Real-time PCR analysis of genes encoding tumor antigens in esophageal tumors and a cancer vaccine
DEFF Research Database (Denmark)
Weinert, Brian T; Krishnadath, Kausilia K; Milano, Francesca
2009-01-01
Tumor antigens are the primary target of therapeutic cancer vaccines. We set out to define and compare the expression pattern of tumor antigen genes in esophagus carcinoma biopsies and in an allogeneic tumor lysate-based cancer vaccine, MelCancerVac. Cells used for vaccine production were treated...... in the production of the vaccine. Quantitative PCR was used to assay 74 tumor antigen genes in patients with squamous cell carcinoma of the esophagus. 81% (13/16) of tumors expressed more than five cancer/testis (CT) antigens. A total of 96 genes were assayed in the tumor cell clone (DDM1.7) used to make tumor cell...
International Nuclear Information System (INIS)
Kang, Joo Hyun
2006-01-01
Knowledge of molecular mechanisms governing malignant transformation brings new opportunities for therapeutic intervention against cancer using novel approaches. One of them is gene therapy based on the transfer of genetic material to an organism with the aim of correcting a disease. The application of gene therapy to the cancer treatment had led to the development of new experimental approaches such as suicidal gene therapy, inhibition of oncogenes and restoration of tumor-suppressor genes. Suicidal gene therapy is based on the expression in tumor cells of a gene encoding an enzyme that converts a prodrug into a toxic product. Representative suicidal genes are Herpes simplex virus type 1 thymidine kinase (HSV1-tk) and cytosine deaminase (CD). Especially, physicians and scientists of nuclear medicine field take an interest in suicidal gene therapy because they can monitor the location and magnitude, and duration of expression of HSV1-tk and CD by PET scanner
Real-time PCR analysis of genes encoding tumor antigens in esophageal tumors and a cancer vaccine
Weinert, Brian T.; Krishnadath, Kausilia K.; Milano, Francesca; Pedersen, Ayako W.; Claesson, Mogens H.; Zocca, Mai-Britt
2009-01-01
Tumor antigens are the primary target of therapeutic cancer vaccines. We set out to define and compare the expression pattern of tumor antigen genes in esophagus carcinoma biopsies and in an allogeneic tumor lysate-based cancer vaccine, MelCancerVac. Cells used for vaccine production were treated
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang
2008-01-01
This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Downregulation of ATM Gene and Protein Expression in Canine Mammary Tumors.
Raposo-Ferreira, T M M; Bueno, R C; Terra, E M; Avante, M L; Tinucci-Costa, M; Carvalho, M; Cassali, G D; Linde, S D; Rogatto, S R; Laufer-Amorim, R
2016-11-01
The ataxia telangiectasia mutated (ATM) gene encodes a protein associated with DNA damage repair and maintenance of genomic integrity. In women, ATM transcript and protein downregulation have been reported in sporadic breast carcinomas, and the absence of ATM protein expression has been associated with poor prognosis. The aim of this study was to evaluate ATM gene and protein expression in canine mammary tumors and their association with clinical outcome. ATM gene and protein expression was evaluated by reverse transcription-quantitative polymerase chain reaction and immunohistochemistry, respectively, in normal mammary gland samples (n = 10), benign mammary tumors (n = 11), nonmetastatic mammary carcinomas (n = 19), and metastatic mammary carcinomas (n = 11). Lower ATM transcript levels were detected in benign mammary tumors and carcinomas compared with normal mammary glands (P = .011). Similarly, lower ATM protein expression was observed in benign tumors (P = .0003), nonmetastatic mammary carcinomas (P ATM gene or protein levels were detected among benign tumors and nonmetastatic and metastatic mammary carcinomas (P > .05). The levels of ATM gene or protein expression were not significantly associated with clinical and pathological features or with survival. Similar to human breast cancer, the data in this study suggest that ATM gene and protein downregulation is involved in canine mammary gland tumorigenesis. © The Author(s) 2016.
Kim, K S; Chilton, W S; Farrand, S K
1996-01-01
The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasm...
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Energy Technology Data Exchange (ETDEWEB)
Heighway, J.; Betticher, D.C.; Altermatt, H.J. [Univ. Hospital of Berne (Switzerland)] [and others
1996-07-01
Analysis of a region of DNA, coamplified in tumors with KRAS2, resulted in the identification of the human homologue of the mouse KRAG gene. The gene was widely expressed in range of cell lines, tumors, and normal tissue and demonstrated a high degree of alternate splicing. A human KRAG cDNA sequence, with a structure similar to that encoded by the amplified gene in mouse Y1 adrenal carcinoma cells, was isolated by RT-PCR. The predicted amino acid similarity between the two sequences was 91%, and hydrophobicity plots suggested a structure closely resembling that of transmembrane 4 superfamily members. Identification of a PCR-based restriction fragment length polymorphism allele-specific splicing differences in tumors. Northern analysis of mRNA derived from a range of tissues suggested high level expression in muscle and confirmed alternate splicing. To facilitate the analysis of exon junctions, a YAC clone encoding the genomic sequence was identified. This allowed the localization of KRAG to human chromosome 12p11.2. Isolation of one end of this nonchimeric clone demonstrated a perfect match with a 247-bp sequence within the 3{prime} untranslated region of the type 2 1,4,5-inositol triphosphate receptor gene. Multiplex PCR confirmed the inclusion of both genes. Multiplex PCR confirmed the inclusion of both genes in the KRAS2 amplicon in human malignancy, suggesting that either may contribute to the malignant phenotypes. 35 refs., 6 figs., 1 tab.
Irradiation promotes Akt-targeting therapeutic gene delivery to the tumor vasculature
International Nuclear Information System (INIS)
Sonveaux, Pierre; Frerart, Francoise; Bouzin, Caroline; Brouet, Agnes; Wever, Julie de; Jordan, Benedicte F.; Gallez, Bernard; Feron, Olivier
2007-01-01
Purpose: To determine whether radiation-induced increases in nitric oxide (NO) production can influence tumor blood flow and improve delivery of Akt-targeting therapeutic DNA lipocomplexes to the tumor. Methods and Materials: The contribution of NO to the endothelial response to radiation was identified using NO synthase (NOS) inhibitors and endothelial NOS (eNOS)-deficient mice. Reporter-encoding plasmids complexed with cationic lipids were used to document the tumor vascular specificity and the efficacy of in vivo lipofection after irradiation. A dominant-negative Akt gene construct was used to evaluate the facilitating effects of radiotherapy on the therapeutic transgene delivery. Results: The abundance of eNOS protein was increased in both irradiated tumor microvessels and endothelial cells, leading to a stimulation of NO release and an associated increase in tumor blood flow. Transgene expression was subsequently improved in the irradiated vs. nonirradiated tumor vasculature. This effect was not apparent in eNOS-deficient mice and could not be reproduced in irradiated cultured endothelial cells. Finally, we combined low-dose radiotherapy with a dominant-negative Akt gene construct and documented synergistic antitumor effects. Conclusions: This study offers a new rationale to combine radiotherapy with gene therapy, by directly exploiting the stimulatory effects of radiation on NO production by tumor endothelial cells. The preferential expression of the transgene in the tumor microvasculature underscores the potential of such an adjuvant strategy to limit the angiogenic response of irradiated tumors
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Tumor Suppressor Genes within Common Fragile Sites Are Active Players in the DNA Damage Response.
Directory of Open Access Journals (Sweden)
Idit Hazan
2016-12-01
Full Text Available The role of common fragile sites (CFSs in cancer remains controversial. Two main views dominate the discussion: one suggests that CFS loci are hotspots of genomic instability leading to inactivation of genes encoded within them, while the other view proposes that CFSs are functional units and that loss of the encoded genes confers selective pressure, leading to cancer development. The latter view is supported by emerging evidence showing that expression of a given CFS is associated with genome integrity and that inactivation of CFS-resident tumor suppressor genes leads to dysregulation of the DNA damage response (DDR and increased genomic instability. These two viewpoints of CFS function are not mutually exclusive but rather coexist; when breaks at CFSs are not repaired accurately, this can lead to deletions by which cells acquire growth advantage because of loss of tumor suppressor activities. Here, we review recent advances linking some CFS gene products with the DDR, genomic instability, and carcinogenesis and discuss how their inactivation might represent a selective advantage for cancer cells.
DEFF Research Database (Denmark)
Nagasawa, T; Zhang, Q; Raghunath, P N
2006-01-01
To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Molecular characterization of the porcine deleted in malignant brain tumors 1 gene (DMBT1)
DEFF Research Database (Denmark)
Haase, Bianca; Humphray, Sean J; Lyer, Stefan
2006-01-01
The human gene deleted in malignant brain tumors 1 (DMBT1) is considered to play a role in tumorigenesis and pathogen defense. It encodes a protein with multiple scavenger receptor cysteine-rich (SRCR) domains, which are involved in recognition and binding of a broad spectrum of bacterial pathogens...
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A
2010-07-01
WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.
Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.
2010-01-01
WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
International Nuclear Information System (INIS)
Schrader, Mark; Burger, Angelika M; Müller, Markus; Krause, Hans; Straub, Bernd; Schostak, Martin; Schulze, Wolfgang; Lauke, Heidrun; Miller, Kurt
2002-01-01
The activity of the ribonucleoprotein enzyme telomerase is detectable in germ, stem and tumor cells. One major component of telomerase is human telomerase reverse transcriptase (hTERT), which encodes the catalytic subunit of telomerase. Here we investigate the correlation of telomerase activity and hTERT gene expression and the differentiation status of primary testicular germ cell tumors (TGCT). Telomerase activity (TA) was detected by a quantitative telomerase PCR ELISA, and hTERT mRNA expression was quantified by online RT-PCR in 42 primary testicular germ cell tumors. The control group consisted of benign testicular biopsies from infertile patients. High levels of telomerase activity and hTERT expression were detected in all examined undifferentiated TGCTs and in the benign testicular tissue specimens with germ cell content. In contrast, differentiated teratomas and testicular control tissue without germ cells (Sertoli-cell-only syndrome) showed no telomerase activity and only minimal hTERT expression. These findings demonstrate an inverse relationship between the level of telomerase activity and hTERT mRNA expression and the differentiation state of germ cell tumors. Quantification of telomerase activity and hTERT mRNA expression enables a new molecular-diagnostic subclassification of germ cell tumors that describes their proliferation potential and differentiation status
Directory of Open Access Journals (Sweden)
Schulze Wolfgang
2002-11-01
Full Text Available Abstract Background The activity of the ribonucleoprotein enzyme telomerase is detectable in germ, stem and tumor cells. One major component of telomerase is human telomerase reverse transcriptase (hTERT, which encodes the catalytic subunit of telomerase. Here we investigate the correlation of telomerase activity and hTERT gene expression and the differentiation status of primary testicular germ cell tumors (TGCT. Methods Telomerase activity (TA was detected by a quantitative telomerase PCR ELISA, and hTERT mRNA expression was quantified by online RT-PCR in 42 primary testicular germ cell tumors. The control group consisted of benign testicular biopsies from infertile patients. Results High levels of telomerase activity and hTERT expression were detected in all examined undifferentiated TGCTs and in the benign testicular tissue specimens with germ cell content. In contrast, differentiated teratomas and testicular control tissue without germ cells (Sertoli-cell-only syndrome showed no telomerase activity and only minimal hTERT expression. Conclusions These findings demonstrate an inverse relationship between the level of telomerase activity and hTERT mRNA expression and the differentiation state of germ cell tumors. Quantification of telomerase activity and hTERT mRNA expression enables a new molecular-diagnostic subclassification of germ cell tumors that describes their proliferation potential and differentiation status.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
A novel proapoptotic gene PANO encodes a post-translational modulator of the tumor suppressor p14ARF
Energy Technology Data Exchange (ETDEWEB)
Watari, Akihiro; Li, Yang; Higashiyama, Shinji; Yutsudo, Masuo, E-mail: yutsudo@biken.osaka-u.ac.jp
2012-02-01
The protein p14ARF is a known tumor suppressor protein controlling cell proliferation and survival, which mainly localizes in nucleoli. However, the regulatory mechanisms that govern its activity or expression remain unclear. Here, we report that a novel proapoptotic nucleolar protein, PANO, modulates the expression and activity of p14ARF in HeLa cells. Overexpression of PANO enhances the stability of p14ARF protein by protecting it from degradation, resulting in an increase in p14ARF expression levels. Overexpression of PANO also induces apoptosis under low serum conditions. This effect is dependent on the nucleolar localization of PANO and inhibited by knocking-down p14ARF. Alternatively, PANO siRNA treated cells exhibit a reduction in p14ARF protein levels. In addition, ectopic expression of PANO suppresses the tumorigenicity of HeLa cells in nude mice. These results indicate that PANO is a new apoptosis-inducing gene by modulating the tumor suppressor protein, p14ARF, and may itself be a new candidate tumor suppressor gene.
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Chiu, Hua-Sheng; Somvanshi, Sonal; Patel, Ektaben; Chen, Ting-Wen; Singh, Vivek P; Zorman, Barry; Patil, Sagar L; Pan, Yinghong; Chatterjee, Sujash S; Sood, Anil K; Gunaratne, Preethi H; Sumazin, Pavel
2018-04-03
Long noncoding RNAs (lncRNAs) are commonly dysregulated in tumors, but only a handful are known to play pathophysiological roles in cancer. We inferred lncRNAs that dysregulate cancer pathways, oncogenes, and tumor suppressors (cancer genes) by modeling their effects on the activity of transcription factors, RNA-binding proteins, and microRNAs in 5,185 TCGA tumors and 1,019 ENCODE assays. Our predictions included hundreds of candidate onco- and tumor-suppressor lncRNAs (cancer lncRNAs) whose somatic alterations account for the dysregulation of dozens of cancer genes and pathways in each of 14 tumor contexts. To demonstrate proof of concept, we showed that perturbations targeting OIP5-AS1 (an inferred tumor suppressor) and TUG1 and WT1-AS (inferred onco-lncRNAs) dysregulated cancer genes and altered proliferation of breast and gynecologic cancer cells. Our analysis indicates that, although most lncRNAs are dysregulated in a tumor-specific manner, some, including OIP5-AS1, TUG1, NEAT1, MEG3, and TSIX, synergistically dysregulate cancer pathways in multiple tumor contexts. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Claudia Gaspar
2009-07-01
Full Text Available Germline mutations in the adenomatous polyposis coli (APC gene are responsible for familial adenomatous polyposis (FAP, an autosomal dominant hereditary predisposition to the development of multiple colorectal adenomas and of a broad spectrum of extra-intestinal tumors. Moreover, somatic APC mutations play a rate-limiting and initiating role in the majority of sporadic colorectal cancers. Notwithstanding its multifunctional nature, the main tumor suppressing activity of the APC gene resides in its ability to regulate Wnt/beta-catenin signaling. Notably, genotype-phenotype correlations have been established at the APC gene between the length and stability of the truncated proteins encoded by different mutant alleles, the corresponding levels of Wnt/beta-catenin signaling activity they encode for, and the incidence and distribution of intestinal and extra-intestinal tumors. Here, we report a novel mouse model, Apc1572T, obtained by targeting a truncated mutation at codon 1572 in the endogenous Apc gene. This hypomorphic mutant allele results in intermediate levels of Wnt/beta-catenin signaling activation when compared with other Apc mutations associated with multifocal intestinal tumors. Notwithstanding the constitutive nature of the mutation, Apc(+/1572T mice have no predisposition to intestinal cancer but develop multifocal mammary adenocarcinomas and subsequent pulmonary metastases in both genders. The histology of the Apc1572T primary mammary tumours is highly heterogeneous with luminal, myoepithelial, and squamous lineages and is reminiscent of metaplastic carcinoma of the breast in humans. The striking phenotype of Apc(+/1572T mice suggests that specific dosages of Wnt/beta-catenin signaling activity differentially affect tissue homeostasis and initiate tumorigenesis in an organ-specific fashion.
International Nuclear Information System (INIS)
Kang, Yu; Zhang, Xiaoyan; Jiang, Wei; Wu, Chaoqun; Chen, Chunmei; Zheng, Yufang; Gu, Jianren; Xu, Congjian
2009-01-01
Compared with viral vectors, nonviral vectors are less immunogenic, more stable, safer and easier to replication for application in cancer gene therapy. However, nonviral gene delivery system has not been extensively used because of the low transfection efficiency and the short transgene expression, especially in vivo. It is desirable to develop a nonviral gene delivery system that can support stable genomic integration and persistent gene expression in vivo. Here, we used a composite nonviral gene delivery system consisting of the piggyBac (PB) transposon and polyethylenimine (PEI) for long-term transgene expression in mouse ovarian tumors. A recombinant plasmid PB [Act-RFP, HSV-tk] encoding both the herpes simplex thymidine kinase (HSV-tk) and the monomeric red fluorescent protein (mRFP1) under PB transposon elements was constructed. This plasmid and the PBase plasmid were injected into ovarian cancer tumor xenografts in mice by in vivo PEI system. The antitumor effects of HSV-tk/ganciclovir (GCV) system were observed after intraperitoneal injection of GCV. Histological analysis and TUNEL assay were performed on the cryostat sections of the tumor tissue. Plasmid construction was confirmed by PCR analysis combined with restrictive enzyme digestion. mRFP1 expression could be visualized three weeks after the last transfection of pPB/TK under fluorescence microscopy. After GCV admission, the tumor volume of PB/TK group was significantly reduced and the tumor inhibitory rate was 81.96% contrasted against the 43.07% in the TK group. Histological analysis showed that there were extensive necrosis and lymphocytes infiltration in the tumor tissue of the PB/TK group but limited in the tissue of control group. TUNEL assays suggested that the transfected cells were undergoing apoptosis after GCV admission in vivo. Our results show that the nonviral gene delivery system coupling PB transposon with PEI can be used as an efficient tool for gene therapy in ovarian cancer
Directory of Open Access Journals (Sweden)
Marina Shirmanova
Full Text Available The strong phototoxicity of the red fluorescent protein KillerRed allows it to be considered as a potential genetically encoded photosensitizer for the photodynamic therapy (PDT of cancer. The advantages of KillerRed over chemical photosensitizers are its expression in tumor cells transduced with the appropriate gene and direct killing of cells through precise damage to any desired cell compartment. The ability of KillerRed to affect cell division and to induce cell death has already been demonstrated in cancer cell lines in vitro and HeLa tumor xenografts in vivo. However, the further development of this approach for PDT requires optimization of the method of treatment. In this study we tested the continuous wave (593 nm and pulsed laser (584 nm, 10 Hz, 18 ns modes to achieve an antitumor effect. The research was implemented on CT26 subcutaneous mouse tumors expressing KillerRed in fusion with histone H2B. The results showed that the pulsed mode provided a higher rate of photobleaching of KillerRed without any temperature increase on the tumor surface. PDT with the continuous wave laser was ineffective against CT26 tumors in mice, whereas the pulsed laser induced pronounced histopathological changes and inhibition of tumor growth. Therefore, we selected an effective regimen for PDT when using the genetically encoded photosensitizer KillerRed and pulsed laser irradiation.
Directory of Open Access Journals (Sweden)
Hua-Sheng Chiu
2018-04-01
Full Text Available Summary: Long noncoding RNAs (lncRNAs are commonly dysregulated in tumors, but only a handful are known to play pathophysiological roles in cancer. We inferred lncRNAs that dysregulate cancer pathways, oncogenes, and tumor suppressors (cancer genes by modeling their effects on the activity of transcription factors, RNA-binding proteins, and microRNAs in 5,185 TCGA tumors and 1,019 ENCODE assays. Our predictions included hundreds of candidate onco- and tumor-suppressor lncRNAs (cancer lncRNAs whose somatic alterations account for the dysregulation of dozens of cancer genes and pathways in each of 14 tumor contexts. To demonstrate proof of concept, we showed that perturbations targeting OIP5-AS1 (an inferred tumor suppressor and TUG1 and WT1-AS (inferred onco-lncRNAs dysregulated cancer genes and altered proliferation of breast and gynecologic cancer cells. Our analysis indicates that, although most lncRNAs are dysregulated in a tumor-specific manner, some, including OIP5-AS1, TUG1, NEAT1, MEG3, and TSIX, synergistically dysregulate cancer pathways in multiple tumor contexts. : Chiu et al. present a pan-cancer analysis of lncRNA regulatory interactions. They suggest that the dysregulation of hundreds of lncRNAs target and alter the expression of cancer genes and pathways in each tumor context. This implies that hundreds of lncRNAs can alter tumor phenotypes in each tumor context. Keywords: lncRNA, regulation, modulation, cancer gene, pan-cancer, noncoding RNA, microRNA, RNA-binding proteins, interactome
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Directory of Open Access Journals (Sweden)
M.O. Diniz
2011-05-01
Full Text Available Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5 expressing three proteins (E7, E6, and E5 of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose induced a strong activation of E7-specific interferon-γ (INF-γ-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Valentijn, Linda J.; Koster, Jan; Versteeg, Rogier
2006-01-01
NM23-H1 and NM23-H2 are neighboring genes on chromosome 17q. They encode nucleoside diphosphate kinases that have additional roles in signal transduction, transcription, and apoptosis. NM23-H1 expression is a strong marker for prognosis and metastatic behavior in many tumor types. A new
International Nuclear Information System (INIS)
Zboralski, Dirk; Böckmann, Miriam; Zapatka, Marc; Hoppe, Sabine; Schöneck, Anna; Hahn, Stephan A; Schmiegel, Wolff; Schwarte-Waldhoff, Irmgard
2008-01-01
Functional inactivation of the tumor suppressor Smad4 in colorectal and pancreatic carcinogenesis occurs coincident with the transition to invasive growth. Breaking the basement membrane (BM) barrier, a prerequisite for invasive growth, can be due to tumor induced proteolytic tissue remodeling or to reduced synthesis of BM molecules by incipient tumor cells. Laminin-332 (laminin-5), a heterotrimeric BM component composed of α3-, β3- and γ2-chains, has recently been identified as a target structure of Smad4 and represents the first example for expression control of an essential BM component by a tumor and invasion suppressor. Biochemically Smad4 is a transmitter of signals of the TGFβ superfamily of cytokines. We have reported previously, that Smad4 functions as a positive transcriptional regulator of constitutive and of TGFβ-induced transcription of all three genes encoding Laminin-332, LAMA3, LAMB3 and LAMC2. Promoter-reporter constructs harboring 4 kb upstream regions, each of the three genes encoding Laminin-322 as well as deletion and mutations constructs were established. Promoter activities and TGFβ induction were assayed through transient transfections in Smad4-negative human cancer cells and their stable Smad4-positive derivatives. Functionally relevant binding sites were subsequently confirmed through chromatin immunoprecipitation. Herein, we report that Smad4 mediates transcriptional regulation through three different mechanisms, namely through Smad4 binding to a functional SBE site exclusively in the LAMA3 promoter, Smad4 binding to AP1 (and Sp1) sites presumably via interaction with AP1 family components and lastly a Smad4 impact on transcription of AP1 factors. Whereas Smad4 is essential for positive regulation of all three genes, the molecular mechanisms are significantly divergent between the LAMA3 promoter as compared to the LAMB3 and LAMC2 promoters. We hypothesize that this divergence in modular regulation of the three promoters may lay the
Kim, K S; Chilton, W S; Farrand, S K
1996-06-01
The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasmid pAtC58. NT1 or UIA5 harboring pYDH208 with an insertion mutation in mocC failed to utilize MOP as the sole carbon source. Plasmid pSa-C, which encodes only mocC, complemented this mutation in both strains. This plasmid also was sufficient to confer utilization of MOP on NT1 but not on UIA5. Computer analysis showed that MocC is related at the amino acid sequence level to members of the short-chain alcohol dehydrogenase family of oxidoreductases. Lysates prepared from Escherichia coli cells expressing mocC contained an enzymatic activity that oxidizes MOP to deoxyfructosyl glutamine (santhopine [SOP]) in the presence of NAD+. The reaction catalyzed by the MOP oxidoreductase is reversible; in the presence of NADH, the enzyme reduced SOP to MOP. The apparent Km values of the enzyme for MOP and SOP were 6.3 and 1.2 mM, respectively. Among analogs of MOP tested, only N-1-(1-deoxy-D-lyxityl)-L-glutamine and N-1-(1-deoxy-D-mannityl)-L-asparagine served as substrates for MOP oxidoreductase. These results indicate that mocC encodes an oxidoreductase that, as an oxidase, is essential for the catabolism of MOP. The reductase activity of this enzyme is precisely the reaction ascribed to its T-region-encoded homolog, Mas1, which is responsible for biosynthesis of mannopine in crown gall tumors.
Directory of Open Access Journals (Sweden)
Dmitrii E. Polev
2014-01-01
Full Text Available Human gene LOC100505644 uncharacterized LOC100505644 [Homo sapiens] (Entrez Gene ID 100505644 is abundantly expressed in tumors but weakly expressed in few normal tissues. Till now the function of this gene remains unknown. Here we identified the chromosomal borders of the transcribed region and the major splice form of the LOC100505644-specific transcript. We characterised the major regulatory motifs of the gene and its splice sites. Analysis of the secondary structure of the major transcript variant revealed a hairpin-like structure characteristic for precursor microRNAs. Comparative genomic analysis of the locus showed that it originated in primates de novo. Taken together, our data indicate that human gene LOC100505644 encodes some non-protein coding RNA, likely a microRNA. It was assigned a gene symbol ELFN1-AS1 (ELFN1 antisense RNA 1 (non-protein coding. This gene combines features of evolutionary novelty and predominant expression in tumors.
Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines
NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho
2007-01-01
Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
Gene alterations in radiation-induced F344 rat lung tumors
International Nuclear Information System (INIS)
Kelly, G.; Hahn, F.F.
1994-01-01
The p53 tumor suppressor gene is frequently altered in all major histopathologic types of human lung tumors. Reported p53 mutations include base substitutions, allelic loss, rearrangements, and deletions. Point mutations resulting in base substitutions are clustered within a highly conserved region of the gene encoding exons 508, and mutations in this region substantially extend the half-life of the p53 protein. In addition to its prominent importance in lung carcinogenesis, the p53 gene plays a critical role in the cellular response to genetic damage caused by radiation. Specifically, the protein product of p53 induces a pause or block at the G 1 to S boundary of the cell cycle following radiation-caused DNA damage. This G 1 block may allow the cell time to repair the damaged DNA prior to replication. Cells lacking a functional p53 protein fail to pause for repair and consequently accumulate mutations in the genome at an accelerated rate. p53 has also been implicated as a controlling factor in apoptosis or in programmed cell death induced by DNA-damaging agents, such as ionizing radiation. The p53 gene is mutated in approximately 50% of squamous cell carcinomas from uranium miners who inhaled high doses of radon daughters. The purpose of the present study was to determine if a similar percentage of squamous cell carcinomas with p53 mutations developed in the lungs of rats exposed to aerosols of 239 PuO 2
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
The molecular mechanism of gene-radiotherapy of tumor
International Nuclear Information System (INIS)
Zhu Xian
2004-01-01
Gene-radiotherapy of tumor is a new method which is induced by ionizing radiation. The molecular mechanism is to activate various molecular target by many ways and induce the apoptosis of tumor cell. It is a gene therapy based on the radiation-inducible property of the Egr-1 gene. It has good application prospect in therapy of tumor
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
Gene therapy and radiotherapy in malignant tumor
International Nuclear Information System (INIS)
Zhang Yaowen; Cao Yongzhen; Li Jin; Wang Qin
2008-01-01
Tumor treatment is one of the most important fields in medical research. Nowadays, a novel method which is combined gene therapy with radiotherapy plays an important role in the field of cancer research, and mainly includes immune gene therapy combined with radiotherapy, suicide gene therapy or tumor suppressor gene therapy combined with radiotherapy, antiangiogenesis gene therapy combined with radiotherapy and protective gene therapy combined with radiotherapy based on the technical features. This review summarized the current status of combined therapies of gene therapy and radiotherapy and possible mechanism. (authors)
Molecular targeting of gene therapy and radiotherapy
International Nuclear Information System (INIS)
Weichselbaum, R.R.; Kufe, D.W.; Advani, S.J.; Roizman, B.
2001-01-01
The full promise of gene therapy has been limited by the lack of specificity of vectors for tumor tissue as well as the lack of antitumor efficacy of transgenes encoded by gene delivery systems. In this paper we review our studies investigating two modifications of gene therapy combined with radiotherapy. The first investigations described include studies of radiation inducible gene therapy. In this paradigm, radio-inducible DNA sequences from the CarG elements of the Egr-1 promoter are cloned upstream of a cDNA encoding TNFa. The therapeutic gene (TNFa) is induced by radiation within the tumor microenvironment. In the second paradigm, genetically engineered herpes simplex virus (HSV-1) is induced by ionizing radiation to proliferate within the tumor volume. These modifications of radiotherapy and gene therapy may enhance the efficacy of both treatments
[Methylation of selected tumor-supressor genes in benign and malignant ovarian tumors].
Cul'bová, M; Lasabová, Z; Stanclová, A; Tilandyová, P; Zúbor, P; Fiolka, R; Danko, J; Visnovský, J
2011-09-01
To evaluate the usefullness of examination of methylation status of selected tumor-supressor genes in early diagnosis of ovarian cancer. Prospective clinical study. Department of Gynecology and Obstetrics, Department of Molecular Biology, Jessenius Medical Faculty, Commenius University, Martin, Slovak Republic. In this study we analyzed hypermethylation of 5 genes RASSF1A, GSTP, E-cadherin, p16 and APC in ovarian tumor samples from 34 patients - 13 patients with epithelial ovarian cancer, 2 patients with border-line ovarian tumors, 12 patients with benign lesions of ovaries and 7 patients with healthy ovarian tissue. The methylation status of promoter region of tumor-supressor genes was determined by Methylation Specific Polymerase Chain Reaction (MSP) using a nested two-step approach with bisulfite modified DNA template and specific primers. Gene methylation analysis revealed hypermethylation of gene RASSF1A (46%) and GSTP (8%) only in malignant ovarian tissue samples. Ecad, p16 and APC genes were methylated both in maignant and benign tissue samples. Methylation positivity in observed genes was present independently to all clinical stages of ovarian cancer and to tumor grades. However, there was observed a trend of increased number and selective involvement of methylated genes with increasing disease stages. Furthermore, there was no association between positive methylation status and histological subtypes of ovarian carcinomas. RASSF1A and GSTP promoter methylation positivity is associated with ovarian cancer. The revealed gene-selective methylation positivity and the increased number of methylated genes with advancing disease stages could be considered as a useful molecular marker for early detection of ovarian cancer. However, there is need to find diagnostic approach of specifically and frequently methylated genes to determining a methylation phenotype for early detection of ovarian malignancies.
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
The tumor suppressor Rb and its related Rbl2 genes are regulated by Utx histone demethylase
Energy Technology Data Exchange (ETDEWEB)
Terashima, Minoru; Ishimura, Akihiko; Yoshida, Masakazu [Division of Functional Genomics, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Ishikawa (Japan); Suzuki, Yutaka; Sugano, Sumio [Graduate School of Frontier Sciences, The University of Tokyo, Kashiwa 277-8561, Chiba (Japan); Suzuki, Takeshi, E-mail: suzuki-t@staff.kanazawa-u.ac.jp [Division of Functional Genomics, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Ishikawa (Japan)
2010-08-20
Research highlights: {yields} Utx increases expression of Rb and Rbl2 genes through its demethylase activity. {yields} Utx changes histone H3 methylation on the Rb and Rbl2 promoters. {yields} Utx induces decreased cell proliferation of mammalian primary cells. -- Abstract: Utx is a candidate tumor suppressor gene that encodes histone H3 lysine 27 (H3K27) demethylase. In this study, we found that ectopic expression of Utx enhanced the expression of retinoblastoma tumor suppressor gene Rb and its related gene Rbl2. This activation was dependent on the demethylase activity of Utx, and was suggested to contribute to the decreased cell proliferation induced by Utx. A chromatin immunoprecipitation assay showed that over-expressed Utx was associated with the promoter regions of Rb and Rbl2 resulting in the removal of repressive H3K27 tri-methylation and the increase in active H3K4 tri-methylation. Furthermore, siRNA-mediated knockdown of Utx revealed the recruitment of endogenous Utx protein on the promoters of Rb and Rbl2 genes. These results indicate that Rb and Rbl2 are downstream target genes of Utx and may play important roles in Utx-mediated cell growth control.
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Directory of Open Access Journals (Sweden)
Jochen Gohlke
Full Text Available Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA-encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA-mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes
Transfection of tumor-infiltrating T cells with mRNA encoding CXCR2
DEFF Research Database (Denmark)
Idorn, Manja; thor Straten, Eivind Per; Svane, Inge Marie
2016-01-01
Adoptive T-cell therapy based on the infusion of patient’s own immune cells after ex vivo culturing is among the most potent forms of personalized treatment among recent clinical developments for the treatment of cancer. However, despite high rates of successful initial clinical responses, only...... infused T cells migrating to the tumor and the clinical response, but also that only a small fraction of adoptively transferred Tcells reach the tumor site. In this chapter, we describe a protocol for transfection of TILs with mRNA encoding the chemokine receptor CXCR2 transiently redirecting...
Park, Y S; Kim, K S; Lee, Y K; Kim, J S; Baek, J Y; Huang, L
2009-01-01
Recently, a number of reports have demonstrated that coexpression of therapeutic genes having different anticancer mechanisms is a more effective strategy for anticancer gene therapy than single gene expression. Saxatilin, a novel disintegrin from snake venom, has recently been shown to have potent antiangiogenic functions, such as inhibition of platelet aggregation, bFGF-induced proliferation of HUVEC, and vitronectin-induced smooth muscle cell migration. IL-12 is a well-known immune modulator that promotes Thl-type antitumor immune responses and inhibits angiogenesis as well. The saxatilin and/or IL-12 genes were transfected intratumorally into C57BL/6 mice carrying TC-1 transformed mouse lung endothelial cells by either lipofection or electroporation. The plasmids encoding saxatilin and IL-12 were administered to tumor tissues via novel cationic liposomes consisting of dimyristyl-glutamyl-lysine (DMKE). On the other hand, expression of the genes was also induced by electroporation after naked pDNA injection to the tumor tissues. Lipofection of saxatilin and/or IL-12 genes appeared to be slightly more effective in inhibition of tumor growth than electroporation of the same genes. Cotransfection of saxatilin and IL-12 genes was clearly more effective than individual administration of either gene. This result implies that cotransfection of saxatilin and IL-12 genes represents an innovative modality for anticancer gene therapy.
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
Directory of Open Access Journals (Sweden)
Werbowetski-Ogilvie Tamra
2008-01-01
Full Text Available Abstract Background The inter-alpha-trypsin inhibitors (ITI are a family of plasma protease inhibitors, assembled from a light chain – bikunin, encoded by AMBP – and five homologous heavy chains (encoded by ITIH1, ITIH2, ITIH3, ITIH4, and ITIH5, contributing to extracellular matrix stability by covalent linkage to hyaluronan. So far, ITIH molecules have been shown to play a particularly important role in inflammation and carcinogenesis. Methods We systematically investigated differential gene expression of the ITIH gene family, as well as AMBP and the interacting partner TNFAIP6 in 13 different human tumor entities (of breast, endometrium, ovary, cervix, stomach, small intestine, colon, rectum, lung, thyroid, prostate, kidney, and pancreas using cDNA dot blot analysis (Cancer Profiling Array, CPA, semiquantitative RT-PCR and immunohistochemistry. Results We found that ITIH genes are clearly downregulated in multiple human solid tumors, including breast, colon and lung cancer. Thus, ITIH genes may represent a family of putative tumor suppressor genes that should be analyzed in greater detail in the future. For an initial detailed analysis we chose ITIH2 expression in human breast cancer. Loss of ITIH2 expression in 70% of cases (n = 50, CPA could be confirmed by real-time PCR in an additional set of breast cancers (n = 36. Next we studied ITIH2 expression on the protein level by analyzing a comprehensive tissue micro array including 185 invasive breast cancer specimens. We found a strong correlation (p Conclusion Altogether, this is the first systematic analysis on the differential expression of ITIH genes in human cancer, showing frequent downregulation that may be associated with initiation and/or progression of these malignancies.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
OFFICIAL MEDICATIONS FOR ANTI-TUMOR GENE THERAPY
Directory of Open Access Journals (Sweden)
E. R. Nemtsova
2016-01-01
Full Text Available This is a review of modern literature data of official medications for anti-tumor gene therapy as well as of medications that finished clinical trials.The article discusses the concept of gene therapy, the statistical analysis results of initiated clinical trials of gene products, the most actively developing directions of anticancer gene therapy, and the characteristics of anti-tumor gene medications.Various delivery systems for gene material are being examined, including viruses that are defective in replication (Gendicine™ and Advexin and oncolytic (tumor specific conditionally replicating viruses (Oncorine™, ONYX-015, Imlygic®.By now three preparations for intra-tumor injection have been introduced into oncology clinical practice: two of them – Gendicine™ and Oncorine™ have been registered in China, and one of them – Imlygic® has been registered in the USA. Gendicine™ and Oncorine™ are based on the wild type p53 gene and are designed for treatment of patients with head and neck malignancies. Replicating adenovirus is the delivery system in Gendicine™, whereas oncolytic adenovirus is the vector for gene material in Oncorine™. Imlygic® is based on the recombinant replicating HSV1 virus with an introduced GM–CSF gene and is designed for treatment of melanoma patients. These medications are well tolerated and do not cause any serious adverse events. Gendicine™ and Oncorine™ are not effective in monotherapy but demonstrate pronounced synergism with chemoand radiation therapy. Imlygic® has just started the post marketing trials.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Gene expression patterns in pancreatic tumors, cells and tissues.
Directory of Open Access Journals (Sweden)
Anson W Lowe
2007-03-01
Full Text Available Cancers of the pancreas originate from both the endocrine and exocrine elements of the organ, and represent a major cause of cancer-related death. This study provides a comprehensive assessment of gene expression for pancreatic tumors, the normal pancreas, and nonneoplastic pancreatic disease.DNA microarrays were used to assess the gene expression for surgically derived pancreatic adenocarcinomas, islet cell tumors, and mesenchymal tumors. The addition of normal pancreata, isolated islets, isolated pancreatic ducts, and pancreatic adenocarcinoma cell lines enhanced subsequent analysis by increasing the diversity in gene expression profiles obtained. Exocrine, endocrine, and mesenchymal tumors displayed unique gene expression profiles. Similarities in gene expression support the pancreatic duct as the origin of adenocarcinomas. In addition, genes highly expressed in other cancers and associated with specific signal transduction pathways were also found in pancreatic tumors.The scope of the present work was enhanced by the inclusion of publicly available datasets that encompass a wide spectrum of human tissues and enabled the identification of candidate genes that may serve diagnostic and therapeutic goals.
Imaging of Intracellular pH in Tumor Spheroids Using Genetically Encoded Sensor SypHer2.
Zagaynova, Elena V; Druzhkova, Irina N; Mishina, Natalia M; Ignatova, Nadezhda I; Dudenkova, Varvara V; Shirmanova, Marina V
2017-01-01
Intracellular pH (pHi) is one of the most important parameters that regulate the physiological state of cells and tissues. pHi homeostasis is crucial for normal cell functioning. Cancer cells are characterized by having a higher (neutral to slightly alkaline) pHi and lower (acidic) extracellular pH (pHe) compared to normal cells. This is referred to as a "reversed" pH gradient, and is essential in supporting their accelerated growth rate, invasion and migration, and in suppressing anti-tumor immunity, the promotion of metabolic coupling with fibroblasts and in preventing apoptosis. Moreover, abnormal pH, both pHi and pHe, contribute to drug resistance in cancers. Therefore, the development of methods for measuring pH in living tumor cells is likely to lead to better understanding of tumor biology and to open new ways for cancer treatment. Genetically encoded, fluorescent, pH-sensitive probes represent promising instruments enabling the subcellular measurement of pHi with unrivaled specificity and high accuracy. Here, we describe a protocol for pHi imaging at a microscopic level in HeLa tumor spheroids, using the genetically encoded ratiometric (dual-excitation) pHi indicator, SypHer2.
International Nuclear Information System (INIS)
Hamm, Alexander; Knuechel, Ruth; Dahl, Edgar; Veeck, Juergen; Bektas, Nuran; Wild, Peter J; Hartmann, Arndt; Heindrichs, Uwe; Kristiansen, Glen; Werbowetski-Ogilvie, Tamra; Del Maestro, Rolando
2008-01-01
The inter-alpha-trypsin inhibitors (ITI) are a family of plasma protease inhibitors, assembled from a light chain – bikunin, encoded by AMBP – and five homologous heavy chains (encoded by ITIH1, ITIH2, ITIH3, ITIH4, and ITIH5), contributing to extracellular matrix stability by covalent linkage to hyaluronan. So far, ITIH molecules have been shown to play a particularly important role in inflammation and carcinogenesis. We systematically investigated differential gene expression of the ITIH gene family, as well as AMBP and the interacting partner TNFAIP6 in 13 different human tumor entities (of breast, endometrium, ovary, cervix, stomach, small intestine, colon, rectum, lung, thyroid, prostate, kidney, and pancreas) using cDNA dot blot analysis (Cancer Profiling Array, CPA), semiquantitative RT-PCR and immunohistochemistry. We found that ITIH genes are clearly downregulated in multiple human solid tumors, including breast, colon and lung cancer. Thus, ITIH genes may represent a family of putative tumor suppressor genes that should be analyzed in greater detail in the future. For an initial detailed analysis we chose ITIH2 expression in human breast cancer. Loss of ITIH2 expression in 70% of cases (n = 50, CPA) could be confirmed by real-time PCR in an additional set of breast cancers (n = 36). Next we studied ITIH2 expression on the protein level by analyzing a comprehensive tissue micro array including 185 invasive breast cancer specimens. We found a strong correlation (p < 0.001) between ITIH2 expression and estrogen receptor (ER) expression indicating that ER may be involved in the regulation of this ECM molecule. Altogether, this is the first systematic analysis on the differential expression of ITIH genes in human cancer, showing frequent downregulation that may be associated with initiation and/or progression of these malignancies
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Molecular biology III - Oncogenes and tumor suppressor genes
International Nuclear Information System (INIS)
Giaccia, Amato J.
1996-01-01
Purpose: The purpose of this course is to introduce to radiation oncologists the basic concepts of tumorigenesis, building on the information that will be presented in the first and second part of this series of lectures. Objective: Our objective is to increase the current understanding of radiation oncologists with the process of tumorigenesis, especially focusing on genes that are altered in many tumor types that are potential candidates for novel molecular strategies. As strategies to treat cancer of cancer are becoming more sophisticated, it will be important for both the practitioner and academician to develop a basic understanding of the function of cancer 'genes'. This will be the third in a series of refresher courses that are meant to address recent advances in Cancer Biology in a way that both clinicians without previous knowledge of molecular biology or experienced researchers will find interesting. The lecture will begin with a basic overview of tumorigenesis; methods of detecting chromosome/DNA alterations, approaches used to isolate oncogenes and tumor suppressor genes, and their role in cell killing by apoptosis. Special attention will be given to oncogenes and tumor suppressor genes that are modulated by ionizing radiation and the tumor microenvironment. We will relate the biology of oncogenes and tumor suppressor genes to basic aspects of radiation biology that would be important in clinical practice. Finally, we will review recent studies on the prognostic significance of p53 mutations and apoptosis in tumor specimens. The main point of this lecture is to relate both researcher and clinician what are the therapeutic ramifications of oncogene and tumor suppressor gene mutations found in human neoptasia
International Nuclear Information System (INIS)
Deen, K.C.; Sweet, R.W.
1986-01-01
Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
International Nuclear Information System (INIS)
Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.
1990-01-01
The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Jablonska, Jadwiga; Leschner, Sara; Westphal, Kathrin; Lienenklaus, Stefan; Weiss, Siegfried
2010-04-01
Angiogenesis is a hallmark of malignant neoplasias, as the formation of new blood vessels is required for tumors to acquire oxygen and nutrients essential for their continued growth and metastasis. However, the signaling pathways leading to tumor vascularization are not fully understood. Here, using a transplantable mouse tumor model, we have demonstrated that endogenous IFN-beta inhibits tumor angiogenesis through repression of genes encoding proangiogenic and homing factors in tumor-infiltrating neutrophils. We determined that IFN-beta-deficient mice injected with B16F10 melanoma or MCA205 fibrosarcoma cells developed faster-growing tumors with better-developed blood vessels than did syngeneic control mice. These tumors displayed enhanced infiltration by CD11b+Gr1+ neutrophils expressing elevated levels of the genes encoding the proangiogenic factors VEGF and MMP9 and the homing receptor CXCR4. They also expressed higher levels of the transcription factors c-myc and STAT3, known regulators of VEGF, MMP9, and CXCR4. In vitro, treatment of these tumor-infiltrating neutrophils with low levels of IFN-beta restored expression of proangiogenic factors to control levels. Moreover, depletion of these neutrophils inhibited tumor growth in both control and IFN-beta-deficient mice. We therefore suggest that constitutively produced endogenous IFN-beta is an important mediator of innate tumor surveillance. Further, we believe our data help to explain the therapeutic effect of IFN treatment during the early stages of cancer development.
Energy Technology Data Exchange (ETDEWEB)
Wang, Bo; Hikosaka, Keisuke; Sultana, Nishat; Sharkar, Mohammad Tofael Kabir [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Noritake, Hidenao [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Department of Internal Medicine, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Kimura, Wataru; Wu, Yi-Xin [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Kobayashi, Yoshimasa [Department of Internal Medicine, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Uezato, Tadayoshi [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Miura, Naoyuki, E-mail: nmiura@hama-med.ac.jp [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan)
2012-01-06
Highlights: Black-Right-Pointing-Pointer Fifty percent of the mutant Rb transgenic mice produced liver tumors. Black-Right-Pointing-Pointer In the tumor, Foxm1, Skp2, Bmi1 and AP-1 mRNAs were up-regulated. Black-Right-Pointing-Pointer No increase in expression of the Myc-target genes was observed in the non-tumorous liver. Black-Right-Pointing-Pointer Tumor formation depends on up-regulation of the Myc-target genes. -- Abstract: The retinoblastoma (Rb) tumor suppressor encodes a nuclear phosphoprotein that regulates cellular proliferation, apoptosis and differentiation. In order to adapt itself to these biological functions, Rb is subjected to modification cycle, phosphorylation and dephosphorylation. To directly determine the effect of phosphorylation-resistant Rb on liver development and function, we generated transgenic mice expressing phosphorylation-resistant human mutant Rb (mt-Rb) under the control of the rat hepatocyte nuclear factor-1 gene promoter/enhancer. Expression of mt-Rb in the liver resulted in macroscopic neoplastic nodules (adenomas) with {approx}50% incidence within 15 months old. Interestingly, quantitative reverse transcriptase-PCR analysis showed that c-Myc was up-regulated in the liver of mt-Rb transgenic mice irrespective of having tumor tissues or no tumor. In tumor tissues, several c-Myc target genes, Foxm1, c-Jun, c-Fos, Bmi1 and Skp2, were also up-regulated dramatically. We determined whether mt-Rb activated the Myc promoter in the HTP9 cells and demonstrated that mt-Rb acted as an inhibitor of wild-type Rb-induced repression on the Myc promoter. Our results suggest that continued upregulation of c-Myc target genes promotes the liver tumor formation after about 1 year of age.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Expression of the p16{sup INK4a} tumor suppressor gene in rodent lung tumors
Energy Technology Data Exchange (ETDEWEB)
Swafford, D.S.; Tesfaigzi, J.; Belinsky, S.A.
1995-12-01
Aberrations on the short arm of chromosome 9 are among the earliest genetic changes in human cancer. p16{sup INK4a} is a candidate tumor suppressor gene that lies within human 9p21, a chromosome region associated with frequent loss of heterozygosity in human lung tumors. The p16{sup INK4a} protein functions as an inhibitor of cyclin D{sub 1}-dependent kinases that phosphorylate the retinoblastoma (Rb) tumor suppressor gene product enabling cell-cycle progression. Thus, overexpression of cyclin D{sub 1}, mutation of cyclin-dependent kinase genes, or loss of p16{sup INK4a} function, can all result in functional inactivation of Rb. Inactivation of Rb by mutation or deletion can result in an increase in p16{sup INK4a} transcription, suggesting that an increased p16{sup INK4a} expression in a tumor cell signals dysfunction of the pathway. The p16{sup (INK4a)} gene, unlike some tumor suppressor genes, is rarely inactivated by mutation. Instead, the expression of this gene is suppressed in some human cancers by hypermethylation of the CpG island within the first exon or by homozygous deletion: 686. Chromosome losses have been observed at 9p21 syntenic loci in tumors of the mouse and rat, two species often used as animal models for pulmonary carcinogenesis. Expression of p16{sup INK4a} is lost in some mouse tumor cell lines, often due to homozygous deletion. These observations indicate that p16{sup INK4a} dysfunction may play a role in the development of neoplasia in rodents as well as humans. The purpose of the current investigation was to define the extent to which p16{sup INK4a} dysfunction contributes to the development of rodent lung tumors and to determine the mechanism of inactivation of the gene. There is no evidence to suggest a loss of function of the p16{sup INK4a} tumor suppressor gene in these primary murine lung tumors by mutation, deletion, or methylation.
Isolation and characterization of the human parathyroid hormone-like peptide gene
International Nuclear Information System (INIS)
Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.
1989-01-01
A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang
2008-01-01
Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)
International Nuclear Information System (INIS)
Mangin, M.; Webb, A.C.; Dreyer, B.E.
1988-01-01
Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12
Directory of Open Access Journals (Sweden)
Alnawaz Rehemtulla
2002-01-01
Full Text Available Cancer gene therapy is an active area of research relying upon the transfer and subsequent expression of a therapeutic transgene into tumor cells in order to provide for therapeutic selectivity. Noninvasive assessment of therapeutic response and correlation of the location, magnitude, and duration of transgene expression in vivo would be particularly useful in the development of cancer gene therapy protocols by facilitating optimization of gene transfer protocols, vector development, and prodrug dosing schedules. In this study, we developed an adenoviral vector containing both the therapeutic transgene yeast cytosine deaminase (yCD along with an optical reporter gene (luciferase. Following intratumoral injection of the vector into orthotopic 9L gliomas, anatomical and diffusion-weighted MR images were obtained over time in order to provide for quantitative assessment of overall therapeutic efficacy and spatial heterogeneity of cell kill, respectively. In addition, bioluminescence images were acquired to assess the duration and magnitude of gene expression. MR images revealed significant reduction in tumor growth rates associated with yCD/5-fluorocytosine (5FC gene therapy. Significant increases in mean tumor diffusion values were also observed during treatment with 5FC. Moreover, spatial heterogeneity in tumor diffusion changes were also observed revealing that diffusion magnetic resonance imaging could detect regional therapeutic effects due to the nonuniform delivery and/or expression of the therapeutic yCD transgene within the tumor mass. In addition, in vivo bioluminescence imaging detected luciferase gene expression, which was found to decrease over time during administration of the prodrug providing a noninvasive surrogate marker for monitoring gene expression. These results demonstrate the efficacy of the yCD/5FC strategy for the treatment of brain tumors and reveal the feasibility of using multimodality molecular and functional imaging
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Directory of Open Access Journals (Sweden)
Hiroshi Fujiwara
2014-12-01
Full Text Available Accumulating clinical evidence suggests that adoptive T-cell immunotherapy could be a promising option for control of cancer; evident examples include the graft-vs-leukemia effect mediated by donor lymphocyte infusion (DLI and therapeutic infusion of ex vivo-expanded tumor-infiltrating lymphocytes (TIL for melanoma. Currently, along with advances in synthetic immunology, gene-modified T cells retargeted to defined tumor antigens have been introduced as “cellular drugs”. As the functional properties of the adoptive immune response mediated by T lymphocytes are decisively regulated by their T-cell receptors (TCRs, transfer of genes encoding target antigen-specific receptors should enable polyclonal T cells to be uniformly redirected toward cancer cells. Clinically, anticancer adoptive immunotherapy using genetically engineered T cells has an impressive track record. Notable examples include the dramatic benefit of chimeric antigen receptor (CAR gene-modified T cells redirected towards CD19 in patients with B-cell malignancy, and the encouraging results obtained with TCR gene-modified T cells redirected towards NY-ESO-1, a cancer-testis antigen, in patients with advanced melanoma and synovial cell sarcoma. This article overviews the current status of this treatment option, and discusses challenging issues that still restrain the full effectiveness of this strategy, especially in the context of hematological malignancy.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
Alternative polyadenylation of tumor suppressor genes in small intestinal neuroendocrine tumors.
Rehfeld, Anders; Plass, Mireya; Døssing, Kristina; Knigge, Ulrich; Kjær, Andreas; Krogh, Anders; Friis-Hansen, Lennart
2014-01-01
The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3' untranslated regions. Additionally, APA can also produce mRNAs containing different 3'-terminal coding regions. Therefore, APA alters both the repertoire and the expression level of proteins. Here, we used high-throughput sequencing data to map polyA sites and characterize polyadenylation genome-wide in three SI-NETs and a reference sample. In the tumors, 16 genes showed significant changes of APA pattern, which lead to either the 3' truncation of mRNA coding regions or 3' untranslated regions. Among these, 11 genes had been previously associated with cancer, with 4 genes being known tumor suppressors: DCC, PDZD2, MAGI1, and DACT2. We validated the APA in three out of three cases with quantitative real-time-PCR. Our findings suggest that changes of APA pattern in these 16 genes could be involved in the tumorigenesis of SI-NETs. Furthermore, they also point to APA as a new target for both diagnostic and treatment of SI-NETs. The identified genes with APA specific to the SI-NETs could be further tested as diagnostic markers and drug targets for disease prevention and treatment.
Anti-EGFR immunonanoparticles containing IL12 and salmosin genes for targeted cancer gene therapy.
Kim, Jung Seok; Kang, Seong Jae; Jeong, Hwa Yeon; Kim, Min Woo; Park, Sang Il; Lee, Yeon Kyung; Kim, Hong Sung; Kim, Keun Sik; Park, Yong Serk
2016-09-01
Tumor-directed gene delivery is of major interest in the field of cancer gene therapy. Varied functionalizations of non-viral vectors have been suggested to enhance tumor targetability. In the present study, we prepared two different types of anti-EGF receptor (EGFR) immunonanoparticles containing pDNA, neutrally charged liposomes and cationic lipoplexes, for tumor-directed transfection of cancer therapeutic genes. Even though both anti-EGFR immunonanoparticles had a high binding affinity to the EGFR-positive cancer cells, the anti-EGFR immunolipoplex formulation exhibited approximately 100-fold higher transfection to the target cells than anti-EGFR immunoliposomes. The lipoplex formulation also showed a higher transfection to SK-OV-3 tumor xenografts in mice. Thus, IL12 and/or salmosin genes were loaded in the anti-EGFR immunolipoplexes and intravenously administered to mice carrying SK-OV-3 tumors. Co-transfection of IL12 and salmosin genes using anti-EGFR immunolipoplexes significantly reduced tumor growth and pulmonary metastasis. Furthermore, combinatorial treatment with doxorubicin synergistically inhibited tumor growth. These results suggest that anti-EGFR immunolipoplexes containing pDNA encoding therapeutic genes could be utilized as a gene-transfer modality for cancer gene therapy.
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Pellerin, Olivier; Amara, Ikram; Sapoval, Marc; Méachi, Tchao; Déan, Carole; Beaune, Philippe; de Waziers, Isabelle
2018-01-01
Gene-directed enzyme prodrug therapy (GDEPT) is a "Trojan-horses" suicide gene therapy that consists of tumor-targeted gene delivery (vectorized by mesenchymal stem cells MSCs) encoding an enzyme that converts a harmless prodrug into cytotoxic metabolites in situ. Then, cytotoxic metabolites passively diffuse in the neighboring tumor cells and kill them (bystander effect). The goal of our study was to assess the feasibility and efficacy of intra-arterial administration of MSCs transduced with an optimized gene (MSC-CYP2B6TM-RED) followed by intravenous administration of cyclophosphamide (CPA) into the VX2 rabbit liver tumor. Nine rabbits with a VX2 liver tumor were randomly assigned into three groups: Control group A (one rabbit) free of any treatment; Control group B (two rabbits) receiving intravenous injection of cyclophosphamide at day 3 and CPA at day 14; and Group C (six rabbits) receiving the GDEPT treatment, consisting of successive intra-arterial injection of transduced-MSCs at days 0 (n = 6) and 11 (n = 3), followed by injection of CPA at days 3 (n = 6) and 14 (n = 3). The tumor response was assessed by ultrasound scan every 7 days and histopathological analysis at sacrifice (D25). There was a significant difference in the tumor volume between control groups (A + B) and group C at D7: 38/19 cm 3 (p = 0.024); D11: 51/20 cm 3 (p = 0.024), and D25: 121/37 cm 3 (p = 0.048). Tumor necrosis was significantly greater and metastatic spread was lower for rabbits who received GDEPT (78% of total tumor surface) than for control animals (A + B) (22% of total tumor surface (p = 0.006). Intra-arterial delivery of transduced-MSCs is feasible and, after CPA injection, resulted in 78% tumor necrosis (p = 0.006) and less metastasis in a VX2 liver tumor model.
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T
2018-01-01
The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Directory of Open Access Journals (Sweden)
Pieter Rottiers
1999-12-01
Full Text Available In addition to eugenetic changes, cancerous cells exhibit extensive modifications in the expression levels of a variety of genes. The phenotypic switch observed after inoculation of T lymphoma cells into syngenic mice illustrates the active participation of tumoral environment in the induction of an aberrant gene expression pattern. To further substantiate this contribution, we performed polymerase chain reaction (PCR-based subtraction suppression hybridization (SSH to identify genes that are differentially expressed in tumor-derived EL4/13.3 cells compared to the same cells isolated from cultures. Besides a number of unknown genes, the subtracted library contained several known genes that have been reported to be expressed at increased levels in tumors and/or to contribute to carcinogenesis. Apart from clones representing translated transcripts, the subtracted library also contained a high number of clones representing B2 repeat elements, viz. short interspersed repetitive elements that are transcribed by RNA polymerase III. Northern blotting confirmed the induction of B2 transcripts in tumor tissue and also revealed induction of chimeric, B2 repeat-containing mRNA. The appearance of chimeric transcripts was accompanied by aberrant, shorter-than-full-length transcripts, specifically from upregulated genes. Accordingly, in addition to altered gene expression, tumoral environmental triggers constitute a potent mechanism to create an epigenetic diversity in cancers by inducing extensive transcript anomalies.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Polymeric nanoparticles for nonviral gene therapy extend brain tumor survival in vivo.
Mangraviti, Antonella; Tzeng, Stephany Yi; Kozielski, Kristen Lynn; Wang, Yuan; Jin, Yike; Gullotti, David; Pedone, Mariangela; Buaron, Nitsa; Liu, Ann; Wilson, David R; Hansen, Sarah K; Rodriguez, Fausto J; Gao, Guo-Dong; DiMeco, Francesco; Brem, Henry; Olivi, Alessandro; Tyler, Betty; Green, Jordan J
2015-02-24
Biodegradable polymeric nanoparticles have the potential to be safer alternatives to viruses for gene delivery; however, their use has been limited by poor efficacy in vivo. In this work, we synthesize and characterize polymeric gene delivery nanoparticles and evaluate their efficacy for DNA delivery of herpes simplex virus type I thymidine kinase (HSVtk) combined with the prodrug ganciclovir (GCV) in a malignant glioma model. We investigated polymer structure for gene delivery in two rat glioma cell lines, 9L and F98, to discover nanoparticle formulations more effective than the leading commercial reagent Lipofectamine 2000. The lead polymer structure, poly(1,4-butanediol diacrylate-co-4-amino-1-butanol) end-modified with 1-(3-aminopropyl)-4-methylpiperazine, is a poly(β-amino ester) (PBAE) and formed nanoparticles with HSVtk DNA that were 138 ± 4 nm in size and 13 ± 1 mV in zeta potential. These nanoparticles containing HSVtk DNA showed 100% cancer cell killing in vitro in the two glioma cell lines when combined with GCV exposure, while control nanoparticles encoding GFP maintained robust cell viability. For in vivo evaluation, tumor-bearing rats were treated with PBAE/HSVtk infusion via convection-enhanced delivery (CED) in combination with systemic administration of GCV. These treated animals showed a significant benefit in survival (p = 0.0012 vs control). Moreover, following a single CED infusion, labeled PBAE nanoparticles spread completely throughout the tumor. This study highlights a nanomedicine approach that is highly promising for the treatment of malignant glioma.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
Microenvironment alters epigenetic and gene expression profiles in Swarm rat chondrosarcoma tumors
International Nuclear Information System (INIS)
Hamm, Christopher A; Wang, Deli; Malchenko, Sergey; Fatima Bonaldo, Maria de; Casavant, Thomas L; Hendrix, Mary JC; Soares, Marcelo B; Stevens, Jeff W; Xie, Hehuang; Vanin, Elio F; Morcuende, Jose A; Abdulkawy, Hakeem; Seftor, Elisabeth A; Sredni, Simone T; Bischof, Jared M
2010-01-01
Chondrosarcomas are malignant cartilage tumors that do not respond to traditional chemotherapy or radiation. The 5-year survival rate of histologic grade III chondrosarcoma is less than 30%. An animal model of chondrosarcoma has been established - namely, the Swarm Rat Chondrosarcoma (SRC) - and shown to resemble the human disease. Previous studies with this model revealed that tumor microenvironment could significantly influence chondrosarcoma malignancy. To examine the effect of the microenvironment, SRC tumors were initiated at different transplantation sites. Pyrosequencing assays were utilized to assess the DNA methylation of the tumors, and SAGE libraries were constructed and sequenced to determine the gene expression profiles of the tumors. Based on the gene expression analysis, subsequent functional assays were designed to determine the relevancy of the specific genes in the development and progression of the SRC. The site of transplantation had a significant impact on the epigenetic and gene expression profiles of SRC tumors. Our analyses revealed that SRC tumors were hypomethylated compared to control tissue, and that tumors at each transplantation site had a unique expression profile. Subsequent functional analysis of differentially expressed genes, albeit preliminary, provided some insight into the role that thymosin-β4, c-fos, and CTGF may play in chondrosarcoma development and progression. This report describes the first global molecular characterization of the SRC model, and it demonstrates that the tumor microenvironment can induce epigenetic alterations and changes in gene expression in the SRC tumors. We documented changes in gene expression that accompany changes in tumor phenotype, and these gene expression changes provide insight into the pathways that may play a role in the development and progression of chondrosarcoma. Furthermore, specific functional analysis indicates that thymosin-β4 may have a role in chondrosarcoma metastasis
Microenvironment alters epigenetic and gene expression profiles in Swarm rat chondrosarcoma tumors
Directory of Open Access Journals (Sweden)
Hamm Christopher A
2010-09-01
Full Text Available Abstract Background Chondrosarcomas are malignant cartilage tumors that do not respond to traditional chemotherapy or radiation. The 5-year survival rate of histologic grade III chondrosarcoma is less than 30%. An animal model of chondrosarcoma has been established - namely, the Swarm Rat Chondrosarcoma (SRC - and shown to resemble the human disease. Previous studies with this model revealed that tumor microenvironment could significantly influence chondrosarcoma malignancy. Methods To examine the effect of the microenvironment, SRC tumors were initiated at different transplantation sites. Pyrosequencing assays were utilized to assess the DNA methylation of the tumors, and SAGE libraries were constructed and sequenced to determine the gene expression profiles of the tumors. Based on the gene expression analysis, subsequent functional assays were designed to determine the relevancy of the specific genes in the development and progression of the SRC. Results The site of transplantation had a significant impact on the epigenetic and gene expression profiles of SRC tumors. Our analyses revealed that SRC tumors were hypomethylated compared to control tissue, and that tumors at each transplantation site had a unique expression profile. Subsequent functional analysis of differentially expressed genes, albeit preliminary, provided some insight into the role that thymosin-β4, c-fos, and CTGF may play in chondrosarcoma development and progression. Conclusion This report describes the first global molecular characterization of the SRC model, and it demonstrates that the tumor microenvironment can induce epigenetic alterations and changes in gene expression in the SRC tumors. We documented changes in gene expression that accompany changes in tumor phenotype, and these gene expression changes provide insight into the pathways that may play a role in the development and progression of chondrosarcoma. Furthermore, specific functional analysis indicates that
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Mehdi, Ouaïssi; Françoise, Silvy; Sofia, Costa Lima; Urs, Giger; Kevin, Zemmour; Bernard, Sastre; Igor, Sielezneff; Anabela, Cordeiro-da-Silva; Dominique, Lombardo; Eric, Mas; Ali, Ouaïssi
2012-01-01
In this study, the effect of LBH589 and trichostatin (TSA), a standard histone deacetylase inhibitor (HDACi) toward the growth of pancreatic cancer cell lines was studied. Thus, we examined for the first time, the HDAC family gene expression levels before and after drug treatment. Several human pancreatic cancer cell lines (Panc-1, BxPC-3, SOJ-6) and a normal human pancreatic duct immortalized epithelial cell line (HPDE/E6E7) were used as target cells. The cell growth was measured by MTT assay, cell cycle alteration, membrane phosphatidylserine exposure, DNA fragmentation, mitochondrial membrane potential loss, RT-PCR and Western blots were done using standard methods. The effect of drugs on tumor growth in vivo was studied using subcutaneous xenograft model. Except in the case of certain HDAC gene/tumor cell line couples: (SIRT1/HPDE-SOJ6/TSA- or LBH589-treated cells; LBH589-treated Panc-1 Cells; HDAC2/BxPC-3/LBH589-treated cells or TSA-treated SOJ-6-1 cells), there were no major significant changes of HDACs genes transcription in cells upon drug treatment. However, significant variation in HDACs and SIRTs protein expression levels could be seen among individual cell samples. The in vivo results showed that LBH589 formulation exhibited similar tumor reduction efficacy as the commercial drug gemcitabine. Our data demonstrate that LBH589 induced the death of pancreatic tumor cell by apoptosis. In line with its in vitro activity, LBH589 achieved a significant reduction in tumor growth in BxPC-3 pancreatic tumor cell line subcutaneous xenograft mouse model. Furthermore, exploring the impact of LBH589 on HDACs encoding genes expression revealed for the first time that some of them, depending on the cell line considered, seem to be regulated during translation. Copyright © 2012 IAP and EPC. Published by Elsevier B.V. All rights reserved.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Directory of Open Access Journals (Sweden)
Tao Jiang
2017-04-01
Full Text Available BACKGROUND: Immunotherapy using dendritic cell (DC vaccine has the potential to overcome the bottleneck of cancer therapy. METHODS: We engineered Lewis lung cancer cells (LLCs and bone marrow–derived DCs to express tumor-associated antigen (TAA ovalbumin (OVA via lentiviral vector plasmid encoding OVA gene. We then tested the antitumor effect of modified DCs both in vitro and in vivo. RESULTS: The results demonstrated that in vitro modified DCs could dramatically enhance T-cell proliferation (P < .01 and killing of LLCs than control groups (P < .05. Moreover, modified DCs could reduce tumor size and prolong the survival of LLC tumor-bearing mice than control groups (P < .01 and P < .01, respectively. Mechanistically, modified DCs demonstrated enhanced homing to T-cell–rich compartments and triggered more naive T cells to become cytotoxic T lymphocytes, which exhibited significant infiltration into the tumors. Interestingly, modified DCs also markedly reduced tumor cells harboring stem cell markers in mice (P < .05, suggesting the potential role on cancer stem-like cells. CONCLUSION: These findings suggested that DCs bioengineered with TAA could enhance antitumor effect and therefore represent a novel anticancer strategy that is worth further exploration.
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Antiangiogenic Metargidin Peptide (AMEP) Gene Therapy in Disseminated Melanoma
DEFF Research Database (Denmark)
Spanggaard, Iben; Gehl, Julie
2015-01-01
Gene delivery by electroporation is an efficient method for transfecting genes into various tissues including tumors. Here we present the treatment protocol used in a phase 1 study on gene electrotransfer of plasmid DNA encoding an antiangiogenic peptide into cutaneous melanoma....
Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response
Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly
2013-01-01
Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
Experimental study on anti-tumor effect of pcEgr-IFNγ gene-radiotherapy
International Nuclear Information System (INIS)
Wu Congmei; Li Xiuyi; Liu Shuzheng
2001-01-01
Objective: To study the anti-tumor effect of IFN γ gene-radiotherapy to murine melanoma and its immunologic mechanism. Methods: pcEgr-IFNγ plasmids were injected locally into tumor, and 36 hours later, the tumors were given 20 Gy X-ray irradiation. Tumor growth at different time, IFN γ expression 3 days later and immunologic indexes 15 days later were detected. Results: At 3-15 days after pcEgr-IFNγ gene-radiotherapy, the tumor growth rate was lower than that of irradiation alone group. It was also lower than that of gene therapy alone group and control plasmid combined with X-ray irradiation group significantly. Day 3 tumor IFN γ expression was higher than that of plasmid treatment alone group. NK activity, IL-2 and IFN γ secretion activities were higher than those of gene therapy alone and irradiation alone groups significantly. Conclusion: The antitumor effect of IFN γ gene-radiotherapy is better than that of either of them applied solely. Its mechanism might be concerned with the higher expression of IFN γ induced by irradiation in tumors and activation of anti-tumor immunologic functions
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
The progress of tumor gene-radiotherapy induced by Egr-1 promoter
International Nuclear Information System (INIS)
Guo Rui; Li Biao
2010-01-01
The promoter of early growth response gene-1 (Egr-1) is a cis-acting element of Egr-1, and its activity is regulated by inducers such as ionizing radiation, free radical. In designated gene-radiotherapy system, radiation combined with therapeutic gene (such as tumor necrosis factor-α gene, suicide gene) can spatially and temporally regulate therapeutic gene expression in the irradiated field, produced a marked effect, while little systemic toxicities were observed. The combination of radiotherapy and gene therapy is promising in tumor therapy. (authors)
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Shirmanova, Marina V; Druzhkova, Irina N; Lukina, Maria M; Matlashov, Mikhail E; Belousov, Vsevolod V; Snopova, Ludmila B; Prodanetz, Natalia N; Dudenkova, Varvara V; Lukyanov, Sergey A; Zagaynova, Elena V
2015-09-01
Measuring intracellular pH (pHi) in tumors is essential for the monitoring of cancer progression and the response of cancer cells to various treatments. The purpose of the study was to develop a method for pHi mapping in living cancer cells in vitro and in tumors in vivo, using the novel genetically encoded indicator, SypHer2. A HeLa Kyoto cell line stably expressing SypHer2 in the cytoplasm was used, to perform ratiometric (dual excitation) imaging of the probe in cell culture, in 3D tumor spheroids and in tumor xenografts in living mice. Using SypHer2, pHi was demonstrated to be 7.34±0.11 in monolayer HeLa cells in vitro under standard cultivation conditions. An increasing pHi gradient from the center to the periphery of the spheroids was displayed. We obtained fluorescence ratio maps for HeLa tumors in vivo and ex vivo. Comparison of the map with the pathomorphology and with hypoxia staining of the tumors revealed a correspondence of the zones with higher pHi to the necrotic and hypoxic areas. Our results demonstrate that pHi imaging with the genetically encoded pHi indicator, SypHer2, can be a valuable tool for evaluating tumor progression in xenograft models. We have demonstrated, for the first time, the possibility of using the genetically encoded sensor SypHer2 for ratiometric pH imaging in cancer cells in vitro and in tumors in vivo. SypHer2 shows great promise as an instrument for pHi monitoring able to provide high accuracy and spatiotemporal resolution. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
Connexin 43 Gene Therapy Delivered by Polymer-Modified Salmonella in Murine Tumor Models
Directory of Open Access Journals (Sweden)
Wei-Kuang Wang
2014-04-01
Full Text Available The use of preferentially tumor-targeting bacteria as vectors is one of the most innovative approaches for the treatment of cancer. This method is based on the observation that some obligate or facultative anaerobic bacteria are capable of selectively multiplying in tumors and inhibiting their growth. Previously, we found that the tumor-targeting efficiency of Salmonella could be modulated by modifying the immune response to these bacteria by coating them with poly(allylamine hydrochloride (PAH, and these organisms are designated PAH-S.C. (S. choleraesuis. PAH can provide a useful platform for the chemical modification of Salmonella, perhaps by allowing a therapeutic gene to bind to tumor-targeting Salmonella. This study aimed to investigate the benefits of the use of PAH-S.C. for gene delivery. To evaluate this modulation, the invasion activity and gene transfer of DNA-PAH-S.C. were measured in vitro and in vivo. Treatment with PAH-S.C. carrying a tumor suppressor gene (connexin 43 resulted in inhibition of tumor growth, which suggested that tumor-targeted gene therapy using PAH-S.C. carrying a therapeutic gene could exert antitumor activities. This technique represents a promising strategy for the treatment of tumors.
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Segmentation of tumor ultrasound image in HIFU therapy based on texture and boundary encoding
International Nuclear Information System (INIS)
Zhang, Dong; Xu, Menglong; Quan, Long; Yang, Yan; Qin, Qianqing; Zhu, Wenbin
2015-01-01
It is crucial in high intensity focused ultrasound (HIFU) therapy to detect the tumor precisely with less manual intervention for enhancing the therapy efficiency. Ultrasound image segmentation becomes a difficult task due to signal attenuation, speckle effect and shadows. This paper presents an unsupervised approach based on texture and boundary encoding customized for ultrasound image segmentation in HIFU therapy. The approach oversegments the ultrasound image into some small regions, which are merged by using the principle of minimum description length (MDL) afterwards. Small regions belonging to the same tumor are clustered as they preserve similar texture features. The mergence is completed by obtaining the shortest coding length from encoding textures and boundaries of these regions in the clustering process. The tumor region is finally selected from merged regions by a proposed algorithm without manual interaction. The performance of the method is tested on 50 uterine fibroid ultrasound images from HIFU guiding transducers. The segmentations are compared with manual delineations to verify its feasibility. The quantitative evaluation with HIFU images shows that the mean true positive of the approach is 93.53%, the mean false positive is 4.06%, the mean similarity is 89.92%, the mean norm Hausdorff distance is 3.62% and the mean norm maximum average distance is 0.57%. The experiments validate that the proposed method can achieve favorable segmentation without manual initialization and effectively handle the poor quality of the ultrasound guidance image in HIFU therapy, which indicates that the approach is applicable in HIFU therapy. (paper)
Gene transfer strategies for improving radiolabeled peptide imaging and therapy
International Nuclear Information System (INIS)
Rogers, B.E.; Buchsbaum, D.J.; Zinn, K.R.
2000-01-01
Utilization of molecular biology techniques offers attractive options in nuclear medicine for improving cancer imaging and therapy with radiolabeled peptides. Two of these options include utilization of phage-panning to identify novel tumor specific peptides or single chain antibodies and gene transfer techniques to increase the antibodies and gene transfer techniques to increase the number of antigen/receptor sites expressed on malignant cells. The group has focused on the latter approach for improving radiolabeled peptide imaging and therapy. The most widely used gene transfer vectors in clinical gene therapy trials include retrovirus, cationic lipids and adenovirus. It has been utilized adenovirus vectors for gene transfer because of their ability to accomplish efficient in vivo gene transfer. Adenovirus vectors encoding the genes for a variety of antigens/receptors (carcinoembryonic antigen, gastrin-releasing peptide receptor, somatostatin receptor subtype 2 (SSTr2) have all shown that their expression is increased on cancer cells both in vitro and in vivo following adenovirus infection. Of particular interest has been the adenovirus encoding for SSTr2 (AdCMVSSTr2). Various radioisotopes have been attached to somatostatin analogues for imaging and therapy of SSTr2-positive tumors both clinically and in animal models. The use of these analogues in combination with AdCMVSSTr2 is a promising approach for improving the detection sensitivity and therapeutic efficacy of these radiolabeled peptides against solid tumors. In addition, it has been proposed the use of SSTr2 as a marker for imaging the expression of another cancer therapeutic transgene (e.g. cytosine deaminase, thymidine kinase) encoded within the same vector. This would allow for non-invasive monitoring of gene delivery to tumor sites
Tumor SHB gene expression affects disease characteristics in human acute myeloid leukemia.
Jamalpour, Maria; Li, Xiujuan; Cavelier, Lucia; Gustafsson, Karin; Mostoslavsky, Gustavo; Höglund, Martin; Welsh, Michael
2017-10-01
The mouse Shb gene coding for the Src Homology 2-domain containing adapter protein B has recently been placed in context of BCRABL1-induced myeloid leukemia in mice and the current study was performed in order to relate SHB to human acute myeloid leukemia (AML). Publicly available AML databases were mined for SHB gene expression and patient survival. SHB gene expression was determined in the Uppsala cohort of AML patients by qPCR. Cell proliferation was determined after SHB gene knockdown in leukemic cell lines. Despite a low frequency of SHB gene mutations, many tumors overexpressed SHB mRNA compared with normal myeloid blood cells. AML patients with tumors expressing low SHB mRNA displayed longer survival times. A subgroup of AML exhibiting a favorable prognosis, acute promyelocytic leukemia (APL) with a PMLRARA translocation, expressed less SHB mRNA than AML tumors in general. When examining genes co-expressed with SHB in AML tumors, four other genes ( PAX5, HDAC7, BCORL1, TET1) related to leukemia were identified. A network consisting of these genes plus SHB was identified that relates to certain phenotypic characteristics, such as immune cell, vascular and apoptotic features. SHB knockdown in the APL PMLRARA cell line NB4 and the monocyte/macrophage cell line MM6 adversely affected proliferation, linking SHB gene expression to tumor cell expansion and consequently to patient survival. It is concluded that tumor SHB gene expression relates to AML survival and its subgroup APL. Moreover, this gene is included in a network of genes that plays a role for an AML phenotype exhibiting certain immune cell, vascular and apoptotic characteristics.
Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne
2010-03-15
Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.
The Epstein-Barr virus encoded BART miRNAs potentiate tumor growth in vivo.
Directory of Open Access Journals (Sweden)
Jin Qiu
2015-01-01
Full Text Available The human herpes virus Epstein-Barr virus (EBV latently infects and drives the proliferation of B lymphocytes in vitro and is associated with several forms of lymphoma and carcinoma in vivo. The virus encodes ~30 miRNAs in the BART region, the function of most of which remains elusive. Here we have used a new mouse xenograft model of EBV driven carcinomagenesis to demonstrate that the BART miRNAs potentiate tumor growth and development in vivo. No effect was seen on invasion or metastasis, and the growth promoting activity was not seen in vitro. In vivo tumor growth was not associated with the expression of specific BART miRNAs but with up regulation of all the BART miRNAs, consistent with previous observations that all the BART miRNAs are highly expressed in all of the EBV associated cancers. Based on these observations, we suggest that deregulated expression of the BART miRNAs potentiates tumor growth and represents a general mechanism behind EBV associated oncogenesis.
Tumor Microenvironment Gene Signature as a Prognostic Classifier and Therapeutic Target
2016-06-01
AWARD NUMBER: W81XWH-14-1-0107 TITLE: Tumor Microenvironment Gene Signature as a Prognostic Classifier and Therapeutic Target PRINCIPAL...AND SUBTITLE Tumor Microenvironment Gene Signature as a 5a. CONTRACT NUMBER W81XWH-14-1-0107 Prognostic Classifier and Therapeutic Target 5b...gene signature that correlates with poor survival in ovarian cancer patients. We are refining this gene signature to develop biomarkers for the
Dissecting Time- from Tumor-Related Gene Expression Variability in Bilateral Breast Cancer
Directory of Open Access Journals (Sweden)
Maurizio Callari
2018-01-01
Full Text Available Metachronous (MBC and synchronous bilateral breast tumors (SBC are mostly distinct primaries, whereas paired primaries and their local recurrences (LRC share a common origin. Intra-pair gene expression variability in MBC, SBC, and LRC derives from time/tumor microenvironment-related and tumor genetic background-related factors and pairs represents an ideal model for trying to dissect tumor-related from microenvironment-related variability. Pairs of tumors derived from women with SBC (n = 18, MBC (n = 11, and LRC (n = 10 undergoing local-regional treatment were profiled for gene expression; similarity between pairs was measured using an intraclass correlation coefficient (ICC computed for each gene and compared using analysis of variance (ANOVA. When considering biologically unselected genes, the highest correlations were found for primaries and paired LRC, and the lowest for MBC pairs. By instead limiting the analysis to the breast cancer intrinsic genes, correlations between primaries and paired LRC were enhanced, while lower similarities were observed for SBC and MBC. Focusing on stromal-related genes, the ICC values decreased for MBC and were significantly different from SBC. These findings indicate that it is possible to dissect intra-pair gene expression variability into components that are associated with genetic origin or with time and microenvironment by using specific gene subsets.
Kiyota, Tsuyoshi; Takahashi, Yuki; Watcharanurak, Kanitta; Nishikawa, Makiya; Ohara, Saori; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2014-05-05
Tumor-associated macrophages (TAMs) negatively affect the therapeutic effects of anticancer agents. To examine the role of TAMs in interferon (IFN)-γ gene therapy, we selected two types of solid tumors, which varied in the number of TAMs, and investigated the effects of IFN-γ gene transfer on tumor growth. Many TAMs were detected in the solid tumors of murine adenocarcinoma colon-26 cells, whereas few TAMs were detected in murine melanoma B16-BL6 cells. IFN-γ gene transfer hardly suppressed the growth of colon-26 tumors, whereas it was effective in suppressing the growth of B16-BL6 tumors. The antiproliferative effects of IFN-γ on cultured colon-26 cells were similar to those on cultured B16-BL6 cells. To evaluate the role of TAMs, we injected clodronate liposomes (CLs) modified with poly(ethylene glycol) (PEG) to functionally deplete TAMs in tumor-bearing mice. Repeated injections of PEG-CLs significantly retarded the growth of colon-26 tumors and combination with IFN-γ gene transfer further inhibited the growth. In contrast, PEG-CLs hardly retarded the growth of B16-BL6 tumors. These results clearly indicate that TAM depletion is effective in enhancing the therapeutic effect of IFN-γ in TAM-repleted and IFN-γ-resistant tumors.
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
The effect of endostatin gene in combination with radiotherapy on rats with implanted tumor
International Nuclear Information System (INIS)
Li Yong; Jin Ning; Yang Haishan; Piao Chunji; Lv Zhe
2005-01-01
Objective: To study the combination therapy effect of the radiotherapy with endostatin gene therapy on the rats with implanted tumor. Methods: Immediate Walker-256 cancerous ascetic injection method was used to make a rat tumor-bearing model, then the tumor was treated with saline, endostatin gene, irradiation or endostatin gene plus irradiation. The tumor growth rate and weight were observed, Western blot and RT-PCR were adopted to check the expressions of endostatin mRNA and protein. Results: The expressions of endostatin mRNA and protein were significant in the gene therapy group and the gene plus radiotherapy group, but there was a significant difference between these two groups. As compared with the control group, the tumor growth rate and weight decreased significantly in all the therapy groups (P 0.05). Conclusion: After the pCMV-Endostatin was induced, the expressions of endostatin mRNA and protein was significant in Walker-256 tumor and the tumor growth was inhibited. However, the effect of the endostatin gene plus radiotherapy was obviously better than that of the endostatin gene therapy group or the radiotherapy group for inhibiting tumor growth. (authors)
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Role for the Wilms tumor gene in genital development?
International Nuclear Information System (INIS)
van Heyningen, V.; Bickmore, W.A.; Seawright, A.; Fletcher, J.M.; Maule, J.; Hastie, N.D.; Fekete, G.; Gessler, M.; Bruns, G.A.P.; Huerre-Jeanpierre, C.; Junien, C.; Williams, B.R.G.
1990-01-01
Detailed molecular definition of the WAGR region at chromosome 11p13 has been achieved by chromosome breakpoint analysis and long-range restriction mapping. Here the authors describe the molecular detection of a cytogenetically invisible 1-megabase deletion in an individual with aniridia, cryptorchidism, and hypospadias but no Wilms tumor (WT). The region of overlap between this deletion and one associated with WT and similar genital anomalies but no aniridia covers a region of 350-400 kilobases, which is coincident with the extent of homozygous deletion detected in tumor tissue from a sporadic WT. A candidate WT gene located within this region has recently been isolated, suggesting nonpenetrance for tumor expression in the first individual. The inclusion within the overlap region of a gene for WT predisposition and a gene for the best-documented WT-associated genitourinary malformations leads to suggest that both of these anomalies result from a loss-of-function mutation at the same locus. This in turn implies that the WT gene exerts pleiotropic effect on both kidney and genitourinary development, a possibility supported by the observed expression pattern of the WT candidate gene in developing kidney and gonads
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
International Nuclear Information System (INIS)
Jang, Su Jin; Kang, Joo Hyun; Kim, Kwang Il; Lee, Tae Sup; Lee, Yong Jin; Woo, Kwang Sun; Chung, Wee Sup; Cheon, Gi Jeong; Choi, Chang Woon; Lim, Sang Moo
2010-01-01
Suicidal gene therapy is based on the transduction of tumor cells with 'suicide' genes encoding for prodrugactivating enzymes that render target cells susceptible to prodrug treatment. Suicidal gene therapy results in the death of tumor with the expression of gene encoding enzyme that converts non-toxic prodrug into cytotoxic product. Cytochrome P450 4B1 (CYP4B1) activates 4- ipomeanol (4-ipo) and 2-aminoanthracene (2-AA) to cytotoxic furane epoxide and unsaturated dialdehyde intermediate. In this study, therapeutic effects of suicidal gene therapy with rabbit CYP4B1/4-ipo or CYP4B1/2-AA system
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Merchant, Soroush; Huang, Naiyan; Korbelik, Mladen
2010-12-01
Treatment of solid tumors by photodynamic therapy (PDT) was recently shown to trigger a strong acute phase response. Using the mouse Lewis lung carcinoma (LLC) model, the present study examined complement and pentraxin proteins as PDT-induced acute phase reactants. The results show a distinct pattern of changes in the expression of genes encoding these proteins in the tumor, as well as host liver and spleen, following PDT mediated by photosensitizer Photofrin™. These changes were influenced by glucocorticoid hormones, as evidenced by transcriptional activation of glucocorticoid receptor and the upregulation of gene encoding this receptor. The expression of gene for glucocorticoid-induced zipper (GILZ) protein, whose activity is particularly susceptible to glucocorticoid regulation, was also changed in PDT-treated tumors. A direct demonstration that tumor PDT induces glucocorticoid hormone upregulation is provided by documenting elevated levels of serum corticosterone in mice bearing PDT-treated LLC tumors. Tumor response to PDT was negatively affected by blocking glucocorticoid receptor activity, which suggests that glucocorticoid hormones have a positive impact on the therapeutic outcome with this therapy. Copyright © 2010 Elsevier B.V. All rights reserved.
ONC201: Stressing tumors to death.
Endo Greer, Yoshimi; Lipkowitz, Stanley
2016-02-16
The small molecule ONC201 was identified in a screen for compounds that would induce expression of the gene encoding tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) in tumors and thus cause an autocrine- or paracrine-induced death in tumor cells. Two Research Articles in this issue of Science Signaling by Ishizawa et al. and Kline et al. describe how ONC201 can also trigger cytotoxicity by inducing a stress response. The mechanisms of the stress response induced differ between hematological malignancies and solid tumors, highlighting the complexity of ONC201-induced toxicity and raising intriguing issues of tissue-specific pathways activated by the drug. Copyright © 2016, American Association for the Advancement of Science.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
RET is a potential tumor suppressor gene in colorectal cancer
Luo, Yanxin; Tsuchiya, Karen D.; Park, Dong Il; Fausel, Rebecca; Kanngurn, Samornmas; Welcsh, Piri; Dzieciatkowski, Slavomir; Wang, Jianping; Grady, William M.
2012-01-01
Cancer arises as the consequence of mutations and epigenetic alterations that activate oncogenes and inactivate tumor suppressor genes. Through a genome-wide screen for methylated genes in colon neoplasms, we identified aberrantly methylated RET in colorectal cancer. RET, a transmembrane receptor tyrosine kinase and a receptor for the GDNF-family ligands, was one of the first oncogenes to be identified and has been shown to be an oncogene in thyroid cancer and pheochromocytoma. However, unexpectedly, we found RET is methylated in 27% of colon adenomas and in 63% of colorectal cancers, and now provide evidence that RET has tumor suppressor activity in colon cancer. The aberrant methylation of RET correlates with decreased RET expression, whereas the restoration of RET in colorectal cancer cell lines results in apoptosis. Furthermore, in support of a tumor suppressor function of RET, mutant RET has also been found in primary colorectal cancer. We now show that these mutations inactivate RET, which is consistent with RET being a tumor suppressor gene in the colon. These findings suggest that the aberrant methylation of RET and the mutational inactivation of RET promote colorectal cancer formation and that RET can serve as a tumor suppressor gene in the colon. Moreover, the increased frequency of methylated RET in colon cancers compared to adenomas suggests RET inactivation is involved in the progression of colon adenomas to cancer. PMID:22751117
Rifatbegovic, Fikret; Frech, Christian; Abbasi, M Reza; Taschner-Mandl, Sabine; Weiss, Tamara; Schmidt, Wolfgang M; Schmidt, Iris; Ladenstein, Ruth; Ambros, Inge M; Ambros, Peter F
2018-01-15
Neuroblastoma is the most common extracranial solid tumor in childhood. The vast majority of metastatic (M) stage patients present with disseminated tumor cells (DTCs) in the bone marrow (BM) at diagnosis and relapse. Although these cells represent a major obstacle in the treatment of neuroblastoma patients, insights into their expression profile remained elusive. The present RNA-Seq study of stage 4/M primary tumors, enriched BM-derived diagnostic and relapse DTCs, as well as the corresponding BM-derived mononuclear cells (MNCs) from 53 patients revealed 322 differentially expressed genes in DTCs as compared to the tumors (q 2). Particularly, the levels of transcripts encoded by mitochondrial DNA were elevated in DTCs, whereas, for example, genes involved in angiogenesis were downregulated. Furthermore, 224 genes were highly expressed in DTCs and only slightly, if at all, in MNCs (q 6). Interestingly, we found the transcriptome of relapse DTCs largely resembling those of diagnostic DTCs with only 113 differentially expressed genes under relaxed cut-offs (q 0.5). Notably, relapse DTCs showed a positional enrichment of 31 downregulated genes on chromosome 19, including five tumor suppressor genes: SIRT6, BBC3/PUMA, STK11, CADM4 and GLTSCR2. This first RNA-Seq analysis of neuroblastoma DTCs revealed their unique expression profile in comparison to the tumors and MNCs, and less pronounced differences between diagnostic and relapse DTCs. The latter preferentially affected downregulation of genes encoded by chromosome 19. As these alterations might be associated with treatment failure and disease relapse, further functional studies on DTCs should be considered. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.
Synergistic gene and drug tumor therapy using a chimeric peptide.
Han, Kai; Chen, Si; Chen, Wei-Hai; Lei, Qi; Liu, Yun; Zhuo, Ren-Xi; Zhang, Xian-Zheng
2013-06-01
Co-delivery of gene and drug for synergistic therapy has provided a promising strategy to cure devastating diseases. Here, an amphiphilic chimeric peptide (Fmoc)2KH7-TAT with pH-responsibility for gene and drug delivery was designed and fabricated. As a drug carrier, the micelles self-assembled from the peptide exhibited a much faster doxorubicin (DOX) release rate at pH 5.0 than that at pH 7.4. As a non-viral gene vector, (Fmoc)(2)KH(7)-TAT peptide could satisfactorily mediate transfection of pGL-3 reporter plasmid with or without the existence of serum in both 293T and HeLa cell-lines. Besides, the endosome escape capability of peptide/DNA complexes was investigated by confocal laser scanning microscopy (CLSM). To evaluate the co-delivery efficiency and the synergistic anti-tumor effect of gene and drug, p53 plasmid and DOX were simultaneously loaded in the peptide micelles to form micelleplexes during the self-assembly of the peptide. Cellular uptake and intracellular delivery of gene and drug were studied by CLSM and flow cytometry respectively. And p53 protein expression was determined via Western blot analysis. The in vitro cytotoxicity and in vivo tumor inhibition effect were also studied. Results suggest that the co-delivery of gene and drug from peptide micelles resulted in effective cell growth inhibition in vitro and significant tumor growth restraining in vivo. The chimeric peptide-based gene and drug co-delivery system will find great potential for tumor therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.
Alternative polyadenylation of tumor suppressor genes in small intestinal neuroendocrine tumors
DEFF Research Database (Denmark)
Rehfeld, Anders Aagaard; Plass, Mireya; Døssing, Kristina
2014-01-01
The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site...... and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3' untranslated regions. Additionally, APA can also produce mRNAs containing different 3'-terminal coding regions. Therefore, APA alters both the repertoire...... and the expression level of proteins. Here, we used high-throughput sequencing data to map polyA sites and characterize polyadenylation genome-wide in three SI-NETs and a reference sample. In the tumors, 16 genes showed significant changes of APA pattern, which lead to either the 3' truncation of mRNA coding regions...
The potential for tumor suppressor gene therapy in head and neck cancer.
Birkeland, Andrew C; Ludwig, Megan L; Spector, Matthew E; Brenner, J Chad
2016-01-01
Head and neck squamous cell carcinoma remains a highly morbid and fatal disease. Importantly, genomic sequencing of head and neck cancers has identified frequent mutations in tumor suppressor genes. While targeted therapeutics increasingly are being investigated in head and neck cancer, the majority of these agents are against overactive/overexpressed oncogenes. Therapy to restore lost tumor suppressor gene function remains a key and under-addressed niche in trials for head and neck cancer. Recent advances in gene editing have captured the interest of both the scientific community and the public. As our technology for gene editing and gene expression modulation improves, addressing lost tumor suppressor gene function in head and neck cancers is becoming a reality. This review will summarize new techniques, challenges to implementation, future directions, and ethical ramifications of gene therapy in head and neck cancer.
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Energy Technology Data Exchange (ETDEWEB)
Jang, Su Jin; Kang, Joo Hyun; Kim, Kwang Il; Lee, Tae Sup; Lee, Yong Jin; Woo, Kwang Sun; Chung, Wee Sup; Cheon, Gi Jeong; Choi, Chang Woon; Lim, Sang Moo [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)
2010-10-15
Suicidal gene therapy is based on the transduction of tumor cells with 'suicide' genes encoding for prodrugactivating enzymes that render target cells susceptible to prodrug treatment. Suicidal gene therapy results in the death of tumor with the expression of gene encoding enzyme that converts non-toxic prodrug into cytotoxic product. Cytochrome P450 4B1 (CYP4B1) activates 4- ipomeanol (4-ipo) and 2-aminoanthracene (2-AA) to cytotoxic furane epoxide and unsaturated dialdehyde intermediate. In this study, therapeutic effects of suicidal gene therapy with rabbit CYP4B1/4-ipo or CYP4B1/2-AA system
Talmadge, J E; Talmadge, C B; Zbar, B; McEwen, R; Meeker, A K; Tribble, H
1987-06-01
The mechanism by which tumor allografts escape host immunologic attack was investigated. B16-BL6 cells (the bladder 6 subline of the B16 melanoma) (H-2b) were transfected with a gene (Dd) encoding an allogeneic class I major histocompatibility complex antigen. Clones that expressed Dd antigen were injected into the footpads of nonimmune syngeneic mice, syngeneic immune mice, and nude mice. Under conditions of immunologic selection a clone that contained multiple copies of the transfected gene formed variants that lacked the transfected gene. Primary tumors and pulmonary metastases of immunized mice and pulmonary metastases of nonimmunized mice had lost the Dd gene and, in most cases, all of the associated plasmid. In contrast, in immunodeficient nude mice, primary tumors and pulmonary metastases retained the Dd gene and the associated plasmid. Deletion of genes encoding cell surface antigens may be one of the mechanisms by which allogeneic tumors escape immunologic attack.
Trojan horse at cellular level for tumor gene therapies.
Collet, Guillaume; Grillon, Catherine; Nadim, Mahdi; Kieda, Claudine
2013-08-10
Among innovative strategies developed for cancer treatments, gene therapies stand of great interest despite their well-known limitations in targeting, delivery, toxicity or stability. The success of any given gene-therapy is highly dependent on the carrier efficiency. New approaches are often revisiting the mythic trojan horse concept to carry therapeutic nucleic acid, i.e. DNAs, RNAs or small interfering RNAs, to pathologic tumor site. Recent investigations are focusing on engineering carrying modalities to overtake the above limitations bringing new promise to cancer patients. This review describes recent advances and perspectives for gene therapies devoted to tumor treatment, taking advantage of available knowledge in biotechnology and medicine. Copyright © 2013 Elsevier B.V. All rights reserved.
Hypoxia-Inducible Regulation of a Prodrug-Activating Enzyme for Tumor-Specific Gene Therapy
Directory of Open Access Journals (Sweden)
Toru Shibata
2002-01-01
Full Text Available Previous studies have suggested that tumor hypoxia could be exploited for cancer gene therapy. Using hypoxia-responsive elements derived from the human vascular endothelial growth factor gene, we have generated vectors expressing a bacterial nitroreductase. (20NTR gene that can activate the anticancer prodrug CB1954. Stable transfectants of human HT1080 tumor cells with hypoxia-inducible vectors were established with G418 selection. Hypoxic induction of NTR protein correlated with increased sensitivity to in vitro exposure of HT 1080 cells to the prodrug. Growth delay assays were performed with established tumor xenografts derived from the same cells to detect the in vivo efficacy of CB1954 conversion to its cytotoxic form. Significant antitumor effects were achieved with intraperitoneal injections of CB1954 both in tumors that express NTR constitutively or with a hypoxia-inducible promoter. In addition, respiration of 10% O2 increased tumor hypoxia in vivo and enhanced the antitumor effects. Taken together, these results demonstrate that hypoxia-inducible vectors may be useful for tumor-selective gene therapy, although the problem of delivery of the vector to the tumors, particularly to the hypoxic cells in the tumors, is not addressed by these studies.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne
2010-01-01
Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190
Lim, Li Ying; Koh, Pei Yin; Somani, Sukrut; Al Robaian, Majed; Karim, Reatul; Yean, Yi Lyn; Mitchell, Jennifer; Tate, Rothwelle J; Edrada-Ebel, RuAngelie; Blatchford, David R; Mullin, Margaret; Dufès, Christine
2015-08-01
The possibility of using gene therapy for the treatment of cancer is limited by the lack of safe, intravenously administered delivery systems able to selectively deliver therapeutic genes to tumors. In this study, we investigated if the conjugation of the polypropylenimine dendrimer to lactoferrin and lactoferricin, whose receptors are overexpressed on cancer cells, could result in a selective gene delivery to tumors and a subsequently enhanced therapeutic efficacy. The conjugation of lactoferrin and lactoferricin to the dendrimer significantly increased the gene expression in the tumor while decreasing the non-specific gene expression in the liver. Consequently, the intravenous administration of the targeted dendriplexes encoding TNFα led to the complete suppression of 60% of A431 tumors and up to 50% of B16-F10 tumors over one month. The treatment was well tolerated by the animals. These results suggest that these novel lactoferrin- and lactoferricin-bearing dendrimers are promising gene delivery systems for cancer therapy. Specific targeting of cancer cells should enhance the delivery of chemotherapeutic agents. This is especially true for gene delivery. In this article, the authors utilized a dendrimer-based system and conjugated this with lactoferrin and lactoferricin to deliver anti-tumor genes. The positive findings in animal studies should provide the basis for further clinical studies. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Regional and temporal differences in gene expression of LH(BETA)T(AG) retinoblastoma tumors.
Houston, Samuel K; Pina, Yolanda; Clarke, Jennifer; Koru-Sengul, Tulay; Scott, William K; Nathanson, Lubov; Schefler, Amy C; Murray, Timothy G
2011-07-23
The purpose of this study was to evaluate by microarray the hypothesis that LH(BETA)T(AG) retinoblastoma tumors exhibit regional and temporal variations in gene expression. LH(BETA)T(AG) mice aged 12, 16, and 20 weeks were euthanatized (n = 9). Specimens were taken from five tumor areas (apex, anterior lateral, center, base, and posterior lateral). Samples were hybridized to gene microarrays. The data were preprocessed and analyzed, and genes with a P 2.5 were considered to be differentially expressed. Differentially expressed genes were analyzed for overlap with known networks by using pathway analysis tools. There were significant temporal (P regional differences in gene expression for LH(BETA)T(AG) retinoblastoma tumors. At P 2.5, there were significant changes in gene expression of 190 genes apically, 84 genes anterolaterally, 126 genes posteriorly, 56 genes centrally, and 134 genes at the base. Differentially expressed genes overlapped with known networks, with significant involvement in regulation of cellular proliferation and growth, response to oxygen levels and hypoxia, regulation of cellular processes, cellular signaling cascades, and angiogenesis. There are significant temporal and regional variations in the LH(BETA)T(AG) retinoblastoma model. Differentially expressed genes overlap with key pathways that may play pivotal roles in murine retinoblastoma development. These findings suggest the mechanisms involved in tumor growth and progression in murine retinoblastoma tumors and identify pathways for analysis at a functional level, to determine significance in human retinoblastoma. Microarray analysis of LH(BETA)T(AG) retinal tumors showed significant regional and temporal variations in gene expression, including dysregulation of genes involved in hypoxic responses and angiogenesis.
DEFF Research Database (Denmark)
Sorensen, Maria R; Holst, Peter J; Pircher, Hanspeter
2009-01-01
of the vaccine antigen to invariant chain (Ii). To evaluate this strategy we used a mouse model, in which an immunodominant epitope (GP33) of the LCMV glycoprotein (GP) represents the tumor-associated neoantigen. Prophylactic vaccination of C57BL/6 mice with a replication-deficient human adenovirus 5 vector...... encoding GP linked to Ii (Ad-Ii-GP) resulted in complete protection against GP33-expressing B16.F10 tumors. Therapeutic vaccination with Ad-Ii-GP delayed tumor growth by more than 2 wk compared with sham vaccination. Notably, therapeutic vaccination with the linked vaccine was significantly better than...... the tumor degradation. Finally, Ad-Ii-GP but not Ad-GP vaccination can break the immunological non-reactivity in GP transgenic mice indicating that our vaccine strategy will prove efficient also against endogenous tumor antigens....
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
Radiation-associated breast tumors display a distinct gene expression profile
DEFF Research Database (Denmark)
Broeks, Annegien; Braaf, Linde M; Wessels, Lodewyk F A
2010-01-01
PURPOSE: Women who received irradiation for Hodgkin's lymphoma have a strong increased risk for developing breast cancer. Approximately 90% of the breast cancers in these patients can be attributed to their radiation treatment, rendering such series extremely useful to determine whether a common...... radiation-associated cause underlies the carcinogenic process. METHODS AND MATERIALS: In this study we used gene expression profiling technology to assess gene expression changes in radiation-associated breast tumors compared with a set of control breast tumors of women unexposed to radiation, diagnosed...... at the same age. RNA was obtained from fresh frozen tissue samples from 22 patients who developed breast cancer after Hodgkin's lymphoma (BfHL) and from 20 control breast tumors. RESULTS: Unsupervised hierarchical clustering of the profile data resulted in a clustering of the radiation-associated tumors...
AZU-1: A Candidate Breast Tumor Suppressor and Biomarker for Tumor Progression
Energy Technology Data Exchange (ETDEWEB)
Chen, Huei-Mei; Schmeichel, Karen L; Mian, I. Saira; Lelie`vre, Sophie; Petersen, Ole W; Bissell, Mina J
2000-02-04
To identify genes misregulated in the final stages of breast carcinogenesis, we performed differential display to compare the gene expression patterns of the human tumorigenic mammary epithelial cells, HMT-3522-T4-2, with those of their immediate premalignant progenitors, HMT-3522-S2. We identified a novel gene, called anti-zuai-1 (AZU-1), that was abundantly expressed in non- and premalignant cells and tissues but was appreciably reduced in breast tumor cell types and in primary tumors. The AZU-1 gene encodes an acidic 571-amino-acid protein containing at least two structurally distinct domains with potential protein-binding functions: an N-terminal serine and proline-rich domain with a predicted immunoglobulin-like fold and a C-terminal coiled-coil domain. In HMT-3522 cells, the bulk of AZU-1 protein resided in a detergent-extractable cytoplasmic pool and was present at much lower levels in tumorigenic T4-2 cells than in their nonmalignant counterparts. Reversion of the tumorigenic phenotype of T4-2 cells, by means described previously, was accompanied by the up-regulation of AZU-1. In addition, reexpression of AZU-1 in T4-2 cells, using viral vectors, was sufficient to reduce their malignant phenotype substantially, both in culture and in vivo. These results indicate that AZU-1 is a candidate breast tumor suppressor that may exert its effects by promoting correct tissue morphogenesis.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
International Nuclear Information System (INIS)
Hwang, Kyung-Sun; Cho, Won-Kyung; Yoo, Jinsang; Yun, Hwan-Jung; Kim, Samyong; Im, Dong-Soo
2005-01-01
Therapeutic gene transfer affords a clinically feasible and safe approach to cancer treatment but a more effective modality is needed to improve clinical outcomes. Combined transfer of therapeutic genes with different modes of actions may be a means to this end. Interleukin-12 (IL-12), a heterodimeric immunoregulatory cytokine composed of covalently linked p35 and p40 subunits, has antitumor activity in animal models. The enzyme/prodrug strategy using cytosine deaminase (CD) and 5-fluorocytosine (5-FC) has been used for cancer gene therapy. We have evaluated the antitumor effect of combining IL-12 with CD gene transfer in mice bearing renal cell carcinoma (Renca) tumors. Adenoviral vectors were constructed encoding one or both subunits of murine IL-12 (Ad.p35, Ad.p40 and Ad.IL-12) or cytosine deaminase (Ad.CD). The functionality of the IL-12 or CD gene products expressed from these vectors was validated by splenic interferon (IFN)-γ production or viability assays in cultured cells. Ad.p35 plus Ad.p40, or Ad.IL-12, with or without Ad.CD, were administered (single-dose) intratumorally to Renca tumor-bearing mice. The animals injected with Ad.CD also received 5-FC intraperitoneally. The antitumor effects were then evaluated by measuring tumor regression, mean animal survival time, splenic natural killer (NK) cell activity and IFN-γ production. The inhibition of tumor growth in mice treated with Ad.p35 plus Ad.p40 and Ad.CD, followed by injection of 5-FC, was significantly greater than that in mice treated with Ad.CD/5-FC, a mixture of Ad.p35 plus Ad.p40, or Ad.GFP (control). The combined gene transfer increased splenic NK cell activity and IFN-γ production by splenocytes. Ad.CD/5-FC treatment significantly increased the antitumor effect of Ad.IL-12 in terms of tumor growth inhibition and mean animal survival time. The results suggest that adenovirus-mediated IL-12 gene transfer combined with Ad.CD followed by 5-FC treatment may be useful for treating cancers
A Restricted Spectrum of Mutations in the SMAD4 Tumor-Suppressor Gene Underlies Myhre Syndrome
Caputo, Viviana; Cianetti, Luciano; Niceta, Marcello; Carta, Claudio; Ciolfi, Andrea; Bocchinfuso, Gianfranco; Carrani, Eugenio; Dentici, Maria Lisa; Biamino, Elisa; Belligni, Elga; Garavelli, Livia; Boccone, Loredana; Melis, Daniela; Andria, Generoso; Gelb, Bruce D.; Stella, Lorenzo; Silengo, Margherita; Dallapiccola, Bruno; Tartaglia, Marco
2012-01-01
Myhre syndrome is a developmental disorder characterized by reduced growth, generalized muscular hypertrophy, facial dysmorphism, deafness, cognitive deficits, joint stiffness, and skeletal anomalies. Here, by performing exome sequencing of a single affected individual and coupling the results to a hypothesis-driven filtering strategy, we establish that heterozygous mutations in SMAD4, which encodes for a transducer mediating transforming growth factor β and bone morphogenetic protein signaling branches, underlie this rare Mendelian trait. Two recurrent de novo SMAD4 mutations were identified in eight unrelated subjects. Both mutations were missense changes altering Ile500 within the evolutionary conserved MAD homology 2 domain, a well known mutational hot spot in malignancies. Structural analyses suggest that the substituted residues are likely to perturb the binding properties of the mutant protein to signaling partners. Although SMAD4 has been established as a tumor suppressor gene somatically mutated in pancreatic, gastrointestinal, and skin cancers, and germline loss-of-function lesions and deletions of this gene have been documented to cause disorders that predispose individuals to gastrointestinal cancer and vascular dysplasias, the present report identifies a previously unrecognized class of mutations in the gene with profound impact on development and growth. PMID:22243968
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Durr, Megan L.; Mydlarz, Wojciech K.; Shao, Chunbo; Zahurak, Marianna L.; Chuang, Alice Y.; Hoque, Mohammad O.; Westra, William H.; Liegeois, Nanette J.; Califano, Joseph A.; Sidransky, David; Ha, Patrick K.
2010-01-01
Background Methylation profiling of tumor suppressor gene (TSGs) promoters is quickly becoming a powerful diagnostic tool for the early detection, prognosis, and even prediction of clinical response to treatment. Few studies address this in salivary gland tumors (SGTs); hence the promoter methylation profile of various TSGs was quantitatively assessed in primary SGT tissue to determine if tumor-specific alterations could be detected. Methodology DNA isolated from 78 tumor and 17 normal parotid gland specimens was assayed for promoter methylation status of 19 TSGs by fluorescence-based, quantitative methylation-specific PCR (qMSP). The data were utilized in a binary fashion as well as quantitatively (using a methylation quotient) allowing for better profiling and interpretation of results. Principal Findings The average number of methylation events across the studied genes was highest in salivary duct carcinoma (SDC), with a methylation value of 9.6, compared to the normal 4.5 (ptrend for increasing methylation in APC, Mint 1, PGP9.5, RAR-β, and Timp3. Conclusions/Significance Screening promoter methylation profiles in SGTs showed considerable heterogeneity. The methylation status of certain markers was surprisingly high in even normal salivary tissue, confirming the need for such controls. Several TSGs were found to be associated with malignant SGTs, especially SDC. Further study is needed to evaluate the potential use of these associations in the detection, prognosis, and therapeutic outcome of these rare tumors. PMID:20520817
DEFF Research Database (Denmark)
Rygaard, K; Sorenson, G D; Pettengill, O S
1990-01-01
The putative retinoblastoma gene (Rb) is a tumor suppressor gene which is believed to cause retinoblastomas when both alleles are inactivated, leading to lack of the encoded Mr 110,000-116,000 phosphoprotein. Inactivation of the Rb gene has also been found in several other tumor types, including...
Ingram, D A; Yang, F C; Travers, J B; Wenning, M J; Hiatt, K; New, S; Hood, A; Shannon, K; Williams, D A; Clapp, D W
2000-01-03
Neurofibromatosis type 1 (NF1) is a common autosomal-dominant disorder characterized by cutaneous neurofibromas infiltrated with large numbers of mast cells, melanocyte hyperplasia, and a predisposition to develop malignant neoplasms. NF1 encodes a GTPase activating protein (GAP) for Ras. Consistent with Knudson's "two hit" model of tumor suppressor genes, leukemias and malignant solid tumors in NF1 patients frequently demonstrate somatic loss of the normal NF1 allele. However, the phenotypic and biochemical consequences of heterozygous inactivation of Nf1 are largely unknown. Recently neurofibromin, the protein encoded by NF1, was shown to negatively regulate Ras activity in Nf1-/- murine myeloid hematopoietic cells in vitro through the c-kit receptor tyrosine kinase (dominant white spotting, W). Since the W and Nf1 locus appear to function along a common developmental pathway, we generated mice with mutations at both loci to examine potential interactions in vivo. Here, we show that haploinsufficiency at Nf1 perturbs cell fates in mast cells in vivo, and partially rescues coat color and mast cell defects in W(41) mice. Haploinsufficiency at Nf1 also increased mast cell proliferation, survival, and colony formation in response to Steel factor, the ligand for c-kit. Furthermore, haploinsufficiency was associated with enhanced Ras-mitogen-activated protein kinase activity, a major downstream effector of Ras, via wild-type and mutant (W(41)) c-kit receptors. These observations identify a novel interaction between c-kit and neurofibromin in vivo, and offer experimental evidence that haploinsufficiency of Nf1 alters both cellular and biochemical phenotypes in two cell lineages that are affected in individuals with NF1. Collectively, these data support the emerging concept that heterozygous inactivation of tumor suppressor genes may have profound biological effects in multiple cell types.
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Directory of Open Access Journals (Sweden)
Monika Stimac
Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.
Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor
2015-01-01
Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.
Norton, Nadine; Advani, Pooja P.; Serie, Daniel J.; Geiger, Xochiquetzal J.; Necela, Brian M.; Axenfeld, Bianca C.; Kachergus, Jennifer M.; Feathers, Ryan W.; Carr, Jennifer M.; Crook, Julia E.; Moreno-Aspitia, Alvaro; Anastasiadis, Panos Z.; Perez, Edith A.; Thompson, E. Aubrey
2016-01-01
Background Invasive lobular carcinoma (ILC) comprises approximately ~10–20% of breast cancers. In general, multifocal/multicentric (MF/MC) breast cancer has been associated with an increased rate of regional lymph node metastases. Tumor heterogeneity between foci represents a largely unstudied source of genomic variation in those rare patients with MF/MC ILC. Methods We characterized gene expression and copy number in 2 or more foci from 11 patients with MF/MC ILC (all ER+, HER2-) and adjacent normal tissue. RNA and DNA were extracted from 3x1.5mm cores from all foci. Gene expression (730 genes) and copy number (80 genes) were measured using Nanostring PanCancer and Cancer CNV panels. Linear mixed models were employed to compare expression in tumor versus normal samples from the same patient, and to assess heterogeneity (variability) in expression among multiple ILC within an individual. Results 35 and 34 genes were upregulated (FC>2) and down-regulated (FC<0.5) respectively in ILC tumor relative to adjacent normal tissue, q<0.05. 9/34 down-regulated genes (FIGF, RELN, PROM1, SFRP1, MMP7, NTRK2, LAMB3, SPRY2, KIT) had changes larger than CDH1, a hallmark of ILC. Copy number changes in these patients were relatively few but consistent across foci within each patient. Amplification of three genes (CCND1, FADD, ORAOV1) at 11q13.3 was present in 2/11 patients in both foci. We observed significant evidence of within-patient between-foci variability (heterogeneity) in gene expression for 466 genes (p<0.05 with FDR 8%), including CDH1, FIGF, RELN, SFRP1, MMP7, NTRK2, LAMB3, SPRY2 and KIT. Conclusions There was substantial variation in gene expression between ILC foci within patients, including known markers of ILC, suggesting an additional level of complexity that should be addressed. PMID:27078887
International Nuclear Information System (INIS)
Moen, Ingrid; Øyan, Anne M; Stuhr, Linda EB; Jevne, Charlotte; Wang, Jian; Kalland, Karl-Henning; Chekenya, Martha; Akslen, Lars A; Sleire, Linda; Enger, Per Ø; Reed, Rolf K
2012-01-01
The tumor microenvironment is pivotal in tumor progression. Thus, we aimed to develop a mammary tumor model to elucidate molecular characteristics in the stroma versus the tumor cell compartment by global gene expression. Secondly, since tumor hypoxia influences several aspects of tumor pathophysiology, we hypothesized that hyperoxia might have an inhibitory effect on tumor growth per se. Finally, we aimed to identify differences in gene expression and key molecular mechanisms, both in the native state and following treatment. 4T1 dsRed breast cancer cells were injected into eGFP expressing NOD/SCID mice. Group 1 was exposed to 3 intermittent HBO treatments (Day 1, 4 and 7), Group 2 to 7 daily HBO treatments (both 2.5bar, 100% O 2 , à 90 min), whereas the controls were exposed to a normal atmosphere. Tumor growth, histology, vascularisation, cell proliferation, cell death and metastasis were assessed. Fluorescence-activated cell sorting was used to separate tumor cells from stromal cells prior to gene expression analysis. The purity of sorted cells was verified by fluorescence microscopy. Gene expression profiling demonstrated that highly expressed genes in the untreated tumor stroma included constituents of the extracellular matrix and matrix metalloproteinases. Tumor growth was significantly inhibited by HBO, and the MAPK pathway was found to be significantly reduced. Immunohistochemistry indicated a significantly reduced microvessel density after intermittent HBO, whereas daily HBO did not show a similar effect. The anti-angiogenic response was reflected in the expression trends of angiogenic factors. The present in vivo mammary tumor model enabled us to separate tumor and stromal cells, and demonstrated that the two compartments are characterized by distinct gene expressions, both in the native state and following HBO treatments. Furthermore, hyperoxia induced a significant tumor growth-inhibitory effect, with significant down-regulation of the MAPK pathway
Vasselli, James R; Shih, Joanna H; Iyengar, Shuba R; Maranchie, Jodi; Riss, Joseph; Worrell, Robert; Torres-Cabala, Carlos; Tabios, Ray; Mariotti, Andra; Stearman, Robert; Merino, Maria; Walther, McClellan M; Simon, Richard; Klausner, Richard D; Linehan, W Marston
2003-06-10
To identify potential molecular determinants of tumor biology and possible clinical outcomes, global gene-expression patterns were analyzed in the primary tumors of patients with metastatic renal cell cancer by using cDNA microarrays. We used grossly dissected tumor masses that included tumor, blood vessels, connective tissue, and infiltrating immune cells to obtain a gene-expression "profile" from each primary tumor. Two patterns of gene expression were found within this uniformly staged patient population, which correlated with a significant difference in overall survival between the two patient groups. Subsets of genes most significantly associated with survival were defined, and vascular cell adhesion molecule-1 (VCAM-1) was the gene most predictive for survival. Therefore, despite the complex biological nature of metastatic cancer, basic clinical behavior as defined by survival may be determined by the gene-expression patterns expressed within the compilation of primary gross tumor cells. We conclude that survival in patients with metastatic renal cell cancer can be correlated with the expression of various genes based solely on the expression profile in the primary kidney tumor.
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Tumor suppressor genes that escape from X-inactivation contribute to cancer sex bias
Dunford, Andrew; Weinstock, David M.; Savova, Virginia; Schumacher, Steven E.; Cleary, John P.; Yoda, Akinori; Sullivan, Timothy J.; Hess, Julian M.; Gimelbrant, Alexander A.; Beroukhim, Rameen; Lawrence, Michael S.; Getz, Gad; Lane, Andrew A.
2016-01-01
There is a striking and unexplained male predominance across many cancer types. A subset of X chromosome (chrX) genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative “Escape from X-Inactivation Tumor Suppressor” (EXITS) genes, we compared somatic alterations from >4100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) chrX genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) more frequently harbored loss-of-function mutations in males (based on false discovery rate <0.1), compared to zero of 18,055 autosomal and PAR genes (P<0.0001). Male-biased mutations in genes that escape X-inactivation were observed in combined analysis across many cancers and in several individual tumor types, suggesting a generalized phenomenon. We conclude that biallelic expression of EXITS genes in females explains a portion of the reduced cancer incidence compared to males across a variety of tumor types. PMID:27869828
Tumor-suppressor genes that escape from X-inactivation contribute to cancer sex bias.
Dunford, Andrew; Weinstock, David M; Savova, Virginia; Schumacher, Steven E; Cleary, John P; Yoda, Akinori; Sullivan, Timothy J; Hess, Julian M; Gimelbrant, Alexander A; Beroukhim, Rameen; Lawrence, Michael S; Getz, Gad; Lane, Andrew A
2017-01-01
There is a striking and unexplained male predominance across many cancer types. A subset of X-chromosome genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative 'escape from X-inactivation tumor-suppressor' (EXITS) genes, we examined somatic alterations from >4,100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) X-chromosome genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) harbored loss-of-function mutations more frequently in males (based on a false discovery rate < 0.1), in comparison to zero of 18,055 autosomal and PAR genes (Fisher's exact P < 0.0001). Male-biased mutations in genes that escape X-inactivation were observed in combined analysis across many cancers and in several individual tumor types, suggesting a generalized phenomenon. We conclude that biallelic expression of EXITS genes in females explains a portion of the reduced cancer incidence in females as compared to males across a variety of tumor types.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Salivary agglutinin/DMBT1SAG expression is up-regulated in the presence of salivary gland tumors
DEFF Research Database (Denmark)
Bikker, F J; van der Wal, J E; Ligtenberg, A J M
2004-01-01
Salivary agglutinin (SAG) is encoded by the gene Deleted in Malignant Brain Tumors 1 (DMBT1) and represents the salivary variant of DMBT1 (DMBT1(SAG)). While SAG is a bona fide anti-caries factor, DMBT1 was proposed as a candidate tumor-suppressor for brain, digestive tract, and lung cancer. Thou...
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
[Correlation analysis of G870A CCND1 gene polymorphism with digestive system tumors].
Yang, Shu-Min; Shi, Ya-Lin
2016-11-20
To study the correlation of G870A CCND1 gene polymorphism and digestive system tumors. From August 2010 to August 2014, 164 digestive system cancer patients (including 82 patients with gastric cancer and 82 with colorectal cancer) and 82 healthy subjects (control group) were examined with PCR-restriction fragment length polymorphism (PCR-RFLP). The distribution of CCND1 gene G870A frequency in the 3 groups and its association with tumor staging and grading were analyzed. The frequencies of the GG, GA and AA genotypes in G870A CCND1 gene loci in patients with gastric cancer and colorectal cancer differed significantly from those in the control group (Pdigestive system tumors (Pdigestive system cancer risk than the GG genotype (Pdigestive system tumors. The allele A is associated with an increased risk of digestive system tumors and correlated with the tumor differentiation and staging of the tumor.
Cytokine Gene Polymorphisms in Egyptian Cases with Brain Tumors
International Nuclear Information System (INIS)
Badr El-Din, N.K.; Abdel-Hady, E.K.; Salem, F.K.; Settin, A.; ALI, N.
2009-01-01
Background: Cytokines are proposed to play important roles in brain tumor biology as well as neuro degeneration or impaired neuronal function. Objectives: This work aimed to check the association of polymorphisms of cytokine genes in Egyptian cases with brain tumors. Methods: This work included 45 cases affected by brain tumors diagnosed as 24 benign and 21 malignant. Their median age was 45 years, and they were 20 males and 25 females. These cases were taken randomly from the Neurosurgery Department of Mansoura University Hospital, Egypt. Case genotypes were compared to 98 healthy unrelated controls from the same locality. DNA was amplified using PCR utilizing sequence specific primers (SSP) for detection of polymorphisms related to TNF-a-308 (G/A), IL-10-1082 (G/A), IL-6-174 (G/C) and IL-1Ra (VNTR) genes. Results: Cases affected with benign brain tumors showed a significant higher frequency of IL-10-1082 A/A [odds ratio (OR=8.0), p<0.001] and IL-6-174 C/C (OR=6.3, p=0.002) homozygous genotypes as compared to controls. Malignant cases, on the other hand, showed significantly higher frequency of IL-6-174 C/C (OR =4.8, p=0.002) homozygous genotype and TNF-a-308 A/A (OR=4.9, p<0.001) homozygous genotype when compared to controls. In the meantime, all cases showed no significant difference regarding the distribution of IL-1Ra VNTR genotype polymorphism compared to controls. Conclusions: Cytokine gene polymorphisms showed a pattern of association with brain tumors which may have potential impact on family counseling and disease management.
Tumor Suppressor Gene-Based Nanotherapy: From Test Tube to the Clinic
Directory of Open Access Journals (Sweden)
Manish Shanker
2011-01-01
Full Text Available Cancer is a major health problem in the world. Advances made in cancer therapy have improved the survival of patients in certain types of cancer. However, the overall five-year survival has not significantly improved in the majority of cancer types. Major challenges encountered in having effective cancer therapy are development of drug resistance by the tumor cells, nonspecific cytotoxicity, and inability to affect metastatic tumors by the chemodrugs. Overcoming these challenges requires development and testing of novel therapies. One attractive cancer therapeutic approach is cancer gene therapy. Several laboratories including the authors' laboratory have been investigating nonviral formulations for delivering therapeutic genes as a mode for effective cancer therapy. In this paper the authors will summarize their experience in the development and testing of a cationic lipid-based nanocarrier formulation and the results from their preclinical studies leading to a Phase I clinical trial for nonsmall cell lung cancer. Their nanocarrier formulation containing therapeutic genes such as tumor suppressor genes when administered intravenously effectively controls metastatic tumor growth. Additional Phase I clinical trials based on the results of their nanocarrier formulation have been initiated or proposed for treatment of cancer of the breast, ovary, pancreas, and metastatic melanoma, and will be discussed.
Expression of iron-related genes in human brain and brain tumors
Directory of Open Access Journals (Sweden)
Britton Robert S
2009-04-01
Full Text Available Abstract Background Defective iron homeostasis may be involved in the development of some diseases within the central nervous system. Although the expression of genes involved in normal iron balance has been intensively studied in other tissues, little is known about their expression in the brain. We investigated the mRNA levels of hepcidin (HAMP, HFE, neogenin (NEO1, transferrin receptor 1 (TFRC, transferrin receptor 2 (TFR2, and hemojuvelin (HFE2 in normal human brain, brain tumors, and astrocytoma cell lines. The specimens included 5 normal brain tissue samples, 4 meningiomas, one medulloblastoma, 3 oligodendrocytic gliomas, 2 oligoastrocytic gliomas, 8 astrocytic gliomas, and 3 astrocytoma cell lines. Results Except for hemojuvelin, all genes studied had detectable levels of mRNA. In most tumor types, the pattern of gene expression was diverse. Notable findings include high expression of transferrin receptor 1 in the hippocampus and medulla oblongata compared to other brain regions, low expression of HFE in normal brain with elevated HFE expression in meningiomas, and absence of hepcidin mRNA in astrocytoma cell lines despite expression in normal brain and tumor specimens. Conclusion These results indicate that several iron-related genes are expressed in normal brain, and that their expression may be dysregulated in brain tumors.
Tumor suppressor gene-based nanotherapy: from test tube to the clinic.
Shanker, Manish; Jin, Jiankang; Branch, Cynthia D; Miyamoto, Shinya; Grimm, Elizabeth A; Roth, Jack A; Ramesh, Rajagopal
2011-01-01
Cancer is a major health problem in the world. Advances made in cancer therapy have improved the survival of patients in certain types of cancer. However, the overall five-year survival has not significantly improved in the majority of cancer types. Major challenges encountered in having effective cancer therapy are development of drug resistance by the tumor cells, nonspecific cytotoxicity, and inability to affect metastatic tumors by the chemodrugs. Overcoming these challenges requires development and testing of novel therapies. One attractive cancer therapeutic approach is cancer gene therapy. Several laboratories including the authors' laboratory have been investigating nonviral formulations for delivering therapeutic genes as a mode for effective cancer therapy. In this paper the authors will summarize their experience in the development and testing of a cationic lipid-based nanocarrier formulation and the results from their preclinical studies leading to a Phase I clinical trial for nonsmall cell lung cancer. Their nanocarrier formulation containing therapeutic genes such as tumor suppressor genes when administered intravenously effectively controls metastatic tumor growth. Additional Phase I clinical trials based on the results of their nanocarrier formulation have been initiated or proposed for treatment of cancer of the breast, ovary, pancreas, and metastatic melanoma, and will be discussed.
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.
Directory of Open Access Journals (Sweden)
Jianqing Pan
Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Re, G G; Willingham, M C; el Bahtimi, R; Brownlee, N A; Hazen-Martin, D J; Garvin, A J
1997-02-01
One reason for the failure of chemotherapy is the overexpression of the multidrug resistance gene, MDR1. The product of this gene is the multidrug transporter P-glycoprotein, an ATP-dependent pump that extrudes drugs from the cytoplasm. Some tumors inherently express P-glycoprotein, whereas others acquire the ability to do so after exposure to certain chemotherapeutic agents, often by the mechanism of gene amplification. Classical Wilms' tumors (nephroblastoma) typically respond to therapy and have a good prognosis. On the contrary, anaplastic Wilms' tumors are generally refractory to chemotherapy. These anaplastic variants are rare (4.5% of all Wilms' tumors reported in the United States), aggressive, and often fatal forms of tumor, which are commonly thought to result from the progression of classical Wilms' tumors. To investigate the basis for this differential response to therapy, we examined a number of classical and anaplastic Wilms' tumors for the expression of the MDR1 gene by immunohistochemical and mRNA analysis. Classical Wilms' tumors consistently did not express P-glycoprotein except in areas of tubular differentiation, as in normal kidney. Similarly, two of three anaplastic tumors failed to show P-glycoprotein expression. In contrast, cultured cells derived from a third anaplastic tumor, W4, exhibited strong P-glycoprotein expression and were drug resistant in vitro. Southern analysis revealed that W4 cells contained a single copy of the MDR1 gene per haploid genome similar to normal cells, demonstrating that the overexpression of MDR1 was not caused by gene amplification. Transcriptional activation of the MDR1 gene would be in keeping with the concept that p53 might act as a transcriptional repressor of the MDR1 gene.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Glucosylated polyethylenimine as a tumor-targeting gene carrier.
Park, In-Kyu; Cook, Seung-Eun; Kim, You-Kyoung; Kim, Hyun-Woo; Cho, Myung-Haing; Jeong, Hwan-Jeong; Kim, Eun-Mi; Nah, Jae-Woon; Bom, Hee-Seung; Cho, Chong-Su
2005-11-01
Glucosylated polyethylenimine (GPEI) was synthesized as a tumor-targeting gene carrier through facilitative glucose metabolism by tumor glucose transporter. Particle sizes of GPEI/DNA complex increased in proportion to glucose content of GPEI, whereas surface charge of the complex was not dependent on glucosylation, partially due to inefficient shielding of the short hydrophilic group introduced. GPEI with higher glucosylation (36 mol-%) had no cytotoxic effect on cells even at polymer concentrations higher than 200 microg/mL. Compared to unglucosylated PEI, glucosylation induced less than one-order decrease of transfection efficiency. Transfection of GPEI/DNA complex into tumor cells possibly occurred through specific interaction between glucose-related cell receptors and glucose moiety of GPEI. Gamma imaging technique revealed GPEI/DNA complex was distributed in liver, spleen, and tumors.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Alterations in the K-ras and p53 genes in rat lung tumors
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others
1997-06-01
Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.
The Multi-Purpose Tool of Tumor Immunotherapy: Gene-Engineered T Cells.
Mo, Zeming; Du, Peixin; Wang, Guoping; Wang, Yongsheng
2017-01-01
A detailed summary of the published clinical trials of chimeric antigen receptor T cells (CAR-T) and TCR-transduced T cells (TCR-T) was constructed to understand the development trend of adoptive T cell therapy (ACT). In contrast to TCR-T, the number of CAR-T clinical trials has increased dramatically in China in the last three years. The ACT seems to be very prosperous. But, the multidimensional interaction of tumor, tumor associated antigen (TAA) and normal tissue exacerbates the uncontrolled outcome of T cells gene therapy. It reminds us the importance that optimizing treatment security to prevent the fatal serious adverse events. How to balance the safety and effectiveness of the ACT? At least six measures can potentially optimize the safety of ACT. At the same time, with the application of gene editing techniques, more endogenous receptors are disrupted while more exogenous receptors are expressed on T cells. As a multi-purpose tool of tumor immunotherapy, gene-engineered T cells (GE-T) have been given different functional weapons. A network which is likely to link radiation therapy, tumor vaccines, CAR-T and TCR-T is being built. Moreover, more and more evidences indicated that the combination of the ACT and other therapies would further enhance the anti-tumor capacity of the GE-T.
Germline Mutations of Inhibins in Early-Onset Ovarian Epithelial Tumors
Tournier, Isabelle; Marlin, Régine; Walton, Kelly; Charbonnier, Françoise; Coutant, Sophie; Théry, Jean-Christophe; Charbonnier, Camille; Spurrell, Cailyn; Vezain, Myriam; Ippolito, Lorena; Bougeard, Gaëlle; Roman, Horace; Tinat, Julie; Sabourin, Jean-Christophe; Stoppa-Lyonnet, Dominique; Caron, Olivier; Bressac-de Paillerets, Brigitte; Vaur, Dominique; King, Mary-Claire; Harrison, Craig; Frebourg, Thierry
2014-01-01
To identify novel genetic bases of early-onset epithelial ovarian tumors, we used the trio exome sequencing strategy in a patient without familial history of cancer who presented metastatic serous ovarian adenocarcinomas at 21 years of age. We identified a single de novo mutation (c.1157A>G/p.Asn386Ser) within the INHBA gene encoding the βA-subunit of inhibins/activins, which play a key role in ovarian development. In vitro, this mutation alters the ratio of secreted activins and inhibins. In a second patient with early-onset serous borderline papillary cystadenoma, we identified an unreported germline mutation (c.179G>T/p.Arg60Leu) of the INHA gene encoding the α-subunit, the partner of the βA-subunit. This mutation also alters the secreted activin/inhibin ratio, by disrupting both inhibin A and inhibin B biosynthesis. In a cohort of 62 cases, we detected an additional unreported germline mutation of the INHBA gene (c.839G>A/p.Gly280Glu). Our results strongly suggest that inhibin mutations contribute to the genetic determinism of epithelial ovarian tumors. PMID:24302632
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Novel fusion genes and chimeric transcripts in ependymal tumors
DEFF Research Database (Denmark)
Olsen, Thale Kristin; Panagopoulos, Ioannis; Gorunova, Ludmila
2016-01-01
with subsequent Sanger sequencing was used to validate the potential fusions. Fluorescent in situ hybridization (FISH) using locus-specific probes was also performed. A total of 841 candidate chimeric transcripts were identified in the 12 tumors, with an average of 49 unique candidate fusions per tumor. After...... infratentorial anaplastic ependymoma. Our previously reported ALK rearrangements and the RELA and YAP1 fusions found in supratentorial ependymomas were until now the only known fusion genes present in ependymal tumors. The chimeric transcripts presented here are the first to be reported in infratentorial...
Santos, Eliane Macedo Sobrinho; Santos, Hércules Otacílio; Dos Santos Dias, Ivoneth; Santos, Sérgio Henrique; Batista de Paula, Alfredo Maurício; Feltenberger, John David; Sena Guimarães, André Luiz; Farias, Lucyana Conceição
2016-01-01
Pathogenesis of odontogenic tumors is not well known. It is important to identify genetic deregulations and molecular alterations. This study aimed to investigate, through bioinformatic analysis, the possible genes involved in the pathogenesis of ameloblastoma (AM) and keratocystic odontogenic tumor (KCOT). Genes involved in the pathogenesis of AM and KCOT were identified in GeneCards. Gene list was expanded, and the gene interactions network was mapped using the STRING software. "Weighted number of links" (WNL) was calculated to identify "leader genes" (highest WNL). Genes were ranked by K-means method and Kruskal-Wallis test was used (Preview data was used to corroborate the bioinformatics data. CDK1 was identified as leader gene for AM. In KCOT group, results show PCNA and TP53 . Both tumors exhibit a power law behavior. Our topological analysis suggested leader genes possibly important in the pathogenesis of AM and KCOT, by clustering coefficient calculated for both odontogenic tumors (0.028 for AM, zero for KCOT). The results obtained in the scatter diagram suggest an important relationship of these genes with the molecular processes involved in AM and KCOT. Ontological analysis for both AM and KCOT demonstrated different mechanisms. Bioinformatics analyzes were confirmed through literature review. These results may suggest the involvement of promising genes for a better understanding of the pathogenesis of AM and KCOT.
Differential Gene Expression in Primary Breast Tumors Associated with Lymph Node Metastasis
International Nuclear Information System (INIS)
Ellsworth, R.E.; Field, L.A.; Kane, J.L.; Love, B.; Hooke, J.A.; Shriver, C.D.
2011-01-01
Lymph node status remains one of the most useful prognostic indicators in breast cancer; however, current methods to assess nodal status disrupt the lymphatic system and may lead to secondary complications. Identification of molecular signatures discriminating lymph node-positive from lymph node-negative primary tumors would allow for stratification of patients requiring surgical assesment of lymph nodes. Primary breast tumors from women with negative (n=41) and positive (n=35) lymph node status matched for possible confounding factors were subjected to laser micro dissection and gene expression data generated. Although ANOVA analysis (P 1.5) revealed 13 differentially expressed genes, hierarchical clustering classified 90% of node-negative but only 66% of node-positive tumors correctly. The inability to derive molecular profiles of metastasis in primary tumors may reflect tumor heterogeneity, paucity of cells within the primary tumor with metastatic potential, influence of the microenvironment, or inherited host susceptibility to metastasis
Differential Gene Expression in Primary Breast Tumors Associated with Lymph Node Metastasis
Ellsworth, Rachel E.; Field, Lori A.; Love, Brad; Kane, Jennifer L.; Hooke, Jeffrey A.; Shriver, Craig D.
2011-01-01
Lymph node status remains one of the most useful prognostic indicators in breast cancer; however, current methods to assess nodal status disrupt the lymphatic system and may lead to secondary complications. Identification of molecular signatures discriminating lymph node-positive from lymph node-negative primary tumors would allow for stratification of patients requiring surgical assesment of lymph nodes. Primary breast tumors from women with negative (n = 41) and positive (n = 35) lymph node status matched for possible confounding factors were subjected to laser microdissection and gene expression data generated. Although ANOVA analysis (P 1.5) revealed 13 differentially expressed genes, hierarchical clustering classified 90% of node-negative but only 66% of node-positive tumors correctly. The inability to derive molecular profiles of metastasis in primary tumors may reflect tumor heterogeneity, paucity of cells within the primary tumor with metastatic potential, influence of the microenvironment, or inherited host susceptibility to metastasis. PMID:22295210
Differential Gene Expression in Primary Breast Tumors Associated with Lymph Node Metastasis
Directory of Open Access Journals (Sweden)
Rachel E. Ellsworth
2011-01-01
Full Text Available Lymph node status remains one of the most useful prognostic indicators in breast cancer; however, current methods to assess nodal status disrupt the lymphatic system and may lead to secondary complications. Identification of molecular signatures discriminating lymph node-positive from lymph node-negative primary tumors would allow for stratification of patients requiring surgical assesment of lymph nodes. Primary breast tumors from women with negative (=41 and positive (=35 lymph node status matched for possible confounding factors were subjected to laser microdissection and gene expression data generated. Although ANOVA analysis (1.5 revealed 13 differentially expressed genes, hierarchical clustering classified 90% of node-negative but only 66% of node-positive tumors correctly. The inability to derive molecular profiles of metastasis in primary tumors may reflect tumor heterogeneity, paucity of cells within the primary tumor with metastatic potential, influence of the microenvironment, or inherited host susceptibility to metastasis.
Study on radiation-inducible genes
Energy Technology Data Exchange (ETDEWEB)
Lim, Sang Yong; Kim, Dong Ho; Joe, Min Ho; Park, Hae Jun; Song, Hyu Npa
2012-01-15
Radiation-inducible genes of E. coli, which is a model strain for bacterial study, and Salmonella, which is a typical strain for pathogenic bacteria were compared through omic analysis. Heat shock response genes and prophage genes were induced by radiation in Salmonella, not in E. coli. Among prophage genes tested, STM2628 showed the highest activation by radiation, and approximately 1 kb promoter region was turned out to be necessary for radiation response. To screen an artificial promoter showing activation by 2 Gy, the high-throughput screening method using fluorescent MUG substrate was established. The use of bacteria as anticancer agents has attracted interest. In this study, we tried to develop tumor targeting bacteria in which the radiation-inducible promoter activate a transgene encoding a cytotoxic protein. To do this, a tumor-targeting hfq Salmonella mutant strain was constructed, and we found that its virulence decreased. For outward secretion of anticancer protein produced inside bacteria, the signal peptide of SspH1 was determined and the signal peptide was proven to be able to secrete an anticancer protein. Tumor xenograft mouse model was secured, which can be used for efficiency evaluation of bacterial tumor therapy.
Study on radiation-inducible genes
International Nuclear Information System (INIS)
Lim, Sang Yong; Kim, Dong Ho; Joe, Min Ho; Park, Hae Jun; Song, Hyu Npa
2012-01-01
Radiation-inducible genes of E. coli, which is a model strain for bacterial study, and Salmonella, which is a typical strain for pathogenic bacteria were compared through omic analysis. Heat shock response genes and prophage genes were induced by radiation in Salmonella, not in E. coli. Among prophage genes tested, STM2628 showed the highest activation by radiation, and approximately 1 kb promoter region was turned out to be necessary for radiation response. To screen an artificial promoter showing activation by 2 Gy, the high-throughput screening method using fluorescent MUG substrate was established. The use of bacteria as anticancer agents has attracted interest. In this study, we tried to develop tumor targeting bacteria in which the radiation-inducible promoter activate a transgene encoding a cytotoxic protein. To do this, a tumor-targeting hfq Salmonella mutant strain was constructed, and we found that its virulence decreased. For outward secretion of anticancer protein produced inside bacteria, the signal peptide of SspH1 was determined and the signal peptide was proven to be able to secrete an anticancer protein. Tumor xenograft mouse model was secured, which can be used for efficiency evaluation of bacterial tumor therapy
PLGA Nanoparticles for Ultrasound-Mediated Gene Delivery to Solid Tumors
Directory of Open Access Journals (Sweden)
Marxa Figueiredo
2012-01-01
Full Text Available This paper focuses on novel approaches in the field of nanotechnology-based carriers utilizing ultrasound stimuli as a means to spatially target gene delivery in vivo, using nanoparticles made with either poly(lactic-co-glycolic acid (PLGA or other polymers. We specifically discuss the potential for gene delivery by particles that are echogenic (amenable to destruction by ultrasound composed either of polymers (PLGA, polystyrene or other contrast agent materials (Optison, SonoVue microbubbles. The use of ultrasound is an efficient tool to further enhance gene delivery by PLGA or other echogenic particles in vivo. Echogenic PLGA nanoparticles are an attractive strategy for ultrasound-mediated gene delivery since this polymer is currently approved by the US Food and Drug Administration for drug delivery and diagnostics in cancer, cardiovascular disease, and also other applications such as vaccines and tissue engineering. This paper will review recent successes and the potential of applying PLGA nanoparticles for gene delivery, which include (a echogenic PLGA used with ultrasound to enhance local gene delivery in tumors or muscle and (b PLGA nanoparticles currently under development, which could benefit in the future from ultrasound-enhanced tumor targeted gene delivery.
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
The Quest for the 1p36 Tumor Suppressor
Bagchi, Anindya; Mills, Alea A.
2010-01-01
Genomic analyses of late-stage human cancers have uncovered deletions encompassing 1p36, thereby providing an extensive body of literature supporting the idea that a potent tumor suppressor resides in this interval. Although a number of genes have been proposed as 1p36 candidate tumor suppressors, convincing evidence that their encoded products protect from cancer has been scanty. A recent functional study identified CHD5 as a novel tumor suppressor mapping to 1p36. Here we discuss evidence supporting CHD5’s tumor suppressive role. Together, these findings suggest that strategies designed to enhance CHD5 activity could provide novel approaches for treating a broad range of human malignancies. PMID:18413720
International Nuclear Information System (INIS)
Breton, E.; Goetz, Ch.; Aubertin, G.; Constantinesco, A.; Choquet, Ph.; Kintz, J.; Accart, N.; Grellier, B.; Erbs, Ph.; Rooke, R.
2010-01-01
Purpose The aim of this study was to monitor in vivo with low field MRI growth of a murine ortho-topic glioma model following a suicide gene therapy. Methods The gene therapy consisted in the stereotactic injection in the mice brain of a modified vaccinia virus Ankara (M.V.A.) vector encoding for a suicide gene (FCU1) that transforms a non toxic pro-drug 5-fluoro-cytosine (5-F.C.) to its highly cytotoxic derivatives 5-fluorouracil (5-F.U.) and 5-fluoro-uridine-5 monophosphate (5-F.U.M.P.). Using a warmed-up imaging cell, sequential 3D T1 and T2 0.1T MRI brain examinations were performed on 16 Swiss female nu/nu mice bearing ortho-topic human glioblastoma (U 87-MG cells). The 6-week in vivo MRI follow-up consisted in a weekly measurement of the intracerebral tumor volume leading to a total of 65 examinations. Mice were divided in four groups: sham group (n = 4), sham group treated with 5-F.C. only (n = 4), sham group with injection of M.V.A.-FCU1 vector only (n = 4), therapy group administered with M.V.A.-FCU1 vector and 5-F.C. (n = 4). Measurements of tumor volumes were obtained after manual segmentation of T1- and T2-weighted images. Results Intra-observer and inter-observer tumor volume measurements show no significant differences. No differences were found between T1 and T2 volume tumor doubling times between the three sham groups. A significant statistical difference (p < 0.05) in T1 and T2 volume tumor doubling times between the three sham groups and the animals treated with the intratumoral injection of M.V.A.-FCU1 vector in combination with 2 weeks per os 5-F.C. administration was demonstrated. Conclusion Preclinical low field MRI was able to monitor efficacy of suicide gene therapy in delaying the tumor growth in an in vivo mouse model of ortho-topic glioblastoma. (authors)
Oncogenic driver genes and the inflammatory microenvironment dictate liver tumor phenotype
DEFF Research Database (Denmark)
Matter, Matthias S; Marquardt, Jens U; Andersen, Jesper B
2016-01-01
The majority of hepatocellular carcinoma (HCC) develops in the background of chronic liver inflammation caused by viral hepatitis and alcoholic or non-alcoholic steatohepatitis. However, the impact of different types of chronic inflammatory microenvironments on the phenotypes of tumors generated...... with transcriptome profiles from human HCCs further demonstrated that AKT-CAT tumors generated in the context of chronic liver inflammation showed enrichment of poor prognosis gene sets or decrease of good prognosis gene sets. In contrast, DDC had a more subtle effect on AKT-NRAS(G12V) tumors and primarily enhanced...... by distinct oncogenes is largely unresolved. To address this issue, we generated murine liver tumors by constitutively active AKT-1 (AKT) and β-catenin (CAT) followed by induction of chronic liver inflammation by 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) and carbon tetrachloride (CCl4 ). Also...
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Gene trapping identifies a putative tumor suppressor and a new inducer of cell migration
International Nuclear Information System (INIS)
Guardiola-Serrano, Francisca; Haendeler, Judith; Lukosz, Margarete; Sturm, Karsten; Melchner, Harald von; Altschmied, Joachim
2008-01-01
Tumor necrosis factor alpha (TNFα) is a pleiotropic cytokine involved in apoptotic cell death, cellular proliferation, differentiation, inflammation, and tumorigenesis. In tumors it is secreted by tumor associated macrophages and can have both pro- and anti-tumorigenic effects. To identify genes regulated by TNFα, we performed a gene trap screen in the mammary carcinoma cell line MCF-7 and recovered 64 unique, TNFα-induced gene trap integration sites. Among these were the genes coding for the zinc finger protein ZC3H10 and for the transcription factor grainyhead-like 3 (GRHL3). In line with the dual effects of TNFα on tumorigenesis, we found that ZC3H10 inhibits anchorage independent growth in soft agar suggesting a tumor suppressor function, whereas GRHL3 strongly stimulated the migration of endothelial cells which is consistent with an angiogenic, pro-tumorigenic function
Directory of Open Access Journals (Sweden)
Luke A. Wiley
2011-07-01
We previously found that lenses lacking the Acvr1 gene, which encodes a bone morphogenetic protein (BMP receptor, had abnormal proliferation and cell death in epithelial and cortical fiber cells. We tested whether the tumor suppressor protein p53 (encoded by Trp53 affected this phenotype. Acvr1 conditional knockout (Acvr1CKO mouse fiber cells had increased numbers of nuclei that stained for p53 phosphorylated on serine 15, an indicator of p53 stabilization and activation. Deletion of Trp53 rescued the Acvr1CKO cell death phenotype in embryos and reduced Acvr1-dependent apoptosis in postnatal lenses. However, deletion of Trp53 alone increased the number of fiber cells that failed to withdraw from the cell cycle. Trp53CKO and Acvr1;Trp53DCKO (double conditional knockout, but not Acvr1CKO, lenses developed abnormal collections of cells at the posterior of the lens that resembled posterior subcapsular cataracts. Cells from human posterior subcapsular cataracts had morphological and molecular characteristics similar to the cells at the posterior of mouse lenses lacking Trp53. In Trp53CKO lenses, cells in the posterior plaques did not proliferate but, in Acvr1;Trp53DCKO lenses, many cells in the posterior plaques continued to proliferate, eventually forming vascularized tumor-like masses at the posterior of the lens. We conclude that p53 protects the lens against posterior subcapsular cataract formation by suppressing the proliferation of fiber cells and promoting the death of any fiber cells that enter the cell cycle. Acvr1 acts as a tumor suppressor in the lens. Enhancing p53 function in the lens could contribute to the prevention of steroid- and radiation-induced posterior subcapsular cataracts.
Molecular analysis of aniridia patients for deletions involving the Wilms' tumor gene
Drechsler, M.; Meijers-Heijboer, E. J.; Schneider, S.; Schurich, B.; Grond-Ginsbach, C.; Tariverdian, G.; Kantner, G.; Blankenagel, A.; Kaps, D.; Schroeder-Kurth, T.
1994-01-01
A human aniridia candidate (AN) gene on chromosome 11p13 has been cloned and characterized. The AN gene is the second cloned gene of the contiguous genes syndrome WAGR (Wilms' tumor, aniridia, genitourinary malformations, mental retardation) on chromosome 11p13, WT1 being the first gene cloned.
Energy Technology Data Exchange (ETDEWEB)
Niwa, Ohtsura; Enoki, Yoshitaka; Yokoro, Kenjiro
1989-03-01
We examined expression of the c-myc gene by the dot blot hybridization of total cellular RNA from mouse primary tumors induced by chemicals and radiations. Expression of the c-myc gene was found to be elevated in 69 cases among 177 independently induced tumors of 12 different types. DNA from tumors overexpressing the myc gene was analyzed by Southern blotting. No case of rearrangement was detected. However, amplification of the c-myc gene was found in 7 cases of primary sarcomas. These included 4 cases out of 24 methylcholanthrene-induced sarcomas and 3 cases out of 7 /alpha/-tocopherol-induced sacromas. We also analyzed 8 cases of sarcomas induced by radiations, but could not find changes in the gene structure of the c-myc gene. Thus, our data indicate tumor type specificity and agent specificity of c-myc gene amplification. (author).
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Identification of Genetic Susceptibility Loci for Colorectal Tumors in a Genome-Wide Meta-analysis.
Peters, Ulrike; Jiao, Shuo; Schumacher, Fredrick R; Hutter, Carolyn M; Aragaki, Aaron K; Baron, John A; Berndt, Sonja I; Bézieau, Stéphane; Brenner, Hermann; Butterbach, Katja; Caan, Bette J; Campbell, Peter T; Carlson, Christopher S; Casey, Graham; Chan, Andrew T; Chang-Claude, Jenny; Chanock, Stephen J; Chen, Lin S; Coetzee, Gerhard A; Coetzee, Simon G; Conti, David V; Curtis, Keith R; Duggan, David; Edwards, Todd; Fuchs, Charles S; Gallinger, Steven; Giovannucci, Edward L; Gogarten, Stephanie M; Gruber, Stephen B; Haile, Robert W; Harrison, Tabitha A; Hayes, Richard B; Henderson, Brian E; Hoffmeister, Michael; Hopper, John L; Hudson, Thomas J; Hunter, David J; Jackson, Rebecca D; Jee, Sun Ha; Jenkins, Mark A; Jia, Wei-Hua; Kolonel, Laurence N; Kooperberg, Charles; Küry, Sébastien; Lacroix, Andrea Z; Laurie, Cathy C; Laurie, Cecelia A; Le Marchand, Loic; Lemire, Mathieu; Levine, David; Lindor, Noralane M; Liu, Yan; Ma, Jing; Makar, Karen W; Matsuo, Keitaro; Newcomb, Polly A; Potter, John D; Prentice, Ross L; Qu, Conghui; Rohan, Thomas; Rosse, Stephanie A; Schoen, Robert E; Seminara, Daniela; Shrubsole, Martha; Shu, Xiao-Ou; Slattery, Martha L; Taverna, Darin; Thibodeau, Stephen N; Ulrich, Cornelia M; White, Emily; Xiang, Yongbing; Zanke, Brent W; Zeng, Yi-Xin; Zhang, Ben; Zheng, Wei; Hsu, Li
2013-04-01
Heritable factors contribute to the development of colorectal cancer. Identifying the genetic loci associated with colorectal tumor formation could elucidate the mechanisms of pathogenesis. We conducted a genome-wide association study that included 14 studies, 12,696 cases of colorectal tumors (11,870 cancer, 826 adenoma), and 15,113 controls of European descent. The 10 most statistically significant, previously unreported findings were followed up in 6 studies; these included 3056 colorectal tumor cases (2098 cancer, 958 adenoma) and 6658 controls of European and Asian descent. Based on the combined analysis, we identified a locus that reached the conventional genome-wide significance level at less than 5.0 × 10(-8): an intergenic region on chromosome 2q32.3, close to nucleic acid binding protein 1 (most significant single nucleotide polymorphism: rs11903757; odds ratio [OR], 1.15 per risk allele; P = 3.7 × 10(-8)). We also found evidence for 3 additional loci with P values less than 5.0 × 10(-7): a locus within the laminin gamma 1 gene on chromosome 1q25.3 (rs10911251; OR, 1.10 per risk allele; P = 9.5 × 10(-8)), a locus within the cyclin D2 gene on chromosome 12p13.32 (rs3217810 per risk allele; OR, 0.84; P = 5.9 × 10(-8)), and a locus in the T-box 3 gene on chromosome 12q24.21 (rs59336; OR, 0.91 per risk allele; P = 3.7 × 10(-7)). In a large genome-wide association study, we associated polymorphisms close to nucleic acid binding protein 1 (which encodes a DNA-binding protein involved in DNA repair) with colorectal tumor risk. We also provided evidence for an association between colorectal tumor risk and polymorphisms in laminin gamma 1 (this is the second gene in the laminin family to be associated with colorectal cancers), cyclin D2 (which encodes for cyclin D2), and T-box 3 (which encodes a T-box transcription factor and is a target of Wnt signaling to β-catenin). The roles of these genes and their products in cancer pathogenesis warrant further
[HMGA proteins and their genes as a potential neoplastic biomarkers].
Balcerczak, Ewa; Balcerczak, Mariusz; Mirowski, Marek
2005-01-01
HMGA proteins and their genes are described in this article. HMGA proteins reveal ability to bind DNA in AT-rich regions, which are characteristic for gene promoter sequences. This interaction lead to gene silencing or their overexpression. In normal tissue HMGA proteins level is low or even undetectable. During embriogenesis their level is increasing. High HMGA proteins level is characteristic for tumor phenotype of spontaneous and experimental malignant neoplasms. High HMGA proteins expression correlate with bad prognostic factors and with metastases formation. HMGA genes expression can be used as a marker of tumor progression. Present studies connected with tumor gene therapy based on HMGA proteins sythesis inhibition by the use of viral vectors containing gene encoding these proteins in antisence orientation, as well as a new potential anticancer drugs acting as crosslinkers between DNA and HMGA proteins suggest their usefulness as a targets in cancer therapy.
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
Transcriptional profiles of SHH pathway genes in keratocystic odontogenic tumor and ameloblastoma.
Gurgel, Clarissa Araújo Silva; Buim, Marcilei Eliza Cavichiolli; Carvalho, Kátia Cândido; Sales, Caroline Brandi Schlaepfer; Reis, Mitermayer Galvão; de Souza, Renata Oliveira; de Faro Valverde, Ludmila; de Azevedo, Roberto Almeida; Dos Santos, Jean Nunes; Soares, Fernando Augusto; Ramos, Eduardo Antônio Gonçalves
2014-09-01
Sonic hedgehog (SHH) pathway activation has been identified as a key factor in the development of many types of tumors, including odontogenic tumors. Our study examined the expression of genes in the SHH pathway to characterize their roles in the pathogenesis of keratocystic odontogenic tumors (KOT) and ameloblastomas (AB). We quantified the expression of SHH, SMO, PTCH1, SUFU, GLI1, CCND1, and BCL2 genes by qPCR in a total of 23 KOT, 11 AB, and three non-neoplastic oral mucosa (NNM). We also measured the expression of proteins related to this pathway (CCND1 and BCL2) by immunohistochemistry. We observed overexpression of SMO, PTCH1, GLI1, and CCND1 genes in both KOT (23/23) and AB (11/11). However, we did not detect expression of the SHH gene in 21/23 KOT and 10/11 AB tumors. Low levels of the SUFU gene were expressed in KOT (P = 0.0199) and AB (P = 0.0127) relative to the NNM. Recurrent KOT exhibited high levels of SMO (P = 0.035), PTCH1 (P = 0.048), CCND1 (P = 0.048), and BCL2 (P = 0.045) transcripts. Using immunolabeling of CCND1, we observed no statistical difference between primary and recurrent KOT (P = 0.8815), sporadic and NBCCS-KOT (P = 0.7688), and unicystic and solid AB (P = 0.7521). Overexpression of upstream (PTCH1 and SMO) and downstream (GLI1, CCND1 and BCL2) genes in the SHH pathway leads to the constitutive activation of this pathway in KOT and AB and may suggest a mechanism for the development of these types of tumors. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Correlation of SHOX2 Gene Amplification and DNA Methylation in Lung Cancer Tumors
International Nuclear Information System (INIS)
Schneider, Katja U; Liebenberg, Volker; Kneip, Christoph; Seegebarth, Anke; Erdogan, Fikret; Rappold, Gudrun; Schmidt, Bernd; Dietrich, Dimo; Fleischhacker, Michael; Leschber, Gunda; Merk, Johannes; Schäper, Frank; Stapert, Henk R; Vossenaar, Erik R; Weickmann, Sabine
2011-01-01
DNA methylation in the SHOX2 locus was previously used to reliably detect lung cancer in a group of critical controls, including 'cytologically negative' samples with no visible tumor cell content, at a high specificity based on the analysis of bronchial lavage samples. This study aimed to investigate, if the methylation correlates with SHOX2 gene expression and/or copy number alterations. An amplification of the SHOX2 gene locus together with the observed tumor-specific hypermethylation might explain the good performance of this marker in bronchial lavage samples. SHOX2 expression, gene copy number and DNA methylation were determined in lung tumor tissues and matched morphologically normal adjacent tissues (NAT) from 55 lung cancer patients. Quantitative HeavyMethyl (HM) real-time PCR was used to detect SHOX2 DNA methylation levels. SHOX2 expression was assayed with quantitative real-time PCR, and copy numbers alterations were measured with conventional real-time PCR and array CGH. A hypermethylation of the SHOX2 locus in tumor tissue as compared to the matched NAT from the same patient was detected in 96% of tumors from a group of 55 lung cancer patients. This correlated highly significantly with the frequent occurrence of copy number amplification (p < 0.0001), while the expression of the SHOX2 gene showed no difference. Frequent gene amplification correlated with hypermethylation of the SHOX2 gene locus. This concerted effect qualifies SHOX2 DNA methylation as a biomarker for lung cancer diagnosis, especially when sensitive detection is needed, i.e. in bronchial lavage or blood samples
Physical interaction between Wilms tumor 1 and p73 proteins modulates their functions
Scharnhorst, V.; Dekker, P.; Eb, van der A.J.; Jochemsen, A.G.
2014-01-01
The WT1 gene, which is heterozygously mutated or deleted in congenital anomaly syndromes and homozygously mutated in about 15% of all Wilms tumors, encodes tissue-specific developmental regulators. Through alternative mRNA splicing, four main WT1 protein isoforms are synthesized. All isoforms can
Yi, Yang; Qi, Hemei; Yuan, Jimin; Wang, Rui; Weng, Shaoping; He, Jianguo; Dong, Chuanfu
2015-08-01
Cyprinid herpesvirus 3 (CyHV3) is a large double-stranded DNA virus of Alloherpesviridae family in the order Herpesvirales. It causes significant morbidity and mortality in common carp and its ornamental koi variety, and threatens the aquaculture industries worldwide. Mimicry of cytokines and cytokine receptors is a particular strategy for large DNA viruses in modulating the host immune response. Here, we report the identification and characterization of two novel viral homologues of tumor necrosis factor receptor (TNFR) encoded by CyHV3-ORF4 and -ORF12, respectively. CyHV3-ORF4 was identified as a homologue of HVEM and CyHV3-ORF12 as a homologue of TNFRSF1. Overexpression of ORF4 and ORF12 in zebrafish embryos results in embryonic lethality, morphological defects and increased apoptosis. Although we failed to identify any interaction between the two vTNFRs and their potential ligands in zebrafish TNF superfamily by yeast two-hybrid system, the expression of some genes in TNF superfamily or TNFR superfamily were mis-regulated in ORF4 or ORF12-overexpressing embryos, especially the death receptor zHDR and its cognate ligand DL1b. Further studies showed that the apoptosis induced by the both CyHV3 vTNFRs is mainly activated through the intrinsic apoptotic pathway and requires the crosstalk between the intrinsic and extrinsic apoptotic pathway. Additionally, using RT-qPCR and Western blot assays, the expression patterns of the both vTNFRs were also analyzed during CyHV3 productive infection. Collectively, this is the first functional study of two unique vTNFRs encoded by a herpesvirus infecting non-mammalian vertebrates, which may provide novel insights into viral immune regulation mechanism and the pathogenesis of CyHV3 infection. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Gene expression signature of normal cell-of-origin predicts ovarian tumor outcomes.
Directory of Open Access Journals (Sweden)
Melissa A Merritt
Full Text Available The potential role of the cell-of-origin in determining the tumor phenotype has been raised, but not adequately examined. We hypothesized that distinct cells-of-origin may play a role in determining ovarian tumor phenotype and outcome. Here we describe a new cell culture medium for in vitro culture of paired normal human ovarian (OV and fallopian tube (FT epithelial cells from donors without cancer. While these cells have been cultured individually for short periods of time, to our knowledge this is the first long-term culture of both cell types from the same donors. Through analysis of the gene expression profiles of the cultured OV/FT cells we identified a normal cell-of-origin gene signature that classified primary ovarian cancers into OV-like and FT-like subgroups; this classification correlated with significant differences in clinical outcomes. The identification of a prognostically significant gene expression signature derived solely from normal untransformed cells is consistent with the hypothesis that the normal cell-of-origin may be a source of ovarian tumor heterogeneity and the associated differences in tumor outcome.
Gene expression analysis of matched ovarian primary tumors and peritoneal metastasis
Directory of Open Access Journals (Sweden)
Malek Joel A
2012-06-01
Full Text Available Abstract Background Ovarian cancer is the most deadly gynecological cancer due to late diagnosis at advanced stage with major peritoneal involvement. To date most research has focused on primary tumor. However the prognosis is directly related to residual disease at the end of the treatment. Therefore it is mandatory to focus and study the biology of meatastatic disease that is most frequently localized to the peritoneal caivty in ovarian cancer. Methods We used high-density gene expression arrays to investigate gene expression changes between matched primary and metastatic (peritoneal lesions. Results Here we show that gene expression profiles in peritoneal metastasis are significantly different than their matched primary tumor and these changes are affected by underlying copy number variation differences among other causes. We show that differentially expressed genes are enriched in specific pathways including JAK/STAT pathway, cytokine signaling and other immune related pathways. We show that underlying copy number variations significantly affect gene expression. Indeed patients with important differences in copy number variation displayed greater gene expression differences between their primary and matched metastatic lesions. Conclusions Our analysis shows a very specific targeting at both the genomic and transcriptomic level to upregulate certain pathways in the peritoneal metastasis of ovarian cancer. Moreover, while primary tumors use certain pathways we identify distinct differences with metastatic lesions. The variation between primary and metastatic lesions should be considered in personalized treatment of ovarian cancer.
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Directory of Open Access Journals (Sweden)
Nikul Patel
2012-01-01
Full Text Available The role of aberrant DNA methylation in Ewing sarcoma is not completely understood. The methylation status of 503 genes in 52 formalin-fixed paraffin-embedded EWS tumors and 3 EWS cell lines was compared to human mesenchymal stem cell primary cultures (hMSCs using bead chip methylation analysis. Relative expression of methylated genes was assessed in 5-Aza-2-deoxycytidine-(5-AZA-treated EWS cell lines and in a cohort of primary EWS samples and hMSCs by gene expression and quantitative RT-PCR. 129 genes demonstrated statistically significant hypermethylation in EWS tumors compared to hMSCs. Thirty-six genes were profoundly methylated in EWS and unmethylated in hMSCs. 5-AZA treatment of EWS cell lines resulted in upregulation of expression of hundreds of genes including 162 that were increased by at least 2-fold. The expression of 19 of 36 candidate hypermethylated genes was increased following 5-AZA. Analysis of gene expression from an independent cohort of tumors confirmed decreased expression of six of nineteen hypermethylated genes (AXL, COL1A1, CYP1B1, LYN, SERPINE1, and VCAN. Comparing gene expression and DNA methylation analyses proved to be an effective way to identify genes epigenetically regulated in EWS. Further investigation is ongoing to elucidate the role of these epigenetic alterations in EWS pathogenesis.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
DEFF Research Database (Denmark)
Oxboel, Jytte; Binderup, Tina; Knigge, Ulrich
2009-01-01
, in neuroendocrine tumors. We used quantitative real-time PCR for measuring mRNA gene-expression of vascular endothelial growth factor (VEGF), integrin alphaV, and integrin beta3, and CD34 for a group of patients with neuroendocrine tumors (n=13). Tissue from patients with colorectal cancer liver metastases (n=14...... compared to both colorectal liver metastases (p=0.10) and normal liver tissue (p=0.06). In neuroendocrine tumors, gene-expression was highly variable of VEGF (530-fold), integrin alphaV (23-fold) and integrin beta3 (106-fold). Quantitative gene-expression levels of the key angiogenesis molecules VEGF......Anti-angiogenesis treatment is a promising new therapy for cancer that recently has also been suggested for patients with neuroendocrine tumors. The aim of the present study was therefore to investigate the level of tumor angiogenesis, and thereby the molecular basis for anti-angiogenesis treatment...
Characterization of the largest effector gene cluster of Ustilago maydis.
Directory of Open Access Journals (Sweden)
Thomas Brefort
2014-07-01
Full Text Available In the genome of the biotrophic plant pathogen Ustilago maydis, many of the genes coding for secreted protein effectors modulating virulence are arranged in gene clusters. The vast majority of these genes encode novel proteins whose expression is coupled to plant colonization. The largest of these gene clusters, cluster 19A, encodes 24 secreted effectors. Deletion of the entire cluster results in severe attenuation of virulence. Here we present the functional analysis of this genomic region. We show that a 19A deletion mutant behaves like an endophyte, i.e. is still able to colonize plants and complete the infection cycle. However, tumors, the most conspicuous symptoms of maize smut disease, are only rarely formed and fungal biomass in infected tissue is significantly reduced. The generation and analysis of strains carrying sub-deletions identified several genes significantly contributing to tumor formation after seedling infection. Another of the effectors could be linked specifically to anthocyanin induction in the infected tissue. As the individual contributions of these genes to tumor formation were small, we studied the response of maize plants to the whole cluster mutant as well as to several individual mutants by array analysis. This revealed distinct plant responses, demonstrating that the respective effectors have discrete plant targets. We propose that the analysis of plant responses to effector mutant strains that lack a strong virulence phenotype may be a general way to visualize differences in effector function.
Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N
1995-02-15
The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Ma, W; Zhang, T-F; Lu, P; Lu, S H
2014-01-01
Breast cancer is categorized into two broad groups: estrogen receptor positive (ER+) and ER negative (ER-) groups. Previous study proposed that under trastuzumab-based neoadjuvant chemotherapy, tumor initiating cell (TIC) featured ER- tumors response better than ER+ tumors. Exploration of the molecular difference of these two groups may help developing new therapeutic strategies, especially for ER- patients. With gene expression profile from the Gene Expression Omnibus (GEO) database, we performed partial least squares (PLS) based analysis, which is more sensitive than common variance/regression analysis. We acquired 512 differentially expressed genes. Four pathways were found to be enriched with differentially expressed genes, involving immune system, metabolism and genetic information processing process. Network analysis identified five hub genes with degrees higher than 10, including APP, ESR1, SMAD3, HDAC2, and PRKAA1. Our findings provide new understanding for the molecular difference between TIC featured ER- and ER+ breast tumors with the hope offer supports for therapeutic studies.
A novel gene therapy-based approach that selectively targets hypoxic regions within solid tumors
International Nuclear Information System (INIS)
Dougherty, S.T.; Dougherty, G.J.; Davis, P.D.
2003-01-01
There is compelling evidence that malignant cells present within the hypoxic regions that are commonly found within solid tumors contribute significantly to local recurrence following radiation therapy. We describe now a novel strategy designed to target such cells that exploits the differential production within hypoxic regions of the pro-angiogenic cytokine vascular endothelial cell growth factor (VEGF). Specifically, we have generated cDNA constructs that encode two distinct chimeric cell surface proteins that incorporate, respectively, the extracellular domains of the VEGF receptors Flk-1 or Flt-1, fused in frame to the membrane spanning and cytoplasmic domains of the pro-apoptotic protein Fas. Both chimeric proteins (Flk/Fas and Flt/Fas) appear stable and can be readily detected on the surface of transfected cells by Western blot and/or FACS analysis. Importantly, tumor cells expressing the chimeric proteins were rapidly killed in a dose-dependent fashion upon the addition of exogenous recombinant VEGF. Adenoviral vectors encoding Flk/Fas have been generated and shown to induce tumor cells to undergo apoptosis upon transfer to hypoxic conditions in vitro. This activity is dependent upon the endogenous production of VEGF. Studies are currently underway to test the ability of adenoviral Flk/Fas (Ad.Flk/Fas) to reduce tumor recurrence in vivo when used as an adjuvant therapy in conjunction with clinically relevant doses of ionizing radiation
Genes that cooperate with tumor promoters in transformation
International Nuclear Information System (INIS)
Colburn, N.H.; Smith, B.M.
1988-01-01
Tumor-promoting phorbol esters, like growth factors, elicit pleiotropic responses involving biochemical pathways that lead to different biological responses. Genetic variant cell lines that are resistant to mitogenic, differentiation, or transformation responses to tumor promoters have been valuable tools for understanding the molecular bases of these responses. Studies using the mouse epidermal JB6 cell lines that are sensitive or resistant to tumor promoter-induced transformation have yielded new understanding of genetic and signal transduction events involved in neoplastic transformation. The isolation and characterization of cloned mouse promotion sensitivity genes pro-1 and pro-2 is reviewed. A new activity of pro-1 has been identified: when transfected into human cancer prone basal cell nevus syndrome fibroblasts but not normal fibroblasts mouse pro-1 confers lifespan extension of these cells. Recently, we have found tat a pro-1 homolog from a library of nasopharyngeal carcinoma, but not the homolog from a normal human library, is activated for transferring promotion sensitivity. The many genetic variants for responses to tumor promoters have also proved valuable for signal transduction studies. JPB P- cells fail to show the 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced syntheses of two proteins of 15 and 16 kD seen in P+ cells. P-, P+, and TPA transformed cells show a progressive decrease in both basal and TPA-inducible levels of a protein kinase C substrate of 80 kD. P- cells are relatively resistant both to anchorage-independent transformation and to a protein band shift induced by the calcium analog lanthanum. It appears that one or more calcium-binding proteins and one or more pro genes may be critical determinants of tumor promoter-induced neoplastic transformation
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Ďuriniková, E; Kučerová, L; Matúšková, M
2014-01-01
Mesenchymal stem/stromal cells (MSC) possess a set of several fairly unique properties which make them ideally suitable both for cellular therapies and regenerative medicine. These include: relative ease of isolation, the ability to differentiate along mesenchymal and non-mesenchymal lineages in vitro and the ability to be extensively expanded in culture without a loss of differentiative capacity. MSC are not only hypoimmunogenic, but they mediate immunosuppression upon transplantation, and possess pronounced anti-inflammatory properties. They are able to home to damaged tissues, tumors, and metastases following systemic administration. The ability of homing holds big promise for tumor-targeted delivery of therapeutic agents. Viruses are naturally evolved vehicles efficiently transferring their genes into host cells. This ability made them suitable for engineering vector systems for the delivery of genes of interest. MSC can be retrovirally transduced with genes encoding prodrug-converting genes (suicide genes), which are not toxic per se, but catalyze the formation of highly toxic metabolites following the application of a nontoxic prodrug. The homing ability of MSC holds advantages compared to virus vehicles which display many shortcomings in effective delivery of the therapeutic agents. Gene therapies mediated by viruses are limited by their restricted ability to track cancer cells infiltrating into the surrounding tissue, and by their low migratory capacity towards tumor. Thus combination of cellular therapy and gene delivery is an attractive option - it protects the vector from immune surveillance, and supports targeted delivery of a therapeutic gene/protein to the tumor site.
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
Tumor suppressor genes that escape from X-inactivation contribute to cancer sex bias
Dunford, Andrew; Weinstock, David M.; Savova, Virginia; Schumacher, Steven E.; Cleary, John P.; Yoda, Akinori; Sullivan, Timothy J.; Hess, Julian M.; Gimelbrant, Alexander A.; Beroukhim, Rameen; Lawrence, Michael S.; Getz, Gad; Lane, Andrew A.
2016-01-01
There is a striking and unexplained male predominance across many cancer types. A subset of X chromosome (chrX) genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative “Escape from X-Inactivation Tumor Suppressor” (EXITS) genes, we compared somatic alterations from >4100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) chrX genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) ...
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Expression Profile of Genes Related to Drug Metabolism in Human Brain Tumors.
Directory of Open Access Journals (Sweden)
Pantelis Stavrinou
Full Text Available Endogenous and exogenous compounds as well as carcinogens are metabolized and detoxified by phase I and II enzymes, the activity of which could be crucial to the inactivation and hence susceptibility to carcinogenic factors. The expression of these enzymes in human brain tumor tissue has not been investigated sufficiently. We studied the association between tumor pathology and the expression profile of seven phase I and II drug metabolizing genes (CYP1A1, CYP1B1, ALDH3A1, AOX1, GSTP1, GSTT1 and GSTM3 and some of their proteins.Using qRT-PCR and western blotting analysis the gene and protein expression in a cohort of 77 tumors were investigated. The major tumor subtypes were meningioma, astrocytoma and brain metastases, -the later all adenocarcinomas from a lung primary.Meningeal tumors showed higher expression levels for AOX1, CYP1B1, GSTM3 and GSTP1. For AOX1, GSTM and GSTP1 this could be verified on a protein level as well. A negative correlation between the WHO degree of malignancy and the strength of expression was identified on both transcriptional and translational level for AOX1, GSTM3 and GSTP1, although the results could have been biased by the prevalence of meningiomas and glioblastomas in the inevitably bipolar distribution of the WHO grades. A correlation between the gene expression and the protein product was observed for AOX1, GSTP1 and GSTM3 in astrocytomas.The various CNS tumors show different patterns of drug metabolizing gene expression. Our results suggest that the most important factor governing the expression of these enzymes is the histological subtype and to a far lesser extent the degree of malignancy itself.
Epigenetic inactivation of CHFR in human tumors
Toyota, Minoru; Sasaki, Yasushi; Satoh, Ayumi; Ogi, Kazuhiro; Kikuchi, Takefumi; Suzuki, Hiromu; Mita, Hiroaki; Tanaka, Nobuyuki; Itoh, Fumio; Issa, Jean-Pierre J.; Jair, Kam-Wing; Schuebel, Kornel E.; Imai, Kohzoh; Tokino, Takashi
2003-01-01
Cell-cycle checkpoints controlling the orderly progression through mitosis are frequently disrupted in human cancers. One such checkpoint, entry into metaphase, is regulated by the CHFR gene encoding a protein possessing forkhead-associated and RING finger domains as well as ubiquitin–ligase activity. Although defects in this checkpoint have been described, the molecular basis and prevalence of CHFR inactivation in human tumors are still not fully understood. To address this question, w...
Alipour, Mohsen; Majidi, Asia; Molaabasi, Fatemeh; Sheikhnejad, Reza; Hosseinkhani, Saman
2018-04-30
Modulating cancer causing genes with nucleic acid based-molecules as cutting-edge approaches need efficient delivery systems to succeed in clinic. Herein, we report design and fabrication of a novel tissue penetrating Peptideticle with charge-structure switching in tumor microenvironment for an effective gene delivery. The comparative in vitro studies indicate that peptideticles identify and bind to tumor endothelial cells and efficiently penetrate into multicellular tumor spheroid. In addition, negatively charged peptideticle at pH 7.4, prevent unwanted interaction while it's sharp charge-structure switching at pH 6.2-6.9 (e.g.in tumor tissue) facilitates malignant cells penetration. More importantly, upon systemic administration into tumor bearing mice, peptideticles effectively localized in tumor tissue and delivered luciferase gene with a 200-fold higher efficiency compared to their non-pH-responsive counterparts. In conclusion, this study presents a robust nanoassembly of safe materials for high efficient tumor gene delivery. This article is protected by copyright. All rights reserved. © 2018 UICC.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
P18 tumor suppressor gene and progression of oligodendrogliomas to anaplasia.
He, J; Hoang-Xuan, K; Marie, Y; Leuraud, P; Mokhtari, K; Kujas, M; Delattre, J Y; Sanson, M
2000-09-26
P18INK4C is a good candidate to be the tumor suppressor gene involved in oligodendrogliomas on 1p32. Loss of heterozygosity on 1p, mutation(s), homozygous deletion(s), and expression of p18 in 30 oligodendroglial tumors were investigated. Loss of heterozygosity on 1p was found in 15 tumors. A p18 mutation was found at an recurrence of an anaplastic oligodendroglioma, but not in the primary, low-grade tumor. No homozygous deletions were found and p18 was expressed in all cases. These results show that p18 alteration is involved in tumor progression in a subset of oligodendrogliomas.
Expression of the tumor suppressor genes NF2, 4.1B, and TSLC1 in canine meningiomas.
Dickinson, P J; Surace, E I; Cambell, M; Higgins, R J; Leutenegger, C M; Bollen, A W; LeCouteur, R A; Gutmann, D H
2009-09-01
Meningiomas are common primary brain tumors in dogs; however, little is known about the molecular genetic mechanisms involved in their tumorigenesis. Several tumor suppressor genes have been implicated in meningioma pathogenesis in humans, including the neurofibromatosis 2 (NF2), protein 4.1B (4.1 B), and tumor suppressor in lung cancer-1 (TSLC1) genes. We investigated the expression of these tumor suppressor genes in a series of spontaneous canine meningiomas using quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) (NF2; n = 25) and western blotting (NF2/merlin, 4.1B, TSLC1; n = 30). Decreased expression of 4.1B and TSLC1 expression on western blotting was seen in 6/30 (20%) and in 15/30 (50%) tumors, respectively, with 18/30 (60%) of meningiomas having decreased or absent expression of one or both proteins. NF2 gene expression assessed by western blotting and RT-PCR varied considerably between individual tumors. Complete loss of NF2 protein on western blotting was not seen, unlike 4.1B and TSLC1. Incidence of TSLC1 abnormalities was similar to that seen in human meningiomas, while perturbation of NF2 and 4.1B appeared to be less common than reported for human tumors. No association was observed between tumor grade, subtype, or location and tumor suppressor gene expression based on western blot or RT-PCR. These results suggest that loss of these tumor suppressor genes is a frequent occurrence in canine meningiomas and may be an early event in tumorigenesis in some cases. In addition, it is likely that other, as yet unidentified, genes play an important role in canine meningioma formation and growth.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Effect of homeopathic treatment on gene expression in Copenhagen rat tumor tissues.
Thangapazham, Rajesh L; Rajeshkumar, N V; Sharma, Anuj; Warren, Jim; Singh, Anoop K; Ives, John A; Gaddipati, Jaya P; Maheshwari, Radha K; Jonas, Wayne B
2006-12-01
Increasing evidence suggests that the inability to undergo apoptosis is an important factor in the development and progression of prostate cancer. Agents that induce apoptosis may inhibit tumor growth and provide therapeutic benefit. In a recent study, the authors found that certain homeopathic treatments produced anticancer effects in an animal model. In this study, the authors examined the immunomodulating and apoptotic effects of these remedies. The authors investigated the effect of a homeopathic treatment regimen containing Conium maculatum, Sabal serrulata, Thuja occidentalis, and a MAT-LyLu Carcinosin nosode on the expression of cytokines and genes that regulate apoptosis. This was assessed in prostate cancer tissues, extracted from animals responsive to these drugs, using ribonuclease protection assay or reverse transcription polymerase chain reaction. There were no significant changes in mRNA levels of the apoptotic genes bax, bcl-2, bcl-x, caspase-1, caspase-2, caspase-3, Fas, FasL, or the cytokines interleukin (IL)-1alpha, IL-1beta, tumor necrosis factor (TNF)-beta, IL-3, IL-4, IL-5, IL-6, IL-10, TNF-alpha, IL-2, and interferon-gamma in prostate tumor and lung metastasis after treatment with homeopathic medicines. This study indicates that treatment with the highly diluted homeopathic remedies does not alter the gene expression in primary prostate tumors or in lung metastasis. The therapeutic effect of homeopathic treatments observed in the in vivo experiments cannot be explained by mechanisms based on distinct alterations in gene expression related to apoptosis or cytokines. Future research should explore subtle modulations in the expression of multiple genes in different biological pathways.
DEFF Research Database (Denmark)
Stecher, Chalotte Willemann; Grønbaek, Kirsten; Hasle, Henrik
2008-01-01
A 20-month-old boy presented with precocious puberty due to a Leydig cell tumor, and at the age of 6 years with a primitive neuroectodermal brain-tumor (PNET). A novel splice site mutation of the TP53-gene, likely to be associated with a nonfunctional protein, was found in the proband, his father...
Luleyap, H. Umit; Onatoglu, Dilge; Yilmaz, M. Bertan; Alptekin, Davut; Tahiroglu, Aysegul Y.; Cetiner, Salih; Pazarbasi, Ayfer; Unal, Ilker; Avci, Ayse; Comertpay, Gamze
2013-01-01
Objectives: Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal Infections (PANDAS) is a newly defined disease in neuropsychiatry and occurs with an autoimmune mechanism after Group A Beta Hemolytic Streptococcus (GABHS) infection. Tumor necrosis factor (TNF), encoded by TNF-α gene has an important role in the apoptotic mechanisms of autoimmune diseases. Recently, TNF-α polymorphisms and autoimmune/psychiatric disorders have been reported to be related. In this regar...
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Tumor-specific apoptotic gene targeting overcomes radiation resistance in esophageal adenocarcinoma
International Nuclear Information System (INIS)
Chang, Joe Y.; Zhang Xiaochun; Komaki, Ritsuko; Cheung, Rex; Fang Bingliang
2006-01-01
Purpose: To overcome radiation resistance in esophageal adenocarcinoma by tumor-specific apoptotic gene targeting using tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). Methods and Materials: Adenoviral vector Ad/TRAIL-F/RGD with a tumor-specific human telomerase reverse transcription promoter was used to transfer TRAIL gene to human esophageal adenocarcinoma and normal human lung fibroblastic cells (NHLF). Activation of apoptosis was analyzed by Western blot, fluorescent activated cell sorting, and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate labeling (TUNEL) assay. A human esophageal adenocarcinoma mouse model was treated with intratumoral injections of Ad/TRAIL-F/RGD plus local radiotherapy. Results: The combination of Ad/TRAIL-F/RGD and radiotherapy increased the cell-killing effect in all esophageal adenocarcinoma cell lines but not in NHLF cells. This combination also significantly reduced clonogenic formation (p < 0.05) and increased sub-G1 deoxyribonucleic acid accumulation in cancer cells (p < 0.05). Activation of apoptosis by Ad/TRAIL-F/RGD plus radiotherapy was demonstrated by activation of caspase-9, caspase-8, and caspase-3 and cleaved poly (adenosine diphosphate-ribose) polymerase in vitro and TUNEL assay in vivo. Combined Ad/TRAIL-F/RGD and radiotherapy dramatically inhibited tumor growth and prolonged mean survival in the esophageal adenocarcinoma model to 31.6 days from 16.7 days for radiotherapy alone and 21.5 days for Ad/TRAIL-F/RGD alone (p < 0.05). Conclusions: The combination of tumor-specific TRAIL gene targeting and radiotherapy enhances the effect of suppressing esophageal adenocarcinoma growth and prolonging survival
Gene therapy for carcinoma of the breast: Genetic immunotherapy
International Nuclear Information System (INIS)
Strong, Theresa V
2000-01-01
Advances in gene transfer technology have greatly expanded the opportunities for developing immunotherapy strategies for breast carcinoma. Genetic immunotherapy approaches include the transfer of genes encoding cytokines and costimulatory molecules to modulate immune function, as well as genetic immunization strategies which rely on the delivery of cloned tumor antigens. Improved gene transfer vectors, coupled with a better understanding of the processes that are necessary to elicit an immune response and an expanding number of target breast tumor antigens, have led to renewed enthusiasm that effective immunotherapy may be achieved. It is likely that immunotherapeutic interventions will find their greatest clinical application as adjuvants to traditional first-line therapies, targeting micrometastatic disease and thereby reducing the risk of cancer recurrence
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
MDM2 SNP309, gene-gene interaction, and tumor susceptibility: an updated meta-analysis
Directory of Open Access Journals (Sweden)
Wu Wei
2011-05-01
Full Text Available Abstract Background The tumor suppressor gene p53 is involved in multiple cellular pathways including apoptosis, transcriptional control, and cell cycle regulation. In the last decade it has been demonstrated that the single nucleotide polymorphism (SNP at codon 72 of the p53 gene is associated with the risk for development of various neoplasms. MDM2 SNP309 is a single nucleotide T to G polymorphism located in the MDM2 gene promoter. From the time that this well-characterized functional polymorphism was identified, a variety of case-control studies have been published that investigate the possible association between MDM2 SNP309 and cancer risk. However, the results of the published studies, as well as the subsequent meta-analyses, remain contradictory. Methods To investigate whether currently published epidemiological studies can clarify the potential interaction between MDM2 SNP309 and the functional genetic variant in p53 codon72 (Arg72Pro and p53 mutation status, we performed a meta-analysis of the risk estimate on 27,813 cases with various tumor types and 30,295 controls. Results The data we reviewed indicated that variant homozygote 309GG and heterozygote 309TG were associated with a significant increased risk of all tumor types (homozygote comparison: odds ratio (OR = 1.25, 95% confidence interval (CI = 1.13-1.37; heterozygote comparison: OR = 1.10, 95% CI = 1.03-1.17. We also found that the combination of GG and Pro/Pro, TG and Pro/Pro, GG and Arg/Arg significantly increased the risk of cancer (OR = 3.38, 95% CI = 1.77-6.47; OR = 1.88, 95% CI = 1.26-2.81; OR = 1.96, 95% CI = 1.01-3.78, respectively. In a stratified analysis by tumor location, we also found a significant increased risk in brain, liver, stomach and uterus cancer (OR = 1.47, 95% CI = 1.06-2.03; OR = 2.24, 95%CI = 1.57-3.18; OR = 1.54, 95%CI = 1.04-2.29; OR = 1.34, 95%CI = 1.07-1.29, respectively. However, no association was seen between MDM2 SNP309 and tumor susceptibility
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Alternative Polyadenylation of Tumor Suppressor Genes in Small Intestinal Neuroendocrine Tumors
Rehfeld, Anders; Plass, Mireya; Døssing, Kristina; Knigge, Ulrich; Kjær, Andreas; Krogh, Anders; Friis-Hansen, Lennart
2014-01-01
The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3′ untranslated regions. Additionally, APA can also pro...
DEFF Research Database (Denmark)
Dahlgaard, Katja; Troelsen, Jesper
2018-01-01
Several tumor suppressors possess gene regulatory activity. Here, we describe how promoter and promoter/enhancer reporter assays can be used to characterize a colorectal tumor suppressor proteins’ gene regulatory activity of possible target genes. In the first part, a bioinformatic approach...... of the quick and efficient In-Fusion cloning method, and how to carry out transient transfections of Caco-2 colon cancer cells with the produced luciferase reporter plasmids using polyethyleneimine (PEI). A plan describing how to set up and carry out the luciferase expression assay is presented. The luciferase...... to identify relevant gene regulatory regions of potential target genes is presented. In the second part, it is demonstrated how to prepare and carry out the functional assay. We explain how to clone the bioinformatically identified gene regulatory regions into luciferase reporter plasmids by the use...
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression.
1996-10-01
AD GRANT NUMBER DAMDI7-94-J-4041 TITLE: Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression PRINCIPAL...October 1996 Annual (1 Sep 95 - 31 Aug 96) 4. TITLE AND SUBTITLE 5. FUNDING NUMBERS Cloning and Characterizing Genes Involved in Monoterpene Induced... Monoterpene -induced/repressed genes were identified in regressing rat mammary carcinomas treated with dietary limonene using a newly developed method
Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle
2011-07-01
Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.
Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun
2010-01-01
A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy
Directory of Open Access Journals (Sweden)
Christian Bressy
2017-06-01
Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.
International Nuclear Information System (INIS)
Chosdol, Kunzang; Misra, Anjan; Puri, Sachin; Srivastava, Tapasya; Chattopadhyay, Parthaprasad; Sarkar, Chitra; Mahapatra, Ashok K; Sinha, Subrata
2009-01-01
We had earlier used the comparison of RAPD (Random Amplification of Polymorphic DNA) DNA fingerprinting profiles of tumor and corresponding normal DNA to identify genetic alterations in primary human glial tumors. This has the advantage that DNA fingerprinting identifies the genetic alterations in a manner not biased for locus. In this study we used RAPD-PCR to identify novel genomic alterations in the astrocytic tumors of WHO grade II (Low Grade Diffuse Astrocytoma) and WHO Grade IV (Glioblastoma Multiforme). Loss of heterozygosity (LOH) of the altered region was studied by microsatellite and Single Nucleotide Polymorphism (SNP) markers. Expression study of the gene identified at the altered locus was done by semi-quantitative reverse-transcriptase-PCR (RT-PCR). Bands consistently altered in the RAPD profile of tumor DNA in a significant proportion of tumors were identified. One such 500 bp band, that was absent in the RAPD profile of 33% (4/12) of the grade II astrocytic tumors, was selected for further study. Its sequence corresponded with a region of FAT, a putative tumor suppressor gene initially identified in Drosophila. Fifty percent of a set of 40 tumors, both grade II and IV, were shown to have Loss of Heterozygosity (LOH) at this locus by microsatellite (intragenic) and by SNP markers. Semi-quantitative RT-PCR showed low FAT mRNA levels in a major subset of tumors. These results point to a role of the FAT in astrocytic tumorigenesis and demonstrate the use of RAPD analysis in identifying specific alterations in astrocytic tumors
Frequency and distribution of Notch mutations in tumor cell lines
International Nuclear Information System (INIS)
Mutvei, Anders Peter; Fredlund, Erik; Lendahl, Urban
2015-01-01
Deregulated Notch signaling is linked to a variety of tumors and it is therefore important to learn more about the frequency and distribution of Notch mutations in a tumor context. In this report, we use data from the recently developed Cancer Cell Line Encyclopedia to assess the frequency and distribution of Notch mutations in a large panel of cancer cell lines in silico. Our results show that the mutation frequency of Notch receptor and ligand genes is at par with that for established oncogenes and higher than for a set of house-keeping genes. Mutations were found across all four Notch receptor genes, but with notable differences between protein domains, mutations were for example more prevalent in the regions encoding the LNR and PEST domains in the Notch intracellular domain. Furthermore, an in silico estimation of functional impact showed that deleterious mutations cluster to the ligand-binding and the intracellular domains of NOTCH1. For most cell line groups, the mutation frequency of Notch genes is higher than in associated primary tumors. Our results shed new light on the spectrum of Notch mutations after in vitro culturing of tumor cells. The higher mutation frequency in tumor cell lines indicates that Notch mutations are associated with a growth advantage in vitro, and thus may be considered to be driver mutations in a tumor cell line context. The online version of this article (doi:10.1186/s12885-015-1278-x) contains supplementary material, which is available to authorized users
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Nonviral gene therapy in vivo with PAM-RG4/apoptin as a potential brain tumor therapeutic.
An, Songhie; Nam, Kihoon; Choi, Sunghyun; Bai, Cheng Z; Lee, Yan; Park, Jong-Sang
2013-01-01
Glioma is still one of the most complicated forms of brain tumor to remove completely due to its location and the lack of an efficient means to specifically eliminate tumor cells. For these reasons, this study has examined the effectiveness of a nonviral gene therapy approach utilizing a tumor-selective killer gene on a brain tumor xenograft model. The therapeutic apoptin gene was recombined into the JDK plasmid and delivered into human brain tumor cells (U87MG) by using a polyamidoamine dendrimer with an arginine surface (PAM-RG4). Studies in vitro showed that the PAM-RG4/apoptin plasmid polyplex exhibited a particularly high transfection activity of .40%. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, 4',6-Diamidino-2-phenylindole (DAPI) TUNEL assay, DAPI staining, and caspase-3 activity assay verified that the tumor cells had undergone apoptosis induced by apoptin. For in vivo studies, the polyplex was injected into tumors, which were induced by injecting U87MG cells intradermally into nude mice. Based on hematoxylin and eosin staining, epidermal growth factor receptor immunohistochemistry results and tumor volume measurement results, tumor growth was effectively inhibited and no specific edema, irritation, or other harm to the skin was observed after polyplex injection. The in vivo expression of apoptin and the induction of apoptosis were verified by reverse-transcription polymerase chain reaction analysis, TUNEL assay, and DAPI staining. The PAM-RG4/apoptin gene polyplex is a strong candidate for brain tumor therapeutics because of the synergistic effect of the carrier's high transfection efficiency (35%-40%) in glioma cells and the selective apoptosis-inducing activity of apoptin in tumor cells.
Hypomethylation and Aberrant Expression of the Glioma Pathogenesis-Related 1 Gene in Wilms Tumors
Directory of Open Access Journals (Sweden)
Laxmi Chilukamarri
2007-11-01
Full Text Available Wilms tumors (WTs have a complex etiology, displaying genetic and epigenetic changes, including loss of imprinting (LOI and tumor suppressor gene silencing. To identify new regions of epigenetic perturbation in WTs, we screened kidney and tumor DNA using CpG island (CGI tags associated with cancer-specific DNA methylation changes. One such tag corresponded to a paralog of the glioma pathogenesis-related 1/related to testis-specific, vespid, and pathogenesis proteins 1 (GLIPR1/RTVP-1 gene, previously reported to be a tumor-suppressor gene silenced by hypermethylation in prostate cancer. Here we report methylation analysis of the GLIPR1/RTVP-1 gene in WTs and normal fetal and pediatric kidneys. Hypomethylation of the GLIPR1/RTVP-1 5'-region in WTs relative to normal tissue is observed in 21/24 (87.5% of WTs analyzed. Quantitative analysis of GLIPR1/RTVP-1 expression in 24 WTs showed elevated transcript levels in 16/24 WTs (67%, with 12 WTs displaying in excess of 20-fold overexpression relative to fetal kidney (FK control samples. Immunohistochemical analysis of FK and WT corroborates the RNA expression data and reveals high GLIPR1/RTVP-1 in WT blastemal cells together with variable levels in stromal and epithelial components. Hypomethylation is also evident in the WT precursor lesions and nephrogenic rests (NRs, supporting a role for GLIPR1/RTVP-1 deregulation early in Wilms tumorigenesis. Our data show that, in addition to gene dosage changes arising from LOI and hypermethylation-induced gene silencing, gene activation resulting from hypomethylation is also prevalent in WTs.
Correlation of Dynamic PET and Gene Array Data in Patients with Gastrointestinal Stromal Tumors
Directory of Open Access Journals (Sweden)
Ludwig G. Strauss
2012-01-01
Full Text Available Introduction. The results obtained with dynamic PET (dPET were compared to gene expression data obtained in patients with gastrointestinal stromal tumors (GIST. The primary aim was to assess the association of the dPET results and gene expression data. Material and Methods. dPET was performed following the injection of F-18-fluorodeoxyglucose (FDG in 22 patients with GIST. All patients were examined prior to surgery for staging purpose. Compartment and noncompartment models were used for the quantitative evaluation of the dPET examinations. Gene array data were based on tumor specimen obtained by surgery after the PET examinations. Results. The data analysis revealed significant correlations for the dPET parameters and the expression of zinc finger genes (znf43, znf85, znf91, znf189. Furthermore, the transport of FDG (k1 was associated with VEGF-A. The cell cycle gene cyclin-dependent kinase inhibitor 1C was correlated with the maximum tracer uptake (SUVmax in the tumors. Conclusions. The data demonstrate a dependency of the tracer kinetics on genes associated with prognosis in GIST. Furthermore, angiogenesis and cell proliferation have an impact on the tracer uptake.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Zherdeva, Victoria; Kazachkina, Natalia I.; Shcheslavskiy, Vladislav; Savitsky, Alexander P.
2018-03-01
Caspase-3 is known for its role in apoptosis and programmed cell death regulation. We detected caspase-3 activation in vivo in tumor xenografts via shift of mean fluorescence lifetimes of a caspase-3 sensor. We used the genetically encoded sensor TR23K based on the red fluorescent protein TagRFP and chromoprotein KFP linked by 23 amino acid residues (TagRFP-23-KFP) containing a specific caspase cleavage DEVD motif to monitor the activity of caspase-3 in tumor xenografts by means of fluorescence lifetime imaging-Forster resonance energy transfer. Apoptosis was induced by injection of paclitaxel for A549 lung adenocarcinoma and etoposide and cisplatin for HEp-2 pharynx adenocarcinoma. We observed a shift in lifetime distribution from 1.6 to 1.9 ns to 2.1 to 2.4 ns, which indicated the activation of caspase-3. Even within the same tumor, the lifetime varied presumably due to the tumor heterogeneity and the different depth of tumor invasion. Thus, processing time-resolved fluorescence images allows detection of both the cleaved and noncleaved states of the TR23K sensor in real-time mode during the course of several weeks noninvasively. This approach can be used in drug screening, facilitating the development of new anticancer agents as well as improvement of chemotherapy efficiency and its adaptation for personal treatment.
Nonviral gene therapy in vivo with PAM-RG4/apoptin as a potential brain tumor therapeutic
Directory of Open Access Journals (Sweden)
An S
2013-02-01
Full Text Available Songhie An,* Kihoon Nam,* Sunghyun Choi, Cheng Z Bai, Yan Lee, Jong-Sang ParkDepartment of Chemistry, Seoul National University, Seoul, Republic of Korea*These authors contributed equally to this workBackground: Glioma is still one of the most complicated forms of brain tumor to remove completely due to its location and the lack of an efficient means to specifically eliminate tumor cells. For these reasons, this study has examined the effectiveness of a nonviral gene therapy approach utilizing a tumor-selective killer gene on a brain tumor xenograft model.Methods and results: The therapeutic apoptin gene was recombined into the JDK plasmid and delivered into human brain tumor cells (U87MG by using a polyamidoamine dendrimer with an arginine surface (PAM-RG4. Studies in vitro showed that the PAM-RG4/apoptin plasmid polyplex exhibited a particularly high transfection activity of >40%. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay, 4´,6-Diamidino-2-phenylindole (DAPI TUNEL assay, DAPI staining, and caspase-3 activity assay verified that the tumor cells had undergone apoptosis induced by apoptin. For in vivo studies, the polyplex was injected into tumors, which were induced by injecting U87MG cells intradermally into nude mice. Based on hematoxylin and eosin staining, epidermal growth factor receptor immunohistochemistry results and tumor volume measurement results, tumor growth was effectively inhibited and no specific edema, irritation, or other harm to the skin was observed after polyplex injection. The in vivo expression of apoptin and the induction of apoptosis were verified by reverse-transcription polymerase chain reaction analysis, TUNEL assay, and DAPI staining.Conclusion: The PAM-RG4/apoptin gene polyplex is a strong candidate for brain tumor therapeutics because of the synergistic effect of the carrier's high transfection efficiency (35%–40% in glioma cells and the selective apoptosis-inducing activity of
Antonescu, Cristina R; Viale, Agnes; Sarran, Lisa; Tschernyavsky, Sylvia J; Gonen, Mithat; Segal, Neil H; Maki, Robert G; Socci, Nicholas D; DeMatteo, Ronald P; Besmer, Peter
2004-05-15
Gastrointestinal stromal tumors (GISTs) are specific KIT expressing and KIT-signaling driven mesenchymal tumors of the human digestive tract, many of which have KIT-activating mutations. Previous studies have found a relatively homogeneous gene expression profile in GIST, as compared with other histological types of sarcomas. Transcriptional heterogeneity within clinically or molecularly defined subsets of GISTs has not been previously reported. We tested the hypothesis that the gene expression profile in GISTs might be related to KIT genotype and possibly to other clinicopathological factors. An HG-U133A Affymetrix chip (22,000 genes) platform was used to determine the variability of gene expression in 28 KIT-expressing GIST samples from 24 patients. A control group of six intra-abdominal leiomyosarcomas was also included for comparison. Statistical analyses (t tests) were performed to identify discriminatory gene lists among various GIST subgroups. The levels of expression of various GIST subsets were also linked to a modified version of the growth factor/KIT signaling pathway to analyze differences at various steps in signal transduction. Genes involved in KIT signaling were differentially expressed among wild-type and mutant GISTs. High gene expression of potential drug targets, such as VEGF, MCSF, and BCL2 in the wild-type group, and Mesothelin in exon 9 GISTs were found. There was a striking difference in gene expression between stomach and small bowel GISTs. This finding was validated in four separate tumors, two gastric and two intestinal, from a patient with familial GIST with a germ-line KIT W557R substitution. GISTs have heterogeneous gene expression depending on KIT genotype and tumor location, which is seen at both the genomic level and the KIT signaling pathway in particular. These findings may explain their variable clinical behavior and response to therapy.
Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng
2016-06-21
To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Osswald, Annika; Sun, Zhongke; Grimm, Verena; Ampem, Grace; Riegel, Karin; Westendorf, Astrid M; Sommergruber, Wolfgang; Otte, Kerstin; Dürre, Peter; Riedel, Christian U
2015-12-12
Several studies in animal models demonstrated that obligate and facultative anaerobic bacteria of the genera Bifidobacterium, Salmonella, or Clostridium specifically colonize solid tumors. Consequently, these and other bacteria are discussed as live vectors to deliver therapeutic genes to inhibit tumor growth. Therapeutic approaches for cancer treatment using anaerobic bacteria have been investigated in different mouse models. In the present study, solid three-dimensional (3D) multicellular tumor spheroids (MCTS) of the colorectal adenocarcinoma cell line HT-29 were generated and tested for their potential to study prodrug-converting enzyme therapies using bacterial vectors in vitro. HT-29 MCTS resembled solid tumors displaying all relevant features with an outer zone of proliferating cells and hypoxic and apoptotic regions in the core. Upon incubation with HT-29 MCTS, Bifidobacterium bifidum S17 and Salmonella typhimurium YB1 selectively localized, survived and replicated in hypoxic areas inside MCTS. Furthermore, spores of the obligate anaerobe Clostridium sporogenes germinated in these hypoxic areas. To further evaluate the potential of MCTS to investigate therapeutic approaches using bacteria as gene delivery vectors, recombinant bifidobacteria expressing prodrug-converting enzymes were used. Expression of a secreted cytosine deaminase in combination with 5-fluorocytosine had no effect on growth of MCTS due to an intrinsic resistance of HT-29 cells to 5-fluorouracil, i.e. the converted drug. However, a combination of the prodrug CB1954 and a strain expressing a secreted chromate reductase effectively inhibited MCTS growth. Collectively, the presented results indicate that MCTS are a suitable and reliable model to investigate live bacteria as gene delivery vectors for cancer therapy in vitro.
Daniel, Dianne C; Johnson, Edward M
2018-02-15
The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding
Metallothioneins in human tumors and potential roles in carcinogenesis
Energy Technology Data Exchange (ETDEWEB)
Cherian, M. George; Jayasurya, A.; Bay, Boon-Huat
2003-12-10
Metallothioneins (MT) are a group of low-molecular weight, cysteine rich intracellular proteins, which are encoded by a family of genes containing at least 10 functional isoforms in human. The expression and induction of these proteins have been associated with protection against DNA damage, oxidative stress and apoptosis. Moreover, MT may potentially activate certain transcriptional factors by donating zinc. Although MT is a cytosolic protein in resting cells, it can be translocated transiently to the cell nucleus during cell proliferation and differentiation. A number of studies have shown an increased expression of MT in various human tumors of the breast, colon, kidney, liver, lung, nasopharynx, ovary, prostate, salivary gland, testes, thyroid and urinary bladder. However, MT is down-regulated in certain tumors such as hepatocellular carcinoma and liver adenocarcinoma. Hence, the expression of MT is not universal to all human tumors, but may depend on the differentiation status and proliferative index of tumors, along with other tissue factors and gene mutations. In certain tumors such as germ cell carcinoma, the expression of MT is closely related to the tumor grade and proliferative activity. Increased expression of MT has also been observed in less differentiated tumors. Thus, expression of MT may be a potential prognostic marker for certain tumors. There are few reports on the expression of the different isoforms of MT which have been analyzed by specific gene probes. They reveal that certain isoforms are expressed in specific cell types. The factors which can influence MT induction in human tumors are not yet understood. Down-regulation of MT synthesis in hepatic tumors may be related to hypermethylation of the MT-promoter or mutation of other genes such as the p53 tumor suppressor gene. In vitro studies using human cancer cells suggest a possible role for p53 and the estrogen-receptor on the expression and induction of MT in epithelial neoplastic cells
Metallothioneins in human tumors and potential roles in carcinogenesis
International Nuclear Information System (INIS)
Cherian, M. George; Jayasurya, A.; Bay, Boon-Huat
2003-01-01
Metallothioneins (MT) are a group of low-molecular weight, cysteine rich intracellular proteins, which are encoded by a family of genes containing at least 10 functional isoforms in human. The expression and induction of these proteins have been associated with protection against DNA damage, oxidative stress and apoptosis. Moreover, MT may potentially activate certain transcriptional factors by donating zinc. Although MT is a cytosolic protein in resting cells, it can be translocated transiently to the cell nucleus during cell proliferation and differentiation. A number of studies have shown an increased expression of MT in various human tumors of the breast, colon, kidney, liver, lung, nasopharynx, ovary, prostate, salivary gland, testes, thyroid and urinary bladder. However, MT is down-regulated in certain tumors such as hepatocellular carcinoma and liver adenocarcinoma. Hence, the expression of MT is not universal to all human tumors, but may depend on the differentiation status and proliferative index of tumors, along with other tissue factors and gene mutations. In certain tumors such as germ cell carcinoma, the expression of MT is closely related to the tumor grade and proliferative activity. Increased expression of MT has also been observed in less differentiated tumors. Thus, expression of MT may be a potential prognostic marker for certain tumors. There are few reports on the expression of the different isoforms of MT which have been analyzed by specific gene probes. They reveal that certain isoforms are expressed in specific cell types. The factors which can influence MT induction in human tumors are not yet understood. Down-regulation of MT synthesis in hepatic tumors may be related to hypermethylation of the MT-promoter or mutation of other genes such as the p53 tumor suppressor gene. In vitro studies using human cancer cells suggest a possible role for p53 and the estrogen-receptor on the expression and induction of MT in epithelial neoplastic cells
Tumor Classification Using High-Order Gene Expression Profiles Based on Multilinear ICA
Directory of Open Access Journals (Sweden)
Ming-gang Du
2009-01-01
Full Text Available Motivation. Independent Components Analysis (ICA maximizes the statistical independence of the representational components of a training gene expression profiles (GEP ensemble, but it cannot distinguish relations between the different factors, or different modes, and it is not available to high-order GEP Data Mining. In order to generalize ICA, we introduce Multilinear-ICA and apply it to tumor classification using high order GEP. Firstly, we introduce the basis conceptions and operations of tensor and recommend Support Vector Machine (SVM classifier and Multilinear-ICA. Secondly, the higher score genes of original high order GEP are selected by using t-statistics and tabulate tensors. Thirdly, the tensors are performed by Multilinear-ICA. Finally, the SVM is used to classify the tumor subtypes. Results. To show the validity of the proposed method, we apply it to tumor classification using high order GEP. Though we only use three datasets, the experimental results show that the method is effective and feasible. Through this survey, we hope to gain some insight into the problem of high order GEP tumor classification, in aid of further developing more effective tumor classification algorithms.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Ardaneswari, Gianinna; Bustamam, Alhadi; Sarwinda, Devvi
2017-10-01
A Tumor is an abnormal growth of cells that serves no purpose. Carcinoma is a tumor that grows from the top of the cell membrane and the organ adenoma is a benign tumor of the gland-like cells or epithelial tissue. In the field of molecular biology, the development of microarray technology is used in the data store of disease genetic expression. For each of microarray gene, an amount of information is stored for each trait or condition. In gene expression data clustering can be done with a bicluster algorithm, thats clustering method which not only the objects to be clustered, but also the properties or condition of the object. This research proposed Plaid Model Biclustering as one of biclustering method. In this study, we discuss the implementation of Plaid Model Biclustering Method on microarray of Carcinoma and Adenoma tumor gene expression data. From the experimental results, we found three biclusters are formed by Carcinoma gene expression data and four biclusters are formed by Adenoma gene expression data.
Effect of Chemical Prevention Drugs-based MicroRNAs and Their Target Genes on Tumor Inhibition
Directory of Open Access Journals (Sweden)
Yanhui JIANG
2015-04-01
Full Text Available Chemopreventive drugs including natural chemopreventive drugs and synthetic chemopreventive drugs, it not only can prevent cancer, can also play a role in tumor treatment. MicroRNAs (miRNAs is a kind of short chains of non-coding RNA, regulating the expression of many genes through the way of degradation of mRNA or inhibitting mRNA translation. In recent years, more and more studies have shown that chemopreventive drugs through influence the expression of miRNAs and their target genes play a role in the prevention and treatment in a variety of tumors, and chemopreventive drugs on the experimental study of miRNAs and their target genes in tumor have demonstrated a good safety and efficacy. Effect on chemopreventive drugs-based microRNAs and their target genes into cancer cells will be expected as a new starting point for cancer research. The thesis expounds and analyzes between the natural chemopreventive drugs and synthetic chemopreventive drugs and miRNAs and their target genes in tumor research progress.
International Nuclear Information System (INIS)
Daya-Grosjean, Leela; Sarasin, Alain
2005-01-01
Xeroderma pigmentosum (XP), a rare hereditary syndrome, is characterized by a hypersensitivity to solar irradiation due to a defect in nucleotide excision repair resulting in a predisposition to squamous and basal cell carcinomas as well as malignant melanomas appearing at a very early age. The mutator phenotype of XP cells is evident by the higher levels of UV specific modifications found in key regulatory genes in XP skin tumors compared to those in the same tumor types from the normal population. Thus, XP provides a unique model for the study of unrepaired DNA lesions, mutations and skin carcinogenesis. The high level of ras oncogene activation, Ink4a-Arf and p53 tumor suppressor gene modifications as well as alterations of the different partners of the mitogenic sonic hedgehog signaling pathway (patched, smoothened and sonic hedgehog), characterized in XP skin tumors have clearly demonstrated the major role of the UV component of sunlight in the development of skin tumors. The majority of the mutations are C to T or tandem CC to TT UV signature transitions, occurring at bipyrimidine sequences, the specific targets of UV induced lesions. These characteristics are also found in the same genes modified in sporadic skin cancers but with lower frequencies confirming the validity of studying the XP model. The knowledge gained by studying XP tumors has given us a greater perception of the contribution of genetic predisposition to cancer as well as the consequences of the many alterations which modulate the activities of different genes affecting crucial pathways vital for maintaining cell homeostasis
Energy Technology Data Exchange (ETDEWEB)
Daya-Grosjean, Leela [Laboratory of Genetic Instability and Cancer, UPR2169 CNRS, IFR 54, Institut Gustave Roussy, 39, rue Camille Desmoulins, 94805 Villejuif Cedex (France)]. E-mail: daya@igr.fr; Sarasin, Alain [Laboratory of Genetic Instability and Cancer, UPR2169 CNRS, IFR 54, Institut Gustave Roussy, 39, rue Camille Desmoulins, 94805 Villejuif Cedex (France)
2005-04-01
Xeroderma pigmentosum (XP), a rare hereditary syndrome, is characterized by a hypersensitivity to solar irradiation due to a defect in nucleotide excision repair resulting in a predisposition to squamous and basal cell carcinomas as well as malignant melanomas appearing at a very early age. The mutator phenotype of XP cells is evident by the higher levels of UV specific modifications found in key regulatory genes in XP skin tumors compared to those in the same tumor types from the normal population. Thus, XP provides a unique model for the study of unrepaired DNA lesions, mutations and skin carcinogenesis. The high level of ras oncogene activation, Ink4a-Arf and p53 tumor suppressor gene modifications as well as alterations of the different partners of the mitogenic sonic hedgehog signaling pathway (patched, smoothened and sonic hedgehog), characterized in XP skin tumors have clearly demonstrated the major role of the UV component of sunlight in the development of skin tumors. The majority of the mutations are C to T or tandem CC to TT UV signature transitions, occurring at bipyrimidine sequences, the specific targets of UV induced lesions. These characteristics are also found in the same genes modified in sporadic skin cancers but with lower frequencies confirming the validity of studying the XP model. The knowledge gained by studying XP tumors has given us a greater perception of the contribution of genetic predisposition to cancer as well as the consequences of the many alterations which modulate the activities of different genes affecting crucial pathways vital for maintaining cell homeostasis.
Gene expression analysis of FABP4 in gastric cancer
Directory of Open Access Journals (Sweden)
Abdulkarim Yasin Karim
2016-06-01
Full Text Available Purpose: Gastric cancer has high incidence and mortality rate in several countries and is still one of the most frequent and lethal disease. In this study, we aimed to determine diagnostic markers in gastric cancer by molecular techniques; include mRNA expression analysis of FABP4 gene. Fatty acid binding protein 4 (FABP4 gene encodes the fatty acid binding protein found in adipocytes. The protein encoded by FABP4 are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Material and Methods: Total RNA were extracted from paired tumor and normal tissues of 47 gastric cancer. The mRNA expression level of FABP4 was measured employing semi- quantitative reverse transcription- polymerase chain reaction (RT- PCR. Results: The mRNA expression level of FABP4 was significantly decreased (down- regulated. Conclusion: Down-regulation of FABP4 gene seems to occur at the initial steps of gastric cancer development. In order to confirm the relationship between the gastric tumor and FABP4 gene, further analysis like immunohistochemistry and epigenetc techniques are necessary. [Cukurova Med J 2016; 41(2.000: 248-252
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Ten Broeke, S W; van Bavel, T C; Jansen, A M L; Gómez-García, E; Hes, F J; van Hest, L P; Letteboer, T G W; Olderode-Berends, M J W; Ruano, D; Spruijt, L; Suerink, M; Tops, C M; van Eijk, R; Morreau, H; van Wezel, T; Nielsen, M
2018-05-11
Germline variants in the mismatch repair genes MLH1, MSH2 (EPCAM), MSH6, or PMS2 cause Lynch syndrome. Patients with these variants have an increased risk of developing colorectal cancers (CRCs) that differ from sporadic CRCs in genetic and histologic features. It has been a challenge to study CRCs associated with PMS2 variants (PMS2-associated CRCs) because these develop less frequently and in patients of older ages than colorectal tumors with variants in the other mismatch repair genes. We analyzed 20 CRCs associated with germline variants in PMS2, 22 sporadic CRCs, 18 CRCs with germline variants in MSH2, and 24 CRCs from patients with germline variants in MLH1. Tumor tissue blocks were collected from Dutch pathology departments in 2017. After extraction of tumor DNA, we used a platform designed to detect approximately 3000 somatic hotspot variants in 55 genes (including KRAS, APC, CTNNB1, and TP53). Somatic variant frequencies were compared using the Fisher's exact test. None of the PMS2-associated CRCs contained any somatic variants in the catenin beta 1 gene (CTNNB1), which encodes β-catenin, whereas 14/24 MLH1-associated CRCs (58%) contained variants in CTNNB1. Half of PMS2-associated CRCs contained KRAS variants, but only 20% of these were in hotspots that encoded G12D or G13D. These hotspot variants occurred more frequently in CRCs associated with variants in MLH1 (37.5%, P=.44) and MSH2 (and 71.4%, P=.035) than with variants in PMS2. In a genetic analysis of 84 colorectal tumors, we found tumors from patients with PMS2-associated Lynch syndrome to be distinct from colorectal tumors associated with defects in other mismatch repair genes. This might account for differences in development and less frequent occurrence. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan
2010-01-01
Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors
International Nuclear Information System (INIS)
Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.
2010-01-01
Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors
International Nuclear Information System (INIS)
Costa, Vera L; Henrique, Rui; Ribeiro, Franclim R; Pinto, Mafalda; Oliveira, Jorge; Lobo, Francisco; Teixeira, Manuel R; Jerónimo, Carmen
2007-01-01
Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses
Directory of Open Access Journals (Sweden)
Skubitz Amy PN
2008-05-01
Full Text Available Abstract The heterogeneity that soft tissue sarcomas (STS exhibit in their clinical behavior, even within histological subtypes, complicates patient care. Histological appearance is determined by gene expression. Morphologic features are generally good predictors of biologic behavior, however, metastatic propensity, tumor growth, and response to chemotherapy may be determined by gene expression patterns that do not correlate well with morphology. One approach to identify heterogeneity is to search for genetic markers that correlate with differences in tumor behavior. Alternatively, subsets may be identified based on gene expression patterns alone, independent of knowledge of clinical outcome. We have reported gene expression patterns that distinguish two subgroups of clear cell renal carcinoma (ccRCC, and other gene expression patterns that distinguish heterogeneity of serous ovarian carcinoma (OVCA and aggressive fibromatosis (AF. In this study, gene expression in 53 samples of STS and AF [including 16 malignant fibrous histiocytoma (MFH, 9 leiomyosarcoma, 12 liposarcoma, 4 synovial sarcoma, and 12 samples of AF] was determined at Gene Logic Inc. (Gaithersburg, MD using Affymetrix GeneChip® U_133 arrays containing approximately 40,000 genes/ESTs. Gene expression analysis was performed with the Gene Logic Genesis Enterprise System® Software and Expressionist software. Hierarchical clustering of the STS using our three previously reported gene sets, each generated subgroups within the STS that for some subtypes correlated with histology, and also suggested the existence of subsets of MFH. All three gene sets also recognized the same two subsets of the fibromatosis samples that we had found in our earlier study of AF. These results suggest that these subgroups may have biological significance, and that these gene sets may be useful for sub-classification of STS. In addition, several genes that are targets of some anti-tumor drugs were found to
International Nuclear Information System (INIS)
Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo
2003-01-01
The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)
Mind the GAP: A Novel Tumor-Promoting Mechanism | Center for Cancer Research
RAS proteins, like light switches, toggle between an “on” conformation where they promote cell growth, survival, and/or the formation of blood vessels (known as angiogenesis) and an “off” conformation in which they are unable to stimulate their target effector proteins. Nearly one-third of human tumors express a mutated RAS gene, which encodes a protein locked permanently in
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
CFTR is a tumor suppressor gene in murine and human intestinal cancer
Than, B. L. N.; Linnekamp, J. F.; Starr, T. K.; Largaespada, D. A.; Rod, A.; Zhang, Y.; Bruner, V.; Abrahante, J.; Schumann, A.; Luczak, T.; Niemczyk, A.; O'Sullivan, M. G.; Medema, J. P.; Fijneman, R. J. A.; Meijer, G. A.; van den Broek, E.; Hodges, C. A.; Scott, P. M.; Vermeulen, L.; Cormier, R. T.
2016-01-01
CFTR, the cystic fibrosis (CF) gene, encodes for the CFTR protein that plays an essential role in anion regulation and tissue homeostasis of various epithelia. In the gastrointestinal (GI) tract CFTR promotes chloride and bicarbonate secretion, playing an essential role in ion and acid-base
Herrera, Mercedes; Islam, Abul B M M K; Herrera, Alberto; Martín, Paloma; García, Vanesa; Silva, Javier; Garcia, Jose M; Salas, Clara; Casal, Ignacio; de Herreros, Antonio García; Bonilla, Félix; Peña, Cristina
2013-11-01
Cancer-associated fibroblasts (CAF) actively participate in reciprocal communication with tumor cells and with other cell types in the microenvironment, contributing to a tumor-permissive neighborhood and promoting tumor progression. The aim of this study is the characterization of how CAFs from primary human colon tumors promote migration of colon cancer cells. Primary CAF cultures from 15 primary human colon tumors were established. Their enrichment in CAFs was evaluated by the expression of various epithelial and myofibroblast specific markers. Coculture assays of primary CAFs with different colon tumor cells were performed to evaluate promigratory CAF-derived effects on cancer cells. Gene expression profiles were developed to further investigate CAF characteristics. Coculture assays showed significant differences in fibroblast-derived paracrine promigratory effects on cancer cells. Moreover, the association between CAFs' promigratory effects on cancer cells and classic fibroblast activation or stemness markers was observed. CAF gene expression profiles were analyzed by microarray to identify deregulated genes in different promigratory CAFs. The gene expression signature, derived from the most protumorogenic CAFs, was identified. Interestingly, this "CAF signature" showed a remarkable prognostic value for the clinical outcome of patients with colon cancer. Moreover, this prognostic value was validated in an independent series of 142 patients with colon cancer, by quantitative real-time PCR (qRT-PCR), with a set of four genes included in the "CAF signature." In summary, these studies show for the first time the heterogeneity of primary CAFs' effect on colon cancer cell migration. A CAF gene expression signature able to classify patients with colon cancer into high- and low-risk groups was identified.
Fujiki, H; Suganuma, M; Yoshizawa, S; Kanazawa, H; Sugimura, T; Manam, S; Kahn, S M; Jiang, W; Hoshina, S; Weinstein, I B
1989-01-01
Three okadaic acid class tumor promoters, okadaic acid, dinophysistoxin-1, and calyculin A, have potent tumor-promoting activity in two-stage carcinogenesis experiments on mouse skin. DNA isolated from tumors induced by 7,12-dimethylbenz[a]anthracene (DMBA) and each of these tumor promoters revealed the same mutation at the second nucleotide of codon 61 (CAA----CTA) in the c-Ha-ras gene, determined by the polymerase chain reaction procedure and DNA sequencing. Three potent 12-O-tetradecanoylphorbol-13-acetate (TPA)-type tumor promoters, TPA, teleocidin, and aplysiatoxin, showed the same effects. These results provide strong evidence that this mutation in the c-Ha-ras gene is due to a direct effect of DMBA rather than a selective effect of specific tumor promoters.
Sun, Wan-Wei; Zhang, Xin-Xu; Wan, Wei-Song; Wang, Shu-Qi; Wen, Xiao-Bo; Zheng, Huai-Ping; Zhang, Yue-Ling; Li, Sheng-Kang
2017-02-01
Tumor necrosis factor receptor-associated factor 6 (TRAF6) is a key cytoplasm signal adaptor that mediates signals activated by tumor necrosis factor receptor (TNFR) superfamily and the Interleukin-1 receptor/Toll-like receptor (IL-1/TLR) superfamily. The full-length 2492 bp TRAF6 (Sp-TRAF6) from Scylla paramamosain contains 1800 bp of open reading frame (ORF) encoding 598 amino acids, including an N-terminal RING-type zinc finger, two TRAF-type zinc fingers and a conserved C-terminal meprin and TRAF homology (MATH) domain. Multiple alignment analysis shows that the putative amino acid sequence of Sp-TRAf6 has highest identity of 88% with Pt-TRAF6 from Portunus trituberculatus, while the similarity of Sp-TRAF6 with other crustacean sequences was 54-55%. RT-PCR analysis indicated that Sp-TRAF6 transcripts were predominantly expressed in the hepatopancreas and stomach, whereas it was barely detected in the heart and hemocytes in our study. Moreover, Sp-TRAF6 transcripts were significantly up-regulated after Vibrio parahemolyticus and LPS challenges. RNA interference assay was carried out used by siRNA to investigate the genes expression patterns regulated by Sp-TRAF6. The qRT-PCR results showed that silencing Sp-TRAF6 gene could inhibit SpALF1, SpALF2, SpALF5 and SpALF6 expression in hemocytes, while inhibit SpALF1, SpALF3, SpALF4, SpALF5 and SpALF6 expression in hepatopancreas. Taken together, the acute-phase response to immune challenges and the inhibition of SpALFs gene expression indicate that Sp-TRAF6 plays an important role in host defense against pathogen invasions via regulation of ALF gene expression in S. paramamosain. Copyright © 2016. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Nelson, Gail M.; Ahlborn, Gene J.; Allen, James W.; Ren, Hongzu; Corton, J. Christopher; Waalkes, Michael P.; Kitchin, Kirk T.; Diwan, Bhalchandra A.; Knapp, Geremy; Delker, Don A.
2009-01-01
Exposure of male C3H mice in utero (from gestational days 8-18) to 85 ppm sodium arsenite via the dams' drinking water has previously been shown to increase liver tumor incidence by 2 years of age. However, in our companion study (Ahlborn et al., 2009), continuous exposure to 85 ppm sodium arsenic (from gestational day 8 to postnatal day 365) did not result in increased tumor incidence, but rather in a significant reduction (0% tumor incidence). The purpose of the present study was to examine the gene expression responses that may lead to the apparent protective effect of continuous arsenic exposure. Genes in many functional categories including cellular growth and proliferation, gene expression, cell death, oxidative stress, protein ubiquitination, and mitochondrial dysfunction were altered by continuous arsenic treatment. Many of these genes are known to be involved in liver cancer. One such gene associated with rodent hepatocarcinogenesis, Scd1, encodes stearoyl-CoA desaturase and was down-regulated by continuous arsenic treatment. An overlap between the genes in our study affected by continuous arsenic exposure and those from the literature affected by long-term caloric restriction suggests that reduction in the spontaneous tumor incidence under both conditions may involve similar gene pathways such as fatty acid metabolism, apoptosis, and stress response.
Directory of Open Access Journals (Sweden)
Iris Wundrack
1994-01-01
Full Text Available A polymerase chain reaction (PCR assay was developed to test for tumor cell specific expression of the BCEI gene. This new marker gene, reported at first for human breast cancer, was found specifically active in various gastrointestinal carcinomas by previously applying immunohistochemistry and RNA (Northern blot analysis. Presently, by using reverse transcription -PCR analysis, a series of primary tumor tissues and established tumor cell lines were testcd for BCEI transcription. This approach was compared to immunostaining achieved by an antibody directed against the BCEI gene’s product. The result demonstrate the superior sensitivity of PCR by indicating the gene’ s expression in cases where immunohistochemical testing remained negative.
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
International Nuclear Information System (INIS)
Chen Daozhen; Tang Qiusha; Xiang Jingying; Xu Fei; Zhang Li; Wang Junfeng
2011-01-01
Objective: To investigate the antitumor therapeutic effect of combined therapy of magnetic induction heating by nano-magnetic particles, herpes simplex virus thymidine kinase gene (HSV-tk suicide gene) and internal radiation in mice bearing MCF-7 breast carcinoma. Methods: The transfection reagents, plasmids heat shock protein-HSV-tk (pHSP-HSV-tk), ferroso-ferric oxide nano-magnetic fluid flow and 188 Re-ganciclovir-bovine serum albumin-nanopaticles (GCV-BSA-NP) were prepared. The heating experiments in vivo were carried out using ferroso-ferric oxide nano-magnetic fluid flow. Sixty mice tumor models bearing MCF-7 breast carcinoma were established and randomly divided into six groups. Group A was the control group, B was gene transfection therapy group, C was hyperthermia group, D was gene transfection therapy combined with radionuclide brachytherapy group, E was gene therapy combined with hyperthermia group, and F was gene therapy, hyperthermia combined with radionuclide brachytherapy group. The tumor growth, tumor mass and histopathological changes were evaluated. The expression of HSV-tk in the groups of B, D, E and F was detected by RT-PCR. Poisson distribution and one-way analysis of variance (ANOVA) were used for statistical analysis by SPSS 10.0 software. Results: In the animal heating experiments, the temperature of tumor increased up to 39.6 degree C, 43.2 degree C, and 48.1 degree C quickly with different injected doses (2, 4 and 6 mg respectively) of nano-magnetic particles and maintained for 40 min. The temperature of tumor tissue reduced to 36.8 degree C, 37.5 degree C and 37.8 degree C in 10 min when alternating magnetic field (AMF) stopped. The tumor mass in Groups C ((452.50±30.29) mg), D ((240.98±35.32)mg), E((231.87±27.41) mg) and F ((141.55±23.78) mg) were much lower than that in Group A ((719.12±22.65) mg) (F=800.07, P<0.01), with the most significant treatment effect in Group F.The tumor mass in Group B((684.05±24.02) mg) was higher than
Badea, Liviu; Herlea, Vlad; Dima, Simona Olimpia; Dumitrascu, Traian; Popescu, Irinel
2008-01-01
The precise details of pancreatic ductal adenocarcinoma (PDAC) pathogenesis are still insufficiently known, requiring the use of high-throughput methods. However, PDAC is especially difficult to study using microarrays due to its strong desmoplastic reaction, which involves a hyperproliferating stroma that effectively "masks" the contribution of the minoritary neoplastic epithelial cells. Thus it is not clear which of the genes that have been found differentially expressed between normal and whole tumor tissues are due to the tumor epithelia and which simply reflect the differences in cellular composition. To address this problem, laser microdissection studies have been performed, but these have to deal with much smaller tissue sample quantities and therefore have significantly higher experimental noise. In this paper we combine our own large sample whole-tissue study with a previously published smaller sample microdissection study by Grützmann et al. to identify the genes that are specifically overexpressed in PDAC tumor epithelia. The overlap of this list of genes with other microarray studies of pancreatic cancer as well as with the published literature is impressive. Moreover, we find a number of genes whose over-expression appears to be inversely correlated with patient survival: keratin 7, laminin gamma 2, stratifin, platelet phosphofructokinase, annexin A2, MAP4K4 and OACT2 (MBOAT2), which are all specifically upregulated in the neoplastic epithelia, rather than the tumor stroma. We improve on other microarray studies of PDAC by putting together the higher statistical power due to a larger number of samples with information about cell-type specific expression and patient survival.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Giant Subependymoma Developed in a Patient with Aniridia: Analyses of PAX6 and Tumor-relevant Genes
Maekawa, Motoko; Fujisawa, Hironori; Iwayama, Yoshimi; Tamase, Akira; Toyota, Tomoko; Osumi, Noriko; Yoshikawa, Takeo
2010-01-01
We observed an unusually large subependymoma in a female patient with congenital aniridia. To analyze the genetic mechanisms of tumorigenesis, we first examined the paired box 6 (PAX6) gene using both tumor tissue and peripheral lymphocytes. Tumor suppressor activity has been proposed for PAX6 in gliomas, in addition to its well-known role in the eye development. Using genomic quantitative PCR and loss of heterozygosity analysis, we identified hemizygous deletions in the 5′-region of PAX6. In lymphocytes, the deletion within PAX6 spanned from between exons 6 and 7 to the 5′-upstream region of the gene, but did not reach the upstream gene, RNC1, which is reported to be associated with tumors. The subependymoma had an additional de novo deletion spanning from the intron 4 to intron 6 of PAX6, although we could not completely determine whether these two deletions are on the same chromosome or not. We also examined other potentially relevant tumor suppressor genes: PTEN, TP53 and SOX2. However, we detected no exonic mutations or deletions in these genes. Collectively, we speculate that the defect in PAX6 may have contributed to the extremely large size of the subependymoma, due to a loss of tumor suppressor activity in glial cell lineage. PMID:20500513
Down-regulation of HSP40 gene family following OCT4B1 suppression in human tumor cell lines
Directory of Open Access Journals (Sweden)
Mohammad Reza Mirzaei
2016-02-01
Full Text Available Objective(s: The OCT4B1, as one of OCT4 variants, is expressed in cancer cell lines and tissues more than other variants and plays an important role in apoptosis and stress (heat shock protein pathways. The present study was designed to determine the effects of OCT4B1 silencing on expressional profile of HSP40 gene family expression in three different human tumor cell lines. Materials and Methods: The OCT4B1 expression was suppressed by specific siRNA transfection in AGS (gastric adenocarcinoma, 5637 (bladder tumor and U-87MG (brain tumor cell lines employing Lipofectamine reagent. Real-time PCR array technique was employed for RNA qualification. The fold changes were calculated using RT2 Profiler PCR array data analysis software version 3.5. Results: Our results indicated that fifteen genes (from 36 studied genes were down-regulated and two genes (DNAJC11 and DNAJC5B were up-regulated in all three studied tumor cell lines by approximately more than two folds. The result of other studied genes (19 genes showed different expressional pattern (up or down-expression based on tumor cell lines. Conclusion: According to the findings of the present study, we may suggest that there is a direct correlation between OCT4B1 expression in tumor cell lines (and tissues and HSP40 family gene expressions to escape from apoptosis and cancer expansion.
Engineering of magnetic DNA nanoparticles for tumor-targeted therapy
International Nuclear Information System (INIS)
Hosseinkhani, Hossein; Chen Yiru; He Wenjie; Hong Poda; Yu, Dah-Shyong; Domb, Abraham J.
2013-01-01
This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe 2+ solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.
Engineering of magnetic DNA nanoparticles for tumor-targeted therapy
Energy Technology Data Exchange (ETDEWEB)
Hosseinkhani, Hossein, E-mail: hosseinkhani@yahoo.com [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Chen Yiru [National Yang-Ming University, Department of Biomedical Engineering (China); He Wenjie; Hong Poda [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Yu, Dah-Shyong [Nanomedicine Research Center, National Defense Medical Center (China); Domb, Abraham J. [Institute of Drug Research, The Center for Nanoscience and Nanotechnology, School of Pharmacy, Faculty of Medicine, Hebrew University of Jerusalem (Israel)
2013-01-15
This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe{sup 2+} solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.
Davis, Barbara J.; Risinger, John I.; Chandramouli, Gadisetti V. R.; Bushel, Pierre R.; Baird, Donna Day; Peddada, Shyamal D.
2013-01-01
The study of uterine leiomyomata (fibroids) provides a unique opportunity to investigate the physiological and molecular determinants of hormone dependent tumor growth and spontaneous tumor regression. We conducted a longitudinal clinical study of premenopausal women with leiomyoma that showed significantly different growth rates between white and black women depending on their age. Growth rates for leiomyoma were on average much higher from older black women than for older white women, and we now report gene expression pattern differences in tumors from these two groups of study participants. Total RNA from 52 leiomyoma and 8 myometrial samples were analyzed using Affymetrix Gene Chip expression arrays. Gene expression data was first compared between all leiomyoma and normal myometrium and then between leiomyoma from older black women (age 35 or older) and from older white women. Genes that were found significant in pairwise comparisons were further analyzed for canonical pathways, networks and biological functions using the Ingenuity Pathway Analysis (IPA) software. Whereas our comparison of leiomyoma to myometrium produced a very large list of genes highly similar to numerous previous studies, distinct sets of genes and signaling pathways were identified in comparisons of older black and white women whose tumors were likely to be growing and non-growing, respectively. Key among these were genes associated with regulation of apoptosis. To our knowledge, this is the first study to compare two groups of tumors that are likely to have different growth rates in order to reveal molecular signals likely to be influential in tumor growth. PMID:23785396
Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha
2017-01-01
During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...
Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip
2017-01-01
ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Field distribution and DNA transport in solid tumors during electric field-mediated gene delivery.
Henshaw, Joshua W; Yuan, Fan
2008-02-01
Gene therapy has a great potential in cancer treatment. However, the efficacy of cancer gene therapy is currently limited by the lack of a safe and efficient means to deliver therapeutic genes into the nucleus of tumor cells. One method under investigation for improving local gene delivery is based on the use of pulsed electric field. Despite repeated demonstration of its effectiveness in vivo, the underlying mechanisms behind electric field-mediated gene delivery remain largely unknown. Without a thorough understanding of these mechanisms, it will be difficult to further advance the gene delivery. In this review, the electric field-mediated gene delivery in solid tumors will be examined by following individual transport processes that must occur in vivo for a successful gene transfer. The topics of examination include: (i) major barriers for gene delivery in the body, (ii) distribution of electric fields at both cell and tissue levels during the application of external fields, and (iii) electric field-induced transport of genes across each of the barriers. Through this approach, the review summarizes what is known about the mechanisms behind electric field-mediated gene delivery and what require further investigations in future studies.
Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors
Directory of Open Access Journals (Sweden)
Oliveira Jorge
2007-07-01
Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.
Directory of Open Access Journals (Sweden)
Yoshiyuki Koyama
2015-07-01
Full Text Available Immune escape of tumor cells is one of the main obstacles hindering the effectiveness of cancer immunotherapy. We developed a novel strategy to block immune escape by transfecting tumor cells in vivo with genes of pathogenic antigens from Mycobacterium tuberculosis (TB. This induces presentation of the TB antigen on tumor cell surfaces, which can be recognized by antigen presenting cells (APCs as a “danger signal” to stimulate antitumor immune response. This strategy is also expected to amplify the immune response against tumor-associated antigens, and block immune escape of the tumor. DNA/PEI/chondroitin sulfate ternary complex is a highly effective non-viral gene vector system for in vivo transfection. A therapeutic complex was prepared using a plasmid encoding the TB antigen, early secretory antigenic target-6 (ESAT-6. This was injected intratumorally into syngeneic tumor-bearing mice, and induced significant tumor growth suppression comparable to or higher than similar complexes expressing cytokines such as interleukin-2 (IL-2 and interleukin-12 (IL-12. Co-transfection of the cytokine-genes and the ESAT-6-gene enhanced the antitumor efficacy of either treatment alone. In addition, complete tumor regression was achieved with the combination of ESAT-6 and IL-2 genes.
Mengesha, Asferd; Dubois, Ludwig; Lambin, Philippe; Landuyt, Willy; Chiu, Roland K; Wouters, Bradly G; Theys, Jan
To increase the potential of attenuated Salmonella as gene delivery vectors for cancer treatment, we developed a hypoxia-inducible promoter system to limit gene expression specifically to the tumor. This approach is envisaged to not only increase tumor specificity, but also to target those cells
Tsyganov, M. M.; Ibragimova, M. K.; Deryusheva, I. V.; Slonimskaya, E. M.; Litviakov, N. V.
2017-09-01
Most current research is limited by only germinal mutations of the BRCA1 gene (more often 5382insC) and the number of studies, which characterize various somatic alterations of the BRCA1 gene in a tumor, namely the expression of this gene and its correlation with the efficiency of chemotherapy, which is scarce. Taking into account the data on the connection between the genetic mutation of BRCA1 with the high efficiency of the platinum medication one may suggest that the expression of the BRCA1 gene is also associated with the high sensitivity of the tumor to the platinum medication. Aim: to evaluate the correlation between the expression of the BRCA1 gene in a breast tumor with the neoadjuvant chemotherapy (NACT) efficiency. The research included 86 patients with BC. We evaluated the expression of BRCA1 in the tumor material before and after NACT. We established that objective response to NACT is connected with a high level of BRCA1 in the general group of patients (p = 0.01) and in case of docetaxel monotherapy (p < 0.05).
Genetic and epigenetic silencing of the beclin 1 gene in sporadic breast tumors
International Nuclear Information System (INIS)
Li, Zidong; Chen, Bo; Wu, Yiqing; Jin, Feng; Xia, Yongjing; Liu, Xiangjun
2010-01-01
Beclin 1, an important autophagy-related protein in human cells, is involved in cell death and cell survival. Beclin 1 mapped to human chromosome 17q21. It is widely expressed in normal mammary epithelial cells. Although down-regulated expression with mono-allelic deletions of beclin 1 gene was frequently observed in breast tumors, whether there was other regulatory mechanism of beclin 1 was to be investigated. We studied the expression of beclin 1 and explored the possible regulatory mechanisms on its expression in breast tumors. 20 pairs of tumors and adjacent normal tissues from patients with sporadic breast invasive ductal cancer (IDCs) were collected. The mRNA expression of beclin 1 was detected by real-time quantitative RT-PCR. Loss of heterozygosity (LOH) was determined by real-time quantitative PCR and microsatellite methods. The protein expression of beclin 1, p53, BRCA1 and BRCA2 was assessed by immunohistochemistry. CpG islands in 5' genomic region of beclin 1 gene were identified using MethylPrimer Program. Sodium bisulfite sequencing was used in examining the methylation status of each CpG island. Decreased beclin 1 mRNA expression was detected in 70% of the breast tumors, and the protein levels were co-related to the mRNA levels. Expression of beclin 1 mRNA was demonstrated to be much higher in the BRCA1 positive tumors than that in the BRCA1 negative ones. Loss of heterozygosity was detected in more than 45% of the breast tumors, and a dense cluster of CpG islands was found from the 5' end to the intron 2 of the beclin 1 gene. Methylation analysis showed that the promoter and the intron 2 of beclin 1 were aberrantly methylated in the tumors with decreased expression. These data indicated that LOH and aberrant DNA methylation might be the possible reasons of the decreased expression of beclin 1 in the breast tumors. The findings here shed some new light on the regulatory mechanisms of beclin 1 in breast cancer
Comparative analyses of gene copy number and mRNA expression in GBM tumors and GBM xenografts
Energy Technology Data Exchange (ETDEWEB)
Hodgson, J. Graeme; Yeh, Ru-Fang; Ray, Amrita; Wang, Nicholas J.; Smirnov, Ivan; Yu, Mamie; Hariono, Sujatmi; Silber, Joachim; Feiler, Heidi S.; Gray, Joe W.; Spellman, Paul T.; Vandenberg, Scott R.; Berger, Mitchel S.; James, C. David
2009-04-03
Development of model systems that recapitulate the molecular heterogeneity observed among glioblastoma multiforme (GBM) tumors will expedite the testing of targeted molecular therapeutic strategies for GBM treatment. In this study, we profiled DNA copy number and mRNA expression in 21 independent GBM tumor lines maintained as subcutaneous xenografts (GBMX), and compared GBMX molecular signatures to those observed in GBM clinical specimens derived from the Cancer Genome Atlas (TCGA). The predominant copy number signature in both tumor groups was defined by chromosome-7 gain/chromosome-10 loss, a poor-prognosis genetic signature. We also observed, at frequencies similar to that detected in TCGA GBM tumors, genomic amplification and overexpression of known GBM oncogenes, such as EGFR, MDM2, CDK6, and MYCN, and novel genes, including NUP107, SLC35E3, MMP1, MMP13, and DDX1. The transcriptional signature of GBMX tumors, which was stable over multiple subcutaneous passages, was defined by overexpression of genes involved in M phase, DNA replication, and chromosome organization (MRC) and was highly similar to the poor-prognosis mitosis and cell-cycle module (MCM) in GBM. Assessment of gene expression in TCGA-derived GBMs revealed overexpression of MRC cancer genes AURKB, BIRC5, CCNB1, CCNB2, CDC2, CDK2, and FOXM1, which form a transcriptional network important for G2/M progression and/or checkpoint activation. Our study supports propagation of GBM tumors as subcutaneous xenografts as a useful approach for sustaining key molecular characteristics of patient tumors, and highlights therapeutic opportunities conferred by this GBMX tumor panel for testing targeted therapeutic strategies for GBM treatment.
International Nuclear Information System (INIS)
Matar, S.N.A.
2011-01-01
Colorectal cancer (CRC) is the second leading cause of cancer-related death in the Western world. In Egypt; there is an increasing incidence of the disease, especially among patients ≤40 years age. While CRC have been reported in low incidence rate in developing countries, it is the third most common tumor in male and the fifth common tumor in females in Egypt. Early diagnosis and surgical interference guarantee long survival of most CRC patients. Early diagnosis is impeded by the disease onset at young age and imprecise symptoms at the initial stages of the disease. As in most solid tumors, the malignant transformation of colonic epithelial cells is to arise through a multistep process during which they acquire genetic changes involving the activation of proto-oncogenes and the loss of tumor suppressor genes. Recently, a candidate tumor suppressor gene, KLF6, which is mapped to chromosome 10p, was found to be frequently mutated in a number of cancers. There are some evidences suggesting that the disruption of the functional activity of KLF6 gene products may be one of the early events in tumor genesis of the colon. The main objective of the present study was to detect mutational changes of KLF6 tumor suppressor gene and to study the loss of heterozygosity (LOH) markers at chromosome 10p15 (KLF6 locus) in colorectal lesions and colorectal cancer in Egyptian patients. The patients included in this study were 83 presented with different indications for colonoscopic examination. Selecting patients with colorectal pre-cancerous lesions or colorectal cancer was done according to the results of tissue biopsy from lesion and adjacent normal. The patients were classified into three main groups; (G I) Cancerous group, (G II) polyps group including patients with adenomatous polyps (AP), familial adenomatous polyps (FAP) and hyperplastic polyps (HP) and (G III) Inflammatory Bowel Diseases (IBD) including patients with ulcerative colitis (UC) and Crohn's disease (CD
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
Tian, Zhiqiang; Wang, Huaizhi; Jia, Zhengcai; Shi, Jinglei; Tang, Jun; Mao, Liwei; Liu, Hongli; Deng, Yijing; He, Yangdong; Ruan, Zhihua; Li, Jintao; Wu, Yuzhang; Ni, Bing
2010-12-01
Pokemon gene has crucial but versatile functions in cell differentiation, proliferation and tumorigenesis. It is a master regulator of the ARF-HDM2-p53 and Rb-E2F pathways. The facts that the expression of Pokemon is essential for tumor formation and many kinds of tumors over-express the Pokemon gene make it an attractive target for therapeutic intervention for cancer treatment. In this study, we used an RNAi strategy to silence the Pokemon gene in a cervical cancer model. To address the issues involving tumor specific delivery and durable expression of siRNA, we applied the Arg-Gly-Asp (RGD) peptide ligand and polylysine (K(18)) fusion peptide to encapsulate a recombinant retrovirus plasmid expressing a siRNA targeting the Pokemon gene and produced the 'mimoretrovirus'. At charge ratio 2.0 of fusion peptide/plasmid, the mimoretrovirus formed stable and homogenous nanoparticles, and provided complete DNase I protection and complete gel retardation. This nanoparticle inhibited SiHa cell proliferation and invasion, while it promoted SiHa cell apoptosis. The binding of the nanoparticle to SiHa cells was mediated via the RGD-integrin α(v)β(3) interaction, as evidenced by the finding that unconjugated RGD peptide inhibited this binding significantly. This tumor-targeting mimoretrovirus exhibited excellent anti-tumor capacity in vivo in a nude mouse model. Moreover, the mimoretrovirus inhibited tumor growth with a much higher efficiency than recombinant retrovirus expressing siRNA or the K(18)/P4 nanoparticle lacking the RGD peptide. Results suggest that the RNAi/RGD-based mimoretrovirus developed in this study represents a novel anti-tumor strategy that may be applicable to most research involving cancer therapy and, thus, has promising potential as a cervical cancer treatment.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Directory of Open Access Journals (Sweden)
Nina V Chaika
Full Text Available Pancreatic cancer is the fourth leading cause of cancer related deaths in the United States with a five-year survival rate of 6%. It is characterized by extremely aggressive tumor growth rate and high incidence of metastasis. One of the most common and profound biochemical phenotypes of animal and human cancer cells is their ability to metabolize glucose at high rates, even under aerobic conditions. However, the contribution of metabolic interrelationships between tumor cells and cells of the surrounding microenvironment to the progression of cancer is not well understood. We evaluated differential expression of metabolic genes and, hence, metabolic pathways in primary tumor and metastases of patients with pancreatic adenocarcinoma.We analyzed the metabolic gene (those involved in glycolysis, tri-carboxylic acid pathway, pentose-phosphate pathway and fatty acid metabolism expression profiles of primary and metastatic lesions from pancreatic cancer patients by gene expression arrays. We observed two principal results: genes that were upregulated in primary and most of the metastatic lesions; and genes that were upregulated only in specific metastatic lesions in a site-specific manner. Immunohistochemical (IHC analyses of several metabolic gene products confirmed the gene expression patterns at the protein level. The IHC analyses also revealed differential tumor and stromal expression patterns of metabolic enzymes that were correlated with the metastasis sites.Here, we present the first comprehensive studies that establish differential metabolic status of tumor and stromal components and elevation of aerobic glycolysis gene expression in pancreatic cancer.
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
International Nuclear Information System (INIS)
Tierney, L.A.; Johnson, N.F.; Lechner, J.F.
1994-01-01
Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins
Directory of Open Access Journals (Sweden)
Yusuke Suenaga
2014-01-01
Full Text Available The rearrangement of pre-existing genes has long been thought of as the major mode of new gene generation. Recently, de novo gene birth from non-genic DNA was found to be an alternative mechanism to generate novel protein-coding genes. However, its functional role in human disease remains largely unknown. Here we show that NCYM, a cis-antisense gene of the MYCN oncogene, initially thought to be a large non-coding RNA, encodes a de novo evolved protein regulating the pathogenesis of human cancers, particularly neuroblastoma. The NCYM gene is evolutionally conserved only in the taxonomic group containing humans and chimpanzees. In primary human neuroblastomas, NCYM is 100% co-amplified and co-expressed with MYCN, and NCYM mRNA expression is associated with poor clinical outcome. MYCN directly transactivates both NCYM and MYCN mRNA, whereas NCYM stabilizes MYCN protein by inhibiting the activity of GSK3β, a kinase that promotes MYCN degradation. In contrast to MYCN transgenic mice, neuroblastomas in MYCN/NCYM double transgenic mice were frequently accompanied by distant metastases, behavior reminiscent of human neuroblastomas with MYCN amplification. The NCYM protein also interacts with GSK3β, thereby stabilizing the MYCN protein in the tumors of the MYCN/NCYM double transgenic mice. Thus, these results suggest that GSK3β inhibition by NCYM stabilizes the MYCN protein both in vitro and in vivo. Furthermore, the survival of MYCN transgenic mice bearing neuroblastoma was improved by treatment with NVP-BEZ235, a dual PI3K/mTOR inhibitor shown to destabilize MYCN via GSK3β activation. In contrast, tumors caused in MYCN/NCYM double transgenic mice showed chemo-resistance to the drug. Collectively, our results show that NCYM is the first de novo evolved protein known to act as an oncopromoting factor in human cancer, and suggest that de novo evolved proteins may functionally characterize human disease.
Directory of Open Access Journals (Sweden)
Zhifu Sun
Full Text Available We used deep sequencing technology to profile the transcriptome, gene copy number, and CpG island methylation status simultaneously in eight commonly used breast cell lines to develop a model for how these genomic features are integrated in estrogen receptor positive (ER+ and negative breast cancer. Total mRNA sequence, gene copy number, and genomic CpG island methylation were carried out using the Illumina Genome Analyzer. Sequences were mapped to the human genome to obtain digitized gene expression data, DNA copy number in reference to the non-tumor cell line (MCF10A, and methylation status of 21,570 CpG islands to identify differentially expressed genes that were correlated with methylation or copy number changes. These were evaluated in a dataset from 129 primary breast tumors. Gene expression in cell lines was dominated by ER-associated genes. ER+ and ER- cell lines formed two distinct, stable clusters, and 1,873 genes were differentially expressed in the two groups. Part of chromosome 8 was deleted in all ER- cells and part of chromosome 17 amplified in all ER+ cells. These loci encoded 30 genes that were overexpressed in ER+ cells; 9 of these genes were overexpressed in ER+ tumors. We identified 149 differentially expressed genes that exhibited differential methylation of one or more CpG islands within 5 kb of the 5' end of the gene and for which mRNA abundance was inversely correlated with CpG island methylation status. In primary tumors we identified 84 genes that appear to be robust components of the methylation signature that we identified in ER+ cell lines. Our analyses reveal a global pattern of differential CpG island methylation that contributes to the transcriptome landscape of ER+ and ER- breast cancer cells and tumors. The role of gene amplification/deletion appears to more modest, although several potentially significant genes appear to be regulated by copy number aberrations.
Tumor-produced, active Interleukin-1 β regulates gene expression in carcinoma-associated fibroblasts
International Nuclear Information System (INIS)
Dudas, Jozsef; Fullar, Alexandra; Bitsche, Mario; Schartinger, Volker; Kovalszky, Ilona; Sprinzl, Georg Mathias; Riechelmann, Herbert
2011-01-01
Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1β (IL1-β) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-β expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-β processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-β. IL1-β signaling was investigated by western blot and immunocytochemistry. IL1-β-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-β, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NFκBα. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-β reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-β-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-β in the tumor cells leads to IL1-β-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-β. PDL fibroblasts possess receptor for IL1-β, and its expression is increased 4.56-times in the presence of SCC-25 tumor cells. IL1-β receptor expression in
Energy Technology Data Exchange (ETDEWEB)
Dudas, Jozsef, E-mail: Jozsef.Dudas@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Fullar, Alexandra, E-mail: fullarsz@gmail.com [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); 1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Bitsche, Mario, E-mail: Mario.Bitsche@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Schartinger, Volker, E-mail: Volker.Schartinger@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Kovalszky, Ilona, E-mail: koval@korb1.sote.hu [1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Sprinzl, Georg Mathias, E-mail: Georg.Sprinzl@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Riechelmann, Herbert, E-mail: Herbert.Riechelmann@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria)
2011-09-10
Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1{beta} (IL1-{beta}) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-{beta} expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-{beta} processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-{beta}. IL1-{beta} signaling was investigated by western blot and immunocytochemistry. IL1-{beta}-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-{beta}, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NF{kappa}B{alpha}. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-{beta} reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-{beta}-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-{beta} in the tumor cells leads to IL1-{beta}-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-{beta}. PDL fibroblasts possess receptor for IL1-{beta}, and its expression is increased 4.56-times in the
International Nuclear Information System (INIS)
García, Normand; Salamanca, Fabio; Astudillo-de la Vega, Horacio; Curiel-Quesada, Everardo; Alvarado, Isabel; Peñaloza, Rosenda; Arenas, Diego
2005-01-01
Breast cancer is one of the most frequent causes of death in Mexican women over 35 years of age. At molecular level, changes in many genetic networks have been reported as associated with this neoplasia. To analyze these changes, we determined gene expression profiles of tumors from Mexican women with breast cancer at different stages and compared these with those of normal breast tissue samples. 32 P-radiolabeled cDNA was synthesized by reverse transcription of mRNA from fresh sporadic breast tumor biopsies, as well as normal breast tissue. cDNA probes were hybridized to microarrays and expression levels registered using a phosphorimager. Expression levels of some genes were validated by real time RT-PCR and immunohistochemical assays. We identified two subgroups of tumors according to their expression profiles, probably related with cancer progression. Ten genes, unexpressed in normal tissue, were turned on in some tumors. We found consistent high expression of Bik gene in 14/15 tumors with predominant cytoplasmic distribution. Recently, the product of the Bik gene has been associated with tumoral reversion in different neoplasic cell lines, and was proposed as therapy to induce apoptosis in cancers, including breast tumors. Even though a relationship among genes, for example those from a particular pathway, can be observed through microarrays, this relationship might not be sufficient to assign a definitive role to Bik in development and progression of the neoplasia. The findings herein reported deserve further investigation
Tenosynovial Giant Cell Tumor: Better molecular understanding revolutionizes treatment outcome
Directory of Open Access Journals (Sweden)
Emad Shash
2016-01-01
Full Text Available Tenosynovial giant cell tumors (TGCTs are rare tumors, which are primarily treated via surgery with a low likelihood of metastasis. Although wide excision is an excellent choice for local control, tumors located within or close to major joints, along with the benign nature of the disease, make such resection impractical. An increase in local recurrences and the need for multiple surgical procedures promoted the interest in targeted-therapies for this disease. TGCTs contain a mixture of giant cells, mononuclear cells and inflammatory cells, with clonal cytogenetic abnormalities through rearrangements involving 1p11–13. Colony stimulating factor (CSF1 gene encodes for the ligand of CSF1 receptor (CSF1R. The CSF1 gene is located at the chromosome 1p13 breakpoint and is found to be translocated in 63%–77% of patients with TGCTs. Selective CSF1R inhibitors yield high response rate and disease control, demonstrating the integration of a new drug development technology that could revolutionize treatment outcomes.
International Nuclear Information System (INIS)
Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado
2011-01-01
LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
Tumor suppressor genes are frequently methylated in lymph node metastases of breast cancers
Directory of Open Access Journals (Sweden)
Xu Jia
2010-07-01
Full Text Available Abstract Introduction Metastasis represents a major adverse step in the progression of breast carcinoma. Lymph node invasion is the most relevant prognostic factor; however little is known on the molecular events associated with lymph node metastasis process. This study is to investigate the status and role of methylation in lymph node metastatic tumors. Materials and methods Bisulfite pyrosequencing is used to screen 6 putative tumor suppressor genes (HIN-1, RASSF1A, RIL, CDH13, RARβ2 and E-cadherin in 38 pairs of primary breast tumors and lymph node metastases. Results We found that HIN-1, CDH13, RIL, RASSF1A and RARβ2 were frequently methylated both in primary and metastatic tissues (range: 55.3%~89.5%. E-cadherin was not frequently methylated in either setting (range: 18.4%~23.7%. The methylation status of HIN-1, CDH13, RIL, and RARβ2 in lymph nodes metastasis were correlated with that in primary tumors. The Pearson correlation values ranged from 0.624 to 0.472 (p values HIN-1 methylation and hormone status in metastatic lymph nodes. Hypermethylation of HIN-1 in metastasis lymph nodes was significantly associated with expression of ER (odds ratio, 1.070; P = 0.024 and with PR (odds ratio, 1.046; P = 0.026. Conclusions This study suggests that hypermethylation of tumor suppressor genes is extended from primary to metastatic tumors during tumor progression.
The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.
Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki
2018-05-01
Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Anti-tumor effects of Egr-IFN gamma gene therapy combined with {sup 125}I-UdR radionuclide therapy
Energy Technology Data Exchange (ETDEWEB)
Jingguo, Zhao [No.403 Hospital of PLA, Dalian (China); Yanjun, Ni; Xiangfu, Song; Yanyi, Li; Wei, Yang; Ting, Sun; Qingjie, Ma; Fengtong, Gao
2008-12-15
Objective: To explore the anti-tumor effects of Egr-IFNgamma gene therapy combined with {sup 125}I-UdR radionuclide therapy in mice bearing H22 hepatocarcinoma and its mechanism. Methods: The recombinant plasmid pcDNAEgr-IFNgamma mixed with liposome was injected into tumor. 48 h later, 370 kBq {sup 125}I-UdR was injected into tumor. The tumor growth rates at different times were observed. After 3 d gene-radionuclide therapy, the concentration of IFNgamma in cytoplasm of H22 cells and cytotoxic activities of splenic CTL of the mice in different groups were examined. Results: The tumor growth rates of pcDNAEgr-IFNgamma + {sup 125}I-UdR group were obviously lower than those of control group, {sup 125}I-UdR group and pcDNAEgr-1 + {sup 125}I-UdR group 6-15 d after gene-radionuclide therapy. IFNgamma protein was found in cytoplasm of H22 cells in pcDNAEgr-IFNgamma + {sup 125}I-UdR group after 3 d gene-radionuclide therapy. Cytotoxic activity of splenic CTL in pcDNAEgr-IFNgamma + {sup 125}I-UdR group was significantly higher than that in the other groups (P<0.01). Conclusions: The anti-tumor effects in vivo of pcDNAEgr-IFNgamma gene therapy combined with {sup 125}I-UdR radionuclide therapy are better than those of {sup 125}I-UdR therapy. (authors)
3D view to tumor suppression: Lkb1, polarity and the arrest of oncogenic c-Myc.
Partanen, Johanna I; Nieminen, Anni I; Klefstrom, Juha
2009-03-01
Machiavelli wrote, in his famous political treatise Il Principe, about disrupting organization by planting seeds of dissension or by eliminating necessary support elements. Tumor cells do exactly that by disrupting the organized architecture of epithelial cell layers during progression from contained benign tumor to full-blown invasive cancer. However, it is still unclear whether tumor cells primarily break free by activating oncogenes powerful enough to cause chaos or by eliminating tumor suppressor genes guarding the order of the epithelial organization. Studies in Drosophila have exposed genes that encode key regulators of the epithelial apicobasal polarity and which, upon inactivation, cause disorganization of the epithelial layers and promote unscheduled cell proliferation. These polarity regulator/tumor suppressor proteins, which include products of neoplastic tumor suppressor genes (nTSGs), are carefully positioned in polarized epithelial cells to maintain the order of epithelial structures and to impose a restraint on cell proliferation. In this review, we have explored the presence and prevalence of somatic mutations in the human counterparts of Drosophila polarity regulator/tumor suppressor genes across the human cancers. The screen points out LKB1, which is a causal genetic lesion in Peutz-Jeghers cancer syndrome, a gene mutated in certain sporadic cancers and a human homologue of the fly polarity gene par-4. We review the evidence linking Lkb1 protein to polarity regulation in the scope of our recent results suggesting a coupled role for Lkb1 as an architect of organized acinar structures and a suppressor of oncogenic c-Myc. We finally present models to explain how Lkb1-dependent formation of epithelial architecture is coupled to suppression of normal and oncogene-induced proliferation.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Second generation sequencing of the mesothelioma tumor genome.
Directory of Open Access Journals (Sweden)
Raphael Bueno
2010-05-01
Full Text Available The current paradigm for elucidating the molecular etiology of cancers relies on the interrogation of small numbers of genes, which limits the scope of investigation. Emerging second-generation massively parallel DNA sequencing technologies have enabled more precise definition of the cancer genome on a global scale. We examined the genome of a human primary malignant pleural mesothelioma (MPM tumor and matched normal tissue by using a combination of sequencing-by-synthesis and pyrosequencing methodologies to a 9.6X depth of coverage. Read density analysis uncovered significant aneuploidy and numerous rearrangements. Method-dependent informatics rules, which combined the results of different sequencing platforms, were developed to identify and validate candidate mutations of multiple types. Many more tumor-specific rearrangements than point mutations were uncovered at this depth of sequencing, resulting in novel, large-scale, inter- and intra-chromosomal deletions, inversions, and translocations. Nearly all candidate point mutations appeared to be previously unknown SNPs. Thirty tumor-specific fusions/translocations were independently validated with PCR and Sanger sequencing. Of these, 15 represented disrupted gene-encoding regions, including kinases, transcription factors, and growth factors. One large deletion in DPP10 resulted in altered transcription and expression of DPP10 transcripts in a set of 53 additional MPM tumors correlated with survival. Additionally, three point mutations were observed in the coding regions of NKX6-2, a transcription regulator, and NFRKB, a DNA-binding protein involved in modulating NFKB1. Several regions containing genes such as PCBD2 and DHFR, which are involved in growth factor signaling and nucleotide synthesis, respectively, were selectively amplified in the tumor. Second-generation sequencing uncovered all types of mutations in this MPM tumor, with DNA rearrangements representing the dominant type.
The 1p-encoded protein stathmin and resistance of malignant gliomas to nitrosoureas.
Ngo, Teri-T B; Peng, Tien; Liang, Xing-Jie; Akeju, Oluwaseun; Pastorino, Sandra; Zhang, Wei; Kotliarov, Yuri; Zenklusen, Jean C; Fine, Howard A; Maric, Dragan; Wen, Patrick Y; De Girolami, Umberto; Black, Peter McL; Wu, Wells W; Shen, Rong-Fong; Jeffries, Neal O; Kang, Dong-Won; Park, John K
2007-04-18
Malignant gliomas are generally resistant to all conventional therapies. Notable exceptions are anaplastic oligodendrogliomas with loss of heterozygosity on chromosome 1p (1p+/-). Patients with 1p+/- anaplastic oligodendroglioma frequently respond to procarbazine, 1-(2-chloroethyl)-3-cyclohexyl-l-nitrosourea, and vincristine. Because the underlying biologic basis for this clinical finding is unclear, we evaluated differentially expressed 1p-encoded proteins in 1p+/- and 1p+/+ malignant glioma cell lines and then examined whether their expression was associated with outcome of patients with anaplastic oligodendroglioma. We used a comparative proteomic screen of A172 (1p+/-) and U251 (1p+/+) malignant glioma cell lines to identify differentially expressed 1p-encoded proteins, including stathmin, a microtubule-associated protein. 1p+/- and 1p+/+ anaplastic oligodendroglioma specimens from 24 patients were assessed for stathmin expression by immunohistochemistry. The relationship between stathmin expression and clinical outcome was assessed with Kaplan-Meier analyses. RNA inhibition and cDNA transfection experiments tested effects of stathmin under- and overexpression, respectively, on the in vitro and in vivo resistance of malignant glioma cells to treatment with nitrosourea. For in vivo resistance studies, 36 mice with intracranial and 16 mice with subcutaneous xenograft tumor implants were used (one tumor per mouse). Flow cytometry was used for cell cycle analysis. Immunoblotting was used to assess protein expression. All statistical tests were two-sided. Decreased stathmin expression in tumors was statistically significantly associated with loss of heterozygosity in 1p (Pnitrosourea-treated mice carrying xenograft tumors. Median survival of mice with stathmin+/- tumors was 95 days (95% CI = 68.7 to 121.3 days) and that of mice with stathmin+/+ tumors was 64 days (95% CI = 58.2 to 69.8 days) (difference = 31 days, 95% CI = 4.1 to 57.9 days; PNitrosoureas induced
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
International Nuclear Information System (INIS)
Ji, Xinglai; Tang, Jie; Halberg, Richard; Busam, Dana; Ferriera, Steve; Peña, Maria Marjorette O; Venkataramu, Chinnambally; Yeatman, Timothy J; Zhao, Shaying
2010-01-01
We are developing a cross-species comparison strategy to distinguish between cancer driver- and passenger gene alteration candidates, by utilizing the difference in genomic location of orthologous genes between the human and other mammals. As an initial test of this strategy, we conducted a pilot study with human colorectal cancer (CRC) and its mouse model C57BL/6J Apc Min/+ , focusing on human 5q22.2 and 18q21.1-q21.2. We first performed bioinformatics analysis on the evolution of 5q22.2 and 18q21.1-q21.2 regions. Then, we performed exon-targeted sequencing, real time quantitative polymerase chain reaction (qPCR), and real time quantitative reverse transcriptase PCR (qRT-PCR) analyses on a number of genes of both regions with both human and mouse colon tumors. These two regions (5q22.2 and 18q21.1-q21.2) are frequently deleted in human CRCs and encode genuine colorectal tumor suppressors APC and SMAD4. They also encode genes such as MCC (mutated in colorectal cancer) with their role in CRC etiology unknown. We have discovered that both regions are evolutionarily unstable, resulting in genes that are clustered in each human region being found scattered at several distinct loci in the genome of many other species. For instance, APC and MCC are within 200 kb apart in human 5q22.2 but are 10 Mb apart in the mouse genome. Importantly, our analyses revealed that, while known CRC driver genes APC and SMAD4 were disrupted in both human colorectal tumors and tumors from Apc Min/+ mice, the questionable MCC gene was disrupted in human tumors but appeared to be intact in mouse tumors. These results indicate that MCC may not actually play any causative role in early colorectal tumorigenesis. We also hypothesize that its disruption in human CRCs is likely a mere result of its close proximity to APC in the human genome. Expanding this pilot study to the entire genome may identify more questionable genes like MCC, facilitating the discovery of new CRC driver gene candidates
Ji, Xinglai; Tang, Jie; Halberg, Richard; Busam, Dana; Ferriera, Steve; Peña, Maria Marjorette O; Venkataramu, Chinnambally; Yeatman, Timothy J; Zhao, Shaying
2010-08-13
We are developing a cross-species comparison strategy to distinguish between cancer driver- and passenger gene alteration candidates, by utilizing the difference in genomic location of orthologous genes between the human and other mammals. As an initial test of this strategy, we conducted a pilot study with human colorectal cancer (CRC) and its mouse model C57BL/6J ApcMin/+, focusing on human 5q22.2 and 18q21.1-q21.2. We first performed bioinformatics analysis on the evolution of 5q22.2 and 18q21.1-q21.2 regions. Then, we performed exon-targeted sequencing, real time quantitative polymerase chain reaction (qPCR), and real time quantitative reverse transcriptase PCR (qRT-PCR) analyses on a number of genes of both regions with both human and mouse colon tumors. These two regions (5q22.2 and 18q21.1-q21.2) are frequently deleted in human CRCs and encode genuine colorectal tumor suppressors APC and SMAD4. They also encode genes such as MCC (mutated in colorectal cancer) with their role in CRC etiology unknown. We have discovered that both regions are evolutionarily unstable, resulting in genes that are clustered in each human region being found scattered at several distinct loci in the genome of many other species. For instance, APC and MCC are within 200 kb apart in human 5q22.2 but are 10 Mb apart in the mouse genome. Importantly, our analyses revealed that, while known CRC driver genes APC and SMAD4 were disrupted in both human colorectal tumors and tumors from ApcMin/+ mice, the questionable MCC gene was disrupted in human tumors but appeared to be intact in mouse tumors. These results indicate that MCC may not actually play any causative role in early colorectal tumorigenesis. We also hypothesize that its disruption in human CRCs is likely a mere result of its close proximity to APC in the human genome. Expanding this pilot study to the entire genome may identify more questionable genes like MCC, facilitating the discovery of new CRC driver gene candidates.
International Nuclear Information System (INIS)
Cemazar, Maja; Wilson, Ian; Dachs, Gabi U; Tozer, Gillian M; Sersa, Gregor
2004-01-01
Electroporation is currently receiving much attention as a way to increase drug and DNA delivery. Recent studies demonstrated the feasibility of electrogene therapy using a range of therapeutic genes for the treatment of experimental tumors. However, the transfection efficiency of electroporation-assisted DNA delivery is still low compared to viral methods and there is a clear need to optimize this approach. In order to optimize treatment, knowledge about spatial and time dependency of gene expression following delivery is of utmost importance in order to improve gene delivery. Intravital microscopy of tumors growing in dorsal skin fold window chambers is a useful method for monitoring gene transfection, since it allows non-invasive dynamic monitoring of gene expression in tumors in a live animal. Intravital microscopy was used to monitor real time spatial distribution of the green fluorescent protein (GFP) and time dependence of transfection efficiency in syngeneic P22 rat tumor model. DNA alone, liposome-DNA complexes and electroporation-assisted DNA delivery using two different sets of electric pulse parameters were compared. Electroporation-assisted DNA delivery using 8 pulses, 600 V/cm, 5 ms, 1 Hz was superior to other methods and resulted in 22% increase in fluorescence intensity in the tumors up to 6 days post-transfection, compared to the non-transfected area in granulation tissue. Functional GFP was detected within 5 h after transfection. Cells expressing GFP were detected throughout the tumor, but not in the surrounding tissue that was not exposed to electric pulses. Intravital microscopy was demonstrated to be a suitable method for monitoring time and spatial distribution of gene expression in experimental tumors and provided evidence that electroporation-assisted gene delivery using 8 pulses, 600 V/cm, 5 ms, 1 Hz is an effective method, resulting in early onset and homogenous distribution of gene expression in the syngeneic P22 rat tumor model
International Nuclear Information System (INIS)
Huang, Jian; Zhang, Yun-Li; Teng, Xiao-Mei; Lin, Yun; Zheng, Da-Li; Yang, Peng-Yuan; Han, Ze-Guang
2007-01-01
Hepatocellular carcinoma (HCC) is one of the most common cancers in the world. SFRP1 (the secreted frizzled-related protein 1), a putative tumor suppressor gene mapped onto chromosome 8p12-p11.1, the frequent loss of heterozygosity (LOH) region in human HCC, encodes a Wingless-type (Wnt) signaling antagonist and is frequently inactivated by promoter methylation in many human cancers. However, whether the down-regulation of SFRP1 can contribute to hepatocarcinogenesis still remains unclear. We investigated the expression of SFRP1 through real time RT-PCR and immunohistochemistry staining. The cell growth and colony formation were observed as the overexpression and knockdown of SFRP1. The DNA methylation status within SFRP1 promoter was analyzed through methylation-specific PCR or bisulphate-treated DNA sequencing assays. Loss of heterozygosity was here detected with microsatellite markers. SFRP1 was significantly down-regulated in 76.1% (35/46) HCC specimens at mRNA level and in 30% (30/100) HCCs indicated by immunohistochemistry staining, as compared to adjacent non-cancerous livers. The overexpression of SFRP1 can significantly inhibit the cell growth and colony formation of YY-8103, SMMC7721, and Hep3B cells. The RNA interference against the constitutional SFRP1 in the offspring SMMC7721 cells, which were stably transfected by ectopic SFRP1, can markedly promote cell growth of these cells. LOH of both microsatellite markers D8S532 and D8SAC016868 flanking the gene locus was found in 13% (6 of 46 HCCs) and 6.5% (3 of 46 HCCs) of the informative cases, respectively, where 5 of 8 HCC specimens with LOH showed the down-regulation of SFRP1. DNA hypermethylation within SFRP1 promoter was identified in two of three HCC specimens without SFRP1 expression. Moreover, the DNA methylation of SFRP1 promoter was significantly reduced, along with the re-expression of the gene, in those HCC cell lines, Bel7404, QGY7701, and MHCC-H, as treated by DAC. Our data suggested that the
Genetic basis of calcifying cystic odontogenic tumors.
Directory of Open Access Journals (Sweden)
Akane Yukimori
Full Text Available Calcifying cystic odontogenic tumors (CCOTs are benign cystic tumors that form abnormally keratinized ghost cells. Mutations in CTNNB1, which encodes beta-catenin, have been implicated in the development of these tumors, but a causal relationship has not been definitively established. Thus, mutational hot spots in 50 cancer genes were examined by targeted next-generation sequencing in 11 samples of CCOT. Mutations in CTNNB1, but not in other genes, were observed in 10 of 11 cases. These mutations constitutively activate beta-catenin signaling by abolishing the phosphorylation sites Asp32, Ser33, or Ser37, and are similar to those reported in pilomatrixoma and adamantinomatous craniopharyngioma. In contrast, BRAF or NRAS mutations were observed in 12 and two control samples of ameloblastoma, respectively. In HEK293 cells, overexpression of mutated CTNNB1 also upregulated hair keratin, a marker of ghost cells. Furthermore, ghost cells were present in two cases of ameloblastoma with BRAF and CTNNB1 mutations, indicating that ghost cells form due to mutations in CTNNB1. The data suggest that mutations in CTNNB1 are the major driver mutations of CCOT, and that CCOT is the genetic analog of pilomatrixoma and adamantinomatous craniopharyngioma in odontogenic tissue.
Directory of Open Access Journals (Sweden)
Vatn Morten
2008-12-01
Full Text Available Abstract Background Multiple epigenetic and genetic changes have been reported in colorectal tumors, but few of these have clinical impact. This study aims to pinpoint epigenetic markers that can discriminate between non-malignant and malignant tissue from the large bowel, i.e. markers with diagnostic potential. The methylation status of eleven genes (ADAMTS1, CDKN2A, CRABP1, HOXA9, MAL, MGMT, MLH1, NR3C1, PTEN, RUNX3, and SCGB3A1 was determined in 154 tissue samples including normal mucosa, adenomas, and carcinomas of the colorectum. The gene-specific and widespread methylation status among the carcinomas was related to patient gender and age, and microsatellite instability status. Possible CIMP tumors were identified by comparing the methylation profile with microsatellite instability (MSI, BRAF-, KRAS-, and TP53 mutation status. Results The mean number of methylated genes per sample was 0.4 in normal colon mucosa from tumor-free individuals, 1.2 in mucosa from cancerous bowels, 2.2 in adenomas, and 3.9 in carcinomas. Widespread methylation was found in both adenomas and carcinomas. The promoters of ADAMTS1, MAL, and MGMT were frequently methylated in benign samples as well as in malignant tumors, independent of microsatellite instability. In contrast, normal mucosa samples taken from bowels without tumor were rarely methylated for the same genes. Hypermethylated CRABP1, MLH1, NR3C1, RUNX3, and SCGB3A1 were shown to be identifiers of carcinomas with microsatellite instability. In agreement with the CIMP concept, MSI and mutated BRAF were associated with samples harboring hypermethylation of several target genes. Conclusion Methylated ADAMTS1, MGMT, and MAL are suitable as markers for early tumor detection.
International Nuclear Information System (INIS)
Hundt, Walter; Yuh, Esther L.; Steinbach, Silke; Bednarski, Mark D.; Guccione, Samira
2010-01-01
The purpose of this study was to investigate the effect of pulsed high-intensity focused ultrasound (HIFU) to tumor and muscle tissue. Pulsed HIFU was applied to tumor and muscle tissue in C3H/Km mice. Three hours after HIFU treatment pre- and post-contrast T1-wt, T2-wt images and a diffusion-wt STEAM-sequence were obtained. After MR imaging, the animals were euthenized and the treated tumor and muscle was taken out for histology and functional genomic analysis. In the tumor tissue a slight increase of the diffusion coefficient could be found. In the muscle tissue T2 images showed increased signal intensity and post-contrast T1 showed a decreased contrast uptake in the center and a severe contrast uptake in the surrounding muscle tissue. A significant increase of the diffusion coefficient was found. Gene expression analysis revealed profound changes in the expression levels of 29 genes being up-regulated and 3 genes being down-regulated in the muscle tissue and 31 genes being up-regulated and 15 genes being down-regulated in the SCCVII tumor tissue. Seven genes were up-regulated in both tissue types. The highest up-regulated gene in the tumor and muscle tissue encoded for Mouse histone H2A.1 gene (FC = 13.2 ± 20.6) and Apolipoprotein E (FC = 12.8 ± 27.4) respectively MHC class III (FC = 83.7 ± 67.4) and hsp70 (FC = 75.3 ± 85.0). Immunoblot confirmed the presence of HSP70 protein in the muscle tissue. Pulsed HIFU treatment on tumor and muscle tissue results in dramatic changes in gene expression, indicating that the effect of pulsed HIFU is in some regard dependent and also independent of the tissue type.
The Use of cDNA Microarray to Study Gene Expression in Wnt-1 Induced Mammary Tumors
National Research Council Canada - National Science Library
Huang, Shixia
2002-01-01
.... Specifically, we have collected tissue samples from virgin mammary glands, hyperplastic mammary glands, Wnt- 1 mammary tumors, and tumors metastasized to the lung, and compared their gene expression patterns...
Gene expression and hormone autonomy in radiation-induced tumors of Arabidopsis thaliana
International Nuclear Information System (INIS)
Persinger, S.M.; Town, C.D.
1989-01-01
In order to study the molecular genetics of factor controlling plant cell growth, we have isolated a group of radiation-induced tumors from Arabidopsis thaliana. Tumors appeared on plants derived from 60 Co gamma-irradiated seed or seedlings, and are capable of hormone-autonomous growth in culture. We have used vertebrate oncogene probes to explore the hypothesis that the tumors arose by the radiation-induced activation of growth-regulating plant oncogenes. One probe, int-2, was used to isolate cDNA clones representing an mRNA differentially expressed between tumors and hormone-dependent callus tissue. The genomic organization and function of this and other differentially expressed Arabidopsis sequences are being further characterized. A second area of study concerns the hormonal status of individual tumors. Tumor tissue varies in color, texture, and degree of differentiation: while some tumors appear undifferentiated, one consistently produces roots, and others occasionally develop shoots or leaflets. The tumors have characteristic growth rates on hormone-free medium, and growth in response to exogenous hormones differs among the tumors themselves and from wild-type. Characterization of the relationships between hormonal status, morphogenesis, and gene expression should yield valuable insights into the mechanisms regulating plant growth and development
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Rupal Sinha
Full Text Available Colorectal cancer (CRC development involves underlying modifications at genetic/epigenetic level. This study evaluated the role of Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation together/independently in sporadic CRC in Indian population and correlation with clinicopathological variables of the disease.One hundred and twenty four consecutive surgically resected tissues (62 tumor and equal number of normal adjacent controls of primary sporadic CRC were included and patient details including demographic characteristics, lifestyle/food or drinking habits, clinical and histopathological profiles were recorded. Polymerase chain reaction - Restriction fragment length polymorphism and direct sequencing for Kras gene mutation and Methylation Specific-PCR for RASSF1A, FHIT and MGMT genes was performed.Kras gene mutation at codon 12 & 13 and methylated RASSF1A, FHIT and MGMT gene was observed in 47%, 19%, 47%, 37% and 47% cases, respectively. Alcohol intake and smoking were significantly associated with presence of Kras mutation (codon 12 and MGMT methylation (p-value <0.049. Tumor stage and metastasis correlated with presence of mutant Kras codon 12 (p-values 0.018, 0.044 and methylated RASSF1A (p-values 0.034, 0.044, FHIT (p-values 0.001, 0.047 and MGMT (p-values 0.018, 0.044 genes. Combinatorial effect of gene mutation/methylation was also observed (p-value <0.025. Overall, tumor stage 3, moderately differentiated tumors, presence of lymphatic invasion and absence of metastasis was more frequently observed in tumors with mutated Kras and/or methylated RASSF1A, FHIT and MGMT genes.Synergistic interrelationship between these genes in sporadic CRC may be used as diagnostic/prognostic markers in assessing the overall pathological status of CRC.
Gene expression analysis supports tumor threshold over 2.0 cm for T-category breast cancer.
Solvang, Hiroko K; Frigessi, Arnoldo; Kaveh, Fateme; Riis, Margit L H; Lüders, Torben; Bukholm, Ida R K; Kristensen, Vessela N; Andreassen, Bettina K
2016-12-01
Tumor size, as indicated by the T-category, is known as a strong prognostic indicator for breast cancer. It is common practice to distinguish the T1 and T2 groups at a tumor size of 2.0 cm. We investigated the 2.0-cm rule from a new point of view. Here, we try to find the optimal threshold based on the differences between the gene expression profiles of the T1 and T2 groups (as defined by the threshold). We developed a numerical algorithm to measure the overall differential gene expression between patients with smaller tumors and those with larger tumors among multiple expression datasets from different studies. We confirmed the performance of the proposed algorithm by a simulation study and then applied it to three different studies conducted at two Norwegian hospitals. We found that the maximum difference in gene expression is obtained at a threshold of 2.2-2.4 cm, and we confirmed that the optimum threshold was over 2.0 cm, as indicated by a validation study using five publicly available expression datasets. Furthermore, we observed a significant differentiation between the two threshold groups in terms of time to local recurrence for the Norwegian datasets. In addition, we performed an associated network and canonical pathway analyses for the genes differentially expressed between tumors below and above the given thresholds, 2.0 and 2.4 cm, using the Norwegian datasets. The associated network function illustrated a cellular assembly of the genes for the 2.0-cm threshold: an energy production for the 2.4-cm threshold and an enrichment in lipid metabolism based on the genes in the intersection for the 2.0- and 2.4-cm thresholds.
Anti-tumor effects of Egr-IFN γ gene therapy combined with 125I-UdR radionuclide therapy
International Nuclear Information System (INIS)
Zhao Jingguo; Ni Yanjun; Song Xiangfu; Li Yanyi; Yang Wei; Sun Ting; Ma Qingjie; Gao Fengtong
2008-01-01
Objective: To explore the anti-tumor effects of Egr-IFNγ gene therapy combined with 125 I-UdR radionuclide therapy in mice bearing H22 hepatocarcinoma and its mechanism. Methods: The recombinant plasmid pcDNAEgr-IFNγ mixed with liposome was injected into tumor. 48 h later, 370 kBq 125 I-UdR was injected into tumor. The tumor growth rates at different times were observed. After 3 d gene-radionuclide therapy, the concentration of IFNγ in cytoplasm of H22 cells and cytotoxic activities of splenic CTL of the mice in different groups were examined. Results: The tumor growth rates of pcDNAEgr-IFNγ + 125 I-UdR group were obviously lower than those of control group, 125 I-UdR group and pcDNAEgr-1 + 125 I-UdR group 6-15 d after gene-radionuclide therapy. IFNγ protein was found in cytoplasm of H22 cells in pcDNAEgr-IFNγ + 125 I-UdR group after 3 d gene-radionuclide therapy. Cytotoxic activity of splenic CTL in pcDNAEgr-IFNγ + 125 I-UdR group was significantly higher than that in the other groups (P 125 I-UdR radionuclide therapy are better than those of 125 I-UdR therapy. (authors)
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
Martin-Montalvo, Alejandro; Lorenzo, Petra I; López-Noriega, Livia; Gauthier, Benoit R
2017-01-01
Four members of the PAX family, PAX2, PAX4, PAX6 and PAX8 are known to be expressed in the pancreas. Accumulated evidences indicate that several pancreatic expressed PAX genes play a significant role in pancreatic development/functionality and alterations in these genes are involved in the pathogenesis of pancreatic diseases. Areas covered: In this review, we summarize the ongoing research related to pancreatic PAX genes in diabetes mellitus and pancreatic neuroendocrine tumors. We dissect the current knowledge at different levels; from mechanistic studies in cell lines performed to understand the molecular processes controlled by pancreatic PAX genes, to in vivo studies using rodent models that over-express or lack specific PAX genes. Finally, we describe human studies associating variants on pancreatic-expressed PAX genes with pancreatic diseases. Expert opinion: Based on the current literature, we propose that future interventions to treat pancreatic neuroendocrine tumors and diabetes mellitus could be developed via the modulation of PAX4 and/or PAX6 regulated pathways.
Directory of Open Access Journals (Sweden)
Oana Tudoran
Full Text Available Breast cancer prognosis and treatment is highly dependent on the molecular features of the primary tumors. These tumors release specific molecules into the environment that trigger characteristic responses into the circulatory cells. In this study we investigated the expression pattern of 84 genes known to be involved in breast cancer signaling in the peripheral blood of breast cancer patients with ER-, PR- primary tumors. The patients were grouped according to Her2 expression on the primary tumors in Her2+ and Her2- cohorts. Transcriptional analysis revealed 15 genes to be differentially expressed between the two groups highlighting that Her2 signaling in primary tumors could be associated with specific blood gene expression. We found CCNA1 to be up-regulated, while ERBB2, RASSF1, CDH1, MKI67, GATA3, GLI1, SFN, PTGS2, JUN, NOTCH1, CTNNB1, KRT8, SRC, and HIC1 genes were down-regulated in the blood of triple negative breast cancer patients compared to Her2+ cohort. IPA network analysis predicts that the identified genes are interconnected and regulate each other. These genes code for cell cycle regulators, cell adhesion molecules, transcription factors or signal transducers that modulate immune signaling, several genes being also associated with cancer progression and treatment response. These results indicate an altered immune signaling in the peripheral blood of triple negative breast cancer patients. The involvement of the immune system is necessary in favorable treatment response, therefore these results could explain the low response rates observed for triple negative breast cancer patients.
Wang, Kui; Kievit, Forrest M; Florczyk, Stephen J; Stephen, Zachary R; Zhang, Miqin
2015-10-12
Cationic nanoparticles (NPs) for targeted gene delivery are conventionally evaluated using 2D in vitro cultures. However, this does not translate well to corresponding in vivo studies because of the marked difference in NP behavior in the presence of the tumor microenvironment. In this study, we investigated whether prostate cancer (PCa) cells cultured in three-dimensional (3D) chitosan-alginate (CA) porous scaffolds could model cationic NP-mediated gene targeted delivery to tumors in vitro. We assessed in vitro tumor cell proliferation, formation of tumor spheroids, and expression of marker genes that promote tumor malignancy in CA scaffolds. The efficacy of NP-targeted gene delivery was evaluated in PCa cells in 2D cultures, PCa tumor spheroids grown in CA scaffolds, and PCa tumors in a mouse TRAMP-C2 flank tumor model. PCa cells cultured in CA scaffolds grew into tumor spheroids and displayed characteristics of higher malignancy as compared to those in 2D cultures. Significantly, targeted gene delivery was only observed in cells cultured in CA scaffolds, whereas cells cultured on 2D plates showed no difference in gene delivery between targeted and nontarget control NPs. In vivo NP evaluation confirmed targeted gene delivery, indicating that only CA scaffolds correctly modeled NP-mediated targeted delivery in vivo. These findings suggest that CA scaffolds serve as a better in vitro platform than 2D cultures for evaluation of NP-mediated targeted gene delivery to PCa.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Directory of Open Access Journals (Sweden)
Liao Dezhong J
2008-01-01
Full Text Available Abstract Background Pancreatic carcinoma usually is a fatal disease with no cure, mainly due to its invasion and metastasis prior to diagnosis. We analyzed the gene expression profiles of paired primary pancreatic tumors and metastatic lesions from Ela-c-myc transgenic mice in order to identify genes that may be involved in the pancreatic cancer progression. Differentially expressed selected genes were verified by semi-quantitative and quantitative RT-PCR. To further evaluate the relevance of some of the selected differentially expressed genes, we investigated their expression pattern in human pancreatic cancer cell lines with high and low metastatic potentials. Results Data indicate that genes involved in posttranscriptional regulation were a major functional category of upregulated genes in both primary pancreatic tumors (PT and liver metastatic lesions (LM compared to normal pancreas (NP. In particular, differential expression for splicing factors, RNA binding/pre-mRNA processing factors and spliceosome related genes were observed, indicating that RNA processing and editing related events may play critical roles in pancreatic tumor development and progression. High expression of insulin growth factor binding protein-1 (Igfbp1 and Serine proteinase inhibitor A1 (Serpina1, and low levels or absence of Wt1 gene expression were exclusive to liver metastatic lesion samples. Conclusion We identified Igfbp1, Serpina1 and Wt1 genes that are likely to be clinically useful biomarkers for prognostic or therapeutic purposes in metastatic pancreatic cancer, particularly in pancreatic cancer where c-Myc is overexpressed.
Thakur, Archana; Bollig, Aliccia; Wu, Jiusheng; Liao, Dezhong J
2008-01-24
Pancreatic carcinoma usually is a fatal disease with no cure, mainly due to its invasion and metastasis prior to diagnosis. We analyzed the gene expression profiles of paired primary pancreatic tumors and metastatic lesions from Ela-c-myc transgenic mice in order to identify genes that may be involved in the pancreatic cancer progression. Differentially expressed selected genes were verified by semi-quantitative and quantitative RT-PCR. To further evaluate the relevance of some of the selected differentially expressed genes, we investigated their expression pattern in human pancreatic cancer cell lines with high and low metastatic potentials. Data indicate that genes involved in posttranscriptional regulation were a major functional category of upregulated genes in both primary pancreatic tumors (PT) and liver metastatic lesions (LM) compared to normal pancreas (NP). In particular, differential expression for splicing factors, RNA binding/pre-mRNA processing factors and spliceosome related genes were observed, indicating that RNA processing and editing related events may play critical roles in pancreatic tumor development and progression. High expression of insulin growth factor binding protein-1 (Igfbp1) and Serine proteinase inhibitor A1 (Serpina1), and low levels or absence of Wt1 gene expression were exclusive to liver metastatic lesion samples. We identified Igfbp1, Serpina1 and Wt1 genes that are likely to be clinically useful biomarkers for prognostic or therapeutic purposes in metastatic pancreatic cancer, particularly in pancreatic cancer where c-Myc is overexpressed.
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Regulation of radiation-induced apoptosis by early growth response-1 gene in solid tumors
International Nuclear Information System (INIS)
Ahmed, M.
2003-01-01
Ionizing radiation exposure is associated with activation of certain immediate-early genes that function as transcription factors. These include members of jun or fos and early growth response (EGR) gene families. In particular, the functional role of EGR-1 in radiation-induced signaling is pivotal since the promoter of EGR-1 contains radiation-inducible CArG DNA sequences. The Egr-1 gene belongs to a family of Egr genes that includes EGR-2, EGR-3, EGR-4, EGR-α and the tumor suppressor, Wilms' tumor gene product, WT1. The Egr-1 gene product, EGR-1, is a nuclear protein that contains three zinc fingers of the C 2 H 2 subtype. The EGR-1 GC-rich consensus target sequence, 5'-GCGT/GGGGCG-3' or 5'-TCCT/ACCTCCTCC-3', has been identified in the promoter regions of transcription factors, growth factors, receptors, cell cycle regulators and pro-apoptotic genes. The gene targets mediated by Egr-1 in response to ionizing radiation include TNF-α , p53, Rb and Bax, all these are effectors of apoptosis. Based on these targets, Egr-1 is a pivotal gene that initiates early signal transduction events in response to ionizing radiation leading to either growth arrest or cell death in tumor cells. There are two potential application of Egr-1 gene in therapy of cancer. First, the Egr-1 promoter contains information for appropriate spatial and temporal expression in-vivo that can be regulated by ionizing radiation to control transcription of genes that have pro-apoptotic and suicidal function. Secondly, EGR-1 protein can eliminate 'induced-radiation resistance' by inhibiting the functions of radiation-induced pro-survival genes (NFκB activity and bcl-2 expression) and activate pro-apoptotic genes (such as bax) to confer a significant radio-sensitizing effect. Together, the reported findings from my laboratory demonstrate clearly that EGR-1 is an early central gene that confers radiation sensitivity and its pro-apoptotic functions are synergized by abrogation of induced radiation
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Directory of Open Access Journals (Sweden)
Ram Prakash Gupta
2017-11-01
Full Text Available During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Eyeless (Ey, and the segment selector, Ultrabithorax (Ubx, readily cooperate to bring about neoplastic transformation of cells displaying somatic loss of the tumor suppressor, Lgl, but in only those developmental domains that express the homeo-box protein, Homothorax (Hth, and/or the Zinc-finger protein, Teashirt (Tsh. In non-Hth/Tsh-expressing domains of these imaginal discs, however, gain of Ey in lgl− somatic clones induces neoplastic transformation in the distal wing disc and haltere, but not in the eye imaginal disc. Likewise, gain of Ubx in lgl− somatic clones induces transformation in the eye imaginal disc but not in its endogenous domain, namely, the haltere imaginal disc. Our results reveal that selector genes could behave as tumor drivers or inhibitors depending on the tissue contexts of their gains.
T cells specific for neoantigens encoded by mutated genes in cancers are increasingly recognized as mediators of tumor destruction after immune checkpoint inhibitor therapy or adoptive cell transfer. Unfortunately, most neoantigens result from random mutations and are patient specific, and some cancers contain few mutations to serve as potential antigens. We describe a patient with stage IV acral melanoma who obtained a complete response following adoptive transfer of tumor infiltrating lymphocytes (TIL).
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma
Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.
2012-01-01
Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009
Directory of Open Access Journals (Sweden)
Hong Wei Yang
2001-01-01
Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu
2005-07-20
Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.
Ohe, Chisato; Kuroda, Naoto; Hes, Ondrej; Michal, Michal; Vanecek, Tomas; Grossmann, Petr; Tanaka, Yukichi; Tanaka, Mio; Inui, Hidekazu; Komai, Yoshihiro; Matsuda, Tadashi; Uemura, Yoshiko
2012-12-01
We present a case of renal epithelioid angiomyolipoma (eAML)/perivascular epithelioid cell tumor (PEComa) with a TFE3 gene break visible by fluorescence in situ hybridization (FISH). Histologically, the tumor was composed of mainly epithelioid cells forming solid arrangements with small foci of spindle cells. In a small portion of the tumor, neoplastic cells displayed nuclear pleomorphism, such as polygonal and enlarged vesicular nuclei with prominent nucleoli. Marked vascularity was noticeable in the background, and perivascular hyaline sclerosis was also seen. Immunohistochemically, neoplastic cells were diffusely positive for α-smooth muscle actin and melanosome in the cytoplasm. Nuclei of many neoplastic cells were positive for TFE3. FISH analysis of the TFE3 gene break using the Poseidon TFE3 (Xp11) Break probe revealed positive results. Reverse transcriptase-polymerase chain reactions (RT-PCR) for ASPL/TFE3, PRCC/TFE3, CLTC/TFE3, PSF/TFE3, and NonO/TFE3 gene fusions all revealed negative results. This is the first reported case of renal eAML/PEComa with a TFE3 gene break, and it has unique histological findings as compared to previously reported TFE3 gene fusion-positive PEComas. Pathologists should recognize that PEComa with TFE3 gene fusion can arise even in the kidney.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Directory of Open Access Journals (Sweden)
Dachs Gabi U
2004-11-01
Full Text Available Abstract Background Electroporation is currently receiving much attention as a way to increase drug and DNA delivery. Recent studies demonstrated the feasibility of electrogene therapy using a range of therapeutic genes for the treatment of experimental tumors. However, the transfection efficiency of electroporation-assisted DNA delivery is still low compared to viral methods and there is a clear need to optimize this approach. In order to optimize treatment, knowledge about spatial and time dependency of gene expression following delivery is of utmost importance in order to improve gene delivery. Intravital microscopy of tumors growing in dorsal skin fold window chambers is a useful method for monitoring gene transfection, since it allows non-invasive dynamic monitoring of gene expression in tumors in a live animal. Methods Intravital microscopy was used to monitor real time spatial distribution of the green fluorescent protein (GFP and time dependence of transfection efficiency in syngeneic P22 rat tumor model. DNA alone, liposome-DNA complexes and electroporation-assisted DNA delivery using two different sets of electric pulse parameters were compared. Results Electroporation-assisted DNA delivery using 8 pulses, 600 V/cm, 5 ms, 1 Hz was superior to other methods and resulted in 22% increase in fluorescence intensity in the tumors up to 6 days post-transfection, compared to the non-transfected area in granulation tissue. Functional GFP was detected within 5 h after transfection. Cells expressing GFP were detected throughout the tumor, but not in the surrounding tissue that was not exposed to electric pulses. Conclusions Intravital microscopy was demonstrated to be a suitable method for monitoring time and spatial distribution of gene expression in experimental tumors and provided evidence that electroporation-assisted gene delivery using 8 pulses, 600 V/cm, 5 ms, 1 Hz is an effective method, resulting in early onset and homogenous
Directory of Open Access Journals (Sweden)
Lanfen Huo
2016-09-01
Full Text Available Notch signaling is a highly conserved signaling pathway, playing an important role in a variety of cell differentiation, development and regulation. Notch signaling includes Notch1-4; Notch1 gene encodes Notch1 signaling that can shorten cell cycle, enhance cell proliferation, inhibit cell differentiation, and promote apoptosis. Mutation and overexpression of the Notch1 gene may induce tumorigenesis, which plays an important role in the development of tumors across a variety of signaling pathways. Currently, using RNA interference technology (RNAi synthesizing small interference RNA (siRNA targeting Notch1 gene(siNotch1)has become a hot topic, and clinical application of gene silencing has also obtained a certain therapeutic effect. In this paper, the application of Notch1 gene silencing in tumor progress was reviewed.
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Duan, Xiaoping; Guan, Hui; Cao, Ying; Kleinerman, Eugenie S
2009-01-01
This study evaluated the therapeutic efficacy of interleukin 12 (IL-12) gene therapy in Ewing sarcoma and whether murine mesenchymal stem cells (MSCs) could serve as vehicles for IL-12 gene delivery. MSCs were isolated from murine bone marrow cells. Cells were phenotyped using flow cytometry. Cultured MSCs differentiated into osteocytes and adipocytes using the appropriate media. Freshly isolated MSCs were transfected with adenoviral vectors containing either the beta-galactosidase (Ad:beta-gal) or the IL-12 (Ad:IL-12) gene. Expression of IL-12 was confirmed using reverse transcription polymerase chain reaction. Mice with TC71 Ewing sarcoma tumors were then treated intravenously with MSCs transfected with Ad:beta-gal or Ad:IL-12. Tumors were measured and analyzed by immunohistochemical analysis for expression of IL-12 protein. Expression of both p35 and p40 IL-12 subunits was demonstrated in MSCs transfected in vitro with Ad:IL-12. IL-12 expression was seen in tumors from mice treated with MSCs transfected with Ad:IL-12. Tumor growth was also significantly inhibited compared with that in mice treated with MSCs transfected with Ad:beta-gal. MSCs can be transfected with the IL-12 gene. These transfected cells localize to tumors after intravenous injection and induce local IL-12 protein production and the regression of established tumors. Copyright (c) 2008 American Cancer Society.
Van Tendeloo, V F; Ponsaerts, P; Lardon, F; Nijs, G; Lenjou, M; Van Broeckhoven, C; Van Bockstaele, D R; Berneman, Z N
2001-07-01
Designing effective strategies to load human dendritic cells (DCs) with tumor antigens is a challenging approach for DC-based tumor vaccines. Here, a cytoplasmic expression system based on mRNA electroporation to efficiently introduce tumor antigens into DCs is described. Preliminary experiments in K562 cells using an enhanced green fluorescent protein (EGFP) reporter gene revealed that mRNA electroporation as compared with plasmid DNA electroporation showed a markedly improved transfection efficiency (89% versus 40% EGFP(+) cells, respectively) and induced a strikingly lower cell toxicity (15% death rate with mRNA versus 51% with plasmid DNA). Next, mRNA electroporation was applied for nonviral transfection of different types of human DCs, including monocyte-derived DCs (Mo-DCs), CD34(+) progenitor-derived DCs (34-DCs) and Langerhans cells (34-LCs). High-level transgene expression by mRNA electroporation was obtained in more than 50% of all DC types. mRNA-electroporated DCs retained their phenotype and maturational potential. Importantly, DCs electroporated with mRNA-encoding Melan-A strongly activated a Melan-A-specific cytotoxic T lymphocyte (CTL) clone in an HLA-restricted manner and were superior to mRNA-lipofected or -pulsed DCs. Optimal stimulation of the CTL occurred when Mo-DCs underwent maturation following mRNA transfection. Strikingly, a nonspecific stimulation of CTL was observed when DCs were transfected with plasmid DNA. The data clearly demonstrate that Mo-DCs electroporated with mRNA efficiently present functional antigenic peptides to cytotoxic T cells. Therefore, electroporation of mRNA-encoding tumor antigens is a powerful technique to charge human dendritic cells with tumor antigens and could serve applications in future DC-based tumor vaccines.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
DEFF Research Database (Denmark)
Higgins, Geoff S; Prevo, Remko; Lee, Yin-Fai
2010-01-01
The effectiveness of radiotherapy treatment could be significantly improved if tumor cells could be rendered more sensitive to ionizing radiation (IR) without altering the sensitivity of normal tissues. However, many of the key therapeutically exploitable mechanisms that determine intrinsic tumor...... radiosensitivity are largely unknown. We have conducted a small interfering RNA (siRNA) screen of 200 genes involved in DNA damage repair aimed at identifying genes whose knockdown increased tumor radiosensitivity. Parallel siRNA screens were conducted in irradiated and unirradiated tumor cells (SQ20B......) and irradiated normal tissue cells (MRC5). Using gammaH2AX foci at 24 hours after IR, we identified several genes, such as BRCA2, Lig IV, and XRCC5, whose knockdown is known to cause increased cell radiosensitivity, thereby validating the primary screening end point. In addition, we identified POLQ (DNA...
Analysis of a Novel 17q25 Cell Cycle Gene Homolog: Is it a Breast Tumor Suppressor Gene?
National Research Council Canada - National Science Library
Kalikin, Linda
2000-01-01
... of these molecular reagents into successful tools for the medical management of breast cancer. We hypothesize that a 350 kb region on 17q25 detected by our allelic imbalance studies harbors a novel breast tumor suppressor gene...
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Directory of Open Access Journals (Sweden)
Jae-Ho Jeong
Full Text Available Bacterial cancer therapy relies on the fact that several bacterial species are capable of targeting tumor tissue and that bacteria can be genetically engineered to selectively deliver therapeutic proteins of interest to the targeted tumors. However, the challenge of bacterial cancer therapy is the release of the therapeutic proteins from the bacteria and entry of the proteins into tumor cells. This study employed an attenuated Salmonella typhimurium to selectively deliver the mitochondrial targeting domain of Noxa (MTD as a potential therapeutic cargo protein, and examined its anti-cancer effect. To release MTD from the bacteria, a novel bacterial lysis system of phage origin was deployed. To facilitate the entry of MTD into the tumor cells, the MTD was fused to DS4.3, a novel cell-penetrating peptide (CPP derived from a voltage-gated potassium channel (Kv2.1. The gene encoding DS4.3-MTD and the phage lysis genes were placed under the control of PBAD , a promoter activated by L-arabinose. We demonstrated that DS4.3-MTD chimeric molecules expressed by the Salmonellae were anti-tumoral in cultured tumor cells and in mice with CT26 colon carcinoma.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Energy Technology Data Exchange (ETDEWEB)
Breton, E.; Goetz, Ch.; Aubertin, G.; Constantinesco, A.; Choquet, Ph. [Service de biophysique et medecine nucleaire, hopital de Hautepierre, CHRU de Strasbourg, 67 - Strasbourg (France); Institut de mecanique des fluides et des solides, CNRS, universite de Strasbourg, 67 - Strasbourg (France); Kintz, J.; Accart, N.; Grellier, B.; Erbs, Ph.; Rooke, R. [Transgene SA, parc d' innovation, 67 - Illkirch Graffenstaden (France)
2010-03-15
Purpose The aim of this study was to monitor in vivo with low field MRI growth of a murine ortho-topic glioma model following a suicide gene therapy. Methods The gene therapy consisted in the stereotactic injection in the mice brain of a modified vaccinia virus Ankara (M.V.A.) vector encoding for a suicide gene (FCU1) that transforms a non toxic pro-drug 5-fluoro-cytosine (5-F.C.) to its highly cytotoxic derivatives 5-fluorouracil (5-F.U.) and 5-fluoro-uridine-5 monophosphate (5-F.U.M.P.). Using a warmed-up imaging cell, sequential 3D T1 and T2 0.1T MRI brain examinations were performed on 16 Swiss female nu/nu mice bearing ortho-topic human glioblastoma (U 87-MG cells). The 6-week in vivo MRI follow-up consisted in a weekly measurement of the intracerebral tumor volume leading to a total of 65 examinations. Mice were divided in four groups: sham group (n = 4), sham group treated with 5-F.C. only (n = 4), sham group with injection of M.V.A.-FCU1 vector only (n = 4), therapy group administered with M.V.A.-FCU1 vector and 5-F.C. (n = 4). Measurements of tumor volumes were obtained after manual segmentation of T1- and T2-weighted images. Results Intra-observer and inter-observer tumor volume measurements show no significant differences. No differences were found between T1 and T2 volume tumor doubling times between the three sham groups. A significant statistical difference (p < 0.05) in T1 and T2 volume tumor doubling times between the three sham groups and the animals treated with the intratumoral injection of M.V.A.-FCU1 vector in combination with 2 weeks per os 5-F.C. administration was demonstrated. Conclusion Preclinical low field MRI was able to monitor efficacy of suicide gene therapy in delaying the tumor growth in an in vivo mouse model of ortho-topic glioblastoma. (authors)
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Directory of Open Access Journals (Sweden)
Preethi Sankaranarayanan
Full Text Available The number of large-scale high-dimensional datasets recording different aspects of a single disease is growing, accompanied by a need for frameworks that can create one coherent model from multiple tensors of matched columns, e.g., patients and platforms, but independent rows, e.g., probes. We define and prove the mathematical properties of a novel tensor generalized singular value decomposition (GSVD, which can simultaneously find the similarities and dissimilarities, i.e., patterns of varying relative significance, between any two such tensors. We demonstrate the tensor GSVD in comparative modeling of patient- and platform-matched but probe-independent ovarian serous cystadenocarcinoma (OV tumor, mostly high-grade, and normal DNA copy-number profiles, across each chromosome arm, and combination of two arms, separately. The modeling uncovers previously unrecognized patterns of tumor-exclusive platform-consistent co-occurring copy-number alterations (CNAs. We find, first, and validate that each of the patterns across only 7p and Xq, and the combination of 6p+12p, is correlated with a patient's prognosis, is independent of the tumor's stage, the best predictor of OV survival to date, and together with stage makes a better predictor than stage alone. Second, these patterns include most known OV-associated CNAs that map to these chromosome arms, as well as several previously unreported, yet frequent focal CNAs. Third, differential mRNA, microRNA, and protein expression consistently map to the DNA CNAs. A coherent picture emerges for each pattern, suggesting roles for the CNAs in OV pathogenesis and personalized therapy. In 6p+12p, deletion of the p21-encoding CDKN1A and p38-encoding MAPK14 and amplification of RAD51AP1 and KRAS encode for human cell transformation, and are correlated with a cell's immortality, and a patient's shorter survival time. In 7p, RPA3 deletion and POLD2 amplification are correlated with DNA stability, and a longer survival
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
Study on radiation-inducible genes
Energy Technology Data Exchange (ETDEWEB)
Lim, Sang Yong; Kim, Dong Ho; Joe, Min Ho; Song, Hyu Npa
2012-01-15
Transcription of previously identified radiation-inducible genes, uscA and cyoA, was examined responding to radiation. The putative promoter regions of both genes were cloned into pRS415 vector containing lacZ, and the core promoter region necessary for radiation response were determined through promoter deletion method. To investigate the role of uscA, which is assumed to be small RNA related with radiation response, a deletion mutant strain of uscA was constructed. However, uscA deletion did not affect bacterial survival against radiation exposure. The use of bacteria as anticancer agents has attracted interest. In this study, we tried to develop tumor targeting bacteria in which the radiation-inducible promoter activate a transgene encoding a cytotoxic protein. For outward secretion of anticancer protein produced inside bacteria, the N-terminal 140 amino acid of SspH1 was found to function as a secretion signal peptide. To create an attenuated tumor-targeting bacteria, Salmonella ptsI mutant strain was constructed, and we found that its virulence decreased. Finally, the tumor-targeting ability of ptsI mutant was verified by the use of in-vivo imaging analysis.
Study on radiation-inducible genes
International Nuclear Information System (INIS)
Lim, Sang Yong; Kim, Dong Ho; Joe, Min Ho; Song, Hyu Npa
2012-01-01
Transcription of previously identified radiation-inducible genes, uscA and cyoA, was examined responding to radiation. The putative promoter regions of both genes were cloned into pRS415 vector containing lacZ, and the core promoter region necessary for radiation response were determined through promoter deletion method. To investigate the role of uscA, which is assumed to be small RNA related with radiation response, a deletion mutant strain of uscA was constructed. However, uscA deletion did not affect bacterial survival against radiation exposure. The use of bacteria as anticancer agents has attracted interest. In this study, we tried to develop tumor targeting bacteria in which the radiation-inducible promoter activate a transgene encoding a cytotoxic protein. For outward secretion of anticancer protein produced inside bacteria, the N-terminal 140 amino acid of SspH1 was found to function as a secretion signal peptide. To create an attenuated tumor-targeting bacteria, Salmonella ptsI mutant strain was constructed, and we found that its virulence decreased. Finally, the tumor-targeting ability of ptsI mutant was verified by the use of in-vivo imaging analysis
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
Imaging gene expression in gene therapy
International Nuclear Information System (INIS)
Wiebe, Leonard I.
1997-01-01
Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Wang, Wen-Chung; Lee, Ya-Ting; Lai, Yen-Chein
2017-03-27
Granulosa cell tumors are rare ovarian malignancies. Their characteristics include unpredictable indolent growth with malignant potential and late recurrence. Approximately 95% are of adult type. Recent molecular studies have characterized the FOXL2 402C > G mutation in adult granulosa cell tumor. Our previous case report showed that unique FOXL2 402C > G mutation and defective DNA mismatch repair system are associated with the development of adult granulosa cell tumor. In this study, the DNA sequences of four genes, MSH2, MLH1, MSH6, and PMS2, in the DNA mismatch repair system were determined via direct sequencing to elucidate the exact mechanism for the development of this granulosa cell tumor. The results showed that two missense germline mutations, T485K and N775L, inactivate the PMS2 gene. The results of this case study indicated that although FOXL2 402C > G mutation determines the development of granulosa cell tumor, PMS2 mutation may be the initial driver of carcinogenesis. Immunohistochemistry-based tumor testing for mismatch repair gene expression may be necessary for granulosa cell tumors to determine their malignant potential or if they are part of Lynch syndrome.
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
International Nuclear Information System (INIS)
Wang, Changdong; Ma, Yongping; Hu, Qiongwen; Xie, Tingting; Wu, Jiayan; Zeng, Fan; Song, Fangzhou
2016-01-01
Directly targeting therapeutic suicide gene to a solid tumor is a hopeful approach for cancer gene therapy. Treatment of a solid tumor by an effective vector for a suicide gene remains a challenge. Given the lack of effective treatments, we constructed a bifidobacterial recombinant thymidine kinase (BF-rTK) -ganciclovir (GCV) targeting system (BKV) to meet this requirement and to explore antitumor mechanisms. Bifidobacterium (BF) or BF-rTK was injected intratumorally with or without ganciclovir in a human colo320 intestinal xenograft tumor model. The tumor tissues were analyzed using apoptosis antibody arrays, real time PCR and western blot. The colo320 cell was analyzed by the gene silencing method. Autophagy and necroptosis were also detected in colo320 cell. Meanwhile, three human digestive system xenograft tumor models (colorectal cancer colo320, gastric cancer MKN-45 and liver cancer SSMC-7721) and a breast cancer (MDA-MB-231) model were employed to validate the universality of BF-rTK + GCV in solid tumor gene therapy. The survival rate was evaluated in three human cancer models after the BF-rTK + GCV intratumor treatment. The analysis of inflammatory markers (TNF-α) in tumor indicated that BF-rTK + GCV significantly inhibited TNF-α expression. The results suggested that BF-rTK + GCV induced tumor apoptosis without autophagy and necroptosis occurrence. The apoptosis was transduced by multiple signaling pathways mediated by FasL and TNFR2 and mainly activated the mitochondrial control of apoptosis via Bid and Bim, which was rescued by silencing Bid or/and Bim. However, BF + GCV only induced apoptosis via Fas/FasL signal pathway accompanied with increased P53 expression. We further found that BF-rTK + GCV inhibited the expression of the inflammatory maker of TNF-α. However, BF-rTK + GCV did not result in necroptosis and autophagy. BF-rTK + GCV induced tumor apoptosis mediated by FasL and TNFR2 through the mitochondrial control of apoptosis via Bid and Bim
Recombinant lambda-phage nanobioparticles for tumor therapy in mice models.
Ghaemi, Amir; Soleimanjahi, Hoorieh; Gill, Pooria; Hassan, Zuhair; Jahromi, Soodeh Razeghi M; Roohvand, Farzin
2010-05-12
Lambda phages have considerable potential as gene delivery vehicles due to their genetic tractability, low cost, safety and physical characteristics in comparison to other nanocarriers and gene porters. Little is known concerning lambda phage-mediated gene transfer and expression in mammalian hosts. We therefore performed experiments to evaluate lambda-ZAP bacteriophage-mediated gene transfer and expression in vitro. For this purpose, we constructed recombinant lambda-phage nanobioparticles containing a mammalian expression cassette encoding enhanced green fluorescent protein (EGFP) and E7 gene of human papillomavirus type 16 (lambda-HPV-16 E7) using Lambda ZAP- CMV XR vector. Four cell lines (COS-7, CHO, TC-1 and HEK-239) were transduced with the nanobioparticles. We also characterized the therapeutic anti-tumor effects of the recombinant lambda-HPV-16 E7 phage in C57BL/6 tumor mice model as a cancer vaccine. Obtained results showed that delivery and expression of these genes in fibroblastic cells (COS-7 and CHO) are more efficient than epithelial cells (TC-1 and HEK-239) using these nanobioparticles. Despite the same phage M.O.I entry, the internalizing titers of COS-7 and CHO cells were more than TC-1 and HEK-293 cells, respectively. Mice vaccinated with lambda-HPV-16 E7 are able to generate potent therapeutic antitumor effects against challenge with E7- expressing tumor cell line, TC-1 compared to group treated with the wild phage. The results demonstrated that the recombinant lambda-phages, due to their capabilities in transducing mammalian cells, can also be considered in design and construction of novel and safe phage-based nanomedicines.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
NUTM1 Gene Fusions Characterize a Subset of Undifferentiated Soft Tissue and Visceral Tumors.
Dickson, Brendan C; Sung, Yun-Shao; Rosenblum, Marc K; Reuter, Victor E; Harb, Mohammed; Wunder, Jay S; Swanson, David; Antonescu, Cristina R
2018-05-01
NUT midline carcinoma is an aggressive tumor that occurs mainly in the head and neck and, less frequently, the mediastinum and lung. Following identification of an index case of a NUTM1 fusion positive undifferentiated soft tissue tumor, we interrogated additional cases of primary undifferentiated soft tissue and visceral tumors for NUTM1 abnormalities. Targeted next-generation sequencing was performed on RNA extracted from formalin-fixed paraffin-embedded tissue, and results validated by fluorescence in situ hybridization using custom bacterial artificial chromosome probes. Six patients were identified: mean age of 42 years (range, 3 to 71 y); equal sex distribution; and, tumors involved the extremity soft tissues (N=2), kidney (N=2), stomach, and brain. On systemic work-up at presentation all patients lacked a distant primary tumor. Morphologically, the tumors were heterogenous, with undifferentiated round-epithelioid-rhabdoid cells arranged in solid sheets, nests, and cords. Mitotic activity was generally brisk. Four cases expressed pancytokeratin, but in only 2 cases was this diffuse. Next-generation sequencing demonstrated the following fusions: BRD4-NUTM1 (3 cases), BRD3-NUTM1, MXD1-NUTM1, and BCORL1-NUTM1. Independent testing by fluorescence in situ hybridization confirmed the presence of NUTM1 and partner gene rearrangement. This study establishes that NUT-associated tumors transgress the midline and account for a subset of primitive neoplasms occurring in soft tissue and viscera. Tumors harboring NUTM1 gene fusions are presumably underrecognized, and the extent to which they account for undifferentiated mesenchymal, neuroendocrine, and/or epithelial neoplasms is unclear. Moreover, the relationship, if any, between NUT-associated tumors in soft tissue and/or viscera, and conventional NUT carcinoma, remains to be elucidated.
A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene
Directory of Open Access Journals (Sweden)
Sanambar Sadighi
2017-02-01
Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Directory of Open Access Journals (Sweden)
Igor Proscurshim
2007-03-01
Full Text Available RACIONAL: Um dos mecanismos genéticos presentes em aproximadamente 80% dos pacientes com síndrome hereditária não-polipóide do câncer colorretal (HNPCC são os defeitos nos genes reparadores de DNA, como o MSH2, MSH6 e MLH1, onde os tumores sincrônicos são relativamente freqüentes. Já no câncer colorretal esporádico as lesões sincrônicas são raras. OBJETIVO: Verificar se o mesmo mecanismo genético presente no HNPCC está presente no câncer colorretal esporádico que apresentam com lesões sincrônicas. MÉTODOS: Foram incluídos no estudo todos os pacientes com câncer colorretal sincrônico não HNPCC. Imunoistoquímica com anticorpos para MSH2,MSH6, e MLH1 foi realizada para cada tumor. RESULTADOS: Todos os pacientes apresentaram expressão normal de MSH2 e MLH1. O único gene com imunoexpressão alterada foi o MSH6. CONCLUSÃO: Possivelmente outro mecanismo genético seja responsável pelo surgimento de dois tumores sincrônicos no câncer colorretal esporádico.BACKGROUND: Mismatch repair genes (such as MSH2, MLH1 and MSH6 mutations are present in over 80% of hereditary non-polyposis colorectal cancer (HNPCC tumors, which frequently exhibit synchronous lesions. Sporadic colorectal cancer is rarely associated with synchronous lesions. AIM: To investigate the role of mismatch repair gene mutation in synchronous sporadic colorectal cancer. METHODS: Patients with sporadic synchronous colorectal adenocarcinomas were included in the study. Immunohistochemistry was performed using MSH2, MLH1 and MSH6 antibodies. RESULTS: All patients had two synchoronous lesions. None of them had altered MSH2 or MLH1 expression. One patient had altered MSH6 expression in both tumors. CONCLUSION: Possibly, other molecular mechanisms are involved in carcinogenesis of sporadic synchronous colorectal cancer.
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Molecular studies on the function of tumor suppressor gene in gastrointestinal cancer
International Nuclear Information System (INIS)
Kim, You Cheoul
1993-01-01
Cancer of stomach, colon and liver are a group of the most common cancer in Korea. However, results with current therapeutic modalities are still unsatisfactory. The intensive efforts have been made to understand basic pathogenesis and to find better therapeutic tools for the treatment of this miserable disease. We studies the alteration of tumor suppressor gene in various Gastrointestinal cancer in Korea. Results showed that genetic alteration of Rb gene was in 83% of colorectal cancer. Our results suggest that genetic alteration of Rb gene is crucially involved in the tumorigenesis of colorectum in Korea. (Author)
Directory of Open Access Journals (Sweden)
Marcel A. Deken
2016-12-01
Full Text Available Current genetically-engineered mouse melanoma models are often based on Tyr::CreERT2-controlled MAPK pathway activation by the BRAFV600E mutation and PI3K pathway activation by loss of PTEN. The major drawback of these models is the occurrence of spontaneous tumors caused by leakiness of the Tyr::CreERT2 system, hampering long-term experiments. To address this problem, we investigated several approaches to optimally provide local delivery of Cre recombinase, including injection of lentiviral particles, DNA tattoo administration and particle-mediated gene transfer, to induce melanomas in PtenLoxP/LoxP;BrafCA/+ mice lacking the Tyr::CreERT2 allele. We found that dermal delivery of the Cre recombinase gene under the control of a non-specific CAG promoter induced the formation of melanomas, but also keratoacanthoma and squamous cell carcinomas. Delivery of Cre recombinase DNA under the control of melanocyte-specific promoters in PtenLoxP/LoxP;BrafCA/+ mice resulted in sole melanoma induction. The growth rate and histological features of the induced tumors were similar to 4-hydroxytamoxifen-induced tumors in Tyr::CreERT2;PtenLoxP/LoxP;BrafCA/+ mice, while the onset of spontaneous tumors was prevented completely. These novel induction methods will allow long-term experiments in mouse models of skin malignancies.
International Nuclear Information System (INIS)
Gordon, Gavin J; Bueno, Raphael; Sugarbaker, David J
2011-01-01
Mesothelioma is an aggressive neoplasm with few effective treatments, one being cytoreductive surgery. We previously described a test, based on differential expression levels of four genes, to predict clinical outcome in prospectively consented mesothelioma patients after surgery. In this study, we determined whether any of these four genes could be linked to a cancer relevant phenotype. We conducted a high-throughput RNA inhibition screen to knockdown gene expression levels of the four genes comprising the test (ARHGDIA, COBLL1, PKM2, TM4SF1) in both a human lung-derived normal and a tumor cell line using three different small inhibitory RNA molecules per gene. Successful knockdown was confirmed using quantitative RT-PCR. Detection of statistically significant changes in apoptosis and mitosis was performed using immunological assays and quantified using video-assisted microscopy at a single time-point. Changes in nuclear shape, size, and numbers were used to provide additional support of initial findings. Each experiment was conducted in triplicate. Specificity was assured by requiring that at least 2 different siRNAs produced the observed change in each cell line/time-point/gene/assay combination. Knockdown of ARHGDIA, COBLL1, and TM4SF1 resulted in 2- to 4-fold increased levels of apoptosis in normal cells (ARHGDIA only) and tumor cells (all three genes). No statistically significant changes were observed in apoptosis after knockdown of PKM2 or for mitosis after knockdown of any gene. We provide evidence that ARHGDIA, COBLL1, and TM4SF1 are negative regulators of apoptosis in cultured tumor cells. These genes, and their related intracellular signaling pathways, may represent potential therapeutic targets in mesothelioma
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS
Directory of Open Access Journals (Sweden)
D. S. Mikhaylenko
2016-01-01
Full Text Available In the recent years, the full exome sequencing helped to reveal a set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the
Chang, Ti Ling; Ito, Kosei; Ko, Tun Kiat; Liu, Qiang; Salto-Tellez, Manuel; Yeoh, Khay Guan; Fukamachi, Hiroshi; Ito, Yoshiaki
2010-01-01
The transcription factor RUNX3 is a gastric tumor suppressor. Tumorigenic Runx3(-/-) gastric epithelial cells attach weakly to each other, compared with nontumorigenic Runx3(+/+) cells. We aimed to identify RUNX3 target genes that promote cell-cell contact to improve our understanding of RUNX3's role in suppressing gastric carcinogenesis. We compared gene expression profiles of Runx3(+/+) and Runx3(-/-) cells and observed down-regulation of genes associated with cell-cell adhesion in Runx3(-/-) cells. Reporter, mobility shift, and chromatin immunoprecipitation assays were used to examine the regulation of these genes by RUNX3. Tumorigenesis assays and immunohistological analyses of human gastric tumors were performed to confirm the role of the candidate genes in gastric tumor development. Mobility shift and chromatin immunoprecipitation assays revealed that the promoter activity of the gene that encodes the tight junction protein claudin-1 was up-regulated via the binding of RUNX3 to the RUNX consensus sites. The tumorigenicity of gastric epithelial cells from Runx3(-/-) mice was significantly reduced by restoration of claudin-1 expression, whereas knockdown of claudin-1 increased the tumorigenicity of human gastric cancer cells. Concomitant expression of RUNX3 and claudin-1 was observed in human normal gastric epithelium and cancers. The tight junction protein claudin-1 has gastric tumor suppressive activity and is a direct transcriptional target of RUNX3. Claudin-1 is down-regulated during the epithelial-mesenchymal transition; RUNX3 might therefore act as a tumor suppressor to antagonize the epithelial-mesenchymal transition. Copyright 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.
Sex, stem cells and tumors in the Drosophila ovary.
Salz, Helen K
2013-01-01
The Drosophila Sex-lethal (Sxl) gene encodes a female-specific RNA binding protein that in somatic cells globally regulates all aspects of female-specific development and behavior. Sxl also has a critical, but less well understood, role in female germ cells. Germ cells without Sxl protein can adopt a stem cell fate when housed in a normal ovary, but fail to successfully execute the self-renewal differentiation fate switch. The failure to differentiate is accompanied by the inappropriate expression of a set of male specific markers, continued proliferation, and formation of a tumor. The findings in Chau et al., (2012) identify the germline stem cell maintenance factor nanos as one of its target genes, and suggest that Sxl enables the switch from germline stem cell to committed daughter cell by posttranscriptional downregulation of nanos expression. These studies provide the basis for a new model in which Sxl directly couples sexual identity with the self-renewal differentiation decision and raises several interesting questions about the genesis of the tumor phenotype.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
Martinelli, Simone; De Luca, Alessandro; Stellacci, Emilia; Rossi, Cesare; Checquolo, Saula; Lepri, Francesca; Caputo, Viviana; Silvano, Marianna; Buscherini, Francesco; Consoli, Federica; Ferrara, Grazia; Digilio, Maria C.; Cavaliere, Maria L.; van Hagen, Johanna M.; Zampino, Giuseppe; van der Burgt, Ineke; Ferrero, Giovanni B.; Mazzanti, Laura; Screpanti, Isabella; Yntema, Helger G.; Nillesen, Willy M.; Savarirayan, Ravi; Zenker, Martin; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco
2010-01-01
RAS signaling plays a key role in controlling appropriate cell responses to extracellular stimuli and participates in early and late developmental processes. Although enhanced flow through this pathway has been established as a major contributor to oncogenesis, recent discoveries have revealed that aberrant RAS activation causes a group of clinically related developmental disorders characterized by facial dysmorphism, a wide spectrum of cardiac disease, reduced growth, variable cognitive deficits, ectodermal and musculoskeletal anomalies, and increased risk for certain malignancies. Here, we report that heterozygous germline mutations in CBL, a tumor-suppressor gene that is mutated in myeloid malignancies and encodes a multivalent adaptor protein with E3 ubiquitin ligase activity, can underlie a phenotype with clinical features fitting or partially overlapping Noonan syndrome (NS), the most common condition of this disease family. Independent CBL mutations were identified in two sporadic cases and two families from among 365 unrelated subjects who had NS or suggestive features and were negative for mutations in previously identified disease genes. Phenotypic heterogeneity and variable expressivity were documented. Mutations were missense changes altering evolutionarily conserved residues located in the RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase binding domain, a known mutational hot spot in myeloid malignancies. Mutations were shown to affect CBL-mediated receptor ubiquitylation and dysregulate signal flow through RAS. These findings document that germline mutations in CBL alter development to cause a clinically variable condition that resembles NS and that possibly predisposes to malignancies. PMID:20619386
Genome-wide identification of key modulators of gene-gene interaction networks in breast cancer.
Chiu, Yu-Chiao; Wang, Li-Ju; Hsiao, Tzu-Hung; Chuang, Eric Y; Chen, Yidong
2017-10-03
With the advances in high-throughput gene profiling technologies, a large volume of gene interaction maps has been constructed. A higher-level layer of gene-gene interaction, namely modulate gene interaction, is composed of gene pairs of which interaction strengths are modulated by (i.e., dependent on) the expression level of a key modulator gene. Systematic investigations into the modulation by estrogen receptor (ER), the best-known modulator gene, have revealed the functional and prognostic significance in breast cancer. However, a genome-wide identification of key modulator genes that may further unveil the landscape of modulated gene interaction is still lacking. We proposed a systematic workflow to screen for key modulators based on genome-wide gene expression profiles. We designed four modularity parameters to measure the ability of a putative modulator to perturb gene interaction networks. Applying the method to a dataset of 286 breast tumors, we comprehensively characterized the modularity parameters and identified a total of 973 key modulator genes. The modularity of these modulators was verified in three independent breast cancer datasets. ESR1, the encoding gene of ER, appeared in the list, and abundant novel modulators were illuminated. For instance, a prognostic predictor of breast cancer, SFRP1, was found the second modulator. Functional annotation analysis of the 973 modulators revealed involvements in ER-related cellular processes as well as immune- and tumor-associated functions. Here we present, as far as we know, the first comprehensive analysis of key modulator genes on a genome-wide scale. The validity of filtering parameters as well as the conservativity of modulators among cohorts were corroborated. Our data bring new insights into the modulated layer of gene-gene interaction and provide candidates for further biological investigations.