing platforms, most of these newly sequenced genomes remained as “drafts”, incomplete representations of the whole genetic content. The previous genome sequencing studies indicated that finishing a genome sequenced by NGS, even bacteria, may require additional sequencing to fill the gaps, making the entire process very expensive. As such, several in silico approaches have been developed to optimize the genome assemblies and facilitate the finishing process. The present review aims to explore some free (open source, in many cases tools that are available to facilitate genome finishing.

  11. Approaches for in silico finishing of microbial genome sequences.

    Science.gov (United States)

    Kremer, Frederico Schmitt; McBride, Alan John Alexander; Pinto, Luciano da Silva

    The introduction of next-generation sequencing (NGS) had a significant effect on the availability of genomic information, leading to an increase in the number of sequenced genomes from a large spectrum of organisms. Unfortunately, due to the limitations implied by the short-read sequencing platforms, most of these newly sequenced genomes remained as "drafts", incomplete representations of the whole genetic content. The previous genome sequencing studies indicated that finishing a genome sequenced by NGS, even bacteria, may require additional sequencing to fill the gaps, making the entire process very expensive. As such, several in silico approaches have been developed to optimize the genome assemblies and facilitate the finishing process. The present review aims to explore some free (open source, in many cases) tools that are available to facilitate genome finishing.

  12. Genomic signal processing for DNA sequence clustering.

    Science.gov (United States)

    Mendizabal-Ruiz, Gerardo; Román-Godínez, Israel; Torres-Ramos, Sulema; Salido-Ruiz, Ricardo A; Vélez-Pérez, Hugo; Morales, J Alejandro

    2018-01-01

    Genomic signal processing (GSP) methods which convert DNA data to numerical values have recently been proposed, which would offer the opportunity of employing existing digital signal processing methods for genomic data. One of the most used methods for exploring data is cluster analysis which refers to the unsupervised classification of patterns in data. In this paper, we propose a novel approach for performing cluster analysis of DNA sequences that is based on the use of GSP methods and the K-means algorithm. We also propose a visualization method that facilitates the easy inspection and analysis of the results and possible hidden behaviors. Our results support the feasibility of employing the proposed method to find and easily visualize interesting features of sets of DNA data.

  13. Genome sequence of herpes simplex virus 1 strain KOS.

    Science.gov (United States)

    Macdonald, Stuart J; Mostafa, Heba H; Morrison, Lynda A; Davido, David J

    2012-06-01

    Herpes simplex virus type 1 (HSV-1) strain KOS has been extensively used in many studies to examine HSV-1 replication, gene expression, and pathogenesis. Notably, strain KOS is known to be less pathogenic than the first sequenced genome of HSV-1, strain 17. To understand the genotypic differences between KOS and other phenotypically distinct strains of HSV-1, we sequenced the viral genome of strain KOS. When comparing strain KOS to strain 17, there are at least 1,024 small nucleotide polymorphisms (SNPs) and 172 insertions/deletions (indels). The polymorphisms observed in the KOS genome will likely provide insights into the genes, their protein products, and the cis elements that regulate the biology of this HSV-1 strain.

  14. Genome sequence of the lager brewing yeast, an interspecies hybrid.

    Science.gov (United States)

    Nakao, Yoshihiro; Kanamori, Takeshi; Itoh, Takehiko; Kodama, Yukiko; Rainieri, Sandra; Nakamura, Norihisa; Shimonaga, Tomoko; Hattori, Masahira; Ashikari, Toshihiko

    2009-04-01

    This work presents the genome sequencing of the lager brewing yeast (Saccharomyces pastorianus) Weihenstephan 34/70, a strain widely used in lager beer brewing. The 25 Mb genome comprises two nuclear sub-genomes originating from Saccharomyces cerevisiae and Saccharomyces bayanus and one circular mitochondrial genome originating from S. bayanus. Thirty-six different types of chromosomes were found including eight chromosomes with translocations between the two sub-genomes, whose breakpoints are within the orthologous open reading frames. Several gene loci responsible for typical lager brewing yeast characteristics such as maltotriose uptake and sulfite production have been increased in number by chromosomal rearrangements. Despite an overall high degree of conservation of the synteny with S. cerevisiae and S. bayanus, the syntenies were not well conserved in the sub-telomeric regions that contain lager brewing yeast characteristic and specific genes. Deletion of larger chromosomal regions, a massive unilateral decrease of the ribosomal DNA cluster and bilateral truncations of over 60 genes reflect a post-hybridization evolution process. Truncations and deletions of less efficient maltose and maltotriose uptake genes may indicate the result of adaptation to brewing. The genome sequence of this interspecies hybrid yeast provides a new tool for better understanding of lager brewing yeast behavior in industrial beer production.

  15. Supplementary Material for: Whole genome sequencing reveals genomic heterogeneity and antibiotic purification in Mycobacterium tuberculosis isolates

    KAUST Repository

    Black, PA; Vos, M. de; Louw, GE; Merwe, RG van der; Dippenaar, A.; Streicher, EM; Abdallah, AM; Sampson, SL; Victor, TC; Dolby, T.; Simpson, JA; Helden, PD van; Warren, RM; Pain, Arnab

    2015-01-01

    Abstract Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug

  16. Mining olive genome through library sequencing and bioinformatics ...

    African Journals Online (AJOL)

    As one of the initial steps of olive (Olea europaea L.) genome analysis, a small insert genomic DNA library was constructed (digesting olive genomic DNA with SmaI and cloning the digestion products into pUC19 vector) and randomly picked 83 colonies were sequenced. Analysis of the insert sequences revealed 12 clones ...

  17. Draft genome sequence of the sexually transmitted pathogen Trichomonas vaginalis

    DEFF Research Database (Denmark)

    Carlton, Jane M.; Hirt, Robert P.; Silva, Joana C.

    2007-01-01

    We describe the genome sequence of the protist Trichomonas vaginalis, a sexually transmitted human pathogen. Repeats and transposable elements comprise about two-thirds of the approximately 160-megabase genome, reflecting a recent massive expansion of genetic material. This expansion...... environment. The genome sequence predicts previously unknown functions for the hydrogenosome, which support a common evolutionary origin of this unusual organelle with mitochondria....

  18. Rapid sequencing of the bamboo mitochondrial genome using Illumina technology and parallel episodic evolution of organelle genomes in grasses.

    Science.gov (United States)

    Ma, Peng-Fei; Guo, Zhen-Hua; Li, De-Zhu

    2012-01-01

    Compared to their counterparts in animals, the mitochondrial (mt) genomes of angiosperms exhibit a number of unique features. However, unravelling their evolution is hindered by the few completed genomes, of which are essentially Sanger sequenced. While next-generation sequencing technologies have revolutionized chloroplast genome sequencing, they are just beginning to be applied to angiosperm mt genomes. Chloroplast genomes of grasses (Poaceae) have undergone episodic evolution and the evolutionary rate was suggested to be correlated between chloroplast and mt genomes in Poaceae. It is interesting to investigate whether correlated rate change also occurred in grass mt genomes as expected under lineage effects. A time-calibrated phylogenetic tree is needed to examine rate change. We determined a largely completed mt genome from a bamboo, Ferrocalamus rimosivaginus (Poaceae), through Illumina sequencing of total DNA. With combination of de novo and reference-guided assembly, 39.5-fold coverage Illumina reads were finally assembled into scaffolds totalling 432,839 bp. The assembled genome contains nearly the same genes as the completed mt genomes in Poaceae. For examining evolutionary rate in grass mt genomes, we reconstructed a phylogenetic tree including 22 taxa based on 31 mt genes. The topology of the well-resolved tree was almost identical to that inferred from chloroplast genome with only minor difference. The inconsistency possibly derived from long branch attraction in mtDNA tree. By calculating absolute substitution rates, we found significant rate change (∼4-fold) in mt genome before and after the diversification of Poaceae both in synonymous and nonsynonymous terms. Furthermore, the rate change was correlated with that of chloroplast genomes in grasses. Our result demonstrates that it is a rapid and efficient approach to obtain angiosperm mt genome sequences using Illumina sequencing technology. The parallel episodic evolution of mt and chloroplast

  19. Rapid whole genome sequencing and precision neonatology.

    Science.gov (United States)

    Petrikin, Joshua E; Willig, Laurel K; Smith, Laurie D; Kingsmore, Stephen F

    2015-12-01

    Traditionally, genetic testing has been too slow or perceived to be impractical to initial management of the critically ill neonate. Technological advances have led to the ability to sequence and interpret the entire genome of a neonate in as little as 26 h. As the cost and speed of testing decreases, the utility of whole genome sequencing (WGS) of neonates for acute and latent genetic illness increases. Analyzing the entire genome allows for concomitant evaluation of the currently identified 5588 single gene diseases. When applied to a select population of ill infants in a level IV neonatal intensive care unit, WGS yielded a diagnosis of a causative genetic disease in 57% of patients. These diagnoses may lead to clinical management changes ranging from transition to palliative care for uniformly lethal conditions for alteration or initiation of medical or surgical therapy to improve outcomes in others. Thus, institution of 2-day WGS at time of acute presentation opens the possibility of early implementation of precision medicine. This implementation may create opportunities for early interventional, frequently novel or off-label therapies that may alter disease trajectory in infants with what would otherwise be fatal disease. Widespread deployment of rapid WGS and precision medicine will raise ethical issues pertaining to interpretation of variants of unknown significance, discovery of incidental findings related to adult onset conditions and carrier status, and implementation of medical therapies for which little is known in terms of risks and benefits. Despite these challenges, precision neonatology has significant potential both to decrease infant mortality related to genetic diseases with onset in newborns and to facilitate parental decision making regarding transition to palliative care. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Directory of Open Access Journals (Sweden)

    Qingyu Chen

    Full Text Available First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases.We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  1. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Science.gov (United States)

    Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin

    2016-01-01

    First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  2. Large-Scale Sequencing: The Future of Genomic Sciences Colloquium

    Energy Technology Data Exchange (ETDEWEB)

    Margaret Riley; Merry Buckley

    2009-01-01

    , since not only are their genomes available, but they are also accompanied by data on environment and physiology that can be used to understand the resulting data. As single cell isolation methods improve, there should be a shift toward incorporating uncultured organisms and communities into this effort. Efforts to sequence cultivated isolates should target characterized isolates from culture collections for which biochemical data are available, as well as other cultures of lasting value from personal collections. The genomes of type strains should be among the first targets for sequencing, but creative culture methods, novel cell isolation, and sorting methods would all be helpful in obtaining organisms we have not yet been able to cultivate for sequencing. The data that should be provided for strains targeted for sequencing will depend on the phylogenetic context of the organism and the amount of information available about its nearest relatives. Annotation is an important part of transforming genome sequences into useful resources, but it represents the most significant bottleneck to the field of comparative genomics right now and must be addressed. Furthermore, there is a need for more consistency in both annotation and achieving annotation data. As new annotation tools become available over time, re-annotation of genomes should be implemented, taking advantage of advancements in annotation techniques in order to capitalize on the genome sequences and increase both the societal and scientific benefit of genomics work. Given the proper resources, the knowledge and ability exist to be able to select model systems, some simple, some less so, and dissect them so that we may understand the processes and interactions at work in them. Colloquium participants suggest a five-pronged, coordinated initiative to exhaustively describe six different microbial ecosystems, designed to describe all the gene diversity, across genomes. In this effort, sequencing should be complemented

  3. Building the sequence map of the human pan-genome

    DEFF Research Database (Denmark)

    Li, Ruiqiang; Li, Yingrui; Zheng, Hancheng

    2010-01-01

    analysis of predicted genes indicated that the novel sequences contain potentially functional coding regions. We estimate that a complete human pan-genome would contain approximately 19-40 Mb of novel sequence not present in the extant reference genome. The extensive amount of novel sequence contributing...

  4. Get your high-quality low-cost genome sequence

    NARCIS (Netherlands)

    Faino, L.; Thomma, B.P.H.J.

    2014-01-01

    The study of whole-genome sequences has become essential for almost all branches of biological research. Next-generation sequencing (NGS) has revolutionized the scalability, speed, and resolution of sequencing and brought genomic science within reach of academic laboratories that study non-model

  5. The diploid genome sequence of an Asian individual

    DEFF Research Database (Denmark)

    Wang, Jun; Wang, Wei; Li, Ruiqiang

    2008-01-01

    Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we...... used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP...... identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J...

  6. Complete genome sequence of Arcanobacterium haemolyticum type strain (11018T)

    Energy Technology Data Exchange (ETDEWEB)

    Yasawong, Montri [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Teshima, Hazuki [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Pukall, Rudiger [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2010-01-01

    Vulcanisaeta distributa Itoh et al. 2002 belongs to the family Thermoproteaceae in the phylum Crenarchaeota. The genus Vulcanisaeta is characterized by a global distribution in hot and acidic springs. This is the first genome sequence from a member of the genus Vulcanisaeta and seventh genome sequence in the family Thermoproteaceae. The 2,374,137 bp long genome with its 2,544 protein-coding and 49 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  7. Genome sequencing and annotation of Stenotrophomonas sp. SAM8

    Directory of Open Access Journals (Sweden)

    Samy Selim

    2015-12-01

    Full Text Available We report draft genome sequence of Stenotrophomonas sp. strain SAM8, isolated from environmental water. The draft genome size is 3,665,538 bp with a G + C content of 67.2% and contains 6 rRNA sequence (single copies of 5S, 16S & 23S rRNA. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LDAV00000000.

  8. Genome sequencing and annotation of Proteus sp. SAS71

    Directory of Open Access Journals (Sweden)

    Samy Selim

    2015-12-01

    Full Text Available We report draft genome sequence of Proteus sp. strain SAS71, isolated from water spring in Aljouf region, Saudi Arabia. The draft genome size is 3,037,704 bp with a G + C content of 39.3% and contains 6 rRNA sequence (single copies of 5S, 16S & 23S rRNA. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LDIU00000000.

  9. Whole Genome Sequencing for Genomics-Guided Investigations of Escherichia coli O157:H7 Outbreaks.

    Science.gov (United States)

    Rusconi, Brigida; Sanjar, Fatemeh; Koenig, Sara S K; Mammel, Mark K; Tarr, Phillip I; Eppinger, Mark

    2016-01-01

    Multi isolate whole genome sequencing (WGS) and typing for outbreak investigations has become a reality in the post-genomics era. We applied this technology to strains from Escherichia coli O157:H7 outbreaks. These include isolates from seven North America outbreaks, as well as multiple isolates from the same patient and from different infected individuals in the same household. Customized high-resolution bioinformatics sequence typing strategies were developed to assess the core genome and mobilome plasticity. Sequence typing was performed using an in-house single nucleotide polymorphism (SNP) discovery and validation pipeline. Discriminatory power becomes of particular importance for the investigation of isolates from outbreaks in which macrogenomic techniques such as pulse-field gel electrophoresis or multiple locus variable number tandem repeat analysis do not differentiate closely related organisms. We also characterized differences in the phage inventory, allowing us to identify plasticity among outbreak strains that is not detectable at the core genome level. Our comprehensive analysis of the mobilome identified multiple plasmids that have not previously been associated with this lineage. Applied phylogenomics approaches provide strong molecular evidence for exceptionally little heterogeneity of strains within outbreaks and demonstrate the value of intra-cluster comparisons, rather than basing the analysis on archetypal reference strains. Next generation sequencing and whole genome typing strategies provide the technological foundation for genomic epidemiology outbreak investigation utilizing its significantly higher sample throughput, cost efficiency, and phylogenetic relatedness accuracy. These phylogenomics approaches have major public health relevance in translating information from the sequence-based survey to support timely and informed countermeasures. Polymorphisms identified in this work offer robust phylogenetic signals that index both short- and

  10. Next-Generation Sequencing and Genome Editing in Plant Virology

    Directory of Open Access Journals (Sweden)

    Ahmed Hadidi

    2016-08-01

    Full Text Available Next-generation sequencing (NGS has been applied to plant virology since 2009. NGS provides highly efficient, rapid, low cost DNA or RNA high-throughput sequencing of the genomes of plant viruses and viroids and of the specific small RNAs generated during the infection process. These small RNAs, which cover frequently the whole genome of the infectious agent, are 21-24 nt long and are known as vsRNAs for viruses and vd-sRNAs for viroids. NGS has been used in a number of studies in plant virology including, but not limited to, discovery of novel viruses and viroids as well as detection and identification of those pathogens already known, analysis of genome diversity and evolution, and study of pathogen epidemiology. The genome engineering editing method, clustered regularly interspaced short palindromic repeats (CRISPR-Cas9 system has been successfully used recently to engineer resistance to DNA geminiviruses (family, Geminiviridae by targeting different viral genome sequences in infected Nicotiana benthamiana or Arabidopsis plants. The DNA viruses targeted include tomato yellow leaf curl virus and merremia mosaic virus (begomovirus; beet curly top virus and beet severe curly top virus (curtovirus; and bean yellow dwarf virus (mastrevirus. The technique has also been used against the RNA viruses zucchini yellow mosaic virus, papaya ringspot virus and turnip mosaic virus (potyvirus and cucumber vein yellowing virus (ipomovirus, family, Potyviridae by targeting the translation initiation genes eIF4E in cucumber or Arabidopsis plants. From these recent advances of major importance, it is expected that NGS and CRISPR-Cas technologies will play a significant role in the very near future in advancing the field of plant virology and connecting it with other related fields of biology.Keywords: Next-generation sequencing, NGS, plant virology, plant viruses, viroids, resistance to plant viruses by CRISPR-Cas9

  11. The mitochondrial genome sequence of the Tasmanian tiger (Thylacinus cynocephalus)

    DEFF Research Database (Denmark)

    Miller, Webb; Drautz, Daniela I; Janecka, Jan E

    2009-01-01

    We report the first two complete mitochondrial genome sequences of the thylacine (Thylacinus cynocephalus), or so-called Tasmanian tiger, extinct since 1936. The thylacine's phylogenetic position within australidelphian marsupials has long been debated, and here we provide strong support for the ......We report the first two complete mitochondrial genome sequences of the thylacine (Thylacinus cynocephalus), or so-called Tasmanian tiger, extinct since 1936. The thylacine's phylogenetic position within australidelphian marsupials has long been debated, and here we provide strong support...... for the thylacine's basal position in Dasyuromorphia, aided by mitochondrial genome sequence that we generated from the extant numbat (Myrmecobius fasciatus). Surprisingly, both of our thylacine sequences differ by 11%-15% from putative thylacine mitochondrial genes in GenBank, with one of our samples originating...... at a very low genetic diversity shortly before extinction. Despite the samples' heavy contamination with bacterial and human DNA and their temperate storage history, we estimate that as much as one-third of the total DNA in each sample is from the thylacine. The microbial content of the two thylacine...

  12. The peculiar landscape of repetitive sequences in the olive (Olea europaea L.) genome.

    Science.gov (United States)

    Barghini, Elena; Natali, Lucia; Cossu, Rosa Maria; Giordani, Tommaso; Pindo, Massimo; Cattonaro, Federica; Scalabrin, Simone; Velasco, Riccardo; Morgante, Michele; Cavallini, Andrea

    2014-04-01

    Analyzing genome structure in different species allows to gain an insight into the evolution of plant genome size. Olive (Olea europaea L.) has a medium-sized haploid genome of 1.4 Gb, whose structure is largely uncharacterized, despite the growing importance of this tree as oil crop. Next-generation sequencing technologies and different computational procedures have been used to study the composition of the olive genome and its repetitive fraction. A total of 2.03 and 2.3 genome equivalents of Illumina and 454 reads from genomic DNA, respectively, were assembled following different procedures, which produced more than 200,000 differently redundant contigs, with mean length higher than 1,000 nt. Mapping Illumina reads onto the assembled sequences was used to estimate their redundancy. The genome data set was subdivided into highly and medium redundant and nonredundant contigs. By combining identification and mapping of repeated sequences, it was established that tandem repeats represent a very large portion of the olive genome (∼31% of the whole genome), consisting of six main families of different length, two of which were first discovered in these experiments. The other large redundant class in the olive genome is represented by transposable elements (especially long terminal repeat-retrotransposons). On the whole, the results of our analyses show the peculiar landscape of the olive genome, related to the massive amplification of tandem repeats, more than that reported for any other sequenced plant genome.

  13. Genome Sequence of Lactobacillus plantarum Strain UCMA 3037

    OpenAIRE

    Naz, Saima; Tareb, Raouf; Bernardeau, Marion; Vaisse, Melissa; Lucchetti-Miganeh, Celine; Rechenmann, Mathias; Vernoux, Jean-Paul

    2013-01-01

    Nucleic acid of the strain Lactobacillus plantarum UCMA 3037, isolated from raw milk camembert cheese in our laboratory, was sequenced. We present its draft genome sequence with the aim of studying its functional properties and relationship to the cheese ecosystem.

  14. Genome Sequence of Lactobacillus plantarum Strain UCMA 3037.

    Science.gov (United States)

    Naz, Saima; Tareb, Raouf; Bernardeau, Marion; Vaisse, Melissa; Lucchetti-Miganeh, Celine; Rechenmann, Mathias; Vernoux, Jean-Paul

    2013-05-23

    Nucleic acid of the strain Lactobacillus plantarum UCMA 3037, isolated from raw milk camembert cheese in our laboratory, was sequenced. We present its draft genome sequence with the aim of studying its functional properties and relationship to the cheese ecosystem.

  15. Comparative sequence analysis of Sordaria macrospora and Neurospora crassa as a means to improve genome annotation.

    Science.gov (United States)

    Nowrousian, Minou; Würtz, Christian; Pöggeler, Stefanie; Kück, Ulrich

    2004-03-01

    One of the most challenging parts of large scale sequencing projects is the identification of functional elements encoded in a genome. Recently, studies of genomes of up to six different Saccharomyces species have demonstrated that a comparative analysis of genome sequences from closely related species is a powerful approach to identify open reading frames and other functional regions within genomes [Science 301 (2003) 71, Nature 423 (2003) 241]. Here, we present a comparison of selected sequences from Sordaria macrospora to their corresponding Neurospora crassa orthologous regions. Our analysis indicates that due to the high degree of sequence similarity and conservation of overall genomic organization, S. macrospora sequence information can be used to simplify the annotation of the N. crassa genome.

  16. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  17. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  18. A Snapshot of the Emerging Tomato Genome Sequence

    Directory of Open Access Journals (Sweden)

    Lukas A. Mueller

    2009-03-01

    Full Text Available The genome of tomato ( L. is being sequenced by an international consortium of 10 countries (Korea, China, the United Kingdom, India, the Netherlands, France, Japan, Spain, Italy, and the United States as part of the larger “International Solanaceae Genome Project (SOL: Systems Approach to Diversity and Adaptation” initiative. The tomato genome sequencing project uses an ordered bacterial artificial chromosome (BAC approach to generate a high-quality tomato euchromatic genome sequence for use as a reference genome for the Solanaceae and euasterids. Sequence is deposited at GenBank and at the SOL Genomics Network (SGN. Currently, there are around 1000 BACs finished or in progress, representing more than a third of the projected euchromatic portion of the genome. An annotation effort is also underway by the International Tomato Annotation Group. The expected number of genes in the euchromatin is ∼40,000, based on an estimate from a preliminary annotation of 11% of finished sequence. Here, we present this first snapshot of the emerging tomato genome and its annotation, a short comparison with potato ( L. sequence data, and the tools available for the researchers to exploit this new resource are also presented. In the future, whole-genome shotgun techniques will be combined with the BAC-by-BAC approach to cover the entire tomato genome. The high-quality reference euchromatic tomato sequence is expected to be near completion by 2010.

  19. Draft Genome Sequences of Four Hospital-Associated Pseudomonas putida Isolates.

    Science.gov (United States)

    Mustapha, Mustapha M; Marsh, Jane W; Ezeonwuka, Chinelo D; Pasculle, Anthony W; Pacey, Marissa P; Querry, Ashley M; Muto, Carlene A; Harrison, Lee H

    2016-09-29

    We present here the draft genome sequences of four Pseudomonas putida isolates belonging to a single clone suspected for nosocomial transmission between patients and a bronchoscope in a tertiary hospital. The four genome sequences belong to a single lineage but contain differences in their mobile genetic elements. Copyright © 2016 Mustapha et al.

  20. Complete Genome Sequence of Photobacterium sp. Strain J15, Isolated from Seawater of Southwestern Johor, Malaysia.

    Science.gov (United States)

    Roslan, Noordiyanah Nadhirah; Sabri, Suriana; Oslan, Siti Nurbaya; Baharum, Syarul Nataqain; Leow, Thean Chor

    2016-07-28

    Here, we report the genome sequences of Photobacterium sp. strain J15, isolated from seawater in Johor, Malaysia, with the ability to produce lipase and asparaginase. The PacBio genome sequence analysis of Photobacterium sp. strain J15 generated revealed its potential in producing enzymes with different catalytic functions. Copyright © 2016 Roslan et al.

  1. Gene Discovery through Genomic Sequencing of Brucella abortus

    OpenAIRE

    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

    2001-01-01

    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposit...

  2. MIPS: a database for protein sequences and complete genomes.

    Science.gov (United States)

    Mewes, H W; Hani, J; Pfeiffer, F; Frishman, D

    1998-01-01

    The MIPS group [Munich Information Center for Protein Sequences of the German National Center for Environment and Health (GSF)] at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, is involved in a number of data collection activities, including a comprehensive database of the yeast genome, a database reflecting the progress in sequencing the Arabidopsis thaliana genome, the systematic analysis of other small genomes and the collection of protein sequence data within the framework of the PIR-International Protein Sequence Database (described elsewhere in this volume). Through its WWW server (http://www.mips.biochem.mpg.de ) MIPS provides access to a variety of generic databases, including a database of protein families as well as automatically generated data by the systematic application of sequence analysis algorithms. The yeast genome sequence and its related information was also compiled on CD-ROM to provide dynamic interactive access to the 16 chromosomes of the first eukaryotic genome unraveled. PMID:9399795

  3. Origin of the Y genome in Elymus and its relationship to other genomes in Triticeae based on evidence from elongation factor G (EF-G) gene sequences.

    Science.gov (United States)

    Sun, Genlou; Komatsuda, Takao

    2010-08-01

    It is well known that Elymus arose through hybridization between representatives of different genera. Cytogenetic analyses show that all its members include the St genome in combination with one or more of four other genomes, the H, Y, P, and W genomes. The origins of the H, P, and W genomes are known, but not for the Y genome. We analyzed the single copy nuclear gene coding for elongation factor G (EF-G) from 28 accessions of polyploid Elymus species and 45 accessions of diploid Triticeae species in order to investigate origin of the Y genome and its relationship to other genomes in the tribe Triticeae. Sequence comparisons among the St, H, Y, P, W, and E genomes detected genome-specific polymorphisms at 66 nucleotide positions. The St and Y genomes are relatively dissimilar. The phylogeny of the Y genome sequences was investigated for the first time. They were most similar to the W genome sequences. The Y genome sequences were placed in two different groups. These two groups were included in an unresolved clade that included the W and E sequences as well as sequences from many annual species. The H genomes sequences were in a clade with the F, P, and Ns genome sequences as sister groups. These two clades were more closely related to each other and to the L and Xp genomes than they were to the St genome sequences. These data support the hypothesis that the Y genome evolved in a diploid species and has a different origin from the St genome. Copyright 2010 Elsevier Inc. All rights reserved.

  4. Microbial genome sequencing using optical mapping and Illumina sequencing

    Science.gov (United States)

    Introduction Optical mapping is a technique in which strands of genomic DNA are digested with one or more restriction enzymes, and a physical map of the genome constructed from the resulting image. In outline, genomic DNA is extracted from a pure culture, linearly arrayed on a specialized glass sli...

  5. Why size really matters when sequencing plant genomes

    Czech Academy of Sciences Publication Activity Database

    Kelly, L.J.; Leitch, A.R.; Fay, M. F.; Renny-Byfield, S.; Pellicer, J.; Macas, Jiří; Leitch, I.J.

    2012-01-01

    Roč. 5, č. 4 (2012), s. 415-425 ISSN 1755-0874 Institutional research plan: CEZ:AV0Z50510513 Institutional support: RVO:60077344 Keywords : C-value * genome assembly * genome size evolution * genome sequencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.924, year: 2012

  6. A computational genomics pipeline for prokaryotic sequencing projects.

    Science.gov (United States)

    Kislyuk, Andrey O; Katz, Lee S; Agrawal, Sonia; Hagen, Matthew S; Conley, Andrew B; Jayaraman, Pushkala; Nelakuditi, Viswateja; Humphrey, Jay C; Sammons, Scott A; Govil, Dhwani; Mair, Raydel D; Tatti, Kathleen M; Tondella, Maria L; Harcourt, Brian H; Mayer, Leonard W; Jordan, I King

    2010-08-01

    New sequencing technologies have accelerated research on prokaryotic genomes and have made genome sequencing operations outside major genome sequencing centers routine. However, no off-the-shelf solution exists for the combined assembly, gene prediction, genome annotation and data presentation necessary to interpret sequencing data. The resulting requirement to invest significant resources into custom informatics support for genome sequencing projects remains a major impediment to the accessibility of high-throughput sequence data. We present a self-contained, automated high-throughput open source genome sequencing and computational genomics pipeline suitable for prokaryotic sequencing projects. The pipeline has been used at the Georgia Institute of Technology and the Centers for Disease Control and Prevention for the analysis of Neisseria meningitidis and Bordetella bronchiseptica genomes. The pipeline is capable of enhanced or manually assisted reference-based assembly using multiple assemblers and modes; gene predictor combining; and functional annotation of genes and gene products. Because every component of the pipeline is executed on a local machine with no need to access resources over the Internet, the pipeline is suitable for projects of a sensitive nature. Annotation of virulence-related features makes the pipeline particularly useful for projects working with pathogenic prokaryotes. The pipeline is licensed under the open-source GNU General Public License and available at the Georgia Tech Neisseria Base (http://nbase.biology.gatech.edu/). The pipeline is implemented with a combination of Perl, Bourne Shell and MySQL and is compatible with Linux and other Unix systems.

  7. Complete Genome Sequence of the Human Gut Symbiont Roseburia hominis

    DEFF Research Database (Denmark)

    Travis, Anthony J.; Kelly, Denise; Flint, Harry J

    2015-01-01

    We report here the complete genome sequence of the human gut symbiont Roseburia hominis A2-183(T) (= DSM 16839(T) = NCIMB 14029(T)), isolated from human feces. The genome is represented by a 3,592,125-bp chromosome with 3,405 coding sequences. A number of potential functions contributing to host...

  8. Draft genome sequence of the Coccolithovirus Emiliania huxleyi virus 203.

    Science.gov (United States)

    Nissimov, Jozef I; Worthy, Charlotte A; Rooks, Paul; Napier, Johnathan A; Kimmance, Susan A; Henn, Matthew R; Ogata, Hiroyuki; Allen, Michael J

    2011-12-01

    The Coccolithoviridae are a recently discovered group of viruses that infect the marine coccolithophorid Emiliania huxleyi. Emiliania huxleyi virus 203 (EhV-203) has a 160- to 180-nm-diameter icosahedral structure and a genome of approximately 400 kbp, consisting of 464 coding sequences (CDSs). Here we describe the genomic features of EhV-203 together with a draft genome sequence and its annotation, highlighting the homology and heterogeneity of this genome in comparison with the EhV-86 reference genome.

  9. Draft genome sequence of the coccolithovirus Emiliania huxleyi virus 202.

    Science.gov (United States)

    Nissimov, Jozef I; Worthy, Charlotte A; Rooks, Paul; Napier, Johnathan A; Kimmance, Susan A; Henn, Matthew R; Ogata, Hiroyuki; Allen, Michael J

    2012-02-01

    Emiliania huxleyi virus 202 (EhV-202) is a member of the Coccolithoviridae, a group of viruses that infect the marine coccolithophorid Emiliania huxleyi. EhV-202 has a 160- to 180-nm-diameter icosahedral structure and a genome of approximately 407 kbp, consisting of 485 coding sequences (CDSs). Here we describe the genomic features of EhV-202, together with a draft genome sequence and its annotation, highlighting the homology and heterogeneity of this genome in comparison with the EhV-86 reference genome.

  10. The genome sequence of Caenorhabditis briggsae: a platform for comparative genomics.

    Directory of Open Access Journals (Sweden)

    Lincoln D Stein

    2003-11-01

    Full Text Available The soil nematodes Caenorhabditis briggsae and Caenorhabditis elegans diverged from a common ancestor roughly 100 million years ago and yet are almost indistinguishable by eye. They have the same chromosome number and genome sizes, and they occupy the same ecological niche. To explore the basis for this striking conservation of structure and function, we have sequenced the C. briggsae genome to a high-quality draft stage and compared it to the finished C. elegans sequence. We predict approximately 19,500 protein-coding genes in the C. briggsae genome, roughly the same as in C. elegans. Of these, 12,200 have clear C. elegans orthologs, a further 6,500 have one or more clearly detectable C. elegans homologs, and approximately 800 C. briggsae genes have no detectable matches in C. elegans. Almost all of the noncoding RNAs (ncRNAs known are shared between the two species. The two genomes exhibit extensive colinearity, and the rate of divergence appears to be higher in the chromosomal arms than in the centers. Operons, a distinctive feature of C. elegans, are highly conserved in C. briggsae, with the arrangement of genes being preserved in 96% of cases. The difference in size between the C. briggsae (estimated at approximately 104 Mbp and C. elegans (100.3 Mbp genomes is almost entirely due to repetitive sequence, which accounts for 22.4% of the C. briggsae genome in contrast to 16.5% of the C. elegans genome. Few, if any, repeat families are shared, suggesting that most were acquired after the two species diverged or are undergoing rapid evolution. Coclustering the C. elegans and C. briggsae proteins reveals 2,169 protein families of two or more members. Most of these are shared between the two species, but some appear to be expanding or contracting, and there seem to be as many as several hundred novel C. briggsae gene families. The C. briggsae draft sequence will greatly improve the annotation of the C. elegans genome. Based on similarity to C

  11. The First Complete Chloroplast Genome Sequences in Actinidiaceae: Genome Structure and Comparative Analysis.

    Science.gov (United States)

    Yao, Xiaohong; Tang, Ping; Li, Zuozhou; Li, Dawei; Liu, Yifei; Huang, Hongwen

    2015-01-01

    Actinidia chinensis is an important economic plant belonging to the basal lineage of the asterids. Availability of a complete Actinidia chloroplast genome sequence is crucial to understanding phylogenetic relationships among major lineages of angiosperms and facilitates kiwifruit genetic improvement. We report here the complete nucleotide sequences of the chloroplast genomes for Actinidia chinensis and A. chinensis var deliciosa obtained through de novo assembly of Illumina paired-end reads produced by total DNA sequencing. The total genome size ranges from 155,446 to 157,557 bp, with an inverted repeat (IR) of 24,013 to 24,391 bp, a large single copy region (LSC) of 87,984 to 88,337 bp and a small single copy region (SSC) of 20,332 to 20,336 bp. The genome encodes 113 different genes, including 79 unique protein-coding genes, 30 tRNA genes and 4 ribosomal RNA genes, with 16 duplicated in the inverted repeats, and a tRNA gene (trnfM-CAU) duplicated once in the LSC region. Comparisons of IR boundaries among four asterid species showed that IR/LSC borders were extended into the 5' portion of the psbA gene and IR contraction occurred in Actinidia. The clap gene has been lost from the chloroplast genome in Actinidia, and may have been transferred to the nucleus during chloroplast evolution. Twenty-seven polymorphic simple sequence repeat (SSR) loci were identified in the Actinidia chloroplast genome. Maximum parsimony analyses of a 72-gene, 16 taxa angiosperm dataset strongly support the placement of Actinidiaceae in Ericales within the basal asterids.

  12. Advanced Whole-Genome Sequencing and Analysis of Fetal Genomes from Amniotic Fluid.

    Science.gov (United States)

    Mao, Qing; Chin, Robert; Xie, Weiwei; Deng, Yuqing; Zhang, Wenwei; Xu, Huixin; Zhang, Rebecca Yu; Shi, Quan; Peters, Erin E; Gulbahce, Natali; Li, Zhenyu; Chen, Fang; Drmanac, Radoje; Peters, Brock A

    2018-04-01

    Amniocentesis is a common procedure, the primary purpose of which is to collect cells from the fetus to allow testing for abnormal chromosomes, altered chromosomal copy number, or a small number of genes that have small single- to multibase defects. Here we demonstrate the feasibility of generating an accurate whole-genome sequence of a fetus from either the cellular or cell-free DNA (cfDNA) of an amniotic sample. cfDNA and DNA isolated from the cell pellet of 31 amniocenteses were sequenced to approximately 50× genome coverage by use of the Complete Genomics nanoarray platform. In a subset of the samples, long fragment read libraries were generated from DNA isolated from cells and sequenced to approximately 100× genome coverage. Concordance of variant calls between the 2 DNA sources and with parental libraries was >96%. Two fetal genomes were found to harbor potentially detrimental variants in chromodomain helicase DNA binding protein 8 ( CHD8 ) and LDL receptor-related protein 1 ( LRP1 ), variations of which have been associated with autism spectrum disorder and keratosis pilaris atrophicans, respectively. We also discovered drug sensitivities and carrier information of fetuses for a variety of diseases. We were able to elucidate the complete genome sequence of 31 fetuses from amniotic fluid and demonstrate that the cfDNA or DNA from the cell pellet can be analyzed with little difference in quality. We believe that current technologies could analyze this material in a highly accurate and complete manner and that analyses like these should be considered for addition to current amniocentesis procedures. © 2018 American Association for Clinical Chemistry.

  13. [Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

    Science.gov (United States)

    Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

    2017-08-01

    To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

  14. Genome sequencing and annotation of Serratia sp. strain TEL.

    Science.gov (United States)

    Lephoto, Tiisetso E; Gray, Vincent M

    2015-12-01

    We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410). This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926) collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  15. Genome sequencing and annotation of Serratia sp. strain TEL

    Directory of Open Access Journals (Sweden)

    Tiisetso E. Lephoto

    2015-12-01

    Full Text Available We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410. This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926 collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  16. Genome sequencing and annotation of Serratia sp. strain TEL

    OpenAIRE

    Lephoto, Tiisetso E.; Gray, Vincent M.

    2015-01-01

    We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410). This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926) collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.

  17. Whole-genome sequence of the Tibetan frog Nanorana parkeri and the comparative evolution of tetrapod genomes.

    Science.gov (United States)

    Sun, Yan-Bo; Xiong, Zi-Jun; Xiang, Xue-Yan; Liu, Shi-Ping; Zhou, Wei-Wei; Tu, Xiao-Long; Zhong, Li; Wang, Lu; Wu, Dong-Dong; Zhang, Bao-Lin; Zhu, Chun-Ling; Yang, Min-Min; Chen, Hong-Man; Li, Fang; Zhou, Long; Feng, Shao-Hong; Huang, Chao; Zhang, Guo-Jie; Irwin, David; Hillis, David M; Murphy, Robert W; Yang, Huan-Ming; Che, Jing; Wang, Jun; Zhang, Ya-Ping

    2015-03-17

    The development of efficient sequencing techniques has resulted in large numbers of genomes being available for evolutionary studies. However, only one genome is available for all amphibians, that of Xenopus tropicalis, which is distantly related from the majority of frogs. More than 96% of frogs belong to the Neobatrachia, and no genome exists for this group. This dearth of amphibian genomes greatly restricts genomic studies of amphibians and, more generally, our understanding of tetrapod genome evolution. To fill this gap, we provide the de novo genome of a Tibetan Plateau frog, Nanorana parkeri, and compare it to that of X. tropicalis and other vertebrates. This genome encodes more than 20,000 protein-coding genes, a number similar to that of Xenopus. Although the genome size of Nanorana is considerably larger than that of Xenopus (2.3 vs. 1.5 Gb), most of the difference is due to the respective number of transposable elements in the two genomes. The two frogs exhibit considerable conserved whole-genome synteny despite having diverged approximately 266 Ma, indicating a slow rate of DNA structural evolution in anurans. Multigenome synteny blocks further show that amphibians have fewer interchromosomal rearrangements than mammals but have a comparable rate of intrachromosomal rearrangements. Our analysis also identifies 11 Mb of anuran-specific highly conserved elements that will be useful for comparative genomic analyses of frogs. The Nanorana genome offers an improved understanding of evolution of tetrapod genomes and also provides a genomic reference for other evolutionary studies.

  18. Whole-Genome Sequences of Thirteen Isolates of Borrelia burgdorferi

    Energy Technology Data Exchange (ETDEWEB)

    Schutzer S. E.; Dunn J.; Fraser-Liggett, C. M.; Casjens, S. R.; Qiu, W.-G.; Mongodin, E. F.; Luft, B. J.

    2011-02-01

    Borrelia burgdorferi is a causative agent of Lyme disease in North America and Eurasia. The first complete genome sequence of B. burgdorferi strain 31, available for more than a decade, has assisted research on the pathogenesis of Lyme disease. Because a single genome sequence is not sufficient to understand the relationship between genotypic and geographic variation and disease phenotype, we determined the whole-genome sequences of 13 additional B. burgdorferi isolates that span the range of natural variation. These sequences should allow improved understanding of pathogenesis and provide a foundation for novel detection, diagnosis, and prevention strategies.

  19. Scrutinizing virus genome termini by high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Shasha Li

    Full Text Available Analysis of genomic terminal sequences has been a major step in studies on viral DNA replication and packaging mechanisms. However, traditional methods to study genome termini are challenging due to the time-consuming protocols and their inefficiency where critical details are lost easily. Recent advances in next generation sequencing (NGS have enabled it to be a powerful tool to study genome termini. In this study, using NGS we sequenced one iridovirus genome and twenty phage genomes and confirmed for the first time that the high frequency sequences (HFSs found in the NGS reads are indeed the terminal sequences of viral genomes. Further, we established a criterion to distinguish the type of termini and the viral packaging mode. We also obtained additional terminal details such as terminal repeats, multi-termini, asymmetric termini. With this approach, we were able to simultaneously detect details of the genome termini as well as obtain the complete sequence of bacteriophage genomes. Theoretically, this application can be further extended to analyze larger and more complicated genomes of plant and animal viruses. This study proposed a novel and efficient method for research on viral replication, packaging, terminase activity, transcription regulation, and metabolism of the host cell.

  20. Genome Sequence of Torulaspora delbrueckii NRRL Y-50541, Isolated from Mezcal Fermentation.

    Science.gov (United States)

    Gomez-Angulo, Jorge; Vega-Alvarado, Leticia; Escalante-García, Zazil; Grande, Ricardo; Gschaedler-Mathis, Anne; Amaya-Delgado, Lorena; Arrizon, Javier; Sanchez-Flores, Alejandro

    2015-07-23

    Torulaspora delbrueckii presents metabolic features interesting for biotechnological applications (in the dairy and wine industries). Recently, the T. delbrueckii CBS 1146 genome, which has been maintained under laboratory conditions since 1970, was published. Thus, a genome of a new mezcal yeast was sequenced and characterized and showed genetic differences and a higher genome assembly quality, offering a better reference genome. Copyright © 2015 Gomez-Angulo et al.

  1. The Complete Chloroplast Genome Sequences of Five Epimedium Species: Lights into Phylogenetic and Taxonomic Analyses

    Science.gov (United States)

    Zhang, Yanjun; Du, Liuwen; Liu, Ao; Chen, Jianjun; Wu, Li; Hu, Weiming; Zhang, Wei; Kim, Kyunghee; Lee, Sang-Choon; Yang, Tae-Jin; Wang, Ying

    2016-01-01

    Epimedium L. is a phylogenetically and economically important genus in the family Berberidaceae. We here sequenced the complete chloroplast (cp) genomes of four Epimedium species using Illumina sequencing technology via a combination of de novo and reference-guided assembly, which was also the first comprehensive cp genome analysis on Epimedium combining the cp genome sequence of E. koreanum previously reported. The five Epimedium cp genomes exhibited typical quadripartite and circular structure that was rather conserved in genomic structure and the synteny of gene order. However, these cp genomes presented obvious variations at the boundaries of the four regions because of the expansion and contraction of the inverted repeat (IR) region and the single-copy (SC) boundary regions. The trnQ-UUG duplication occurred in the five Epimedium cp genomes, which was not found in the other basal eudicotyledons. The rapidly evolving cp genome regions were detected among the five cp genomes, as well as the difference of simple sequence repeats (SSR) and repeat sequence were identified. Phylogenetic relationships among the five Epimedium species based on their cp genomes showed accordance with the updated system of the genus on the whole, but reminded that the evolutionary relationships and the divisions of the genus need further investigation applying more evidences. The availability of these cp genomes provided valuable genetic information for accurately identifying species, taxonomy and phylogenetic resolution and evolution of Epimedium, and assist in exploration and utilization of Epimedium plants. PMID:27014326

  2. The complete chloroplast genome sequences of five Epimedium species: lights into phylogenetic and taxonomic analyses

    Directory of Open Access Journals (Sweden)

    Yanjun eZhang

    2016-03-01

    Full Text Available Epimedium L. is a phylogenetically and economically important genus in the family Berberidaceae. We here sequenced the complete chloroplast (cp genomes of four Epimedium species using Illumina sequencing technology via a combination of de novo and reference-guided assembly, which was also the first comprehensive cp genome analysis on Epimedium combining the cp genome sequence of E. koreanum previously reported. The five Epimedium cp genomes exhibited typical quadripartite and circular structure that was rather conserved in genomic structure and the synteny of gene order. However, these cp genomes presented obvious variations at the boundaries of the four regions because of the expansion and contraction of the inverted repeat (IR region and the single-copy (SC boundary regions. The trnQ-UUG duplication occurred in the five Epimedium cp genomes, which was not found in the other basal eudicotyledons. The rapidly evolving cp genome regions were detected among the five cp genomes, as well as the difference of simple sequence repeats (SSR and repeat sequence were identified. Phylogenetic relationships among the five Epimedium species based on their cp genomes showed accordance with the updated system of the genus on the whole, but reminded that the evolutionary relationships and the divisions of the genus need further investigation applying more evidences. The availability of these cp genomes provided valuable genetic information for accurately identifying species, taxonomy and phylogenetic resolution and evolution of Epimedium, and assist in exploration and utilization of Epimedium plants.

  3. A novel bioinformatics method for efficient knowledge discovery by BLSOM from big genomic sequence data.

    Science.gov (United States)

    Bai, Yu; Iwasaki, Yuki; Kanaya, Shigehiko; Zhao, Yue; Ikemura, Toshimichi

    2014-01-01

    With remarkable increase of genomic sequence data of a wide range of species, novel tools are needed for comprehensive analyses of the big sequence data. Self-Organizing Map (SOM) is an effective tool for clustering and visualizing high-dimensional data such as oligonucleotide composition on one map. By modifying the conventional SOM, we have previously developed Batch-Learning SOM (BLSOM), which allows classification of sequence fragments according to species, solely depending on the oligonucleotide composition. In the present study, we introduce the oligonucleotide BLSOM used for characterization of vertebrate genome sequences. We first analyzed pentanucleotide compositions in 100 kb sequences derived from a wide range of vertebrate genomes and then the compositions in the human and mouse genomes in order to investigate an efficient method for detecting differences between the closely related genomes. BLSOM can recognize the species-specific key combination of oligonucleotide frequencies in each genome, which is called a "genome signature," and the specific regions specifically enriched in transcription-factor-binding sequences. Because the classification and visualization power is very high, BLSOM is an efficient powerful tool for extracting a wide range of information from massive amounts of genomic sequences (i.e., big sequence data).

  4. Epigenetics of obesity: beyond the genome sequence.

    Science.gov (United States)

    Cordero, Paul; Li, Jiawei; Oben, Jude A

    2015-07-01

    After the study of the gene code as a trigger for obesity, epigenetic code has appeared as a novel tool in the diagnosis, prognosis and treatment of obesity, and its related comorbidities. This review summarizes the status of the epigenetic field associated with obesity, and the current epigenetic-based approaches for obesity treatment. Thanks to technical advances, novel and key obesity-associated polymorphisms have been described by genome-wide association studies, but there are limitations with their predictive power. Epigenetics is also studied for disease association, which involves decoding of the genome information, transcriptional status and later phenotypes. Obesity could be induced during adult life by feeding and other environmental factors, and there is a strong association between obesity features and specific epigenetic patterns. These patterns could be established during early life stages, and programme the risk of obesity and its comorbidities during adult life. Furthermore, recent studies have shown that DNA methylation profile could be applied as biomarkers of diet-induced weight loss treatment. High-throughput technologies, recently implemented for commercial genetic test panels, could soon lead to the creation of epigenetic test panels for obesity. Nonetheless, epigenetics is a modifiable risk factor, and different dietary patterns or environmental insights during distinct stages of life could lead to rewriting of the epigenetic profile.

  5. From Conventional to Next Generation Sequencing of Epstein-Barr Virus Genomes.

    Science.gov (United States)

    Kwok, Hin; Chiang, Alan Kwok Shing

    2016-02-24

    Genomic sequences of Epstein-Barr virus (EBV) have been of interest because the virus is associated with cancers, such as nasopharyngeal carcinoma, and conditions such as infectious mononucleosis. The progress of whole-genome EBV sequencing has been limited by the inefficiency and cost of the first-generation sequencing technology. With the advancement of next-generation sequencing (NGS) and target enrichment strategies, increasing number of EBV genomes has been published. These genomes were sequenced using different approaches, either with or without EBV DNA enrichment. This review provides an overview of the EBV genomes published to date, and a description of the sequencing technology and bioinformatic analyses employed in generating these sequences. We further explored ways through which the quality of sequencing data can be improved, such as using DNA oligos for capture hybridization, and longer insert size and read length in the sequencing runs. These advances will enable large-scale genomic sequencing of EBV which will facilitate a better understanding of the genetic variations of EBV in different geographic regions and discovery of potentially pathogenic variants in specific diseases.

  6. From Conventional to Next Generation Sequencing of Epstein-Barr Virus Genomes

    Directory of Open Access Journals (Sweden)

    Hin Kwok

    2016-02-01

    Full Text Available Genomic sequences of Epstein–Barr virus (EBV have been of interest because the virus is associated with cancers, such as nasopharyngeal carcinoma, and conditions such as infectious mononucleosis. The progress of whole-genome EBV sequencing has been limited by the inefficiency and cost of the first-generation sequencing technology. With the advancement of next-generation sequencing (NGS and target enrichment strategies, increasing number of EBV genomes has been published. These genomes were sequenced using different approaches, either with or without EBV DNA enrichment. This review provides an overview of the EBV genomes published to date, and a description of the sequencing technology and bioinformatic analyses employed in generating these sequences. We further explored ways through which the quality of sequencing data can be improved, such as using DNA oligos for capture hybridization, and longer insert size and read length in the sequencing runs. These advances will enable large-scale genomic sequencing of EBV which will facilitate a better understanding of the genetic variations of EBV in different geographic regions and discovery of potentially pathogenic variants in specific diseases.

  7. Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

    Science.gov (United States)

    Cao, Yinhe; Tung, Wen-Wen; Gao, J B

    2004-01-01

    With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

  8. Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

    Energy Technology Data Exchange (ETDEWEB)

    McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.

    2005-08-26

    Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.

  9. From Sequence to Morphology - Long-Range Correlations in Complete Sequenced Genomes

    NARCIS (Netherlands)

    T.A. Knoch (Tobias)

    2004-01-01

    textabstractThe largely unresolved sequential organization, i.e. the relations within DNA sequences, and its connection to the three-dimensional organization of genomes was investigated by correlation analyses of completely sequenced chromosomes from Viroids, Archaea, Bacteria, Arabidopsis

  10. A Probabilistic Genome-Wide Gene Reading Frame Sequence Model

    DEFF Research Database (Denmark)

    Have, Christian Theil; Mørk, Søren

    We introduce a new type of probabilistic sequence model, that model the sequential composition of reading frames of genes in a genome. Our approach extends gene finders with a model of the sequential composition of genes at the genome-level -- effectively producing a sequential genome annotation...... as output. The model can be used to obtain the most probable genome annotation based on a combination of i: a gene finder score of each gene candidate and ii: the sequence of the reading frames of gene candidates through a genome. The model --- as well as a higher order variant --- is developed and tested...... and are evaluated by the effect on prediction performance. Since bacterial gene finding to a large extent is a solved problem it forms an ideal proving ground for evaluating the explicit modeling of larger scale gene sequence composition of genomes. We conclude that the sequential composition of gene reading frames...

  11. Investigation of genome sequences within the family Pasteurellaceae

    DEFF Research Database (Denmark)

    Angen, Øystein; Ussery, David

    Introduction The bacterial genome sequences are now available for an increasing number of strains within the family Pasteurellaceae. At present, 24 Pasteurellaceae genomes are publicly available through internet databases, and another 40 genomes are being sequenced. This investigation will describe...... the core genome for both the family Pasteurellaceae and for the species Haemophilus influenzae. Methods Twenty genome sequences from the following species were included: Haemophilus influenzae (11 strains), Haemophilus ducreyi (1 strain), Histophilus somni (2 strains), Haemophilus parasuis (1 strain......), Actinobacillus pleuropneumoniae (2 strains), Actinobacillus succinogenes (1 strain), Mannheimia succiniciproducens (1 strain), and Pasteurella multocida (1 strain). The predicted proteins for each genome were BLASTed against each other, and a set of conserved core gene families was determined as described...

  12. Genome BLAST distance phylogenies inferred from whole plastid and whole mitochondrion genome sequences

    Directory of Open Access Journals (Sweden)

    Holland Barbara R

    2006-07-01

    Full Text Available Abstract Background Phylogenetic methods which do not rely on multiple sequence alignments are important tools in inferring trees directly from completely sequenced genomes. Here, we extend the recently described Genome BLAST Distance Phylogeny (GBDP strategy to compute phylogenetic trees from all completely sequenced plastid genomes currently available and from a selection of mitochondrial genomes representing the major eukaryotic lineages. BLASTN, TBLASTX, or combinations of both are used to locate high-scoring segment pairs (HSPs between two sequences from which pairwise similarities and distances are computed in different ways resulting in a total of 96 GBDP variants. The suitability of these distance formulae for phylogeny reconstruction is directly estimated by computing a recently described measure of "treelikeness", the so-called δ value, from the respective distance matrices. Additionally, we compare the trees inferred from these matrices using UPGMA, NJ, BIONJ, FastME, or STC, respectively, with the NCBI taxonomy tree of the taxa under study. Results Our results indicate that, at this taxonomic level, plastid genomes are much more valuable for inferring phylogenies than are mitochondrial genomes, and that distances based on breakpoints are of little use. Distances based on the proportion of "matched" HSP length to average genome length were best for tree estimation. Additionally we found that using TBLASTX instead of BLASTN and, particularly, combining TBLASTX and BLASTN leads to a small but significant increase in accuracy. Other factors do not significantly affect the phylogenetic outcome. The BIONJ algorithm results in phylogenies most in accordance with the current NCBI taxonomy, with NJ and FastME performing insignificantly worse, and STC performing as well if applied to high quality distance matrices. δ values are found to be a reliable predictor of phylogenetic accuracy. Conclusion Using the most treelike distance matrices, as

  13. Sequencing and annotation of mitochondrial genomes from individual parasitic helminths.

    Science.gov (United States)

    Jex, Aaron R; Littlewood, D Timothy; Gasser, Robin B

    2015-01-01

    Mitochondrial (mt) genomics has significant implications in a range of fundamental areas of parasitology, including evolution, systematics, and population genetics as well as explorations of mt biochemistry, physiology, and function. Mt genomes also provide a rich source of markers to aid molecular epidemiological and ecological studies of key parasites. However, there is still a paucity of information on mt genomes for many metazoan organisms, particularly parasitic helminths, which has often related to challenges linked to sequencing from tiny amounts of material. The advent of next-generation sequencing (NGS) technologies has paved the way for low cost, high-throughput mt genomic research, but there have been obstacles, particularly in relation to post-sequencing assembly and analyses of large datasets. In this chapter, we describe protocols for the efficient amplification and sequencing of mt genomes from small portions of individual helminths, and highlight the utility of NGS platforms to expedite mt genomics. In addition, we recommend approaches for manual or semi-automated bioinformatic annotation and analyses to overcome the bioinformatic "bottleneck" to research in this area. Taken together, these approaches have demonstrated applicability to a range of parasites and provide prospects for using complete mt genomic sequence datasets for large-scale molecular systematic and epidemiological studies. In addition, these methods have broader utility and might be readily adapted to a range of other medium-sized molecular regions (i.e., 10-100 kb), including large genomic operons, and other organellar (e.g., plastid) and viral genomes.

  14. Reference genome sequence of the model plant Setaria.

    Science.gov (United States)

    Bennetzen, Jeffrey L; Schmutz, Jeremy; Wang, Hao; Percifield, Ryan; Hawkins, Jennifer; Pontaroli, Ana C; Estep, Matt; Feng, Liang; Vaughn, Justin N; Grimwood, Jane; Jenkins, Jerry; Barry, Kerrie; Lindquist, Erika; Hellsten, Uffe; Deshpande, Shweta; Wang, Xuewen; Wu, Xiaomei; Mitros, Therese; Triplett, Jimmy; Yang, Xiaohan; Ye, Chu-Yu; Mauro-Herrera, Margarita; Wang, Lin; Li, Pinghua; Sharma, Manoj; Sharma, Rita; Ronald, Pamela C; Panaud, Olivier; Kellogg, Elizabeth A; Brutnell, Thomas P; Doust, Andrew N; Tuskan, Gerald A; Rokhsar, Daniel; Devos, Katrien M

    2012-05-13

    We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ∼400-Mb assembly covers ∼80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).

  15. Reference genome sequence of the model plant Setaria

    Energy Technology Data Exchange (ETDEWEB)

    Bennetzen, Jeffrey L [ORNL; Schmutz, Jeremy [Hudson Alpha Institute of Biotechnology; Wang, Hao [University of Georgia, Athens, GA; Percifield, Ryan [University of Georgia, Athens, GA; Hawkins, Jennifer [University of Georgia, Athens, GA; Pontaroli, Ana C. [University of Georgia, Athens, GA; Estep, Matt [University of Georgia, Athens, GA; Feng, Liang [University of Georgia, Athens, GA; Vaughn, Justin N [ORNL; Grimwood, Jane [Hudson Alpha Institute of Biotechnology; Jenkins, Jerry [Hudson Alpha Institute of Biotechnology; Barry, Kerrie [U.S. Department of Energy, Joint Genome Institute; Lindquist, Erika [U.S. Department of Energy, Joint Genome Institute; Hellsten, Uffe [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Wang, Xuewen [University of Georgia, Athens, GA; Wu, Xiaomei [University of Georgia, Athens, GA; Mitros, Therese [University of California, Berkeley; Triplett, Jimmy [University of Missouri, St. Louis; Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Mauro-Herrera, Margarita [Oklahoma State University; Wang, Lin [Cornell University; Li, Pinghua [Cornell University; Sharma, Manoj [University of California, Davis; Sharma, Rita [University of California, Davis; Ronald, Pamela [University of California, Davis; Panaud, Olivier [Universite de Perpignan, Perpignan, France; Kellogg, Elizabeth A. [University of Missouri, St. Louis; Brutnell, Thomas P. [Cornell University; Doust, Andrew N. [Oklahoma State University; Tuskan, Gerald A [ORNL; Rokhsar, Daniel [U.S. Department of Energy, Joint Genome Institute; Devos, Katrien M [ORNL

    2012-01-01

    We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ~400-Mb assembly covers ~80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).

  16. Reference genome sequence of the model plant Setaria

    Energy Technology Data Exchange (ETDEWEB)

    Bennetzen, Jeffrey L [ORNL; Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Tuskan, Gerald A [ORNL

    2012-01-01

    We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The {approx}400-Mb assembly covers {approx}80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).

  17. Applications of Genomic Sequencing in Pediatric CNS Tumors.

    Science.gov (United States)

    Bavle, Abhishek A; Lin, Frank Y; Parsons, D Williams

    2016-05-01

    Recent advances in genome-scale sequencing methods have resulted in a significant increase in our understanding of the biology of human cancers. When applied to pediatric central nervous system (CNS) tumors, these remarkable technological breakthroughs have facilitated the molecular characterization of multiple tumor types, provided new insights into the genetic basis of these cancers, and prompted innovative strategies that are changing the management paradigm in pediatric neuro-oncology. Genomic tests have begun to affect medical decision making in a number of ways, from delineating histopathologically similar tumor types into distinct molecular subgroups that correlate with clinical characteristics, to guiding the addition of novel therapeutic agents for patients with high-risk or poor-prognosis tumors, or alternatively, reducing treatment intensity for those with a favorable prognosis. Genomic sequencing has also had a significant impact on translational research strategies in pediatric CNS tumors, resulting in wide-ranging applications that have the potential to direct the rational preclinical screening of novel therapeutic agents, shed light on tumor heterogeneity and evolution, and highlight differences (or similarities) between pediatric and adult CNS tumors. Finally, in addition to allowing the identification of somatic (tumor-specific) mutations, the analysis of patient-matched constitutional (germline) DNA has facilitated the detection of pathogenic germline alterations in cancer genes in patients with CNS tumors, with critical implications for genetic counseling and tumor surveillance strategies for children with familial predisposition syndromes. As our understanding of the molecular landscape of pediatric CNS tumors continues to advance, innovative applications of genomic sequencing hold significant promise for further improving the care of children with these cancers.

  18. Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

    DEFF Research Database (Denmark)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.

    2005-01-01

    years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences......We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each...... between the species-but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence...

  19. Second generation sequencing of the mesothelioma tumor genome.

    Directory of Open Access Journals (Sweden)

    Raphael Bueno

    2010-05-01

    Full Text Available The current paradigm for elucidating the molecular etiology of cancers relies on the interrogation of small numbers of genes, which limits the scope of investigation. Emerging second-generation massively parallel DNA sequencing technologies have enabled more precise definition of the cancer genome on a global scale. We examined the genome of a human primary malignant pleural mesothelioma (MPM tumor and matched normal tissue by using a combination of sequencing-by-synthesis and pyrosequencing methodologies to a 9.6X depth of coverage. Read density analysis uncovered significant aneuploidy and numerous rearrangements. Method-dependent informatics rules, which combined the results of different sequencing platforms, were developed to identify and validate candidate mutations of multiple types. Many more tumor-specific rearrangements than point mutations were uncovered at this depth of sequencing, resulting in novel, large-scale, inter- and intra-chromosomal deletions, inversions, and translocations. Nearly all candidate point mutations appeared to be previously unknown SNPs. Thirty tumor-specific fusions/translocations were independently validated with PCR and Sanger sequencing. Of these, 15 represented disrupted gene-encoding regions, including kinases, transcription factors, and growth factors. One large deletion in DPP10 resulted in altered transcription and expression of DPP10 transcripts in a set of 53 additional MPM tumors correlated with survival. Additionally, three point mutations were observed in the coding regions of NKX6-2, a transcription regulator, and NFRKB, a DNA-binding protein involved in modulating NFKB1. Several regions containing genes such as PCBD2 and DHFR, which are involved in growth factor signaling and nucleotide synthesis, respectively, were selectively amplified in the tumor. Second-generation sequencing uncovered all types of mutations in this MPM tumor, with DNA rearrangements representing the dominant type.

  20. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  1. The complete chloroplast genome sequence of Podocarpus lambertii: genome structure, evolutionary aspects, gene content and SSR detection.

    Directory of Open Access Journals (Sweden)

    Leila do Nascimento Vieira

    Full Text Available BACKGROUND: Podocarpus lambertii (Podocarpaceae is a native conifer from the Brazilian Atlantic Forest Biome, which is considered one of the 25 biodiversity hotspots in the world. The advancement of next-generation sequencing technologies has enabled the rapid acquisition of whole chloroplast (cp genome sequences at low cost. Several studies have proven the potential of cp genomes as tools to understand enigmatic and basal phylogenetic relationships at different taxonomic levels, as well as further probe the structural and functional evolution of plants. In this work, we present the complete cp genome sequence of P. lambertii. METHODOLOGY/PRINCIPAL FINDINGS: The P. lambertii cp genome is 133,734 bp in length, and similar to other sequenced cupressophytes, it lacks one of the large inverted repeat regions (IR. It contains 118 unique genes and one duplicated tRNA (trnN-GUU, which occurs as an inverted repeat sequence. The rps16 gene was not found, which was previously reported for the plastid genome of another Podocarpaceae (Nageia nagi and Araucariaceae (Agathis dammara. Structurally, P. lambertii shows 4 inversions of a large DNA fragment ∼20,000 bp compared to the Podocarpus totara cp genome. These unexpected characteristics may be attributed to geographical distance and different adaptive needs. The P. lambertii cp genome presents a total of 28 tandem repeats and 156 SSRs, with homo- and dipolymers being the most common and tri-, tetra-, penta-, and hexapolymers occurring with less frequency. CONCLUSION: The complete cp genome sequence of P. lambertii revealed significant structural changes, even in species from the same genus. These results reinforce the apparently loss of rps16 gene in Podocarpaceae cp genome. In addition, several SSRs in the P. lambertii cp genome are likely intraspecific polymorphism sites, which may allow highly sensitive phylogeographic and population structure studies, as well as phylogenetic studies of species of

  2. High-density rhesus macaque oligonucleotide microarray design using early-stage rhesus genome sequence information and human genome annotations

    Directory of Open Access Journals (Sweden)

    Magness Charles L

    2007-01-01

    a closely related species. Conclusion The number of different genes represented on microarrays for unfinished genomes can be greatly increased by matching known gene transcript annotations from a closely related species with sequence data from the unfinished genome. Signal intensity on both EST- and genome-derived arrays was highly correlated with probe distance from the 3' UTR, information often missing from ESTs yet present in early-stage genome projects.

  3. Advantages of genome sequencing by long-read sequencer using SMRT technology in medical area.

    Science.gov (United States)

    Nakano, Kazuma; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Ashimine, Noriko; Ohki, Shun; Shinzato, Misuzu; Minami, Maiko; Nakanishi, Tetsuhiro; Teruya, Kuniko; Satou, Kazuhito; Hirano, Takashi

    2017-07-01

    PacBio RS II is the first commercialized third-generation DNA sequencer able to sequence a single molecule DNA in real-time without amplification. PacBio RS II's sequencing technology is novel and unique, enabling the direct observation of DNA synthesis by DNA polymerase. PacBio RS II confers four major advantages compared to other sequencing technologies: long read lengths, high consensus accuracy, a low degree of bias, and simultaneous capability of epigenetic characterization. These advantages surmount the obstacle of sequencing genomic regions such as high/low G+C, tandem repeat, and interspersed repeat regions. Moreover, PacBio RS II is ideal for whole genome sequencing, targeted sequencing, complex population analysis, RNA sequencing, and epigenetics characterization. With PacBio RS II, we have sequenced and analyzed the genomes of many species, from viruses to humans. Herein, we summarize and review some of our key genome sequencing projects, including full-length viral sequencing, complete bacterial genome and almost-complete plant genome assemblies, and long amplicon sequencing of a disease-associated gene region. We believe that PacBio RS II is not only an effective tool for use in the basic biological sciences but also in the medical/clinical setting.

  4. Complete genome sequence of Gordonia bronchialis type strain (3410T)

    Energy Technology Data Exchange (ETDEWEB)

    Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Jando, Marlen [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Chen, Feng [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Chain, Patrick S. G. [Lawrence Livermore National Laboratory (LLNL); Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J C [U.S. Department of Energy, Joint Genome Institute; Brettin, Thomas S [ORNL; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute

    2010-01-01

    Gordonia bronchialis Tsukamura 1971 is the type species of the genus. G. bronchialis is a human-pathogenic organism that has been isolated from a large variety of human tissues. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first completed genome sequence of the family Gordoniaceae. The 5,290,012 bp long genome with its 4,944 protein-coding and 55 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  5. Complete genome sequence of Acidimicrobium ferrooxidans type strain (ICPT)

    Energy Technology Data Exchange (ETDEWEB)

    Clum, Alicia; Nolan, Matt; Lang, Elke; Glavina Del Rio, Tijana; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Goker, Markus; Spring, Stefan; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Chain, Patrick; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Lapidus, Alla

    2009-05-20

    Acidimicrobium ferrooxidans (Clark and Norris 1996) is the sole and type species of the genus, which until recently was the only genus within the actinobacterial family Acidimicrobiaceae and in the order Acidomicrobiales. Rapid oxidation of iron pyrite during autotrophic growth in the absence of an enhanced CO2 concentration is characteristic for A. ferrooxidans. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the order Acidomicrobiales, and the 2,158,157 bp long single replicon genome with its 2038 protein coding and 54 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  6. Whole-genome in-silico subtractive hybridization (WISH - using massive sequencing for the identification of unique and repetitive sex-specific sequences: the example of Schistosoma mansoni

    Directory of Open Access Journals (Sweden)

    Parrinello Hugues

    2010-06-01

    Full Text Available Abstract Background Emerging methods of massive sequencing that allow for rapid re-sequencing of entire genomes at comparably low cost are changing the way biological questions are addressed in many domains. Here we propose a novel method to compare two genomes (genome-to-genome comparison. We used this method to identify sex-specific sequences of the human blood fluke Schistosoma mansoni. Results Genomic DNA was extracted from male and female (heterogametic S. mansoni adults and sequenced with a Genome Analyzer (Illumina. Sequences are available at the NCBI sequence read archive http://www.ncbi.nlm.nih.gov/Traces/sra/ under study accession number SRA012151.6. Sequencing reads were aligned to the genome, and a pseudogenome composed of known repeats. Straightforward comparative bioinformatics analysis was performed to compare male and female schistosome genomes and identify female-specific sequences. We found that the S. mansoni female W chromosome contains only few specific unique sequences (950 Kb i.e. about 0.2% of the genome. The majority of W-specific sequences are repeats (10.5 Mb i.e. about 2.5% of the genome. Arbitrarily selected W-specific sequences were confirmed by PCR. Primers designed for unique and repetitive sequences allowed to reliably identify the sex of both larval and adult stages of the parasite. Conclusion Our genome-to-genome comparison method that we call "whole-genome in-silico subtractive hybridization" (WISH allows for rapid identification of sequences that are specific for a certain genotype (e.g. the heterogametic sex. It can in principle be used for the detection of any sequence differences between isolates (e.g. strains, pathovars or even closely related species.

  7. Oxford Nanopore MinION Sequencing and Genome Assembly

    Directory of Open Access Journals (Sweden)

    Hengyun Lu

    2016-10-01

    Full Text Available The revolution of genome sequencing is continuing after the successful second-generation sequencing (SGS technology. The third-generation sequencing (TGS technology, led by Pacific Biosciences (PacBio, is progressing rapidly, moving from a technology once only capable of providing data for small genome analysis, or for performing targeted screening, to one that promises high quality de novo assembly and structural variation detection for human-sized genomes. In 2014, the MinION, the first commercial sequencer using nanopore technology, was released by Oxford Nanopore Technologies (ONT. MinION identifies DNA bases by measuring the changes in electrical conductivity generated as DNA strands pass through a biological pore. Its portability, affordability, and speed in data production makes it suitable for real-time applications, the release of the long read sequencer MinION has thus generated much excitement and interest in the genomics community. While de novo genome assemblies can be cheaply produced from SGS data, assembly continuity is often relatively poor, due to the limited ability of short reads to handle long repeats. Assembly quality can be greatly improved by using TGS long reads, since repetitive regions can be easily expanded into using longer sequencing lengths, despite having higher error rates at the base level. The potential of nanopore sequencing has been demonstrated by various studies in genome surveillance at locations where rapid and reliable sequencing is needed, but where resources are limited.

  8. Effects of informed consent for individual genome sequencing on relevant knowledge.

    Science.gov (United States)

    Kaphingst, K A; Facio, F M; Cheng, M-R; Brooks, S; Eidem, H; Linn, A; Biesecker, B B; Biesecker, L G

    2012-11-01

    Increasing availability of individual genomic information suggests that patients will need knowledge about genome sequencing to make informed decisions, but prior research is limited. In this study, we examined genome sequencing knowledge before and after informed consent among 311 participants enrolled in the ClinSeq™ sequencing study. An exploratory factor analysis of knowledge items yielded two factors (sequencing limitations knowledge; sequencing benefits knowledge). In multivariable analysis, high pre-consent sequencing limitations knowledge scores were significantly related to education [odds ratio (OR): 8.7, 95% confidence interval (CI): 2.45-31.10 for post-graduate education, and OR: 3.9; 95% CI: 1.05, 14.61 for college degree compared with less than college degree] and race/ethnicity (OR: 2.4, 95% CI: 1.09, 5.38 for non-Hispanic Whites compared with other racial/ethnic groups). Mean values increased significantly between pre- and post-consent for the sequencing limitations knowledge subscale (6.9-7.7, p benefits knowledge subscale (7.0-7.5, p < 0.0001); increase in knowledge did not differ by sociodemographic characteristics. This study highlights gaps in genome sequencing knowledge and underscores the need to target educational efforts toward participants with less education or from minority racial/ethnic groups. The informed consent process improved genome sequencing knowledge. Future studies could examine how genome sequencing knowledge influences informed decision making. © 2012 John Wiley & Sons A/S.

  9. Puzzling sequences: studying microbial genomes from 'Ötzi'

    International Nuclear Information System (INIS)

    Rattei, T.

    2012-01-01

    Ancient remains, and mummies in particular, are of central value for archaeological research. The Tyrolean iceman “Ötzi” was conserved in a glacier of the Ötztal Alps about 5000 years ago. Aside from morphological and phenotypical classification, the determination of DNA sequences and the subsequent genome analyses have been first applied to mitochondrial DNA and then been extended to genomic DNA. Typically also ancient microbial DNA is sequenced. These sequences allow the identification of pathogens as well as studying the evolution of microorganisms. The talk will explain the metagenomic aspects of the “Ötzi” genome project and discuss the first results. (author)

  10. Mapping genomic features to functional traits through microbial whole genome sequences.

    Science.gov (United States)

    Zhang, Wei; Zeng, Erliang; Liu, Dan; Jones, Stuart E; Emrich, Scott

    2014-01-01

    Recently, the utility of trait-based approaches for microbial communities has been identified. Increasing availability of whole genome sequences provide the opportunity to explore the genetic foundations of a variety of functional traits. We proposed a machine learning framework to quantitatively link the genomic features with functional traits. Genes from bacteria genomes belonging to different functional traits were grouped to Cluster of Orthologs (COGs), and were used as features. Then, TF-IDF technique from the text mining domain was applied to transform the data to accommodate the abundance and importance of each COG. After TF-IDF processing, COGs were ranked using feature selection methods to identify their relevance to the functional trait of interest. Extensive experimental results demonstrated that functional trait related genes can be detected using our method. Further, the method has the potential to provide novel biological insights.

  11. MIPS: a database for genomes and protein sequences.

    Science.gov (United States)

    Mewes, H W; Frishman, D; Güldener, U; Mannhaupt, G; Mayer, K; Mokrejs, M; Morgenstern, B; Münsterkötter, M; Rudd, S; Weil, B

    2002-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF, Neuherberg, Germany) continues to provide genome-related information in a systematic way. MIPS supports both national and European sequencing and functional analysis projects, develops and maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences, and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the databases for the comprehensive set of genomes (PEDANT genomes), the database of annotated human EST clusters (HIB), the database of complete cDNAs from the DHGP (German Human Genome Project), as well as the project specific databases for the GABI (Genome Analysis in Plants) and HNB (Helmholtz-Netzwerk Bioinformatik) networks. The Arabidospsis thaliana database (MATDB), the database of mitochondrial proteins (MITOP) and our contribution to the PIR International Protein Sequence Database have been described elsewhere [Schoof et al. (2002) Nucleic Acids Res., 30, 91-93; Scharfe et al. (2000) Nucleic Acids Res., 28, 155-158; Barker et al. (2001) Nucleic Acids Res., 29, 29-32]. All databases described, the protein analysis tools provided and the detailed descriptions of our projects can be accessed through the MIPS World Wide Web server (http://mips.gsf.de).

  12. Deciphering the biology of Mycobacterium tuberculosis from thecomplete genome sequence

    DEFF Research Database (Denmark)

    Cole, S.T.; Krogh, Anders Stærmose

    1998-01-01

    Countless millions of people have died from tuberculosis, a chronic infectious disease caused by the tubercle bacillus. The complete genome sequence of the best-characterized strain of Mycobacterium tuberculosis, H37Rv, has been determined and analysed in order to improve our understanding....... tuberculosis differs radically from other bacteria in that a very large portion of its coding capacity is devoted to the production of enzymes involved in lipogenesis and lipolysis, and to two new families of glycine-rich proteins with a repetitive structure that may represent a source of antigenic variation....

  13. Integrating sequencing technologies in personal genomics: optimal low cost reconstruction of structural variants.

    Directory of Open Access Journals (Sweden)

    Jiang Du

    2009-07-01

    Full Text Available The goal of human genome re-sequencing is obtaining an accurate assembly of an individual's genome. Recently, there has been great excitement in the development of many technologies for this (e.g. medium and short read sequencing from companies such as 454 and SOLiD, and high-density oligo-arrays from Affymetrix and NimbelGen, with even more expected to appear. The costs and sensitivities of these technologies differ considerably from each other. As an important goal of personal genomics is to reduce the cost of re-sequencing to an affordable point, it is worthwhile to consider optimally integrating technologies. Here, we build a simulation toolbox that will help us optimally combine different technologies for genome re-sequencing, especially in reconstructing large structural variants (SVs. SV reconstruction is considered the most challenging step in human genome re-sequencing. (It is sometimes even harder than de novo assembly of small genomes because of the duplications and repetitive sequences in the human genome. To this end, we formulate canonical problems that are representative of issues in reconstruction and are of small enough scale to be computationally tractable and simulatable. Using semi-realistic simulations, we show how we can combine different technologies to optimally solve the assembly at low cost. With mapability maps, our simulations efficiently handle the inhomogeneous repeat-containing structure of the human genome and the computational complexity of practical assembly algorithms. They quantitatively show how combining different read lengths is more cost-effective than using one length, how an optimal mixed sequencing strategy for reconstructing large novel SVs usually also gives accurate detection of SNPs/indels, how paired-end reads can improve reconstruction efficiency, and how adding in arrays is more efficient than just sequencing for disentangling some complex SVs. Our strategy should facilitate the sequencing of

  14. Genome Sequence of Australian Indigenous Wine Yeast Torulaspora delbrueckii COFT1 Using Nanopore Sequencing.

    Science.gov (United States)

    Tondini, Federico; Jiranek, Vladimir; Grbin, Paul R; Onetto, Cristobal A

    2018-04-26

    Here, we report the first sequenced genome of an indigenous Australian wine isolate of Torulaspora delbrueckii using the Oxford Nanopore MinION and Illumina HiSeq sequencing platforms. The genome size is 9.4 Mb and contains 4,831 genes. Copyright © 2018 Tondini et al.

  15. The complete genome sequence and comparative genome analysis of the high pathogenicity Yersinia enterocolitica strain 8081.

    Directory of Open Access Journals (Sweden)

    Nicholas R Thomson

    2006-12-01

    Full Text Available The human enteropathogen, Yersinia enterocolitica, is a significant link in the range of Yersinia pathologies extending from mild gastroenteritis to bubonic plague. Comparison at the genomic level is a key step in our understanding of the genetic basis for this pathogenicity spectrum. Here we report the genome of Y. enterocolitica strain 8081 (serotype 0:8; biotype 1B and extensive microarray data relating to the genetic diversity of the Y. enterocolitica species. Our analysis reveals that the genome of Y. enterocolitica strain 8081 is a patchwork of horizontally acquired genetic loci, including a plasticity zone of 199 kb containing an extraordinarily high density of virulence genes. Microarray analysis has provided insights into species-specific Y. enterocolitica gene functions and the intraspecies differences between the high, low, and nonpathogenic Y. enterocolitica biotypes. Through comparative genome sequence analysis we provide new information on the evolution of the Yersinia. We identify numerous loci that represent ancestral clusters of genes potentially important in enteric survival and pathogenesis, which have been lost or are in the process of being lost, in the other sequenced Yersinia lineages. Our analysis also highlights large metabolic operons in Y. enterocolitica that are absent in the related enteropathogen, Yersinia pseudotuberculosis, indicating major differences in niche and nutrients used within the mammalian gut. These include clusters directing, the production of hydrogenases, tetrathionate respiration, cobalamin synthesis, and propanediol utilisation. Along with ancestral gene clusters, the genome of Y. enterocolitica has revealed species-specific and enteropathogen-specific loci. This has provided important insights into the pathology of this bacterium and, more broadly, into the evolution of the genus. Moreover, wider investigations looking at the patterns of gene loss and gain in the Yersinia have highlighted common

  16. Sequencing of chloroplast genome using whole cellular DNA and Solexa sequencing technology

    Directory of Open Access Journals (Sweden)

    Jian eWu

    2012-11-01

    Full Text Available Sequencing of the chloroplast genome using traditional sequencing methods has been difficult because of its size (>120 kb and the complicated procedures required to prepare templates. To explore the feasibility of sequencing the chloroplast genome using DNA extracted from whole cells and Solexa sequencing technology, we sequenced whole cellular DNA isolated from leaves of three Brassica rapa accessions with one lane per accession. In total, 246 Mb, 362Mb, 361 Mb sequence data were generated for the three accessions Chiifu-401-42, Z16 and FT, respectively. Microreads were assembled by reference-guided assembly using the cpDNA sequences of B. rapa, Arabidopsis thaliana, and Nicotiana tabacum. We achieved coverage of more than 99.96% of the cp genome in the three tested accessions using the B. rapa sequence as the reference. When A. thaliana or N. tabacum sequences were used as references, 99.7–99.8% or 95.5–99.7% of the B. rapa chloroplast genome was covered, respectively. These results demonstrated that sequencing of whole cellular DNA isolated from young leaves using the Illumina Genome Analyzer is an efficient method for high-throughput sequencing of chloroplast genome.

  17. Whole genome shotgun sequencing of Indian strains of Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Balaji Veeraraghavan

    2017-12-01

    Full Text Available Group B streptococcus is known as a leading cause of neonatal infections in developing countries. The present study describes the whole genome shotgun sequences of four Group B Streptococcus (GBS isolates. Molecular data on clonality is lacking for GBS in India. The present genome report will add important information on the scarce genome data of GBS and will help in deriving comparative genome studies of GBS isolates at global level. This Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under the accession numbers NHPL00000000 – NHPO00000000.

  18. Simple sequence repeats in mycobacterial genomes

    Indian Academy of Sciences (India)

    2006-12-18

    Dec 18, 2006 ... Although prokaryotic genomes derive some plasticity due to microsatellite mutations they have in-built mechanisms to arrest undue expansions of microsatellites and one such mechanism is constituted by post-replicative DNA repair enzymes MutL, MutH and MutS. The mycobacterial genomes lack these ...

  19. The Complete Chloroplast Genome Sequences of Six Rehmannia Species

    Directory of Open Access Journals (Sweden)

    Shuyun Zeng

    2017-03-01

    Full Text Available Rehmannia is a non-parasitic genus in Orobanchaceae including six species mainly distributed in central and north China. Its phylogenetic position and infrageneric relationships remain uncertain due to potential hybridization and polyploidization. In this study, we sequenced and compared the complete chloroplast genomes of six Rehmannia species using Illumina sequencing technology to elucidate the interspecific variations. Rehmannia plastomes exhibited typical quadripartite and circular structures with good synteny of gene order. The complete genomes ranged from 153,622 bp to 154,055 bp in length, including 133 genes encoding 88 proteins, 37 tRNAs, and 8 rRNAs. Three genes (rpoA, rpoC2, accD have potentially experienced positive selection. Plastome size variation of Rehmannia was mainly ascribed to the expansion and contraction of the border regions between the inverted repeat (IR region and the single-copy (SC regions. Despite of the conserved structure in Rehmannia plastomes, sequence variations provide useful phylogenetic information. Phylogenetic trees of 23 Lamiales species reconstructed with the complete plastomes suggested that Rehmannia was monophyletic and sister to the clade of Lindenbergia and the parasitic taxa in Orobanchaceae. The interspecific relationships within Rehmannia were completely different with the previous studies. In future, population phylogenomic works based on plastomes are urgently needed to clarify the evolutionary history of Rehmannia.

  20. HEP Computing Tools, Grid and Supercomputers for Genome Sequencing Studies

    Science.gov (United States)

    De, K.; Klimentov, A.; Maeno, T.; Mashinistov, R.; Novikov, A.; Poyda, A.; Tertychnyy, I.; Wenaus, T.

    2017-10-01

    PanDA - Production and Distributed Analysis Workload Management System has been developed to address ATLAS experiment at LHC data processing and analysis challenges. Recently PanDA has been extended to run HEP scientific applications on Leadership Class Facilities and supercomputers. The success of the projects to use PanDA beyond HEP and Grid has drawn attention from other compute intensive sciences such as bioinformatics. Recent advances of Next Generation Genome Sequencing (NGS) technology led to increasing streams of sequencing data that need to be processed, analysed and made available for bioinformaticians worldwide. Analysis of genomes sequencing data using popular software pipeline PALEOMIX can take a month even running it on the powerful computer resource. In this paper we will describe the adaptation the PALEOMIX pipeline to run it on a distributed computing environment powered by PanDA. To run pipeline we split input files into chunks which are run separately on different nodes as separate inputs for PALEOMIX and finally merge output file, it is very similar to what it done by ATLAS to process and to simulate data. We dramatically decreased the total walltime because of jobs (re)submission automation and brokering within PanDA. Using software tools developed initially for HEP and Grid can reduce payload execution time for Mammoths DNA samples from weeks to days.

  1. Complete genome sequence of Corynebacterium pseudotuberculosis Cp31, isolated from an Egyptian buffalo

    DEFF Research Database (Denmark)

    Silva, Artur; Ramos, Rommel Thiago Jucá; Ribeiro Carneiro, Adriana

    2012-01-01

    Corynebacterium pseudotuberculosis is of major veterinary importance because it affects many animal species, causing economically significant livestock diseases and losses. Therefore, the genomic sequencing of various lines of this organism, isolated from different hosts, will aid in the developm...

  2. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  3. The fast changing landscape of sequencing technologies and their impact on microbial genome assemblies and annotation.

    Science.gov (United States)

    Mavromatis, Konstantinos; Land, Miriam L; Brettin, Thomas S; Quest, Daniel J; Copeland, Alex; Clum, Alicia; Goodwin, Lynne; Woyke, Tanja; Lapidus, Alla; Klenk, Hans Peter; Cottingham, Robert W; Kyrpides, Nikos C

    2012-01-01

    The emergence of next generation sequencing (NGS) has provided the means for rapid and high throughput sequencing and data generation at low cost, while concomitantly creating a new set of challenges. The number of available assembled microbial genomes continues to grow rapidly and their quality reflects the quality of the sequencing technology used, but also of the analysis software employed for assembly and annotation. In this work, we have explored the quality of the microbial draft genomes across various sequencing technologies. We have compared the draft and finished assemblies of 133 microbial genomes sequenced at the Department of Energy-Joint Genome Institute and finished at the Los Alamos National Laboratory using a variety of combinations of sequencing technologies, reflecting the transition of the institute from Sanger-based sequencing platforms to NGS platforms. The quality of the public assemblies and of the associated gene annotations was evaluated using various metrics. Results obtained with the different sequencing technologies, as well as their effects on downstream processes, were analyzed. Our results demonstrate that the Illumina HiSeq 2000 sequencing system, the primary sequencing technology currently used for de novo genome sequencing and assembly at JGI, has various advantages in terms of total sequence throughput and cost, but it also introduces challenges for the downstream analyses. In all cases assembly results although on average are of high quality, need to be viewed critically and consider sources of errors in them prior to analysis. These data follow the evolution of microbial sequencing and downstream processing at the JGI from draft genome sequences with large gaps corresponding to missing genes of significant biological role to assemblies with multiple small gaps (Illumina) and finally to assemblies that generate almost complete genomes (Illumina+PacBio).

  4. The Release 6 reference sequence of the Drosophila melanogaster genome.

    Science.gov (United States)

    Hoskins, Roger A; Carlson, Joseph W; Wan, Kenneth H; Park, Soo; Mendez, Ivonne; Galle, Samuel E; Booth, Benjamin W; Pfeiffer, Barret D; George, Reed A; Svirskas, Robert; Krzywinski, Martin; Schein, Jacqueline; Accardo, Maria Carmela; Damia, Elisabetta; Messina, Giovanni; Méndez-Lago, María; de Pablos, Beatriz; Demakova, Olga V; Andreyeva, Evgeniya N; Boldyreva, Lidiya V; Marra, Marco; Carvalho, A Bernardo; Dimitri, Patrizio; Villasante, Alfredo; Zhimulev, Igor F; Rubin, Gerald M; Karpen, Gary H; Celniker, Susan E

    2015-03-01

    Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy and middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. Further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads. © 2015 Hoskins et al.; Published by Cold Spring Harbor Laboratory Press.

  5. Genomic treasure troves: complete genome sequencing of herbarium and insect museum specimens.

    Science.gov (United States)

    Staats, Martijn; Erkens, Roy H J; van de Vossenberg, Bart; Wieringa, Jan J; Kraaijeveld, Ken; Stielow, Benjamin; Geml, József; Richardson, James E; Bakker, Freek T

    2013-01-01

    Unlocking the vast genomic diversity stored in natural history collections would create unprecedented opportunities for genome-scale evolutionary, phylogenetic, domestication and population genomic studies. Many researchers have been discouraged from using historical specimens in molecular studies because of both generally limited success of DNA extraction and the challenges associated with PCR-amplifying highly degraded DNA. In today's next-generation sequencing (NGS) world, opportunities and prospects for historical DNA have changed dramatically, as most NGS methods are actually designed for taking short fragmented DNA molecules as templates. Here we show that using a standard multiplex and paired-end Illumina sequencing approach, genome-scale sequence data can be generated reliably from dry-preserved plant, fungal and insect specimens collected up to 115 years ago, and with minimal destructive sampling. Using a reference-based assembly approach, we were able to produce the entire nuclear genome of a 43-year-old Arabidopsis thaliana (Brassicaceae) herbarium specimen with high and uniform sequence coverage. Nuclear genome sequences of three fungal specimens of 22-82 years of age (Agaricus bisporus, Laccaria bicolor, Pleurotus ostreatus) were generated with 81.4-97.9% exome coverage. Complete organellar genome sequences were assembled for all specimens. Using de novo assembly we retrieved between 16.2-71.0% of coding sequence regions, and hence remain somewhat cautious about prospects for de novo genome assembly from historical specimens. Non-target sequence contaminations were observed in 2 of our insect museum specimens. We anticipate that future museum genomics projects will perhaps not generate entire genome sequences in all cases (our specimens contained relatively small and low-complexity genomes), but at least generating vital comparative genomic data for testing (phylo)genetic, demographic and genetic hypotheses, that become increasingly more horizontal

  6. Evolutionary growth process of highly conserved sequences in vertebrate genomes.

    Science.gov (United States)

    Ishibashi, Minaka; Noda, Akiko Ogura; Sakate, Ryuichi; Imanishi, Tadashi

    2012-08-01

    Genome sequence comparison between evolutionarily distant species revealed ultraconserved elements (UCEs) among mammals under strong purifying selection. Most of them were also conserved among vertebrates. Because they tend to be located in the flanking regions of developmental genes, they would have fundamental roles in creating vertebrate body plans. However, the evolutionary origin and selection mechanism of these UCEs remain unclear. Here we report that UCEs arose in primitive vertebrates, and gradually grew in vertebrate evolution. We searched for UCEs in two teleost fishes, Tetraodon nigroviridis and Oryzias latipes, and found 554 UCEs with 100% identity over 100 bps. Comparison of teleost and mammalian UCEs revealed 43 pairs of common, jawed-vertebrate UCEs (jUCE) with high sequence identities, ranging from 83.1% to 99.2%. Ten of them retain lower similarities to the Petromyzon marinus genome, and the substitution rates of four non-exonic jUCEs were reduced after the teleost-mammal divergence, suggesting that robust conservation had been acquired in the jawed vertebrate lineage. Our results indicate that prototypical UCEs originated before the divergence of jawed and jawless vertebrates and have been frozen as perfect conserved sequences in the jawed vertebrate lineage. In addition, our comparative sequence analyses of UCEs and neighboring regions resulted in a discovery of lineage-specific conserved sequences. They were added progressively to prototypical UCEs, suggesting step-wise acquisition of novel regulatory roles. Our results indicate that conserved non-coding elements (CNEs) consist of blocks with distinct evolutionary history, each having been frozen since different evolutionary era along the vertebrate lineage. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Perceived ambiguity as a barrier to intentions to learn genome sequencing results.

    Science.gov (United States)

    Taber, Jennifer M; Klein, William M P; Ferrer, Rebecca A; Han, Paul K J; Lewis, Katie L; Biesecker, Leslie G; Biesecker, Barbara B

    2015-10-01

    Many variants that could be returned from genome sequencing may be perceived as ambiguous-lacking reliability, credibility, or adequacy. Little is known about how perceived ambiguity influences thoughts about sequencing results. Participants (n = 494) in an NIH genome sequencing study completed a baseline survey before sequencing results were available. We examined how perceived ambiguity regarding sequencing results and individual differences in medical ambiguity aversion and tolerance for uncertainty were associated with cognitions and intentions concerning sequencing results. Perceiving sequencing results as more ambiguous was associated with less favorable cognitions about results and lower intentions to learn and share results. Among participants low in tolerance for uncertainty or optimism, greater perceived ambiguity was associated with lower intentions to learn results for non-medically actionable diseases; medical ambiguity aversion did not moderate any associations. Results are consistent with the phenomenon of "ambiguity aversion" and may influence whether people learn and communicate genomic information.

  8. Using nanopore sequencing to get complete genomes from complex samples

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Nielsen, Per Halkjær

    The advantages of “next generation sequencing” has come at the cost of genome finishing. The dominant sequencing technology provides short reads of 150-300 bp, which has made genome assembly very difficult as the reads do not span important repeat regions. Genomes have thus been added...... to the databases as fragmented assemblies and not as finished contigs that resemble the chromosomes in which the DNA is organised within the cells. This is especially troublesome for genomes derived from complex metagenome sequencing. Databases with incomplete genomes can lead to false conclusions about...... the absence of genes and functional predictions of the organisms. Furthermore, it is common that repetitive elements and marker genes such as the 16S rRNA gene are missing completely from these genome bins. Using nanopore long reads, we demonstrate that it is possible to span these regions and make complete...

  9. Perspectives of Integrative Cancer Genomics in Next Generation Sequencing Era

    Directory of Open Access Journals (Sweden)

    So Mee Kwon

    2012-06-01

    Full Text Available The explosive development of genomics technologies including microarrays and next generation sequencing (NGS has provided comprehensive maps of cancer genomes, including the expression of mRNAs and microRNAs, DNA copy numbers, sequence variations, and epigenetic changes. These genome-wide profiles of the genetic aberrations could reveal the candidates for diagnostic and/or prognostic biomarkers as well as mechanistic insights into tumor development and progression. Recent efforts to establish the huge cancer genome compendium and integrative omics analyses, so-called "integromics", have extended our understanding on the cancer genome, showing its daunting complexity and heterogeneity. However, the challenges of the structured integration, sharing, and interpretation of the big omics data still remain to be resolved. Here, we review several issues raised in cancer omics data analysis, including NGS, focusing particularly on the study design and analysis strategies. This might be helpful to understand the current trends and strategies of the rapidly evolving cancer genomics research.

  10. Complete chloroplast genome sequence of a tree fern Alsophila spinulosa: insights into evolutionary changes in fern chloroplast genomes.

    Science.gov (United States)

    Gao, Lei; Yi, Xuan; Yang, Yong-Xia; Su, Ying-Juan; Wang, Ting

    2009-06-11

    Ferns have generally been neglected in studies of chloroplast genomics. Before this study, only one polypod and two basal ferns had their complete chloroplast (cp) genome reported. Tree ferns represent an ancient fern lineage that first occurred in the Late Triassic. In recent phylogenetic analyses, tree ferns were shown to be the sister group of polypods, the most diverse group of living ferns. Availability of cp genome sequence from a tree fern will facilitate interpretation of the evolutionary changes of fern cp genomes. Here we have sequenced the complete cp genome of a scaly tree fern Alsophila spinulosa (Cyatheaceae). The Alsophila cp genome is 156,661 base pairs (bp) in size, and has a typical quadripartite structure with the large (LSC, 86,308 bp) and small single copy (SSC, 21,623 bp) regions separated by two copies of an inverted repeat (IRs, 24,365 bp each). This genome contains 117 different genes encoding 85 proteins, 4 rRNAs and 28 tRNAs. Pseudogenes of ycf66 and trnT-UGU are also detected in this genome. A unique trnR-UCG gene (derived from trnR-CCG) is found between rbcL and accD. The Alsophila cp genome shares some unusual characteristics with the previously sequenced cp genome of the polypod fern Adiantum capillus-veneris, including the absence of 5 tRNA genes that exist in most other cp genomes. The genome shows a high degree of synteny with that of Adiantum, but differs considerably from two basal ferns (Angiopteris evecta and Psilotum nudum). At one endpoint of an ancient inversion we detected a highly repeated 565-bp-region that is absent from the Adiantum cp genome. An additional minor inversion of the trnD-GUC, which is possibly shared by all ferns, was identified by comparison between the fern and other land plant cp genomes. By comparing four fern cp genome sequences it was confirmed that two major rearrangements distinguish higher leptosporangiate ferns from basal fern lineages. The Alsophila cp genome is very similar to that of the

  11. Complete chloroplast genome sequence of a tree fern Alsophila spinulosa: insights into evolutionary changes in fern chloroplast genomes

    Directory of Open Access Journals (Sweden)

    Yang Yong-Xia

    2009-06-01

    Full Text Available Abstract Background Ferns have generally been neglected in studies of chloroplast genomics. Before this study, only one polypod and two basal ferns had their complete chloroplast (cp genome reported. Tree ferns represent an ancient fern lineage that first occurred in the Late Triassic. In recent phylogenetic analyses, tree ferns were shown to be the sister group of polypods, the most diverse group of living ferns. Availability of cp genome sequence from a tree fern will facilitate interpretation of the evolutionary changes of fern cp genomes. Here we have sequenced the complete cp genome of a scaly tree fern Alsophila spinulosa (Cyatheaceae. Results The Alsophila cp genome is 156,661 base pairs (bp in size, and has a typical quadripartite structure with the large (LSC, 86,308 bp and small single copy (SSC, 21,623 bp regions separated by two copies of an inverted repeat (IRs, 24,365 bp each. This genome contains 117 different genes encoding 85 proteins, 4 rRNAs and 28 tRNAs. Pseudogenes of ycf66 and trnT-UGU are also detected in this genome. A unique trnR-UCG gene (derived from trnR-CCG is found between rbcL and accD. The Alsophila cp genome shares some unusual characteristics with the previously sequenced cp genome of the polypod fern Adiantum capillus-veneris, including the absence of 5 tRNA genes that exist in most other cp genomes. The genome shows a high degree of synteny with that of Adiantum, but differs considerably from two basal ferns (Angiopteris evecta and Psilotum nudum. At one endpoint of an ancient inversion we detected a highly repeated 565-bp-region that is absent from the Adiantum cp genome. An additional minor inversion of the trnD-GUC, which is possibly shared by all ferns, was identified by comparison between the fern and other land plant cp genomes. Conclusion By comparing four fern cp genome sequences it was confirmed that two major rearrangements distinguish higher leptosporangiate ferns from basal fern lineages. The

  12. Draft Genome Sequence of Type Strain Streptococcus gordonii ATCC 10558

    DEFF Research Database (Denmark)

    Rasmussen, Louise Hesselbjerg; Dargis, Rimtas; Christensen, Jens Jørgen Elmer

    2016-01-01

    Streptococcus gordonii ATCC 10558T was isolated from a patient with infective endocarditis in 1946 and announced as a type strain in 1989. Here, we report the 2,154,510-bp draft genome sequence of S. gordonii ATCC 10558T. This sequence will contribute to knowledge about the pathogenesis of infect......Streptococcus gordonii ATCC 10558T was isolated from a patient with infective endocarditis in 1946 and announced as a type strain in 1989. Here, we report the 2,154,510-bp draft genome sequence of S. gordonii ATCC 10558T. This sequence will contribute to knowledge about the pathogenesis...

  13. Complete Genome Sequence of Mycobacterium phlei Type Strain RIVM601174

    KAUST Repository

    Abdallah, A. M.; Rashid, M.; Adroub, S. A.; Arnoux, M.; Ali, Shahjahan; van Soolingen, D.; Bitter, W.; Pain, Arnab

    2012-01-01

    Mycobacterium phlei is a rapidly growing nontuberculous Mycobacterium species that is typically nonpathogenic, with few reported cases of human disease. Here we report the whole genome sequence of M. phlei type strain RIVM601174.

  14. Complete Genome Sequence of Mycobacterium phlei Type Strain RIVM601174

    KAUST Repository

    Abdallah, A. M.

    2012-05-24

    Mycobacterium phlei is a rapidly growing nontuberculous Mycobacterium species that is typically nonpathogenic, with few reported cases of human disease. Here we report the whole genome sequence of M. phlei type strain RIVM601174.

  15. Bos taurus strain:dairy beef (cattle): 1000 Bull Genomes Run 2, Bovine Whole Genome Sequence

    NARCIS (Netherlands)

    Bouwman, A.C.; Daetwyler, H.D.; Chamberlain, Amanda J.; Ponce, Carla Hurtado; Sargolzaei, Mehdi; Schenkel, Flavio S.; Sahana, Goutam; Govignon-Gion, Armelle; Boitard, Simon; Dolezal, Marlies; Pausch, Hubert; Brøndum, Rasmus F.; Bowman, Phil J.; Thomsen, Bo; Guldbrandtsen, Bernt; Lund, Mogens S.; Servin, Bertrand; Garrick, Dorian J.; Reecy, James M.; Vilkki, Johanna; Bagnato, Alessandro; Wang, Min; Hoff, Jesse L.; Schnabel, Robert D.; Taylor, Jeremy F.; Vinkhuyzen, Anna A.E.; Panitz, Frank; Bendixen, Christian; Holm, Lars-Erik; Gredler, Birgit; Hozé, Chris; Boussaha, Mekki; Sanchez, Marie Pierre; Rocha, Dominique; Capitan, Aurelien; Tribout, Thierry; Barbat, Anne; Croiseau, Pascal; Drögemüller, Cord; Jagannathan, Vidhya; Vander Jagt, Christy; Crowley, John J.; Bieber, Anna; Purfield, Deirdre C.; Berry, Donagh P.; Emmerling, Reiner; Götz, Kay Uwe; Frischknecht, Mirjam; Russ, Ingolf; Sölkner, Johann; Tassell, van Curtis P.; Fries, Ruedi; Stothard, Paul; Veerkamp, R.F.; Boichard, Didier; Goddard, Mike E.; Hayes, Ben J.

    2014-01-01

    Whole genome sequence data (BAM format) of 234 bovine individuals aligned to UMD3.1. The aim of the study was to identify genetic variants (SNPs and indels) for downstream analysis such as imputation, GWAS, and detection of lethal recessives. Additional sequences for later 1000 bull genomes runs can

  16. Draft genome sequences of two commensal Enterococcus cecorum strains isolated from chickens in Belgium

    DEFF Research Database (Denmark)

    Dolka, Beata; Boyen, Filip; Butaye, Patrick

    2015-01-01

    Here, we report the draft genome sequences of two commensal Enterococcus cecorum strains (1710s23 and 1711s24), cultivated from the ceca of healthy laying hens originating from different farms in Belgium.......Here, we report the draft genome sequences of two commensal Enterococcus cecorum strains (1710s23 and 1711s24), cultivated from the ceca of healthy laying hens originating from different farms in Belgium....

  17. Comparative genomics beyond sequence-based alignments

    DEFF Research Database (Denmark)

    Þórarinsson, Elfar; Yao, Zizhen; Wiklund, Eric D.

    2008-01-01

    Recent computational scans for non-coding RNAs (ncRNAs) in multiple organisms have relied on existing multiple sequence alignments. However, as sequence similarity drops, a key signal of RNA structure--frequent compensating base changes--is increasingly likely to cause sequence-based alignment me...

  18. Intra-species sequence comparisons for annotating genomes

    Energy Technology Data Exchange (ETDEWEB)

    Boffelli, Dario; Weer, Claire V.; Weng, Li; Lewis, Keith D.; Shoukry, Malak I.; Pachter, Lior; Keys, David N.; Rubin, Edward M.

    2004-07-15

    Analysis of sequence variation among members of a single species offers a potential approach to identify functional DNA elements responsible for biological features unique to that species. Due to its high rate of allelic polymorphism and ease of genetic manipulability, we chose the sea squirt, Ciona intestinalis, to explore intra-species sequence comparisons for genome annotation. A large number of C. intestinalis specimens were collected from four continents and a set of genomic intervals amplified, resequenced and analyzed to determine the mutation rates at each nucleotide in the sequence. We found that regions with low mutation rates efficiently demarcated functionally constrained sequences: these include a set of noncoding elements, which we showed in C intestinalis transgenic assays to act as tissue-specific enhancers, as well as the location of coding sequences. This illustrates that comparisons of multiple members of a species can be used for genome annotation, suggesting a path for the annotation of the sequenced genomes of organisms occupying uncharacterized phylogenetic branches of the animal kingdom and raises the possibility that the resequencing of a large number of Homo sapiens individuals might be used to annotate the human genome and identify sequences defining traits unique to our species. The sequence data from this study has been submitted to GenBank under accession nos. AY667278-AY667407.

  19. The Arabidopsis lyrata genome sequence and the basis of rapid genome size change

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Tina T.; Pattyn, Pedro; Bakker, Erica G.; Cao, Jun; Cheng, Jan-Fang; Clark, Richard M.; Fahlgren, Noah; Fawcett, Jeffrey A.; Grimwood, Jane; Gundlach, Heidrun; Haberer, Georg; Hollister, Jesse D.; Ossowski, Stephan; Ottilar, Robert P.; Salamov, Asaf A.; Schneeberger, Korbinian; Spannagl, Manuel; Wang, Xi; Yang, Liang; Nasrallah, Mikhail E.; Bergelson, Joy; Carrington, James C.; Gaut, Brandon S.; Schmutz, Jeremy; Mayer, Klaus F. X.; Van de Peer, Yves; Grigoriev, Igor V.; Nordborg, Magnus; Weigel, Detlef; Guo, Ya-Long

    2011-04-29

    In our manuscript, we present a high-quality genome sequence of the Arabidopsis thaliana relative, Arabidopsis lyrata, produced by dideoxy sequencing. We have performed the usual types of genome analysis (gene annotation, dN/dS studies etc. etc.), but this is relegated to the Supporting Information. Instead, we focus on what was a major motivation for sequencing this genome, namely to understand how A. thaliana lost half its genome in a few million years and lived to tell the tale. The rather surprising conclusion is that there is not a single genomic feature that accounts for the reduced genome, but that every aspect centromeres, intergenic regions, transposable elements, gene family number is affected through hundreds of thousands of cuts. This strongly suggests that overall genome size in itself is what has been under selection, a suggestion that is strongly supported by our demonstration (using population genetics data from A. thaliana) that new deletions seem to be driven to fixation.

  20. Complete Genome Sequence of Bifidobacterium bifidum S17▿

    Science.gov (United States)

    Zhurina, Daria; Zomer, Aldert; Gleinser, Marita; Brancaccio, Vincenco Francesco; Auchter, Marc; Waidmann, Mark S.; Westermann, Christina; van Sinderen, Douwe; Riedel, Christian U.

    2011-01-01

    Here, we report on the first completely annotated genome sequence of a Bifidobacterium bifidum strain. B. bifidum S17, isolated from feces of a breast-fed infant, was shown to strongly adhere to intestinal epithelial cells and has potent anti-inflammatory activity in vitro and in vivo. The genome sequence will provide new insights into the biology of this potential probiotic organism and allow for the characterization of the molecular mechanisms underlying its beneficial properties. PMID:21037011

  1. Genome Sequence of the Biocontrol Strain Pseudomonas fluorescens F113

    Science.gov (United States)

    Redondo-Nieto, Miguel; Barret, Matthieu; Morrisey, John P.; Germaine, Kieran; Martínez-Granero, Francisco; Barahona, Emma; Navazo, Ana; Sánchez-Contreras, María; Moynihan, Jennifer A.; Giddens, Stephen R.; Coppoolse, Eric R.; Muriel, Candela; Stiekema, Willem J.; Rainey, Paul B.; Dowling, David; O'Gara, Fergal; Martín, Marta

    2012-01-01

    Pseudomonas fluorescens F113 is a plant growth-promoting rhizobacterium (PGPR) that has biocontrol activity against fungal plant pathogens and is a model for rhizosphere colonization. Here, we present its complete genome sequence, which shows that besides a core genome very similar to those of other strains sequenced within this species, F113 possesses a wide array of genes encoding specialized functions for thriving in the rhizosphere and interacting with eukaryotic organisms. PMID:22328765

  2. Draft genome sequence of Therminicola potens strain JR

    Energy Technology Data Exchange (ETDEWEB)

    Byrne-Bailey, K.G.; Wrighton, K.C.; Melnyk, R.A.; Agbo, P.; Hazen, T.C.; Coates, J.D.

    2010-07-01

    'Thermincola potens' strain JR is one of the first Gram-positive dissimilatory metal-reducing bacteria (DMRB) for which there is a complete genome sequence. Consistent with the physiology of this organism, preliminary annotation revealed an abundance of multiheme c-type cytochromes that are putatively associated with the periplasm and cell surface in a Gram-positive bacterium. Here we report the complete genome sequence of strain JR.

  3. Draft genome sequence of Penicillium marneffei strain PM1.

    Science.gov (United States)

    Woo, Patrick C Y; Lau, Susanna K P; Liu, Bin; Cai, James J; Chong, Ken T K; Tse, Herman; Kao, Richard Y T; Chan, Che-Man; Chow, Wang-Ngai; Yuen, Kwok-Yung

    2011-12-01

    Penicillium marneffei is the most important thermal dimorphic, pathogenic fungus endemic in China and Southeast Asia and is particularly important in HIV-positive patients. We report the 28,887,485-bp draft genome sequence of P. marneffei, which contains its complete mitochondrial genome, sexual cycle genes, a high diversity of Mp1p homologues, and polyketide synthase genes.

  4. Complete Genome Sequence of Pediococcus pentosaceus Strain SL4

    DEFF Research Database (Denmark)

    Dantoft, Shruti Harnal; Bielak, Eliza Maria; Seo, Jae-Gu

    2013-01-01

    Pediococcus pentosaceus SL4 was isolated from a Korean fermented vegetable product, kimchi. We report here the whole-genome sequence (WGS) of P. pentosaceus SL4. The genome consists of a 1.79-Mb circular chromosome (G+C content of 37.3%) and seven distinct plasmids ranging in size from 4 kb to 50...

  5. Whole-Genome Sequences of Three Symbiotic Endozoicomonas Bacteria

    KAUST Repository

    Neave, Matthew J.

    2014-08-14

    Members of the genus Endozoicomonas associate with a wide range of marine organisms. Here, we report on the whole-genome sequencing, assembly, and annotation of three Endozoicomonas type strains. These data will assist in exploring interactions between Endozoicomonas organisms and their hosts, and it will aid in the assembly of genomes from uncultivated Endozoicomonas spp.

  6. The complete chloroplast genome sequence of Abies nephrolepis (Pinaceae: Abietoideae

    Directory of Open Access Journals (Sweden)

    Dong-Keun Yi

    2016-06-01

    Full Text Available The plant chloroplast (cp genome has maintained a relatively conserved structure and gene content throughout evolution. Cp genome sequences have been used widely for resolving evolutionary and phylogenetic issues at various taxonomic levels of plants. Here, we report the complete cp genome of Abies nephrolepis. The A. nephrolepis cp genome is 121,336 base pairs (bp in length including a pair of short inverted repeat regions (IRa and IRb of 139 bp each separated by a small single copy (SSC region of 54,323 bp (SSC and a large single copy region of 66,735 bp (LSC. It contains 114 genes, 68 of which are protein coding genes, 35 tRNA and four rRNA genes, six open reading frames, and one pseudogene. Seventeen repeat units and 64 simple sequence repeats (SSR have been detected in A. nephrolepis cp genome. Large IR sequences locate in 42-kb inversion points (1186 bp. The A. nephrolepis cp genome is identical to Abies koreana’s which is closely related to taxa. Pairwise comparison between two cp genomes revealed 140 polymorphic sites in each. Complete cp genome sequence of A. nephrolepis has a significant potential to provide information on the evolutionary pattern of Abietoideae and valuable data for development of DNA markers for easy identification and classification.

  7. Whole-genome sequence-based analysis of thyroid function

    DEFF Research Database (Denmark)

    Taylor, Peter N.; Porcu, Eleonora; Chew, Shelby

    2015-01-01

    Normal thyroid function is essential for health, but its genetic architecture remains poorly understood. Here, for the heritable thyroid traits thyrotropin (TSH) and free thyroxine (FT4), we analyse whole-genome sequence data from the UK10K project (N = 2,287). Using additional whole-genome seque...

  8. The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome

    NARCIS (Netherlands)

    Chen, X.; IJkel, W.F.J.; Tarchini, R.; Sun, X.; Sandbrink, H.; Wang, H.; Peters, S.; Zuidema, D.; Klein Lankhorst, R.; Vlak, J.M.; Hu, Z.

    2001-01-01

    The nucleotide sequence of the Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) DNA genome was determined and analysed. The circular genome encompasses 131 403 bp, has a G C content of 39.1 molnd contains five homologous regions with a unique pattern of repeats.

  9. Draft Genome Sequence of Escherichia coli K-12 (ATCC 10798)

    OpenAIRE

    Dimitrova, Daniela; Engelbrecht, Kathleen C.; Putonti, Catherine; Koenig, David W.; Wolfe, Alan J.

    2017-01-01

    ABSTRACT Here, we present the draft genome sequence of Escherichia coli ATCC 10798. E.?coli ATCC 10798 is a K-12 strain, one of the most well-studied model microorganisms. The size of the genome was 4,685,496?bp, with a G+C content of 50.70%. This assembly consists of 62 contigs and the F plasmid.

  10. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  11. A bibliometric analysis of global research on genome sequencing ...

    African Journals Online (AJOL)

    The results show that disease and protein related researches were the leading research focuses, and comparative genomics and evolution related research had strong potential in the near future. Key words: Genome sequencing, research trend, scientometrics, science citation index expanded (SCI-Expanded), word cluster ...

  12. Whole-Genome Sequences of Three Symbiotic Endozoicomonas Bacteria

    KAUST Repository

    Neave, Matthew J.; Michell, Craig; Apprill, Amy; Voolstra, Christian R.

    2014-01-01

    Members of the genus Endozoicomonas associate with a wide range of marine organisms. Here, we report on the whole-genome sequencing, assembly, and annotation of three Endozoicomonas type strains. These data will assist in exploring interactions between Endozoicomonas organisms and their hosts, and it will aid in the assembly of genomes from uncultivated Endozoicomonas spp.

  13. Genome sequence of Chinese porcine parvovirus strain PPV2010.

    Science.gov (United States)

    Cui, Jin; Wang, Xin; Ren, Yudong; Cui, Shangjin; Li, Guangxing; Ren, Xiaofeng

    2012-02-01

    Porcine parvovirus (PPV) isolate PPV2010 has recently emerged in China. Herein, we analyze the complete genome sequence of PPV2010. Our results indicate that the genome of PPV2010 bears mixed characteristics of virulent PPV and vaccine strains. Importantly, PPV2010 has the potential to be a naturally attenuated candidate vaccine strain.

  14. Genome Sequence of Chinese Porcine Parvovirus Strain PPV2010

    OpenAIRE

    Cui, Jin; Wang, Xin; Ren, Yudong; Cui, Shangjin; Li, Guangxing; Ren, Xiaofeng

    2012-01-01

    Porcine parvovirus (PPV) isolate PPV2010 has recently emerged in China. Herein, we analyze the complete genome sequence of PPV2010. Our results indicate that the genome of PPV2010 bears mixed characteristics of virulent PPV and vaccine strains. Importantly, PPV2010 has the potential to be a naturally attenuated candidate vaccine strain.

  15. Draft genome sequence of the silver pomfret fish, Pampus argenteus.

    Science.gov (United States)

    AlMomin, Sabah; Kumar, Vinod; Al-Amad, Sami; Al-Hussaini, Mohsen; Dashti, Talal; Al-Enezi, Khaznah; Akbar, Abrar

    2016-01-01

    Silver pomfret, Pampus argenteus, is a fish species from coastal waters. Despite its high commercial value, this edible fish has not been sequenced. Hence, its genetic and genomic studies have been limited. We report the first draft genome sequence of the silver pomfret obtained using a Next Generation Sequencing (NGS) technology. We assembled 38.7 Gb of nucleotides into scaffolds of 350 Mb with N50 of about 1.5 kb, using high quality paired end reads. These scaffolds represent 63.7% of the estimated silver pomfret genome length. The newly sequenced and assembled genome has 11.06% repetitive DNA regions, and this percentage is comparable to that of the tilapia genome. The genome analysis predicted 16 322 genes. About 91% of these genes showed homology with known proteins. Many gene clusters were annotated to protein and fatty-acid metabolism pathways that may be important in the context of the meat texture and immune system developmental processes. The reference genome can pave the way for the identification of many other genomic features that could improve breeding and population-management strategies, and it can also help characterize the genetic diversity of P. argenteus.

  16. Finished Genome Sequence of Collimonas arenae Cal35

    NARCIS (Netherlands)

    Wu, Je-Jia; de Jager, Victor; Deng, Wen-ling; Leveau, Johan

    2015-01-01

    We announce the finished genome sequence of soil forest isolate Collimonas arenae Cal35, which comprises a 5.6-Mbp chromosome and 41-kb plasmid. The Cal35 genome is the second one published for the bacterial genus Collimonas and represents the first opportunity for high-resolution comparison of

  17. Complete genome sequence of pronghorn virus, a pestivirus

    Science.gov (United States)

    The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....

  18. Complete sequence of the mitochondrial genome of ...

    Indian Academy of Sciences (India)

    products were purified using the DNA Gel Extraction Kit. (Tiangen, Shanghai, China). The purified products obtained ..... Base composition of O. rubicundus mitochondrial genome. .... the help of fish sampled and identified by morphology.

  19. The whole genome sequences and experimentally phased haplotypes of over 100 personal genomes.

    Science.gov (United States)

    Mao, Qing; Ciotlos, Serban; Zhang, Rebecca Yu; Ball, Madeleine P; Chin, Robert; Carnevali, Paolo; Barua, Nina; Nguyen, Staci; Agarwal, Misha R; Clegg, Tom; Connelly, Abram; Vandewege, Ward; Zaranek, Alexander Wait; Estep, Preston W; Church, George M; Drmanac, Radoje; Peters, Brock A

    2016-10-11

    Since the completion of the Human Genome Project in 2003, it is estimated that more than 200,000 individual whole human genomes have been sequenced. A stunning accomplishment in such a short period of time. However, most of these were sequenced without experimental haplotype data and are therefore missing an important aspect of genome biology. In addition, much of the genomic data is not available to the public and lacks phenotypic information. As part of the Personal Genome Project, blood samples from 184 participants were collected and processed using Complete Genomics' Long Fragment Read technology. Here, we present the experimental whole genome haplotyping and sequencing of these samples to an average read coverage depth of 100X. This is approximately three-fold higher than the read coverage applied to most whole human genome assemblies and ensures the highest quality results. Currently, 114 genomes from this dataset are freely available in the GigaDB repository and are associated with rich phenotypic data; the remaining 70 should be added in the near future as they are approved through the PGP data release process. For reproducibility analyses, 20 genomes were sequenced at least twice using independent LFR barcoded libraries. Seven genomes were also sequenced using Complete Genomics' standard non-barcoded library process. In addition, we report 2.6 million high-quality, rare variants not previously identified in the Single Nucleotide Polymorphisms database or the 1000 Genomes Project Phase 3 data. These genomes represent a unique source of haplotype and phenotype data for the scientific community and should help to expand our understanding of human genome evolution and function.

  20. First fungal genome sequence from Africa: A preliminary analysis

    Directory of Open Access Journals (Sweden)

    Rene Sutherland

    2012-01-01

    Full Text Available Some of the most significant breakthroughs in the biological sciences this century will emerge from the development of next generation sequencing technologies. The ease of availability of DNA sequence made possible through these new technologies has given researchers opportunities to study organisms in a manner that was not possible with Sanger sequencing. Scientists will, therefore, need to embrace genomics, as well as develop and nurture the human capacity to sequence genomes and utilise the ’tsunami‘ of data that emerge from genome sequencing. In response to these challenges, we sequenced the genome of Fusarium circinatum, a fungal pathogen of pine that causes pitch canker, a disease of great concern to the South African forestry industry. The sequencing work was conducted in South Africa, making F. circinatum the first eukaryotic organism for which the complete genome has been sequenced locally. Here we report on the process that was followed to sequence, assemble and perform a preliminary characterisation of the genome. Furthermore, details of the computer annotation and manual curation of this genome are presented. The F. circinatum genome was found to be nearly 44 million bases in size, which is similar to that of four other Fusarium genomes that have been sequenced elsewhere. The genome contains just over 15 000 open reading frames, which is less than that of the related species, Fusarium oxysporum, but more than that for Fusarium verticillioides. Amongst the various putative gene clusters identified in F. circinatum, those encoding the secondary metabolites fumosin and fusarin appeared to harbour evidence of gene translocation. It is anticipated that similar comparisons of other loci will provide insights into the genetic basis for pathogenicity of the pitch canker pathogen. Perhaps more importantly, this project has engaged a relatively large group of scientists

  1. What can we learn about lyssavirus genomes using 454 sequencing?

    Science.gov (United States)

    Höper, Dirk; Finke, Stefan; Freuling, Conrad M; Hoffmann, Bernd; Beer, Martin

    2012-01-01

    The main task of the individual project number four"Whole genome sequencing, virus-host adaptation, and molecular epidemiological analyses of lyssaviruses "within the network" Lyssaviruses--a potential re-emerging public health threat" is to provide high quality complete genome sequences from lyssaviruses. These sequences are analysed in-depth with regard to the diversity of the viral populations as to both quasi-species and so-called defective interfering RNAs. Moreover, the sequence data will facilitate further epidemiological analyses, will provide insight into the evolution of lyssaviruses and will be the basis for the design of novel nucleic acid based diagnostics. The first results presented here indicate that not only high quality full-length lyssavirus genome sequences can be generated, but indeed efficient analysis of the viral population gets feasible.

  2. Multi-scale coding of genomic information: From DNA sequence to genome structure and function

    International Nuclear Information System (INIS)

    Arneodo, Alain; Vaillant, Cedric; Audit, Benjamin; Argoul, Francoise; D'Aubenton-Carafa, Yves; Thermes, Claude

    2011-01-01

    Understanding how chromatin is spatially and dynamically organized in the nucleus of eukaryotic cells and how this affects genome functions is one of the main challenges of cell biology. Since the different orders of packaging in the hierarchical organization of DNA condition the accessibility of DNA sequence elements to trans-acting factors that control the transcription and replication processes, there is actually a wealth of structural and dynamical information to learn in the primary DNA sequence. In this review, we show that when using concepts, methodologies, numerical and experimental techniques coming from statistical mechanics and nonlinear physics combined with wavelet-based multi-scale signal processing, we are able to decipher the multi-scale sequence encoding of chromatin condensation-decondensation mechanisms that play a fundamental role in regulating many molecular processes involved in nuclear functions.

  3. Identifying driver mutations in sequenced cancer genomes

    DEFF Research Database (Denmark)

    Raphael, Benjamin J; Dobson, Jason R; Oesper, Layla

    2014-01-01

    High-throughput DNA sequencing is revolutionizing the study of cancer and enabling the measurement of the somatic mutations that drive cancer development. However, the resulting sequencing datasets are large and complex, obscuring the clinically important mutations in a background of errors, nois...... patterns of mutual exclusivity. These techniques, coupled with advances in high-throughput DNA sequencing, are enabling precision medicine approaches to the diagnosis and treatment of cancer....

  4. Genomic sequence of 'Candidatus Liberibacter solanacearum' haplotype C and its comparison with haplotype A and B genomes.

    Directory of Open Access Journals (Sweden)

    Jinhui Wang

    Full Text Available Haplotypes A and B of 'Candidatus Liberibacter solanacearum' (CLso are associated with diseases of solanaceous plants, especially Zebra chip disease of potato, and haplotypes C, D and E are associated with symptoms on apiaceous plants. To date, one complete genome of haplotype B and two high quality draft genomes of haplotype A have been obtained for these unculturable bacteria using metagenomics from the psyllid vector Bactericera cockerelli. Here, we present the first genomic sequences obtained for the carrot-associated CLso. These two genomic sequences of haplotype C, FIN114 (1.24 Mbp and FIN111 (1.20 Mbp, were obtained from carrot psyllids (Trioza apicalis harboring CLso. Genomic comparisons between the haplotypes A, B and C revealed that the genome organization differs between these haplotypes, due to large inversions and other recombinations. Comparison of protein-coding genes indicated that the core genome of CLso consists of 885 ortholog groups, with the pan-genome consisting of 1327 ortholog groups. Twenty-seven ortholog groups are unique to CLso haplotype C, whilst 11 ortholog groups shared by the haplotypes A and B, are not found in the haplotype C. Some of these ortholog groups that are not part of the core genome may encode functions related to interactions with the different host plant and psyllid species.

  5. Ancient Human Genome Sequence of an Extinct Palaeo-Eskimo

    DEFF Research Database (Denmark)

    Rasmussen, Morten; Li, Yingrui; Lindgreen, Stinus

    2010-01-01

    We report here the genome sequence of an ancient human. Obtained from approximately 4,000-year-old permafrost-preserved hair, the genome represents a male individual from the first known culture to settle in Greenland. Sequenced to an average depth of 20x, we recover 79% of the diploid genome...... possible phenotypic characteristics of the individual that belonged to a culture whose location has yielded only trace human remains. We compare the high-confidence SNPs to those of contemporary populations to find the populations most closely related to the individual. This provides evidence...

  6. Biased distribution of DNA uptake sequences towards genome maintenance genes

    DEFF Research Database (Denmark)

    Davidsen, T.; Rodland, E.A.; Lagesen, K.

    2004-01-01

    Repeated sequence signatures are characteristic features of all genomic DNA. We have made a rigorous search for repeat genomic sequences in the human pathogens Neisseria meningitidis, Neisseria gonorrhoeae and Haemophilus influenzae and found that by far the most frequent 9-10mers residing within...... in these organisms. Pasteurella multocida also displayed high frequencies of a putative DUS identical to that previously identified in H. influenzae and with a skewed distribution towards genome maintenance genes, indicating that this bacterium might be transformation competent under certain conditions....

  7. Complete genome sequence of Serratia plymuthica strain AS12

    Energy Technology Data Exchange (ETDEWEB)

    Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Finlay, Roger D. [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Han, James [U.S. Department of Energy, Joint Genome Institute; Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Hogberg, Nils [Uppsala University, Uppsala, Sweden

    2012-01-01

    A plant associated member of the family Enterobacteriaceae, Serratia plymuthica strain AS12 was isolated from rapeseed roots. It is of scientific interest due to its plant growth promoting and plant pathogen inhibiting ability. The genome of S. plymuthica AS12 comprises a 5,443,009 bp long circular chromosome, which consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome was sequenced within the 2010 DOE-JGI Community Sequencing Program (CSP2010) as part of the project entitled 'Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens'.

  8. Genome Sequences of Four Italian Streptococcus thermophilus Strains of Dairy Origin

    DEFF Research Database (Denmark)

    Treu, Laura; Vendramin, Veronica; Bovo, Barbara

    2014-01-01

    This report describes the genome sequences of four Streptococcus thermophilus strains, namely, TH982, TH985, TH1477, and 1F8CT, isolated from different dairy environments from the Campania and the Veneto regions in Italy. These data are aimed at increasing the genomic information available on thi...

  9. Draft Genome Sequence of the Antagonistic Rhizosphere Bacterium Serratia plymuthica Strain PRI-2C

    NARCIS (Netherlands)

    Garbeva, P.; van Elsas, J.D.; de Boer, W.

    Serratia plymuthica strain PRI-2C is a rhizosphere bacterial strain with antagonistic activity against different plant pathogens. Here we present the 5.39-Mb (G+C content, 55.67%) draft genome sequence of S. plymuthica strain PRI-2C with the aim of providing insight into the genomic basis of its

  10. Comparison of two Next Generation sequencing platforms for full genome sequencing of Classical Swine Fever Virus

    DEFF Research Database (Denmark)

    Fahnøe, Ulrik; Pedersen, Anders Gorm; Höper, Dirk

    2013-01-01

    to the consensus sequence. Additionally, we got an average sequence depth for the genome of 4000 for the Iontorrent PGM and 400 for the FLX platform making the mapping suitable for single nucleotide variant (SNV) detection. The analysis revealed a single non-silent SNV A10665G leading to the amino acid change D......Next Generation Sequencing (NGS) is becoming more adopted into viral research and will be the preferred technology in the years to come. We have recently sequenced several strains of Classical Swine Fever Virus (CSFV) by NGS on both Genome Sequencer FLX (GS FLX) and Iontorrent PGM platforms...

  11. Distribution of Ds-like sequences in genomes of cereals

    International Nuclear Information System (INIS)

    Vershinin, A.V.; Salina, E.A.; Shumnii, V.K.; Svitashev, S.K.

    1986-01-01

    It has been suggested that insertions of Ds-elements may alter the effectiveness of transcription or translation of the genetic loci and the normal processing of introns and exons, and that they may impair coding frames, etc. The object of the present study was to determine the frequency of occurence of DNA sequences similar to the Ds-controlling elements of mazie (Ds-like sequences) among other representatives of cereals. The conservative feature of the primary structure of transposons from different eukaryotic species served as a basis in this investigation. By means of the ''nick-translation'' reaction with the aid of DNA-polymerase I (alpha- 32 P) dCTP or TTP was introduced into the Ds-element. The specific radioactivity of the preparations obtained was 5 x 10 7 to 1 x 10 8 cpm/gamma. From the results obtained, it is suggested that the genomes of cereals examined contain a collection of Ds-like sequences. The Ds-element may have a significant effect on gene expression in the presence of Ac-like or other sequences, which undergo transposition

  12. The genome sequence of the model ascomycete fungus Podospora anserina

    NARCIS (Netherlands)

    Espagne, Eric; Lespinet, Olivier; Malagnac, Fabienne; Da Silva, Corinne; Jaillon, Olivier; Porcel, Betina M; Couloux, Arnaud; Aury, Jean-Marc; Ségurens, Béatrice; Poulain, Julie; Anthouard, Véronique; Grossetete, Sandrine; Khalili, Hamid; Coppin, Evelyne; Déquard-Chablat, Michelle; Picard, Marguerite; Contamine, Véronique; Arnaise, Sylvie; Bourdais, Anne; Berteaux-Lecellier, Véronique; Gautheret, Daniel; de Vries, Ronald P; Battaglia, Evy; Coutinho, Pedro M; Danchin, Etienne Gj; Henrissat, Bernard; Khoury, Riyad El; Sainsard-Chanet, Annie; Boivin, Antoine; Pinan-Lucarré, Bérangère; Sellem, Carole H; Debuchy, Robert; Wincker, Patrick; Weissenbach, Jean; Silar, Philippe

    2008-01-01

    BACKGROUND: The dung-inhabiting ascomycete fungus Podospora anserina is a model used to study various aspects of eukaryotic and fungal biology, such as ageing, prions and sexual development. RESULTS: We present a 10X draft sequence of P. anserina genome, linked to the sequences of a large expressed

  13. Sequencing and analysis of an Irish human genome.

    LENUS (Irish Health Repository)

    Tong, Pin

    2010-01-01

    Recent studies generating complete human sequences from Asian, African and European subgroups have revealed population-specific variation and disease susceptibility loci. Here, choosing a DNA sample from a population of interest due to its relative geographical isolation and genetic impact on further populations, we extend the above studies through the generation of 11-fold coverage of the first Irish human genome sequence.

  14. Genome sequence of Stachybotrys chartarum Strain 51-11

    Science.gov (United States)

    Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

  15. Complete genome sequence of a novel pestivirus from sheep.

    Science.gov (United States)

    Becher, Paul; Schmeiser, Stefanie; Oguzoglu, Tuba Cigdem; Postel, Alexander

    2012-10-01

    We report here the complete genome sequence of pestivirus strain Aydin/04-TR, which is the prototype of a group of similar viruses currently present in sheep and goats in Turkey. Sequence data from this virus showed that it clusters separately from the established and previously proposed tentative pestivirus species.

  16. Complete Genome Sequence of a Novel Pestivirus from Sheep

    OpenAIRE

    Becher, Paul; Schmeiser, Stefanie; Oguzoglu, Tuba Cigdem; Postel, Alexander

    2012-01-01

    We report here the complete genome sequence of pestivirus strain Aydin/04-TR, which is the prototype of a group of similar viruses currently present in sheep and goats in Turkey. Sequence data from this virus showed that it clusters separately from the established and previously proposed tentative pestivirus species.

  17. Pig genome sequence - analysis and publication strategy

    DEFF Research Database (Denmark)

    Archibald, Alan L.; Bolund, Lars; Churcher, Carol

    2010-01-01

    preferentially selected for sequencing. In accordance with the Bermuda and Fort Lauderdale agreements and the more recent Toronto Statement the data have been released into public sequence repositories (Genbank/EMBL, NCBI/Ensembl trace repositories) in a timely manner and in advance of publication. CONCLUSIONS...

  18. Human genome and genetic sequencing research and informed consent

    International Nuclear Information System (INIS)

    Iwakawa, Mayumi

    2003-01-01

    On March 29, 2001, the Ethical Guidelines for Human Genome and Genetic Sequencing Research were established. They have intended to serve as ethical guidelines for all human genome and genetic sequencing research practice, for the purpose of upholding respect for human dignity and rights and enforcing use of proper methods in the pursuit of human genome and genetic sequencing research, with the understanding and cooperation of the public. The RadGenomics Project has prepared a research protocol and informed consent document that follow these ethical guidelines. We have endeavored to protect the privacy of individual information, and have established a procedure for examination of research practices by an ethics committee. Here we report our procedure in order to offer this concept to the patients. (authors)

  19. Complete genome sequence of the myxobacterium Sorangium cellulosum

    DEFF Research Database (Denmark)

    Schneiker, S; Perlova, O; Kaiser, O

    2007-01-01

    The genus Sorangium synthesizes approximately half of the secondary metabolites isolated from myxobacteria, including the anti-cancer metabolite epothilone. We report the complete genome sequence of the model Sorangium strain S. cellulosum Soce56, which produces several natural products and has...... morphological and physiological properties typical of the genus. The circular genome, comprising 13,033,779 base pairs, is the largest bacterial genome sequenced to date. No global synteny with the genome of Myxococcus xanthus is apparent, revealing an unanticipated level of divergence between...... these myxobacteria. A large percentage of the genome is devoted to regulation, particularly post-translational phosphorylation, which probably supports the strain's complex, social lifestyle. This regulatory network includes the highest number of eukaryotic protein kinase-like kinases discovered in any organism...

  20. Genomic Sequencing of Single Microbial Cells from Environmental Samples

    Energy Technology Data Exchange (ETDEWEB)

    Ishoey, Thomas; Woyke, Tanja; Stepanauskas, Ramunas; Novotny, Mark; Lasken, Roger S.

    2008-02-01

    Recently developed techniques allow genomic DNA sequencing from single microbial cells [Lasken RS: Single-cell genomic sequencing using multiple displacement amplification, Curr Opin Microbiol 2007, 10:510-516]. Here, we focus on research strategies for putting these methods into practice in the laboratory setting. An immediate consequence of single-cell sequencing is that it provides an alternative to culturing organisms as a prerequisite for genomic sequencing. The microgram amounts of DNA required as template are amplified from a single bacterium by a method called multiple displacement amplification (MDA) avoiding the need to grow cells. The ability to sequence DNA from individual cells will likely have an immense impact on microbiology considering the vast numbers of novel organisms, which have been inaccessible unless culture-independent methods could be used. However, special approaches have been necessary to work with amplified DNA. MDA may not recover the entire genome from the single copy present in most bacteria. Also, some sequence rearrangements can occur during the DNA amplification reaction. Over the past two years many research groups have begun to use MDA, and some practical approaches to single-cell sequencing have been developed. We review the consensus that is emerging on optimum methods, reliability of amplified template, and the proper interpretation of 'composite' genomes which result from the necessity of combining data from several single-cell MDA reactions in order to complete the assembly. Preferred laboratory methods are considered on the basis of experience at several large sequencing centers where >70% of genomes are now often recovered from single cells. Methods are reviewed for preparation of bacterial fractions from environmental samples, single-cell isolation, DNA amplification by MDA, and DNA sequencing.

  1. Draft Genome Sequence of Uncultured SAR324 Bacterium lautmerah10, Binned from a Red Sea Metagenome

    KAUST Repository

    Haroon, Mohamed; Thompson, Luke R.; Stingl, Ulrich

    2016-01-01

    A draft genome of SAR324 bacterium lautmerah10 was assembled from a metagenome of a surface water sample from the Red Sea, Saudi Arabia. The genome is more complete and has a higher G+C content than that of previously sequenced SAR324 representatives. Its genomic information shows a versatile metabolism that confers an advantage to SAR324, which is reflected in its distribution throughout different depths of the marine water column.

  2. Draft Genome Sequence of Uncultured SAR324 Bacterium lautmerah10, Binned from a Red Sea Metagenome

    KAUST Repository

    Haroon, Mohamed

    2016-02-11

    A draft genome of SAR324 bacterium lautmerah10 was assembled from a metagenome of a surface water sample from the Red Sea, Saudi Arabia. The genome is more complete and has a higher G+C content than that of previously sequenced SAR324 representatives. Its genomic information shows a versatile metabolism that confers an advantage to SAR324, which is reflected in its distribution throughout different depths of the marine water column.

  3. Genomic insight into the common carp (Cyprinus carpio genome by sequencing analysis of BAC-end sequences

    Directory of Open Access Journals (Sweden)

    Wang Jintu

    2011-04-01

    Full Text Available Abstract Background Common carp is one of the most important aquaculture teleost fish in the world. Common carp and other closely related Cyprinidae species provide over 30% aquaculture production in the world. However, common carp genomic resources are still relatively underdeveloped. BAC end sequences (BES are important resources for genome research on BAC-anchored genetic marker development, linkage map and physical map integration, and whole genome sequence assembling and scaffolding. Result To develop such valuable resources in common carp (Cyprinus carpio, a total of 40,224 BAC clones were sequenced on both ends, generating 65,720 clean BES with an average read length of 647 bp after sequence processing, representing 42,522,168 bp or 2.5% of common carp genome. The first survey of common carp genome was conducted with various bioinformatics tools. The common carp genome contains over 17.3% of repetitive elements with GC content of 36.8% and 518 transposon ORFs. To identify and develop BAC-anchored microsatellite markers, a total of 13,581 microsatellites were detected from 10,355 BES. The coding region of 7,127 genes were recognized from 9,443 BES on 7,453 BACs, with 1,990 BACs have genes on both ends. To evaluate the similarity to the genome of closely related zebrafish, BES of common carp were aligned against zebrafish genome. A total of 39,335 BES of common carp have conserved homologs on zebrafish genome which demonstrated the high similarity between zebrafish and common carp genomes, indicating the feasibility of comparative mapping between zebrafish and common carp once we have physical map of common carp. Conclusion BAC end sequences are great resources for the first genome wide survey of common carp. The repetitive DNA was estimated to be approximate 28% of common carp genome, indicating the higher complexity of the genome. Comparative analysis had mapped around 40,000 BES to zebrafish genome and established over 3

  4. Genomic insight into the common carp (Cyprinus carpio) genome by sequencing analysis of BAC-end sequences

    Science.gov (United States)

    2011-01-01

    Background Common carp is one of the most important aquaculture teleost fish in the world. Common carp and other closely related Cyprinidae species provide over 30% aquaculture production in the world. However, common carp genomic resources are still relatively underdeveloped. BAC end sequences (BES) are important resources for genome research on BAC-anchored genetic marker development, linkage map and physical map integration, and whole genome sequence assembling and scaffolding. Result To develop such valuable resources in common carp (Cyprinus carpio), a total of 40,224 BAC clones were sequenced on both ends, generating 65,720 clean BES with an average read length of 647 bp after sequence processing, representing 42,522,168 bp or 2.5% of common carp genome. The first survey of common carp genome was conducted with various bioinformatics tools. The common carp genome contains over 17.3% of repetitive elements with GC content of 36.8% and 518 transposon ORFs. To identify and develop BAC-anchored microsatellite markers, a total of 13,581 microsatellites were detected from 10,355 BES. The coding region of 7,127 genes were recognized from 9,443 BES on 7,453 BACs, with 1,990 BACs have genes on both ends. To evaluate the similarity to the genome of closely related zebrafish, BES of common carp were aligned against zebrafish genome. A total of 39,335 BES of common carp have conserved homologs on zebrafish genome which demonstrated the high similarity between zebrafish and common carp genomes, indicating the feasibility of comparative mapping between zebrafish and common carp once we have physical map of common carp. Conclusion BAC end sequences are great resources for the first genome wide survey of common carp. The repetitive DNA was estimated to be approximate 28% of common carp genome, indicating the higher complexity of the genome. Comparative analysis had mapped around 40,000 BES to zebrafish genome and established over 3,100 microsyntenies, covering over 50% of

  5. Sequencing of a new target genome: the Pediculus humanus humanus (Phthiraptera: Pediculidae) genome project.

    Science.gov (United States)

    Pittendrigh, B R; Clark, J M; Johnston, J S; Lee, S H; Romero-Severson, J; Dasch, G A

    2006-11-01

    The human body louse, Pediculus humanus humanus (L.), and the human head louse, Pediculus humanus capitis, belong to the hemimetabolous order Phthiraptera. The body louse is the primary vector that transmits the bacterial agents of louse-borne relapsing fever, trench fever, and epidemic typhus. The genomes of the bacterial causative agents of several of these aforementioned diseases have been sequenced. Thus, determining the body louse genome will enhance studies of host-vector-pathogen interactions. Although not important as a major disease vector, head lice are of major social concern. Resistance to traditional pesticides used to control head and body lice have developed. It is imperative that new molecular targets be discovered for the development of novel compounds to control these insects. No complete genome sequence exists for a hemimetabolous insect species primarily because hemimetabolous insects often have large (2000 Mb) to very large (up to 16,300 Mb) genomes. Fortuitously, we determined that the human body louse has one of the smallest genome sizes known in insects, suggesting it may be a suitable choice as a minimal hemimetabolous genome in which many genes have been eliminated during its adaptation to human parasitism. Because many louse species infest birds and mammals, the body louse genome-sequencing project will facilitate studies of their comparative genomics. A 6-8X coverage of the body louse genome, plus sequenced expressed sequence tags, should provide the entomological, evolutionary biology, medical, and public health communities with useful genetic information.

  6. Genome sequence analysis of the model grass Brachypodium distachyon: insights into grass genome evolution

    Energy Technology Data Exchange (ETDEWEB)

    Schulman, Al

    2009-08-09

    Three subfamilies of grasses, the Erhardtoideae (rice), the Panicoideae (maize, sorghum, sugar cane and millet), and the Pooideae (wheat, barley and cool season forage grasses) provide the basis of human nutrition and are poised to become major sources of renewable energy. Here we describe the complete genome sequence of the wild grass Brachypodium distachyon (Brachypodium), the first member of the Pooideae subfamily to be completely sequenced. Comparison of the Brachypodium, rice and sorghum genomes reveals a precise sequence- based history of genome evolution across a broad diversity of the grass family and identifies nested insertions of whole chromosomes into centromeric regions as a predominant mechanism driving chromosome evolution in the grasses. The relatively compact genome of Brachypodium is maintained by a balance of retroelement replication and loss. The complete genome sequence of Brachypodium, coupled to its exceptional promise as a model system for grass research, will support the development of new energy and food crops

  7. The genome sequence of four isolates from the family Lichtheimiaceae.

    Science.gov (United States)

    Chibucos, Marcus C; Etienne, Kizee A; Orvis, Joshua; Lee, Hongkyu; Daugherty, Sean; Lockhart, Shawn R; Ibrahim, Ashraf S; Bruno, Vincent M

    2015-07-01

    This study reports the release of draft genome sequences of two isolates of Lichtheimia corymbifera and two isolates of L. ramosa. Phylogenetic analyses indicate that the two L. corymbifera strains (CDC-B2541 and 008-049) are closely related to the previously sequenced L. corymbifera isolate (FSU 9682) while our two L. ramosa strains CDC-B5399 and CDC-B5792 cluster apart from them. These genome sequences will further the understanding of intraspecies and interspecies genetic variation within the Mucoraceae family of pathogenic fungi. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Involvement of Disperse Repetitive Sequences in Wheat/Rye Genome Adjustment

    Directory of Open Access Journals (Sweden)

    Manuela Silva

    2012-07-01

    Full Text Available The union of different genomes in the same nucleus frequently results in hybrid genotypes with improved genome plasticity related to both genome remodeling events and changes in gene expression. Most modern cereal crops are polyploid species. Triticale, synthesized by the cross between wheat and rye, constitutes an excellent model to study polyploidization functional implications. We intend to attain a deeper knowledge of dispersed repetitive sequence involvement in parental genome reshuffle in triticale and in wheat-rye addition lines that have the entire wheat genome plus each rye chromosome pair. Through Random Amplified Polymorphic DNA (RAPD analysis with OPH20 10-mer primer we unraveled clear alterations corresponding to the loss of specific bands from both parental genomes. Moreover, the sequential nature of those events was revealed by the increased absence of rye-origin bands in wheat-rye addition lines in comparison with triticale. Remodeled band sequencing revealed that both repetitive and coding genome domains are affected in wheat-rye hybrid genotypes. Additionally, the amplification and sequencing of pSc20H internal segments showed that the disappearance of parental bands may result from restricted sequence alterations and unraveled the involvement of wheat/rye related repetitive sequences in genome adjustment needed for hybrid plant stabilization.

  9. Genome sequencing of ovine isolates of Mycobacterium avium subspecies paratuberculosis offers insights into host association

    Directory of Open Access Journals (Sweden)

    Bannantine John P

    2012-03-01

    Full Text Available Abstract Background The genome of Mycobacterium avium subspecies paratuberculosis (MAP is remarkably homogeneous among the genomes of bovine, human and wildlife isolates. However, previous work in our laboratories with the bovine K-10 strain has revealed substantial differences compared to sheep isolates. To systematically characterize all genomic differences that may be associated with the specific hosts, we sequenced the genomes of three U.S. sheep isolates and also obtained an optical map. Results Our analysis of one of the isolates, MAP S397, revealed a genome 4.8 Mb in size with 4,700 open reading frames (ORFs. Comparative analysis of the MAP S397 isolate showed it acquired approximately 10 large sequence regions that are shared with the human M. avium subsp. hominissuis strain 104 and lost 2 large regions that are present in the bovine strain. In addition, optical mapping defined the presence of 7 large inversions between the bovine and ovine genomes (~ 2.36 Mb. Whole-genome sequencing of 2 additional sheep strains of MAP (JTC1074 and JTC7565 further confirmed genomic homogeneity of the sheep isolates despite the presence of polymorphisms on the nucleotide level. Conclusions Comparative sequence analysis employed here provided a better understanding of the host association, evolution of members of the M. avium complex and could help in deciphering the phenotypic differences observed among sheep and cattle strains of MAP. A similar approach based on whole-genome sequencing combined with optical mapping could be employed to examine closely related pathogens. We propose an evolutionary scenario for M. avium complex strains based on these genome sequences.

  10. Draft genome sequence of an elite Dura palm and whole-genome patterns of DNA variation in oil palm.

    Science.gov (United States)

    Jin, Jingjing; Lee, May; Bai, Bin; Sun, Yanwei; Qu, Jing; Rahmadsyah; Alfiko, Yuzer; Lim, Chin Huat; Suwanto, Antonius; Sugiharti, Maria; Wong, Limsoon; Ye, Jian; Chua, Nam-Hai; Yue, Gen Hua

    2016-12-01

    Oil palm is the world's leading source of vegetable oil and fat. Dura, Pisifera and Tenera are three forms of oil palm. The genome sequence of Pisifera is available whereas the Dura form has not been sequenced yet. We sequenced the genome of one elite Dura palm, and re-sequenced 17 palm genomes. The assemble genome sequence of the elite Dura tree contained 10,971 scaffolds and was 1.701 Gb in length, covering 94.49% of the oil palm genome. 36,105 genes were predicted. Re-sequencing of 17 additional palm trees identified 18.1 million SNPs. We found high genetic variation among palms from different geographical regions, but lower variation among Southeast Asian Dura and Pisifera palms. We mapped 10,000 SNPs on the linkage map of oil palm. In addition, high linkage disequilibrium (LD) was detected in the oil palms used in breeding populations of Southeast Asia, suggesting that LD mapping is likely to be practical in this important oil crop. Our data provide a valuable resource for accelerating genetic improvement and studying the mechanism underlying phenotypic variations of important oil palm traits. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  11. Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology.

    Science.gov (United States)

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y

    2015-10-22

    Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.

  12. Spectral entropy criteria for structural segmentation in genomic DNA sequences

    International Nuclear Information System (INIS)

    Chechetkin, V.R.; Lobzin, V.V.

    2004-01-01

    The spectral entropy is calculated with Fourier structure factors and characterizes the level of structural ordering in a sequence of symbols. It may efficiently be applied to the assessment and reconstruction of the modular structure in genomic DNA sequences. We present the relevant spectral entropy criteria for the local and non-local structural segmentation in DNA sequences. The results are illustrated with the model examples and analysis of intervening exon-intron segments in the protein-coding regions

  13. Rapid and Accurate Sequencing of Enterovirus Genomes Using MinION Nanopore Sequencer.

    Science.gov (United States)

    Wang, Ji; Ke, Yue Hua; Zhang, Yong; Huang, Ke Qiang; Wang, Lei; Shen, Xin Xin; Dong, Xiao Ping; Xu, Wen Bo; Ma, Xue Jun

    2017-10-01

    Knowledge of an enterovirus genome sequence is very important in epidemiological investigation to identify transmission patterns and ascertain the extent of an outbreak. The MinION sequencer is increasingly used to sequence various viral pathogens in many clinical situations because of its long reads, portability, real-time accessibility of sequenced data, and very low initial costs. However, information is lacking on MinION sequencing of enterovirus genomes. In this proof-of-concept study using Enterovirus 71 (EV71) and Coxsackievirus A16 (CA16) strains as examples, we established an amplicon-based whole genome sequencing method using MinION. We explored the accuracy, minimum sequencing time, discrimination and high-throughput sequencing ability of MinION, and compared its performance with Sanger sequencing. Within the first minute (min) of sequencing, the accuracy of MinION was 98.5% for the single EV71 strain and 94.12%-97.33% for 10 genetically-related CA16 strains. In as little as 14 min, 99% identity was reached for the single EV71 strain, and in 17 min (on average), 99% identity was achieved for 10 CA16 strains in a single run. MinION is suitable for whole genome sequencing of enteroviruses with sufficient accuracy and fine discrimination and has the potential as a fast, reliable and convenient method for routine use. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  14. Enhanced Dynamic Algorithm of Genome Sequence Alignments

    OpenAIRE

    Arabi E. keshk

    2014-01-01

    The merging of biology and computer science has created a new field called computational biology that explore the capacities of computers to gain knowledge from biological data, bioinformatics. Computational biology is rooted in life sciences as well as computers, information sciences, and technologies. The main problem in computational biology is sequence alignment that is a way of arranging the sequences of DNA, RNA or protein to identify the region of similarity and relationship between se...

  15. Development of Mycoplasma synoviae (MS) core genome multilocus sequence typing (cgMLST) scheme.

    Science.gov (United States)

    Ghanem, Mostafa; El-Gazzar, Mohamed

    2018-05-01

    Mycoplasma synoviae (MS) is a poultry pathogen with reported increased prevalence and virulence in recent years. MS strain identification is essential for prevention, control efforts and epidemiological outbreak investigations. Multiple multilocus based sequence typing schemes have been developed for MS, yet the resolution of these schemes could be limited for outbreak investigation. The cost of whole genome sequencing became close to that of sequencing the seven MLST targets; however, there is no standardized method for typing MS strains based on whole genome sequences. In this paper, we propose a core genome multilocus sequence typing (cgMLST) scheme as a standardized and reproducible method for typing MS based whole genome sequences. A diverse set of 25 MS whole genome sequences were used to identify 302 core genome genes as cgMLST targets (35.5% of MS genome) and 44 whole genome sequences of MS isolates from six countries in four continents were used for typing applying this scheme. cgMLST based phylogenetic trees displayed a high degree of agreement with core genome SNP based analysis and available epidemiological information. cgMLST allowed evaluation of two conventional MLST schemes of MS. The high discriminatory power of cgMLST allowed differentiation between samples of the same conventional MLST type. cgMLST represents a standardized, accurate, highly discriminatory, and reproducible method for differentiation between MS isolates. Like conventional MLST, it provides stable and expandable nomenclature, allowing for comparing and sharing the typing results between different laboratories worldwide. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Genome Sequence of the Freshwater Yangtze Finless Porpoise.

    Science.gov (United States)

    Yuan, Yuan; Zhang, Peijun; Wang, Kun; Liu, Mingzhong; Li, Jing; Zheng, Jingsong; Wang, Ding; Xu, Wenjie; Lin, Mingli; Dong, Lijun; Zhu, Chenglong; Qiu, Qiang; Li, Songhai

    2018-04-16

    The Yangtze finless porpoise ( Neophocaena asiaeorientalis ssp. asiaeorientalis ) is a subspecies of the narrow-ridged finless porpoise ( N. asiaeorientalis ). In total, 714.28 gigabases (Gb) of raw reads were generated by whole-genome sequencing of the Yangtze finless porpoise, using an Illumina HiSeq 2000 platform. After filtering the low-quality and duplicated reads, we assembled a draft genome of 2.22 Gb, with contig N50 and scaffold N50 values of 46.69 kilobases (kb) and 1.71 megabases (Mb), respectively. We identified 887.63 Mb of repetitive sequences and predicted 18,479 protein-coding genes in the assembled genome. The phylogenetic tree showed a relationship between the Yangtze finless porpoise and the Yangtze River dolphin, which diverged approximately 20.84 million years ago. In comparisons with the genomes of 10 other mammals, we detected 44 species-specific gene families, 164 expanded gene families, and 313 positively selected genes in the Yangtze finless porpoise genome. The assembled genome sequence and underlying sequence data are available at the National Center for Biotechnology Information under BioProject accession number PRJNA433603.

  17. Comparison of whole genome amplification techniques for human single cell exome sequencing.

    Science.gov (United States)

    Borgström, Erik; Paterlini, Marta; Mold, Jeff E; Frisen, Jonas; Lundeberg, Joakim

    2017-01-01

    Whole genome amplification (WGA) is currently a prerequisite for single cell whole genome or exome sequencing. Depending on the method used the rate of artifact formation, allelic dropout and sequence coverage over the genome may differ significantly. The largest difference between the evaluated protocols was observed when analyzing the target coverage and read depth distribution. These differences also had impact on the downstream variant calling. Conclusively, the products from the AMPLI1 and MALBAC kits were shown to be most similar to the bulk samples and are therefore recommended for WGA of single cells. In this study four commercial kits for WGA (AMPLI1, MALBAC, Repli-G and PicoPlex) were used to amplify human single cells. The WGA products were exome sequenced together with non-amplified bulk samples from the same source. The resulting data was evaluated in terms of genomic coverage, allelic dropout and SNP calling.

  18. Genome-wide sequence variations among Mycobacterium avium subspecies paratuberculosis.

    Directory of Open Access Journals (Sweden)

    Chung-Yi eHsu

    2011-12-01

    Full Text Available Mycobacterium avium subspecies paratuberculosis (M. ap, the causative agent of Johne’s disease (JD, infects many farmed ruminants, wildlife animals and humans. To better understand the molecular pathogenesis of these infections, we analyzed the whole genome sequences of several M. ap and M. avium subspecies avium (M. avium strains isolated from various hosts and environments. Using Next-generation sequencing technology, all 6 M. ap isolates showed a high percentage of homology (98% to the reference genome sequence of M. ap K-10 isolated from cattle. However, 2 M. avium isolates (DT 78 and Env 77 showed significant sequence diversity from the reference strain M. avium 104. The genomes of M. avium isolates DT 78 and Env 77 exhibited only 87% and 40% homology, respectively, to the M. avium 104 reference genome. Within the M. ap isolates, genomic rearrangements (insertions/deletions, Indels were not detected, and only unique single nucleotide polymorphisms (SNPs were observed among the 6 M. ap strains. While most of the SNPs (~100 in M. ap genomes were non-synonymous, a total of ~ 6000 SNPs were detected among M. avium genomes, most of them were synonymous suggesting a differential selective pressure between M. ap and M. avium isolates. In addition, SNPs-based phylo-genomic analysis showed that isolates from goat and Oryx are closely related to the cattle (K-10 strain while the human isolate (M. ap 4B is closely related to the environmental strains, indicating environmental source to human infections. Overall, SNPs were the most common variations among M. ap isolates while SNPs in addition to Indels were prevalent among M. avium isolates. Genomic variations will be useful in designing host-specific markers for the analysis of mycobacterial evolution and for developing novel diagnostics directed against Johne’s disease in animals.

  19. The diploid genome sequence of an individual human.

    Directory of Open Access Journals (Sweden)

    Samuel Levy

    2007-09-01

    Full Text Available Presented here is a genome sequence of an individual human. It was produced from approximately 32 million random DNA fragments, sequenced by Sanger dideoxy technology and assembled into 4,528 scaffolds, comprising 2,810 million bases (Mb of contiguous sequence with approximately 7.5-fold coverage for any given region. We developed a modified version of the Celera assembler to facilitate the identification and comparison of alternate alleles within this individual diploid genome. Comparison of this genome and the National Center for Biotechnology Information human reference assembly revealed more than 4.1 million DNA variants, encompassing 12.3 Mb. These variants (of which 1,288,319 were novel included 3,213,401 single nucleotide polymorphisms (SNPs, 53,823 block substitutions (2-206 bp, 292,102 heterozygous insertion/deletion events (indels(1-571 bp, 559,473 homozygous indels (1-82,711 bp, 90 inversions, as well as numerous segmental duplications and copy number variation regions. Non-SNP DNA variation accounts for 22% of all events identified in the donor, however they involve 74% of all variant bases. This suggests an important role for non-SNP genetic alterations in defining the diploid genome structure. Moreover, 44% of genes were heterozygous for one or more variants. Using a novel haplotype assembly strategy, we were able to span 1.5 Gb of genome sequence in segments >200 kb, providing further precision to the diploid nature of the genome. These data depict a definitive molecular portrait of a diploid human genome that provides a starting point for future genome comparisons and enables an era of individualized genomic information.

  20. Deciphering the distance to antibiotic resistance for the pneumococcus using genome sequencing data

    NARCIS (Netherlands)

    Mobegi, Fredrick M; Cremers, Amelieke J H; de Jonge, Marien I; Bentley, Stephen D; van Hijum, Sacha A F T; Zomer, Aldert|info:eu-repo/dai/nl/304642754

    2017-01-01

    Advances in genome sequencing technologies and genome-wide association studies (GWAS) have provided unprecedented insights into the molecular basis of microbial phenotypes and enabled the identification of the underlying genetic variants in real populations. However, utilization of genome sequencing

  1. Draft genome sequences of two virulent serotypes of avian Pasteurella multocida

    Science.gov (United States)

    Here we report the draft genome sequences of two virulent avian strains of Pasteurella multocida. Comparative analyses of these genomes were done with the published genome sequence of avirulent Pasteurella multocida strain Pm70....

  2. Draft Genome Sequences of Two Virulent Serotypes of Avian Pasteurella multocida

    OpenAIRE

    Abrahante, Juan E.; Johnson, Timothy J.; Hunter, Samuel S.; Maheswaran, Samuel K.; Hauglund, Melissa J.; Bayles, Darrell O.; Tatum, Fred M.; Briggs, Robert E.

    2013-01-01

    Here we report the draft genome sequences of two virulent avian strains of Pasteurella multocida. Comparative analyses of these genomes were done with the published genome sequence of avirulent P.?multocida strain Pm70.

  3. Draft Genome Sequences of Two Virulent Serotypes of Avian Pasteurella multocida

    Science.gov (United States)

    Abrahante, Juan E.; Johnson, Timothy J.; Hunter, Samuel S.; Maheswaran, Samuel K.; Hauglund, Melissa J.; Bayles, Darrell O.; Tatum, Fred M.

    2013-01-01

    Here we report the draft genome sequences of two virulent avian strains of Pasteurella multocida. Comparative analyses of these genomes were done with the published genome sequence of avirulent P. multocida strain Pm70. PMID:23405337

  4. The Complete Sequence of a Human Parainfluenzavirus 4 Genome

    Science.gov (United States)

    Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond

    2009-01-01

    Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536

  5. The Complete Sequence of a Human Parainfluenzavirus 4 Genome

    Directory of Open Access Journals (Sweden)

    Carmen Yea

    2009-06-01

    Full Text Available Although the human parainfluenza virus 4 (HPIV4 has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada. The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97% with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized.

  6. Mitochondrial genome sequencing helps show the evolutionary mechanism of mitochondrial genome formation in Brassica

    Science.gov (United States)

    2011-01-01

    Background Angiosperm mitochondrial genomes are more complex than those of other organisms. Analyses of the mitochondrial genome sequences of at least 11 angiosperm species have showed several common properties; these cannot easily explain, however, how the diverse mitotypes evolved within each genus or species. We analyzed the evolutionary relationships of Brassica mitotypes by sequencing. Results We sequenced the mitotypes of cam (Brassica rapa), ole (B. oleracea), jun (B. juncea), and car (B. carinata) and analyzed them together with two previously sequenced mitotypes of B. napus (pol and nap). The sizes of whole single circular genomes of cam, jun, ole, and car are 219,747 bp, 219,766 bp, 360,271 bp, and 232,241 bp, respectively. The mitochondrial genome of ole is largest as a resulting of the duplication of a 141.8 kb segment. The jun mitotype is the result of an inherited cam mitotype, and pol is also derived from the cam mitotype with evolutionary modifications. Genes with known functions are conserved in all mitotypes, but clear variation in open reading frames (ORFs) with unknown functions among the six mitotypes was observed. Sequence relationship analysis showed that there has been genome compaction and inheritance in the course of Brassica mitotype evolution. Conclusions We have sequenced four Brassica mitotypes, compared six Brassica mitotypes and suggested a mechanism for mitochondrial genome formation in Brassica, including evolutionary events such as inheritance, duplication, rearrangement, genome compaction, and mutation. PMID:21988783

  7. SeqEntropy: genome-wide assessment of repeats for short read sequencing.

    Directory of Open Access Journals (Sweden)

    Hsueh-Ting Chu

    Full Text Available BACKGROUND: Recent studies on genome assembly from short-read sequencing data reported the limitation of this technology to reconstruct the entire genome even at very high depth coverage. We investigated the limitation from the perspective of information theory to evaluate the effect of repeats on short-read genome assembly using idealized (error-free reads at different lengths. METHODOLOGY/PRINCIPAL FINDINGS: We define a metric H(k to be the entropy of sequencing reads at a read length k and use the relative loss of entropy ΔH(k to measure the impact of repeats for the reconstruction of whole-genome from sequences of length k. In our experiments, we found that entropy loss correlates well with de-novo assembly coverage of a genome, and a score of ΔH(k>1% indicates a severe loss in genome reconstruction fidelity. The minimal read lengths to achieve ΔH(k<1% are different for various organisms and are independent of the genome size. For example, in order to meet the threshold of ΔH(k<1%, a read length of 60 bp is needed for the sequencing of human genome (3.2 10(9 bp and 320 bp for the sequencing of fruit fly (1.8×10(8 bp. We also calculated the ΔH(k scores for 2725 prokaryotic chromosomes and plasmids at several read lengths. Our results indicate that the levels of repeats in different genomes are diverse and the entropy of sequencing reads provides a measurement for the repeat structures. CONCLUSIONS/SIGNIFICANCE: The proposed entropy-based measurement, which can be calculated in seconds to minutes in most cases, provides a rapid quantitative evaluation on the limitation of idealized short-read genome sequencing. Moreover, the calculation can be parallelized to scale up to large euakryotic genomes. This approach may be useful to tune the sequencing parameters to achieve better genome assemblies when a closely related genome is already available.

  8. Complete genome sequence of Nakamurella multipartita type strain (Y-104).

    Science.gov (United States)

    Tice, Hope; Mayilraj, Shanmugam; Sims, David; Lapidus, Alla; Nolan, Matt; Lucas, Susan; Glavina Del Rio, Tijana; Copeland, Alex; Cheng, Jan-Fang; Meincke, Linda; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavromatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Detter, John C; Brettin, Thomas; Rohde, Manfred; Göker, Markus; Bristow, Jim; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Chen, Feng

    2010-03-30

    Nakamurella multipartita (Yoshimi et al. 1996) Tao et al. 2004 is the type species of the monospecific genus Nakamurella in the actinobacterial suborder Frankineae. The nonmotile, coccus-shaped strain was isolated from activated sludge acclimated with sugar-containing synthetic wastewater, and is capable of accumulating large amounts of polysaccharides in its cells. Here we describe the features of the organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of a member of the family Nakamurellaceae. The 6,060,298 bp long single replicon genome with its 5415 protein-coding and 56 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  9. Whole genome sequencing in clinical and public health microbiology.

    Science.gov (United States)

    Kwong, J C; McCallum, N; Sintchenko, V; Howden, B P

    2015-04-01

    Genomics and whole genome sequencing (WGS) have the capacity to greatly enhance knowledge and understanding of infectious diseases and clinical microbiology.The growth and availability of bench-top WGS analysers has facilitated the feasibility of genomics in clinical and public health microbiology.Given current resource and infrastructure limitations, WGS is most applicable to use in public health laboratories, reference laboratories, and hospital infection control-affiliated laboratories.As WGS represents the pinnacle for strain characterisation and epidemiological analyses, it is likely to replace traditional typing methods, resistance gene detection and other sequence-based investigations (e.g., 16S rDNA PCR) in the near future.Although genomic technologies are rapidly evolving, widespread implementation in clinical and public health microbiology laboratories is limited by the need for effective semi-automated pipelines, standardised quality control and data interpretation, bioinformatics expertise, and infrastructure.

  10. Complete genome sequence of Truepera radiovictrix type strain (RQ-24).

    Science.gov (United States)

    Ivanova, Natalia; Rohde, Christine; Munk, Christine; Nolan, Matt; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Deshpande, Shweta; Cheng, Jan-Fang; Tapia, Roxane; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Brambilla, Evelyne; Rohde, Manfred; Göker, Markus; Tindall, Brian J; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Lapidus, Alla

    2011-02-22

    Truepera radiovictrix Albuquerque et al. 2005 is the type species of the genus Truepera within the phylum "Deinococcus/Thermus". T. radiovictrix is of special interest not only because of its isolated phylogenetic location in the order Deinococcales, but also because of its ability to grow under multiple extreme conditions in alkaline, moderately saline, and high temperature habitats. Of particular interest is the fact that, T. radiovictrix is also remarkably resistant to ionizing radiation, a feature it shares with members of the genus Deinococcus. This is the first completed genome sequence of a member of the family Trueperaceae and the fourth type strain genome sequence from a member of the order Deinococcales. The 3,260,398 bp long genome with its 2,994 protein-coding and 52 RNA genes consists of one circular chromosome and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  11. Draft genome sequence of the rubber tree Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Rahman Ahmad Yamin Abdul

    2013-02-01

    Full Text Available Abstract Background Hevea brasiliensis, a member of the Euphorbiaceae family, is the major commercial source of natural rubber (NR. NR is a latex polymer with high elasticity, flexibility, and resilience that has played a critical role in the world economy since 1876. Results Here, we report the draft genome sequence of H. brasiliensis. The assembly spans ~1.1 Gb of the estimated 2.15 Gb haploid genome. Overall, ~78% of the genome was identified as repetitive DNA. Gene prediction shows 68,955 gene models, of which 12.7% are unique to Hevea. Most of the key genes associated with rubber biosynthesis, rubberwood formation, disease resistance, and allergenicity have been identified. Conclusions The knowledge gained from this genome sequence will aid in the future development of high-yielding clones to keep up with the ever increasing need for natural rubber.

  12. Understanding Cancer Genome and Its Evolution by Next Generation Sequencing

    DEFF Research Database (Denmark)

    Hou, Yong

    Cancer will cause 13 million deaths by the year of 2030, ranking the second leading cause of death worldwide. Previous studies indicate that most of the cancers originate from cells that acquired somatic mutations and evolved as Darwin Theory. Ten biological insights of cancer have been summarized...... recently. Cutting-age technologies like next generation sequencing (NGS) enable exploring cancer genome and evolution much more efficiently. However, integrated cancer genome sequencing studies showed great inter-/intra-tumoral heterogeneity (ITH) and complex evolution patterns beyond the cancer biological...... knowledge we previously know. There is very limited knowledge of East Asia lung cancer genome except enrichment of EGFR mutations and lack of KRAS mutations. We carried out integrated genomic, transcriptomic and methylomic analysis of 335 primary Chinese lung adenocarcinomas (LUAD) and 35 corresponding...

  13. Draft genome sequences of three Escherichia coli strains with different In Vivo pathogenicities in an avian (Ascending) infection model of the oviduct

    DEFF Research Database (Denmark)

    Olsen, Rikke Heidemann; Thøfner, Ida; Pors, Susanne Elisabeth

    2015-01-01

    Here, we present three draft genome sequences of Escherichia coli strains that experimentally were proven to possess low (strain D2-2), intermediate (Chronic_salp), or high virulence (Cp6salp3) in an avian (ascending) infection model of the oviduct.......Here, we present three draft genome sequences of Escherichia coli strains that experimentally were proven to possess low (strain D2-2), intermediate (Chronic_salp), or high virulence (Cp6salp3) in an avian (ascending) infection model of the oviduct....

  14. High-throughput sequencing of three Lemnoideae (duckweeds chloroplast genomes from total DNA.

    Directory of Open Access Journals (Sweden)

    Wenqin Wang

    Full Text Available BACKGROUND: Chloroplast genomes provide a wealth of information for evolutionary and population genetic studies. Chloroplasts play a particularly important role in the adaption for aquatic plants because they float on water and their major surface is exposed continuously to sunlight. The subfamily of Lemnoideae represents such a collection of aquatic species that because of photosynthesis represents one of the fastest growing plant species on earth. METHODS: We sequenced the chloroplast genomes from three different genera of Lemnoideae, Spirodela polyrhiza, Wolffiella lingulata and Wolffia australiana by high-throughput DNA sequencing of genomic DNA using the SOLiD platform. Unfractionated total DNA contains high copies of plastid DNA so that sequences from the nucleus and mitochondria can easily be filtered computationally. Remaining sequence reads were assembled into contiguous sequences (contigs using SOLiD software tools. Contigs were mapped to a reference genome of Lemna minor and gaps, selected by PCR, were sequenced on the ABI3730xl platform. CONCLUSIONS: This combinatorial approach yielded whole genomic contiguous sequences in a cost-effective manner. Over 1,000-time coverage of chloroplast from total DNA were reached by the SOLiD platform in a single spot on a quadrant slide without purification. Comparative analysis indicated that the chloroplast genome was conserved in gene number and organization with respect to the reference genome of L. minor. However, higher nucleotide substitution, abundant deletions and insertions occurred in non-coding regions of these genomes, indicating a greater genomic dynamics than expected from the comparison of other related species in the Pooideae. Noticeably, there was no transition bias over transversion in Lemnoideae. The data should have immediate applications in evolutionary biology and plant taxonomy with increased resolution and statistical power.

  15. Comparative analysis of complete chloroplast genome sequence and inversion variation in Lasthenia burkei (Madieae, Asteraceae).

    Science.gov (United States)

    Walker, Joseph F; Zanis, Michael J; Emery, Nancy C

    2014-04-01

    Complete chloroplast genome studies can help resolve relationships among large, complex plant lineages such as Asteraceae. We present the first whole plastome from the Madieae tribe and compare its sequence variation to other chloroplast genomes in Asteraceae. We used high throughput sequencing to obtain the Lasthenia burkei chloroplast genome. We compared sequence structure and rates of molecular evolution in the small single copy (SSC), large single copy (LSC), and inverted repeat (IR) regions to those for eight Asteraceae accessions and one Solanaceae accession. The chloroplast sequence of L. burkei is 150 746 bp and contains 81 unique protein coding genes and 4 coding ribosomal RNA sequences. We identified three major inversions in the L. burkei chloroplast, all of which have been found in other Asteraceae lineages, and a previously unreported inversion in Lactuca sativa. Regions flanking inversions contained tRNA sequences, but did not have particularly high G + C content. Substitution rates varied among the SSC, LSC, and IR regions, and rates of evolution within each region varied among species. Some observed differences in rates of molecular evolution may be explained by the relative proportion of coding to noncoding sequence within regions. Rates of molecular evolution vary substantially within and among chloroplast genomes, and major inversion events may be promoted by the presence of tRNAs. Collectively, these results provide insight into different mechanisms that may promote intramolecular recombination and the inversion of large genomic regions in the plastome.

  16. Full-length genome sequences of porcine epidemic diarrhoea virus strain CV777; Use of NGS to analyse genomic and sub-genomic RNAs

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Boniotti, Maria Beatrice; Papetti, Alice

    2018-01-01

    Porcine epidemic diarrhoea virus, strain CV777, was initially characterized in 1978 as the causative agent of a disease first identified in the UK in 1971. This coronavirus has been widely distributed among laboratories and has been passaged both within pigs and in cell culture. To determine...... the variability between different stocks of the PEDV strain CV777, sequencing of the full-length genome (ca. 28kb) has been performed in 6 different laboratories, using different protocols. Not surprisingly, each of the different full genome sequences were distinct from each other and from the reference sequence...... the analysis of sub-genomic mRNAs from infected cells. It is clearly important to know the features of the specific sample of CV777 being used for experimental studies....

  17. Genome Sequences of Marine Shrimp Exopalaemon carinicauda Holthuis Provide Insights into Genome Size Evolution of Caridea.

    Science.gov (United States)

    Yuan, Jianbo; Gao, Yi; Zhang, Xiaojun; Wei, Jiankai; Liu, Chengzhang; Li, Fuhua; Xiang, Jianhai

    2017-07-05

    Crustacea, particularly Decapoda, contains many economically important species, such as shrimps and crabs. Crustaceans exhibit enormous (nearly 500-fold) variability in genome size. However, limited genome resources are available for investigating these species. Exopalaemon carinicauda Holthuis, an economical caridean shrimp, is a potential ideal experimental animal for research on crustaceans. In this study, we performed low-coverage sequencing and de novo assembly of the E. carinicauda genome. The assembly covers more than 95% of coding regions. E. carinicauda possesses a large complex genome (5.73 Gb), with size twice higher than those of many decapod shrimps. As such, comparative genomic analyses were implied to investigate factors affecting genome size evolution of decapods. However, clues associated with genome duplication were not identified, and few horizontally transferred sequences were detected. Ultimately, the burst of transposable elements, especially retrotransposons, was determined as the major factor influencing genome expansion. A total of 2 Gb repeats were identified, and RTE-BovB, Jockey, Gypsy, and DIRS were the four major retrotransposons that significantly expanded. Both recent (Jockey and Gypsy) and ancestral (DIRS) originated retrotransposons responsible for the genome evolution. The E. carinicauda genome also exhibited potential for the genomic and experimental research of shrimps.

  18. Complete Genome Sequence of Pseudomonas aeruginosa Phage AAT-1.

    Science.gov (United States)

    Andrade-Domínguez, Andrés; Kolter, Roberto

    2016-08-25

    Aspects of the interaction between phages and animals are of interest and importance for medical applications. Here, we report the genome sequence of the lytic Pseudomonas phage AAT-1, isolated from mammalian serum. AAT-1 is a double-stranded DNA phage, with a genome of 57,599 bp, containing 76 predicted open reading frames. Copyright © 2016 Andrade-Domínguez and Kolter.

  19. Draft Genome Sequence of Escherichia coli K-12 (ATCC 10798).

    Science.gov (United States)

    Dimitrova, Daniela; Engelbrecht, Kathleen C; Putonti, Catherine; Koenig, David W; Wolfe, Alan J

    2017-07-06

    Here, we present the draft genome sequence of Escherichia coli ATCC 10798. E. coli ATCC 10798 is a K-12 strain, one of the most well-studied model microorganisms. The size of the genome was 4,685,496 bp, with a G+C content of 50.70%. This assembly consists of 62 contigs and the F plasmid. Copyright © 2017 Dimitrova et al.

  20. GABenchToB: a genome assembly benchmark tuned on bacteria and benchtop sequencers.

    Directory of Open Access Journals (Sweden)

    Sebastian Jünemann

    Full Text Available De novo genome assembly is the process of reconstructing a complete genomic sequence from countless small sequencing reads. Due to the complexity of this task, numerous genome assemblers have been developed to cope with different requirements and the different kinds of data provided by sequencers within the fast evolving field of next-generation sequencing technologies. In particular, the recently introduced generation of benchtop sequencers, like Illumina's MiSeq and Ion Torrent's Personal Genome Machine (PGM, popularized the easy, fast, and cheap sequencing of bacterial organisms to a broad range of academic and clinical institutions. With a strong pragmatic focus, here, we give a novel insight into the line of assembly evaluation surveys as we benchmark popular de novo genome assemblers based on bacterial data generated by benchtop sequencers. Therefore, single-library assemblies were generated, assembled, and compared to each other by metrics describing assembly contiguity and accuracy, and also by practice-oriented criteria as for instance computing time. In addition, we extensively analyzed the effect of the depth of coverage on the genome assemblies within reasonable ranges and the k-mer optimization problem of de Bruijn Graph assemblers. Our results show that, although both MiSeq and PGM allow for good genome assemblies, they require different approaches. They not only pair with different assembler types, but also affect assemblies differently regarding the depth of coverage where oversampling can become problematic. Assemblies vary greatly with respect to contiguity and accuracy but also by the requirement on the computing power. Consequently, no assembler can be rated best for all preconditions. Instead, the given kind of data, the demands on assembly quality, and the available computing infrastructure determines which assembler suits best. The data sets, scripts and all additional information needed to replicate our results are freely

  1. Whole genome sequencing: an efficient approach to ensuring food safety

    Science.gov (United States)

    Lakicevic, B.; Nastasijevic, I.; Dimitrijevic, M.

    2017-09-01

    Whole genome sequencing is an effective, powerful tool that can be applied to a wide range of public health and food safety applications. A major difference between WGS and the traditional typing techniques is that WGS allows all genes to be included in the analysis, instead of a well-defined subset of genes or variable intergenic regions. Also, the use of WGS can facilitate the understanding of contamination/colonization routes of foodborne pathogens within the food production environment, and can also afford efficient tracking of pathogens’ entry routes and distribution from farm-to-consumer. Tracking foodborne pathogens in the food processing-distribution-retail-consumer continuum is of the utmost importance for facilitation of outbreak investigations and rapid action in controlling/preventing foodborne outbreaks. Therefore, WGS likely will replace most of the numerous workflows used in public health laboratories to characterize foodborne pathogens into one consolidated, efficient workflow.

  2. Predictive genomics: A cancer hallmark network framework for predicting tumor clinical phenotypes using genome sequencing data

    OpenAIRE

    Wang, Edwin; Zaman, Naif; Mcgee, Shauna; Milanese, Jean-Sébastien; Masoudi-Nejad, Ali; O'Connor, Maureen

    2014-01-01

    We discuss a cancer hallmark network framework for modelling genome-sequencing data to predict cancer clonal evolution and associated clinical phenotypes. Strategies of using this framework in conjunction with genome sequencing data in an attempt to predict personalized drug targets, drug resistance, and metastasis for a cancer patient, as well as cancer risks for a healthy individual are discussed. Accurate prediction of cancer clonal evolution and clinical phenotypes will have substantial i...

  3. Order and correlations in genomic DNA sequences. The spectral approach

    International Nuclear Information System (INIS)

    Lobzin, Vasilii V; Chechetkin, Vladimir R

    2000-01-01

    The structural analysis of genomic DNA sequences is discussed in the framework of the spectral approach, which is sufficiently universal due to the reciprocal correspondence and mutual complementarity of Fourier transform length scales. The spectral characteristics of random sequences of the same nucleotide composition possess the property of self-averaging for relatively short sequences of length M≥100-300. Comparison with the characteristics of random sequences determines the statistical significance of the structural features observed. Apart from traditional applications to the search for hidden periodicities, spectral methods are also efficient in studying mutual correlations in DNA sequences. By combining spectra for structure factors and correlation functions, not only integral correlations can be estimated but also their origin identified. Using the structural spectral entropy approach, the regularity of a sequence can be quantitatively assessed. A brief introduction to the problem is also presented and other major methods of DNA sequence analysis described. (reviews of topical problems)

  4. Establishing a framework for comparative analysis of genome sequences

    Energy Technology Data Exchange (ETDEWEB)

    Bansal, A.K.

    1995-06-01

    This paper describes a framework and a high-level language toolkit for comparative analysis of genome sequence alignment The framework integrates the information derived from multiple sequence alignment and phylogenetic tree (hypothetical tree of evolution) to derive new properties about sequences. Multiple sequence alignments are treated as an abstract data type. Abstract operations have been described to manipulate a multiple sequence alignment and to derive mutation related information from a phylogenetic tree by superimposing parsimonious analysis. The framework has been applied on protein alignments to derive constrained columns (in a multiple sequence alignment) that exhibit evolutionary pressure to preserve a common property in a column despite mutation. A Prolog toolkit based on the framework has been implemented and demonstrated on alignments containing 3000 sequences and 3904 columns.

  5. Preliminary Genomic Characterization of Ten Hardwood Tree Species from Multiplexed Low Coverage Whole Genome Sequencing.

    Directory of Open Access Journals (Sweden)

    Margaret Staton

    Full Text Available Forest health issues are on the rise in the United States, resulting from introduction of alien pests and diseases, coupled with abiotic stresses related to climate change. Increasingly, forest scientists are finding genetic/genomic resources valuable in addressing forest health issues. For a set of ten ecologically and economically important native hardwood tree species representing a broad phylogenetic spectrum, we used low coverage whole genome sequencing from multiplex Illumina paired ends to economically profile their genomic content. For six species, the genome content was further analyzed by flow cytometry in order to determine the nuclear genome size. Sequencing yielded a depth of 0.8X to 7.5X, from which in silico analysis yielded preliminary estimates of gene and repetitive sequence content in the genome for each species. Thousands of genomic SSRs were identified, with a clear predisposition toward dinucleotide repeats and AT-rich repeat motifs. Flanking primers were designed for SSR loci for all ten species, ranging from 891 loci in sugar maple to 18,167 in redbay. In summary, we have demonstrated that useful preliminary genome information including repeat content, gene content and useful SSR markers can be obtained at low cost and time input from a single lane of Illumina multiplex sequence.

  6. The minimum information about a genome sequence (MIGS) specification

    Science.gov (United States)

    Field, Dawn; Garrity, George; Gray, Tanya; Morrison, Norman; Selengut, Jeremy; Sterk, Peter; Tatusova, Tatiana; Thomson, Nicholas; Allen, Michael J; Angiuoli, Samuel V; Ashburner, Michael; Axelrod, Nelson; Baldauf, Sandra; Ballard, Stuart; Boore, Jeffrey; Cochrane, Guy; Cole, James; Dawyndt, Peter; De Vos, Paul; dePamphilis, Claude; Edwards, Robert; Faruque, Nadeem; Feldman, Robert; Gilbert, Jack; Gilna, Paul; Glöckner, Frank Oliver; Goldstein, Philip; Guralnick, Robert; Haft, Dan; Hancock, David; Hermjakob, Henning; Hertz-Fowler, Christiane; Hugenholtz, Phil; Joint, Ian; Kagan, Leonid; Kane, Matthew; Kennedy, Jessie; Kowalchuk, George; Kottmann, Renzo; Kolker, Eugene; Kravitz, Saul; Kyrpides, Nikos; Leebens-Mack, Jim; Lewis, Suzanna E; Li, Kelvin; Lister, Allyson L; Lord, Phillip; Maltsev, Natalia; Markowitz, Victor; Martiny, Jennifer; Methe, Barbara; Mizrachi, Ilene; Moxon, Richard; Nelson, Karen; Parkhill, Julian; Proctor, Lita; White, Owen; Sansone, Susanna-Assunta; Spiers, Andrew; Stevens, Robert; Swift, Paul; Taylor, Chris; Tateno, Yoshio; Tett, Adrian; Turner, Sarah; Ussery, David; Vaughan, Bob; Ward, Naomi; Whetzel, Trish; Gil, Ingio San; Wilson, Gareth; Wipat, Anil

    2008-01-01

    With the quantity of genomic data increasing at an exponential rate, it is imperative that these data be captured electronically, in a standard format. Standardization activities must proceed within the auspices of open-access and international working bodies. To tackle the issues surrounding the development of better descriptions of genomic investigations, we have formed the Genomic Standards Consortium (GSC). Here, we introduce the minimum information about a genome sequence (MIGS) specification with the intent of promoting participation in its development and discussing the resources that will be required to develop improved mechanisms of metadata capture and exchange. As part of its wider goals, the GSC also supports improving the ‘transparency’ of the information contained in existing genomic databases. PMID:18464787

  7. The minimum information about a genome sequence (MIGS) specification

    DEFF Research Database (Denmark)

    Field, D; Garrity, G; Gray, T

    2008-01-01

    With the quantity of genomic data increasing at an exponential rate, it is imperative that these data be captured electronically, in a standard format. Standardization activities must proceed within the auspices of open-access and international working bodies. To tackle the issues surrounding the...... that will be required to develop improved mechanisms of metadata capture and exchange. As part of its wider goals, the GSC also supports improving the 'transparency' of the information contained in existing genomic databases....... the development of better descriptions of genomic investigations, we have formed the Genomic Standards Consortium (GSC). Here, we introduce the minimum information about a genome sequence (MIGS) specification with the intent of promoting participation in its development and discussing the resources...

  8. An integrated semiconductor device enabling non-optical genome sequencing.

    Science.gov (United States)

    Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James

    2011-07-20

    The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.

  9. Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

    Science.gov (United States)

    Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

    2012-01-01

    Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

  10. The complete chloroplast genome sequence of Curcuma flaviflora (Curcuma).

    Science.gov (United States)

    Zhang, Yan; Deng, Jiabin; Li, Yangyi; Gao, Gang; Ding, Chunbang; Zhang, Li; Zhou, Yonghong; Yang, Ruiwu

    2016-09-01

    The complete chloroplast (cp) genome of Curcuma flaviflora, a medicinal plant in Southeast Asia, was sequenced. The genome size was 160 478 bp in length, with 36.3% GC content. A pair of inverted repeats (IRs) of 26 946 bp were separated by a large single copy (LSC) of 88 008 bp and a small single copy (SSC) of 18 578 bp, respectively. The cp genome contained 132 annotated genes, including 79 protein coding genes, 30 tRNA genes, and four rRNA genes. And 19 of these genes were duplicated in inverted repeat regions.

  11. Complete Genome Sequence of Escherichia coli Strain WG5

    DEFF Research Database (Denmark)

    Imamovic, Lejla; Misiakou, Maria-Anna; van der Helm, Eric

    2018-01-01

    Escherichia coli strain WG5 is a widely used host for phage detection, including somatic coliphages employed as standard ISO method 10705-1 (2000). Here, we present the complete genome sequence of a commercial E. coli WG5 strain.......Escherichia coli strain WG5 is a widely used host for phage detection, including somatic coliphages employed as standard ISO method 10705-1 (2000). Here, we present the complete genome sequence of a commercial E. coli WG5 strain....

  12. Sequence modelling and an extensible data model for genomic database

    Energy Technology Data Exchange (ETDEWEB)

    Li, Peter Wei-Der [California Univ., San Francisco, CA (United States); Univ. of California, Berkeley, CA (United States)

    1992-01-01

    The Human Genome Project (HGP) plans to sequence the human genome by the beginning of the next century. It will generate DNA sequences of more than 10 billion bases and complex marker sequences (maps) of more than 100 million markers. All of these information will be stored in database management systems (DBMSs). However, existing data models do not have the abstraction mechanism for modelling sequences and existing DBMS`s do not have operations for complex sequences. This work addresses the problem of sequence modelling in the context of the HGP and the more general problem of an extensible object data model that can incorporate the sequence model as well as existing and future data constructs and operators. First, we proposed a general sequence model that is application and implementation independent. This model is used to capture the sequence information found in the HGP at the conceptual level. In addition, abstract and biological sequence operators are defined for manipulating the modelled sequences. Second, we combined many features of semantic and object oriented data models into an extensible framework, which we called the ``Extensible Object Model``, to address the need of a modelling framework for incorporating the sequence data model with other types of data constructs and operators. This framework is based on the conceptual separation between constructors and constraints. We then used this modelling framework to integrate the constructs for the conceptual sequence model. The Extensible Object Model is also defined with a graphical representation, which is useful as a tool for database designers. Finally, we defined a query language to support this model and implement the query processor to demonstrate the feasibility of the extensible framework and the usefulness of the conceptual sequence model.

  13. Sequence modelling and an extensible data model for genomic database

    Energy Technology Data Exchange (ETDEWEB)

    Li, Peter Wei-Der (California Univ., San Francisco, CA (United States) Lawrence Berkeley Lab., CA (United States))

    1992-01-01

    The Human Genome Project (HGP) plans to sequence the human genome by the beginning of the next century. It will generate DNA sequences of more than 10 billion bases and complex marker sequences (maps) of more than 100 million markers. All of these information will be stored in database management systems (DBMSs). However, existing data models do not have the abstraction mechanism for modelling sequences and existing DBMS's do not have operations for complex sequences. This work addresses the problem of sequence modelling in the context of the HGP and the more general problem of an extensible object data model that can incorporate the sequence model as well as existing and future data constructs and operators. First, we proposed a general sequence model that is application and implementation independent. This model is used to capture the sequence information found in the HGP at the conceptual level. In addition, abstract and biological sequence operators are defined for manipulating the modelled sequences. Second, we combined many features of semantic and object oriented data models into an extensible framework, which we called the Extensible Object Model'', to address the need of a modelling framework for incorporating the sequence data model with other types of data constructs and operators. This framework is based on the conceptual separation between constructors and constraints. We then used this modelling framework to integrate the constructs for the conceptual sequence model. The Extensible Object Model is also defined with a graphical representation, which is useful as a tool for database designers. Finally, we defined a query language to support this model and implement the query processor to demonstrate the feasibility of the extensible framework and the usefulness of the conceptual sequence model.

  14. Characterization of Three Mycobacterium spp. with Potential Use in Bioremediation by Genome Sequencing and Comparative Genomics.

    Science.gov (United States)

    Das, Sarbashis; Pettersson, B M Fredrik; Behra, Phani Rama Krishna; Ramesh, Malavika; Dasgupta, Santanu; Bhattacharya, Alok; Kirsebom, Leif A

    2015-06-16

    We provide the genome sequences of the type strains of the polychlorophenol-degrading Mycobacterium chlorophenolicum (DSM43826), the degrader of chlorinated aliphatics Mycobacterium chubuense (DSM44219) and Mycobacterium obuense (DSM44075) that has been tested for use in cancer immunotherapy. The genome sizes of M. chlorophenolicum, M. chubuense, and M. obuense are 6.93, 5.95, and 5.58 Mb with GC-contents of 68.4%, 69.2%, and 67.9%, respectively. Comparative genomic analysis revealed that 3,254 genes are common and we predicted approximately 250 genes acquired through horizontal gene transfer from different sources including proteobacteria. The data also showed that the biodegrading Mycobacterium spp. NBB4, also referred to as M. chubuense NBB4, is distantly related to the M. chubuense type strain and should be considered as a separate species, we suggest it to be named Mycobacterium ethylenense NBB4. Among different categories we identified genes with potential roles in: biodegradation of aromatic compounds and copper homeostasis. These are the first nonpathogenic Mycobacterium spp. found harboring genes involved in copper homeostasis. These findings would therefore provide insight into the role of this group of Mycobacterium spp. in bioremediation as well as the evolution of copper homeostasis within the Mycobacterium genus. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Mapping and characterizing N6-methyladenine in eukaryotic genomes using single molecule real-time sequencing.

    Science.gov (United States)

    Zhu, Shijia; Beaulaurier, John; Deikus, Gintaras; Wu, Tao; Strahl, Maya; Hao, Ziyang; Luo, Guanzheng; Gregory, James A; Chess, Andrew; He, Chuan; Xiao, Andrew; Sebra, Robert; Schadt, Eric E; Fang, Gang

    2018-05-15

    N6-methyladenine (m6dA) has been discovered as a novel form of DNA methylation prevalent in eukaryotes, however, methods for high resolution mapping of m6dA events are still lacking. Single-molecule real-time (SMRT) sequencing has enabled the detection of m6dA events at single-nucleotide resolution in prokaryotic genomes, but its application to detecting m6dA in eukaryotic genomes has not been rigorously examined. Herein, we identified unique characteristics of eukaryotic m6dA methylomes that fundamentally differ from those of prokaryotes. Based on these differences, we describe the first approach for mapping m6dA events using SMRT sequencing specifically designed for the study of eukaryotic genomes, and provide appropriate strategies for designing experiments and carrying out sequencing in future studies. We apply the novel approach to study two eukaryotic genomes. For green algae, we construct the first complete genome-wide map of m6dA at single nucleotide and single molecule resolution. For human lymphoblastoid cells (hLCLs), joint analyses of SMRT sequencing and independent sequencing data suggest that putative m6dA events are enriched in the promoters of young, full length LINE-1 elements (L1s). These analyses demonstrate a general method for rigorous mapping and characterization of m6dA events in eukaryotic genomes. Published by Cold Spring Harbor Laboratory Press.

  16. The Douglas-Fir Genome Sequence Reveals Specialization of the Photosynthetic Apparatus in Pinaceae

    Directory of Open Access Journals (Sweden)

    David B. Neale

    2017-09-01

    Full Text Available A reference genome sequence for Pseudotsuga menziesii var. menziesii (Mirb. Franco (Coastal Douglas-fir is reported, thus providing a reference sequence for a third genus of the family Pinaceae. The contiguity and quality of the genome assembly far exceeds that of other conifer reference genome sequences (contig N50 = 44,136 bp and scaffold N50 = 340,704 bp. Incremental improvements in sequencing and assembly technologies are in part responsible for the higher quality reference genome, but it may also be due to a slightly lower exact repeat content in Douglas-fir vs. pine and spruce. Comparative genome annotation with angiosperm species reveals gene-family expansion and contraction in Douglas-fir and other conifers which may account for some of the major morphological and physiological differences between the two major plant groups. Notable differences in the size of the NDH-complex gene family and genes underlying the functional basis of shade tolerance/intolerance were observed. This reference genome sequence not only provides an important resource for Douglas-fir breeders and geneticists but also sheds additional light on the evolutionary processes that have led to the divergence of modern angiosperms from the more ancient gymnosperms.

  17. Organization and evolution of primate centromeric DNA from whole-genome shotgun sequence data.

    Directory of Open Access Journals (Sweden)

    Can Alkan

    2007-09-01

    Full Text Available The major DNA constituent of primate centromeres is alpha satellite DNA. As much as 2%-5% of sequence generated as part of primate genome sequencing projects consists of this material, which is fragmented or not assembled as part of published genome sequences due to its highly repetitive nature. Here, we develop computational methods to rapidly recover and categorize alpha-satellite sequences from previously uncharacterized whole-genome shotgun sequence data. We present an algorithm to computationally predict potential higher-order array structure based on paired-end sequence data and then experimentally validate its organization and distribution by experimental analyses. Using whole-genome shotgun data from the human, chimpanzee, and macaque genomes, we examine the phylogenetic relationship of these sequences and provide further support for a model for their evolution and mutation over the last 25 million years. Our results confirm fundamental differences in the dispersal and evolution of centromeric satellites in the Old World monkey and ape lineages of evolution.

  18. Organization and evolution of primate centromeric DNA from whole-genome shotgun sequence data.

    Science.gov (United States)

    Alkan, Can; Ventura, Mario; Archidiacono, Nicoletta; Rocchi, Mariano; Sahinalp, S Cenk; Eichler, Evan E

    2007-09-01

    The major DNA constituent of primate centromeres is alpha satellite DNA. As much as 2%-5% of sequence generated as part of primate genome sequencing projects consists of this material, which is fragmented or not assembled as part of published genome sequences due to its highly repetitive nature. Here, we develop computational methods to rapidly recover and categorize alpha-satellite sequences from previously uncharacterized whole-genome shotgun sequence data. We present an algorithm to computationally predict potential higher-order array structure based on paired-end sequence data and then experimentally validate its organization and distribution by experimental analyses. Using whole-genome shotgun data from the human, chimpanzee, and macaque genomes, we examine the phylogenetic relationship of these sequences and provide further support for a model for their evolution and mutation over the last 25 million years. Our results confirm fundamental differences in the dispersal and evolution of centromeric satellites in the Old World monkey and ape lineages of evolution.

  19. Correction for Measurement Error from Genotyping-by-Sequencing in Genomic Variance and Genomic Prediction Models

    DEFF Research Database (Denmark)

    Ashraf, Bilal; Janss, Luc; Jensen, Just

    sample). The GBSeq data can be used directly in genomic models in the form of individual SNP allele-frequency estimates (e.g., reference reads/total reads per polymorphic site per individual), but is subject to measurement error due to the low sequencing depth per individual. Due to technical reasons....... In the current work we show how the correction for measurement error in GBSeq can also be applied in whole genome genomic variance and genomic prediction models. Bayesian whole-genome random regression models are proposed to allow implementation of large-scale SNP-based models with a per-SNP correction...... for measurement error. We show correct retrieval of genomic explained variance, and improved genomic prediction when accounting for the measurement error in GBSeq data...

  20. Application of representational difference analysis to identify genomic differences between Bradyrhizobium elkanii and B. Japonicum species.

    Science.gov (United States)

    Soares, René Arderius; Passaglia, Luciane Maria Pereira

    2010-10-01

    Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.

  1. Whole-Genome Sequencing for National Surveillance of Shigella flexneri

    Directory of Open Access Journals (Sweden)

    Marie A. Chattaway

    2017-09-01

    Full Text Available National surveillance of Shigella flexneri ensures the rapid detection of outbreaks to facilitate public health investigation and intervention strategies. In this study, we used whole-genome sequencing (WGS to type S. flexneri in order to detect linked cases and support epidemiological investigations. We prospectively analyzed 330 isolates of S. flexneri received at the Gastrointestinal Bacteria Reference Unit at Public Health England between August 2015 and January 2016. Traditional phenotypic and WGS sub-typing methods were compared. PCR was carried out on isolates exhibiting phenotypic/genotypic discrepancies with respect to serotype. Phylogenetic relationships between isolates were analyzed by WGS using single nucleotide polymorphism (SNP typing to facilitate cluster detection. For 306/330 (93% isolates there was concordance between serotype derived from the genome and phenotypic serology. Discrepant results between the phenotypic and genotypic tests were attributed to novel O-antigen synthesis/modification gene combinations or indels identified in O-antigen synthesis/modification genes rendering them dysfunctional. SNP typing identified 36 clusters of two isolates or more. WGS provided microbiological evidence of epidemiologically linked clusters and detected novel O-antigen synthesis/modification gene combinations associated with two outbreaks. WGS provided reliable and robust data for monitoring trends in the incidence of different serotypes over time. SNP typing can be used to facilitate outbreak investigations in real-time thereby informing surveillance strategies and providing the opportunities for implementing timely public health interventions.

  2. EuMicroSatdb: A database for microsatellites in the sequenced genomes of eukaryotes

    Directory of Open Access Journals (Sweden)

    Grover Atul

    2007-07-01

    Full Text Available Abstract Background Microsatellites have immense utility as molecular markers in different fields like genome characterization and mapping, phylogeny and evolutionary biology. Existing microsatellite databases are of limited utility for experimental and computational biologists with regard to their content and information output. EuMicroSatdb (Eukaryotic MicroSatellite database http://ipu.ac.in/usbt/EuMicroSatdb.htm is a web based relational database for easy and efficient positional mining of microsatellites from sequenced eukaryotic genomes. Description A user friendly web interface has been developed for microsatellite data retrieval using Active Server Pages (ASP. The backend database codes for data extraction and assembly have been written using Perl based scripts and C++. Precise need based microsatellites data retrieval is possible using different input parameters like microsatellite type (simple perfect or compound perfect, repeat unit length (mono- to hexa-nucleotide, repeat number, microsatellite length and chromosomal location in the genome. Furthermore, information about clustering of different microsatellites in the genome can also be retrieved. Finally, to facilitate primer designing for PCR amplification of any desired microsatellite locus, 200 bp upstream and downstream sequences are provided. Conclusion The database allows easy systematic retrieval of comprehensive information about simple and compound microsatellites, microsatellite clusters and their locus coordinates in 31 sequenced eukaryotic genomes. The information content of the database is useful in different areas of research like gene tagging, genome mapping, population genetics, germplasm characterization and in understanding microsatellite dynamics in eukaryotic genomes.

  3. Building a model: developing genomic resources for common milkweed (Asclepias syriaca with low coverage genome sequencing

    Directory of Open Access Journals (Sweden)

    Weitemier Kevin

    2011-05-01

    Full Text Available Abstract Background Milkweeds (Asclepias L. have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L. could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. Results A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp and 5S rDNA (120 bp sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp, with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae unigenes (median coverage of 0.29× and 66% of single copy orthologs (COSII in asterids (median coverage of 0.14×. From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites and phylogenetics (low-copy nuclear genes studies were developed. Conclusions The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species

  4. Building a model: developing genomic resources for common milkweed (Asclepias syriaca) with low coverage genome sequencing.

    Science.gov (United States)

    Straub, Shannon C K; Fishbein, Mark; Livshultz, Tatyana; Foster, Zachary; Parks, Matthew; Weitemier, Kevin; Cronn, Richard C; Liston, Aaron

    2011-05-04

    Milkweeds (Asclepias L.) have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L.) could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp) and 5S rDNA (120 bp) sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp), with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae) unigenes (median coverage of 0.29×) and 66% of single copy orthologs (COSII) in asterids (median coverage of 0.14×). From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites) and phylogenetics (low-copy nuclear genes) studies were developed. The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species and its relatives. This study represents a first

  5. Isolation and complete genome sequencing of Mimivirus bombay, a Giant Virus in sewage of Mumbai, India

    Directory of Open Access Journals (Sweden)

    Anirvan Chatterjee

    2016-09-01

    Full Text Available We report the isolation and complete genome sequencing of a new Mimiviridae family member, infecting Acanthamoeba castellanii, from sewage in Mumbai, India. The isolated virus has a particle size of about 435 nm and a 1,182,200-bp genome. A phylogeny based on the DNA polymerase sequence placed the isolate as a new member of the Mimiviridae family lineage A and was named as Mimivirus bombay. Extensive presence of Mimiviridae family members in different environmental niches, with remarkably similar genome size and genetic makeup, point towards an evolutionary advantage that needs to be further investigated. The complete genome sequence of Mimivirus bombay was deposited at GenBank/EMBL/DDBJ under the accession number KU761889.

  6. Salmonella enterica Prophage Sequence Profiles Reflect Genome Diversity and Can Be Used for High Discrimination Subtyping

    Directory of Open Access Journals (Sweden)

    Walid Mottawea

    2018-05-01

    Full Text Available Non-typhoidal Salmonella is a leading cause of foodborne illness worldwide. Prompt and accurate identification of the sources of Salmonella responsible for disease outbreaks is crucial to minimize infections and eliminate ongoing sources of contamination. Current subtyping tools including single nucleotide polymorphism (SNP typing may be inadequate, in some instances, to provide the required discrimination among epidemiologically unrelated Salmonella strains. Prophage genes represent the majority of the accessory genes in bacteria genomes and have potential to be used as high discrimination markers in Salmonella. In this study, the prophage sequence diversity in different Salmonella serovars and genetically related strains was investigated. Using whole genome sequences of 1,760 isolates of S. enterica representing 151 Salmonella serovars and 66 closely related bacteria, prophage sequences were identified from assembled contigs using PHASTER. We detected 154 different prophages in S. enterica genomes. Prophage sequences were highly variable among S. enterica serovars with a median ± interquartile range (IQR of 5 ± 3 prophage regions per genome. While some prophage sequences were highly conserved among the strains of specific serovars, few regions were lineage specific. Therefore, strains belonging to each serovar could be clustered separately based on their prophage content. Analysis of S. Enteritidis isolates from seven outbreaks generated distinct prophage profiles for each outbreak. Taken altogether, the diversity of the prophage sequences correlates with genome diversity. Prophage repertoires provide an additional marker for differentiating S. enterica subtypes during foodborne outbreaks.

  7. Whole Genome Sequencing of Enterovirus species C Isolates by High-throughput Sequencing: Development of Generic Primers

    Directory of Open Access Journals (Sweden)

    Maël Bessaud

    2016-08-01

    Full Text Available Enteroviruses are among the most common viruses infecting humans and can cause diverse clinical syndromes ranging from minor febrile illness to severe and potentially fatal diseases. Enterovirus species C (EV-C consists of more than 20 types, among which the 3 serotypes of polioviruses, the etiological agents of poliomyelitis, are included. Biodiversity and evolution of EV-C genomes are shaped by frequent recombination events. Therefore, identification and characterization of circulating EV-C strains require the sequencing of different genomic regions.A simple method was developed to sequence quickly the entire genome of EV-C isolates. Four overlapping fragments were produced separately by RT-PCR performed with generic primers. The four amplicons were then pooled and purified prior to be sequenced by high-throughput technique.The method was assessed on a panel of EV-Cs belonging to a wide-range of types. It can be used to determine full-length genome sequences through de novo assembly of thousands of reads. It was also able to discriminate reads from closely related viruses in mixtures.By decreasing the workload compared to classical Sanger-based techniques, this method will serve as a precious tool for sequencing large panels of EV-Cs isolated in cell cultures during environmental surveillance or from patients, including vaccine-derived polioviruses.

  8. The complete chloroplast genome sequences of Lychnis wilfordii and Silene capitata and comparative analyses with other Caryophyllaceae genomes.

    Science.gov (United States)

    Kang, Jong-Soo; Lee, Byoung Yoon; Kwak, Myounghai

    2017-01-01

    The complete chloroplast genomes of Lychnis wilfordii and Silene capitata were determined and compared with ten previously reported Caryophyllaceae chloroplast genomes. The chloroplast genome sequences of L. wilfordii and S. capitata contain 152,320 bp and 150,224 bp, respectively. The gene contents and orders among 12 Caryophyllaceae species are consistent, but several microstructural changes have occurred. Expansion of the inverted repeat (IR) regions at the large single copy (LSC)/IRb and small single copy (SSC)/IR boundaries led to partial or entire gene duplications. Additionally, rearrangements of the LSC region were caused by gene inversions and/or transpositions. The 18 kb inversions, which occurred three times in different lineages of tribe Sileneae, were thought to be facilitated by the intermolecular duplicated sequences. Sequence analyses of the L. wilfordii and S. capitata genomes revealed 39 and 43 repeats, respectively, including forward, palindromic, and reverse repeats. In addition, a total of 67 and 56 simple sequence repeats were discovered in the L. wilfordii and S. capitata chloroplast genomes, respectively. Finally, we constructed phylogenetic trees of the 12 Caryophyllaceae species and two Amaranthaceae species based on 73 protein-coding genes using both maximum parsimony and likelihood methods.

  9. The Solanum commersonii Genome Sequence Provides Insights into Adaptation to Stress Conditions and Genome Evolution of Wild Potato Relatives

    Science.gov (United States)

    Aversano, Riccardo; Contaldi, Felice; Ercolano, Maria Raffaella; Grosso, Valentina; Iorizzo, Massimo; Tatino, Filippo; Xumerle, Luciano; Dal Molin, Alessandra; Avanzato, Carla; Ferrarini, Alberto; Delledonne, Massimo; Sanseverino, Walter; Cigliano, Riccardo Aiese; Capella-Gutierrez, Salvador; Gabaldón, Toni; Frusciante, Luigi; Bradeen, James M.; Carputo, Domenico

    2015-01-01

    Here, we report the draft genome sequence of Solanum commersonii, which consists of ∼830 megabases with an N50 of 44,303 bp anchored to 12 chromosomes, using the potato (Solanum tuberosum) genome sequence as a reference. Compared with potato, S. commersonii shows a striking reduction in heterozygosity (1.5% versus 53 to 59%), and differences in genome sizes were mainly due to variations in intergenic sequence length. Gene annotation by ab initio prediction supported by RNA-seq data produced a catalog of 1703 predicted microRNAs, 18,882 long noncoding RNAs of which 20% are shown to target cold-responsive genes, and 39,290 protein-coding genes with a significant repertoire of nonredundant nucleotide binding site-encoding genes and 126 cold-related genes that are lacking in S. tuberosum. Phylogenetic analyses indicate that domesticated potato and S. commersonii lineages diverged ∼2.3 million years ago. Three duplication periods corresponding to genome enrichment for particular gene families related to response to salt stress, water transport, growth, and defense response were discovered. The draft genome sequence of S. commersonii substantially increases our understanding of the domesticated germplasm, facilitating translation of acquired knowledge into advances in crop stability in light of global climate and environmental changes. PMID:25873387

  10. Chloroplast Genome Sequence of pigeonpea (Cajanus cajan (L. Millspaugh and Cajanus scarabaeoides: Genome organization and Comparison with other legumes

    Directory of Open Access Journals (Sweden)

    Tanvi Kaila

    2016-12-01

    Full Text Available Pigeonpea (Cajanus cajan (L. Millspaugh, a diploid (2n = 22 legume crop with a genome size of 852 Mbp, serves as an important source of human dietary protein especially in South East Asian and African regions. In this study, the draft chloroplast genomes of Cajanus cajan and Cajanus scarabaeoides were sequenced. Cajanus scarabaeoides is an important species of the Cajanus gene pool and has also been used for developing promising CMS system by different groups. A male sterile genotype harbouring the Cajanus scarabaeoides cytoplasm was used for sequencing the plastid genome. The cp genome of Cajanus cajan is 152,242bp long, having a quadripartite structure with LSC of 83,455 bp and SSC of 17,871 bp separated by IRs of 25,398 bp. Similarly, the cp genome of Cajanus scarabaeoides is 152,201bp long, having a quadripartite structure in which IRs of 25,402 bp length separates 83,423 bp of LSC and 17,854 bp of SSC. The pigeonpea cp genome contains 116 unique genes, including 30 tRNA, 4 rRNA, 78 predicted protein coding genes and 5 pseudogenes. A 50kb inversion was observed in the LSC region of pigeonpea cp genome, consistent with other legumes. Comparison of cp genome with other legumes revealed the contraction of IR boundaries due to the absence of rps19 gene in the IR region. Chloroplast SSRs were mined and a total of 280 and 292 cpSSRs were identified in Cajanus scarabaeoides and Cajanus cajan respectively. RNA editing was observed at 37 sites in both Cajanus scarabaeoides and Cajanus cajan, with maximum occurrence in the ndh genes. The pigeonpea cp genome sequence would be beneficial in providing informative molecular markers which can be utilized for genetic diversity analysis and aid in understanding the plant systematics studies among major grain legumes.

  11. The complete chloroplast genome of Capsicum annuum var. glabriusculum using Illumina sequencing.

    Science.gov (United States)

    Raveendar, Sebastin; Na, Young-Wang; Lee, Jung-Ro; Shim, Donghwan; Ma, Kyung-Ho; Lee, Sok-Young; Chung, Jong-Wook

    2015-07-20

    Chloroplast (cp) genome sequences provide a valuable source for DNA barcoding. Molecular phylogenetic studies have concentrated on DNA sequencing of conserved gene loci. However, this approach is time consuming and more difficult to implement when gene organization differs among species. Here we report the complete re-sequencing of the cp genome of Capsicum pepper (Capsicum annuum var. glabriusculum) using the Illumina platform. The total length of the cp genome is 156,817 bp with a 37.7% overall GC content. A pair of inverted repeats (IRs) of 50,284 bp were separated by a small single copy (SSC; 18,948 bp) and a large single copy (LSC; 87,446 bp). The number of cp genes in C. annuum var. glabriusculum is the same as that in other Capsicum species. Variations in the lengths of LSC; SSC and IR regions were the main contributors to the size variation in the cp genome of this species. A total of 125 simple sequence repeat (SSR) and 48 insertions or deletions variants were found by sequence alignment of Capsicum cp genome. These findings provide a foundation for further investigation of cp genome evolution in Capsicum and other higher plants.

  12. Automated typing of red blood cell and platelet antigens: a whole-genome sequencing study.

    Science.gov (United States)

    Lane, William J; Westhoff, Connie M; Gleadall, Nicholas S; Aguad, Maria; Smeland-Wagman, Robin; Vege, Sunitha; Simmons, Daimon P; Mah, Helen H; Lebo, Matthew S; Walter, Klaudia; Soranzo, Nicole; Di Angelantonio, Emanuele; Danesh, John; Roberts, David J; Watkins, Nick A; Ouwehand, Willem H; Butterworth, Adam S; Kaufman, Richard M; Rehm, Heidi L; Silberstein, Leslie E; Green, Robert C

    2018-06-01

    There are more than 300 known red blood cell (RBC) antigens and 33 platelet antigens that differ between individuals. Sensitisation to antigens is a serious complication that can occur in prenatal medicine and after blood transfusion, particularly for patients who require multiple transfusions. Although pre-transfusion compatibility testing largely relies on serological methods, reagents are not available for many antigens. Methods based on single-nucleotide polymorphism (SNP) arrays have been used, but typing for ABO and Rh-the most important blood groups-cannot be done with SNP typing alone. We aimed to develop a novel method based on whole-genome sequencing to identify RBC and platelet antigens. This whole-genome sequencing study is a subanalysis of data from patients in the whole-genome sequencing arm of the MedSeq Project randomised controlled trial (NCT01736566) with no measured patient outcomes. We created a database of molecular changes in RBC and platelet antigens and developed an automated antigen-typing algorithm based on whole-genome sequencing (bloodTyper). This algorithm was iteratively improved to address cis-trans haplotype ambiguities and homologous gene alignments. Whole-genome sequencing data from 110 MedSeq participants (30 × depth) were used to initially validate bloodTyper through comparison with conventional serology and SNP methods for typing of 38 RBC antigens in 12 blood-group systems and 22 human platelet antigens. bloodTyper was further validated with whole-genome sequencing data from 200 INTERVAL trial participants (15 × depth) with serological comparisons. We iteratively improved bloodTyper by comparing its typing results with conventional serological and SNP typing in three rounds of testing. The initial whole-genome sequencing typing algorithm was 99·5% concordant across the first 20 MedSeq genomes. Addressing discordances led to development of an improved algorithm that was 99·8% concordant for the remaining 90 Med

  13. Genome sequence of a urease-positive Campylobacter lari strain

    Science.gov (United States)

    Campylobacter lari is frequently isolated from shore birds and can cause illness in humans. Here we report the draft whole genome sequence of an urease-positive strain of C. lari that was isolated in estuarial water on the coast of Delaware, USA....

  14. Complete Genome Sequence of Beijerinckia indica subsp. indica▿

    Science.gov (United States)

    Tamas, Ivica; Dedysh, Svetlana N.; Liesack, Werner; Stott, Matthew B.; Alam, Maqsudul; Murrell, J. Colin; Dunfield, Peter F.

    2010-01-01

    Beijerinckia indica subsp. indica is an aerobic, acidophilic, exopolysaccharide-producing, N2-fixing soil bacterium. It is a generalist chemoorganotroph that is phylogenetically closely related to facultative and obligate methanotrophs of the genera Methylocella and Methylocapsa. Here we report the full genome sequence of this bacterium. PMID:20601475

  15. Complete genome sequence of Beijerinckia indica subsp. indica.

    Science.gov (United States)

    Tamas, Ivica; Dedysh, Svetlana N; Liesack, Werner; Stott, Matthew B; Alam, Maqsudul; Murrell, J Colin; Dunfield, Peter F

    2010-09-01

    Beijerinckia indica subsp. indica is an aerobic, acidophilic, exopolysaccharide-producing, N(2)-fixing soil bacterium. It is a generalist chemoorganotroph that is phylogenetically closely related to facultative and obligate methanotrophs of the genera Methylocella and Methylocapsa. Here we report the full genome sequence of this bacterium.

  16. Draft Genome Sequence of Corynebacterium kefirresidentii SB, Isolated from Kefir.

    Science.gov (United States)

    Blasche, Sonja; Kim, Yongkyu; Patil, Kiran R

    2017-09-14

    The genus Corynebacterium includes Gram-positive species with a high G+C content. We report here a novel species, Corynebacterium kefirresidentii SB, isolated from kefir grains collected in Germany. Its draft genome sequence was remarkably dissimilar (average nucleotide identity, 76.54%) to those of other Corynebacterium spp., confirming that this is a unique novel species. Copyright © 2017 Blasche et al.

  17. Genome Sequence of Gordonia Phage BetterKatz

    Science.gov (United States)

    Berryman, Emily N.; Forrest, Kaitlyn M.; McHale, Lilliana; Wertz, Anthony T.; Zhuang, Zenas; Kasturiarachi, Naomi S.; Pressimone, Catherine A.; Schiebel, Johnathon G.; Furbee, Emily C.; Grubb, Sarah R.; Warner, Marcie H.; Montgomery, Matthew T.; Garlena, Rebecca A.; Russell, Daniel A.; Jacobs-Sera, Deborah; Hatfull, Graham F.

    2016-01-01

    BetterKatz is a bacteriophage isolated from a soil sample collected in Pittsburgh, Pennsylvania using the host Gordonia terrae 3612. BetterKatz’s genome is 50,636 bp long and contains 75 predicted protein-coding genes, 35 of which have been assigned putative functions. BetterKatz is not closely related to other sequenced Gordonia phages. PMID:27516497

  18. Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus

    OpenAIRE

    Spence, Robert J.; Noune, Christopher; Hauxwell, Caroline

    2016-01-01

    Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length.

  19. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  20. Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus.

    Science.gov (United States)

    Spence, Robert J; Noune, Christopher; Hauxwell, Caroline

    2016-06-30

    Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length. Copyright © 2016 Spence et al.

  1. Complete Genome Sequence of Mycobacterium vaccae Type Strain ATCC 25954

    KAUST Repository

    Ho, Y. S.; Adroub, S. A.; Abadi, Maram; Al Alwan, B.; Alkhateeb, R.; Gao, G.; Ragab, A.; Ali, Shahjahan; van Soolingen, D.; Bitter, W.; Pain, Arnab; Abdallah, A. M.

    2012-01-01

    Mycobacterium vaccae is a rapidly growing, nontuberculous Mycobacterium species that is generally not considered a human pathogen and is of major pharmaceutical interest as an immunotherapeutic agent. We report here the annotated genome sequence of the M. vaccae type strain, ATCC 25954.

  2. Complete Genome Sequence of Mycobacterium vaccae Type Strain ATCC 25954

    KAUST Repository

    Ho, Y. S.

    2012-10-26

    Mycobacterium vaccae is a rapidly growing, nontuberculous Mycobacterium species that is generally not considered a human pathogen and is of major pharmaceutical interest as an immunotherapeutic agent. We report here the annotated genome sequence of the M. vaccae type strain, ATCC 25954.

  3. Templated sequence insertion polymorphisms in the human genome

    Science.gov (United States)

    Onozawa, Masahiro; Aplan, Peter

    2016-11-01

    Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

  4. Draft Genome Sequence of Campylobacter jejuni 11168H

    Science.gov (United States)

    Macdonald, Sarah E.; Gundogdu, Ozan; Dorrell, Nick; Wren, Brendan W.; Blake, Damer

    2017-01-01

    ABSTRACT Campylobacter jejuni is the most prevalent cause of food-borne gastroenteritis in the developed world. The reference and original sequenced strain C. jejuni NCTC11168 has low levels of motility compared to clinical isolates. Here, we describe the draft genome of the laboratory derived hypermotile variant named 11168H. PMID:28153902

  5. Genome Sequence of Novel Human Parechovirus Type 17

    OpenAIRE

    B?ttcher, Sindy; Obermeier, Patrick E.; Diedrich, Sabine; Kabor?, Yolande; D?Alfonso, Rossella; Pfister, Herbert; Kaiser, Rolf; Di Cristanziano, Veronica

    2017-01-01

    ABSTRACT Human parechoviruses (HPeV) circulate worldwide, causing a broad variety of symptoms, preferentially in early childhood. We report here the nearly complete genome sequence of a novel HPeV type, consisting of 7,062 nucleotides and encoding 2,179?amino acids. M36/CI/2014 was taxonomically classified as HPeV-17 by the picornavirus study group.

  6. The complete mitochondrial genome sequence of Diaphorina citri (Hemiptera: Psyllidae)

    Science.gov (United States)

    The first complete mitochondrial genome (mitogenome) sequence of Asian citrus psyllid, Diaphorina citri (Hemiptera: Psyllidae), from Guangzhou, China is presented. The circular mitogenome is 14,996 bp in length with an A+T content of 74.5%, and contains 13 protein-coding genes (PCGs), 22 tRNA genes ...

  7. Genome Sequences of 19 Novel Erwinia amylovora Bacteriophages.

    Science.gov (United States)

    Esplin, Ian N D; Berg, Jordan A; Sharma, Ruchira; Allen, Robert C; Arens, Daniel K; Ashcroft, Cody R; Bairett, Shannon R; Beatty, Nolan J; Bickmore, Madeline; Bloomfield, Travis J; Brady, T Scott; Bybee, Rachel N; Carter, John L; Choi, Minsey C; Duncan, Steven; Fajardo, Christopher P; Foy, Brayden B; Fuhriman, David A; Gibby, Paul D; Grossarth, Savannah E; Harbaugh, Kala; Harris, Natalie; Hilton, Jared A; Hurst, Emily; Hyde, Jonathan R; Ingersoll, Kayleigh; Jacobson, Caitlin M; James, Brady D; Jarvis, Todd M; Jaen-Anieves, Daniella; Jensen, Garrett L; Knabe, Bradley K; Kruger, Jared L; Merrill, Bryan D; Pape, Jenny A; Payne Anderson, Ashley M; Payne, David E; Peck, Malia D; Pollock, Samuel V; Putnam, Micah J; Ransom, Ethan K; Ririe, Devin B; Robinson, David M; Rogers, Spencer L; Russell, Kerri A; Schoenhals, Jonathan E; Shurtleff, Christopher A; Simister, Austin R; Smith, Hunter G; Stephenson, Michael B; Staley, Lyndsay A; Stettler, Jason M; Stratton, Mallorie L; Tateoka, Olivia B; Tatlow, P J; Taylor, Alexander S; Thompson, Suzanne E; Townsend, Michelle H; Thurgood, Trever L; Usher, Brittian K; Whitley, Kiara V; Ward, Andrew T; Ward, Megan E H; Webb, Charles J; Wienclaw, Trevor M; Williamson, Taryn L; Wells, Michael J; Wright, Cole K; Breakwell, Donald P; Hope, Sandra; Grose, Julianne H

    2017-11-16

    Erwinia amylovora is the causal agent of fire blight, a devastating disease affecting some plants of the Rosaceae family. We isolated bacteriophages from samples collected from infected apple and pear trees along the Wasatch Front in Utah. We announce 19 high-quality complete genome sequences of E. amylovora bacteriophages. Copyright © 2017 Esplin et al.

  8. Draft Genome Sequence of Mycobacterium chimaera Type Strain Fl-0169

    Science.gov (United States)

    We report the draft genome sequence of the type strain Mycobacterium chimaera Fl-0169T, a member of the Mycobacterium avium complex (MAC). M. chimaera Fl-0169T was isolated from a patient in Italy and is highly similar to strains of M. chimaera isolated in Ireland, though Fl-016...

  9. Phytophthora Genome Sequences Uncover Evolutionary Origins and Mechanisms of Pathogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Lamour, Kurt H [ORNL; McDonald, W Hayes [ORNL; Savidor, Alon [ORNL

    2006-01-01

    Genome sequences of the soybean pathogen, Phytophthora sojae, and the sudden oak death pathogen, Phytophthora ramorum, suggest a photosynthetic past and reveal recent massive expansion and diversification of potential pathogenicity gene families. Abstract: Draft genome sequences of the soybean pathogen, Phytophthora sojae, and the sudden oak death pathogen, Phytophthora ramorum, have been determined. O mycetes such as these Phytophthora species share the kingdom Stramenopila with photosynthetic algae such as diatoms and the presence of many Phytophthora genes of probable phototroph origin support a photosynthetic ancestry for the stramenopiles. Comparison of the two species' genomes reveals a rapid expansion and diversification of many protein families associated with plant infection such as hydrolases, ABC transporters, protein toxins, proteinase inhibitors and, in particular, a superfamily of 700 proteins with similarity to known o mycete avirulence genes.

  10. Complete genome sequence of Oceanithermus profundus type strain (506T)

    Energy Technology Data Exchange (ETDEWEB)

    Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Zhang, Xiaojing [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Hauser, Loren John [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Ruhl, Alina [U.S. Department of Energy, Joint Genome Institute; Mwirichia, Romano [University of Munster, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Wirth, Reinhard [Universitat Regensburg, Regensburg, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL

    2011-01-01

    Oceanithermus profundus Miroshnichenko et al. 2003 is the type species of the genus Oceanithermus, which belongs to the family Thermaceae. The genus currently comprises two species whose members are thermophilic and are able to reduce sulfur compounds and nitrite. The organism is adapted to the salinity of sea water, is able to utilize a broad range of carbohydrates, some proteinaceous substrates, organic acids and alcohols. This is the first completed genome sequence of a member of the genus Oceanithermus and the fourth sequence from the family Thermaceae. The 2,439,291 bp long genome with its 2,391 protein-coding and 54 RNA genes consists of one chromosome and a 135,351 bp long plasmid, and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  11. Bioinformatics for whole-genome shotgun sequencing of microbial communities.

    Directory of Open Access Journals (Sweden)

    Kevin Chen

    2005-07-01

    Full Text Available The application of whole-genome shotgun sequencing to microbial communities represents a major development in metagenomics, the study of uncultured microbes via the tools of modern genomic analysis. In the past year, whole-genome shotgun sequencing projects of prokaryotic communities from an acid mine biofilm, the Sargasso Sea, Minnesota farm soil, three deep-sea whale falls, and deep-sea sediments have been reported, adding to previously published work on viral communities from marine and fecal samples. The interpretation of this new kind of data poses a wide variety of exciting and difficult bioinformatics problems. The aim of this review is to introduce the bioinformatics community to this emerging field by surveying existing techniques and promising new approaches for several of the most interesting of these computational problems.

  12. Complete genome sequence of Marivirga tractuosa type strain (H-43).

    Science.gov (United States)

    Pagani, Ioanna; Chertkov, Olga; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Nolan, Matt; Saunders, Elizabeth; Pitluck, Sam; Held, Brittany; Goodwin, Lynne; Liolios, Konstantinos; Ovchinikova, Galina; Ivanova, Natalia; Mavromatis, Konstantinos; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Jeffries, Cynthia D; Detter, John C; Han, Cliff; Tapia, Roxanne; Ngatchou-Djao, Olivier D; Rohde, Manfred; Göker, Markus; Spring, Stefan; Sikorski, Johannes; Woyke, Tanja; Bristow, Jim; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C

    2011-04-29

    Marivirga tractuosa (Lewin 1969) Nedashkovskaya et al. 2010 is the type species of the genus Marivirga, which belongs to the family Flammeovirgaceae. Members of this genus are of interest because of their gliding motility. The species is of interest because representative strains show resistance to several antibiotics, including gentamicin, kanamycin, neomycin, polymixin and streptomycin. This is the first complete genome sequence of a member of the family Flammeovirgaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 4,511,574 bp long chromosome and the 4,916 bp plasmid with their 3,808 protein-coding and 49 RNA genes are a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  13. The wolf reference genome sequence (Canis lupus lupus) and its implications for Canis spp. population genomics

    DEFF Research Database (Denmark)

    Gopalakrishnan, Shyam; Samaniego Castruita, Jose Alfredo; Sinding, Mikkel Holger Strander

    2017-01-01

    Background An increasing number of studies are addressing the evolutionary genomics of dog domestication, principally through resequencing dog, wolf and related canid genomes. There is, however, only one de novo assembled canid genome currently available against which to map such data - that of a......Background An increasing number of studies are addressing the evolutionary genomics of dog domestication, principally through resequencing dog, wolf and related canid genomes. There is, however, only one de novo assembled canid genome currently available against which to map such data...... that regardless of the reference genome choice, most evolutionary genomic analyses yield qualitatively similar results, including those exploring the structure between the wolves and dogs using admixture and principal component analysis. However, we do observe differences in the genomic coverage of re-mapped...

  14. Draft genome sequence of the Algerian bee Apis mellifera intermissa

    Directory of Open Access Journals (Sweden)

    Nizar Jamal Haddad

    2015-06-01

    Full Text Available Apis mellifera intermissa is the native honeybee subspecies of Algeria. A. m. intermissa occurs in Tunisia, Algeria and Morocco, between the Atlas and the Mediterranean and Atlantic coasts. This bee is very important due to its high ability to adapt to great variations in climatic conditions and due to its preferable cleaning behavior. Here we report the draft genome sequence of this honey bee, its Whole Genome Shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession JSUV00000000. The 240-Mb genome is being annotated and analyzed. Comparison with the genome of other Apis mellifera sub-species promises to yield insights into the evolution of adaptations to high temperature and resistance to Varroa parasite infestation.

  15. Complete genome sequence of 'Thermobaculum terrenum' type strain (YNP1).

    Science.gov (United States)

    Kiss, Hajnalka; Cleland, David; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Nolan, Matt; Tice, Hope; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Liolios, Konstantinos; Ivanova, Natalia; Mavromatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Lu, Megan; Brettin, Thomas; Detter, John C; Göker, Markus; Tindall, Brian J; Beck, Brian; McDermott, Timothy R; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Cheng, Jan-Fang

    2010-10-27

    'Thermobaculum terrenum' Botero et al. 2004 is the sole species within the proposed genus 'Thermobaculum'. Strain YNP1(T) is the only cultivated member of an acid tolerant, extremely thermophilic species belonging to a phylogenetically isolated environmental clone group within the phylum Chloroflexi. At present, the name 'Thermobaculum terrenum' is not yet validly published as it contravenes Rule 30 (3a) of the Bacteriological Code. The bacterium was isolated from a slightly acidic extreme thermal soil in Yellowstone National Park, Wyoming (USA). Depending on its final taxonomic allocation, this is likely to be the third completed genome sequence of a member of the class Thermomicrobia and the seventh type strain genome from the phylum Chloroflexi. The 3,101,581 bp long genome with its 2,872 protein-coding and 58 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  16. A genome-wide analysis of lentivector integration sites using targeted sequence capture and next generation sequencing technology.

    Science.gov (United States)

    Ustek, Duran; Sirma, Sema; Gumus, Ergun; Arikan, Muzaffer; Cakiris, Aris; Abaci, Neslihan; Mathew, Jaicy; Emrence, Zeliha; Azakli, Hulya; Cosan, Fulya; Cakar, Atilla; Parlak, Mahmut; Kursun, Olcay

    2012-10-01

    One application of next-generation sequencing (NGS) is the targeted resequencing of interested genes which has not been used in viral integration site analysis of gene therapy applications. Here, we combined targeted sequence capture array and next generation sequencing to address the whole genome profiling of viral integration sites. Human 293T and K562 cells were transduced with a HIV-1 derived vector. A custom made DNA probe sets targeted pLVTHM vector used to capture lentiviral vector/human genome junctions. The captured DNA was sequenced using GS FLX platform. Seven thousand four hundred and eighty four human genome sequences flanking the long terminal repeats (LTR) of pLVTHM fragment sequences matched with an identity of at least 98% and minimum 50 bp criteria in both cells. In total, 203 unique integration sites were identified. The integrations in both cell lines were totally distant from the CpG islands and from the transcription start sites and preferentially located in introns. A comparison between the two cell lines showed that the lentiviral-transduced DNA does not have the same preferred regions in the two different cell lines. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

    Directory of Open Access Journals (Sweden)

    Mohammed Bakkali

    Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

  18. Complete chloroplast genome sequence of a major allogamous forage species, perennial ryegrass (Lolium perenne L.).

    Science.gov (United States)

    Diekmann, Kerstin; Hodkinson, Trevor R; Wolfe, Kenneth H; van den Bekerom, Rob; Dix, Philip J; Barth, Susanne

    2009-06-01

    Lolium perenne L. (perennial ryegrass) is globally one of the most important forage and grassland crops. We sequenced the chloroplast (cp) genome of Lolium perenne cultivar Cashel. The L. perenne cp genome is 135 282 bp with a typical quadripartite structure. It contains genes for 76 unique proteins, 30 tRNAs and four rRNAs. As in other grasses, the genes accD, ycf1 and ycf2 are absent. The genome is of average size within its subfamily Pooideae and of medium size within the Poaceae. Genome size differences are mainly due to length variations in non-coding regions. However, considerable length differences of 1-27 codons in comparison of L. perenne to other Poaceae and 1-68 codons among all Poaceae were also detected. Within the cp genome of this outcrossing cultivar, 10 insertion/deletion polymorphisms and 40 single nucleotide polymorphisms were detected. Two of the polymorphisms involve tiny inversions within hairpin structures. By comparing the genome sequence with RT-PCR products of transcripts for 33 genes, 31 mRNA editing sites were identified, five of them unique to Lolium. The cp genome sequence of L. perenne is available under Accession number AM777385 at the European Molecular Biology Laboratory, National Center for Biotechnology Information and DNA DataBank of Japan.

  19. Sequencing the CHO DXB11 genome reveals regional variations in genomic stability and haploidy

    DEFF Research Database (Denmark)

    Kaas, Christian Schrøder; Kristensen, Claus; Betenbaugh, Michael J.

    2015-01-01

    Background: The DHFR negative CHO DXB11 cell line (also known as DUX-B11 and DUKX) was historically the first CHO cell line to be used for large scale production of heterologous proteins and is still used for production of a number of complex proteins.  Results: Here we present the genomic sequence...... of the CHO DXB11 genome sequenced to a depth of 33x. Overall a significant genomic drift was seen favoring GC -> AT point mutations in line with the chemical mutagenesis strategy used for generation of the cell line. The sequencing depth for each gene in the genome revealed distinct peaks at sequencing...... in eight additional analyzed CHO genomes (15-20% haploidy) but not in the genome of the Chinese hamster. The dhfr gene is confirmed to be haploid in CHO DXB11; transcriptionally active and the remaining allele contains a G410C point mutation causing a Thr137Arg missense mutation. We find similar to 2...

  20. Distribution and evolution of repeated sequences in genomes of Triatominae (Hemiptera-Reduviidae inferred from genomic in situ hybridization.

    Directory of Open Access Journals (Sweden)

    Sebastian Pita

    Full Text Available The subfamily Triatominae, vectors of Chagas disease, comprises 140 species characterized by a highly homogeneous chromosome number. We analyzed the chromosomal distribution and evolution of repeated sequences in Triatominae genomes by Genomic in situ Hybridization using Triatoma delpontei and Triatoma infestans genomic DNAs as probes. Hybridizations were performed on their own chromosomes and on nine species included in six genera from the two main tribes: Triatomini and Rhodniini. Genomic probes clearly generate two different hybridization patterns, dispersed or accumulated in specific regions or chromosomes. The three used probes generate the same hybridization pattern in each species. However, these patterns are species-specific. In closely related species, the probes strongly hybridized in the autosomal heterochromatic regions, resembling C-banding and DAPI patterns. However, in more distant species these co-localizations are not observed. The heterochromatic Y chromosome is constituted by highly repeated sequences, which is conserved among 10 species of Triatomini tribe suggesting be an ancestral character for this group. However, the Y chromosome in Rhodniini tribe is markedly different, supporting the early evolutionary dichotomy between both tribes. In some species, sex chromosomes and autosomes shared repeated sequences, suggesting meiotic chromatin exchanges among these heterologous chromosomes. Our GISH analyses enabled us to acquire not only reliable information about autosomal repeated sequences distribution but also an insight into sex chromosome evolution in Triatominae. Furthermore, the differentiation obtained by GISH might be a valuable marker to establish phylogenetic relationships and to test the controversial origin of the Triatominae subfamily.

  1. Whole genome sequencing reveals genomic heterogeneity and antibiotic purification in Mycobacterium tuberculosis isolates

    KAUST Repository

    Black, PA

    2015-10-24

    Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug resistance. In an age where whole genome sequencing is increasingly relied upon for defining the structure of bacterial genomes, it is important to investigate the reliability of next generation sequencing to identify clonal variants present in a minor percentage of the population. This study aimed to define a reliable cut-off for identification of low frequency sequence variants and to subsequently investigate genetic heterogeneity and the evolution of drug resistance in M. tuberculosis. Methods Genomic DNA was isolated from single colonies from 14 rifampicin mono-resistant M. tuberculosis isolates, as well as the primary cultures and follow up MDR cultures from two of these patients. The whole genomes of the M. tuberculosis isolates were sequenced using either the Illumina MiSeq or Illumina HiSeq platforms. Sequences were analysed with an in-house pipeline. Results Using next-generation sequencing in combination with Sanger sequencing and statistical analysis we defined a read frequency cut-off of 30 % to identify low frequency M. tuberculosis variants with high confidence. Using this cut-off we demonstrated a high rate of genetic diversity between single colonies isolated from one population, showing that by using the current sequencing technology, single colonies are not a true reflection of the genetic diversity within a whole population and vice versa. We further showed that numerous heterogeneous variants emerge and then disappear during the evolution of isoniazid resistance within individual patients. Our findings allowed us to formulate a model for the selective bottleneck which occurs during the course of infection, acting as a genomic purification event. Conclusions Our study demonstrated true levels of genetic diversity

  2. Supplementary Material for: Whole genome sequencing reveals genomic heterogeneity and antibiotic purification in Mycobacterium tuberculosis isolates

    KAUST Repository

    Black, PA

    2015-01-01

    Abstract Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug resistance. In an age where whole genome sequencing is increasingly relied upon for defining the structure of bacterial genomes, it is important to investigate the reliability of next generation sequencing to identify clonal variants present in a minor percentage of the population. This study aimed to define a reliable cut-off for identification of low frequency sequence variants and to subsequently investigate genetic heterogeneity and the evolution of drug resistance in M. tuberculosis. Methods Genomic DNA was isolated from single colonies from 14 rifampicin mono-resistant M. tuberculosis isolates, as well as the primary cultures and follow up MDR cultures from two of these patients. The whole genomes of the M. tuberculosis isolates were sequenced using either the Illumina MiSeq or Illumina HiSeq platforms. Sequences were analysed with an in-house pipeline. Results Using next-generation sequencing in combination with Sanger sequencing and statistical analysis we defined a read frequency cut-off of 30 % to identify low frequency M. tuberculosis variants with high confidence. Using this cut-off we demonstrated a high rate of genetic diversity between single colonies isolated from one population, showing that by using the current sequencing technology, single colonies are not a true reflection of the genetic diversity within a whole population and vice versa. We further showed that numerous heterogeneous variants emerge and then disappear during the evolution of isoniazid resistance within individual patients. Our findings allowed us to formulate a model for the selective bottleneck which occurs during the course of infection, acting as a genomic purification event. Conclusions Our study demonstrated true levels of genetic

  3. Complete Genome Sequence of EtG, the First Phage Sequenced from Erwinia tracheiphila.

    Science.gov (United States)

    Andrade-Domínguez, Andrés; Kolter, Roberto; Shapiro, Lori R

    2018-02-22

    Erwinia tracheiphila is the causal agent of bacterial wilt of cucurbits. Here, we report the genome sequence of the temperate phage EtG, which was isolated from an E. tracheiphila -infected cucumber plant. Phage EtG has a linear 30,413-bp double-stranded DNA genome with cohesive ends and 45 predicted open reading frames. Copyright © 2018 Andrade-Domínguez et al.

  4. Genome sequence diversity and clues to the evolution of variola (smallpox) virus.

    Science.gov (United States)

    Esposito, Joseph J; Sammons, Scott A; Frace, A Michael; Osborne, John D; Olsen-Rasmussen, Melissa; Zhang, Ming; Govil, Dhwani; Damon, Inger K; Kline, Richard; Laker, Miriam; Li, Yu; Smith, Geoffrey L; Meyer, Hermann; Leduc, James W; Wohlhueter, Robert M

    2006-08-11

    Comparative genomics of 45 epidemiologically varied variola virus isolates from the past 30 years of the smallpox era indicate low sequence diversity, suggesting that there is probably little difference in the isolates' functional gene content. Phylogenetic clustering inferred three clades coincident with their geographical origin and case-fatality rate; the latter implicated putative proteins that mediate viral virulence differences. Analysis of the viral linear DNA genome suggests that its evolution involved direct descent and DNA end-region recombination events. Knowing the sequences will help understand the viral proteome and improve diagnostic test precision, therapeutics, and systems for their assessment.

  5. High-precision, whole-genome sequencing of laboratory strains facilitates genetic studies.

    Directory of Open Access Journals (Sweden)

    Anjana Srivatsan

    2008-08-01

    Full Text Available Whole-genome sequencing is a powerful technique for obtaining the reference sequence information of multiple organisms. Its use can be dramatically expanded to rapidly identify genomic variations, which can be linked with phenotypes to obtain biological insights. We explored these potential applications using the emerging next-generation sequencing platform Solexa Genome Analyzer, and the well-characterized model bacterium Bacillus subtilis. Combining sequencing with experimental verification, we first improved the accuracy of the published sequence of the B. subtilis reference strain 168, then obtained sequences of multiple related laboratory strains and different isolates of each strain. This provides a framework for comparing the divergence between different laboratory strains and between their individual isolates. We also demonstrated the power of Solexa sequencing by using its results to predict a defect in the citrate signal transduction pathway of a common laboratory strain, which we verified experimentally. Finally, we examined the molecular nature of spontaneously generated mutations that suppress the growth defect caused by deletion of the stringent response mediator relA. Using whole-genome sequencing, we rapidly mapped these suppressor mutations to two small homologs of relA. Interestingly, stable suppressor strains had mutations in both genes, with each mutation alone partially relieving the relA growth defect. This supports an intriguing three-locus interaction module that is not easily identifiable through traditional suppressor mapping. We conclude that whole-genome sequencing can drastically accelerate the identification of suppressor mutations and complex genetic interactions, and it can be applied as a standard tool to investigate the genetic traits of model organisms.

  6. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

    Science.gov (United States)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  7. Characterizing immunoglobulin repertoire from whole blood by a personal genome sequencer.

    Directory of Open Access Journals (Sweden)

    Fan Gao

    Full Text Available In human immune system, V(DJ recombination produces an enormously large repertoire of immunoglobulins (Ig so that they can tackle different antigens from bacteria, viruses and tumor cells. Several studies have demonstrated the utility of next-generation sequencers such as Roche 454 and Illumina Genome Analyzer to characterize the repertoire of immunoglobulins. However, these techniques typically require separation of B cell population from whole blood and require a few weeks for running the sequencers, so it may not be practical to implement them in clinical settings. Recently, the Ion Torrent personal genome sequencer has emerged as a tabletop personal genome sequencer that can be operated in a time-efficient and cost-effective manner. In this study, we explored the technical feasibility to use multiplex PCR for amplifying V(DJ recombination for IgH, directly from whole blood, then sequence the amplicons by the Ion Torrent sequencer. The whole process including data generation and analysis can be completed in one day. We tested the method in a pilot study on patients with benign, atypical and malignant meningiomas. Despite the noisy data, we were able to compare the samples by their usage frequencies of the V segment, as well as their somatic hypermutation rates. In summary, our study suggested that it is technically feasible to perform clinical monitoring of V(DJ recombination within a day by personal genome sequencers.

  8. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    Energy Technology Data Exchange (ETDEWEB)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2004-04-01

    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  9. ReRep: Computational detection of repetitive sequences in genome survey sequences (GSS

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcelo

    2008-09-01

    Full Text Available Abstract Background Genome survey sequences (GSS offer a preliminary global view of a genome since, unlike ESTs, they cover coding as well as non-coding DNA and include repetitive regions of the genome. A more precise estimation of the nature, quantity and variability of repetitive sequences very early in a genome sequencing project is of considerable importance, as such data strongly influence the estimation of genome coverage, library quality and progress in scaffold construction. Also, the elimination of repetitive sequences from the initial assembly process is important to avoid errors and unnecessary complexity. Repetitive sequences are also of interest in a variety of other studies, for instance as molecular markers. Results We designed and implemented a straightforward pipeline called ReRep, which combines bioinformatics tools for identifying repetitive structures in a GSS dataset. In a case study, we first applied the pipeline to a set of 970 GSSs, sequenced in our laboratory from the human pathogen Leishmania braziliensis, the causative agent of leishmaniosis, an important public health problem in Brazil. We also verified the applicability of ReRep to new sequencing technologies using a set of 454-reads of an Escheria coli. The behaviour of several parameters in the algorithm is evaluated and suggestions are made for tuning of the analysis. Conclusion The ReRep approach for identification of repetitive elements in GSS datasets proved to be straightforward and efficient. Several potential repetitive sequences were found in a L. braziliensis GSS dataset generated in our laboratory, and further validated by the analysis of a more complete genomic dataset from the EMBL and Sanger Centre databases. ReRep also identified most of the E. coli K12 repeats prior to assembly in an example dataset obtained by automated sequencing using 454 technology. The parameters controlling the algorithm behaved consistently and may be tuned to the properties

  10. Complete genome sequence of Actinosynnema mirum type strain (101T)

    Energy Technology Data Exchange (ETDEWEB)

    Land, Miriam; Lapidus, Alla; Mayilraj, Shanmugam; Chen, Feng; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Chertkov, Olga; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Rohde, Manfred; Goker, Markus; Pati, Amrita; Ivanova, Natalia; Mavrommatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia; Brettin, Thomas; Detter, John C.; Han, Cliff; Chain, Patrick; Tindall, Brian; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter

    2009-05-20

    Actinosynnema mirum Hasegawa et al. 1978 is the type species of the genus, and is of phylogenetic interest because of its central phylogenetic location in the Actino-synnemataceae, a rapidly growing family within the actinobacterial suborder Pseudo-nocardineae. A. mirum is characterized by its motile spores borne on synnemata and as a producer of nocardicin antibiotics. It is capable of growing aerobically and under a moderate CO2 atmosphere. The strain is a Gram-positive, aerial and substrate mycelium producing bacterium, originally isolated from a grass blade collected from the Raritan River, New Jersey. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of a member of the family Actinosynnemataceae, and only the second sequence from the actinobacterial suborder Pseudonocardineae. The 8,248,144 bp long single replicon genome with its 7100 protein-coding and 77 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  11. The complete mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).

    Science.gov (United States)

    Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Liu, Guo-Hua; Wang, Chun-Ren; Zhu, Xing-Quan

    2015-01-01

    In the present study, we determined the complete mitochondrial DNA (mtDNA) sequence of Eimeria magna from rabbits for the first time, and compared its gene contents and genome organizations with that of seven Eimeria spp. from domestic chickens. The size of the complete mt genome sequence of E. magna is 6249 bp, which consists of 3 protein-coding genes (cytb, cox1 and cox3), 12 gene fragments for the large subunit (LSU) rRNA, and 7 gene fragments for the small subunit (SSU) rRNA, without transfer RNA genes, in accordance with that of Eimeria spp. from chickens. The putative direction of translation for three genes (cytb, cox1 and cox3) was the same as those of Eimeria species from domestic chickens. The content of A + T is 65.16% for E. magna mt genome (29.73% A, 35.43% T, 17.09 G and 17.75% C). The E. magna mt genome sequence provides novel mtDNA markers for studying the molecular epidemiology and population genetics of Eimeria spp. and has implications for the molecular diagnosis and control of rabbit coccidiosis.

  12. Insights into hominid evolution from the gorilla genome sequence

    Science.gov (United States)

    Scally, Aylwyn; Dutheil, Julien Y.; Hillier, LaDeana W.; Jordan, Greg E.; Goodhead, Ian; Herrero, Javier; Hobolth, Asger; Lappalainen, Tuuli; Mailund, Thomas; Marques-Bonet, Tomas; McCarthy, Shane; Montgomery, Stephen H.; Schwalie, Petra C.; Tang, Y. Amy; Ward, Michelle C.; Xue, Yali; Yngvadottir, Bryndis; Alkan, Can; Andersen, Lars N.; Ayub, Qasim; Ball, Edward V.; Beal, Kathryn; Bradley, Brenda J.; Chen, Yuan; Clee, Chris M.; Fitzgerald, Stephen; Graves, Tina A.; Gu, Yong; Heath, Paul; Heger, Andreas; Karakoc, Emre; Kolb-Kokocinski, Anja; Laird, Gavin K.; Lunter, Gerton; Meader, Stephen; Mort, Matthew; Mullikin, James C.; Munch, Kasper; O’Connor, Timothy D.; Phillips, Andrew D.; Prado-Martinez, Javier; Rogers, Anthony S.; Sajjadian, Saba; Schmidt, Dominic; Shaw, Katy; Simpson, Jared T.; Stenson, Peter D.; Turner, Daniel J.; Vigilant, Linda; Vilella, Albert J.; Whitener, Weldon; Zhu, Baoli; Cooper, David N.; de Jong, Pieter; Dermitzakis, Emmanouil T.; Eichler, Evan E.; Flicek, Paul; Goldman, Nick; Mundy, Nicholas I.; Ning, Zemin; Odom, Duncan T.; Ponting, Chris P.; Quail, Michael A.; Ryder, Oliver A.; Searle, Stephen M.; Warren, Wesley C.; Wilson, Richard K.; Schierup, Mikkel H.; Rogers, Jane; Tyler-Smith, Chris; Durbin, Richard

    2012-01-01

    Summary Gorillas are humans’ closest living relatives after chimpanzees, and are of comparable importance for the study of human origins and evolution. Here we present the assembly and analysis of a genome sequence for the western lowland gorilla, and compare the whole genomes of all extant great ape genera. We propose a synthesis of genetic and fossil evidence consistent with placing the human-chimpanzee and human-chimpanzee-gorilla speciation events at approximately 6 and 10 million years ago (Mya). In 30% of the genome, gorilla is closer to human or chimpanzee than the latter are to each other; this is rarer around coding genes, indicating pervasive selection throughout great ape evolution, and has functional consequences in gene expression. A comparison of protein coding genes reveals approximately 500 genes showing accelerated evolution on each of the gorilla, human and chimpanzee lineages, and evidence for parallel acceleration, particularly of genes involved in hearing. We also compare the western and eastern gorilla species, estimating an average sequence divergence time 1.75 million years ago, but with evidence for more recent genetic exchange and a population bottleneck in the eastern species. The use of the genome sequence in these and future analyses will promote a deeper understanding of great ape biology and evolution. PMID:22398555

  13. Controversy and debate on clinical genomics sequencing-paper 2: clinical genome-wide sequencing: don't throw out the baby with the bathwater!

    Science.gov (United States)

    Adam, Shelin; Friedman, Jan M

    2017-12-01

    Genome-wide (exome or whole genome) sequencing with appropriate genetic counseling should be considered for any patient with a suspected Mendelian disease that has not been identified by conventional testing. Clinical genome-wide sequencing provides a powerful and effective means of identifying specific genetic causes of serious disease and improving clinical care. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Genomic suppression subtractive hybridization as a tool to identify differences in mycorrhizal fungal genomes.

    Science.gov (United States)

    Murat, Claude; Zampieri, Elisa; Vallino, Marta; Daghino, Stefania; Perotto, Silvia; Bonfante, Paola

    2011-05-01

    Characterization of genomic variation among different microbial species, or different strains of the same species, is a field of significant interest with a wide range of potential applications. We have investigated the genomic variation in mycorrhizal fungal genomes through genomic suppressive subtractive hybridization. The comparison was between phylogenetically distant and close truffle species (Tuber spp.), and between isolates of the ericoid mycorrhizal fungus Oidiodendron maius featuring different degrees of metal tolerance. In the interspecies experiment, almost all the sequences that were identified in the Tuber melanosporum genome and absent in Tuber borchii and Tuber indicum corresponded to transposable elements. In the intraspecies comparison, some specific sequences corresponded to regions coding for enzymes, among them a glutathione synthetase known to be involved in metal tolerance. This approach is a quick and rather inexpensive tool to develop molecular markers for mycorrhizal fungi tracking and barcoding, to identify functional genes and to investigate the genome plasticity, adaptation and evolution. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  15. Draft genome sequence of Acidithiobacillus ferrooxidans YQH-1

    Directory of Open Access Journals (Sweden)

    Lei Yan

    2015-12-01

    Full Text Available Acidithiobacillus ferrooxidans YQH-1 is a moderate acidophilic bacterium isolated from a river in a volcano of Northeast China. Here, we describe the draft genome of strain YQH-1, which was assembled into 123 contigs containing 3,111,222 bp with a G + C content of 58.63%. A large number of genes related to carbon dioxide fixation, dinitrogen fixation, pH tolerance, heavy metal detoxification, and oxidative stress defense were detected. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LJBT00000000.

  16. The complete chloroplast genome sequence of Hibiscus syriacus.

    Science.gov (United States)

    Kwon, Hae-Yun; Kim, Joon-Hyeok; Kim, Sea-Hyun; Park, Ji-Min; Lee, Hyoshin

    2016-09-01

    The complete chloroplast genome sequence of Hibiscus syriacus L. is presented in this study. The genome is composed of 161 019 bp in length, with a typical circular structure containing a pair of inverted repeats of 25 745 bp of length separated by a large single-copy region and a small single-copy region of 89 698 bp and 19 831 bp of length, respectively. The overall GC content is 36.8%. One hundred and fourteen genes were annotated, including 81 protein-coding genes, 4 ribosomal RNA genes and 29 transfer RNA genes.

  17. Phytophthora Genome Sequences Uncover Evolutionary Origins and Mechanisms of Pathogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tyler, Brett M.; Tripathy, Sucheta; Zhang, Xuemin; Dehal, Paramvir; Jiang, Rays H. Y.; Aerts, Andrea; Arredondo, Felipe D.; Baxter, Laura; Bensasson, Douda; Beynon, JIm L.; Chapman, Jarrod; Damasceno, Cynthia M. B.; Dorrance, Anne E.; Dou, Daolong; Dickerman, Allan W.; Dubchak, Inna L.; Garbelotto, Matteo; Gijzen, Mark; Gordon, Stuart G.; Govers, Francine; Grunwald, NIklaus J.; Huang, Wayne; Ivors, Kelly L.; Jones, Richard W.; Kamoun, Sophien; Krampis, Konstantinos; Lamour, Kurt H.; Lee, Mi-Kyung; McDonald, W. Hayes; Medina, Monica; Meijer, Harold J. G.; Nordberg, Erik K.; Maclean, Donald J.; Ospina-Giraldo, Manuel D.; Morris, Paul F.; Phuntumart, Vipaporn; Putnam, Nicholas J.; Rash, Sam; Rose, Jocelyn K. C.; Sakihama, Yasuko; Salamov, Asaf A.; Savidor, Alon; Scheuring, Chantel F.; Smith, Brian M.; Sobral, Bruno W. S.; Terry, Astrid; Torto-Alalibo, Trudy A.; Win, Joe; Xu, Zhanyou; Zhang, Hongbin; Grigoriev, Igor V.; Rokhsar, Daniel S.; Boore, Jeffrey L.

    2006-04-17

    Draft genome sequences have been determined for the soybean pathogen Phytophthora sojae and the sudden oak death pathogen Phytophthora ramorum. Oömycetes such as these Phytophthora species share the kingdom Stramenopila with photosynthetic algae such as diatoms, and the presence of many Phytophthora genes of probable phototroph origin supports a photosynthetic ancestry for the stramenopiles. Comparison of the two species' genomes reveals a rapid expansion and diversification of many protein families associated with plant infection such as hydrolases, ABC transporters, protein toxins, proteinase inhibitors, and, in particular, a superfamily of 700 proteins with similarity to known oömycete avirulence genes.

  18. IdentiCS – Identification of coding sequence and in silico reconstruction of the metabolic network directly from unannotated low-coverage bacterial genome sequence

    Directory of Open Access Journals (Sweden)

    Zeng An-Ping

    2004-08-01

    Full Text Available Abstract Background A necessary step for a genome level analysis of the cellular metabolism is the in silico reconstruction of the metabolic network from genome sequences. The available methods are mainly based on the annotation of genome sequences including two successive steps, the prediction of coding sequences (CDS and their function assignment. The annotation process takes time. The available methods often encounter difficulties when dealing with unfinished error-containing genomic sequence. Results In this work a fast method is proposed to use unannotated genome sequence for predicting CDSs and for an in silico reconstruction of metabolic networks. Instead of using predicted genes or CDSs to query public databases, entries from public DNA or protein databases are used as queries to search a local database of the unannotated genome sequence to predict CDSs. Functions are assigned to the predicted CDSs simultaneously. The well-annotated genome of Salmonella typhimurium LT2 is used as an example to demonstrate the applicability of the method. 97.7% of the CDSs in the original annotation are correctly identified. The use of SWISS-PROT-TrEMBL databases resulted in an identification of 98.9% of CDSs that have EC-numbers in the published annotation. Furthermore, two versions of sequences of the bacterium Klebsiella pneumoniae with different genome coverage (3.9 and 7.9 fold, respectively are examined. The results suggest that a 3.9-fold coverage of the bacterial genome could be sufficiently used for the in silico reconstruction of the metabolic network. Compared to other gene finding methods such as CRITICA our method is more suitable for exploiting sequences of low genome coverage. Based on the new method, a program called IdentiCS (Identification of Coding Sequences from Unfinished Genome Sequences is delivered that combines the identification of CDSs with the reconstruction, comparison and visualization of metabolic networks (free to download

  19. The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4.

    Directory of Open Access Journals (Sweden)

    Jin Duan

    Full Text Available The plant growth-promoting bacterium (PGPB Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated "housekeeping" genes (16S rRNA, gyrB, rpoB and rpoD of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup.

  20. Genome-wide microsatellite characterization and marker development in the sequenced Brassica crop species.

    Science.gov (United States)

    Shi, Jiaqin; Huang, Shunmou; Zhan, Jiepeng; Yu, Jingyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

    2014-02-01

    Although much research has been conducted, the pattern of microsatellite distribution has remained ambiguous, and the development/utilization of microsatellite markers has still been limited/inefficient in Brassica, due to the lack of genome sequences. In view of this, we conducted genome-wide microsatellite characterization and marker development in three recently sequenced Brassica crops: Brassica rapa, Brassica oleracea and Brassica napus. The analysed microsatellite characteristics of these Brassica species were highly similar or almost identical, which suggests that the pattern of microsatellite distribution is likely conservative in Brassica. The genomic distribution of microsatellites was highly non-uniform and positively or negatively correlated with genes or transposable elements, respectively. Of the total of 115 869, 185 662 and 356 522 simple sequence repeat (SSR) markers developed with high frequencies (408.2, 343.8 and 356.2 per Mb or one every 2.45, 2.91 and 2.81 kb, respectively), most represented new SSR markers, the majority had determined physical positions, and a large number were genic or putative single-locus SSR markers. We also constructed a comprehensive database for the newly developed SSR markers, which was integrated with public Brassica SSR markers and annotated genome components. The genome-wide SSR markers developed in this study provide a useful tool to extend the annotated genome resources of sequenced Brassica species to genetic study/breeding in different Brassica species.

  1. The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

    Science.gov (United States)

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.

    2013-01-01

    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  2. Reference-quality genome sequence of Aegilops tauschii, the source of wheat D genome, shows that recombination shapes genome structure and evolution

    Science.gov (United States)

    Aegilops tauschii is the diploid progenitor of the D genome of hexaploid wheat and an important genetic resource for wheat. A reference-quality sequence for the Ae. tauschii genome was produced with a combination of ordered-clone sequencing, whole-genome shotgun sequencing, and BioNano optical geno...

  3. Characterization of Human Cytomegalovirus Genome Diversity in Immunocompromised Hosts by Whole-Genome Sequencing Directly From Clinical Specimens.

    Science.gov (United States)

    Hage, Elias; Wilkie, Gavin S; Linnenweber-Held, Silvia; Dhingra, Akshay; Suárez, Nicolás M; Schmidt, Julius J; Kay-Fedorov, Penelope C; Mischak-Weissinger, Eva; Heim, Albert; Schwarz, Anke; Schulz, Thomas F; Davison, Andrew J; Ganzenmueller, Tina

    2017-06-01

    Advances in next-generation sequencing (NGS) technologies allow comprehensive studies of genetic diversity over the entire genome of human cytomegalovirus (HCMV), a significant pathogen for immunocompromised individuals. Next-generation sequencing was performed on target enriched sequence libraries prepared directly from a variety of clinical specimens (blood, urine, breast milk, respiratory samples, biopsies, and vitreous humor) obtained longitudinally or from different anatomical compartments from 20 HCMV-infected patients (renal transplant recipients, stem cell transplant recipients, and congenitally infected children). De novo-assembled HCMV genome sequences were obtained for 57 of 68 sequenced samples. Analysis of longitudinal or compartmental HCMV diversity revealed various patterns: no major differences were detected among longitudinal, intraindividual blood samples from 9 of 15 patients and in most of the patients with compartmental samples, whereas a switch of the major HCMV population was observed in 6 individuals with sequential blood samples and upon compartmental analysis of 1 patient with HCMV retinitis. Variant analysis revealed additional aspects of minor virus population dynamics and antiviral-resistance mutations. In immunosuppressed patients, HCMV can remain relatively stable or undergo drastic genomic changes that are suggestive of the emergence of minor resident strains or de novo infection. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  4. SOLiD sequencing of four Vibrio vulnificus genomes enables comparative genomic analysis and identification of candidate clade-specific virulence genes

    Directory of Open Access Journals (Sweden)

    Telonis-Scott Marina

    2010-09-01

    Full Text Available Abstract Background Vibrio vulnificus is the leading cause of reported death from consumption of seafood in the United States. Despite several decades of research on molecular pathogenesis, much remains to be learned about the mechanisms of virulence of this opportunistic bacterial pathogen. The two complete and annotated genomic DNA sequences of V. vulnificus belong to strains of clade 2, which is the predominant clade among clinical strains. Clade 2 strains generally possess higher virulence potential in animal models of disease compared with clade 1, which predominates among environmental strains. SOLiD sequencing of four V. vulnificus strains representing different clades (1 and 2 and biotypes (1 and 2 was used for comparative genomic analysis. Results Greater than 4,100,000 bases were sequenced of each strain, yielding approximately 100-fold coverage for each of the four genomes. Although the read lengths of SOLiD genomic sequencing were only 35 nt, we were able to make significant conclusions about the unique and shared sequences among the genomes, including identification of single nucleotide polymorphisms. Comparative analysis of the newly sequenced genomes to the existing reference genomes enabled the identification of 3,459 core V. vulnificus genes shared among all six strains and 80 clade 2-specific genes. We identified 523,161 SNPs among the six genomes. Conclusions We were able to glean much information about the genomic content of each strain using next generation sequencing. Flp pili, GGDEF proteins, and genomic island XII were identified as possible virulence factors because of their presence in virulent sequenced strains. Genomic comparisons also point toward the involvement of sialic acid catabolism in pathogenesis.

  5. Five Complete Chloroplast Genome Sequences from Diospyros: Genome Organization and Comparative Analysis.

    Science.gov (United States)

    Fu, Jianmin; Liu, Huimin; Hu, Jingjing; Liang, Yuqin; Liang, Jinjun; Wuyun, Tana; Tan, Xiaofeng

    2016-01-01

    Diospyros is the largest genus in Ebenaceae, comprising more than 500 species with remarkable economic value, especially Diospyros kaki Thunb., which has traditionally been an important food resource in China, Korea, and Japan. Complete chloroplast (cp) genomes from D. kaki, D. lotus L., D. oleifera Cheng., D. glaucifolia Metc., and Diospyros 'Jinzaoshi' were sequenced using Illumina sequencing technology. This is the first cp genome reported in Ebenaceae. The cp genome sequences of Diospyros ranged from 157,300 to 157,784 bp in length, presenting a typical quadripartite structure with two inverted repeats each separated by one large and one small single-copy region. For each cp genome, 134 genes were annotated, including 80 protein-coding, 31 tRNA, and 4 rRNA unique genes. In all, 179 repeats and 283 single sequence repeats were identified. Four hypervariable regions, namely, intergenic region of trnQ_rps16, trnV_ndhC, and psbD_trnT, and intron of ndhA, were identified in the Diospyros genomes. Phylogenetic analyses based on the whole cp genome, protein-coding, and intergenic and intron sequences indicated that D. oleifera is closely related to D. kaki and could be used as a model plant for future research on D. kaki; to our knowledge, this is proposed for the first time. Further, these analyses together with two large deletions (301 and 140 bp) in the cp genome of D. 'Jinzaoshi', support its placement as a new species in Diospyros. Both maximum parsimony and likelihood analyses for 19 taxa indicated the basal position of Ericales in asterids and suggested that Ebenaceae is monophyletic in Ericales.

  6. Five Complete Chloroplast Genome Sequences from Diospyros: Genome Organization and Comparative Analysis.

    Directory of Open Access Journals (Sweden)

    Jianmin Fu

    Full Text Available Diospyros is the largest genus in Ebenaceae, comprising more than 500 species with remarkable economic value, especially Diospyros kaki Thunb., which has traditionally been an important food resource in China, Korea, and Japan. Complete chloroplast (cp genomes from D. kaki, D. lotus L., D. oleifera Cheng., D. glaucifolia Metc., and Diospyros 'Jinzaoshi' were sequenced using Illumina sequencing technology. This is the first cp genome reported in Ebenaceae. The cp genome sequences of Diospyros ranged from 157,300 to 157,784 bp in length, presenting a typical quadripartite structure with two inverted repeats each separated by one large and one small single-copy region. For each cp genome, 134 genes were annotated, including 80 protein-coding, 31 tRNA, and 4 rRNA unique genes. In all, 179 repeats and 283 single sequence repeats were identified. Four hypervariable regions, namely, intergenic region of trnQ_rps16, trnV_ndhC, and psbD_trnT, and intron of ndhA, were identified in the Diospyros genomes. Phylogenetic analyses based on the whole cp genome, protein-coding, and intergenic and intron sequences indicated that D. oleifera is closely related to D. kaki and could be used as a model plant for future research on D. kaki; to our knowledge, this is proposed for the first time. Further, these analyses together with two large deletions (301 and 140 bp in the cp genome of D. 'Jinzaoshi', support its placement as a new species in Diospyros. Both maximum parsimony and likelihood analyses for 19 taxa indicated the basal position of Ericales in asterids and suggested that Ebenaceae is monophyletic in Ericales.

  7. Are Escherichia coli Pathotypes Still Relevant in the Era of Whole-Genome Sequencing?

    Science.gov (United States)

    Robins-Browne, Roy M.; Holt, Kathryn E.; Ingle, Danielle J.; Hocking, Dianna M.; Yang, Ji; Tauschek, Marija

    2016-01-01

    The empirical and pragmatic nature of diagnostic microbiology has given rise to several different schemes to subtype E.coli, including biotyping, serotyping, and pathotyping. These schemes have proved invaluable in identifying and tracking outbreaks, and for prognostication in individual cases of infection, but they are imprecise and potentially misleading due to the malleability and continuous evolution of E. coli. Whole genome sequencing can be used to accurately determine E. coli subtypes that are based on allelic variation or differences in gene content, such as serotyping and pathotyping. Whole genome sequencing also provides information about single nucleotide polymorphisms in the core genome of E. coli, which form the basis of sequence typing, and is more reliable than other systems for tracking the evolution and spread of individual strains. A typing scheme for E. coli based on genome sequences that includes elements of both the core and accessory genomes, should reduce typing anomalies and promote understanding of how different varieties of E. coli spread and cause disease. Such a scheme could also define pathotypes more precisely than current methods. PMID:27917373

  8. The pan-genome of the animal pathogen Corynebacterium pseudotuberculosis reveals differences in genome plasticity between the biovar ovis and equi strains

    DEFF Research Database (Denmark)

    Soares, Siomar C; Silva, Artur; Trost, Eva

    2013-01-01

    , Corynebacterium pseudotuberculosis infections pose a rising worldwide economic problem in ruminants. The complete genome sequences of 15 C. pseudotuberculosis strains isolated from different hosts and countries were comparatively analyzed using a pan-genomic strategy. Phylogenomic, pan-genomic, core genomic...

  9. Human genetics and genomics a decade after the release of the draft sequence of the human genome

    Science.gov (United States)

    2011-01-01

    Substantial progress has been made in human genetics and genomics research over the past ten years since the publication of the draft sequence of the human genome in 2001. Findings emanating directly from the Human Genome Project, together with those from follow-on studies, have had an enormous impact on our understanding of the architecture and function of the human genome. Major developments have been made in cataloguing genetic variation, the International HapMap Project, and with respect to advances in genotyping technologies. These developments are vital for the emergence of genome-wide association studies in the investigation of complex diseases and traits. In parallel, the advent of high-throughput sequencing technologies has ushered in the 'personal genome sequencing' era for both normal and cancer genomes, and made possible large-scale genome sequencing studies such as the 1000 Genomes Project and the International Cancer Genome Consortium. The high-throughput sequencing and sequence-capture technologies are also providing new opportunities to study Mendelian disorders through exome sequencing and whole-genome sequencing. This paper reviews these major developments in human genetics and genomics over the past decade. PMID:22155605

  10. Genome sequencing of chimpanzee malaria parasites reveals possible pathways of adaptation to human hosts

    KAUST Repository

    Otto, Thomas D.

    2014-09-09

    Plasmodium falciparum causes most human malaria deaths, having prehistorically evolved from parasites of African Great Apes. Here we explore the genomic basis of P. falciparum adaptation to human hosts by fully sequencing the genome of the closely related chimpanzee parasite species P. reichenowi, and obtaining partial sequence data from a more distantly related chimpanzee parasite (P. gaboni). The close relationship between P. reichenowi and P. falciparum is emphasized by almost complete conservation of genomic synteny, but against this strikingly conserved background we observe major differences at loci involved in erythrocyte invasion. The organization of most virulence-associated multigene families, including the hypervariable var genes, is broadly conserved, but P. falciparum has a smaller subset of rif and stevor genes whose products are expressed on the infected erythrocyte surface. Genome-wide analysis identifies other loci under recent positive selection, but a limited number of changes at the host–parasite interface may have mediated host switching.

  11. Genome sequence of the tsetse fly (Glossina morsitans ): Vector of African trypanosomiasis

    KAUST Repository

    Watanabe, Junichi

    2014-04-24

    Tsetse flies are the sole vectors of human African trypanosomiasis throughout sub-Saharan Africa. Both sexes of adult tsetse feed exclusively on blood and contribute to disease transmission. Notable differences between tsetse and other disease vectors include obligate microbial symbioses, viviparous reproduction, and lactation. Here, we describe the sequence and annotation of the 366-megabase Glossina morsitans morsitans genome. Analysis of the genome and the 12,308 predicted protein-encoding genes led to multiple discoveries, including chromosomal integrations of bacterial (Wolbachia) genome sequences, a family of lactation-specific proteins, reduced complement of host pathogen recognition proteins, and reduced olfaction/chemosensory associated genes. These genome data provide a foundation for research into trypanosomiasis prevention and yield important insights with broad implications for multiple aspects of tsetse biology.

  12. Complete genome sequence of Mahella australiensis type strain (50-1 BONT)

    Energy Technology Data Exchange (ETDEWEB)

    Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Teshima, Hazuki [Los Alamos National Laboratory (LANL); Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Ngatchou, Olivier Duplex [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Pukall, Rudiger [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Abt, Birte [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute

    2011-01-01

    Mahella australiensis Bonilla Salinas et al. 2004 is the type species of the genus Mahella, which belongs to the family Thermoanaerobacteraceae. The species is of interest because it differs from other known anaerobic spore-forming bacteria in its G+C content, and in certain phenotypic traits, such as carbon source utilization and relationship to temperature. Moreo- ver, it has been discussed that this species might be an indigenous member of petroleum and oil reservoirs. This is the first completed genome sequence of a member of the genus Mahella and the ninth completed type strain genome sequence from the family Thermoanaerobacte- raceae. The 3,135,972 bp long genome with its 2,974 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  13. Whole-genome and Transcriptome Sequencing of Prostate Cancer Identify New Genetic Alterations Driving Disease Progression

    DEFF Research Database (Denmark)

    Ren, Shancheng; Wei, Gong-Hong; Liu, Dongbing

    2018-01-01

    BACKGROUND: Global disparities in prostate cancer (PCa) incidence highlight the urgent need to identify genomic abnormalities in prostate tumors in different ethnic populations including Asian men. OBJECTIVE: To systematically explore the genomic complexity and define disease-driven genetic......-scale and comprehensive genomic data of prostate cancer from Asian population. Identification of these genetic alterations may help advance prostate cancer diagnosis, prognosis, and treatment....... alterations in PCa. DESIGN, SETTING, AND PARTICIPANTS: The study sequenced whole-genome and transcriptome of tumor-benign paired tissues from 65 treatment-naive Chinese PCa patients. Subsequent targeted deep sequencing of 293 PCa-relevant genes was performed in another cohort of 145 prostate tumors. OUTCOME...

  14. Genome sequence of the tsetse fly (Glossina morsitans ): Vector of African trypanosomiasis

    KAUST Repository

    Watanabe, Junichi; Hattori, Masahira; Berriman, Matthew; Lehane, Michael J.; Hall, Neil; Solano, Philippe; Aksoy, Serap; Hide, Winston; Touré , Yé ya Tié moko; Attardo, Geoffrey M.; Darby, Alistair Charles; Toyoda, Atsushi; Hertz-Fowler, Christiane; Larkin, Denis M.; Cotton, James A.; Sanders, Mandy J.; Swain, Martin T.; Quail, Michael A.; Inoue, Noboru; Ravel, Sophie; Taylor, Todd Duane; Srivastava, Tulika P.; Sharma, Vineet Kumar; Warren, Wesley C.; Wilson, Richard K.; Suzuki, Yutaka; Lawson, Daniel; Hughes, Daniel Seth Toney; Megy, Karyn; Masiga, Daniel K.; Mireji, Paul Odhiambo; Hansen, Immo Alex; Van Den Abbeele, Jan; Benoit, Joshua B.; Bourtzis, Kostas; Obiero, George F O; Robertson, Hugh M.; Jones, Jeffery W.; Zhou, Jingjiang; Field, Linda M.; Friedrich, Markus; Nyanjom, Steven R G; Telleria, Erich Loza; Caljon, Guy; Ribeiro, José M. C.; Acosta-Serrano, Alvaro; Ooi, Cherpheng; Rose, Clair; Price, David P.; Haines, Lee Rafuse; Christoffels, Alan G.; Sim, Cheolho; Pham, Daphne Q D; Denlinger, David L.; Geiser, Dawn L.; Omedo, Irene A.; Winzerling, Joy J.; Peyton, Justin T.; Marucha, Kevin K.; Jonas, Mario; Meuti, Megan E.; Rawlings, Neil David; Zhang, Qirui; Macharia, Rosaline Wanjiru; Michalkova, Veronika; Dashti, Zahra Jalali Sefid; Baumann, Aaron A.; Gä de, Gerd; Marco, Heather G.; Caers, Jelle; Schoofs, Liliane; Riehle, Michael A.; Hu, Wanqi; Tu, Zhijian; Tarone, Aaron M.; Malacrida, Anna Rodolfa; Kibet, Caleb K.; Scolari, Francesca; Koekemoer, J. J. O.; Willis, Judith H.; Gomulski, Ludvik M.; Falchetto, Marco; Scott, Maxwell J.; Fu, Shuhua; Sze, Singhoi; Luiz, Thiago; Weiss, Brian L.; Walshe, Deirdre P.; Wang, Jingwen; Wamalwa, Mark; Mwangi, Sarah; Ramphul, Urvashi N.; Snyder, Anna K.; Brelsfoard, Corey L.; Thomas, Gavin H.; Tsiamis, George; Arensburger, Peter; Rio, Rita V M; Macdonald, Sandy J.; Panji, Sumir; Kruger, Adele F.; Benkahla, Alia; Balyeidhusa, Apollo Simon Peter; Msangi, Atway R.; Okoro, Chinyere K.; Stephens, Dawn; Stanley, Eleanor J.; Mpondo, Feziwe; Wamwiri, Florence N.; Mramba, Furaha; Siwo, Geoffrey H.; Githinji, George; Harkins, Gordon William; Murilla, Grace Adira; Lehvä slaiho, Heikki; Malele, Imna I.; Auma, Joanna Eseri; Kinyua, Johnson K.; Ouma, Johnson O.; Okedi, Loyce M A; Manga, Lucien; Aslett, Martin A.; Koffi, Mathurin; Gaunt, Michael W.; Makgamathe, Mmule; Mulder, Nicola Jane; Manangwa, Oliver; Abila, Patrick P.; Wincker, Patrick; Gregory, Richard I.; Bateta, Rosemary; Sakate, Ryuichi; Ommeh, Sheila; Lehane, Stella M.; Imanishi, Tadashi; Osamor, Victor Chukwudi; Kawahara, Yoshihiro

    2014-01-01

    Tsetse flies are the sole vectors of human African trypanosomiasis throughout sub-Saharan Africa. Both sexes of adult tsetse feed exclusively on blood and contribute to disease transmission. Notable differences between tsetse and other disease vectors include obligate microbial symbioses, viviparous reproduction, and lactation. Here, we describe the sequence and annotation of the 366-megabase Glossina morsitans morsitans genome. Analysis of the genome and the 12,308 predicted protein-encoding genes led to multiple discoveries, including chromosomal integrations of bacterial (Wolbachia) genome sequences, a family of lactation-specific proteins, reduced complement of host pathogen recognition proteins, and reduced olfaction/chemosensory associated genes. These genome data provide a foundation for research into trypanosomiasis prevention and yield important insights with broad implications for multiple aspects of tsetse biology.

  15. Large-scale chromosome folding versus genomic DNA sequences: A discrete double Fourier transform technique.

    Science.gov (United States)

    Chechetkin, V R; Lobzin, V V

    2017-08-07

    Using state-of-the-art techniques combining imaging methods and high-throughput genomic mapping tools leaded to the significant progress in detailing chromosome architecture of various organisms. However, a gap still remains between the rapidly growing structural data on the chromosome folding and the large-scale genome organization. Could a part of information on the chromosome folding be obtained directly from underlying genomic DNA sequences abundantly stored in the databanks? To answer this question, we developed an original discrete double Fourier transform (DDFT). DDFT serves for the detection of large-scale genome regularities associated with domains/units at the different levels of hierarchical chromosome folding. The method is versatile and can be applied to both genomic DNA sequences and corresponding physico-chemical parameters such as base-pairing free energy. The latter characteristic is closely related to the replication and transcription and can also be used for the assessment of temperature or supercoiling effects on the chromosome folding. We tested the method on the genome of E. coli K-12 and found good correspondence with the annotated domains/units established experimentally. As a brief illustration of further abilities of DDFT, the study of large-scale genome organization for bacteriophage PHIX174 and bacterium Caulobacter crescentus was also added. The combined experimental, modeling, and bioinformatic DDFT analysis should yield more complete knowledge on the chromosome architecture and genome organization. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Complete genome sequence of the fire blight pathogen Erwinia pyrifoliae DSM 12163T and comparative genomic insights into plant pathogenicity

    Directory of Open Access Journals (Sweden)

    Frey Jürg E

    2010-01-01

    Full Text Available Abstract Background Erwinia pyrifoliae is a newly described necrotrophic pathogen, which causes fire blight on Asian (Nashi pear and is geographically restricted to Eastern Asia. Relatively little is known about its genetics compared to the closely related main fire blight pathogen E. amylovora. Results The genome of the type strain of E. pyrifoliae strain DSM 12163T, was sequenced using both 454 and Solexa pyrosequencing and annotated. The genome contains a circular chromosome of 4.026 Mb and four small plasmids. Based on their respective role in virulence in E. amylovora or related organisms, we identified several putative virulence factors, including type III and type VI secretion systems and their effectors, flagellar genes, sorbitol metabolism, iron uptake determinants, and quorum-sensing components. A deletion in the rpoS gene covering the most conserved region of the protein was identified which may contribute to the difference in virulence/host-range compared to E. amylovora. Comparative genomics with the pome fruit epiphyte Erwinia tasmaniensis Et1/99 showed that both species are overall highly similar, although specific differences were identified, for example the presence of some phage gene-containing regions and a high number of putative genomic islands containing transposases in the E. pyrifoliae DSM 12163T genome. Conclusions The E. pyrifoliae genome is an important addition to the published genome of E. tasmaniensis and the unfinished genome of E. amylovora providing a foundation for re-sequencing additional strains that may shed light on the evolution of the host-range and virulence/pathogenicity of this important group of plant-associated bacteria.

  17. Genome Sequence of the Probiotic Strain Lactobacillus rhamnosus (Formerly Lactobacillus casei) LOCK900

    OpenAIRE

    Aleksandrzak-Piekarczyk, Tamara; Koryszewska-Bagi?ska, Anna; Bardowski, Jacek

    2013-01-01

    Lactobacillus rhamnosus LOCK900 fulfills the criteria required for probiotic strains. In this study, we report a whole-genome sequence of this isolate and compare it with other L.?rhamnosus complete genome sequences already published.

  18. Analysis of the complete genome sequence of Nocardia seriolae UTF1, the causative agent of fish nocardiosis: The first reference genome sequence of the fish pathogenic Nocardia species.

    Science.gov (United States)

    Yasuike, Motoshige; Nishiki, Issei; Iwasaki, Yuki; Nakamura, Yoji; Fujiwara, Atushi; Shimahara, Yoshiko; Kamaishi, Takashi; Yoshida, Terutoyo; Nagai, Satoshi; Kobayashi, Takanori; Katoh, Masaya

    2017-01-01

    Nocardiosis caused by Nocardia seriolae is one of the major threats in the aquaculture of Seriola species (yellowtail; S. quinqueradiata, amberjack; S. dumerili and kingfish; S. lalandi) in Japan. Here, we report the complete nucleotide genome sequence of N. seriolae UTF1, isolated from a cultured yellowtail. The genome is a circular chromosome of 8,121,733 bp with a G+C content of 68.1% that encodes 7,697 predicted proteins. In the N. seriolae UTF1 predicted genes, we found orthologs of virulence factors of pathogenic mycobacteria and human clinical Nocardia isolates involved in host cell invasion, modulation of phagocyte function and survival inside the macrophages. The virulence factor candidates provide an essential basis for understanding their pathogenic mechanisms at the molecular level by the fish nocardiosis research community in future studies. We also found many potential antibiotic resistance genes on the N. seriolae UTF1 chromosome. Comparative analysis with the four existing complete genomes, N. farcinica IFM 10152, N. brasiliensis HUJEG-1 and N. cyriacigeorgica GUH-2 and N. nova SH22a, revealed that 2,745 orthologous genes were present in all five Nocardia genomes (core genes) and 1,982 genes were unique to N. seriolae UTF1. In particular, the N. seriolae UTF1 genome contains a greater number of mobile elements and genes of unknown function that comprise the differences in structure and gene content from the other Nocardia genomes. In addition, a lot of the N. seriolae UTF1-specific genes were assigned to the ABC transport system. Because of limited resources in ocean environments, these N. seriolae UTF1 specific ABC transporters might facilitate adaptation strategies essential for marine environment survival. Thus, the availability of the complete N. seriolae UTF1 genome sequence will provide a valuable resource for comparative genomic studies of N. seriolae isolates, as well as provide new insights into the ecological and functional diversity of

  19. Genome sequence and description of Anaerosalibacter massiliensis sp. nov.

    Directory of Open Access Journals (Sweden)

    N. Dione

    2016-03-01

    Full Text Available Anaerosalibacter massiliensis sp. nov. strain ND1T (= CSUR P762 = DSM 27308 is the type strain of A. massiliensis sp. nov., a new species within the genus Anaerosalibacter. This strain, the genome of which is described here, was isolated from the faecal flora of a 49-year-old healthy Brazilian man. Anaerosalibacter massiliensis is a Gram-positive, obligate anaerobic rod and member of the family Clostridiaceae. With the complete genome sequence and annotation, we describe here the features of this organism. The 3 197 911 bp long genome (one chromosome but no plasmid contains 3271 protein-coding and 62 RNA genes, including six rRNA genes.

  20. The complete chloroplast genome sequence of Dendrobium nobile.

    Science.gov (United States)

    Yan, Wenjin; Niu, Zhitao; Zhu, Shuying; Ye, Meirong; Ding, Xiaoyu

    2016-11-01

    The complete chloroplast (cp) genome sequence of Dendrobium nobile, an endangered and traditional Chinese medicine with important economic value, is presented in this article. The total genome size is 150,793 bp, containing a large single copy (LSC) region (84,939 bp) and a small single copy region (SSC) (13,310 bp) which were separated by two inverted repeat (IRs) regions (26,272 bp). The overall GC contents of the plastid genome were 38.8%. In total, 130 unique genes were annotated and they were consisted of 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. Fourteen genes contained one or two introns.

  1. Targeted sequencing of large genomic regions with CATCH-Seq.

    Directory of Open Access Journals (Sweden)

    Kenneth Day

    Full Text Available Current target enrichment systems for large-scale next-generation sequencing typically require synthetic oligonucleotides used as capture reagents to isolate sequences of interest. The majority of target enrichment reagents are focused on gene coding regions or promoters en masse. Here we introduce development of a customizable targeted capture system using biotinylated RNA probe baits transcribed from sheared bacterial artificial chromosome clone templates that enables capture of large, contiguous blocks of the genome for sequencing applications. This clone adapted template capture hybridization sequencing (CATCH-Seq procedure can be used to capture both coding and non-coding regions of a gene, and resolve the boundaries of copy number variations within a genomic target site. Furthermore, libraries constructed with methylated adapters prior to solution hybridization also enable targeted bisulfite sequencing. We applied CATCH-Seq to diverse targets ranging in size from 125 kb to 3.5 Mb. Our approach provides a simple and cost effective alternative to other capture platforms because of template-based, enzymatic probe synthesis and the lack of oligonucleotide design costs. Given its similarity in procedure, CATCH-Seq can also be performed in parallel with commercial systems.

  2. The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus).

    Science.gov (United States)

    Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya

    2011-05-01

    The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% identical in ORF5. These sequence comparisons and previously studied biological properties indicate that PeVYV is a distinctly different virus and belongs to a new species of the genus Polerovirus.

  3. Construction of an integrated database to support genomic sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert, W.; Overbeek, R.

    1994-11-01

    The central goal of this project is to develop an integrated database to support comparative analysis of genomes including DNA sequence data, protein sequence data, gene expression data and metabolism data. In developing the logic-based system GenoBase, a broader integration of available data was achieved due to assistance from collaborators. Current goals are to easily include new forms of data as they become available and to easily navigate through the ensemble of objects described within the database. This report comments on progress made in these areas.

  4. Combined evidence annotation of transposable elements in genome sequences.

    Directory of Open Access Journals (Sweden)

    Hadi Quesneville

    2005-07-01

    Full Text Available Transposable elements (TEs are mobile, repetitive sequences that make up significant fractions of metazoan genomes. Despite their near ubiquity and importance in genome and chromosome biology, most efforts to annotate TEs in genome sequences rely on the results of a single computational program, RepeatMasker. In contrast, recent advances in gene annotation indicate that high-quality gene models can be produced from combining multiple independent sources of computational evidence. To elevate the quality of TE annotations to a level comparable to that of gene models, we have developed a combined evidence-model TE annotation pipeline, analogous to systems used for gene annotation, by integrating results from multiple homology-based and de novo TE identification methods. As proof of principle, we have annotated "TE models" in Drosophila melanogaster Release 4 genomic sequences using the combined computational evidence derived from RepeatMasker, BLASTER, TBLASTX, all-by-all BLASTN, RECON, TE-HMM and the previous Release 3.1 annotation. Our system is designed for use with the Apollo genome annotation tool, allowing automatic results to be curated manually to produce reliable annotations. The euchromatic TE fraction of D. melanogaster is now estimated at 5.3% (cf. 3.86% in Release 3.1, and we found a substantially higher number of TEs (n = 6,013 than previously identified (n = 1,572. Most of the new TEs derive from small fragments of a few hundred nucleotides long and highly abundant families not previously annotated (e.g., INE-1. We also estimated that 518 TE copies (8.6% are inserted into at least one other TE, forming a nest of elements. The pipeline allows rapid and thorough annotation of even the most complex TE models, including highly deleted and/or nested elements such as those often found in heterochromatic sequences. Our pipeline can be easily adapted to other genome sequences, such as those of the D. melanogaster heterochromatin or other

  5. The complete chloroplast genome sequence of Euonymus japonicus (Celastraceae).

    Science.gov (United States)

    Choi, Kyoung Su; Park, SeonJoo

    2016-09-01

    The complete chloroplast (cp) genome sequence of the Euonymus japonicus, the first sequenced of the genus Euonymus, was reported in this study. The total length was 157 637 bp, containing a pair of 26 678 bp inverted repeat region (IR), which were separated by small single copy (SSC) region and large single copy (LSC) region of 18 340 bp and 85 941 bp, respectively. This genome contains 107 unique genes, including 74 coding genes, four rRNA genes, and 29 tRNA genes. Seventeen genes contain intron of E. japonicus, of which three genes (clpP, ycf3, and rps12) include two introns. The maximum likelihood (ML) phylogenetic analysis revealed that E. japonicus was closely related to Manihot and Populus.

  6. The "most wanted" taxa from the human microbiome for whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Anthony A Fodor

    Full Text Available The goal of the Human Microbiome Project (HMP is to generate a comprehensive catalog of human-associated microorganisms including reference genomes representing the most common species. Toward this goal, the HMP has characterized the microbial communities at 18 body habitats in a cohort of over 200 healthy volunteers using 16S rRNA gene (16S sequencing and has generated nearly 1,000 reference genomes from human-associated microorganisms. To determine how well current reference genome collections capture the diversity observed among the healthy microbiome and to guide isolation and future sequencing of microbiome members, we compared the HMP's 16S data sets to several reference 16S collections to create a 'most wanted' list of taxa for sequencing. Our analysis revealed that the diversity of commonly occurring taxa within the HMP cohort microbiome is relatively modest, few novel taxa are represented by these OTUs and many common taxa among HMP volunteers recur across different populations of healthy humans. Taken together, these results suggest that it should be possible to perform whole-genome sequencing on a large fraction of the human microbiome, including the 'most wanted', and that these sequences should serve to support microbiome studies across multiple cohorts. Also, in stark contrast to other taxa, the 'most wanted' organisms are poorly represented among culture collections suggesting that novel culture- and single-cell-based methods will be required to isolate these organisms for sequencing.

  7. Large Scale Sequencing of Dothideomycetes Provides Insights into Genome Evolution and Adaptation

    Energy Technology Data Exchange (ETDEWEB)

    Haridas, Sajeet; Crous, Pedro; Binder, Manfred; Spatafora, Joseph; Grigoriev, Igor

    2015-03-16

    Dothideomycetes is the largest and most diverse class of ascomycete fungi with 23 orders 110 families, 1300 genera and over 19,000 known species. We present comparative analysis of 70 Dothideomycete genomes including over 50 that we sequenced and are as yet unpublished. This extensive sampling has almost quadrupled the previous study of 18 species and uncovered a 10 fold range of genome sizes. We were able to clarify the phylogenetic positions of several species whose origins were unclear in previous morphological and sequence comparison studies. We analyzed selected gene families including proteases, transporters and small secreted proteins and show that major differences in gene content is influenced by speciation.

  8. Genome sequence of carboxylesterase, carboxylase and xylose isomerase producing alkaliphilic haloarchaeon Haloterrigena turkmenica WANU15

    Directory of Open Access Journals (Sweden)

    Samy Selim

    2016-03-01

    Full Text Available We report draft genome sequence of Haloterrigena turkmenica strain WANU15, isolated from Soda Lake. The draft genome size is 2,950,899 bp with a G + C content of 64% and contains 49 RNA sequence. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. LKCV00000000. Keywords: Soda Lake, Haloterrigena turkmenica, Carboxylesterase, Carboxylase, Xylose isomerase, Whole genome sequencing

  9. Functional annotation from the genome sequence of the giant panda

    OpenAIRE

    Huo, Tong; Zhang, Yinjie; Lin, Jianping

    2012-01-01

    The giant panda is one of the most critically endangered species due to the fragmentation and loss of its habitat. Studying the functions of proteins in this animal, especially specific trait-related proteins, is therefore necessary to protect the species. In this work, the functions of these proteins were investigated using the genome sequence of the giant panda. Data on 21,001 proteins and their functions were stored in the Giant Panda Protein Database, in which the proteins were divided in...

  10. Complete Genome Sequence of Mycobacterium xenopi Type Strain RIVM700367

    KAUST Repository

    Abdallah, A. M.; Rashid, M.; Adroub, S. A.; Elabdalaoui, H.; Ali, Shahjahan; van Soolingen, D.; Bitter, W.; Pain, Arnab

    2012-01-01

    Mycobacterium xenopi is a slow-growing, thermophilic, water-related Mycobacterium species. Like other nontuberculous mycobacteria, M. xenopi more commonly infects humans with altered immune function, such as chronic obstructive pulmonary disease patients. It is considered clinically relevant in a significant proportion of the patients from whom it is isolated. We report here the whole genome sequence of M. xenopi type strain RIVM700367.

  11. Mitochondrial genome sequence of the Tibetan wild ass (Equus kiang).

    Science.gov (United States)

    Luo, Yongjun; Chen, Yu; Liu, Fuyu; Jiang, Chunhua; Gao, Yuqi

    2011-02-01

    The Tibetan wild ass, or kiang (Equus kiang) is endemic to the cold and hypoxic (4000-7000 m above sea level) climates of the montane and alpine grasslands of the Tibetan Plateau. We report here the complete nucleotide sequence of the E. kiang mitochondrial genome. Our results show that E. kiang mitochondrial DNA is 16,634 bp long, and predicted to encode all the 37 genes that are typical for vertebrates.

  12. Complete Genome Sequence of Mycobacterium xenopi Type Strain RIVM700367

    KAUST Repository

    Abdallah, A. M.

    2012-05-24

    Mycobacterium xenopi is a slow-growing, thermophilic, water-related Mycobacterium species. Like other nontuberculous mycobacteria, M. xenopi more commonly infects humans with altered immune function, such as chronic obstructive pulmonary disease patients. It is considered clinically relevant in a significant proportion of the patients from whom it is isolated. We report here the whole genome sequence of M. xenopi type strain RIVM700367.

  13. A Genome Sequencing Program for Novel Undiagnosed Diseases

    OpenAIRE

    Bloss, Cinnamon S.; Scott-Van Zeeland, Ashley A.; Topol, Sarah E.; Darst, Burcu F.; Boeldt, Debra L.; Erikson, Galina A.; Bethel, Kelly J.; Bjork, Robert L.; Friedman, Jennifer R.; Hwynn, Nelson; Patay, Bradley A.; Pockros, Paul J.; Scott, Erick R.; Simon, Ronald A.; Williams, Gary W.

    2015-01-01

    Purpose The Scripps Idiopathic Diseases of huMan (IDIOM) study aims to discover novel gene-disease relationships and provide molecular genetic diagnosis and treatment guidance for individuals with novel diseases using genome sequencing integrated with clinical assessment and multidisciplinary case review. Methods Here we describe the IDIOM study operational protocol and initial results. Results 121 cases underwent first tier review by the principal investigators to determine if the primary in...

  14. Whole Genome Sequencing of a Healthy Aging Cohort

    OpenAIRE

    Erikson, Galina A.; Bodian, Dale L.; Rueda, Manuel; Molparia, Bhuvan; Scott, Erick R.; Scott-Van Zeeland, Ashley A.; Topol, Sarah E.; Wineinger, Nathan E.; Niederhuber, John E.; Topol, Eric J.; Torkamani, Ali

    2016-01-01

    Studies of long-lived individuals have revealed few genetic mechanisms for protection against age-associated disease. Therefore, we pursued genome sequencing of a related phenotype – healthy aging – to understand the genetics of disease-free aging without medical intervention. In contrast with studies of exceptional longevity, usually focused on centenarians, healthy aging is not associated with known longevity variants but is associated with reduced genetic susceptibility to Alzheimer and co...

  15. Complete genome sequence of Marivirga tractuosa type strain (H-43).

    OpenAIRE

    Pagani, Ioanna; Chertkov, Olga; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Nolan, Matt; Saunders, Elizabeth; Pitluck, Sam; Held, Brittany; Goodwin, Lynne; Liolios, Konstantinos; Ovchinikova, Galina

    2011-01-01

    Marivirga tractuosa (Lewin 1969) Nedashkovskaya et al. 2010 is the type species of the genus Marivirga, which belongs to the family Flammeovirgaceae. Members of this genus are of interest because of their gliding motility. The species is of interest because representative strains show resistance to several antibiotics, including gentamicin, kanamycin, neomycin, polymixin and streptomycin. This is the first complete genome sequence of a member of the family Flammeovirgaceae. Here we describe t...

  16. Genome sequence of Yersinia pestis, the causative agent of plague.

    Science.gov (United States)

    Parkhill, J; Wren, B W; Thomson, N R; Titball, R W; Holden, M T; Prentice, M B; Sebaihia, M; James, K D; Churcher, C; Mungall, K L; Baker, S; Basham, D; Bentley, S D; Brooks, K; Cerdeño-Tárraga, A M; Chillingworth, T; Cronin, A; Davies, R M; Davis, P; Dougan, G; Feltwell, T; Hamlin, N; Holroyd, S; Jagels, K; Karlyshev, A V; Leather, S; Moule, S; Oyston, P C; Quail, M; Rutherford, K; Simmonds, M; Skelton, J; Stevens, K; Whitehead, S; Barrell, B G

    2001-10-04

    The Gram-negative bacterium Yersinia pestis is the causative agent of the systemic invasive infectious disease classically referred to as plague, and has been responsible for three human pandemics: the Justinian plague (sixth to eighth centuries), the Black Death (fourteenth to nineteenth centuries) and modern plague (nineteenth century to the present day). The recent identification of strains resistant to multiple drugs and the potential use of Y. pestis as an agent of biological warfare mean that plague still poses a threat to human health. Here we report the complete genome sequence of Y. pestis strain CO92, consisting of a 4.65-megabase (Mb) chromosome and three plasmids of 96.2 kilobases (kb), 70.3 kb and 9.6 kb. The genome is unusually rich in insertion sequences and displays anomalies in GC base-composition bias, indicating frequent intragenomic recombination. Many genes seem to have been acquired from other bacteria and viruses (including adhesins, secretion systems and insecticidal toxins). The genome contains around 150 pseudogenes, many of which are remnants of a redundant enteropathogenic lifestyle. The evidence of ongoing genome fluidity, expansion and decay suggests Y. pestis is a pathogen that has undergone large-scale genetic flux and provides a unique insight into the ways in which new and highly virulent pathogens evolve.

  17. Complete genome sequence of Halanaerobium praevalens type strain (GSLT)

    Energy Technology Data Exchange (ETDEWEB)

    Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Chertkov, Olga [Los Alamos National Laboratory (LANL); Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kannan, K. Palani [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute

    2011-01-01

    Halanaerobium praevalens Zeikus et al. 1984 is the type species of the genus Halanaero- bium, which in turn is the type genus of the family Halanaerobiaceae. The species is of inter- est because it is able to reduce a variety of nitro-substituted aromatic compounds at a high rate, and because of its ability to degrade organic pollutants. The strain is also of interest be- cause it functions as a hydrolytic bacterium, fermenting complex organic matter and produc- ing intermediary metabolites for other trophic groups such as sulfate-reducing and methano- genic bacteria. It is further reported as being involved in carbon removal in the Great Salt Lake, its source of isolation. This is the first completed genome sequence of a representative of the genus Halanaerobium and the second genome sequence from a type strain of the fami- ly Halanaerobiaceae. The 2,309,262 bp long genome with its 2,110 protein-coding and 70 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  18. Complete genome sequence of Rhodospirillum rubrum type strain (S1).

    Science.gov (United States)

    Munk, A Christine; Copeland, Alex; Lucas, Susan; Lapidus, Alla; Del Rio, Tijana Glavina; Barry, Kerrie; Detter, John C; Hammon, Nancy; Israni, Sanjay; Pitluck, Sam; Brettin, Thomas; Bruce, David; Han, Cliff; Tapia, Roxanne; Gilna, Paul; Schmutz, Jeremy; Larimer, Frank; Land, Miriam; Kyrpides, Nikos C; Mavromatis, Konstantinos; Richardson, Paul; Rohde, Manfred; Göker, Markus; Klenk, Hans-Peter; Zhang, Yaoping; Roberts, Gary P; Reslewic, Susan; Schwartz, David C

    2011-07-01

    Rhodospirillum rubrum (Esmarch 1887) Molisch 1907 is the type species of the genus Rhodospirillum, which is the type genus of the family Rhodospirillaceae in the class Alphaproteobacteria. The species is of special interest because it is an anoxygenic phototroph that produces extracellular elemental sulfur (instead of oxygen) while harvesting light. It contains one of the most simple photosynthetic systems currently known, lacking light harvesting complex 2. Strain S1(T) can grow on carbon monoxide as sole energy source. With currently over 1,750 PubMed entries, R. rubrum is one of the most intensively studied microbial species, in particular for physiological and genetic studies. Next to R. centenum strain SW, the genome sequence of strain S1(T) is only the second genome of a member of the genus Rhodospirillum to be published, but the first type strain genome from the genus. The 4,352,825 bp long chromosome and 53,732 bp plasmid with a total of 3,850 protein-coding and 83 RNA genes were sequenced as part of the DOE Joint Genome Institute Program DOEM 2002.

  19. Complete genome sequence of Desulfomicrobium baculatum type strain (XT)

    Energy Technology Data Exchange (ETDEWEB)

    Copeland, Alex; Spring, Stefan; Goker, Markus; Schneider, Susanne; Lapidus, Alla; Glavina Del Rio, Tijana; Tice, Hope; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Nolan, Matt; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C; Meincke, Linda; Sims, David; Brettin, Thomas; Detter, John C; Han, Cliff; Chain, Patrick; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C; Lucas, Susan

    2009-05-20

    Desulfomicrobium baculatum is the type species of the genus Desulfomicrobium, which is the type genus of the family Desulfomicrobiaceae. It is of phylogenetic interest because of the isolated location of the family Desulfomicrobiaceae within the order Desulfovibrionales. D. baculatum strain XT is a Gram-negative, motile, sulfate-reducing bacterium isolated from water-saturated manganese carbonate ore. It is strictly anaerobic and does not require NaCl for growth, although NaCl concentrations up to 6percent (w/v) are tolerated. The metabolism is respiratory or fermentative. In the presence of sulfate, pyruvate and lactate are incompletely oxidized to acetate and CO2. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first completed genome sequence of a member of the deltaproteobacterial family Desulfomicrobiaceae, and this 3,942,657 bp long single replicon genome with its 3494 protein-coding and 72 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  20. Variable selection models for genomic selection using whole-genome sequence data and singular value decomposition.

    Science.gov (United States)

    Meuwissen, Theo H E; Indahl, Ulf G; Ødegård, Jørgen

    2017-12-27

    Non-linear Bayesian genomic prediction models such as BayesA/B/C/R involve iteration and mostly Markov chain Monte Carlo (MCMC) algorithms, which are computationally expensive, especially when whole-genome sequence (WGS) data are analyzed. Singular value decomposition (SVD) of the genotype matrix can facilitate genomic prediction in large datasets, and can be used to estimate marker effects and their prediction error variances (PEV) in a computationally efficient manner. Here, we developed, implemented, and evaluated a direct, non-iterative method for the estimation of marker effects for the BayesC genomic prediction model. The BayesC model assumes a priori that markers have normally distributed effects with probability [Formula: see text] and no effect with probability (1 - [Formula: see text]). Marker effects and their PEV are estimated by using SVD and the posterior probability of the marker having a non-zero effect is calculated. These posterior probabilities are used to obtain marker-specific effect variances, which are subsequently used to approximate BayesC estimates of marker effects in a linear model. A computer simulation study was conducted to compare alternative genomic prediction methods, where a single reference generation was used to estimate marker effects, which were subsequently used for 10 generations of forward prediction, for which accuracies were evaluated. SVD-based posterior probabilities of markers having non-zero effects were generally lower than MCMC-based posterior probabilities, but for some regions the opposite occurred, resulting in clear signals for QTL-rich regions. The accuracies of breeding values estimated using SVD- and MCMC-based BayesC analyses were similar across the 10 generations of forward prediction. For an intermediate number of generations (2 to 5) of forward prediction, accuracies obtained with the BayesC model tended to be slightly higher than accuracies obtained using the best linear unbiased prediction of SNP

  1. Complete genome sequences of two strains of Treponema pallidum subsp. pertenue from Ghana, Africa: Identical genome sequences in samples isolated more than 7 years apart.

    Directory of Open Access Journals (Sweden)

    Michal Strouhal

    2017-09-01

    Full Text Available Treponema pallidum subsp. pertenue (TPE is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier and one TPE strain (Fribourg-Blanc isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet.Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively. Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation.The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.

  2. Haematobia irritans dataset of raw sequence reads from Illumina and Pac Bio sequencing of genomic DNA

    Science.gov (United States)

    The genome of the horn fly, Haematobia irritans, was sequenced using Illumina- and Pac Bio-based protocols. Following quality filtering, the raw reads have been deposited at NCBI under the BioProject and BioSample accession numbers PRJNA30967 and SAMN07830356, respectively. The Illumina reads are un...

  3. Genome sequence and genetic diversity of European ash trees.

    Science.gov (United States)

    Sollars, Elizabeth S A; Harper, Andrea L; Kelly, Laura J; Sambles, Christine M; Ramirez-Gonzalez, Ricardo H; Swarbreck, David; Kaithakottil, Gemy; Cooper, Endymion D; Uauy, Cristobal; Havlickova, Lenka; Worswick, Gemma; Studholme, David J; Zohren, Jasmin; Salmon, Deborah L; Clavijo, Bernardo J; Li, Yi; He, Zhesi; Fellgett, Alison; McKinney, Lea Vig; Nielsen, Lene Rostgaard; Douglas, Gerry C; Kjær, Erik Dahl; Downie, J Allan; Boshier, David; Lee, Steve; Clark, Jo; Grant, Murray; Bancroft, Ian; Caccamo, Mario; Buggs, Richard J A

    2017-01-12

    Ash trees (genus Fraxinus, family Oleaceae) are widespread throughout the Northern Hemisphere, but are being devastated in Europe by the fungus Hymenoscyphus fraxineus, causing ash dieback, and in North America by the herbivorous beetle Agrilus planipennis. Here we sequence the genome of a low-heterozygosity Fraxinus excelsior tree from Gloucestershire, UK, annotating 38,852 protein-coding genes of which 25% appear ash specific when compared with the genomes of ten other plant species. Analyses of paralogous genes suggest a whole-genome duplication shared with olive (Olea europaea, Oleaceae). We also re-sequence 37 F. excelsior trees from Europe, finding evidence for apparent long-term decline in effective population size. Using our reference sequence, we re-analyse association transcriptomic data, yielding improved markers for reduced susceptibility to ash dieback. Surveys of these markers in British populations suggest that reduced susceptibility to ash dieback may be more widespread in Great Britain than in Denmark. We also present evidence that susceptibility of trees to H. fraxineus is associated with their iridoid glycoside levels. This rapid, integrated, multidisciplinary research response to an emerging health threat in a non-model organism opens the way for mitigation of the epidemic.

  4. The Personal Genome Project Canada: findings from whole genome sequences of the inaugural 56 participants.

    Science.gov (United States)

    Reuter, Miriam S; Walker, Susan; Thiruvahindrapuram, Bhooma; Whitney, Joe; Cohn, Iris; Sondheimer, Neal; Yuen, Ryan K C; Trost, Brett; Paton, Tara A; Pereira, Sergio L; Herbrick, Jo-Anne; Wintle, Richard F; Merico, Daniele; Howe, Jennifer; MacDonald, Jeffrey R; Lu, Chao; Nalpathamkalam, Thomas; Sung, Wilson W L; Wang, Zhuozhi; Patel, Rohan V; Pellecchia, Giovanna; Wei, John; Strug, Lisa J; Bell, Sherilyn; Kellam, Barbara; Mahtani, Melanie M; Bassett, Anne S; Bombard, Yvonne; Weksberg, Rosanna; Shuman, Cheryl; Cohn, Ronald D; Stavropoulos, Dimitri J; Bowdin, Sarah; Hildebrandt, Matthew R; Wei, Wei; Romm, Asli; Pasceri, Peter; Ellis, James; Ray, Peter; Meyn, M Stephen; Monfared, Nasim; Hosseini, S Mohsen; Joseph-George, Ann M; Keeley, Fred W; Cook, Ryan A; Fiume, Marc; Lee, Hin C; Marshall, Christian R; Davies, Jill; Hazell, Allison; Buchanan, Janet A; Szego, Michael J; Scherer, Stephen W

    2018-02-05

    The Personal Genome Project Canada is a comprehensive public data resource that integrates whole genome sequencing data and health information. We describe genomic variation identified in the initial recruitment cohort of 56 volunteers. Volunteers were screened for eligibility and provided informed consent for open data sharing. Using blood DNA, we performed whole genome sequencing and identified all possible classes of DNA variants. A genetic counsellor explained the implication of the results to each participant. Whole genome sequencing of the first 56 participants identified 207 662 805 sequence variants and 27 494 copy number variations. We analyzed a prioritized disease-associated data set ( n = 1606 variants) according to standardized guidelines, and interpreted 19 variants in 14 participants (25%) as having obvious health implications. Six of these variants (e.g., in BRCA1 or mosaic loss of an X chromosome) were pathogenic or likely pathogenic. Seven were risk factors for cancer, cardiovascular or neurobehavioural conditions. Four other variants - associated with cancer, cardiac or neurodegenerative phenotypes - remained of uncertain significance because of discrepancies among databases. We also identified a large structural chromosome aberration and a likely pathogenic mitochondrial variant. There were 172 recessive disease alleles (e.g., 5 individuals carried mutations for cystic fibrosis). Pharmacogenomics analyses revealed another 3.9 potentially relevant genotypes per individual. Our analyses identified a spectrum of genetic variants with potential health impact in 25% of participants. When also considering recessive alleles and variants with potential pharmacologic relevance, all 56 participants had medically relevant findings. Although access is mostly limited to research, whole genome sequencing can provide specific and novel information with the potential of major impact for health care. © 2018 Joule Inc. or its licensors.

  5. Navigating the tip of the genomic iceberg: Next-generation sequencing for plant systematics.

    Science.gov (United States)

    Straub, Shannon C K; Parks, Matthew; Weitemier, Kevin; Fishbein, Mark; Cronn, Richard C; Liston, Aaron

    2012-02-01

    Just as Sanger sequencing did more than 20 years ago, next-generation sequencing (NGS) is poised to revolutionize plant systematics. By combining multiplexing approaches with NGS throughput, systematists may no longer need to choose between more taxa or more characters. Here we describe a genome skimming (shallow sequencing) approach for plant systematics. Through simulations, we evaluated optimal sequencing depth and performance of single-end and paired-end short read sequences for assembly of nuclear ribosomal DNA (rDNA) and plastomes and addressed the effect of divergence on reference-guided plastome assembly. We also used simulations to identify potential phylogenetic markers from low-copy nuclear loci at different sequencing depths. We demonstrated the utility of genome skimming through phylogenetic analysis of the Sonoran Desert clade (SDC) of Asclepias (Apocynaceae). Paired-end reads performed better than single-end reads. Minimum sequencing depths for high quality rDNA and plastome assemblies were 40× and 30×, respectively. Divergence from the reference significantly affected plastome assembly, but relatively similar references are available for most seed plants. Deeper rDNA sequencing is necessary to characterize intragenomic polymorphism. The low-copy fraction of the nuclear genome was readily surveyed, even at low sequencing depths. Nearly 160000 bp of sequence from three organelles provided evidence of phylogenetic incongruence in the SDC. Adoption of NGS will facilitate progress in plant systematics, as whole plastome and rDNA cistrons, partial mitochondrial genomes, and low-copy nuclear markers can now be efficiently obtained for molecular phylogenetics studies.

  6. Factors influencing success of clinical genome sequencing across a broad spectrum of disorders

    OpenAIRE

    Taylor, Jenny C; Martin, Hilary C; Lise, Stefano; Broxholme, John; Cazier, Jean-Baptiste; Rimmer, Andy; Kanapin, Alexander; Lunter, Gerton; Fiddy, Simon; Allan, Chris; Aricescu, A. Radu; Attar, Moustafa; Babbs, Christian; Becq, Jennifer; Beeson, David

    2015-01-01

    To assess factors influencing the success of whole genome sequencing for mainstream clinical diagnosis, we sequenced 217 individuals from 156 independent cases across a broad spectrum of disorders in whom prior screening had identified no pathogenic variants. We quantified the number of candidate variants identified using different strategies for variant calling, filtering, annotation and prioritisation. We found that jointly calling variants across samples, filtering against both local and e...

  7. The Douglas-fir genome sequence reveals specialization of the photosynthetic apparatus in Pinaceae

    Science.gov (United States)

    David B. Neale; Patrick E. McGuire; Nicholas C. Wheeler; Kristian A. Stevens; Marc W. Crepeau; Charis Cardeno; Aleksey V. Zimin; Daniela Puiu; Geo M. Pertea; U. Uzay Sezen; Claudio Casola; Tomasz E. Koralewski; Robin Paul; Daniel Gonzalez-Ibeas; Sumaira Zaman; Richard Cronn; Mark Yandell; Carson Holt; Charles H. Langley; James A. Yorke; Steven L. Salzberg; Jill L. Wegrzyn

    2017-01-01

    A reference genome sequence for Pseudotsuga menziesii var. menziesii (Mirb.) Franco (Coastal Douglas-fir) is reported, thus providing a reference sequence for a third genus of the family Pinaceae. The contiguity and quality of the genome assembly far exceeds that of other conifer reference genome sequences (contig N50 = 44,136 bp and scaffold N50...

  8. Draft genome sequences of seven isolates of Phytophthora ramorum EU2 from Northern Ireland

    Directory of Open Access Journals (Sweden)

    Lourdes de la Mata Saez

    2015-12-01

    Full Text Available Here we present draft-quality genome sequence assemblies for the oomycete Phytophthora ramorum genetic lineage EU2. We sequenced genomes of seven isolates collected in Northern Ireland between 2010 and 2012. Multiple genome sequences from P. ramorum EU2 will be valuable for identifying genetic variation within the clonal lineage that can be useful for tracking its spread.

  9. Draft Genome Sequence of "Terrisporobacter othiniensis" Isolated from a Blood Culture from a Human Patient

    DEFF Research Database (Denmark)

    Lund, Lars Christian; Sydenham, Thomas Vognbjerg; Høgh, Silje Vermedal

    2015-01-01

    "Terrisporobacter othiniensis" (proposed species) was isolated from a blood culture. Genomic DNA was sequenced using a MiSeq benchtop sequencer (Illumina) and assembled using the SPAdes genome assembler. This resulted in a draft genome sequence comprising 3,980,019 bp in 167 contigs containing 3...

  10. Evaluation of whole genome sequencing for outbreak detection of Salmonella enterica

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Nielsen, Eva M.; Kaas, Rolf Sommer

    2014-01-01

    Salmonella enterica is a common cause of minor and large food borne outbreaks. To achieve successful and nearly ‘real-time’ monitoring and identification of outbreaks, reliable sub-typing is essential. Whole genome sequencing (WGS) shows great promises for using as a routine epidemiological typing....... Enteritidis and 5 S. Derby were also sequenced and used for comparison. A number of different bioinformatics approaches were applied on the data; including pan-genome tree, k-mer tree, nucleotide difference tree and SNP tree. The outcome of each approach was evaluated in relation to the association...... of the isolates to specific outbreaks. The pan-genome tree clustered 65% of the S. Typhimurium isolates according to the pre-defined epidemiology, the k-mer tree 88%, the nucleotide difference tree 100% and the SNP tree 100% of the strains within S. Typhimurium. The resulting outcome of the four phylogenetic...

  11. Functional noncoding sequences derived from SINEs in the mammalian genome.

    Science.gov (United States)

    Nishihara, Hidenori; Smit, Arian F A; Okada, Norihiro

    2006-07-01

    Recent comparative analyses of mammalian sequences have revealed that a large number of nonprotein-coding genomic regions are under strong selective constraint. Here, we report that some of these loci have been derived from a newly defined family of ancient SINEs (short interspersed repetitive elements). This is a surprising result, as SINEs and other transposable elements are commonly thought to be genomic parasites. We named the ancient SINE family AmnSINE1, for Amniota SINE1, because we found it to be present in mammals as well as in birds, and some copies predate the mammalian-bird split 310 million years ago (Mya). AmnSINE1 has a chimeric structure of a 5S rRNA and a tRNA-derived SINE, and is related to five tRNA-derived SINE families that we characterized here in the coelacanth, dogfish shark, hagfish, and amphioxus genomes. All of the newly described SINE families have a common central domain that is also shared by zebrafish SINE3, and we collectively name them the DeuSINE (Deuterostomia SINE) superfamily. Notably, of the approximately 1000 still identifiable copies of AmnSINE1 in the human genome, 105 correspond to loci phylogenetically highly conserved among mammalian orthologs. The conservation is strongest over the central domain. Thus, AmnSINE1 appears to be the best example of a transposable element of which a significant fraction of the copies have acquired genomic functionality.

  12. Two complete chloroplast genome sequences of Cannabis sativa varieties.

    Science.gov (United States)

    Oh, Hyehyun; Seo, Boyoung; Lee, Seunghwan; Ahn, Dong-Ha; Jo, Euna; Park, Jin-Kyoung; Min, Gi-Sik

    2016-07-01

    In this study, we determined the complete chloroplast (cp) genomes from two varieties of Cannabis sativa. The genome sizes were 153,848 bp (the Korean non-drug variety, Cheungsam) and 153,854 bp (the African variety, Yoruba Nigeria). The genome structures were identical with 131 individual genes [86 protein-coding genes (PCGs), eight rRNA, and 37 tRNA genes]. Further, except for the presence of an intron in the rps3 genes of two C. sativa varieties, the cp genomes of C. sativa had conservative features similar to that of all known species in the order Rosales. To verify the position of C. sativa within the order Rosales, we conducted phylogenetic analysis by using concatenated sequences of all PCGs from 17 complete cp genomes. The resulting tree strongly supported monophyly of Rosales. Further, the family Cannabaceae, represented by C. sativa, showed close relationship with the family Moraceae. The phylogenetic relationship outlined in our study is well congruent with those previously shown for the order Rosales.

  13. Whole-Genome de novo Sequencing Of Quail And Grey Partridge

    DEFF Research Database (Denmark)

    Holm, Lars-Erik; Panitz, Frank; Burt, Dave

    2011-01-01

    The development in sequencing methods has made it possible to perform whole genome de novo sequencing of species without large commercial interests. Within the EU-financed QUANTOMICS project (KBBE-2A-222664), we have performed de novo sequencing of quail (Coturnix coturnix) and grey partridge...... (Perdix perdix) on a Genome Analyzer GAII (Illumina) using paired-end sequencing. The amount of generated sequences amounts to 8 to 9 Gb for each species. The analysis and assembly of the generated sequences is ongoing. Access to the whole genome sequence from these two species will enable enhanced...... comparative studies towards the chicken genome and will aid in identifying evolutionarily conserved sequences within the Galliformes. The obtained sequences from quail and partridge represent a beginning of generating the whole genome sequence for these species. The continuation of establishing the genome...

  14. Soybean (Glycine max) SWEET gene family: insights through comparative genomics, transcriptome profiling and whole genome re-sequence analysis.

    Science.gov (United States)

    Patil, Gunvant; Valliyodan, Babu; Deshmukh, Rupesh; Prince, Silvas; Nicander, Bjorn; Zhao, Mingzhe; Sonah, Humira; Song, Li; Lin, Li; Chaudhary, Juhi; Liu, Yang; Joshi, Trupti; Xu, Dong; Nguyen, Henry T

    2015-07-11

    SWEET (MtN3_saliva) domain proteins, a recently identified group of efflux transporters, play an indispensable role in sugar efflux, phloem loading, plant-pathogen interaction and reproductive tissue development. The SWEET gene family is predominantly studied in Arabidopsis and members of the family are being investigated in rice. To date, no transcriptome or genomics analysis of soybean SWEET genes has been reported. In the present investigation, we explored the evolutionary aspect of the SWEET gene family in diverse plant species including primitive single cell algae to angiosperms with a major emphasis on Glycine max. Evolutionary features showed expansion and duplication of the SWEET gene family in land plants. Homology searches with BLAST tools and Hidden Markov Model-directed sequence alignments identified 52 SWEET genes that were mapped to 15 chromosomes in the soybean genome as tandem duplication events. Soybean SWEET (GmSWEET) genes showed a wide range of expression profiles in different tissues and developmental stages. Analysis of public transcriptome data and expression profiling using quantitative real time PCR (qRT-PCR) showed that a majority of the GmSWEET genes were confined to reproductive tissue development. Several natural genetic variants (non-synonymous SNPs, premature stop codons and haplotype) were identified in the GmSWEET genes using whole genome re-sequencing data analysis of 106 soybean genotypes. A significant association was observed between SNP-haplogroup and seed sucrose content in three gene clusters on chromosome 6. Present investigation utilized comparative genomics, transcriptome profiling and whole genome re-sequencing approaches and provided a systematic description of soybean SWEET genes and identified putative candidates with probable roles in the reproductive tissue development. Gene expression profiling at different developmental stages and genomic variation data will aid as an important resource for the soybean research

  15. Isolation and genome sequencing of four Arctic marine Psychrobacter strains exhibiting multicopper oxidase activity.

    Science.gov (United States)

    Moghadam, Morteza Shojaei; Albersmeier, Andreas; Winkler, Anika; Cimmino, Lorenzo; Rise, Kjersti; Hohmann-Marriott, Martin Frank; Kalinowski, Jörn; Rückert, Christian; Wentzel, Alexander; Lale, Rahmi

    2016-02-16

    Marine cold-temperature environments are an invaluable source of psychrophilic microbial life for new biodiscoveries. An Arctic marine bacterial strain collection was established consisting of 1448 individual isolates originating from biota, water and sediment samples taken at a various depth in the Barents Sea, North of mainland Norway, with an all year round seawater temperature of 4 °C. The entire collection was subjected to high-throughput screening for detection of extracellular laccase activity with guaiacol as a substrate. In total, 13 laccase-positive isolates were identified, all belonging to the Psychrobacter genus. From the most diverse four strains, based on 16S rRNA gene sequence analysis, all originating from the same Botryllus sp. colonial ascidian tunicate sample, genomic DNA was isolated and genome sequenced using a combined approach of whole genome shotgun and 8 kb mate-pair library sequencing on an Illumina MiSeq platform. The genomes were assembled and revealed genome sizes between 3.29 and 3.52 Mbp with an average G + C content of around 42%, with one to seven plasmids present in the four strains. Bioinformatics based genome mining was performed to describe the metabolic potential of these four strains and to identify gene candidates potentially responsible for the observed laccase-positive phenotype. Up to two different laccase-like multicopper oxidase (LMCO) encoding gene candidates were identified in each of the four strains. Heterologous expression of P11F6-LMCO and P11G5-LMCO2 in Escherichia coli BL21 (DE3) resulted in recombinant proteins exhibiting 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulphonic acid (ABTS) and guaiacol oxidizing activity. Thirteen Psychrobacter species with laccase-positive phenotype were isolated from a collection of Arctic marine bacteria. Four of the isolates were genome sequenced. The overall genome features were similar to other publicly available Psychrobacter genome sequences except for P11G5 harboring seven

  16. Genome sequencing of bacteria: sequencing, de novo assembly and rapid analysis using open source tools.

    Science.gov (United States)

    Kisand, Veljo; Lettieri, Teresa

    2013-04-01

    De novo genome sequencing of previously uncharacterized microorganisms has the potential to open up new frontiers in microbial genomics by providing insight into both functional capabilities and biodiversity. Until recently, Roche 454 pyrosequencing was the NGS method of choice for de novo assembly because it generates hundreds of thousands of long reads (tools for processing NGS data are increasingly free and open source and are often adopted for both their high quality and role in promoting academic freedom. The error rate of pyrosequencing the Alcanivorax borkumensis genome was such that thousands of insertions and deletions were artificially introduced into the finished genome. Despite a high coverage (~30 fold), it did not allow the reference genome to be fully mapped. Reads from regions with errors had low quality, low coverage, or were missing. The main defect of the reference mapping was the introduction of artificial indels into contigs through lower than 100% consensus and distracting gene calling due to artificial stop codons. No assembler was able to perform de novo assembly comparable to reference mapping. Automated annotation tools performed similarly on reference mapped and de novo draft genomes, and annotated most CDSs in the de novo assembled draft genomes. Free and open source software (FOSS) tools for assembly and annotation of NGS data are being developed rapidly to provide accurate results with less computational effort. Usability is not high priority and these tools currently do not allow the data to be processed without manual intervention. Despite this, genome assemblers now readily assemble medium short reads into long contigs (>97-98% genome coverage). A notable gap in pyrosequencing technology is the quality of base pair calling and conflicting base pairs between single reads at the same nucleotide position. Regardless, using draft whole genomes that are not finished and remain fragmented into tens of contigs allows one to characterize

  17. Complete Genome Sequence of the Halophilic Methylotrophic Methanogen Archaeon Methanohalophilus portucalensis Strain FDF-1T

    KAUST Repository

    L’Haridon, Stéphane

    2018-01-17

    We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.

  18. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    KAUST Repository

    Lafi, Feras Fawzi

    2017-03-03

    Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic of plant growth promotion activity and environmental adaptation of SA148.

  19. Whole genome sequences of the raspberry and strawberry pathogens Phytophthora rubi and P. fragariae

    Science.gov (United States)

    Phytophthora rubi and P. fragariae are two closely related oomycete plant pathogens that exhibit strong morphological and physiological similarities, but are specialized to infect different hosts of economic importance, namely raspberry and strawberry. Here, we report the draft genome sequences of t...

  20. Genome sequencing and comparison of two nonhuman primate animal models, the cynomolgus and Chinese rhesus macaques

    DEFF Research Database (Denmark)

    Yan, Guangmei; Zhang, Guojie; Fang, Xiaodong

    2011-01-01

    The nonhuman primates most commonly used in medical research are from the genus Macaca. To better understand the genetic differences between these animal models, we present high-quality draft genome sequences from two macaque species, the cynomolgus/crab-eating macaque and the Chinese rhesus...

  1. Complete Genome Sequence of the Halophilic Methylotrophic Methanogen Archaeon Methanohalophilus portucalensis Strain FDF-1T

    KAUST Repository

    L’ Haridon, Sté phane; Corre, Erwan; Guan, Yue; Vinu, Manikandan; La Cono, Violetta; Yakimov, Michail; Stingl, Ulrich; Toffin, Laurent; Jebbar, Mohamed

    2018-01-01

    We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.

  2. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    KAUST Repository

    Lafi, Feras Fawzi; Alam, Intikhab; Geurts, Rene; Bisseling, Ton; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic

  3. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

    Science.gov (United States)

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

    2016-01-01

    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  4. Genome sequence of the Thermotoga thermarum type strain (LA3(T)) from an African solfataric spring.

    Science.gov (United States)

    Göker, Markus; Spring, Stefan; Scheuner, Carmen; Anderson, Iain; Zeytun, Ahmet; Nolan, Matt; Lucas, Susan; Tice, Hope; Del Rio, Tijana Glavina; Cheng, Jan-Fang; Han, Cliff; Tapia, Roxanne; Goodwin, Lynne A; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Pagani, Ioanna; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Rohde, Manfred; Detter, John C; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Lapidus, Alla

    2014-06-15

    Thermotoga thermarum Windberger et al. 1989 is a member to the genomically well characterized genus Thermotoga in the phylum 'Thermotogae'. T. thermarum is of interest for its origin from a continental solfataric spring vs. predominantly marine oil reservoirs of other members of the genus. The genome of strain LA3T also provides fresh data for the phylogenomic positioning of the (hyper-)thermophilic bacteria. T. thermarum strain LA3(T) is the fourth sequenced genome of a type strain from the genus Thermotoga, and the sixth in the family Thermotogaceae to be formally described in a publication. Phylogenetic analyses do not reveal significant discrepancies between the current classification of the group, 16S rRNA gene data and whole-genome sequences. Nevertheless, T. thermarum significantly differs from other Thermotoga species regarding its iron-sulfur cluster synthesis, as it contains only a minimal set of the necessary proteins. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,039,943 bp long chromosome with its 2,015 protein-coding and 51 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  5. Analysis of transposable elements in the genome of Asparagus officinalis from high coverage sequence data.

    Science.gov (United States)

    Li, Shu-Fen; Gao, Wu-Jun; Zhao, Xin-Peng; Dong, Tian-Yu; Deng, Chuan-Liang; Lu, Long-Dou

    2014-01-01

    Asparagus officinalis is an economically and nutritionally important vegetable crop that is widely cultivated and is used as a model dioecious species to study plant sex determination and sex chromosome evolution. To improve our understanding of its genome composition, especially with respect to transposable elements (TEs), which make up the majority of the genome, we performed Illumina HiSeq2000 sequencing of both male and female asparagus genomes followed by bioinformatics analysis. We generated 17 Gb of sequence (12×coverage) and assembled them into 163,406 scaffolds with a total cumulated length of 400 Mbp, which represent about 30% of asparagus genome. Overall, TEs masked about 53% of the A. officinalis assembly. Majority of the identified TEs belonged to LTR retrotransposons, which constitute about 28% of genomic DNA, with Ty1/copia elements being more diverse and accumulated to higher copy numbers than Ty3/gypsy. Compared with LTR retrotransposons, non-LTR retrotransposons and DNA transposons were relatively rare. In addition, comparison of the abundance of the TE groups between male and female genomes showed that the overall TE composition was highly similar, with only slight differences in the abundance of several TE groups, which is consistent with the relatively recent origin of asparagus sex chromosomes. This study greatly improves our knowledge of the repetitive sequence construction of asparagus, which facilitates the identification of TEs responsible for the early evolution of plant sex chromosomes and is helpful for further studies on this dioecious plant.

  6. Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features

    Directory of Open Access Journals (Sweden)

    Gillet Laurent

    2011-08-01

    Full Text Available Abstract Background Bovine herpesvirus 4 (BoHV-4 is a useful model for the human pathogenic gammaherpesviruses Epstein-Barr virus and Kaposi's Sarcoma-associated Herpesvirus. Although genome manipulations of this virus have been greatly facilitated by the cloning of the BoHV-4 V.test strain as a Bacterial Artificial Chromosome (BAC, the lack of a complete genome sequence for this strain limits its experimental use. Methods In this study, we have determined the complete sequence of BoHV-4 V.test strain by a pyrosequencing approach. Results The long unique coding region (LUR consists of 108,241 bp encoding at least 79 open reading frames and is flanked by several polyrepetitive DNA units (prDNA. As previously suggested, we showed that the prDNA unit located at the left prDNA-LUR junction (prDNA-G differs from the other prDNA units (prDNA-inner. Namely, the prDNA-G unit lacks the conserved pac-2 cleavage and packaging signal in its right terminal region. Based on the mechanisms of cleavage and packaging of herpesvirus genomes, this feature implies that only genomes bearing left and right end prDNA units are encapsulated into virions. Conclusions In this study, we have determined the complete genome sequence of the BAC-cloned BoHV-4 V.test strain and identified genome organization features that could be important in other herpesviruses.

  7. Complete Genome Sequence of Zucchini Yellow Mosaic Virus Strain Kurdistan, Iran.

    Science.gov (United States)

    Maghamnia, Hamid Reza; Hajizadeh, Mohammad; Azizi, Abdolbaset

    2018-03-01

    The complete genome sequence of Zucchini yellow mosaic virus strain Kurdistan (ZYMV-Kurdistan) infecting squash from Iran was determined from 13 overlapping fragments. Excluding the poly (A) tail, ZYMV-Kurdistan genome consisted of 9593 nucleotides (nt), with 138 and 211 nt at the 5' and 3' non-translated regions, respectively. It contained two open-reading frames (ORFs), the large ORF encoding a polyprotein of 3080 amino acids (aa) and the small overlapping ORF encoding a P3N-PIPO protein of 74 aa. This isolate had six unique aa differences compared to other ZYMV isolates and shared 79.6-98.8% identities with other ZYMV genome sequences at the nt level and 90.1-99% identities at the aa level. A phylogenetic tree of ZYMV complete genomic sequences showed that Iranian and Central European isolates are closely related and form a phylogenetically homogenous group. All values in the ratio of substitution rates at non-synonymous and synonymous sites ( d N / d S ) were below 1, suggestive of strong negative selection forces during ZYMV protein history. This is the first report of complete genome sequence information of the most prevalent virus in the west of Iran. This study helps our understanding of the genetic diversity of ZYMV isolates infecting cucurbit plants in Iran, virus evolution and epidemiology and can assist in designing better diagnostic tools.

  8. Gene Discovery through Genomic Sequencing of Brucella abortus

    Science.gov (United States)

    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

    2001-01-01

    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

  9. Draft genome sequence of the arsenite-oxidizing strain Aliihoeflea sp. 2WW, isolated from arsenic-contaminated groundwater

    NARCIS (Netherlands)

    Cavalca, L.; Corsini, A.; Andreoni, V.; Muyzer, G.

    2013-01-01

    Here, we report the draft genome sequence of the arsenite-oxidizing bacterium Aliihoeflea sp. strain 2WW, which consists of a 4.15-Mb chromosome and contains different genes that are involved in arsenic transformations.

  10. Complete genome sequence of an attenuated Sparfloxacin-resistant Streptococcus agalactiae strain 138spar

    Science.gov (United States)

    The complete genome of a sparfloxacin-resistant Streptococcus agalactiae vaccine strain 138spar is 1,838,126 bp in size. The genome has 1892 coding sequences and 82 RNAs. The annotation of the genome is added by the NCBI Prokaryotic Genome Annotation Pipeline. The publishing of this genome will allo...

  11. Sequence imputation of HPV16 genomes for genetic association studies.

    Directory of Open Access Journals (Sweden)

    Benjamin Smith

    Full Text Available Human Papillomavirus type 16 (HPV16 causes over half of all cervical cancer and some HPV16 variants are more oncogenic than others. The genetic basis for the extraordinary oncogenic properties of HPV16 compared to other HPVs is unknown. In addition, we neither know which nucleotides vary across and within HPV types and lineages, nor which of the single nucleotide polymorphisms (SNPs determine oncogenicity.A reference set of 62 HPV16 complete genome sequences was established and used to examine patterns of evolutionary relatedness amongst variants using a pairwise identity heatmap and HPV16 phylogeny. A BLAST-based algorithm was developed to impute complete genome data from partial sequence information using the reference database. To interrogate the oncogenic risk of determined and imputed HPV16 SNPs, odds-ratios for each SNP were calculated in a case-control viral genome-wide association study (VWAS using biopsy confirmed high-grade cervix neoplasia and self-limited HPV16 infections from Guanacaste, Costa Rica.HPV16 variants display evolutionarily stable lineages that contain conserved diagnostic SNPs. The imputation algorithm indicated that an average of 97.5±1.03% of SNPs could be accurately imputed. The VWAS revealed specific HPV16 viral SNPs associated with variant lineages and elevated odds ratios; however, individual causal SNPs could not be distinguished with certainty due to the nature of HPV evolution.Conserved and lineage-specific SNPs can be imputed with a high degree of accuracy from limited viral polymorphic data due to the lack of recombination and the stochastic mechanism of variation accumulation in the HPV genome. However, to determine the role of novel variants or non-lineage-specific SNPs by VWAS will require direct sequence analysis. The investigation of patterns of genetic variation and the identification of diagnostic SNPs for lineages of HPV16 variants provides a valuable resource for future studies of HPV16

  12. Prokaryotic Phylogenies Inferred from Whole-Genome Sequence and Annotation Data

    Directory of Open Access Journals (Sweden)

    Wei Du

    2013-01-01

    Full Text Available Phylogenetic trees are used to represent the evolutionary relationship among various groups of species. In this paper, a novel method for inferring prokaryotic phylogenies using multiple genomic information is proposed. The method is called CGCPhy and based on the distance matrix of orthologous gene clusters between whole-genome pairs. CGCPhy comprises four main steps. First, orthologous genes are determined by sequence similarity, genomic function, and genomic structure information. Second, genes involving potential HGT events are eliminated, since such genes are considered to be the highly conserved genes across different species and the genes located on fragments with abnormal genome barcode. Third, we calculate the distance of the orthologous gene clusters between each genome pair in terms of the number of orthologous genes in conserved clusters. Finally, the neighbor-joining method is employed to construct phylogenetic trees across different species. CGCPhy has been examined on different datasets from 617 complete single-chromosome prokaryotic genomes and achieved applicative accuracies on different species sets in agreement with Bergey's taxonomy in quartet topologies. Simulation results show that CGCPhy achieves high average accuracy and has a low standard deviation on different datasets, so it has an applicative potential for phylogenetic analysis.

  13. BioNano genome mapping of individual chromosomes supports physical mapping and sequence assembly in complex plant genomes.

    Science.gov (United States)

    Staňková, Helena; Hastie, Alex R; Chan, Saki; Vrána, Jan; Tulpová, Zuzana; Kubaláková, Marie; Visendi, Paul; Hayashi, Satomi; Luo, Mingcheng; Batley, Jacqueline; Edwards, David; Doležel, Jaroslav; Šimková, Hana

    2016-07-01

    The assembly of a reference genome sequence of bread wheat is challenging due to its specific features such as the genome size of 17 Gbp, polyploid nature and prevalence of repetitive sequences. BAC-by-BAC sequencing based on chromosomal physical maps, adopted by the International Wheat Genome Sequencing Consortium as the key strategy, reduces problems caused by the genome complexity and polyploidy, but the repeat content still hampers the sequence assembly. Availability of a high-resolution genomic map to guide sequence scaffolding and validate physical map and sequence assemblies would be highly beneficial to obtaining an accurate and complete genome sequence. Here, we chose the short arm of chromosome 7D (7DS) as a model to demonstrate for the first time that it is possible to couple chromosome flow sorting with genome mapping in nanochannel arrays and create a de novo genome map of a wheat chromosome. We constructed a high-resolution chromosome map composed of 371 contigs with an N50 of 1.3 Mb. Long DNA molecules achieved by our approach facilitated chromosome-scale analysis of repetitive sequences and revealed a ~800-kb array of tandem repeats intractable to current DNA sequencing technologies. Anchoring 7DS sequence assemblies obtained by clone-by-clone sequencing to the 7DS genome map provided a valuable tool to improve the BAC-contig physical map and validate sequence assembly on a chromosome-arm scale. Our results indicate that creating genome maps for the whole wheat genome in a chromosome-by-chromosome manner is feasible and that they will be an affordable tool to support the production of improved pseudomolecules. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Distilled single-cell genome sequencing and de novo assembly for sparse microbial communities.

    Science.gov (United States)

    Taghavi, Zeinab; Movahedi, Narjes S; Draghici, Sorin; Chitsaz, Hamidreza

    2013-10-01

    Identification of every single genome present in a microbial sample is an important and challenging task with crucial applications. It is challenging because there are typically millions of cells in a microbial sample, the vast majority of which elude cultivation. The most accurate method to date is exhaustive single-cell sequencing using multiple displacement amplification, which is simply intractable for a large number of cells. However, there is hope for breaking this barrier, as the number of different cell types with distinct genome sequences is usually much smaller than the number of cells. Here, we present a novel divide and conquer method to sequence and de novo assemble all distinct genomes present in a microbial sample with a sequencing cost and computational complexity proportional to the number of genome types, rather than the number of cells. The method is implemented in a tool called Squeezambler. We evaluated Squeezambler on simulated data. The proposed divide and conquer method successfully reduces the cost of sequencing in comparison with the naïve exhaustive approach. Squeezambler and datasets are available at http://compbio.cs.wayne.edu/software/squeezambler/.

  15. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  16. Defining and Evaluating a Core Genome Multilocus Sequence Typing Scheme for Genome-Wide Typing of Clostridium difficile.

    Science.gov (United States)

    Bletz, Stefan; Janezic, Sandra; Harmsen, Dag; Rupnik, Maja; Mellmann, Alexander

    2018-06-01

    Clostridium difficile , recently renamed Clostridioides difficile , is the most common cause of antibiotic-associated nosocomial gastrointestinal infections worldwide. To differentiate endogenous infections and transmission events, highly discriminatory subtyping is necessary. Today, methods based on whole-genome sequencing data are increasingly used to subtype bacterial pathogens; however, frequently a standardized methodology and typing nomenclature are missing. Here we report a core genome multilocus sequence typing (cgMLST) approach developed for C. difficile Initially, we determined the breadth of the C. difficile population based on all available MLST sequence types with Bayesian inference (BAPS). The resulting BAPS partitions were used in combination with C. difficile clade information to select representative isolates that were subsequently used to define cgMLST target genes. Finally, we evaluated the novel cgMLST scheme with genomes from 3,025 isolates. BAPS grouping ( n = 6 groups) together with the clade information led to a total of 11 representative isolates that were included for cgMLST definition and resulted in 2,270 cgMLST genes that were present in all isolates. Overall, 2,184 to 2,268 cgMLST targets were detected in the genome sequences of 70 outbreak-associated and reference strains, and on average 99.3% cgMLST targets (1,116 to 2,270 targets) were present in 2,954 genomes downloaded from the NCBI database, underlining the representativeness of the cgMLST scheme. Moreover, reanalyzing different cluster scenarios with cgMLST were concordant to published single nucleotide variant analyses. In conclusion, the novel cgMLST is representative for the whole C. difficile population, is highly discriminatory in outbreak situations, and provides a unique nomenclature facilitating interlaboratory exchange. Copyright © 2018 American Society for Microbiology.

  17. Complete chloroplast genome sequence of Elodea canadensis and comparative analyses with other monocot plastid genomes.

    Science.gov (United States)

    Huotari, Tea; Korpelainen, Helena

    2012-10-15

    Elodea canadensis is an aquatic angiosperm native to North America. It has attracted great attention due to its invasive nature when transported to new areas in its non-native range. We have determined the complete nucleotide sequence of the chloroplast (cp) genome of Elodea. Taxonomically Elodea is a basal monocot, and only few monocot cp genomes representing early lineages of monocots have been sequenced so far. The genome is a circular double-stranded DNA molecule 156,700 bp in length, and has a typical structure with large (LSC 86,194 bp) and small (SSC 17,810 bp) single-copy regions separated by a pair of inverted repeats (IRs 26,348 bp each). The Elodea cp genome contains 113 unique genes and 16 duplicated genes in the IR regions. A comparative analysis showed that the gene order and organization of the Elodea cp genome is almost identical to that of Amborella trichopoda, a basal angiosperm. The structure of IRs in Elodea is unique among monocot species with the whole cp genome sequenced. In Elodea and another monocot Lemna minor the borders between IRs and LSC are located upstream of rps 19 gene and downstream of trnH-GUG gene, while in most monocots, IR has extended to include both trnH and rps 19 genes. A phylogenetic analysis conducted using Bayesian method, based on the DNA sequences of 81 chloroplast genes from 17 monocot taxa provided support for the placement of Elodea together with Lemna as a basal monocot and the next diverging lineage of monocots after Acorales. In comparison with other monocots, the Elodea cp genome has gone through only few rearrangements or gene losses. IR of Elodea has a unique structure among the monocot species studied so far as its structure is similar to that of a basal angiosperm Amborella. This result together with phylogenetic analyses supports the placement of Elodea as a basal monocot to the next diverging lineage of monocots after Acorales. So far, only few cp genomes representing early lineages of monocots have been

  18. Survey sequencing and comparative analysis of the elephant shark (Callorhinchus milii genome.

    Directory of Open Access Journals (Sweden)

    Byrappa Venkatesh

    2007-04-01

    Full Text Available Owing to their phylogenetic position, cartilaginous fishes (sharks, rays, skates, and chimaeras provide a critical reference for our understanding of vertebrate genome evolution. The relatively small genome of the elephant shark, Callorhinchus milii, a chimaera, makes it an attractive model cartilaginous fish genome for whole-genome sequencing and comparative analysis. Here, the authors describe survey sequencing (1.4x coverage and comparative analysis of the elephant shark genome, one of the first cartilaginous fish genomes to be sequenced to this depth. Repetitive sequences, represented mainly by a novel family of short interspersed element-like and long interspersed element-like sequences, account for about 28% of the elephant shark genome. Fragments of approximately 15,000 elephant shark genes reveal specific examples of genes that have been lost differentially during the evolution of tetrapod and teleost fish lineages. Interestingly, the degree of conserved synteny and conserved sequences between the human and elephant shark genomes are higher than that between human and teleost fish genomes. Elephant shark contains putative four Hox clusters indicating that, unlike teleost fish genomes, the elephant shark genome has not experienced an additional whole-genome duplication. These findings underscore the importance of the elephant shark as a critical reference vertebrate genome for comparative analysis of the human and other vertebrate genomes. This study also demonstrates that a survey-sequencing approach can be applied productively for comparative analysis of distantly related vertebrate genomes.

  19. An overview of the Phalaenopsis orchid genome through BAC end sequence analysis

    Directory of Open Access Journals (Sweden)

    Hsiao Yu-Yun

    2011-01-01

    Full Text Available Abstract Background Phalaenopsis orchids are popular floral crops, and development of new cultivars is economically important to floricultural industries worldwide. Analysis of orchid genes could facilitate orchid improvement. Bacterial artificial chromosome (BAC end sequences (BESs can provide the first glimpses into the sequence composition of a novel genome and can yield molecular markers for use in genetic mapping and breeding. Results We used two BAC libraries (constructed using the BamHI and HindIII restriction enzymes of Phalaenopsis equestris to generate pair-end sequences from 2,920 BAC clones (71.4% and 28.6% from the BamHI and HindIII libraries, respectively, at a success rate of 95.7%. A total of 5,535 BESs were generated, representing 4.5 Mb, or about 0.3% of the Phalaenopsis genome. The trimmed sequences ranged from 123 to 1,397 base pairs (bp in size, with an average edited read length of 821 bp. When these BESs were subjected to sequence homology searches, it was found that 641 (11.6% were predicted to represent protein-encoding regions, whereas 1,272 (23.0% contained repetitive DNA. Most of the repetitive DNA sequences were gypsy- and copia-like retrotransposons (41.9% and 12.8%, respectively, whereas only 10.8% were DNA transposons. Further, 950 potential simple sequence repeats (SSRs were discovered. Dinucleotides were the most abundant repeat motifs; AT/TA dimer repeats were the most frequent SSRs, representing 253 (26.6% of all identified SSRs. Microsynteny analysis revealed that more BESs mapped to the whole-genome sequences of poplar than to those of grape or Arabidopsis, and even fewer mapped to the rice genome. This work will facilitate analysis of the Phalaenopsis genome, and will help clarify similarities and differences in genome composition between orchids and other plant species. Conclusion Using BES analysis, we obtained an overview of the Phalaenopsis genome in terms of gene abundance, the presence of repetitive

  20. Human genome sequencing with direct x-ray holographic imaging

    International Nuclear Information System (INIS)

    Rhodes, C.K.

    1993-01-01

    Direct holographic imaging of biological materials is widely applicable to the study of the structure, properties and action of genetic material. This particular application involves the sequencing of the human genome where prospective genomic imaging technology is composed of three subtechnologies, name an x-ray holographic camera, suitable chemistry and enzymology for the preparation of tagged DNA samples, and the illuminator in the form of an x-ray laser. We report appropriate x-ray camera, embodied by the instrument developed by MCR, is available and that suitable chemical and enzymatic procedures exist for the preparation of the necessary tagged DNA strands. Concerning the future development of the x-ray illuminator. We find that a practical small scale x-ray light source is indeed feasible. This outcome requires the use of unconventional physical processes in order to achieve the necessary power-compression in the amplifying medium. The understanding of these new physical mechanisms is developing rapidly. Importantly, although the x-ray source does not currently exist, the understanding of these new physical mechanisms is developing rapidly and the research has established the basic scaling laws that will determine the properties of the x-ray illuminator. When this x-ray source becomes available, an extremely rapid and cost effective instrument for 3-D imaging of biological materials can be applied to a wide range of biological structural assays, including the base-pair sequencing of the human genome and many questions regarding its higher levels of organization

  1. Microsatellite DNA in genomic survey sequences and UniGenes of loblolly pine

    Science.gov (United States)

    Craig S Echt; Surya Saha; Dennis L Deemer; C Dana Nelson

    2011-01-01

    Genomic DNA sequence databases are a potential and growing resource for simple sequence repeat (SSR) marker development in loblolly pine (Pinus taeda L.). Loblolly pine also has many expressed sequence tags (ESTs) available for microsatellite (SSR) marker development. We compared loblolly pine SSR densities in genome survey sequences (GSSs) to those in non-redundant...

  2. The sequence and analysis of a Chinese pig genome

    Directory of Open Access Journals (Sweden)

    Fang Xiaodong

    2012-11-01

    Full Text Available Abstract Background The pig is an economically important food source, amounting to approximately 40% of all meat consumed worldwide. Pigs also serve as an important model organism because of their similarity to humans at the anatomical, physiological and genetic level, making them very useful for studying a variety of human diseases. A pig strain of particular interest is the miniature pig, specifically the Wuzhishan pig (WZSP, as it has been extensively inbred. Its high level of homozygosity offers increased ease for selective breeding for specific traits and a more straightforward understanding of the genetic changes that underlie its biological characteristics. WZSP also serves as a promising means for applications in surgery, tissue engineering, and xenotransplantation. Here, we report the sequencing and analysis of an inbreeding WZSP genome. Results Our results reveal some unique genomic features, including a relatively high level of homozygosity in the diploid genome, an unusual distribution of heterozygosity, an over-representation of tRNA-derived transposable elements, a small amount of porcine endogenous retrovirus, and a lack of type C retroviruses. In addition, we carried out systematic research on gene evolution, together with a detailed investigation of the counterparts of human drug target genes. Conclusion Our results provide the opportunity to more clearly define the genomic character of pig, which could enhance our ability to create more useful pig models.

  3. 1000 Bull Genomes - Toward genomic Selectionf from whole genome sequence Data in Dairy and Beef Cattle

    NARCIS (Netherlands)

    Hayes, B.; Daetwyler, H.D.; Fries, R.; Guldbrandtsen, B.; Mogens Sando Lund, M.; Didier A. Boichard, D.A.; Stothard, P.; Veerkamp, R.F.; Hulsegge, B.; Rocha, D.; Tassell, C.; Mullaart, E.; Gredler, B.; Druet, T.; Bagnato, A.; Goddard, M.E.; Chamberlain, H.L.

    2013-01-01

    Genomic prediction of breeding values is now used as the basis for selection of dairy cattle, and in some cases beef cattle, in a number of countries. When genomic prediction was introduced most of the information was to thought to be derived from linkage disequilibrium between markers and causative

  4. Comparative genomics of human and non-human Listeria monocytogenes sequence type 121 strains.

    Directory of Open Access Journals (Sweden)

    Kathrin Rychli

    Full Text Available The food-borne pathogen Listeria (L. monocytogenes is able to survive for months and even years in food production environments. Strains belonging to sequence type (ST121 are particularly found to be abundant and to persist in food and food production environments. To elucidate genetic determinants characteristic for L. monocytogenes ST121, we sequenced the genomes of 14 ST121 strains and compared them with currently available L. monocytogenes ST121 genomes. In total, we analyzed 70 ST121 genomes deriving from 16 different countries, different years of isolation, and different origins-including food, animal and human ST121 isolates. All ST121 genomes show a high degree of conservation sharing at least 99.7% average nucleotide identity. The main differences between the strains were found in prophage content and prophage conservation. We also detected distinct highly conserved subtypes of prophages inserted at the same genomic locus. While some of the prophages showed more than 99.9% similarity between strains from different sources and years, other prophages showed a higher level of diversity. 81.4% of the strains harbored virtually identical plasmids. 97.1% of the ST121 strains contain a truncated internalin A (inlA gene. Only one of the seven human ST121 isolates encodes a full-length inlA gene, illustrating the need of better understanding their survival and virulence mechanisms.

  5. The zebrafish reference genome sequence and its relationship to the human genome

    Science.gov (United States)

    Howe, Kerstin; Clark, Matthew D.; Torroja, Carlos F.; Torrance, James; Berthelot, Camille; Muffato, Matthieu; Collins, John E.; Humphray, Sean; McLaren, Karen; Matthews, Lucy; McLaren, Stuart; Sealy, Ian; Caccamo, Mario; Churcher, Carol; Scott, Carol; Barrett, Jeffrey C.; Koch, Romke; Rauch, Gerd-Jörg; White, Simon; Chow, William; Kilian, Britt; Quintais, Leonor T.; Guerra-Assunção, José A.; Zhou, Yi; Gu, Yong; Yen, Jennifer; Vogel, Jan-Hinnerk; Eyre, Tina; Redmond, Seth; Banerjee, Ruby; Chi, Jianxiang; Fu, Beiyuan; Langley, Elizabeth; Maguire, Sean F.; Laird, Gavin K.; Lloyd, David; Kenyon, Emma; Donaldson, Sarah; Sehra, Harminder; Almeida-King, Jeff; Loveland, Jane; Trevanion, Stephen; Jones, Matt; Quail, Mike; Willey, Dave; Hunt, Adrienne; Burton, John; Sims, Sarah; McLay, Kirsten; Plumb, Bob; Davis, Joy; Clee, Chris; Oliver, Karen; Clark, Richard; Riddle, Clare; Eliott, David; Threadgold, Glen; Harden, Glenn; Ware, Darren; Mortimer, Beverly; Kerry, Giselle; Heath, Paul; Phillimore, Benjamin; Tracey, Alan; Corby, Nicole; Dunn, Matthew; Johnson, Christopher; Wood, Jonathan; Clark, Susan; Pelan, Sarah; Griffiths, Guy; Smith, Michelle; Glithero, Rebecca; Howden, Philip; Barker, Nicholas; Stevens, Christopher; Harley, Joanna; Holt, Karen; Panagiotidis, Georgios; Lovell, Jamieson; Beasley, Helen; Henderson, Carl; Gordon, Daria; Auger, Katherine; Wright, Deborah; Collins, Joanna; Raisen, Claire; Dyer, Lauren; Leung, Kenric; Robertson, Lauren; Ambridge, Kirsty; Leongamornlert, Daniel; McGuire, Sarah; Gilderthorp, Ruth; Griffiths, Coline; Manthravadi, Deepa; Nichol, Sarah; Barker, Gary; Whitehead, Siobhan; Kay, Michael; Brown, Jacqueline; Murnane, Clare; Gray, Emma; Humphries, Matthew; Sycamore, Neil; Barker, Darren; Saunders, David; Wallis, Justene; Babbage, Anne; Hammond, Sian; Mashreghi-Mohammadi, Maryam; Barr, Lucy; Martin, Sancha; Wray, Paul; Ellington, Andrew; Matthews, Nicholas; Ellwood, Matthew; Woodmansey, Rebecca; Clark, Graham; Cooper, James; Tromans, Anthony; Grafham, Darren; Skuce, Carl; Pandian, Richard; Andrews, Robert; Harrison, Elliot; Kimberley, Andrew; Garnett, Jane; Fosker, Nigel; Hall, Rebekah; Garner, Patrick; Kelly, Daniel; Bird, Christine; Palmer, Sophie; Gehring, Ines; Berger, Andrea; Dooley, Christopher M.; Ersan-Ürün, Zübeyde; Eser, Cigdem; Geiger, Horst; Geisler, Maria; Karotki, Lena; Kirn, Anette; Konantz, Judith; Konantz, Martina; Oberländer, Martina; Rudolph-Geiger, Silke; Teucke, Mathias; Osoegawa, Kazutoyo; Zhu, Baoli; Rapp, Amanda; Widaa, Sara; Langford, Cordelia; Yang, Fengtang; Carter, Nigel P.; Harrow, Jennifer; Ning, Zemin; Herrero, Javier; Searle, Steve M. J.; Enright, Anton; Geisler, Robert; Plasterk, Ronald H. A.; Lee, Charles; Westerfield, Monte; de Jong, Pieter J.; Zon, Leonard I.; Postlethwait, John H.; Nüsslein-Volhard, Christiane; Hubbard, Tim J. P.; Crollius, Hugues Roest; Rogers, Jane; Stemple, Derek L.

    2013-01-01

    Zebrafish have become a popular organism for the study of vertebrate gene function1,2. The virtually transparent embryos of this species, and the ability to accelerate genetic studies by gene knockdown or overexpression, have led to the widespread use of zebrafish in the detailed investigation of vertebrate gene function and increasingly, the study of human genetic disease3–5. However, for effective modelling of human genetic disease it is important to understand the extent to which zebrafish genes and gene structures are related to orthologous human genes. To examine this, we generated a high-quality sequence assembly of the zebrafish genome, made up of an overlapping set of completely sequenced large-insert clones that were ordered and oriented using a high-resolution high-density meiotic map. Detailed automatic and manual annotation provides evidence of more than 26,000 protein-coding genes6, the largest gene set of any vertebrate so far sequenced. Comparison to the human reference genome shows that approximately 70% of human genes have at least one obvious zebrafish orthologue. In addition, the high quality of this genome assembly provides a clearer understanding of key genomic features such as a unique repeat content, a scarcity of pseudogenes, an enrichment of zebrafish-specific genes on chromosome 4 and chromosomal regions that influence sex determination. PMID:23594743

  6. The zebrafish reference genome sequence and its relationship to the human genome.

    Science.gov (United States)

    Howe, Kerstin; Clark, Matthew D; Torroja, Carlos F; Torrance, James; Berthelot, Camille; Muffato, Matthieu; Collins, John E; Humphray, Sean; McLaren, Karen; Matthews, Lucy; McLaren, Stuart; Sealy, Ian; Caccamo, Mario; Churcher, Carol; Scott, Carol; Barrett, Jeffrey C; Koch, Romke; Rauch, Gerd-Jörg; White, Simon; Chow, William; Kilian, Britt; Quintais, Leonor T; Guerra-Assunção, José A; Zhou, Yi; Gu, Yong; Yen, Jennifer; Vogel, Jan-Hinnerk; Eyre, Tina; Redmond, Seth; Banerjee, Ruby; Chi, Jianxiang; Fu, Beiyuan; Langley, Elizabeth; Maguire, Sean F; Laird, Gavin K; Lloyd, David; Kenyon, Emma; Donaldson, Sarah; Sehra, Harminder; Almeida-King, Jeff; Loveland, Jane; Trevanion, Stephen; Jones, Matt; Quail, Mike; Willey, Dave; Hunt, Adrienne; Burton, John; Sims, Sarah; McLay, Kirsten; Plumb, Bob; Davis, Joy; Clee, Chris; Oliver, Karen; Clark, Richard; Riddle, Clare; Elliot, David; Eliott, David; Threadgold, Glen; Harden, Glenn; Ware, Darren; Begum, Sharmin; Mortimore, Beverley; Mortimer, Beverly; Kerry, Giselle; Heath, Paul; Phillimore, Benjamin; Tracey, Alan; Corby, Nicole; Dunn, Matthew; Johnson, Christopher; Wood, Jonathan; Clark, Susan; Pelan, Sarah; Griffiths, Guy; Smith, Michelle; Glithero, Rebecca; Howden, Philip; Barker, Nicholas; Lloyd, Christine; Stevens, Christopher; Harley, Joanna; Holt, Karen; Panagiotidis, Georgios; Lovell, Jamieson; Beasley, Helen; Henderson, Carl; Gordon, Daria; Auger, Katherine; Wright, Deborah; Collins, Joanna; Raisen, Claire; Dyer, Lauren; Leung, Kenric; Robertson, Lauren; Ambridge, Kirsty; Leongamornlert, Daniel; McGuire, Sarah; Gilderthorp, Ruth; Griffiths, Coline; Manthravadi, Deepa; Nichol, Sarah; Barker, Gary; Whitehead, Siobhan; Kay, Michael; Brown, Jacqueline; Murnane, Clare; Gray, Emma; Humphries, Matthew; Sycamore, Neil; Barker, Darren; Saunders, David; Wallis, Justene; Babbage, Anne; Hammond, Sian; Mashreghi-Mohammadi, Maryam; Barr, Lucy; Martin, Sancha; Wray, Paul; Ellington, Andrew; Matthews, Nicholas; Ellwood, Matthew; Woodmansey, Rebecca; Clark, Graham; Cooper, James D; Cooper, James; Tromans, Anthony; Grafham, Darren; Skuce, Carl; Pandian, Richard; Andrews, Robert; Harrison, Elliot; Kimberley, Andrew; Garnett, Jane; Fosker, Nigel; Hall, Rebekah; Garner, Patrick; Kelly, Daniel; Bird, Christine; Palmer, Sophie; Gehring, Ines; Berger, Andrea; Dooley, Christopher M; Ersan-Ürün, Zübeyde; Eser, Cigdem; Geiger, Horst; Geisler, Maria; Karotki, Lena; Kirn, Anette; Konantz, Judith; Konantz, Martina; Oberländer, Martina; Rudolph-Geiger, Silke; Teucke, Mathias; Lanz, Christa; Raddatz, Günter; Osoegawa, Kazutoyo; Zhu, Baoli; Rapp, Amanda; Widaa, Sara; Langford, Cordelia; Yang, Fengtang; Schuster, Stephan C; Carter, Nigel P; Harrow, Jennifer; Ning, Zemin; Herrero, Javier; Searle, Steve M J; Enright, Anton; Geisler, Robert; Plasterk, Ronald H A; Lee, Charles; Westerfield, Monte; de Jong, Pieter J; Zon, Leonard I; Postlethwait, John H; Nüsslein-Volhard, Christiane; Hubbard, Tim J P; Roest Crollius, Hugues; Rogers, Jane; Stemple, Derek L

    2013-04-25

    Zebrafish have become a popular organism for the study of vertebrate gene function. The virtually transparent embryos of this species, and the ability to accelerate genetic studies by gene knockdown or overexpression, have led to the widespread use of zebrafish in the detailed investigation of vertebrate gene function and increasingly, the study of human genetic disease. However, for effective modelling of human genetic disease it is important to understand the extent to which zebrafish genes and gene structures are related to orthologous human genes. To examine this, we generated a high-quality sequence assembly of the zebrafish genome, made up of an overlapping set of completely sequenced large-insert clones that were ordered and oriented using a high-resolution high-density meiotic map. Detailed automatic and manual annotation provides evidence of more than 26,000 protein-coding genes, the largest gene set of any vertebrate so far sequenced. Comparison to the human reference genome shows that approximately 70% of human genes have at least one obvious zebrafish orthologue. In addition, the high quality of this genome assembly provides a clearer understanding of key genomic features such as a unique repeat content, a scarcity of pseudogenes, an enrichment of zebrafish-specific genes on chromosome 4 and chromosomal regions that influence sex determination.

  7. The complete genome sequence of the Atlantic salmon paramyxovirus (ASPV)

    International Nuclear Information System (INIS)

    Nylund, Stian; Karlsen, Marius; Nylund, Are

    2008-01-01

    The complete RNA genome of the Atlantic salmon paramyxovirus (ASPV), isolated from Atlantic salmon suffering from proliferative gill inflammation (PGI), has been determined. The genome is 16,965 nucleotides in length and consists of six nonoverlapping genes in the order 3'- N - P/C/V - M - F - HN - L -5', coding for the nucleocapsid, phospho-, matrix, fusion, hemagglutinin-neuraminidase and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and trinucleotide intergenic regions similar to those of other Paramyxoviridae. The ASPV P-gene expression strategy is like that of the respiro- and morbilliviruses, which express the phosphoprotein from the primary transcript, and edit a portion of the mRNA to encode the accessory proteins V and W. It also encodes the C-protein by ribosomal choice of translation initiation. Pairwise comparisons of amino acid identities, and phylogenetic analysis of deduced ASPV protein sequences with homologous sequences from other Paramyxoviridae, show that ASPV has an affinity for the genus Respirovirus, but may represent a new genus within the subfamily Paramyxovirinae

  8. Bacillus anthracis genome organization in light of whole transcriptome sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Jeffrey; Zhu, Wenhan; Passalacqua, Karla D.; Bergman, Nicholas; Borodovsky, Mark

    2010-03-22

    Emerging knowledge of whole prokaryotic transcriptomes could validate a number of theoretical concepts introduced in the early days of genomics. What are the rules connecting gene expression levels with sequence determinants such as quantitative scores of promoters and terminators? Are translation efficiency measures, e.g. codon adaptation index and RBS score related to gene expression? We used the whole transcriptome shotgun sequencing of a bacterial pathogen Bacillus anthracis to assess correlation of gene expression level with promoter, terminator and RBS scores, codon adaptation index, as well as with a new measure of gene translational efficiency, average translation speed. We compared computational predictions of operon topologies with the transcript borders inferred from RNA-Seq reads. Transcriptome mapping may also improve existing gene annotation. Upon assessment of accuracy of current annotation of protein-coding genes in the B. anthracis genome we have shown that the transcriptome data indicate existence of more than a hundred genes missing in the annotation though predicted by an ab initio gene finder. Interestingly, we observed that many pseudogenes possess not only a sequence with detectable coding potential but also promoters that maintain transcriptional activity.

  9. The Complete Chloroplast and Mitochondrial Genome Sequences of Boea hygrometrica: Insights into the Evolution of Plant Organellar Genomes

    Science.gov (United States)

    Wang, Xumin; Deng, Xin; Zhang, Xiaowei; Hu, Songnian; Yu, Jun

    2012-01-01

    The complete nucleotide sequences of the chloroplast (cp) and mitochondrial (mt) genomes of resurrection plant Boea hygrometrica (Bh, Gesneriaceae) have been determined with the lengths of 153,493 bp and 510,519 bp, respectively. The smaller chloroplast genome contains more genes (147) with a 72% coding sequence, and the larger mitochondrial genome have less genes (65) with a coding faction of 12%. Similar to other seed plants, the Bh cp genome has a typical quadripartite organization with a conserved gene in each region. The Bh mt genome has three recombinant sequence repeats of 222 bp, 843 bp, and 1474 bp in length, which divide the genome into a single master circle (MC) and four isomeric molecules. Compared to other angiosperms, one remarkable feature of the Bh mt genome is the frequent transfer of genetic material from the cp genome during recent Bh evolution. We also analyzed organellar genome evolution in general regarding genome features as well as compositional dynamics of sequence and gene structure/organization, providing clues for the understanding of the evolution of organellar genomes in plants. The cp-derived sequences including tRNAs found in angiosperm mt genomes support the conclusion that frequent gene transfer events may have begun early in the land plant lineage. PMID:22291979

  10. A mitochondrial genome sequence of the Tibetan antelope (Pantholops hodgsonii)

    DEFF Research Database (Denmark)

    Xu, Shu Qing; Yang, Ying Zhong; Zhou, Jun

    2005-01-01

    To investigate genetic mechanisms of high altitude adaptations of native mammals on the Tibetan Plateau, we compared mitochondrial sequences of the endangered Pantholops hodgsonii with its lowland distant relatives Ovis aries and Capra hircus, as well as other mammals. The complete mitochondrial...... genome of P. hodgsonii (16,498 bp) revealed a similar gene order as of other mammals. Because of tandem duplications, the control region of P. hodgsonii mitochondrial genome is shorter than those of O. aries and C. hircus, but longer than those of Bos species. Phylogenetic analysis based on alignments...... of the entire cytochrome b genes suggested that P. hodgsonii is more closely related to O. aries and C. hircus, rather than to species of the Antilopinae subfamily. The estimated divergence time between P. hodgsonii and O. aries is about 2.25 million years ago. Further analysis on natural selection indicated...

  11. Assembly of the Complete Sitka Spruce Chloroplast Genome Using 10X Genomics' GemCode Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Lauren Coombe

    Full Text Available The linked read sequencing library preparation platform by 10X Genomics produces barcoded sequencing libraries, which are subsequently sequenced using the Illumina short read sequencing technology. In this new approach, long fragments of DNA are partitioned into separate micro-reactions, where the same index sequence is incorporated into each of the sequencing fragment inserts derived from a given long fragment. In this study, we exploited this property by using reads from index sequences associated with a large number of reads, to assemble the chloroplast genome of the Sitka spruce tree (Picea sitchensis. Here we report on the first Sitka spruce chloroplast genome assembled exclusively from P. sitchensis genomic libraries prepared using the 10X Genomics protocol. We show that the resulting 124,049 base pair long genome shares high sequence similarity with the related white spruce and Norway spruce chloroplast genomes, but diverges substantially from a previously published P. sitchensis- P. thunbergii chimeric genome. The use of reads from high-frequency indices enabled separation of the nuclear genome reads from that of the chloroplast, which resulted in the simplification of the de Bruijn graphs used at the various stages of assembly.

  12. Fibonacci difference sequence spaces for modulus functions

    Directory of Open Access Journals (Sweden)

    Kuldip Raj

    2015-05-01

    Full Text Available In the present paper we introduce Fibonacci difference sequence spaces l(F, Ƒ, p, u and  l_∞(F, Ƒ, p, u by using a sequence of modulus functions and a new band matrix F. We also make an effort to study some inclusion relations, topological and geometric properties of these spaces. Furthermore, the alpha, beta, gamma duals and matrix transformation of the space l(F, Ƒ, p, u are determined.

  13. Whole Genome Sequence of the Heterozygous Clinical Isolate Candida krusei 81-B-5

    Directory of Open Access Journals (Sweden)

    Christina A. Cuomo

    2017-09-01

    Full Text Available Candida krusei is a diploid, heterozygous yeast that is an opportunistic fungal pathogen in immunocompromised patients. This species also is utilized for fermenting cocoa beans during chocolate production. One major concern in the clinical setting is the innate resistance of this species to the most commonly used antifungal drug fluconazole. Here, we report a high-quality genome sequence and assembly for the first clinical isolate of C. krusei, strain 81-B-5, into 11 scaffolds generated with PacBio sequencing technology. Gene annotation and comparative analysis revealed a unique profile of transporters that could play a role in drug resistance or adaptation to different environments. In addition, we show that, while 82% of the genome is highly heterozygous, a 2.0 Mb region of the largest scaffold has undergone loss of heterozygosity. This genome will serve as a reference for further genetic studies of this pathogen.

  14. Comparing sequencing assays and human-machine analyses in actionable genomics for glioblastoma.

    Science.gov (United States)

    Wrzeszczynski, Kazimierz O; Frank, Mayu O; Koyama, Takahiko; Rhrissorrakrai, Kahn; Robine, Nicolas; Utro, Filippo; Emde, Anne-Katrin; Chen, Bo-Juen; Arora, Kanika; Shah, Minita; Vacic, Vladimir; Norel, Raquel; Bilal, Erhan; Bergmann, Ewa A; Moore Vogel, Julia L; Bruce, Jeffrey N; Lassman, Andrew B; Canoll, Peter; Grommes, Christian; Harvey, Steve; Parida, Laxmi; Michelini, Vanessa V; Zody, Michael C; Jobanputra, Vaidehi; Royyuru, Ajay K; Darnell, Robert B

    2017-08-01

    To analyze a glioblastoma tumor specimen with 3 different platforms and compare potentially actionable calls from each. Tumor DNA was analyzed by a commercial targeted panel. In addition, tumor-normal DNA was analyzed by whole-genome sequencing (WGS) and tumor RNA was analyzed by RNA sequencing (RNA-seq). The WGS and RNA-seq data were analyzed by a team of bioinformaticians and cancer oncologists, and separately by IBM Watson Genomic Analytics (WGA), an automated system for prioritizing somatic variants and identifying drugs. More variants were identified by WGS/RNA analysis than by targeted panels. WGA completed a comparable analysis in a fraction of the time required by the human analysts. The development of an effective human-machine interface in the analysis of deep cancer genomic datasets may provide potentially clinically actionable calls for individual patients in a more timely and efficient manner than currently possible. NCT02725684.

  15. The genome sequence of the emerging common midwife toad virus identifies an evolutionary intermediate within ranaviruses.

    Science.gov (United States)

    Mavian, Carla; López-Bueno, Alberto; Balseiro, Ana; Casais, Rosa; Alcamí, Antonio; Alejo, Alí

    2012-04-01

    Worldwide amphibian population declines have been ascribed to global warming, increasing pollution levels, and other factors directly related to human activities. These factors may additionally be favoring the emergence of novel pathogens. In this report, we have determined the complete genome sequence of the emerging common midwife toad ranavirus (CMTV), which has caused fatal disease in several amphibian species across Europe. Phylogenetic and gene content analyses of the first complete genomic sequence from a ranavirus isolated in Europe show that CMTV is an amphibian-like ranavirus (ALRV). However, the CMTV genome structure is novel and represents an intermediate evolutionary stage between the two previously described ALRV groups. We find that CMTV clusters with several other ranaviruses isolated from different hosts and locations which might also be included in this novel ranavirus group. This work sheds light on the phylogenetic relationships within this complex group of emerging, disease-causing viruses.

  16. Comparative genomic assessment of Multi-Locus Sequence Typing: rapid accumulation of genomic heterogeneity among clonal isolates of Campylobacter jejuni

    Directory of Open Access Journals (Sweden)

    Nash John HE

    2008-08-01

    Full Text Available Abstract Background Multi-Locus Sequence Typing (MLST has emerged as a leading molecular typing method owing to its high ability to discriminate among bacterial isolates, the relative ease with which data acquisition and analysis can be standardized, and the high portability of the resulting sequence data. While MLST has been successfully applied to the study of the population structure for a number of different bacterial species, it has also provided compelling evidence for high rates of recombination in some species. We have analyzed a set of Campylobacter jejuni strains using MLST and Comparative Genomic Hybridization (CGH on a full-genome microarray in order to determine whether recombination and high levels of genomic mosaicism adversely affect the inference of strain relationships based on the analysis of a restricted number of genetic loci. Results Our results indicate that, in general, there is significant concordance between strain relationships established by MLST and those based on shared gene content as established by CGH. While MLST has significant predictive power with respect to overall genome similarity of isolates, we also found evidence for significant differences in genomic content among strains that would otherwise appear to be highly related based on their MLST profiles. Conclusion The extensive genomic mosaicism between closely related strains has important implications in the context of establishing strain to strain relationships because it suggests that the exact gene content of strains, and by extension their phenotype, is less likely to be "predicted" based on a small number of typing loci. This in turn suggests that a greater emphasis should be placed on analyzing genes of clinical interest as we forge ahead with the next generation of molecular typing methods.

  17. Predictive genomics: a cancer hallmark network framework for predicting tumor clinical phenotypes using genome sequencing data.

    Science.gov (United States)

    Wang, Edwin; Zaman, Naif; Mcgee, Shauna; Milanese, Jean-Sébastien; Masoudi-Nejad, Ali; O'Connor-McCourt, Maureen

    2015-02-01

    Tumor genome sequencing leads to documenting thousands of DNA mutations and other genomic alterations. At present, these data cannot be analyzed adequately to aid in the understanding of tumorigenesis and its evolution. Moreover, we have little insight into how to use these data to predict clinical phenotypes and tumor progression to better design patient treatment. To meet these challenges, we discuss a cancer hallmark network framework for modeling genome sequencing data to predict cancer clonal evolution and associated clinical phenotypes. The framework includes: (1) cancer hallmarks that can be represented by a few molecular/signaling networks. 'Network operational signatures' which represent gene regulatory logics/strengths enable to quantify state transitions and measures of hallmark traits. Thus, sets of genomic alterations which are associated with network operational signatures could be linked to the state/measure of hallmark traits. The network operational signature transforms genotypic data (i.e., genomic alterations) to regulatory phenotypic profiles (i.e., regulatory logics/strengths), to cellular phenotypic profiles (i.e., hallmark traits) which lead to clinical phenotypic profiles (i.e., a collection of hallmark traits). Furthermore, the framework considers regulatory logics of the hallmark networks under tumor evolutionary dynamics and therefore also includes: (2) a self-promoting positive feedback loop that is dominated by a genomic instability network and a cell survival/proliferation network is the main driver of tumor clonal evolution. Surrounding tumor stroma and its host immune systems shape the evolutionary paths; (3) cell motility initiating metastasis is a byproduct of the above self-promoting loop activity during tumorigenesis; (4) an emerging hallmark network which triggers genome duplication dominates a feed-forward loop which in turn could act as a rate-limiting step for tumor formation; (5) mutations and other genomic alterations have

  18. Whole Genome Amplification and Reduced-Representation Genome Sequencing of Schistosoma japonicum Miracidia.

    Directory of Open Access Journals (Sweden)

    Jonathan A Shortt

    2017-01-01

    Full Text Available In areas where schistosomiasis control programs have been implemented, morbidity and prevalence have been greatly reduced. However, to sustain these reductions and move towards interruption of transmission, new tools for disease surveillance are needed. Genomic methods have the potential to help trace the sources of new infections, and allow us to monitor drug resistance. Large-scale genotyping efforts for schistosome species have been hindered by cost, limited numbers of established target loci, and the small amount of DNA obtained from miracidia, the life stage most readily acquired from humans. Here, we present a method using next generation sequencing to provide high-resolution genomic data from S. japonicum for population-based studies.We applied whole genome amplification followed by double digest restriction site associated DNA sequencing (ddRADseq to individual S. japonicum miracidia preserved on Whatman FTA cards. We found that we could effectively and consistently survey hundreds of thousands of variants from 10,000 to 30,000 loci from archived miracidia as old as six years. An analysis of variation from eight miracidia obtained from three hosts in two villages in Sichuan showed clear population structuring by village and host even within this limited sample.This high-resolution sequencing approach yields three orders of magnitude more information than microsatellite genotyping methods that have been employed over the last decade, creating the potential to answer detailed questions about the sources of human infections and to monitor drug resistance. Costs per sample range from $50-$200, depending on the amount of sequence information desired, and we expect these costs can be reduced further given continued reductions in sequencing costs, improvement of protocols, and parallelization. This approach provides new promise for using modern genome-scale sampling to S. japonicum surveillance, and could be applied to other schistosome species

  19. Whole Genome Amplification and Reduced-Representation Genome Sequencing of Schistosoma japonicum Miracidia.

    Science.gov (United States)

    Shortt, Jonathan A; Card, Daren C; Schield, Drew R; Liu, Yang; Zhong, Bo; Castoe, Todd A; Carlton, Elizabeth J; Pollock, David D

    2017-01-01

    In areas where schistosomiasis control programs have been implemented, morbidity and prevalence have been greatly reduced. However, to sustain these reductions and move towards interruption of transmission, new tools for disease surveillance are needed. Genomic methods have the potential to help trace the sources of new infections, and allow us to monitor drug resistance. Large-scale genotyping efforts for schistosome species have been hindered by cost, limited numbers of established target loci, and the small amount of DNA obtained from miracidia, the life stage most readily acquired from humans. Here, we present a method using next generation sequencing to provide high-resolution genomic data from S. japonicum for population-based studies. We applied whole genome amplification followed by double digest restriction site associated DNA sequencing (ddRADseq) to individual S. japonicum miracidia preserved on Whatman FTA cards. We found that we could effectively and consistently survey hundreds of thousands of variants from 10,000 to 30,000 loci from archived miracidia as old as six years. An analysis of variation from eight miracidia obtained from three hosts in two villages in Sichuan showed clear population structuring by village and host even within this limited sample. This high-resolution sequencing approach yields three orders of magnitude more information than microsatellite genotyping methods that have been employed over the last decade, creating the potential to answer detailed questions about the sources of human infections and to monitor drug resistance. Costs per sample range from $50-$200, depending on the amount of sequence information desired, and we expect these costs can be reduced further given continued reductions in sequencing costs, improvement of protocols, and parallelization. This approach provides new promise for using modern genome-scale sampling to S. japonicum surveillance, and could be applied to other schistosome species and other

  20. Twenty-one genome sequences from Pseudomonas species and 19 genome sequences from diverse bacteria isolated from the rhizosphere and endosphere of Populus deltoides.

    Science.gov (United States)

    Brown, Steven D; Utturkar, Sagar M; Klingeman, Dawn M; Johnson, Courtney M; Martin, Stanton L; Land, Miriam L; Lu, Tse-Yuan S; Schadt, Christopher W; Doktycz, Mitchel J; Pelletier, Dale A

    2012-11-