WorldWideScience

Sample records for generation sfg vibrational

  1. Quantitative spectral and orientational analysis in surface sum frequency generation vibrational spectroscopy (SFG-VS)

    Science.gov (United States)

    Wang, Hong-Fei; Gan, Wei; Lu, Rong; Rao, Yi; Wu, Bao-Hua

    Sum frequency generation vibrational spectroscopy (SFG-VS) has been proven to be a uniquely effective spectroscopic technique in the investigation of molecular structure and conformations, as well as the dynamics of molecular interfaces. However, the ability to apply SFG-VS to complex molecular interfaces has been limited by the ability to abstract quantitative information from SFG-VS experiments. In this review, we try to make assessments of the limitations, issues and techniques as well as methodologies in quantitative orientational and spectral analysis with SFG-VS. Based on these assessments, we also try to summarize recent developments in methodologies on quantitative orientational and spectral analysis in SFG-VS, and their applications to detailed analysis of SFG-VS data of various vapour/neat liquid interfaces. A rigorous formulation of the polarization null angle (PNA) method is given for accurate determination of the orientational parameter D = /, and comparison between the PNA method with the commonly used polarization intensity ratio (PIR) method is discussed. The polarization and incident angle dependencies of the SFG-VS intensity are also reviewed, in the light of how experimental arrangements can be optimized to effectively abstract crucial information from the SFG-VS experiments. The values and models of the local field factors in the molecular layers are discussed. In order to examine the validity and limitations of the bond polarizability derivative model, the general expressions for molecular hyperpolarizability tensors and their expression with the bond polarizability derivative model for C3v, C2v and C∞v molecular groups are given in the two appendixes. We show that the bond polarizability derivative model can quantitatively describe many aspects of the intensities observed in the SFG-VS spectrum of the vapour/neat liquid interfaces in different polarizations. Using the polarization analysis in SFG-VS, polarization selection rules or

  2. Quantification of crystalline cellulose in lignocellulosic biomass using sum frequency generation (SFG) vibration spectroscopy and comparison with other analytical methods.

    Science.gov (United States)

    Barnette, Anna L; Lee, Christopher; Bradley, Laura C; Schreiner, Edward P; Park, Yong Bum; Shin, Heenae; Cosgrove, Daniel J; Park, Sunkyu; Kim, Seong H

    2012-07-01

    The non-centrosymmetry requirement of sum frequency generation (SFG) vibration spectroscopy allows the detection and quantification of crystalline cellulose in lignocellulose biomass without spectral interferences from hemicelluloses and lignin. This paper shows a correlation between the amount of crystalline cellulose in biomass and the SFG signal intensity. Model biomass samples were prepared by mixing commercially available cellulose, xylan, and lignin to defined concentrations. The SFG signal intensity was found sensitive to a wide range of crystallinity, but varied non-linearly with the mass fraction of cellulose in the samples. This might be due to the matrix effects such as light scattering and absorption by xylan and lignin, as well as the non-linear density dependence of the SFG process itself. Comparison with other techniques such as XRD, FT-Raman, FT-IR and NMR demonstrate that SFG can be a complementary and sensitive tool to assess crystalline cellulose in biomass. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Selective detection of crystalline cellulose in plant cell walls with sum-frequency-generation (SFG) vibration spectroscopy.

    Science.gov (United States)

    Barnette, Anna L; Bradley, Laura C; Veres, Brandon D; Schreiner, Edward P; Park, Yong Bum; Park, Junyeong; Park, Sunkyu; Kim, Seong H

    2011-07-11

    The selective detection of crystalline cellulose in biomass was demonstrated with sum-frequency-generation (SFG) vibration spectroscopy. SFG is a second-order nonlinear optical response from a system where the optical centrosymmetry is broken. In secondary plant cell walls that contain mostly cellulose, hemicellulose, and lignin with varying concentrations, only certain vibration modes in the crystalline cellulose structure can meet the noninversion symmetry requirements. Thus, SFG can be used to detect and analyze crystalline cellulose selectively in lignocellulosic biomass without extraction of noncellulosic species from biomass or deconvolution of amorphous spectra. The selective detection of crystalline cellulose in lignocellulosic biomass is not readily achievable with other techniques such as XRD, solid-state NMR, IR, and Raman analyses. Therefore, the SFG analysis presents a unique opportunity to reveal the cellulose crystalline structure in lignocellulosic biomass.

  4. Vibrational sum frequency generation (SFG) spectroscopic study of crystalline cellulose in biomass

    Science.gov (United States)

    Kim, Seong H.; Lee, Christopher M.; Kafle, Kabindra; Park, Yong Bum; Xi, Xiaoning

    2013-09-01

    The noncentrosymmetry requirement of sum frequency generation (SFG) spectroscopy allows selective detection of crystalline cellulose in plant cell walls and lignocellulose biomass without spectral interferences from hemicelluloses and lignin. In addition, the phase synchronization requirement of the SFG process allows noninvasive investigation of spatial arrangement of crystalline cellulose microfibrils in the sample. This paper reviews how these principles are applied to reveal structural information of crystalline cellulose in plant cell walls and biomass.

  5. Multimodal Broadband Vibrational Sum Frequency Generation (MM-BB-V-SFG) Spectrometer and Microscope.

    Science.gov (United States)

    Lee, Christopher M; Kafle, Kabindra; Huang, Shixin; Kim, Seong H

    2016-01-14

    A broadband sum frequency generation (BB-SFG) spectrometer with multimodal (MM) capabilities was constructed, which could be routinely reconfigured for tabletop experiments in reflection, transmission, and total internal reflection (TIR) geometries, as well as microscopic imaging. The system was constructed using a Ti:sapphire amplifier (800 nm, pulse width = 85 fs, repetition rate = 2 kHz), an optical parameter amplification (OPA) system for production of broadband IR pulses tunable between 1000 and 4000 cm(-1), and two Fabry-Pérot etalons arranged in series for production of narrowband 800 nm pulses. The key feature allowing the MM operation was the nearly collinear alignment of the visible (fixed, 800 nm) and infrared (tunable, 1000-4000 cm(-1)) pulses which were spatially separated. Physical insights discussed in this paper include the comparison of spectral bandwidth produced with 40 and 85 fs pump beams, the improvement of spectral resolution using etalons, the SFG probe volume in bulk analysis, the normalization of SFG signals, the stitching of multiple spectral segments, and the operation in different modes for air/liquid and adsorbate/solid interfaces, bulk samples, as well as spectral imaging combined with principle component analysis (PCA). The SFG spectral features obtained with the MM-BB-SFG system were compared with those obtained with picosecond-scanning-SFG system and high-resolution BB-SFG system (HR-BB-SFG) for dimethyl sulfoxide, α-pinene, and various samples containing cellulose (purified commercial products, Cladophora cell wall, cotton and flax fibers, and onion epidermis cell wall).

  6. Quantum Mechanical Calculations of Vibrational Sum-Frequency-Generation (SFG) Spectra of Cellulose: Dependence of the CH and OH Peak Intensity on the Polarity of Cellulose Chains within the SFG Coherence Domain.

    Science.gov (United States)

    Lee, Christopher M; Chen, Xing; Weiss, Philip A; Jensen, Lasse; Kim, Seong H

    2017-01-05

    Vibrational sum-frequency-generation (SFG) spectroscopy is capable of selectively detecting crystalline biopolymers interspersed in amorphous polymer matrices. However, the spectral interpretation is difficult due to the lack of knowledge on how spatial arrangements of crystalline segments influence SFG spectra features. Here we report time-dependent density functional theory (TD-DFT) calculations of cellulose crystallites in intimate contact with two different polarities: parallel versus antiparallel. TD-DFT calculations reveal that the CH/OH intensity ratio is very sensitive to the polarity of the crystallite packing. Theoretical calculations of hyperpolarizability tensors (β abc ) clearly show the dependence of SFG intensities on the polarity of crystallite packing within the SFG coherence length, which provides the basis for interpretation of the empirically observed SFG features of native cellulose in biological systems.

  7. Nanoscale chemical and mechanical characterization of thin films:sum frequency generation (SFG) vibrational spectroscopy at buriedinterfaces

    Energy Technology Data Exchange (ETDEWEB)

    Kweskin, Sasha Joseph [Univ. of California, Berkeley, CA (United States)

    2006-01-01

    Sum frequency generation (SFG) surface vibrational spectroscopy was used to characterize interfaces pertinent to current surface engineering applications, such as thin film polymers and novel catalysts. An array of advanced surface science techniques like scanning probe microscopy (SPM), x-ray photoelectron spectroscopy (XPS), gas chromatography (GC) and electron microscopy were used to obtain experimental measurements complementary to SFG data elucidating polymer and catalyst surface composition, surface structure, and surface mechanical behavior. Experiments reported in this dissertation concentrate on three fundamental questions: (1) How does the interfacial molecular structure differ from that of the bulk in real world applications? (2) How do differences in chemical environment affect interface composition or conformation? (3) How do these changes correlate to properties such as mechanical or catalytic performance? The density, surface energy and bonding at a solid interface dramatically alter the polymer configuration, physics and mechanical properties such as surface glass transition, adhesion and hardness. The enhanced sensitivity of SFG at the buried interface is applied to three systems: a series of acrylates under compression, the compositions and segregation behavior of binary polymer polyolefin blends, and the changes in surface structure of a hydrogel as a function of hydration. In addition, a catalytically active thin film of polymer coated nanoparticles is investigated to evaluate the efficacy of SFG to provide in situ information for catalytic reactions involving small mass adsorption and/or product development. Through the use of SFG, in situ total internal reflection (TIR) was used to increase the sensitivity of SFG and provide the necessary specificity to investigate interfaces of thin polymer films and nanostructures previously considered unfeasible. The dynamic nature of thin film surfaces is examined and it is found that the non

  8. Sum frequency generation (SFG) vibrational spectroscopy of planar phosphatidylethanolamine hybrid bilayer membranes under water.

    Science.gov (United States)

    Kett, Peter J N; Casford, Michael T L; Davies, Paul B

    2010-06-15

    Sum frequency generation (SFG) spectroscopy has been used to study the structure of phosphatidylethanolamine hybrid bilayer membranes (HBMs) under water at ambient temperatures. The HBMs were formed using a modified Langmuir-Schaefer technique and consisted of a layer of dipalmitoyl phosphatidylethanolamine (DPPE) physisorbed onto an octadecanethiol (ODT) self-assembled monolayer (SAM) at a series of surface pressures from 1 to 40 mN m(-1). The DPPE and ODT were selectively deuterated so that the contributions to the SFG spectra from the two layers could be determined separately. SFG spectra in both the C-H and C-D stretching regions confirmed that a monolayer of DPPE had been adsorbed to the ODT SAM and that there were gauche defects within the alkyl chains of the phospholipid. On adsorption of a layer of DPPE, methylene modes from the ODT SAM were detected, indicating that the phospholipid had partially disordered the alkanethiol monolayer. SFG spectra recorded in air indicated that removal of water from the surface of the HBM resulted in disruption of the DPPE layer and the formation of phospholipid bilayers.

  9. Sum frequency generation vibrational spectroscopy (SFG-VS) for complex molecular surfaces and interfaces: Spectral lineshape measurement and analysis plus some controversial issues

    Science.gov (United States)

    Wang, Hong-Fei

    2016-12-01

    Sum-frequency generation vibrational spectroscopy (SFG-VS) was first developed in the 1980s and it has been proven a uniquely sensitive and surface/interface selective spectroscopic probe for characterization of the structure, conformation and dynamics of molecular surfaces and interfaces. In recent years, there have been many progresses in the development of methodology and instrumentation in the SFG-VS toolbox that have significantly broadened the application to complex molecular surfaces and interfaces. In this review, after presenting a unified view on the theory and methodology focusing on the SFG-VS spectral lineshape, as well as the new opportunities in SFG-VS applications with such developments, some of the controversial issues that have been puzzling the community are discussed. The aim of this review is to present to the researchers and students interested in molecular surfaces and interfacial sciences up-to-date perspectives complementary to the existing textbooks and reviews on SFG-VS.

  10. Salt Effects on Surface Structures of Polyelectrolyte Multilayers (PEMs) Investigated by Vibrational Sum Frequency Generation (SFG) Spectroscopy.

    Science.gov (United States)

    Ge, Aimin; Matsusaki, Michiya; Qiao, Lin; Akashi, Mitsuru; Ye, Shen

    2016-04-26

    Sum frequency generation (SFG) vibrational spectroscopy was employed to investigate the surface structures of polyelectrolyte multilayers (PEMs) constructed by sequentially alternating adsorption of poly(diallyldimethylammonium chloride) (PDDA) and poly(styrenesulfonate) (PSS). It was found that the surface structures and surface charge density of the as-deposited PEMs of PDDA/PSS significantly depend on the concentration of sodium chloride (NaCl) present in the polyelectrolyte solutions. Furthermore, it was found that the surface structure of the as-deposited PEMs is in a metastable state and will reach the equilibrium state by diffusion of the polyelectrolyte chain after an aging process, resulting in a polyelectrolyte mixture on the PEM surfaces.

  11. Capturing inhomogeneous broadening of the -CN stretch vibration in a Langmuir monolayer with high-resolution spectra and ultrafast vibrational dynamics in sum-frequency generation vibrational spectroscopy (SFG-VS)

    Science.gov (United States)

    Velarde, Luis; Wang, Hong-fei

    2013-08-01

    While in principle the frequency-domain and time-domain spectroscopic measurements should generate identical information for a given molecular system, the inhomogeneous character of surface vibrations in sum-frequency generation vibrational spectroscopy (SFG-VS) studies has only been studied with time-domain SFG-VS by mapping the decay of the vibrational polarization using ultrafast lasers, this due to the lack of SFG vibrational spectra with high enough spectral resolution and accurate enough lineshape. Here, with the recently developed high-resolution broadband SFG-VS (HR-BB-SFG-VS) technique, we show that the inhomogeneous lineshape can be obtained in the frequency-domain for the anchoring CN stretch of the 4-n-octyl-4'-cyanobiphenyl (8CB) Langmuir monolayer at the air-water interface, and that an excellent agreement with the time-domain SFG free-induction-decay can be established. We found that the 8CB CN stretch spectrum consists of a single peak centered at 2234.00 ± 0.01 cm-1 with a total linewidth of 10.9 ± 0.3 cm-1 at half maximum. The Lorentzian contribution accounts only for 4.7 ± 0.4 cm-1 to this width and the Gaussian (inhomogeneous) broadening for as much as 8.1 ± 0.2 cm-1. Polarization analysis of the -CN spectra showed that the -CN group is tilted 57° ± 2° from the surface normal. The large heterogeneity in the -CN spectrum is tentatively attributed to the -CN group interactions with the interfacial water molecules penetrated/accommodated into the 8CB monolayer, a unique phenomenon for the nCB Langmuir monolayers reported previously.

  12. Interpreting intensities in vibrational sum frequency generation (SFG) spectroscopy: CO adsorption on Pd surfaces

    Science.gov (United States)

    Morkel, M.; Unterhalt, H.; Klüner, T.; Rupprechter, G.; Freund, H.-J.

    2005-07-01

    The lineshape and intensity of SFG signals of CO adsorbed on supported Pd nanoparticles and Pd(1 1 1) are analyzed. For CO/Pd(1 1 1) nearly symmetric lorentzian lineshapes were observed. Applying two different visible wavelengths for excitation, asymmetric lineshapes observed for the CO/Pd/Al 2O 3/NiAl(1 1 0) system are explained by a lower resonant and a higher non-resonant SFG signal and a change in the phase between resonant and non-resonant signals, most likely originating from an interband transition in the NiAl substrate. The relative intensity of different CO species (hollow, bridge, on-top) was modeled by DFT calculations of IR transition moments and Raman activities. While the (experimental) sensitivity of SFG towards different CO species strongly varies, the calculated IR and Raman activities are rather similar. The inability to exactly reproduce experimental SFG intensities suggests a strong coverage dependence of Raman activities or that non-linear effects occur that can currently not be properly accounted for.

  13. Coherent optical effect on time-resolved vibrational SFG spectrum of adsorbates

    Science.gov (United States)

    Ueba, H.; Sawabu, T.; Mii, T.

    2002-04-01

    We present a theory to study the influence of the coherent mixing between pump-infrared and probe-visible pulse on a time-resolved sum-frequency generation (TR-SFG) spectrum for vibrations at surfaces. The general formula of the time-dependent and its Fourier transform of the SFG polarization and its Fourier transform allows us to calculate the time-resolved vibrational SFG spectrum and the transient characteristics of the SFG intensity as a function of the delay time td between the pump-infrared and probe-visible pulse. It is found the coherent optical effect manifests itself in the broadening and narrowing of the SFG spectrum with the intrinsic width of T2 at negative and positive td, respectively, being in qualitative agreement with recent experimental results. The influence of the coherent mixing on the transient behavior of the SFG intensity is also discussed in conjunction to the T2 determination.

  14. Low energy electron diffraction (LEED) and sum frequency generation (SFG) vibrational spectroscopy studies of solid-vacuum, solid-air and solid-liquid interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Hoffer, Saskia [Univ. of California, Berkeley, CA (United States)

    2002-01-01

    Electron based surface probing techniques can provide detailed information about surface structure or chemical composition in vacuum environments. The development of new surface techniques has made possible in situ molecular level studies of solid-gas interfaces and more recently, solid-liquid interfaces. The aim of this dissertation is two-fold. First, by using novel sample preparation, Low Energy Electron Diffraction (LEED) and other traditional ultra high vacuum (UHV) techniques are shown to provide new information on the insulator/vacuum interface. The surface structure of the classic insulator NaCl has been determined using these methods. Second, using sum frequency generation (SFG) surface specific vibrational spectroscopy studies were performed on both the biopolymer/air and electrode/electrolyte interfaces. The surface structure and composition of polyetherurethane-silicone copolymers were determined in air using SFG, atomic force microscopy (AFM), and X-ray photoelectron spectroscopy (XPS). SFG studies of the electrode (platinum, gold and copper)/electrolyte interface were performed as a function of applied potential in an electrochemical cell.

  15. Phase transition behaviors of the supported DPPC bilayer investigated by sum frequency generation (SFG) vibrational spectroscopy and atomic force microscopy (AFM).

    Science.gov (United States)

    Wu, Heng-Liang; Tong, Yujin; Peng, Qiling; Li, Na; Ye, Shen

    2016-01-21

    The phase transition behaviors of a supported bilayer of dipalmitoylphosphatidyl-choline (DPPC) have been systematically evaluated by in situ sum frequency generation (SFG) vibrational spectroscopy and atomic force microscopy (AFM). By using an asymmetric bilayer composed of per-deuterated and per-protonated monolayers, i.e., DPPC-d75/DPPC and a symmetric bilayer of DPPC/DPPC, we were able to probe the molecular structural changes during the phase transition process of the lipid bilayer by SFG spectroscopy. It was found that the DPPC bilayer is sequentially melted from the top (adjacent to the solution) to bottom leaflet (adjacent to the substrate) over a wide temperature range. The conformational ordering of the supported bilayer does not decrease (even slightly increases) during the phase transition process. The conformational defects in the bilayer can be removed after the complete melting process. The phase transition enthalpy for the bottom leaflet was found to be approximately three times greater than that for the top leaflet, indicating a strong interaction of the lipids with the substrate. The present SFG and AFM observations revealed similar temperature dependent profiles. Based on these results, the temperature-induced structural changes in the supported lipid bilayer during its phase transition process are discussed in comparison with previous studies.

  16. Hydration of Sulphobetaine (SB) and Tetra(ethylene glycol) (EG4)-Terminated Self-Assembled Monolayers Studied by Sum Frequency Generation (SFG) Vibrational Spectroscopy

    Science.gov (United States)

    Stein, M. Jeanette; Weidner, Tobias; McCrea, Keith; Castner, David G.; Ratner, Buddy D.

    2010-01-01

    Sum frequency generation (SFG) vibrational spectroscopy is used to study the surface and the underlying substrate of both homogeneous and mixed self-assembled monolayers (SAMs) of 11-mercaptoundecyl-1-sulphobetainethiol (HS(CH2)11N+(CH3)2(CH2)3SO3−, SB) and 1-mercapto-11-undecyl tetra(ethylene glycol) (HS(CH2)11O(CH2CH2O)4OH, EG4) with an 11-mercapto-1-undecanol (HS(CH2)11OH, MCU) diluent. SFG results on the C–H region of the dry and hydrated SAMs gave an in situ look into the molecular orientation and suggested an approach to maximize signal-to-noise ratio on these difficult to analyze hydrophilic SAMs. Vibrational fingerprint studies in the 3000–3600 cm−1 spectral range for the SAMs exposed serially to air, water, and deuterated water revealed that a layer of tightly-bound structured water was associated with the surface of a non-fouling monolayer but was not present on a hydrophobic N-undecylmercaptan (HS(CH2)10CH3, UnD) control. The percentage of water retained upon submersion in D2O correlated well with the relative amount of protein that was previously shown to absorb onto the monolayers. These results provide evidence supporting the current theory regarding the role of a tightly-bound vicinal water layer in the protein resistance of a non-fouling group. PMID:19639981

  17. Vibrational Dynamics of Interfacial Water by Free Induction Decay Sum Frequency Generation (FID-SFG) at the Al2O3(1120)/H2O Interface.

    Science.gov (United States)

    Boulesbaa, Abdelaziz; Borguet, Eric

    2014-02-06

    The dephasing dynamics of a vibrational coherence may reveal the interactions of chemical functional groups with their environment. To investigate this process at a surface, we employ free induction decay sum frequency generation (FID-SFG) to measure the time that it takes for free OH stretch oscillators at the charged (pH ≈ 13, KOH) interface of alumina/water (Al2O3/H2O) to lose their collective coherence. By employing noncollinear optical parametric amplification (NOPA) technology and nonlinear vibrational spectroscopy, we showed that the single free OH peak actually corresponds to two distinct oscillators oriented opposite to each other and measured the total dephasing time, T2, of the free OH stretch modes at the Al2O3/H2O interface with a sub-40 fs temporal resolution. Our results suggested that the free OH oscillators associated with interfacial water dephase on the time scale of 89.4 ± 6.9 fs, whereas the homogeneous dephasing of interfacial alumina hydroxyls is an order of magnitude slower.

  18. Wetting effect on optical sum frequency generation (SFG) spectra of D-glucose, D-fructose, and sucrose

    Science.gov (United States)

    Hieu, Hoang Chi; Li, Hongyan; Miyauchi, Yoshihiro; Mizutani, Goro; Fujita, Naoko; Nakamura, Yasunori

    2015-03-01

    We report a sum frequency generation (SFG) spectroscopy study of D-glucose, D-fructose and sucrose in the Csbnd H stretching vibration regime. Wetting effect on the SFG spectra was investigated. The SFG spectrum of D-glucose changed from that of α-D-glucose into those of α-D-glucose monohydrate by wetting. The SFG spectra showed evidence of a small change of β-D-fructopyranose into other anomers by wetting. SFG spectra of sucrose did not change by wetting. Assignments of the vibrational peaks in the SFG spectra of the three sugars in the dry and wet states were performed in the Csbnd H stretching vibration region near 3000 cm-1.

  19. Femtosecond time-resolved vibrational SFG spectroscopy of CO/Ru( 0 0 1 )

    Science.gov (United States)

    Hess, Ch.; Wolf, M.; Roke, S.; Bonn, M.

    2002-04-01

    Vibrational sum-frequency generation (SFG) employing femtosecond infrared (IR) laser pulses is used to study the dynamics of the C-O stretch vibration on Ru(0 0 1). Time-resolved measurements of the free induction decay (FID) of the IR-polarization for 0.33 ML CO/Ru(0 0 1) exhibit single exponential decays over three decades corresponding to dephasing times of T2=1.94 ps at 95 K and T2=1.16 ps at 340 K. This is consistent with pure homogeneous broadening due to anharmonic coupling with the thermally activated low-frequency dephasing mode together with a contribution from saturation of the IR transition. In pump-probe SFG experiments using a strong visible (VIS) pump pulse the perturbation of the FID leads to transient line shifts even at negative delay times, i.e. when the IR-VIS SFG probe pair precedes the pump pulse. Based on an analysis of the time-dependent polarization we discuss the influence of the perturbed FID on time-resolved SFG spectra. We investigate how coherent effects affect the SFG spectra and we examine the time resolution in these experiments, in particular in dependence of the dephasing time.

  20. Quantitative Interpretation of Polarization SFG Vibrational Spectra of Air/Methanol Interface

    Science.gov (United States)

    Wu, Hui; Zhang, Wen-kai; Gan, Wei; Cui, Zhi-feng; Wang, Hong-fei

    2006-06-01

    Even though in IR and Raman spectra of liquid methanol there is always an apparent feature for the asymmetric stretching mode of the CH3 group around 2970 cm-1, this feature has not been observed in the Sum Frequency Generation Vibrational Spectroscopy (SFG-VS) in any polarizations from the air/methanol interface. Here we present a treatment based on a corrected bond additivity model to quantitatively interpret the SFG-VS of the air/methanol interface from the IR and Raman spectra of liquid methanol.

  1. Synchronous-flux-generator (SFG)

    Energy Technology Data Exchange (ETDEWEB)

    Zweygbergk, S.V.; Ljungstroem, O. (ed.)

    1976-01-01

    The synchronous machine is the most common rotating electric machine for producing electric energy in a large scale, but it is also used for other purposes. One well known everyday example is its use as driving motor in the electric synchronous clock. One has in this connection made full use of one of the main qualities of this kind of machine--its rotating speed is bound to the frequency of the feeding voltage, either if it is working as a motor or as a generator. Characteristics are discussed.

  2. The structure of oleamide films at the aluminum/oil interface and aluminum/air interface studied by Sum Frequency Generation (SFG) vibrational spectroscopy and Reflection Absorption Infrared Spectroscopy (RAIRS).

    Science.gov (United States)

    Casford, Michael T L; Davies, Paul B

    2009-08-01

    The structure of oleamide (cis-9-octadecenamide) films on aluminum has been investigated by sum frequency generation vibrational spectroscopy (SFG) and reflection absorption infrared spectroscopy (RAIRS). Three different film deposition strategies were investigated: (i) films formed by equilibrium adsorption from oleamide solutions in oil, (ii) Langmuir-Blodgett films cast at 1 and 25 mN m(-1), (iii) thick spin-cast films. Both L-B and spin-cast films were examined in air and under oil. The adsorbate formed in the 1 mN m(-1) film in air showed little orientational order. For this film, the spectroscopic results and the ellipsometric thickness point to a relatively conformationally disordered monolayer that is oriented principally in the plane of the interface. Direct adsorption to the metal interface from oil results in SFG spectra of oleamide that are comparable to those observed for the 1 mN m(-1) L-B film in air. In contrast, SFG and RAIRS results for the 25 mN m(-1) film in air and SFG spectra of the spin-cast film in air both show strong conformational ordering and orientational alignment normal to the interface. The 25 mN m(-1) film has an ellipsometric thickness almost twice that of the 1 mN m(-1) L-B film. Taken in combination with the spectroscopic results, this is indicative of a well packed monolayer in air in which the hydrocarbon chain is in an essentially defect-free extended conformation with the methyl terminus oriented away from the surface. A similar structure is also deduced for the surface of the spin-cast film in air. Upon immersion of the 25 mN m(-1) L-B film in oil the SFG spectra show that this film rapidly adopts a relatively disordered structure similar to that seen for the 1 mN m(-1) L-B film in air. Immersion of the spin-cast film in oil results in the gradual disordering of the amide film over a period of several days until the observed spectra become essentially identical to those observed for direct adsorption of oleamide from oil.

  3. Studies on the substrate mediated vibrational excitation of CO/Si(100) by means of SFG spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Han, Xu; Lass, Kristian; Balgar, Thorsten; Hasselbrink, Eckart [Universitaet Duisburg-Essen, Fachbereich Chemie, 45117 Essen (Germany)

    2009-07-01

    Vibrational excitations of adsorbates play an important role in chemical reaction dynamics. In the past decade CO on solid surfaces was chosen as adequate model system for studying vibrational relaxation dynamics. Our work is focused on the energy dissipation of vibrationally excited CO adsorbed on a silicon surface by means of IR/Vis sum frequency generation (SFG) spectroscopy. Here we present studies on substrate mediated excitation of vibrational modes of CO on Si(100) induced by UV radiation. We suppose the observation of highly excited internal stretch vibrations of CO caused by hot electrons generated within the silicon substrate.

  4. Non-invasive vibrational SFG spectroscopy reveals that bacterial adhesion can alter the conformation of grafted "brush" chains on SAM.

    Science.gov (United States)

    Bulard, Emilie; Guo, Ziang; Zheng, Wanquan; Dubost, Henri; Fontaine-Aupart, Marie-Pierre; Bellon-Fontaine, Marie-Noëlle; Herry, Jean-Marie; Briandet, Romain; Bourguignon, Bernard

    2011-04-19

    Understanding bacterial adhesion on a surface is a crucial step to design new materials with improved properties or to control biofilm formation and eradication. Sum Frequency Generation (SFG) vibrational spectroscopy has been employed to study in situ the conformational response of a self-assembled monolayer (SAM) of octadecanethiol (ODT) on a gold film to the adhesion of hydrophilic and hydrophobic ovococcoid model bacteria. The present work highlights vibrational SFG spectroscopy as a powerful and unique non-invasive biophysical technique to probe and control bacteria interaction with ordered surfaces. Indeed, the SFG vibrational spectral changes reveal different ODT SAM conformations in air and upon exposure to aqueous solution or bacterial adhesion. Furthermore, this effect depends on the bacterial cell surface properties. The SFG spectral modeling demonstrates that hydrophobic bacteria flatten the ODT SAM alkyl chain terminal part, whereas the hydrophilic ones raise this ODT SAM terminal part. Microorganism-induced alteration of grafted chains can thus affect the desired interfacial functionality, a result that should be considered for the design of new reactive materials. © 2011 American Chemical Society

  5. Sum frequency generation of CO on (III) and polycrystalline platinum electrode surfaces: Evidence for SFG invisible surface CO

    Energy Technology Data Exchange (ETDEWEB)

    Baldelli, S.; Markovic, N.; Ross, P.; Shen, Y.R.; Somorjai, G.

    1999-10-21

    The vibrational spectroscopy sum frequency generation (SFG) is used to investigate the adsorption of carbon monoxide on the single crystal (111) and polycrystalline platinum surfaces. By varying the frequency and polarization of the light beams, different surface species of CO species are probed. SFG signal intensities for different polarization indicate that adsorbed CO polarizability is significantly perturbed from the gas-phase molecule. The SFG signal of CO disappears well below the main oxidation potential of CO to CO{sub 2}. The disappearance of the CO signal is interpreted as a transformation in the CO layer to a state which is invisible to SFG. The invisible state is suggested to be CO with the bond axis nearly parallel to the platinum surface.

  6. IR and SFG vibrational spectroscopy of the water bend in the bulk liquid and at the liquid-vapor interface, respectively

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Yicun; Skinner, J. L. [Theoretical Chemistry Institute and Department of Chemistry, University of Wisconsin, Madison, Wisconsin 53706 (United States)

    2015-07-07

    Vibrational spectroscopy of the water bending mode has been investigated experimentally to study the structure of water in condensed phases. In the present work, we calculate the theoretical infrared (IR) and sum-frequency generation (SFG) spectra of the HOH bend in liquid water and at the water liquid/vapor interface using a mixed quantum/classical approach. Classical molecular dynamics simulation is performed by using a recently developed water model that explicitly includes three-body interactions and yields a better description of the water surface. Ab-initio-based transition frequency, dipole, polarizability, and intermolecular coupling maps are developed for the spectral calculations. The calculated IR and SFG spectra show good agreement with the experimental measurements. In the theoretical imaginary part of the SFG susceptibility for the water liquid/vapor interface, we find two features: a negative band centered at 1615 cm{sup −1} and a positive band centered at 1670 cm{sup −1}. We analyze this spectrum in terms of the contributions from molecules in different hydrogen-bond classes to the SFG spectral density and also compare to SFG results for the OH stretch. SFG of the water bending mode provides a complementary picture of the heterogeneous hydrogen-bond configurations at the water surface.

  7. IR and SFG vibrational spectroscopy of the water bend in the bulk liquid and at the liquid-vapor interface, respectively

    Science.gov (United States)

    Ni, Yicun; Skinner, J. L.

    2015-07-01

    Vibrational spectroscopy of the water bending mode has been investigated experimentally to study the structure of water in condensed phases. In the present work, we calculate the theoretical infrared (IR) and sum-frequency generation (SFG) spectra of the HOH bend in liquid water and at the water liquid/vapor interface using a mixed quantum/classical approach. Classical molecular dynamics simulation is performed by using a recently developed water model that explicitly includes three-body interactions and yields a better description of the water surface. Ab-initio-based transition frequency, dipole, polarizability, and intermolecular coupling maps are developed for the spectral calculations. The calculated IR and SFG spectra show good agreement with the experimental measurements. In the theoretical imaginary part of the SFG susceptibility for the water liquid/vapor interface, we find two features: a negative band centered at 1615 cm-1 and a positive band centered at 1670 cm-1. We analyze this spectrum in terms of the contributions from molecules in different hydrogen-bond classes to the SFG spectral density and also compare to SFG results for the OH stretch. SFG of the water bending mode provides a complementary picture of the heterogeneous hydrogen-bond configurations at the water surface.

  8. Sum Frequency Generation Vibrational Spectroscopy of Colloidal Platinum Nanoparticle Catalysts: Disordering versus Removal of Organic Capping

    KAUST Repository

    Krier, James M.; Michalak, William D.; Baker, L. Robert; An, Kwangjin; Komvopoulos, Kyriakos; Somorjai, Gabor A.

    2012-01-01

    Recent work with nanoparticle catalysts shows that size and shape control on the nanometer scale influences reaction rate and selectivity. Sum frequency generation (SFG) vibrational spectroscopy is a powerful tool for studying heterogeneous

  9. Structure Sensitivity in Pt Nanoparticle Catalysts for Hydrogenation of 1,3-Butadiene: In Situ Study of Reaction Intermediates Using SFG Vibrational Spectroscopy

    KAUST Repository

    Michalak, William D.

    2013-01-31

    The product selectivity during 1,3-butadiene hydrogenation on monodisperse, colloidally synthesized, Pt nanoparticles was studied under reaction conditions with kinetic measurements and in situ sum frequency generation (SFG) vibrational spectroscopy. SFG was performed with the capping ligands intact in order to maintain nanoparticle size by reduced sintering. Four products are formed at 75 C: 1-butene, cis-2-butene, trans-2-butene, and n-butane. Ensembles of Pt nanoparticles with average diameters of 0.9 and 1.8 nm exhibit a ∼30% and ∼20% increase in the full hydrogenation products, respectively, as compared to Pt nanoparticles with average diameters of 4.6 and 6.7 nm. Methyl and methylene vibrational stretches of reaction intermediates observed under working conditions using SFG were used to correlate the stable reaction intermediates with the product distribution. Kinetic and SFG results correlate with previous DFT predictions for two parallel reaction pathways of 1,3-butadiene hydrogenation. Hydrogenation of 1,3-butadiene can initiate with H-addition at internal or terminal carbons leading to the formation of 1-buten-4-yl radical (metallocycle) and 2-buten-1-yl radical intermediates, respectively. Small (0.9 and 1.8 nm) nanoparticles exhibited vibrational resonances originating from both intermediates, while the large (4.6 and 6.7 nm) particles exhibited vibrational resonances originating predominately from the 2-buten-1-yl radical. This suggests each reaction pathway competes for partial and full hydrogenation and the nanoparticle size affects the kinetic preference for the two pathways. The reaction pathway through the metallocycle intermediate on the small nanoparticles is likely due to the presence of low-coordinated sites. © 2012 American Chemical Society.

  10. Sum frequency generation for surface vibrational spectroscopy

    International Nuclear Information System (INIS)

    Hunt, J.H.; Guyot-Sionnest, P.; Shen, Y.R.

    1987-01-01

    Surface vibrational spectroscopy is one of the best means for characterizing molecular adsorbates. For this reason, many techniques have been developed in the past. However, most of them suffer from poor sensitivity, low spectral and temporal resolution, and applications limited to vacuum solid interfaces. Recently, the second harmonic generation (SHG) technique was proved repeatedly to be a simple but versatile surface probe. It is highly sensitive and surface specific; it is also capable of achieving high temporal, spatial, and spectral resolution. Being an optical technique, it can be applied to any interface accessible by light. The only serious drawback is its lack of molecular selectivity. An obvious remedy is the extension of the technique to IR-visible sum frequency generation (SFG). Surface vibrational spectroscopy with submonolayer sensitivity is then possible using SFG with the help of a tunable IR laser. The authors report here an SFG measurement of the C-H stretch vibration of monolayers of molecules at air-solid and air-liquid interfaces

  11. Probing electronic and vibrational properties at the electrochemical interface using SFG spectroscopy: Methanol electro-oxidation on Pt(1 1 0)

    Science.gov (United States)

    Vidal, F.; Busson, B.; Tadjeddine, A.

    2005-02-01

    We report the study of methanol electro-oxidation on Pt(1 1 0) using infrared-visible sum-frequency generation (SFG) vibrational spectroscopy. The use of this technique enables to probe the vibrational and electronic properties of the interface simultaneously in situ. We have investigated the vibrational properties of the interface in the CO ads internal stretch spectral region (1700-2150 cm -1) over a wide range of potentials. The analysis of the evolution of the C-O stretch line shape, which is related to the interference between the vibrational and electronic parts of the non-linear response, with the potential allows us to show that the onset of bulk methanol oxidation corresponds to the transition from a negatively to a positively charged surface.

  12. Characterizing interstate vibrational coherent dynamics of surface adsorbed catalysts by fourth-order 3D SFG spectroscopy

    Science.gov (United States)

    Li, Yingmin; Wang, Jiaxi; Clark, Melissa L.; Kubiak, Clifford P.; Xiong, Wei

    2016-04-01

    We report the first fourth-order 3D SFG spectroscopy of a monolayer of the catalyst Re(diCN-bpy)(CO)3Cl on a gold surface. Besides measuring the vibrational coherences of single vibrational modes, the fourth-order 3D SFG spectrum also measures the dynamics of interstate coherences and vibrational coherences states between two vibrational modes. By comparing the 3D SFG to the corresponding 2D and third-order 3D IR spectroscopy of the same molecules in solution, we found that the interstate coherences exist in both liquid and surface systems, suggesting that the interstate coherence is not disrupted by surface interactions. However, by analyzing the 3D spectral lineshape, we found that the interstate coherences also experience non-negligible homogenous dephasing dynamics that originate from surface interactions. This unique ability of determining interstate vibrational coherence dynamics of the molecular monolayer can help in understanding of how energy flows within surface catalysts and other molecular monolayers.

  13. Circularly polarized infrared and visible sum-frequency-generation spectroscopy: Vibrational optical activity measurement

    International Nuclear Information System (INIS)

    Cheon, Sangheon; Cho, Minhaeng

    2005-01-01

    Vibrational optical activity spectroscopies utilizing either circularly polarized ir or circularly polarized visible beams were theoretically investigated by considering the infrared and visible sum-frequency-generation (IV-SFG) schemes. In addition to the purely electric dipole-allowed chiral component of the IV-SFG susceptibility, the polarizability-electric quadrupole hyperpolarizability term also contributes to the vibrationally resonant IV-SFG susceptibility. The circular-intensity-difference signal is shown to be determined by the interferences between the all-electric dipole-allowed chiral component and the polarizability-electric-dipole or electric-dipole-electric-quadrupole Raman optical activity tensor components. The circularly polarized SFG methods are shown to be potentially useful coherent spectroscopic tools for determining absolute configurations of chiral molecules in condensed phases

  14. Sum Frequency Generation Vibrational Spectroscopy of Colloidal Platinum Nanoparticle Catalysts: Disordering versus Removal of Organic Capping

    KAUST Repository

    Krier, James M.

    2012-08-23

    Recent work with nanoparticle catalysts shows that size and shape control on the nanometer scale influences reaction rate and selectivity. Sum frequency generation (SFG) vibrational spectroscopy is a powerful tool for studying heterogeneous catalysis because it enables the observation of surface intermediates during catalytic reactions. To control the size and shape of catalytic nanoparticles, an organic ligand was used as a capping agent to stabilize nanoparticles during synthesis. However, the presence of an organic capping agent presents two major challenges in SFG and catalytic reaction studies: it blocks a significant fraction of active surface sites and produces a strong signal that prevents the detection of reaction intermediates with SFG. Two methods for cleaning Pt nanoparticles capped with poly (vinylpyrrolidone) (PVP) are examined in this study: solvent cleaning and UV cleaning. Solvent cleaning leaves more PVP intact and relies on disordering with hydrogen gas to reduce the SFG signal of PVP. In contrast, UV cleaning depends on nearly complete removal of PVP to reduce SFG signal. Both UV and solvent cleaning enable the detection of reaction intermediates by SFG. However, solvent cleaning also yields nanoparticles that are stable under reaction conditions, whereas UV cleaning results in aggregation during reaction. The results of this study indicate that solvent cleaning is more advantageous for studying the effects of nanoparticle size and shape on catalytic selectivity by SFG vibrational spectroscopy. © 2012 American Chemical Society.

  15. Characterization of polymer surface structure and surface mechanical behaviour by sum frequency generation surface vibrational spectroscopy and atomic force microscopy

    International Nuclear Information System (INIS)

    Opdahl, Aric; Koffas, Telly S; Amitay-Sadovsky, Ella; Kim, Joonyeong; Somorjai, Gabor A

    2004-01-01

    Sum frequency generation (SFG) vibrational spectroscopy and atomic force microscopy (AFM) have been used to study polymer surface structure and surface mechanical behaviour, specifically to study the relationships between the surface properties of polymers and their bulk compositions and the environment to which the polymer is exposed. The combination of SFG surface vibrational spectroscopy and AFM has been used to study surface segregation behaviour of polyolefin blends at the polymer/air and polymer/solid interfaces. SFG surface vibrational spectroscopy and AFM experiments have also been performed to characterize the properties of polymer/liquid and polymer/polymer interfaces, focusing on hydrogel materials. A method was developed to study the surface properties of hydrogel contact lens materials at various hydration conditions. Finally, the effect of mechanical stretching on the surface composition and surface mechanical behaviour of phase-separated polyurethanes, used in biomedical implant devices, has been studied by both SFG surface vibrational spectroscopy and AFM. (topical review)

  16. Theory of sum-frequency generation spectroscopy of adsorbed molecules using the density matrix method-broadband vibrational sum-frequency generation and applications

    International Nuclear Information System (INIS)

    Bonn, M; Ueba, H; Wolf, M

    2005-01-01

    A generalized theory of frequency- and time-resolved vibrational sum-frequency generation (SFG) spectroscopy of adsorbates at surfaces is presented using the density matrix formalism. Our theoretical treatment is specifically aimed at addressing issues that accompany the relatively novel SFG approach using broadband infrared pulses. The ultrashort duration of these pulses makes them ideally suited for time-resolved investigations, for which we present a complete theoretical treatment. A second key characteristic of these pulses is their large bandwidth and high intensity, which allow for highly non-linear effects, including vibrational ladder climbing of surface vibrations. We derive general expressions relating the density matrix to SFG spectra, and apply these expressions to specific experimental results by solving the coupled optical Bloch equations of the density matrix elements. Thus, we can theoretically reproduce recent experimentally demonstrated hot band SFG spectra using femtosecond broadband infrared excitation of carbon monoxide (CO) on a Ru(001) surface

  17. Quantitative Surface Chirality Detection with Sum Frequency Generation Vibrational Spectroscopy: Twin Polarization Angle Approach

    International Nuclear Information System (INIS)

    Wei, Feng; Xu, Yanyan; Guo, Yuan; Liu, Shi-lin; Wang, Hongfei

    2009-01-01

    Here we report a novel twin polarization angle (TPA) approach in the quantitative chirality detection with the surface sum-frequency generation vibrational spectroscopy (SFG-VS). Generally, the achiral contribution dominates the surface SFG-VS signal, and the pure chiral signal is usually two or three orders of magnitude smaller. Therefore, it has been difficult to make quantitative detection and analysis of the chiral contributions to the surface SFG-VS signal. In the TPA method, by varying together the polarization angles of the incoming visible light and the sum frequency signal at fixed s or p polarization of the incoming infrared beam, the polarization dependent SFG signal can give not only direct signature of the chiral contribution in the total SFG-VS signal, but also the accurate measurement of the chiral and achiral components in the surface SFG signal. The general description of the TPA method is presented and the experiment test of the TPA approach is also presented for the SFG-VS from the S- and R-limonene chiral liquid surfaces. The most accurate degree of chiral excess values thus obtained for the 2878 cm -1 spectral peak of the S- and R-limonene liquid surfaces are (23.7±0.4)% and (25.4±1.3)%, respectively.

  18. Elucidation of Compression-Induced Surface Crystallization in Amorphous Tablets Using Sum Frequency Generation (SFG) Microscopy.

    Science.gov (United States)

    Mah, Pei T; Novakovic, Dunja; Saarinen, Jukka; Van Landeghem, Stijn; Peltonen, Leena; Laaksonen, Timo; Isomäki, Antti; Strachan, Clare J

    2017-05-01

    To investigate the effect of compression on the crystallization behavior in amorphous tablets using sum frequency generation (SFG) microscopy imaging and more established analytical methods. Tablets containing neat amorphous griseofulvin with/without excipients (silica, hydroxypropyl methylcellulose acetate succinate (HPMCAS), microcrystalline cellulose (MCC) and polyethylene glycol (PEG)) were prepared. They were analyzed upon preparation and storage using attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectroscopy, scanning electron microscopy (SEM) and SFG microscopy. Compression-induced crystallization occurred predominantly on the surface of the neat amorphous griseofulvin tablets, with minimal crystallinity being detected in the core of the tablets. The presence of various types of excipients was not able to mitigate the compression-induced surface crystallization of the amorphous griseofulvin tablets. However, the excipients affected the crystallization rate of amorphous griseofulvin in the core of the tablet upon compression and storage. SFG microscopy can be used in combination with ATR-FTIR spectroscopy and SEM to understand the crystallization behaviour of amorphous tablets upon compression and storage. When selecting excipients for amorphous formulations, it is important to consider the effect of the excipients on the physical stability of the amorphous formulations.

  19. Two-dimensional sum-frequency generation (2D SFG) reveals structure and dynamics of a surface-bound peptide

    Science.gov (United States)

    Laaser, Jennifer E.; Skoff, David R.; Ho, Jia-Jung; Joo, Yongho; Serrano, Arnaldo L.; Steinkruger, Jay D.; Gopalan, Padma; Gellman, Samuel H.; Zanni, Martin T.

    2014-01-01

    Surface-bound polypeptides and proteins are increasingly used to functionalize inorganic interfaces such as electrodes, but their structural characterization is exceedingly difficult with standard technologies. In this paper, we report the first two-dimensional sum-frequency generation (2D SFG) spectra of a peptide monolayer, which is collected by adding a mid-IR pulse shaper to a standard femtosecond SFG spectrometer. On a gold surface, standard FTIR spectroscopy is inconclusive about the peptide structure because of solvation-induced frequency shifts, but the 2D lineshapes, anharmonic shifts, and lifetimes obtained from 2D SFG reveal that the peptide is largely α-helical and upright. Random coil residues are also observed, which do not themselves appear in SFG spectra due to their isotropic structural distribution, but which still absorb infrared light and so can be detected by cross-peaks in 2D SFG spectra. We discuss these results in the context of peptide design. Because of the similar way in which the spectra are collected, these 2D SFG spectra can be directly compared to 2D IR spectra, thereby enabling structural interpretations of surface-bound peptides and biomolecules based on the well-studied structure/2D IR spectra relationships established from soluble proteins. PMID:24372101

  20. Spectrally- and Time-Resolved Sum Frequency Generation (STiR-SFG): a new tool for ultrafast hydrogen bond dynamics at interfaces.

    Science.gov (United States)

    Benderskii, Alexander; Bordenyuk, Andrey; Weeraman, Champika

    2006-03-01

    The recently developed spectrally- and time-resolved Sum Frequency Generation (STiR-SFG) is a surface-selective 3-wave mixing (IR+visible) spectroscopic technique capable of measuring ultrafast spectral evolution of vibrational coherences. A detailed description of this measurement will be presented, and a noniterative method or deconvolving the laser pulses will be introduced to obtain the molecular response function. STiR-SFG, combined with the frequency-domain SFG spectroscopy, was applied to study hydrogen bonding dynamics at aqueous interfaces (D2O/CaF2). Spectral dynamics of the OD-stretch on the 50-150 fs time scale provides real-time observation of ultrafast H-bond rearrangement. Tuning the IR wavelength to the blue or red side of the OD-stretch transition, we selectively monitor the dynamics of different sub-ensembles in the distribution of the H-bond structures. The blue-side excitation (weaker H-bonding) shows monotonic red-shift of the OD-frequency. In contrast, the red-side excitation (stronger H-bonding structures) produces a blue-shift and a recursion, which may indicate the presence of an underdamped intermolecular mode of interfacial water. Effect of electrolyte concentration on the H-bond dynamics will be discussed.

  1. Adding a dimension to the infrared spectra of interfaces using heterodyne detected 2D sum-frequency generation (HD 2D SFG) spectroscopy.

    Science.gov (United States)

    Xiong, Wei; Laaser, Jennifer E; Mehlenbacher, Randy D; Zanni, Martin T

    2011-12-27

    In the last ten years, two-dimensional infrared spectroscopy has become an important technique for studying molecular structures and dynamics. We report the implementation of heterodyne detected two-dimensional sum-frequency generation (HD 2D SFG) spectroscopy, which is the analog of 2D infrared (2D IR) spectroscopy, but is selective to noncentrosymmetric systems such as interfaces. We implement the technique using mid-IR pulse shaping, which enables rapid scanning, phase cycling, and automatic phasing. Absorptive spectra are obtained, that have the highest frequency resolution possible, from which we extract the rephasing and nonrephasing signals that are sometimes preferred. Using this technique, we measure the vibrational mode of CO adsorbed on a polycrystalline Pt surface. The 2D spectrum reveals a significant inhomogenous contribution to the spectral line shape, which is quantified by simulations. This observation indicates that the surface conformation and environment of CO molecules is more complicated than the simple "atop" configuration assumed in previous work. Our method can be straightforwardly incorporated into many existing SFG spectrometers. The technique enables one to quantify inhomogeneity, vibrational couplings, spectral diffusion, chemical exchange, and many other properties analogous to 2D IR spectroscopy, but specifically for interfaces.

  2. Sum Frequency Generation Vibrational Spectroscopy of 1,3-Butadiene Hydrogenation on 4 nm Pt@SiO 2 , Pd@SiO 2 , and Rh@SiO 2 Core–Shell Catalysts

    KAUST Repository

    Krier, James M.; Michalak, William D.; Cai, Xiaojun; Carl, Lindsay; Komvopoulos, Kyriakos; Somorjai, Gabor A.

    2015-01-01

    NPs (Stöber encapsulation) prepared by colloidal synthesis. Sum frequency generation (SFG) vibrational spectroscopy was performed to correlate surface intermediates observed in situ with reaction selectivity. It is shown that calcination is effective

  3. Probing alpha-helical and beta-sheet structures of peptides at solid/liquid interfaces with SFG.

    Science.gov (United States)

    Chen, Xiaoyun; Wang, Jie; Sniadecki, Jason J; Even, Mark A; Chen, Zhan

    2005-03-29

    We demonstrated that sum frequency generation (SFG) vibrational spectroscopy can distinguish different secondary structures of proteins or peptides adsorbed at solid/liquid interfaces. The SFG spectrum for tachyplesin I at the polystyrene (PS)/solution interface has a fingerprint peak corresponding to the B1/B3 mode of the antiparallel beta-sheet. This peak disappeared upon the addition of dithiothreitol, which can disrupt the beta-sheet structure. The SFG spectrum indicative of the MSI594 alpha-helical structure was observed at the PS/MSI594 solution interface. This research validates SFG as a powerful technique for revealing detailed secondary structures of interfacial proteins and peptides.

  4. Sum Frequency Generation Vibrational Spectroscopy of Adsorbed Amino Acids, Peptides and Proteins of Hydrophilic and Hydrophobic Solid-Water Interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Holinga IV, George Joseph [Univ. of California, Berkeley, CA (United States)

    2010-09-01

    Sum frequency generation (SFG) vibrational spectroscopy was used to investigate the interfacial properties of several amino acids, peptides, and proteins adsorbed at the hydrophilic polystyrene solid-liquid and the hydrophobic silica solid-liquid interfaces. The influence of experimental geometry on the sensitivity and resolution of the SFG vibrational spectroscopy technique was investigated both theoretically and experimentally. SFG was implemented to investigate the adsorption and organization of eight individual amino acids at model hydrophilic and hydrophobic surfaces under physiological conditions. Biointerface studies were conducted using a combination of SFG and quartz crystal microbalance (QCM) comparing the interfacial structure and concentration of two amino acids and their corresponding homopeptides at two model liquid-solid interfaces as a function of their concentration in aqueous solutions. The influence of temperature, concentration, equilibration time, and electrical bias on the extent of adsorption and interfacial structure of biomolecules were explored at the liquid-solid interface via QCM and SFG. QCM was utilized to quantify the biological activity of heparin functionalized surfaces. A novel optical parametric amplifier was developed and utilized in SFG experiments to investigate the secondary structure of an adsorbed model peptide at the solid-liquid interface.

  5. Two-dimensional sum-frequency generation (2D SFG) spectroscopy: summary of principles and its application to amyloid fiber monolayers.

    Science.gov (United States)

    Ghosh, Ayanjeet; Ho, Jia-Jung; Serrano, Arnaldo L; Skoff, David R; Zhang, Tianqi; Zanni, Martin T

    2015-01-01

    By adding a mid-infrared pulse shaper to a sum-frequency generation (SFG) spectrometer, we have built a 2D SFG spectrometer capable of measuring spectra analogous to 2D IR spectra but with monolayer sensitivity and SFG selection rules. In this paper, we describe the experimental apparatus and provide an introduction to 2D SFG spectroscopy to help the reader interpret 2D SFG spectra. The main aim of this manuscript is to report 2D SFG spectra of the amyloid forming peptide FGAIL. FGAIL is a critical segment of the human islet amyloid polypeptide (hIAPP or amylin) that aggregates in people with type 2 diabetes. FGAIL is catalyzed into amyloid fibers by many types of surfaces. Here, we study the structure of FGAIL upon deposition onto a gold surface covered with a self-assembled monolayer of methyl-4-mercaptobenzoate (MMB) that produces an ester coating. FGAIL deposited on bare gold does not form ordered layers. The measured 2D SFG spectrum is consistent with amyloid fiber formation, exhibiting both the parallel (a+) and perpendicular (a-) symmetry modes associated with amyloid β-sheets. Cross peaks are observed between the ester stretches of the coating and the FGAIL peptides. Simulations are presented for two possible structures of FGAIL amyloid β-sheets that illustrate the sensitivity of the 2D SFG spectra to structure and orientation. These results provide some of the first molecular insights into surface catalyzed amyloid fiber structure.

  6. Detection of amide I signals of interfacial proteins in situ using SFG.

    Science.gov (United States)

    Wang, Jie; Even, Mark A; Chen, Xiaoyun; Schmaier, Alvin H; Waite, J Herbert; Chen, Zhan

    2003-08-20

    In this Communication, we demonstrate the novel observation that it is feasible to collect amide signals from polymer/protein solution interfaces in situ using sum frequency generation (SFG) vibrational spectroscopy. Such SFG amide signals allow for acquisition of more detailed molecular level information of entire interfacial protein structures. Proteins investigated include bovine serum albumin, mussel protein mefp-2, factor XIIa, and ubiquitin. Our studies indicate that different proteins generate different SFG amide signals at the polystyrene/protein solution interface, showing that they have different interfacial coverage, secondary structure, or orientation.

  7. Structure and orientation of interfacial proteins determined by sum frequency generation vibrational spectroscopy: method and application.

    Science.gov (United States)

    Ye, Shuji; Wei, Feng; Li, Hongchun; Tian, Kangzhen; Luo, Yi

    2013-01-01

    In situ and real-time characterization of molecular structures and orientation of proteins at interfaces is essential to understand the nature of interfacial protein interaction. Such work will undoubtedly provide important clues to control biointerface in a desired manner. Sum frequency generation vibrational spectroscopy (SFG-VS) has been demonstrated to be a powerful technique to study the interfacial structures and interactions at the molecular level. This paper first systematically introduced the methods for the calculation of the Raman polarizability tensor, infrared transition dipole moment, and SFG molecular hyperpolarizability tensor elements of proteins/peptides with the secondary structures of α-helix, 310-helix, antiparallel β-sheet, and parallel β-sheet, as well as the methodology to determine the orientation of interfacial protein secondary structures using SFG amide I spectra. After that, recent progresses on the determination of protein structure and orientation at different interfaces by SFG-VS were then reviewed, which provides a molecular-level understanding of the structures and interactions of interfacial proteins, specially understanding the nature of driving force behind such interactions. Although this review has focused on analysis of amide I spectra, it will be expected to offer a basic idea for the spectral analysis of amide III SFG signals and other complicated molecular systems such as RNA and DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. NOLM-based all-optical 40 Gbit/s format conversion through sum-frequency generation (SFG) in a PPLN waveguide

    Science.gov (United States)

    Wang, Jian; Sun, Junqiang

    2005-11-01

    A novel all-optical format conversion scheme from NRZ to RZ based on sum-frequency generation (SFG) in a periodically poled LiNbO 3 (PPLN) waveguide is proposed, using a nonlinear optical loop mirror (NOLM). The conversion mechanism relies on the combination of attenuation and nonlinear phase shift induced on the clockwise signal field during the SFG process. The SFG between pump, and co- and counter- propagating signals in the PPLN waveguide are numerically studied, showing that counter-propagating SFG can be ignored when quasi-phase matching (QPM) for SFG during co-propagating interaction. The nonlinear phase shift induced on the clockwise signal field is analyzed in detail, showing that it is more effective to yield large values for nonlinear phase shift when appropriately phase mismatched for the SFG process. Two tuning schemes are proposed depend on whether the sum-frequency wavelength is variable or fixed. It is found that the latter has a rather wide 3dB signal conversion bandwidth approximately 154nm. Finally, the influence of reversible process of SFG is discussed and the optimum arrangement of pump and signal peak powers is theoretically demonstrated. The result shows that proper power arrangement, pump width, and waveguide length are necessary for achieving a good conversion effect.

  9. The molecular orientation of CO on Pd(1 1 1): a polarization-dependent SFG study

    Science.gov (United States)

    Galletto, Paolo; Unterhalt, Holger; Rupprechter, Günther

    2003-01-01

    The molecular orientation of carbon monoxide adsorbed on Pd(1 1 1) was examined by sum frequency generation (SFG) vibrational spectroscopy utilizing different polarization combinations of the visible and SFG light. This allows to determine the CO tilt angle with respect to the substrate, provided that a proper optical model for the interface can be defined. It is demonstrated that it is essential to invoke the βaac hyperpolarizability into the analysis and that polarization-dependent SFG of CO/Pd(1 1 1) yields information on βaac/ βccc rather than the tilt angle.

  10. Wavelength tunable CW red laser generated based on an intracavity-SFG composite cavity

    Science.gov (United States)

    Zhang, Z. N.; Bai, Y.; Lei, G. Z.; Bai, B.; Sun, Y. X.; Hu, M. X.; Wang, C.; Bai, J. T.

    2016-12-01

    We report a wavelength-tunable watt-level continuous wave (CW) red laser that uses a composite cavity based on an intracavity sum-frequency generation (SFG). The composite cavity is composed of a LD side-pumped Nd: GdVO4 p-polarized 1062.9 nm resonant cavity and a resonant optical parametric oscillator (SRO) of s-polarized signal light using a periodically poled crystal MgO: PPLN. Based on the temperature tuning from 30 °C to 200 °C, the CW red laser beams are obtained in a tunable waveband from 634.4 nm to 649.1 nm, corresponding to a tunable output waveband from 3278.0 nm to 2940.2 nm of the mid-infrared idler lights. The maximum CW output power of the red laser at 634.4 nm and the idler light at 3278.0 nm reach 3.03 W and 4.13 W under 30 °C, respectively.

  11. Chemical imaging of structured SAMs with a novel SFG microscope

    Science.gov (United States)

    Hoffmann, Dominik M. P.; Kuhnke, Klaus; Kern, Klaus

    2002-11-01

    We present a newly developed microscope for sum frequency generation (SFG) imaging of opaque and reflecting interfaces. The sample is viewed at an angle of 60° with respect to the surface normal in order to increase the collected SFG intensity. Our setup is designed to keep the whole field of view (FOV) in focus and to compensate for the distortion usually related to oblique imaging by means of a blazed grating. The separation of the SFG intensity and the reflected visible beam is accomplished by a suitable combination of spectral filters. The sum frequency microscope (SFM) is capable of in-situ chemically selective imaging by tuning the IR-beam to vibrational transitions of the respective molecules. The SFM is applied to imaging of structured self-assembled monolayers (SAM) of thiol molecules on a gold surface.

  12. Deducing 2D crystal structure at the liquid/solid interface with atomic resolution: a combined STM and SFG study.

    Science.gov (United States)

    McClelland, Arthur A; Ahn, Seokhoon; Matzger, Adam J; Chen, Zhan

    2009-11-17

    Sum frequency generation vibrational spectroscopy (SFG) has been applied to study two-dimensional (2D) crystals formed by an isophthalic acid diester on the surface of highly oriented pyrolytic graphite, providing complementary measurements to scanning tunneling microscopy (STM) and computational modeling. SFG results indicate that both aromatic and C=O groups in the 2D crystal tilt from the surface. This study demonstrates that a combination of SFG and STM techniques can be used to gain a more complete picture of 2D crystal structure, and it is necessary to consider solvent-2D crystal interactions and dynamics in the computer models to achieve an accurate representation of interfacial structure.

  13. Sensibility to Changes of Vibrational Modes of Excited Electron: Sum Frequency Signals Versus Difference Frequency Signals

    International Nuclear Information System (INIS)

    Gu Anna; Liang Xianting

    2011-01-01

    In this paper, we investigate a two electronic level system with vibrational modes coupled to a Brownian oscillator bath. The difference frequency generation (DFG) signals and sum frequency generation (SFG) signals are calculated. It is shown that, for the same model, the SFG signals are more sensitive than the DFG signals to the changes of the vibrational modes of the electronic two-level system. Because the SFG conversion efficiency can be improved by using the time-delay method, the findings in this paper predict that the SFG spectrum may probe the changes of the microstructure more effectively. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

  14. Self-assembled organic and fullerene monolayers characterisation by two-colour SFG spectroscopy: a pathway to meet doubly resonant SFG process

    International Nuclear Information System (INIS)

    Humbert, C.; Caudano, Y.; Dreesen, L.; Sartenaer, Y.; Mani, A.A.; Silien, C.; Lemaire, J.-J.; Thiry, P.A.; Peremans, A.

    2004-01-01

    Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C 60 /Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces is explained in terms of metal interband transition, molecular electronic transition and of electron-phonon coupling, respectively

  15. Self-assembled organic and fullerene monolayers characterisation by two-colour SFG spectroscopy: a pathway to meet doubly resonant SFG process

    Science.gov (United States)

    Humbert, C.; Caudano, Y.; Dreesen, L.; Sartenaer, Y.; Mani, A. A.; Silien, C.; Lemaire, J.-J.; Thiry, P. A.; Peremans, A.

    2004-10-01

    Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[ p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C 60/Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces is explained in terms of metal interband transition, molecular electronic transition and of electron-phonon coupling, respectively.

  16. Self-assembled organic and fullerene monolayers characterisation by two-colour SFG spectroscopy: a pathway to meet doubly resonant SFG process

    OpenAIRE

    Humbert, C.; Caudano, Y.; Dreesen, Laurent; Sartenaer, Y.; Mani, A. A.; Silien, C.; Lemaire, J.-J.; Thiry, P. A.; Peremans, A.

    2004-01-01

    Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C60/Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces...

  17. Vibrational dynamics of adsorbed molecules under conditions of photodesorption: Pump-probe SFG spectra of CO/Pt(111)

    Science.gov (United States)

    Fournier, Frédéric; Zheng, Wanquan; Carrez, Serge; Dubost, Henri; Bourguignon, Bernard

    2004-09-01

    Interaction of CO adsorbed on Pt(111) with electrons and phonons is studied experimentally by means of a pump-probe experiment where CO is probed by IR+visible sum frequency generation under a pump laser intensity that allows photodesorption. Vibrational spectra of CO internal stretch are obtained as a function of pump-probe delay. A two-temperature and anharmonic coupling model is used to extract from the spectra the real time variations of CO peak frequency and dephasing time. The main conclusions are the following: (i) The CO stretch is perturbed by two low-frequency modes, assigned to frustrated rotation and frustrated translation. (ii) The frustrated rotation is directly coupled to electrons photoexcited in Pt(111) by the pump laser. (iii) There is no evidence of Pt-CO stretch excitation in the spectra. The implications for the photodesorption dynamics are discussed.

  18. An SFG study of interfacial amino acids at the hydrophilic SiO2 and hydrophobic deuterated polystyrene surfaces.

    Science.gov (United States)

    Holinga, George J; York, Roger L; Onorato, Robert M; Thompson, Christopher M; Webb, Nic E; Yoon, Alfred P; Somorjai, Gabor A

    2011-04-27

    Sum frequency generation (SFG) vibrational spectroscopy was employed to characterize the interfacial structure of eight individual amino acids--L-phenylalanine, L-leucine, glycine, L-lysine, L-arginine, L-cysteine, L-alanine, and L-proline--in aqueous solution adsorbed at model hydrophilic and hydrophobic surfaces. Specifically, SFG vibrational spectra were obtained for the amino acids at the solid-liquid interface between both hydrophobic d(8)-polystyrene (d(8)-PS) and SiO(2) model surfaces and phosphate buffered saline (PBS) at pH 7.4. At the hydrophobic d(8)-PS surface, seven of the amino acids solutions investigated showed clear and identifiable C-H vibrational modes, with the exception being l-alanine. In the SFG spectra obtained at the hydrophilic SiO(2) surface, no C-H vibrational modes were observed from any of the amino acids studied. However, it was confirmed by quartz crystal microbalance that amino acids do adsorb to the SiO(2) interface, and the amino acid solutions were found to have a detectable and widely varying influence on the magnitude of SFG signal from water at the SiO(2)/PBS interface. This study provides the first known SFG spectra of several individual amino acids in aqueous solution at the solid-liquid interface and under physiological conditions.

  19. Hydrogenation of the alpha,beta-Unsaturated Aldehydes Acrolein, Crotonaldehyde, and Prenal over Pt Single Crystals: A Kinetic and Sum-Frequency Generation Vibrational Spectroscopy Study

    Energy Technology Data Exchange (ETDEWEB)

    Kliewer, C.J.; Somorjai, G.A.

    2008-11-26

    Sum-frequency generation vibrational spectroscopy (SFG-VS) and kinetic measurements using gas chromatography have been used to study the surface reaction intermediates during the hydrogenation of three {alpha},{beta}-unsaturated aldehydes, acrolein, crotonaldehyde, and prenal, over Pt(111) at Torr pressures (1 Torr aldehyde, 100 Torr hydrogen) in the temperature range of 295K to 415K. SFG-VS data showed that acrolein has mixed adsorption species of {eta}{sub 2}-di-{sigma}(CC)-trans, {eta}{sub 2}-di-{sigma}(CC)-cis as well as highly coordinated {eta}{sub 3} or {eta}{sub 4} species. Crotonaldehyde adsorbed to Pt(111) as {eta}{sub 2} surface intermediates. SFG-VS during prenal hydrogenation also suggested the presence of the {eta}{sub 2} adsorption species, and became more highly coordinated as the temperature was raised to 415K, in agreement with its enhanced C=O hydrogenation. The effect of catalyst surface structure was clarified by carrying out the hydrogenation of crotonaldehyde over both Pt(111) and Pt(100) single crystals while acquiring the SFG-VS spectra in situ. Both the kinetics and SFG-VS showed little structure sensitivity. Pt(100) generated more decarbonylation 'cracking' product while Pt(111) had a higher selectivity for the formation of the desired unsaturated alcohol, crotylalcohol.

  20. Probing organic field effect transistors in situ during operation using SFG.

    Science.gov (United States)

    Ye, Hongke; Abu-Akeel, Ashraf; Huang, Jia; Katz, Howard E; Gracias, David H

    2006-05-24

    In this communication, we report results obtained using surface-sensitive IR+Visible Sum Frequency Generation (SFG) nonlinear optical spectroscopy on interfaces of organic field effect transistors during operation. We observe remarkable correlations between trends in the surface vibrational spectra and electrical properties of the transistor, with changes in gate voltage (VG). These results suggest that field effects on electronic conduction in thin film organic semiconductor devices are correlated to interfacial nonlinear optical characteristics and point to the possibility of using SFG spectroscopy to monitor electronic properties of OFETs.

  1. Intrinsic Chirality and Prochirality at Air/R-(+)- and S-(-)-Limonene Interfaces: Spectral Signatures with Interference Chiral Sum-Frequency Generation Vibrational Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Li; Zhang, Yun; Wei, Zhehao; Wang, Hongfei

    2014-06-04

    We report in this work detailed measurements on the chiral and achiral sum-frequency vibrational spectra in the C-H stretching vibration region (2800-3050cm-1) of the air/liquid interfaces of R-limonene and S-limonene, using the recently developed high-resolution broadband sum-frequency generation vibrational spectroscopy (HR-BB-SFG-VS). The achiral SFG spectra of R-limonene and S-limonene, as well as the equal amount (50/50) racemic mixture show that the enantiomers are with the same interfacial orientations. The interference chiral SFG spectra of the limonene enantiomers exhibit spectral signature from chiral response of the Cα-H stretching mode, and spectral signature from prochiral response of the CH2 asymmetric stretching mode, respectively. The chiral spectral feature of the Cα-H stretching mode changes sign from R-limonene to S-limonene, and disappears for the 50/50 racemic mixture. While the prochiral spectral feature of the CH2 asymmetric stretching mode is the same for R-limonene and S-limonene, and also surprisingly remains the same for the 50/50 racemic mixture. These results provided detail information in understanding the structure and chirality of molecular interfaces, and demonstrated the sensitivity and potential of SFG-VS as unique spectroscopic tool for chirality characterization and chiral recognition at the molecular interface.

  2. Interfacial structure of soft matter probed by SFG spectroscopy.

    Science.gov (United States)

    Ye, Shen; Tong, Yujin; Ge, Aimin; Qiao, Lin; Davies, Paul B

    2014-10-01

    Sum frequency generation (SFG) vibrational spectroscopy, an interface-specific technique in contrast to, for example, attenuated total reflectance spectroscopy, which is only interface sensitive, has been employed to investigate the surface and interface structure of soft matter on a molecular scale. The experimental arrangement required to carry out SFG spectroscopy, with particular reference to soft matter, and the analytical methods developed to interpret the spectra are described. The elucidation of the interfacial structure of soft matter systems is an essential prerequisite in order to understand and eventually control the surface properties of these important functional materials. Copyright © 2014 The Chemical Society of Japan and Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. SFG and SPR Study of Sodium Dodecyl Sulfate Film Assembly on Positively Charged Surfaces

    Science.gov (United States)

    Song, Sanghun; Weidner, Tobias; Wagner, Matthew; Castner, David

    2012-02-01

    This study uses sum frequency generation (SFG) vibrational spectroscopy and surface plasmon resonance (SPR) sensing to investigate the structure of sodium dodecyl sulfate (SDS) films formed on positively charged and hydrophilic surfaces. The SPR signals show a good surface coverage suggesting that full monolayer coverage is reached at 1 mM. SFG spectra of SDS adsorbed exhibits well resolved CH3 peaks and OH peaks. At both 0.2 mM and 1 mM SDS concentration the intensity of both the CH3 and OH peaks decreased close to background levels. We found that the loss of SFG signal at 0.2 mM occurs at this concentration independent of surface charge density. It is more likely that the loss of signal is related to structural inhomogeneity induced by a striped phase - stand-up phase transition. This is supported by a distinct change of the relative SFG phase between CH3/OH near 0.2 mM. The second intensity minimum might be related to charge compensation effects. We observed a substrate dependence for the high concentration transition. We also observed distinct SFG signal phase changes for water molecules associated with SDS layers at different SDS solution concentrations indicating that the orientation of bound water changed with SDS surface structure.

  4. SFG studies on interactions between antimicrobial peptides and supported lipid bilayers.

    Science.gov (United States)

    Chen, Xiaoyun; Chen, Zhan

    2006-09-01

    The mode of action of antimicrobial peptides (AMPs) in disrupting cell membrane bilayers is of fundamental importance in understanding the efficiency of different AMPs, which is crucial to design antibiotics with improved properties. Recent developments in the field of sum frequency generation (SFG) vibrational spectroscopy have made it a powerful and unique biophysical technique in investigating the interactions between AMPs and a single substrate supported planar lipid bilayer. We will review some of the recent progress in applying SFG to study membrane lipid bilayers and discuss how SFG can provide novel information such as real-time bilayer structure change and AMP orientation during AMP-lipid bilayer interactions in a very biologically relevant manner. Several examples of applying SFG to monitor such interactions between AMPs and a dipalmitoyl phosphatidylglycerol (DPPG) bilayer are presented. Different modes of actions are observed for melittin, tachyplesin I, d-magainin 2, MSI-843, and a synthetic antibacterial oligomer, demonstrating that SFG is very effective in the study of AMPs and AMP-lipid bilayer interactions.

  5. Demonstrating the feasibility of monitoring the molecular-level structures of moving polymer/silane interfaces during silane diffusion using SFG.

    Science.gov (United States)

    Chen, Chunyan; Wang, Jie; Loch, Cheryl L; Ahn, Dongchan; Chen, Zhan

    2004-02-04

    In this paper, the feasibility of monitoring molecular structures at a moving polymer/liquid interface by sum frequency generation (SFG) vibrational spectroscopy has been demonstrated. N-(2-Aminoethyl)-3-aminopropyltrimethoxysilane (AATM, NH2(CH2)2NH(CH2)3Si(OCH3)3) has been brought into contact with a deuterated poly(methyl methacrylate) (d-PMMA) film, and the interfacial silane structure has been monitored using SFG. Upon initial contact, the SFG spectra can be detected, but as time progresses, the spectral intensity changes and finally disappears. Additional experiments indicate that these silane molecules can diffuse into the polymer film and the detected SFG signals are actually from the moving polymer/silane interface. Our results show that the molecular order of the polymer/silane interface exists during the entire diffusion process and is lost when the silane molecules traverse through the thickness of the d-PMMA film. The loss of the SFG signal is due to the formation of a new disordered substrate/silane interface, which contributes no detectable SFG signal. The kinetics of the diffusion of the silane into the polymer have been deduced from the time-dependent SFG signals detected from the AATM molecules as they diffuse through polymer films of different thickness.

  6. Effect of surface structure on catalytic reactions: A sum frequency generation surface vibrational spectroscopy study

    International Nuclear Information System (INIS)

    McCrea, Keith R.

    2001-01-01

    In the results discussed above, it is clear that Sum Frequency Generation (SFG) is a unique tool that allows the detection of vibrational spectra of adsorbed molecules present on single crystal surfaces under catalytic reaction conditions. Not only is it possible to detect active surface intermediates, it is also possible to detect spectator species which are not responsible for the measured turnover rates. By correlating high-pressure SFG spectra under reaction conditions and gas chromatography (GC) kinetic data, it is possible to determine which species are important under reaction intermediates. Because of the flexibility of this technique for studying surface intermediates, it is possible to determine how the structures of single crystal surfaces affect the observed rates of catalytic reactions. As an example of a structure insensitive reaction, ethylene hydrogenation was explored on both Pt(111) and Pt(100). The rates were determined to be essentially the same. It was observed that both ethylidyne and di-(sigma) bonded ethylene were present on the surface under reaction conditions on both crystals, although in different concentrations. This result shows that these two species are not responsible for the measured turnover rate, as it would be expected that one of the two crystals would be more active than the other, since the concentration of the surface intermediate would be different on the two crystals. The most likely active intermediates are weakly adsorbed molecules such as(pi)-bonded ethylene and ethyl. These species are not easily detected because their concentration lies at the detection limit of SFG. The SFG spectra and GC data essentially show that ethylene hydrogenation is structure insensitive for Pt(111) and Pt(100). SFG has proven to be a unique and excellent technique for studying adsorbed species on single crystal surfaces under high-pressure catalytic reactions. Coupled with kinetic data obtained from gas chromatography measurements, it can

  7. Hydrogen-Bonding Network and OH Stretch Vibration of Cellulose: Comparison of Computational Modeling with Polarized IR and SFG Spectra.

    Science.gov (United States)

    Lee, Christopher M; Kubicki, James D; Fan, Bingxin; Zhong, Linghao; Jarvis, Michael C; Kim, Seong H

    2015-12-10

    Hydrogen bonds play critical roles in noncovalent directional interactions determining the crystal structure of cellulose. Although diffraction studies accurately determined the coordinates of carbon and oxygen atoms in crystalline cellulose, the structural information on hydrogen atoms involved in hydrogen-bonding is still elusive. This could be complemented by vibrational spectroscopy; but the assignment of the OH stretch peaks has been controversial. In this study, we performed calculations using density functional theory with dispersion corrections (DFT-D2) for the cellulose Iβ crystal lattices with the experimentally determined carbon and oxygen coordinates. DFT-D2 calculations revealed that the OH stretch vibrations of cellulose are highly coupled and delocalized through intra- and interchain hydrogen bonds involving all OH groups in the crystal. Additionally, molecular dynamics (MD) simulations of a single cellulose microfibril showed that the conformations of OH groups exposed at the microfibril surface are not well-defined. Comparison of the computation results with the experimentally determined IR dichroism of uniaxially aligned cellulose microfibrils and the peak positions of various cellulose crystals allowed unambiguous identification of OH stretch modes observed in the vibrational spectra of cellulose.

  8. Adsorption of 1- and 2-butylimidazoles at the copper/air and steel/air interfaces studied by sum frequency generation vibrational spectroscopy.

    Science.gov (United States)

    Casford, Michael T L; Davies, Paul B

    2012-07-24

    The structure of thin films of 1- and 2-butylimidazoles adsorbed on copper and steel surfaces under air was examined using sum frequency generation (SFG) vibrational spectroscopy in the ppp and ssp polarizations. Additionally, the SFG spectra of both isomers were recorded at 55 °C at the liquid imidazole/air interface for reference. Complementary bulk infrared, reflection-absorption infrared spectroscopy (RAIRS), and Raman spectra of both imidazoles were recorded for assignment purposes. The SFG spectra in the C-H stretching region at the liquid/air interface are dominated by resonances from the methyl end group of the butyl side chain of the imidazoles, indicating that they are aligned parallel or closely parallel to the surface normal. These are also the most prominent features in the SFG spectra on copper and steel. In addition, both the ppp and ssp spectra on copper show resonances from the C-H stretching modes of the imidazole ring for both isomers. The ring C-H resonances are completely absent from the spectra on steel and at the liquid/air interface. The relative intensities of the SFG spectra can be interpreted as showing that, on copper, under air, both butylimidazoles are adsorbed with their butyl side chains perpendicular to the interface and with the ring significantly inclined away from the surface plane and toward the surface normal. The SFG spectra of both imidazoles on steel indicate an orientation where the imidazole rings are parallel or nearly parallel to the surface. The weak C-H resonances from the ring at the liquid/air interface suggest that the tilt angle of the ring from the surface normal at this interface is significantly greater than it is on copper.

  9. A trough for improved SFG spectroscopy of lipid monolayers

    Science.gov (United States)

    Franz, Johannes; van Zadel, Marc-Jan; Weidner, Tobias

    2017-05-01

    Lipid monolayers are indispensable model systems for biological membranes. The main advantage over bilayer model systems is that the surface pressure within the layer can be directly and reliably controlled. The sensitive interplay between surface pressure and temperature determines the molecular order within a model membrane and consequently determines the membrane phase behavior. The lipid phase is of crucial importance for a range of membrane functions such as protein interactions and membrane permeability. A very reliable method to probe the structure of lipid monolayers is sum frequency generation (SFG) vibrational spectroscopy. Not only is SFG extremely surface sensitive but it can also directly access critical parameters such as lipid order and orientation, and it can provide valuable information about protein interactions along with interfacial hydration. However, recent studies have shown that temperature gradients caused by high power laser beams perturb the lipid layers and potentially obscure the spectroscopic results. Here we demonstrate how the local heating problem can be effectively reduced by spatially distributing the laser pulses on the sample surface using a translating Langmuir trough for SFG experiments at lipid monolayers. The efficiency of the trough is illustrated by the detection of enhanced molecular order due to reduced heat load.

  10. Cooperative Effects of Zwitterionic-Ionic Surfactant Mixtures on the Interfacial Water Structure Revealed by Sum Frequency Generation Vibrational Spectroscopy.

    Science.gov (United States)

    Pan, Xuecong; Yang, Fangyuan; Chen, Shunli; Zhu, Xuefeng; Wang, Chuanyi

    2018-05-08

    Cooperative effects of a series of equimolar binary zwitterionic-ionic surfactant mixtures on the interfacial water structure at the air-water interfaces have been studied by sum frequency generation vibrational spectroscopy (SFG-VS). For zwitterionic surfactant palmityl sulfobetaine (SNC 16 ), anionic surfactant sodium hexadecyl sulfate (SHS), and cationic surfactant cetyltrimethylammonium bromide (CTAB) with the same length of alkyl chain, significantly enhanced ordering of interfacial water molecules was observed for the zwitterionic-anionic surfactant mixtures SNC 16 -SHS, indicating that SNC 16 interacts more strongly with SHS than with CTAB because of the strong headgroup-headgroup electrostatic attraction for SNC 16 -SHS. Meanwhile, the SFG amplitude ratio of methyl and methylene symmetric stretching modes was used to verify the stronger interaction between SNC 16 and SHS. The conformational order indicator increased from 0.64 for SNC 16 to 7.17 for SNC 16 -SHS but only 0.94 for SNC 16 -CTAB. In addition, another anionic surfactant sodium dodecyl sulfate (SDS) was introduced to study the influence of chain-chain interaction. Decreased SFG amplitude of interfacial water molecules for SNC 16 -SDS was observed. Therefore, both the headgroup-headgroup electrostatic interaction and chain-chain van der Waals attractive interaction of the surfactants play an important role in enhancing the ordering of interfacial water molecules. The results provided experimental and theoretical bases for practical applications of the surfactants.

  11. Studies of Heterogeneously Catalyzed Liquid-Phase Alcohol Oxidation on Platinum bySum-frequency Generation Vibrational Spectroscopy and Reaction Rate Measurements

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Christopher [Univ. of California, Berkeley, CA (United States)

    2014-05-15

    Compared to many branches of chemistry, the molecular level study of catalytically active surfaces is young. Only with the invention of ultrahigh vacuum technology in the past half century has it been possible to carry out experiments that yield useful molecular information about the reactive occurrences at a surface. The reason is two-fold: low pressure is necessary to keep a surface clean for an amount of time long enough to perform an experiment, and most atomic scale techniques that are surface speci c (x-ray photoelectron spectroscopy, electron energy loss spectroscopy, Auger electron spectroscopy, etc.) cannot be used at ambient pressures, because electrons, which act as chemical probes in these techniques, are easily scattered by molecules. Sum-frequency generation (SFG) vibrational spectroscopy is one technique that can provide molecular level information from the surface without the necessity for high vacuum. Since the advent of SFG as a surface spectroscopic tool it has proved its worth in the studies of surface catalyzed reactions in the gas phase, with numerous reactions in the gas phase having been investigated on a multitude of surfaces. However, in situ SFG characterization of catalysis at the solid-liquid interface has yet to be thoroughly pursued despite the broad interest in the use of heterogeneous catalysts in the liquid phase as replacements for homogeneous counterparts. This work describes an attempt to move in that direction, applying SFG to study the solid-liquid interface under conditions of catalytic alcohol oxidation on platinum.

  12. Self-assembled organic and fullerene monolayers characterisation by two-colour SFG spectroscopy: a pathway to meet doubly resonant SFG process

    Energy Technology Data Exchange (ETDEWEB)

    Humbert, C.; Caudano, Y.; Dreesen, L.; Sartenaer, Y.; Mani, A.A.; Silien, C.; Lemaire, J.-J.; Thiry, P.A.; Peremans, A

    2004-10-15

    Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C{sub 60}/Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces is explained in terms of metal interband transition, molecular electronic transition and of electron-phonon coupling, respectively.

  13. Seasonal signatures in SFG vibrational spectra of the sea surface nanolayer at Boknis Eck Time Series Station (SW Baltic Sea

    Directory of Open Access Journals (Sweden)

    K. Laß

    2013-08-01

    Full Text Available The very thin sea surface nanolayer on top of the sea surface microlayer, sometimes just one monomolecular layer thick, forms the interface between ocean and atmosphere. Due to the small dimension and tiny amount of substance, knowledge about the development of the layer in the course of the year is scarce. In this work, the sea surface nanolayer at Boknis Eck Time Series Station (BE, southwestern Baltic Sea, has been investigated over a period of three and a half years. Surface water samples were taken monthly by screen sampling and were analyzed in terms of organic content and composition by sum frequency generation spectroscopy, which is specifically sensitive to interfacial layers. A yearly periodicity has been observed with a pronounced abundance of sea surface nanolayer material (such as carbohydrate-rich material during the summer months. On the basis of our results we conclude that the abundance of organic material in the nanolayer at Boknis Eck is not directly related to phytoplankton abundance alone. We speculate that indeed sloppy feeding of zooplankton together with photochemical and/or microbial processing of organic precursor compounds is responsible for the pronounced seasonality.

  14. Seasonal signatures in SFG vibrational spectra of the sea surface nanolayer at Boknis Eck Time Series Station (SW Baltic Sea)

    Science.gov (United States)

    Laß, K.; Bange, H. W.; Friedrichs, G.

    2013-08-01

    The very thin sea surface nanolayer on top of the sea surface microlayer, sometimes just one monomolecular layer thick, forms the interface between ocean and atmosphere. Due to the small dimension and tiny amount of substance, knowledge about the development of the layer in the course of the year is scarce. In this work, the sea surface nanolayer at Boknis Eck Time Series Station (BE), southwestern Baltic Sea, has been investigated over a period of three and a half years. Surface water samples were taken monthly by screen sampling and were analyzed in terms of organic content and composition by sum frequency generation spectroscopy, which is specifically sensitive to interfacial layers. A yearly periodicity has been observed with a pronounced abundance of sea surface nanolayer material (such as carbohydrate-rich material) during the summer months. On the basis of our results we conclude that the abundance of organic material in the nanolayer at Boknis Eck is not directly related to phytoplankton abundance alone. We speculate that indeed sloppy feeding of zooplankton together with photochemical and/or microbial processing of organic precursor compounds is responsible for the pronounced seasonality.

  15. Intrinsic chirality and prochirality at Air/R-(+)- and S-(-)-limonene interfaces: spectral signatures with interference chiral sum-frequency generation vibrational spectroscopy.

    Science.gov (United States)

    Fu, Li; Zhang, Yun; Wei, Zhe-Hao; Wang, Hong-Fei

    2014-09-01

    We report in this work detailed measurements of the chiral and achiral sum-frequency vibrational spectra in the C-H stretching vibration region (2800-3050 cm(-1)) of the air/liquid interfaces of R-(+)-limonene and S-(-)-limonene, using the recently developed high-resolution broadband sum-frequency generation vibrational spectroscopy (HR-BB-SFG-VS). The achiral SFG spectra of R-limonene and S-limonene, as well as the RS racemic mixture (50/50 equal amount mixture), show that the corresponding molecular groups of the R and S enantiomers are with the same interfacial orientations. The interference chiral SFG spectra of the limonene enantiomers exhibit a spectral signature from the chiral response of the Cα-H stretching mode, and a spectral signature from the prochiral response of the CH(2) asymmetric stretching mode, respectively. The chiral spectral feature of the Cα-H stretching mode changes sign from R-(+)-limonene to S-(-)-limonene surfaces, and disappears for the RS racemic mixture surface. While the prochiral spectral feature of the CH(2) asymmetric stretching mode is the same for R-(+)-limonene and S-(-)-limonene surfaces, and also surprisingly remains the same for the RS racemic mixture surface. Therefore, the structures of the R-(+)-limonene and the S-(-)-limonene at the liquid interfaces are nevertheless not mirror images to each other, even though the corresponding groups have the same tilt angle from the interfacial normal, i.e., the R-(+)-limonene and the S-(-)-limonene at the surface are diastereomeric instead of enantiomeric. These results provide detailed information in understanding the structure and chirality of molecular interfaces and demonstrate the sensitivity and potential of SFG-VS as a unique spectroscopic tool for chirality characterization and chiral recognition at the molecular interface. © 2014 Wiley Periodicals, Inc.

  16. Sum Frequency Generation Vibrational Spectroscopy of 1,3-Butadiene Hydrogenation on 4 nm Pt@SiO 2 , Pd@SiO 2 , and Rh@SiO 2 Core–Shell Catalysts

    KAUST Repository

    Krier, James M.

    2015-01-14

    © 2014 American Chemical Society. 1,3-Butadiene (1,3-BD) hydrogenation was performed on 4 nm Pt, Pd, and Rh nanoparticles (NPs) encapsulated in SiO2 shells at 20, 60, and 100 °C. The core-shells were grown around polyvinylpyrrolidone (PVP) coated NPs (Stöber encapsulation) prepared by colloidal synthesis. Sum frequency generation (SFG) vibrational spectroscopy was performed to correlate surface intermediates observed in situ with reaction selectivity. It is shown that calcination is effective in removing PVP, and the SFG signal can be generated from the metal surface. Using SFG, it is possible to compare the surface vibrational spectrum of Pt@SiO2 (1,3-BD is hydrogenated through multiple paths and produces butane, 1-butene, and cis/trans-2-butene) to Pd@SiO2 (1,3-BD favors one path and produces 1-butene and cis/trans-2-butene). In contrast to Pt@SiO2 and Pd@SiO2, SFG and kinetic experiments of Rh@SiO2 show a permanent accumulation of organic material.

  17. Sum Frequency Generation Vibrational Spectroscopy Studies on ModelPeptide Adsorption at the Hydrophobic Solid-Water and HydrophilicSolid-Water Interfaces

    Energy Technology Data Exchange (ETDEWEB)

    York, Roger L. [Univ. of California, Berkeley, CA (United States)

    2007-01-01

    Sum frequency generation (SFG) vibrational spectroscopy has been used to study the interfacial structure of several polypeptides and amino acids adsorbed to hydrophobic and hydrophilic surfaces under a variety of experimental conditions. Peptide sequence, peptide chain length, peptide hydrophobicity, peptide side-chain type, surface hydrophobicity, and solution ionic strength all affect an adsorbed peptide's interfacial structure. Herein, it is demonstrated that with the choice of simple, model peptides and amino acids, surface specific SFG vibrational spectroscopy can be a powerful tool to elucidate the interfacial structure of these adsorbates. Herein, four experiments are described. In one, a series of isosequential amphiphilic peptides are synthesized and studied when adsorbed to both hydrophobic and hydrophilic surfaces. On hydrophobic surfaces of deuterated polystyrene, it was determined that the hydrophobic part of the peptide is ordered at the solid-liquid interface, while the hydrophilic part of the peptide appears to have a random orientation at this interface. On a hydrophilic surface of silica, it was determined that an ordered peptide was only observed if a peptide had stable secondary structure in solution. In another experiment, the interfacial structure of a model amphiphilic peptide was studied as a function of the ionic strength of the solution, a parameter that could change the peptide's secondary structure in solution. It was determined that on a hydrophobic surface, the peptide's interfacial structure was independent of its structure in solution. This was in contrast to the adsorbed structure on a hydrophilic surface, where the peptide's interfacial structure showed a strong dependence on its solution secondary structure. In a third experiment, the SFG spectra of lysine and proline amino acids on both hydrophobic and hydrophilic surfaces were obtained by using a different experimental geometry that increases the SFG signal

  18. Coherent Raman Imaging of Live Muscle Sarcomeres Assisted by SFG Microscopy.

    Science.gov (United States)

    Kim, Hyunmin; Kim, Do-Young; Joo, Kyung-Il; Kim, Jung-Hye; Jeong, Soon Moon; Lee, Eun Seong; Hahm, Jeong-Hoon; Kim, Kyuhyung; Moon, Dae Woon

    2017-08-23

    In this study, we used spectrally focused coherent anti-Stokes Raman scattering (spCARS) microscopy assisted by sum-frequency generation (SFG) to monitor the variations in the structural morphology and molecular vibrations of a live muscle of Caenorhabditis elegans. The subunits of the muscle sarcomeres, such as the M-line, myosin, dense body, and α-actinin, were alternatively observed using spCARS microscopy for different sample orientations, with the guidance of a myosin positional marker captured by SFG microscopy. Interestingly enough, the beam polarization dependence of the spCARS contrasts for two parallel subunits (dense body and myosin) showed a ~90° phase difference. The chemically sensitive spCARS spectra induced by the time-varying overlap of two pulses allowed (after a robust subtraction of the non-resonant background using a modified Kramers-Krönig transformation method) high-fidelity detection of various genetically modified muscle sarcomeres tuned to the C-H vibration (2800-3100 cm -1 ). Conversely, SFG image mapping assisted by phase-retrieved spCARS spectra also facilitated label-free monitoring of the changes in the muscle content of C. elegans that are associated with aging, based on the hypothesis that the C-H vibrational modes could serve as qualitative chemical markers sensitive to the amount and/or structural modulation of the muscle.

  19. Catalyzed hydrogenation of nitrogen and ethylene on metal (Fe, Pt) single crystal surfaces and effects of coadsorption: A sum frequency generation vibrational spectroscopy study

    Energy Technology Data Exchange (ETDEWEB)

    Westerberg, Staffan Per Gustav [Univ. of California, Berkeley, CA (United States)

    2004-01-01

    High-pressure catalytic reactions and associated processes, such as adsorption have been studied on a molecular level on single crystal surfaces. Sum Frequency Generation (SFG) vibrational spectroscopy together with Auger Electron Spectroscopy (AES), Temperature Programmed Desorption (TPD) and Gas Chromatography (GC) were used to investigate the nature of species on catalytic surfaces and to measure the catalytic reaction rates. Special attention has been directed at studying high-pressure reactions and in particular, ammonia synthesis in order to identify reaction intermediates and the influence of adsorbates on the surface during reaction conditions. The adsorption of gases N2, H2, O2 and NH3 that play a role in ammonia synthesis have been studied on the Fe(111) crystal surface by sum frequency generation vibrational spectroscopy using an integrated Ultra-High Vacuum (UHV)/high-pressure system. SFG spectra are presented for the dissociation intermediates, NH2 (~3325 cm-1) and NH (~3235 cm-1) under high pressure of ammonia (200 Torr) on the clean Fe(111) surface. Addition of 0.5 Torr of oxygen to 200 Torr of ammonia does not significantly change the bonding of dissociation intermediates to the surface. However, it leads to a phase change of nearly 180° between the resonant and non-resonant second order non-linear susceptibility of the surface, demonstrated by the reversal of the SFG spectral features. Heating the surface in the presence of 200 Torr ammonia and 0.5 Torr oxygen reduces the oxygen coverage, which can be seen from the SFG spectra as another relative phase change of 180°. The reduction of the oxide is also supported by Auger electron spectroscopy. The result suggests that the phase change of the spectral features could serve as a sensitive indicator of the chemical environment of the adsorbates.

  20. SFG experiment and ab initio study of the chemisorption of CN - on low-index platinum surfaces

    Science.gov (United States)

    Tadjeddine, M.; Flament, J.-P.; Le Rille, A.; Tadjeddine, A.

    2006-05-01

    A dual analysis is proposed in order to have a better understanding of the adsorption of the cyanide ions on a platinum electrode. The SFG (Sum Frequency Generation) spectroscopy allows the in situ vibrational study and the SFG spectra of the CN - species adsorbed on single crystal Pt electrode allow a systematic study of the low-index platinum surfaces. This experimental work is supported by ab initio calculations using density functional theory and cluster models. For each surface orientation and each geometry, a cluster model of 20-30 Pt atoms has been built in order to interpret the chemisorption of the CN - ions through four kinds of adsorption geometry: on-top or bridge site, bonding via C or N atoms. Geometries have been optimized and adsorption energies, electronic properties and vibrational frequencies have been computed. From the electronic properties, we can propose an analysis of the bonding mechanism for each studied kind of adsorption. The SFG spectra of the CN -/Pt(1 1 1) system present an unique resonance owing to the top C adsorption. It is mainly the same for the CN -/Pt(1 0 0) system. It is also the case for the SFG spectra of the CN -/Pt(1 1 0) system recorded at negative electrochemical voltage; at more positive voltage, a second resonance appears at a lower frequency, owing to the top N adsorption. Experimental and theoretical values of the C-N stretching frequencies are in excellent agreement.

  1. Experimental demonstration of wavelength conversion between ps-pulses based on cascaded sum- and difference frequency generation (SFG+DFG) in LiNbO3 waveguides

    Science.gov (United States)

    Wang, Jian; Sun, Junqiang; Lou, Chuanhong; Sun, Qizhen

    2005-09-01

    All-optical wavelength conversion between ps-pulses based on cascaded sum- and difference frequency generation (SFG+DFG) is proposed and experimentally demonstrated in periodically poled LiNbO3 (PPLN) waveguides. The signal pulse with 40-GHz repetition rate and 1.57- ps pulse width is adopted. The converted idler wavelength can be tuned from 1527.4 to 1540.5nm as the signal wavelength is varied from 1561.9 to 1548.4nm. No obvious changes of the pulse shape and width, also no chirp are observed in the converted idler pulse. The results imply that single-to-multiple channel wavelength conversions can be achieved by appropriately tuning the two pump wavelengths.

  2. Site-specific Orientation of an α-helical Peptide Ovispirin-1 from Isotope Labeled SFG Spectroscopy

    Science.gov (United States)

    Ding, Bei; Laaser, Jennifer E.; Liu, Yuwei; Wang, Pengrui; Zanni, Martin T.; Chen, Zhan

    2013-01-01

    Sum-frequency generation (SFG) vibrational spectroscopy is often used to probe the backbone structures and orientations of polypeptides at surfaces. Using the ovispirin-1 polypeptide at the solid/liquid interface of polystyrene, we demonstrate for the first time that SFG can probe the polarization response of a single isotope labeled residue. To interpret the spectral intensities, we simulated the spectra using an excitonic Hamiltonian approach. We show that the polarization dependence of either the label or the unlabeled amide I band alone does not provide sufficient structural constraints to obtain both the tilt and the twist of the ovispirin helix at a solid/liquid interface, but that both can be determined from the polarization dependence of the complete spectrum. For ovispirin, the detailed analysis of the polarized SFG experimental data shows that the helix axis is tilted at roughly 138 degrees from the surface normal, and the transition dipole of the isotope labeled C=O group is tilted at 23 degrees from the surface normal, with the hydrophobic region facing the polystyrene surface. We further demonstrated that the Hamiltonian approach is able to address the coupling effect and the structural disorder. For comparison, we also collected the FTIR spectrum of ovispirin under similar conditions, which reveals the enhanced sensitivity of SFG for structural studies of single monolayer peptide surfaces. Our study provides insight into how structural and environmental effects appear in SFG spectra of the amide I band and establishes that SFG of isotope labeled peptides will be a powerful technique for elucidating secondary structures with residue-by-residue resolution. PMID:24228619

  3. Site-specific orientation of an α-helical peptide ovispirin-1 from isotope-labeled SFG spectroscopy.

    Science.gov (United States)

    Ding, Bei; Laaser, Jennifer E; Liu, Yuwei; Wang, Pengrui; Zanni, Martin T; Chen, Zhan

    2013-11-27

    Sum-frequency generation (SFG) vibrational spectroscopy is often used to probe the backbone structures and orientations of polypeptides at surfaces. Using the ovispirin-1 polypeptide at the solid/liquid interface of polystyrene, we demonstrate for the first time that SFG can probe the polarization response of a single-isotope-labeled residue. To interpret the spectral intensities, we simulated the spectra using an excitonic Hamiltonian approach. We show that the polarization dependence of either the label or the unlabeled amide I band alone does not provide sufficient structural constraints to obtain both the tilt and the twist of the ovispirin helix at a solid/liquid interface, but that both can be determined from the polarization dependence of the complete spectrum. For ovispirin, the detailed analysis of the polarized SFG experimental data shows that the helix axis is tilted at roughly 138° from the surface normal, and the transition dipole of the isotope-labeled C═O group is tilted at 23° from the surface normal, with the hydrophobic region facing the polystyrene surface. We further demonstrate that the Hamiltonian approach is able to address the coupling effect and the structural disorder. For comparison, we also collected the FTIR spectrum of ovispirin under similar conditions, which reveals the enhanced sensitivity of SFG for structural studies of single monolayer peptide surfaces. Our study provides insight into how structural and environmental effects appear in SFG spectra of the amide I band and establishes that SFG of isotope-labeled peptides will be a powerful technique for elucidating secondary structures with residue-by-residue resolution.

  4. Physiologically-Relevant Modes of Membrane Interactions by the Human Antimicrobial Peptide, LL-37, Revealed by SFG Experiments

    Science.gov (United States)

    Ding, Bei; Soblosky, Lauren; Nguyen, Khoi; Geng, Junqing; Yu, Xinglong; Ramamoorthy, Ayyalusamy; Chen, Zhan

    2013-05-01

    Antimicrobial peptides (AMPs) could become the next generation antibiotic compounds which can overcome bacterial resistance by disrupting cell membranes and it is essential to determine the factors underlying its mechanism of action. Although high-resolution NMR and other biological studies have provided valuable insights, it has been a major challenge to follow the AMP-membrane interactions at physiologically-relevant low peptide concentrations. In this study, we demonstrate a novel approach to overcome this major limitation by performing Sum Frequency Generation (SFG) vibrational spectroscopic experiments on lipid bilayers containing an AMP, LL-37. Our results demonstrate the power of SFG to study non-linear helical peptides and also infer that lipid-peptide interaction and the peptide orientation depend on the lipid membrane composition. The observed SFG signal changes capture the aggregating process of LL-37 on membrane. In addition, our SFG results on cholesterol-containing lipid bilayers indicate the inhibition effect of cholesterol on peptide-induced membrane permeation process.

  5. Sum Frequency Generation Studies of Hydrogenation Reactions on Platinum Nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Krier, James M. [Univ. of California, Berkeley, CA (United States)

    2013-08-31

    Sum Frequency Generation (SFG) vibrational spectroscopy is used to characterize intermediate species of hydrogenation reactions on the surface of platinum nanoparticle catalysts. In contrast to other spectroscopy techniques which operate in ultra-high vacuum or probe surface species after reaction, SFG collects information under normal conditions as the reaction is taking place. Several systems have been studied previously using SFG on single crystals, notably alkene hydrogenation on Pt(111). In this thesis, many aspects of SFG experiments on colloidal nanoparticles are explored for the first time. To address spectral interference by the capping agent (PVP), three procedures are proposed: UV cleaning, H2 induced disordering and calcination (core-shell nanoparticles). UV cleaning and calcination physically destroy organic capping while disordering reduces SFG signal through a reversible structural change by PVP.

  6. Limerick Nuclear Generating Station vibration monitoring system

    International Nuclear Information System (INIS)

    Mikulski, R.

    1988-01-01

    Philadelphia Electric Company utilizes a vibration monitoring computer system at its Limerick Nuclear Generating Station to evaluate machine performance. Performance can be evaluated through instantaneous sampling, online static and transient data. The system functions as an alarm monitor, displaying timely alarm data to the control area. The passage of time since the system's inception has been a learning period. Evaluation through continuous use has led to many enhancements in alarm handling and in the acquisition and display of machine data. Due to the system's sophistication, a routine maintenance program is a necessity. This paper describes the system's diagnostic tools and current utilization. System development and maintenance techniques will also be discussed

  7. In Situ Adsorption Studies at the Solid/Liquid Interface: Characterization of Biological Surfaces and Interfaces Using Sum Frequency Generation Vibrational Spectroscopy, Atomic Force Microscopy, and Quartz Crystal Microbalance

    International Nuclear Information System (INIS)

    Phillips, D.C.

    2006-01-01

    Sum frequency generation (SFG) vibrational spectroscopy, atomic force microscopy (AFM), and quartz crystal microbalance (QCM) have been used to study the molecular surface structure, surface topography and mechanical properties, and quantitative adsorbed amount of biological molecules at the solid-liquid interface. The molecular-level behavior of designed peptides adsorbed on hydrophobic polystyrene and hydrophilic silica substrates has been examined as a model of protein adsorption on polymeric biomaterial surfaces. Proteins are such large and complex molecules that it is difficult to identify the features in their structure that lead to adsorption and interaction with solid surfaces. Designed peptides which possess secondary structure provide simple model systems for understanding protein adsorption. Depending on the amino acid sequence of a peptide, different secondary structures (α-helix and β-sheet) can be induced at apolar (air/liquid or air/solid) interfaces. Having a well-defined secondary structure allows experiments to be carried out under controlled conditions, where it is possible to investigate the affects of peptide amino acid sequence and chain length, concentration, buffering effects, etc. on adsorbed peptide structure. The experiments presented in this dissertation demonstrate that SFG vibrational spectroscopy can be used to directly probe the interaction of adsorbing biomolecules with a surface or interface. The use of well designed model systems aided in isolation of the SFG signal of the adsorbing species, and showed that surface functional groups of the substrate are sensitive to surface adsorbates. The complementary techniques of AFM and QCM allowed for deconvolution of the effects of surface topography and coverage from the observed SFG spectra. Initial studies of biologically relevant surfaces are also presented: SFG spectroscopy was used to study the surface composition of common soil bacteria for use in bioremediation of nuclear waste

  8. In Situ Adsorption Studies at the Solid/Liquid Interface:Characterization of Biological Surfaces and Interfaces Using SumFrequency Generation Vibrational Spectroscopy, Atomic Force Microscopy,and Quartz Crystal Microbalance

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, Diana Christine [Univ. of California, Berkeley, CA (United States)

    2006-01-01

    Sum frequency generation (SFG) vibrational spectroscopy, atomic force microscopy (AFM), and quartz crystal microbalance (QCM) have been used to study the molecular surface structure, surface topography and mechanical properties, and quantitative adsorbed amount of biological molecules at the solid-liquid interface. The molecular-level behavior of designed peptides adsorbed on hydrophobic polystyrene and hydrophilic silica substrates has been examined as a model of protein adsorption on polymeric biomaterial surfaces. Proteins are such large and complex molecules that it is difficult to identify the features in their structure that lead to adsorption and interaction with solid surfaces. Designed peptides which possess secondary structure provide simple model systems for understanding protein adsorption. Depending on the amino acid sequence of a peptide, different secondary structures (α-helix and β-sheet) can be induced at apolar (air/liquid or air/solid) interfaces. Having a well-defined secondary structure allows experiments to be carried out under controlled conditions, where it is possible to investigate the affects of peptide amino acid sequence and chain length, concentration, buffering effects, etc. on adsorbed peptide structure. The experiments presented in this dissertation demonstrate that SFG vibrational spectroscopy can be used to directly probe the interaction of adsorbing biomolecules with a surface or interface. The use of well designed model systems aided in isolation of the SFG signal of the adsorbing species, and showed that surface functional groups of the substrate are sensitive to surface adsorbates. The complementary techniques of AFM and QCM allowed for deconvolution of the effects of surface topography and coverage from the observed SFG spectra. Initial studies of biologically relevant surfaces are also presented: SFG spectroscopy was used to study the surface composition of common soil bacteria for use in bioremediation of nuclear waste.

  9. Amide or Amine: Determining the Origin of the 3300 cm−1 NH Mode in Protein SFG Spectra Using 15N Isotope Labels

    Science.gov (United States)

    Weidner, Tobias; Breen, Nicholas F.; Drobny, Gary P.; Castner, David G.

    2009-01-01

    Sum frequency generation (SFG) vibrational spectroscopy has been employed in biomaterials research and protein adsorption studies with growing success in recent years. A number of studies focusing on understanding SFG spectra of proteins and peptides at different interfaces have laid the foundation for future, more complex studies. In many cases a strong NH mode near 3300 cm−1 is observed in the SFG spectra, but the relationship of this mode to the peptide structure is uncertain since it has been assigned to either a backbone amide mode or a side chain related amine resonance. A thorough understanding of the SFG spectra of these first model systems is an important first step for future experiments. To clarify the origin of the NH SFG mode we studied 15N isotopically labeled 14-amino acid amphiphilic model peptides composed of lysine (K) and leucine (L) in an α-helical secondary structure (LKα14) that were adsorbed onto charged surfaces in situ at the solid-liquid interface. 15N substitution at the terminal amine group of the lysine side chains resulted in a red-shift of the NH mode of 9 cm−1 on SiO2 and 13 cm−1 on CaF2. This clearly shows the 3300 cm−1 NH feature is associated with side chain NH stretches and not with backbone amide modes. PMID:19873996

  10. Amide or amine: determining the origin of the 3300 cm(-1) NH mode in protein SFG spectra using 15N isotope labels.

    Science.gov (United States)

    Weidner, Tobias; Breen, Nicholas F; Drobny, Gary P; Castner, David G

    2009-11-26

    Sum frequency generation (SFG) vibrational spectroscopy has been employed in biomaterials research and protein adsorption studies with growing success in recent years. A number of studies focusing on understanding SFG spectra of proteins and peptides at different interfaces have laid the foundation for future, more complex studies. In many cases, a strong NH mode near 3300 cm(-1) is observed in the SFG spectra, but the relationship of this mode to the peptide structure is uncertain, since it has been assigned to either a backbone amide mode or a side chain related amine resonance. A thorough understanding of the SFG spectra of these first model systems is an important first step for future experiments. To clarify the origin of the NH SFG mode, we studied (15)N isotopically labeled 14-amino acid amphiphilic model peptides composed of lysine (K) and leucine (L) in an alpha-helical secondary structure (LKalpha14) that were adsorbed onto charged surfaces in situ at the solid-liquid interface. (15)N substitution at the terminal amine group of the lysine side chains resulted in a red-shift of the NH mode of 9 cm(-1) on SiO(2) and 13 cm(-1) on CaF(2). This clearly shows the 3300 cm(-1) NH feature is associated with side chain NH stretches and not with backbone amide modes.

  11. 5.5 W of Diffraction-Limited Green Light Generated by SFG of Tapered Diode Lasers in a Cascade of Nonlinear Crystals

    DEFF Research Database (Denmark)

    Hansen, Anders Kragh; Jensen, Ole Bjarlin; Andersen, Peter Eskil

    2015-01-01

    Diode-based high power visible lasers are perfect pump sources for, e.g., titaniumsapphire lasers. The combination of favorable scaling laws in both SFG and cascading of nonlinear crystals allows access to unprecedented powers in diode-based systems.......Diode-based high power visible lasers are perfect pump sources for, e.g., titaniumsapphire lasers. The combination of favorable scaling laws in both SFG and cascading of nonlinear crystals allows access to unprecedented powers in diode-based systems....

  12. Dynamics of Dangling Od-Stretch at the Air/water Interface by Heterodyne-Detected Sfg Spectroscopy

    Science.gov (United States)

    Stiopkin, I. V.; Weeraman, C.; Shalhout, F.; Benderskii, A. V.

    2009-06-01

    SFG spectra of dangling OD-stretch at the air/water interface contain information on vibrational dephasing dynamics, ultrafast reorientational molecular motion, and vibrational energy transfer. To better separate these processes we conducted heterodyne-detected SFG experiments to measure real and imaginary contributions of the SFG spectrum of the dangling OD-stretch at the air/D_2O interface for SSP, PPP, and SPS polarizations. Variations in the temporal profiles of the SFG signals for these three polarizations will be also discussed.

  13. IR visible sum-frequency vibrational spectroscopy of Biphenyl-3 methylene thiol monolayer on gold and silver: effect of the visible wavelength on the SFG spectrum

    Science.gov (United States)

    Humbert, C.; Dreesen, L.; Mani, A. A.; Caudano, Y.; Lemaire, J.-J.; Thiry, P. A.; Peremans, A.

    2002-04-01

    We measured IR-visible sum-frequency generation spectra of CH 3-(C 6H 4) 2-(CH 2) 3-S-H (Biphenyl-3) self-assembled monolayers on a silver and a gold substrate. For the latter substrate, we observed different interference patterns between the resonant signal of the CH vibration and the non-resonant contribution of the substrate as a function of the visible beam wavelength. The non-linear response of the gold substrate is enhanced around 480 nm corresponding to the s-d interband transition. Such effect is not observed for the silver substrate the interband transition of which is located out of the investigated visible spectral range of 450-700 nm.

  14. Dependence of steam generator vibrations on feedwater pressure

    International Nuclear Information System (INIS)

    Sadilek, J.

    1989-01-01

    Vibration sensors are attached to the bottom of the steam generator jacket between the input and output primary circuit collectors. The effective vibration value is recorded daily. Several times higher vibrations were observed at irregular intervals; their causes were sought, and the relation between the steam generator vibrations measured at the bottom of its vessel and the feedwater pressure was established. The source of the vibrations was found to be in the feedwater tract of the steam generator. The feedwater tract is described and its hydraulic characteristics are given. Vibrations were measured on the S02 valve. It is concluded that vibrations can be eliminated by reducing the water pressure before the control valves and by replacing the control valves with ones with more suitable control characteristics. (E.J.). 3 figs., 1 tab., 3 refs

  15. Orientational Analysis of Dodecanethiol and P-Nitrothiophenol SAMs on Metals with Polarisation - dependent SFG spectroscopy

    International Nuclear Information System (INIS)

    Manea, A.

    2011-01-01

    Polarisation-dependent sum frequency generation (SFG) spectroscopy is used to investigate the orientation of molecules on metallic surfaces. In particular, self-assembled monolayers (SAMs) of dodecanethiol (DDT) and of p-nitro thiophenol (p-NTP), grown on Pt and on Au, have been chosen as models to highlight the ability of combining ppp and ssp polarizations sets (representing the polarisation of the involved beams in the conventional order of SFG, Vis and IR beam) to infer orientational information at metallic interfaces. Indeed, using only the ppp set of data, as it is usually done for metallic surfaces, is not sufficient to determine the full molecular orientation. We show here that simply combining ppp and ssp polarizations enables both the tilt and rotation angles of methyl groups in DDT SAMs to be determined. Moreover, for p-NTP, while the SFG active vibrations detected with the ppp polarisation alone provide no orientational information, however, the combination with ssp spectra enables to retrieve the tilt angle of the p-NTP 1,4 axis. Though orientational information obtained by polarisation-dependent measurements has been extensively used at insulating interfaces, we report here their first application to metallic surfaces. (author)

  16. Vibration analysis of a hydro generator for different operating regimes

    Science.gov (United States)

    Haţiegan, C.; Pădureanu, I.; Jurcu, M.; Nedeloni, M. D.; Hamat, C. O.; Chioncel, C. P.; Trocaru, S.; Vasile, O.; Bădescu, O.; Micliuc, D.; (Filip Nedeloni, L.; Băra, A.; (Barboni Haţiegan, L.

    2017-01-01

    Based on experimental measurements, this paper presents the vibration analysis of a hydro generator that equips a Kaplan hydraulic turbine of a Hydropower plant in Romania. This analysis means vibrations measurement to different operating regimes of the hydro generator respectively before installing it and into operation, namely putting off load mode (unexcited and excited) respectively putting on load mode. By comparing, through the experimental results obtained before and after the operation of hydro aggregates are observed vibrations improvements.

  17. Sum-Frequency Generation from Chiral Media and Interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Na [Univ. of California, Berkeley, CA (United States)

    2006-02-13

    Sum frequency generation (SFG), a second-order nonlinear optical process, is electric-dipole forbidden in systems with inversion symmetry. As a result, it has been used to study chiral media and interfaces, systems intrinsically lacking inversion symmetry. This thesis describes recent progresses in the applications of and new insights into SFG from chiral media and interfaces. SFG from solutions of chiral amino acids is investigated, and a theoretical model explaining the origin and the strength of the chiral signal in electronic-resonance SFG spectroscopy is discussed. An interference scheme that allows us to distinguish enantiomers by measuring both the magnitude and the phase of the chiral SFG response is described, as well as a chiral SFG microscope producing chirality-sensitive images with sub-micron resolution. Exploiting atomic and molecular parity nonconservation, the SFG process is also used to solve the Ozma problems. Sum frequency vibrational spectroscopy is used to obtain the adsorption behavior of leucine molecules at air-water interfaces. With poly(tetrafluoroethylene) as a model system, we extend the application of this surface-sensitive vibrational spectroscopy to fluorine-containing polymers.

  18. Sum-Frequency Generation from Chiral Media and Interfaces

    International Nuclear Information System (INIS)

    Ji, Na

    2006-01-01

    Sum frequency generation (SFG), a second-order nonlinear optical process, is electric-dipole forbidden in systems with inversion symmetry. As a result, it has been used to study chiral media and interfaces, systems intrinsically lacking inversion symmetry. This thesis describes recent progresses in the applications of and new insights into SFG from chiral media and interfaces. SFG from solutions of chiral amino acids is investigated, and a theoretical model explaining the origin and the strength of the chiral signal in electronic-resonance SFG spectroscopy is discussed. An interference scheme that allows us to distinguish enantiomers by measuring both the magnitude and the phase of the chiral SFG response is described, as well as a chiral SFG microscope producing chirality-sensitive images with sub-micron resolution. Exploiting atomic and molecular parity nonconservation, the SFG process is also used to solve the Ozma problems. Sum frequency vibrational spectroscopy is used to obtain the adsorption behavior of leucine molecules at air-water interfaces. With poly(tetrafluoroethylene) as a model system, we extend the application of this surface-sensitive vibrational spectroscopy to fluorine-containing polymers

  19. Anti-vibration bars for nuclear steam generators

    International Nuclear Information System (INIS)

    Gowda, B.V.; Wilson, R.M.; Wepfer, R.M.

    1986-01-01

    A method of installing tubular anti-vibration bars into a tube bundle of a steam generator wherein the tube bundle comprises rows of tubes, with the anti-vibration bars received between adjacent rows of the tube bundle for stabilizing the tubes against vibration. The anti-vibration bars are first inserted between adjacent rows of the tube bundle and a pressurized fluid is then introduced into the anti-vibration bars which are thus expanded into contact with the tubes of the adjacent rows for support

  20. Deducing 2D Crystal Structure at the Solid/Liquid Interface with Atomic Resolution by Combined STM and SFG Study

    Science.gov (United States)

    McClelland, Arthur; Ahn, Seokhoon; Matzger, Adam J.; Chen, Zhan

    2009-03-01

    Supplemented by computed models, Scanning Tunneling Microscopy (STM) can provide detailed structure of 2D crystals formed at the liquid/solid interface with atomic resolution. However, some structural information such as functional group orientations in such 2D crystals needs to be tested experimentally to ensure the accuracy of the deduced structures. Due to the limited sensitivity, many other experimental techniques such as Raman and infrared spectroscopy have not been allowed to provide such structural information of 2D crystals. Here we showed that Sum Frequency Generation Vibrational Spectroscopy (SFG) can measure average orientation of functional groups in such 2D crystals, or physisorbed monolayers, providing key experimental data to aid in the modeling and interpretation of the STM images. The usefulness of combining these two techniques is demonstrated with a phthalate diesters monolayer formed at the 1-phenyloctane/ highly oriented pyrolytic graphite (HOPG) interface. The spatial orientation of the ester C=O of the monolayer was successfully determined using SFG.

  1. Vibration monitoring of large generator stator and-winding

    International Nuclear Information System (INIS)

    Duffeau, F.; Bernard, P.

    1999-01-01

    Large generators of French Nuclear Power plants are equipped with a standardised vibration monitoring system. The first aim of these new systems is to protect the machines by generating alarms in the control room when predefined vibration thresholds have been over-passed. Secondly, this specially designed instrumentation permits to create a National data base allowing to compare different generators of the same technology. Additionally, statistical methods have been developed in order to 'guess' vibration level at several locations of the stator end-windings, depending on the actual operating parameters of the generator, i.e. reactive and active power load. So this paper presents the general concept of the vibration monitoring of EDF large generator stators and deals with a new method to predict vibrations in different locations under control. (authors)

  2. Orientations of nonlocal vibrational modes from combined experimental and theoretical sum frequency spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Chase, Hilary M.; Chen, Shunli; Fu, Li; Upshur, Mary Alice; Rudshteyn, Benjamin; Thomson, Regan J.; Wang, Hong-Fei; Batista, Victor S.; Geiger, Franz M.

    2017-09-01

    Inferring molecular orientations from vibrational sum frequency generation (SFG) spectra is challenging in polarization combinations that result in low signal intensities, or when the local point group symmetry approximation fails. While combining experiments with density functional theory (DFT) could overcome this problem, the scope of the combined method has yet to be established. Here, we assess its feasibility of determining the distributions of molecular orientations for one monobasic ester, two epoxides and three alcohols at the vapor/fused silica interface. We find that molecular orientations of nonlocal vibrational modes cannot be determined using polarization-resolved SFG measurements alone.

  3. Simulation Study on Material Property of Cantilever Piezoelectric Vibration Generator

    Directory of Open Access Journals (Sweden)

    Yan Zhen

    2014-06-01

    Full Text Available For increasing generating capacity of cantilever piezoelectric vibration generator with limited volume, relation between output voltage, inherent frequency and material parameter of unimorph, bimorph in series type and bimorph in parallel type piezoelectric vibration generator is analyzed respectively by mechanical model and finite element modeling. The results indicate PZT-4, PZT- 5A and PZT-5H piezoelectric materials and stainless steel, nickel alloy substrate material should be firstly chosen.

  4. Effect of mechanical vibration generated in oscillating/vibratory ...

    African Journals Online (AJOL)

    Background: Whole body vibration (WBV) exercise has been used in health sciences. Authors have reported that changes on the concentration of plasma biomarkers could be associated with the WBV effects. The aim of this investigation is to assess the consequences of exposition of 25 Hz mechanical vibration generated ...

  5. Surface and buried interfacial structures of epoxy resins used as underfills studied by sum frequency generation vibrational spectroscopy.

    Science.gov (United States)

    Vázquez, Anne V; Holden, Brad; Kristalyn, Cornelius; Fuller, Mike; Wilkerson, Brett; Chen, Zhan

    2011-05-01

    Flip chip technology has greatly improved the performance of semiconductor devices, but relies heavily on the performance of epoxy underfill adhesives. Because epoxy underfills are cured in situ in flip chip semiconductor devices, understanding their surface and interfacial structures is critical for understanding their adhesion to various substrates. Here, sum frequency generation (SFG) vibrational spectroscopy was used to study surface and buried interfacial structures of two model epoxy resins used as underfills in flip chip devices, bisphenol A digylcidyl ether (BADGE) and 1,4-butanediol diglycidyl ether (BDDGE). The surface structures of these epoxies were compared before and after cure, and the orientations of their surface functional groups were deduced to understand how surface structural changes during cure may affect adhesion properties. Further, the effect of moisture exposure, a known cause of adhesion failure, on surface structures was studied. It was found that the BADGE surface significantly restructured upon moisture exposure while the BDDGE surface did not, showing that BADGE adhesives may be more prone to moisture-induced delamination. Lastly, although surface structure can give some insight into adhesion, buried interfacial structures more directly correspond to adhesion properties of polymers. SFG was used to study buried interfaces between deuterated polystyrene (d-PS) and the epoxies before and after moisture exposure. It was shown that moisture exposure acted to disorder the buried interfaces, most likely due to swelling. These results correlated with lap shear adhesion testing showing a decrease in adhesion strength after moisture exposure. The presented work showed that surface and interfacial structures can be correlated to adhesive strength and may be helpful in understanding and designing optimized epoxy underfill adhesives.

  6. Orientational analysis of dodecanethiol and p-nitrothiophenol SAMs on metals with polarisation-dependent SFG spectroscopy.

    Science.gov (United States)

    Cecchet, Francesca; Lis, Dan; Guthmuller, Julien; Champagne, Benoît; Caudano, Yves; Silien, Christophe; Mani, Alaa Addin; Thiry, Paul A; Peremans, André

    2010-02-22

    Polarisation-dependent sum frequency generation (SFG) spectroscopy is used to investigate the orientation of molecules on metallic surfaces. In particular, self-assembled monolayers (SAMs) of dodecanethiol (DDT) and of p-nitrothiophenol (p-NTP), grown on Pt and on Au, have been chosen as models to highlight the ability of combining ppp and ssp polarisations sets (representing the polarisation of the involved beams in the conventional order of SFG, Vis and IR beam) to infer orientational information at metallic interfaces. Indeed, using only the ppp set of data, as it is usually done for metallic surfaces, is not sufficient to determine the full molecular orientation. We show here that simply combining ppp and ssp polarisations enables both the tilt and rotation angles of methyl groups in DDT SAMs to be determined. Moreover, for p-NTP, while the SFG active vibrations detected with the ppp polarisation alone provide no orientational information, however, the combination with ssp spectra enables to retrieve the tilt angle of the p-NTP 1,4 axis. Though orientational information obtained by polarisation-dependent measurements has been extensively used at insulating interfaces, we report here their first application to metallic surfaces.

  7. In-situ Studies of the Reactions of Bifunctional and Heterocyclic Molecules over Noble Metal Single Crystal and Nanoparticle Catalysts Studied with Kinetics and Sum-Frequency Generation Vibrational Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Kliewer, Christopher J. [Univ. of California, Berkeley, CA (United States)

    2009-06-30

    Sum frequency generation surface vibrational spectroscopy (SFG-VS) in combination with gas chromatography (GC) was used in-situ to monitor surface bound reaction intermediates and reaction selectivities for the hydrogenation reactions of pyrrole, furan, pyridine, acrolein, crotonaldehyde, and prenal over Pt(111), Pt(100), Rh(111), and platinum nanoparticles under Torr reactant pressures and temperatures of 300K to 450K. The focus of this work is the correlation between the SFG-VS observed surface bound reaction intermediates and adsorption modes with the reaction selectivity, and how this is affected by catalyst structure and temperature. Pyrrole hydrogenation was investigated over Pt(111) and Rh(111) single crystals at Torr pressures. It was found that pyrrole adsorbs to Pt(111) perpendicularly by cleaving the N-H bond and binding through the nitrogen. However, over Rh(111) pyrrole adsorbs in a tilted geometry binding through the {pi}-aromatic orbitals. A surface-bound pyrroline reaction intermediate was detected over both surfaces with SFG-VS. It was found that the ring-cracking product butylamine is a reaction poison over both surfaces studied. Furan hydrogenation was studied over Pt(111), Pt(100), 10 nm cubic platinum nanoparticles and 1 nm platinum nanoparticles. The product distribution was observed to be highly structure sensitive and the acquired SFG-VS spectra reflected this sensitivity. Pt(100) exhibited more ring-cracking to form butanol than Pt(111), while the nanoparticles yielded higher selectivities for the partially saturated ring dihydrofuran. Pyridine hydrogenation was investigated over Pt(111) and Pt(100). The α-pyridyl surface adsorption mode was observed with SFG-VS over both surfaces. 1,4-dihydropyridine was seen as a surface intermediate over Pt(100) but not Pt(111). Upon heating the surfaces to 350K, the adsorbed pyridine changes to a flat-lying adsorption mode. No evidence was found for the pyridinium cation. The hydrogenation of the

  8. Model Catalysis of Ammonia Synthesis ad Iron-Water Interfaces - ASum Frequency Generation Vibrational Spectroscopic Study of Solid-GasInterfaces and Anion Photoelectron Spectroscopic Study of Selected Anionclusters

    Energy Technology Data Exchange (ETDEWEB)

    Ferguson, Michael James [Univ. of California, Berkeley, CA (United States)

    2005-01-01

    The ammonia synthesis reaction has been studied using single crystal model catalysis combined with sum frequency generation (SFG) vibrational spectroscopy. The adsorption of gases N2, H2, O2 and NH3 that play a role in ammonia synthesis have been studied on the Fe(111) crystal surface by sum frequency generation vibrational spectroscopy using an integrated Ultra-High Vacuum (UHV)/high-pressure system. SFG spectra are presented for the dissociation intermediates, NH2 (~3325 cm-1) and NH (~3235 cm-1) under high pressure of ammonia or equilibrium concentrations of reactants and products on Fe(111) surfaces. Special attention was paid to understand how potassium promotion of the iron catalyst affects the intermediates of ammonia synthesis. An Fe(111) surface promoted with 0.2 monolayers of potassium red shifts the vibrational frequencies of the reactive surface intermediates, NH and NH2, providing evidence for weakened the nitrogen-hydrogen bonds relative to clean Fe(111). Spectral features of these surface intermediates persisted to higher temperatures for promoted iron surfaces than for clean Fe(111) surfaces implying that nitrogen-iron bonds are stronger for the promoted surface. The ratio of the NH to NH2 signal changed for promoted surfaces in the presence of equilibrium concentrations of reactants and products. The order of adding oxygen and potassium to promoted surfaces does not alter the spectra indicating that ammonia induces surface reconstruction of the catalyst to produce the same surface morphology. When oxygen is co-adsorbed with nitrogen, hydrogen, ammonia or potassium on Fe(111), a relative phase shift of the spectra occurs as compared to the presence of adsorbates on clean iron surfaces. Water adsorption on iron was also probed using SFG vibrational spectroscopy. For both H2O and D2O, the only spectral feature was in the range of

  9. Theoretical and experimental study of vibration, generated by monorail trains

    Science.gov (United States)

    Rybak, Samuil A.; Makhortykh, Sergey A.; Kostarev, Stanislav A.

    2002-11-01

    Monorail transport as all other city transport vehicles is the source of high noise and vibration levels. It is less widespread than cars or underground transport but its influence in modern cities enhances. Now in Moscow the first monorail road with trains on tires is designed, therefore the problem of vibration and noise assessments and prediction of its impact on the residential region appears. To assess the levels of generated vibration a physical model of interaction in the system wagon-tire-road coating-viaduct-soil has been proposed and then numerically analyzed. The model is based on the known from publications facts of automobile transport vibration and our own practice concerning underground trains vibration generation. To verify computer simulation results and adjust model parameters the series of measurements of noise and vibration near experimental monorail road was carried out. In the report the results of calculations and measurements will be presented and some outcomes of possible acoustical ecologic situation near monorail roads will be proposed.

  10. High-Pressure Catalytic Reactions of C6 Hydrocarbons on PlatinumSingle-Crystals and nanoparticles: A Sum Frequency Generation VibrationalSpectroscopic and Kinetic Study

    Energy Technology Data Exchange (ETDEWEB)

    Bratlie, Kaitlin [Univ. of California, Berkeley, CA (United States)

    2007-01-01

    Catalytic reactions of cyclohexene, benzene, n-hexane, 2-methylpentane, 3-methylpentane, and 1-hexene on platinum catalysts were monitored in situ via sum frequency generation (SFG) vibrational spectroscopy and gas chromatography (GC). SFG is a surface specific vibrational spectroscopic tool capable of monitoring submonolayer coverages under reaction conditions without gas-phase interference. SFG was used to identify the surface intermediates present during catalytic processes on Pt(111) and Pt(100) single-crystals and on cubic and cuboctahedra Pt nanoparticles in the Torr pressure regime and at high temperatures (300K-450K). At low pressures (<10-6 Torr), cyclohexene hydrogenated and dehydrogenates to form cyclohexyl (C6H11) and π-allyl C6H9, respectively, on Pt(100). Increasing pressures to 1.5 Torr form cyclohexyl, π-allyl C6H9, and 1,4-cyclohexadiene, illustrating the necessity to investigate catalytic reactions at high-pressures. Simultaneously, GC was used to acquire turnover rates that were correlated to reactive intermediates observed spectroscopically. Benzene hydrogenation on Pt(111) and Pt(100) illustrated structure sensitivity via both vibrational spectroscopy and kinetics. Both cyclohexane and cyclohexene were produced on Pt(111), while only cyclohexane was formed on Pt(100). Additionally, π-allyl c-C6H9 was found only on Pt(100), indicating that cyclohexene rapidly dehydrogenates on the (100) surface. The structure insensitive production of cyclohexane was found to exhibit a compensation effect and was analyzed using the selective energy transfer (SET) model. The SET model suggests that the Pt-H system donates energy to the E2u mode of free benzene, which leads to catalysis. Linear C6 (n-hexane, 2-methylpentane, 3-methylpentane, and 1-hexene) hydrocarbons were also investigated in the presence and absence of excess hydrogen on Pt

  11. Vibrations measurement at the Embalse nuclear power plant's electrical generator

    International Nuclear Information System (INIS)

    Salomoni, R.C.; Belinco, C.G.; Pastorini, A.J.; Sacchi, M.A.

    1987-01-01

    After the modifications made at the Embalse nuclear power plant's electrical generator to reduce its vibration level produced by electromagnetic phenomena, it was necessary to perform measurements at the new levels, under different areas and power conditions. To this purpose, a work was performed jointly with the 'Vibrations Team' of the ANSALDO Company (the generator constructor) and the Hydrodynamic Assays Division under the coordination and supervision of the plant's electrical maintenance responsible. This paper includes the main results obtained and the instrumentation criteria and analysis performed. (Author)

  12. Analysis of tube vibrations in D-4 steam generator

    International Nuclear Information System (INIS)

    Mavko, B.; Peterlin, G.; Boltezar, M.

    1983-01-01

    Accelerometer data for the most exposed tube in steam generator D-4 were recorded on magnetic tape. Procedures for calculations of the most characteristic parameters were prepared for spectral analyzer on SD 360. Parameters which most satisfactorily describe the vibrations are power spectral densities peak to peak acceleration volume and root mean square displacement. Computer program was written to calculate the natural frequencies of a multispaned tube. Procedures and the computer program will be used for independent analysis of tube vibrations in Krsko D-4 type steam generator. (author)

  13. Capacitance-Based Frequency Adjustment of Micro Piezoelectric Vibration Generator

    Directory of Open Access Journals (Sweden)

    Xinhua Mao

    2014-01-01

    Full Text Available Micro piezoelectric vibration generator has a wide application in the field of microelectronics. Its natural frequency is unchanged after being manufactured. However, resonance cannot occur when the natural frequencies of a piezoelectric generator and the source of vibration frequency are not consistent. Output voltage of the piezoelectric generator will sharply decline. It cannot normally supply power for electronic devices. In order to make the natural frequency of the generator approach the frequency of vibration source, the capacitance FM technology is adopted in this paper. Different capacitance FM schemes are designed by different locations of the adjustment layer. The corresponding capacitance FM models have been established. Characteristic and effect of the capacitance FM have been simulated by the FM model. Experimental results show that the natural frequency of the generator could vary from 46.5 Hz to 42.4 Hz when the bypass capacitance value increases from 0 nF to 30 nF. The natural frequency of a piezoelectric vibration generator could be continuously adjusted by this method.

  14. Capacitance-based frequency adjustment of micro piezoelectric vibration generator.

    Science.gov (United States)

    Mao, Xinhua; He, Qing; Li, Hong; Chu, Dongliang

    2014-01-01

    Micro piezoelectric vibration generator has a wide application in the field of microelectronics. Its natural frequency is unchanged after being manufactured. However, resonance cannot occur when the natural frequencies of a piezoelectric generator and the source of vibration frequency are not consistent. Output voltage of the piezoelectric generator will sharply decline. It cannot normally supply power for electronic devices. In order to make the natural frequency of the generator approach the frequency of vibration source, the capacitance FM technology is adopted in this paper. Different capacitance FM schemes are designed by different locations of the adjustment layer. The corresponding capacitance FM models have been established. Characteristic and effect of the capacitance FM have been simulated by the FM model. Experimental results show that the natural frequency of the generator could vary from 46.5 Hz to 42.4 Hz when the bypass capacitance value increases from 0 nF to 30 nF. The natural frequency of a piezoelectric vibration generator could be continuously adjusted by this method.

  15. SFG characterization of a cationic ONLO dye in biological thin films

    Science.gov (United States)

    Johnson, Lewis E.; Casford, Michael T.; Elder, Delwin L.; Davies, Paul B.; Johal, Malkiat S.

    2013-10-01

    Biopolymer-based thin films, such as those composed of CTMA-DNA, can be used as a host material for NLOactive dyes for applications such as electro-optic (EO) switching and second harmonic generation. Previous work by Heckman et al. (Proc. SPIE 6401, 640108-2) has demonstrated functioning DNA-based EO modulators. Improved performance requires optimization of both the first hyperpolarizabilities (β) and degree of acentric ordering exhibited by the chromophores. The cationic dye DANPY-1 (Proc. SPIE 8464, 846409-D) has a high affinity for DNA and a substantial hyperpolarizability; however, its macroscopic ordering has not been previously characterized. We have characterized the acentric ordering of the dye using sum-frequency generation (SFG) vibrational spectroscopy in surface-immobilized DNA and on planar metal and dielectric surfaces.

  16. Competition of bovine serum albumin adsorption and bacterial adhesion onto surface-grafted ODT: in situ study by vibrational SFG and fluorescence confocal microscopy.

    Science.gov (United States)

    Bulard, Emilie; Fontaine-Aupart, Marie-Pierre; Dubost, Henri; Zheng, Wanquan; Bellon-Fontaine, Marie-Noëlle; Herry, Jean-Marie; Bourguignon, Bernard

    2012-12-11

    The interaction of hydrophilic and hydrophobic ovococcoid bacteria and bovine serum albumin (BSA) proteins with a well ordered surface of octadecanethiol (ODT) self assembled monolayer (SAM) has been studied in different situations where proteins were either preadsorbed on ODT or adsorbed simultaneously with bacterial adhesion as in life conditions. The two situations lead to very different antimicrobial behavior. Bacterial adhesion on preadsorbed BSA is very limited, while the simultaneous exposure of ODT SAM to proteins and bacteria lead to a markedly weaker antimicrobial effect. The combination of sum frequency generation spectroscopy and fluorescence confocal microscopy experiments allow one to draw conclusions on the factors that govern the ODT SAM or BSA film interaction with bacteria at the molecular level. On the hydrophobic ODT surface, interaction with hydrophobic or hydrophilic biomolecules results in opposite effects on the SAM, namely, a flattening or a raise of the terminal methyl groups of ODT. On an amphiphilic BSA layer, the bacterial adhesion strength is weakened by the negative charges carried by both BSA and bacteria. Surprisingly, preadsorbed BSA that cover part of the bacteria cell walls increase the adhesion strength to the BSA film and reduce hydrophobic interactions with the ODT SAM. Finally, bacterial adhesion on a BSA film is shown to modify the BSA proteins in some way that change their interaction with the ODT SAM. The antimicrobial effect is much stronger in the case of a preadsorbed BSA layer than when BSA and bacteria are in competition to colonize the ODT SAM surface.

  17. Two-phase flow induced vibrations in CANDU steam generators

    International Nuclear Information System (INIS)

    Gidi, A.

    2009-01-01

    The U-Bend region of nuclear steam generators tube bundles have suffered from two-phase cross flow induced vibrations. Tubes in this region have experienced high amplitude vibrations leading to catastrophic failures. Turbulent buffeting and fluid-elastic instability has been identified as the main causes. Previous investigations have focused on flow regime and two-phase flow damping ratio. However, tube bundles in steam generators have vapour generated on the surface of the tubes, which might affect the flow regime, void fraction distribution, turbulent intensity levels and tube-flow interaction, all of which have the potential to change the tube vibration response. A cantilevered tube bundle made of electric cartridges heaters was built and tested in a Freon-11 flow loop at McMaster University. Tubes were arranged in a parallel triangular configuration. The bundle was exposed to two-phase cross flows consisting of different combinations of void from two sources, void generated upstream of the bundle and void generated at the surface of the tubes. Tube tip vibration response was measured optically and void fraction was measured by gamma densitometry technique. It was found that tube vibration amplitude in the transverse direction was reduced by a factor of eight for void fraction generated at the tube surfaces only, when compared to the upstream only void generation case. The main explanation for this effect is a reduction in the correlation length of the turbulent buffeting forcing function. Theoretical calculations of the tube vibration response due to turbulent buffeting under the same experimental conditions predicted a similar reduction in tube amplitude. The void fraction for the fluid-elastic instability threshold in the presence of tube bundle void fraction generation was higher than that for the upstream void fraction generation case. The first explanation of this difference is the level of turbulent buffeting forces the tube bundle was exposed to

  18. Toward a simple molecular understanding of sum frequency generation at air-water interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Noah-Vanhoucke, Joyce; Smith, Jared D.; Geissler, Phillip L.

    2009-01-13

    Second-order vibrational spectroscopies successfully isolate signals from interfaces, but they report on intermolecular structure in a complicated and indirect way. Here we adapt a perspective on vibrational response developed for bulk spectroscopies to explore the microscopic fluctuations to which sum frequency generation (SFG), a popular surface-specific measurement, is most sensitive. We focus exclusively on inhomogeneous broadening of spectral susceptibilities for OH stretching of HOD as a dilute solute in D{sub 2}O. Exploiting a simple connection between vibrational frequency shifts and an electric field variable, we identify several functions of molecular orientation whose averages govern SFG. The frequency-dependence of these quantities is well captured by a pair of averages, involving alignment of OH and OD bonds with the surface normal at corresponding values of the electric field. The approximate form we obtain for SFG susceptibility highlights a dramatic sensitivity to the way a simulated liquid slab is partitioned for calculating second-order response.

  19. Generation of three-mode nonclassical vibrational states of ions

    International Nuclear Information System (INIS)

    Nguyen Ba An; Truong Minh Duc

    2002-01-01

    We propose using eight lasers with appropriate orientations and conditions to generate stable trio coherent states of an ion in a three-dimensional isotropic trap. Seven lasers whose orientations are important should be detuned to the third lower sideband of the ion vibrational motion. The eighth laser whose direction is not important should be in resonance with the ionic transition

  20. Laboratory evaluation of a vibrating orifice monodisperse aerosol generator

    International Nuclear Information System (INIS)

    Everitt, N.M.; Snelling, K.W.

    1985-02-01

    The Berglund-Liu vibrating orifice aerosol generator is capable of producing monodisperse particles in the diameter range 5 to 50 μm. Experiments have been carried out to set up and evaluate such a generator for the preparation of standard liquid (olive oil) and solid (methylene blue) aerosols in the size range 8 to 13 μm. Modifications have been made to the apparatus to improve its performance and increase its particle output. (author)

  1. Anti-vibration bars for nuclear steam generators

    International Nuclear Information System (INIS)

    Gowda, B.V.; Wilson, R.M.; Wepfer, R.M.

    1988-01-01

    This patent describes anti-vibrations bars structurally supporting tubes carrying high-temperature coolant in a steam generator, the antivibration bars being disposed between adjacent rows of tubes and expanded from a rest state to an expanded state as pressure is applied to the interior of the anti-vibration bars, each of the anti-vibration bars being configured as a hollow member of a rectangular shape. The rectangular shape comprising a pair of opposing wall lengths and a pair of opposing wall widths, each of the wall lengths have a thickness greater than that of the wall widths to facilitate expansion of the opposing wall lengths away from each other and into contact respectively with tubes of adjacent rows, the wall lengths having sufficient rigidity to resist deformation as the bars are expanded to their expanded state so that the wall lengths make a line contact with their respective tubes

  2. An SFG and ERS investigation of the corrosion of CoW{sub 0.013}C{sub 0.001} alloys and WC-Co cermets in CN{sup -}-containing aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Bozzini, Benedetto [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy)]. E-mail: benedetto.bozzini@unile.it; Busson, Bertrand [CLIO-LCP, Batiment 201P2, Universitaire Paris Sud 11, 91420 Orsay Cedex (France); De Gaudenzi, Gian Pietro [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); D' Urzo, Lucia [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Mele, Claudio [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Tadjeddine, Abderrahmane [UDIL-CNRS, Batiment 201P1, BP34, 91898 Orsay, Cedex (France)

    2007-05-15

    In order to increase the knowledge of the corrosion mechanism, in situ spectroelectrochemical methodologies were employed in the investigation of the electrochemical interface of WC-Co hardmetals. Together with standard cyclic voltammetries (CV), ElectroReflectance Spectroscopy (ERS) and Sum Frequency Generation (SFG) spectroscopy measurements were performed both on a Co-base alloy, simulating the metallic binder of hardmetal composites, and on a model WC-Co system. A cyanide solution, encountered in the gold extraction industry, was employed as electrolyte. Electrochemical cells and experimental apparatuses were designed to allow in situ experiments. CV measurements showed corrosion attack to run at potentials more anodic than -500 mV vs. Ag/AgCl, both for the alloy and the composite. The high reactivity of the alloy in cyanide environment was witnessed by the time-dependence of the surface vibrational (SFG) and electronic (SFG and ERS) properties under cathodic polarisation. Furthermore, SFG measurements highlighted two different adsorbation sites for cyanide ion, probably {alpha}- and {epsilon}-Co. The WC-Co system showed a pseudo-passivation peak, typical of the corrosion behaviour of this material, due to precipitation of corrosion products. ERS data at 532 nm showed an ennobling of the potential at which the reflectivity increase was recorded.

  3. An SFG and ERS investigation of the corrosion of CoW0.013C0.001 alloys and WC-Co cermets in CN--containing aqueous solutions

    International Nuclear Information System (INIS)

    Bozzini, Benedetto; Busson, Bertrand; De Gaudenzi, Gian Pietro; D'Urzo, Lucia; Mele, Claudio; Tadjeddine, Abderrahmane

    2007-01-01

    In order to increase the knowledge of the corrosion mechanism, in situ spectroelectrochemical methodologies were employed in the investigation of the electrochemical interface of WC-Co hardmetals. Together with standard cyclic voltammetries (CV), ElectroReflectance Spectroscopy (ERS) and Sum Frequency Generation (SFG) spectroscopy measurements were performed both on a Co-base alloy, simulating the metallic binder of hardmetal composites, and on a model WC-Co system. A cyanide solution, encountered in the gold extraction industry, was employed as electrolyte. Electrochemical cells and experimental apparatuses were designed to allow in situ experiments. CV measurements showed corrosion attack to run at potentials more anodic than -500 mV vs. Ag/AgCl, both for the alloy and the composite. The high reactivity of the alloy in cyanide environment was witnessed by the time-dependence of the surface vibrational (SFG) and electronic (SFG and ERS) properties under cathodic polarisation. Furthermore, SFG measurements highlighted two different adsorbation sites for cyanide ion, probably α- and ε-Co. The WC-Co system showed a pseudo-passivation peak, typical of the corrosion behaviour of this material, due to precipitation of corrosion products. ERS data at 532 nm showed an ennobling of the potential at which the reflectivity increase was recorded

  4. Vibration Analysis for Steam Dryer of APR1400 Steam Generator

    Energy Technology Data Exchange (ETDEWEB)

    Han, Sung-heum; Ko, Doyoung [KHNP CRI, Daejeon (Korea, Republic of); Cho, Minki [Doosan Heavy Industry, Changwon (Korea, Republic of)

    2016-10-15

    This paper is related to comprehensive vibration assessment program for APR1400 steam generator internals. According to U.S. Nuclear Regulatory Commission, Regulatory Guide 1.20 (Rev.3, March 2007), we conducted vibration analysis for a steam dryer as the second steam separator of steam generator internals. The vibration analysis was performed at the 100 % power operating condition as the normal operation condition. The random hydraulic loads were calculated by the computational fluid dynamics and the structural responses were predicted by power spectral density analysis for the probabilistic method. In order to meet the recently revised U.S. NRC RG 1.20 Rev.3, the CVAP against the potential adverse flow effects in APR1400 SG internals should be performed. This study conducted the vibration response analysis for the SG steam dryer as the second moisture separator at the 100% power condition, and evaluated the structural integrity. The predicted alternating stress intensities were evaluated to have more than 17.78 times fatigue margin compared to the endurance limit.

  5. Resolution of torsional vibration issue for large turbine generators

    International Nuclear Information System (INIS)

    Evans, D.G.; Giesecke, H.D.; Willman, E.C.; Moffitt, S.P.

    1995-01-01

    The excitation of turbine generator torsional natural frequencies in the region near 120 Hz by electrical transients in the power system has resulted in blade failures for several large 1,800 rpm nuclear turbines. At Cleveland Electric's Perry Nuclear Power plant a combination of advanced measurement techniques and analyses were used to identify and resolve a potential torsional vibration problem without adverse impact on the plant availability. The Perry turbine generator consists of a high pressure turbine, three low pressure turbines with 43 inch last stage blades, and a 1,250 MWe four pole generator operating at 1,800 rpm. Torsional vibration measurements obtained from random vibration during operation were acquired just prior to the 1994 refueling outage. The measurements indicated that the 26th torsional mode of vibration was just under 120 Hz and within the range of frequencies for which the manufacturer recommends modifying the unit to shift the problem torsional natural frequency. Extensive analytical modeling was used to design a modification to shift the torsional natural frequencies away from 120 Hertz and the modification was implemented during the refueling outage without affecting outage critical path. An off-line ramp test and additional on-line monitoring performed at the conclusion of the outage confirmed that the on-line method provided accurate measurements of the torsional natural frequencies and demonstrated that, with the modification, the torsional natural frequencies were sufficiently removed from 120 Hertz to allow turbine generator operation. The modification, which involved brazing of the tie wires on all last stage blades, also significantly reduces the stress on the last stage blades that result from negative sequence currents, further increasing the operating margin of the turbine generator with respect to electrical transients and faults

  6. Characterization of the molecular structure and mechanical properties of polymer surfaces and protein/polymer interfaces by sum frequency generation vibrational spectroscopy and atomic force microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Koffas, Telly Stelianos [Univ. of California, Berkeley, CA (United States)

    2004-01-01

    Sum frequency generation (SFG) vibrational spectroscopy, atomic force microscopy (AFM), and other complementary surface-sensitive techniques have been used to study the surface molecular structure and surface mechanical behavior of biologically-relevant polymer systems. SFG and AFM have emerged as powerful analytical tools to deduce structure/property relationships, in situ, for polymers at air, liquid and solid interfaces. The experiments described in this dissertation have been performed to understand how polymer surface properties are linked to polymer bulk composition, substrate hydrophobicity, changes in the ambient environment (e.g., humidity and temperature), or the adsorption of macromolecules. The correlation of spectroscopic and mechanical data by SFG and AFM can become a powerful methodology to study and engineer materials with tailored surface properties. The overarching theme of this research is the interrogation of systems of increasing structural complexity, which allows us to extend conclusions made on simpler model systems. We begin by systematically describing the surface molecular composition and mechanical properties of polymers, copolymers, and blends having simple linear architectures. Subsequent chapters focus on networked hydrogel materials used as soft contact lenses and the adsorption of protein and surfactant at the polymer/liquid interface. The power of SFG is immediately demonstrated in experiments which identify the chemical parameters that influence the molecular composition and ordering of a polymer chain's side groups at the polymer/air and polymer/liquid interfaces. In general, side groups with increasingly greater hydrophobic character will be more surface active in air. Larger side groups impose steric restrictions, thus they will tend to be more randomly ordered than smaller hydrophobic groups. If exposed to a hydrophilic environment, such as water, the polymer chain will attempt to orient more of its hydrophilic groups to

  7. Vibration power generator for a linear MR damper

    International Nuclear Information System (INIS)

    Sapiński, Bogdan

    2010-01-01

    The paper describes the structure and the results of numerical calculations and experimental tests of a newly developed vibration power generator for a linear magnetorheological (MR) damper. The generator consists of permanent magnets and coil with foil winding. The device produces electrical energy according to Faraday's law of electromagnetic induction. This energy is applied to vary the damping characteristics of the MR damper attached to the generator by the input current produced by the device. The objective of the numerical calculations was to determine the magnetic field distribution in the generator as well as the electric potential and current density in the generator's coil during the idle run and under the load applied to the MR damper control coil. The results of the calculations were used during the design and manufacturing stages of the device. The objective of the experimental tests carried out on a dynamic testing machine was to evaluate the generator's efficiency and to compare the experimental and predicted data. The experimental results demonstrate that the engineered device enables a change in the kinetic energy of the reciprocal motion of the MR damper which leads to variations in the damping characteristics. That is why the generator may be used to build up MR damper based vibration control systems which require no external power

  8. SFG analysis of the molecular structures at the surfaces and buried interfaces of PECVD ultralow-dielectric constant pSiCOH: Reactive ion etching and dielectric recovery

    Science.gov (United States)

    Myers, John N.; Zhang, Xiaoxian; Huang, Huai; Shobha, Hosadurga; Grill, Alfred; Chen, Zhan

    2017-05-01

    Molecular structures at the surface and buried interface of an amorphous ultralow-k pSiCOH dielectric film were quantitatively characterized before and after reactive ion etching (RIE) and subsequent dielectric repair using sum frequency generation (SFG) vibrational spectroscopy and Auger electron spectroscopy. SFG results indicated that RIE treatment of the pSiCOH film resulted in a depletion of ˜66% of the surface methyl groups and changed the orientation of surface methyl groups from ˜47° to ˜40°. After a dielectric recovery process that followed the RIE treatment, the surface molecular structure was dominated by methyl groups with an orientation of ˜55° and the methyl surface coverage at the repaired surface was 271% relative to the pristine surface. Auger depth profiling indicated that the RIE treatment altered the top ˜25 nm of the film and that the dielectric recovery treatment repaired the top ˜9 nm of the film. Both SFG and Auger profiling results indicated that the buried SiCNH/pSiCOH interface was not affected by the RIE or the dielectric recovery process. Beyond characterizing low-k materials, the developed methodology is general and can be used to distinguish and characterize different molecular structures and elemental compositions at the surface, in the bulk, and at the buried interface of many different polymer or organic thin films.

  9. SFG analysis of the molecular structures at the surfaces and buried interfaces of PECVD ultralow-dielectric constant pSiCOH

    Science.gov (United States)

    Zhang, Xiaoxian; Myers, John N.; Huang, Huai; Shobha, Hosadurga; Chen, Zhan; Grill, Alfred

    2016-02-01

    PECVD deposited porous SiCOH with ultralow dielectric constant has been successfully integrated as the insulator in advanced interconnects to decrease the RC delay. The effects of NH3 plasma treatment and the effectiveness of the dielectric repair on molecular structures at the surface and buried interface of a pSiCOH film deposited on top of a SiCNH film on a Si wafer were fully characterized using sum frequency generation vibrational spectroscopy (SFG), supplemented by X-ray photoelectron spectroscopy. After exposure to NH3 plasma for 18 s, about 40% of the methyl groups were removed from the pSiCOH surface, and the average orientation of surface methyl groups tilted more towards the surface. The repair method used here effectively repaired the molecular structures at the pSiCOH surface but did not totally recover the entire plasma-damaged layer. Additionally, simulated SFG spectra with various average orientations of methyl groups at the SiCNH/pSiCOH buried interface were compared with the experimental SFG spectra collected using three different laser input angles to determine the molecular structural information at the SiCNH/pSiCOH buried interface after NH3 plasma treatment and repair. The molecular structures including the coverage and the average orientation of methyl groups at the buried interface were found to be unchanged by NH3 plasma treatment and repair.

  10. A compact OPO/SFG laser for ultraviolet biological sensing

    Science.gov (United States)

    Tiihonen, Mikael; Pasiskevicius, Valdas; Laurell, Fredrik; Jonsson, Per; Lindgren, Mikael

    2004-07-01

    A compact parametric oscillator (OPO) with intracavity sum-frequency generation (SFG) to generate 293 nm UV laser irradiation, was developed. The OPO/SFG device was pumped by a 100 Hz Nd:YAG laser (1064 nm) of own design, including subsequent second harmonic generation (SHG) in an external periodically poled KTiOPO4 (KTP) crystal. The whole system could be used to deliver more than 30 μJ laser irradiation per pulse (100 Hz) at 293 nm. The UV laser light was introduced in an optical fiber attached to a sample compartment allowing detection of fluorescence emission using a commercial spectrometer. Aqueous samples containing biomolecules (ovalbumin) or bacteria spores (Bacillus subtilis) were excited by the UV-light at 293 nm resulting in strong fluorescence emission in the range 325 - 600 nm.

  11. Ultrahigh vacuum and high-pressure coadsorption of CO and H2 on Pd(111): A combined SFG, TDS, and LEED study

    Science.gov (United States)

    Morkel, Matthias; Rupprechter, Günther; Freund, Hans-Joachim

    2003-11-01

    Sum frequency generation (SFG) vibrational spectroscopy was carried out in conjunction with thermal desorption spectroscopy, low-energy electron diffraction, and Auger electron spectroscopy to examine the coadsorption of CO and H2 on Pd(111). Sequential dosing as well as various CO/H2 mixtures was utilized to study intermolecular interactions between CO and H2. Preadsorbed CO effectively prevented the dissociative adsorption of hydrogen for CO coverages ⩾0.33 ML. While preadsorbed hydrogen was able to hinder CO adsorption at low temperature (100 K), hydrogen was replaced from the surface by CO at 150 K. When 1:1 mixtures of CO/H2 were used at 100 K, hydrogen selectively hindered CO adsorption on on-top sites, while above ˜125 K no blocking of CO adsorption was observed. The observations are explained in terms of mutual site blocking, of a CO-H phase separation, and of a CO-assisted hydrogen dissolution in the Pd bulk. The temperature-dependent site blocking effect of hydrogen is attributed to the ability (inability) of surface hydrogen to diffuse into the Pd bulk above (below) ˜125 K. Nonlinear optical SFG spectroscopy allowed us to study these effects not only in ultrahigh vacuum but also in a high-pressure environment. Using an SFG-compatible ultrahigh vacuum-high-pressure cell, spectra of 1:10 CO/H2 mixtures were acquired up to 55 mbar and 550 K, with simultaneous gas chromatographic and mass spectrometric gas phase analysis. Under reaction conditions, CO coverages ⩾0.5 ML were observed which strongly limit H2 adsorption and thus may be partly responsible for the low CO hydrogenation rate. The high-pressure and high-temperature SFG spectra also showed indications of a reversible surface roughening or a highly dynamic (not perfectly ordered) CO adsorbate phase. Implications of the observed adsorbate structures on catalytic CO hydrogenation on supported Pd nanoparticles are discussed.

  12. Ultrahigh vacuum and high-pressure coadsorption of CO and H2 on Pd(111): A combined SFG, TDS, and LEED study

    International Nuclear Information System (INIS)

    Morkel, Matthias; Rupprechter, Guenther; Freund, Hans-Joachim

    2003-01-01

    Sum frequency generation (SFG) vibrational spectroscopy was carried out in conjunction with thermal desorption spectroscopy, low-energy electron diffraction, and Auger electron spectroscopy to examine the coadsorption of CO and H 2 on Pd(111). Sequential dosing as well as various CO/H 2 mixtures was utilized to study intermolecular interactions between CO and H 2 . Preadsorbed CO effectively prevented the dissociative adsorption of hydrogen for CO coverages ≥0.33 ML. While preadsorbed hydrogen was able to hinder CO adsorption at low temperature (100 K), hydrogen was replaced from the surface by CO at 150 K. When 1:1 mixtures of CO/H 2 were used at 100 K, hydrogen selectively hindered CO adsorption on on-top sites, while above ∼125 K no blocking of CO adsorption was observed. The observations are explained in terms of mutual site blocking, of a CO-H phase separation, and of a CO-assisted hydrogen dissolution in the Pd bulk. The temperature-dependent site blocking effect of hydrogen is attributed to the ability (inability) of surface hydrogen to diffuse into the Pd bulk above (below) ∼125 K. Nonlinear optical SFG spectroscopy allowed us to study these effects not only in ultrahigh vacuum but also in a high-pressure environment. Using an SFG-compatible ultrahigh vacuum-high-pressure cell, spectra of 1:10 CO/H 2 mixtures were acquired up to 55 mbar and 550 K, with simultaneous gas chromatographic and mass spectrometric gas phase analysis. Under reaction conditions, CO coverages ≥0.5 ML were observed which strongly limit H 2 adsorption and thus may be partly responsible for the low CO hydrogenation rate. The high-pressure and high-temperature SFG spectra also showed indications of a reversible surface roughening or a highly dynamic (not perfectly ordered) CO adsorbate phase. Implications of the observed adsorbate structures on catalytic CO hydrogenation on supported Pd nanoparticles are discussed

  13. AFM and SFG studies of pHEMA-based hydrogel contact lens surfaces in saline solution: adhesion, friction, and the presence of non-crosslinked polymer chains at the surface.

    Science.gov (United States)

    Kim, Seong Han; Opdahl, Aric; Marmo, Chris; Somorjai, Gabor A

    2002-04-01

    The surfaces of two types of soft contact lenses neutral and ionic hydrogels--were characterized by atomic force microscopy (AFM) and sum-frequency-generation (SFG) vibrational spectroscopy. AFM measurements in saline solution showed that the presence of ionic functional groups at the surface lowered the friction and adhesion to a hydrophobic polystyrene tip. This was attributed to the specific interactions of water and the molecular orientation of hydrogel chains at the surface. Friction and adhesion behavior also revealed the presence of domains of non-crosslinked polymer chains at the lens surface. SFG showed that the lens surface became partially dehydrated upon exposure to air. On this partially dehydrated lens surface, the non-crosslinked domains exhibited low friction and adhesion in AFM. Fully hydrated in saline solution, the non-crosslinked domains extended more than tens of nanometers into solution and were mobile.

  14. Flow-induced vibration in LMFBR steam generators: a state-of-the-art review

    International Nuclear Information System (INIS)

    Shin, Y.S.; Wambsganss, M.W.

    1975-05-01

    This state-of-the-art review identifies and discusses existing methods of flow-induced vibration analysis applicable to steam generators, their limitations, and base-technology needs. Also included are discussions of five different LMFBR steam-generator configurations and important design considerations, failure experiences, possible flow-induced excitation mechanisms, vibration testing, and available methods of vibration analysis. The objectives are to aid LMFBR steam-generator designers in making the best possible evaluation of potential vibration in steam-generator internals, and to provide the basis for development of design guidelines to avoid detrimental flow-induced vibration

  15. Chemische Reaktionen auf Oberflächen - eine SFG Studie

    OpenAIRE

    Kirsch, Harald

    2014-01-01

    This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...

  16. Vibration and wear characteristics of steam generator tubes

    International Nuclear Information System (INIS)

    Choi, Young Hwan

    2003-06-01

    This study investigates the fluid elastic instability characteristics of Steam Generator (SG) U-tubes with defect and the safety assessment of the potential for fretting-wear damages on Steam Generator (SG) U-tubes caused by foreign object in operating nuclear power plants. The operating SG shell-side flow field conditions for determining the fluid elastic instability or fretting-wear parameters such as damping ratio, added mass and flow velocity are obtained from three-dimensional SG flow calculation using the ATHOS3 code. To get the natural frequency, corresponding mode shape and participation factor, modal analyses are performed for the U-tubes either with axial or circumferential flaw with different sizes. Special emphases are on the effects of flaw orientation and size on the modal and instability characteristics of tubes, which are expressed in terms of the natural frequency, corresponding mode shape and stability ratio. Also, the wear rate of U-tube caused by foreign object is calculated using the Archard formula and the remaining life of the tube is predicted, and discussed in this study is the effect of the flow velocity and vibration of the tube on the remaining life of the tube. In addition, addressed is the effect of the internal pressure on the vibration and fretting-wear characteristics of the tube

  17. Substantiation of vibration strength of nuclear reactor and steam generator internals. Main problems

    International Nuclear Information System (INIS)

    Fyodorov, V.G.; Sinyavasky, V.F.

    1977-01-01

    The report details the scope and priority of studies necessary for substantiation of vibration strength of steam generator tube bundles and reactor fuel assemblies, and design modifications helping to reduce flow-induced vibration of the internals specified. Steam generator tube bundles are studied on the basis of a standard establishing vibration requirements at various stages of design, manufacture and operation of a steam generator at a nuclear power station. The main vibration characteristics of tubes obtained through model and full-scale tests are compared with calculation results. Results are provided concerning test-stand vibration tests of fuel elements and fuel assemblies. (author)

  18. SFG investigation of adsorbed CO and NO on NiO(111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Bandara, Athula; Dobashi, Shinsaku; Kubota, Jun; Onda, Ken; Wada, Akihide; Domen, Kazunari; Hirose, Chiaki [Tokyo Inst. of Tech., Yokohama (Japan). Research Lab. of Resources Utilization; Kano, S.S.

    1997-07-01

    Adsorption structures of CO and NO on the NiO(111) film grown on Ni(111) crystal have been investigated by sum frequency generation (SFG) spectroscopy and infrared reflection absorption spectroscopy (IRAS). The CO stretching band of adsorbed CO on NiO(111) was observed at 2144 cm{sup -1} on the SFG spectra for both p- and s-polarized visible light. However, adsorbed NO on NiO(111) was observed at 1805 cm{sup -1} on the SFG spectra only for the p-polarized visible light. The results suggest that the adsorbed CO molecule was tilted from the surface normal but the NO molecule was perpendicular to the surface. These orientations of CO and NO reflect the surface structure of NiO(111) which has (2 x 2)-reconstructed microfacets. Adsorption of CO on Ni(111) instead of NiO(111) was also examined by SFG and IRAS. Absorption bands due to linear and bridged CO were observed at 2076 and 1918 cm{sup -1}, respectively, by IRAS. On the other hand, the linear CO molecules on Ni(111) gave an SFG peak at 2076 cm{sup -1} only for the p-polarized visible light indicating the CO molecules are perpendicular to the surface, and bridged CO molecules did not give any SFG signal. The absence of the bridged CO signal is believed to be due to the smaller Raman tensor of bridged CO. (author)

  19. SFG investigation of adsorbed CO and NO on NiO(111) surface

    International Nuclear Information System (INIS)

    Bandara, Athula; Dobashi, Shinsaku; Kubota, Jun; Onda, Ken; Wada, Akihide; Domen, Kazunari; Hirose, Chiaki; Kano, S.S.

    1997-01-01

    Adsorption structures of CO and NO on the NiO(111) film grown on Ni(111) crystal have been investigated by sum frequency generation (SFG) spectroscopy and infrared reflection absorption spectroscopy (IRAS). The CO stretching band of adsorbed CO on NiO(111) was observed at 2144 cm -1 on the SFG spectra for both p- and s-polarized visible light. However, adsorbed NO on NiO(111) was observed at 1805 cm -1 on the SFG spectra only for the p-polarized visible light. The results suggest that the adsorbed CO molecule was tilted from the surface normal but the NO molecule was perpendicular to the surface. These orientations of CO and NO reflect the surface structure of NiO(111) which has (2 x 2)-reconstructed microfacets. Adsorption of CO on Ni(111) instead of NiO(111) was also examined by SFG and IRAS. Absorption bands due to linear and bridged CO were observed at 2076 and 1918 cm -1 , respectively, by IRAS. On the other hand, the linear CO molecules on Ni(111) gave an SFG peak at 2076 cm -1 only for the p-polarized visible light indicating the CO molecules are perpendicular to the surface, and bridged CO molecules did not give any SFG signal. The absence of the bridged CO signal is believed to be due to the smaller Raman tensor of bridged CO. (author)

  20. An SFG and DFG investigation of polycrystalline Au, Au-Cu and Au-Ag-Cu electrodes in contact with aqueous solutions containing KCN

    International Nuclear Information System (INIS)

    Bozzini, Benedetto; Busson, Bertrand; De Gaudenzi, Gian Pietro; Mele, Claudio; Tadjeddine, Abderrahmane

    2007-01-01

    In this paper, the behaviour of polycrystalline Au, Au-Cu (Cu 25%) and Au-Ag-Cu (Ag 10%, Cu 15%) electrodes in contact with neutral aqueous solutions of KCN has been studied as a function of potential by means of in situ sum frequency generation (SFG) and difference frequency generation (DFG) spectroscopies. The potential-dependent spectra have been analysed quantitatively with a model for the second-order non-linear susceptibility accounting for vibrational and electronic effects. The potential-dependence of the CN - stretching band position and of the free-electron contribution to the real part of the non-resonant component of the second-order susceptibility have been accounted for. Spectroelectrochemical results were complemented by cyclic voltammetric measurements. The chief stress in this work has been placed on systematising and quantifying the interaction between the vibrational and electronic structures of the electrodic interfaces studied. The effects of adsorbates on the electronic structure of the adsorbing electrode, as a function of electrode alloy composition and applied potential are particularly critical for the understanding of Au-alloy electrochemistry in the presence of cyanide and cyanocomplexes. The systematic comparison of SFG and DFG spectra measured under the same electrochemical conditions for Au, Au-Cu and Au-Ag-Cu electrodes discloses a rich phenomenology related to the electronic structure of the interface

  1. An SFG and DFG investigation of polycrystalline Au, Au-Cu and Au-Ag-Cu electrodes in contact with aqueous solutions containing KCN

    Energy Technology Data Exchange (ETDEWEB)

    Bozzini, Benedetto [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy)]. E-mail: benedetto.bozzini@unile.it; Busson, Bertrand [CLIO-LCP, Universite Paris-Sud, 91405 Orsay Cedex (France); De Gaudenzi, Gian Pietro [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Mele, Claudio [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Tadjeddine, Abderrahmane [UDIL-CNRS, Bat. 201, Centre Universitaire Paris-Sud, BP 34, 91898 Orsay Cedex (France)

    2007-01-16

    In this paper, the behaviour of polycrystalline Au, Au-Cu (Cu 25%) and Au-Ag-Cu (Ag 10%, Cu 15%) electrodes in contact with neutral aqueous solutions of KCN has been studied as a function of potential by means of in situ sum frequency generation (SFG) and difference frequency generation (DFG) spectroscopies. The potential-dependent spectra have been analysed quantitatively with a model for the second-order non-linear susceptibility accounting for vibrational and electronic effects. The potential-dependence of the CN{sup -} stretching band position and of the free-electron contribution to the real part of the non-resonant component of the second-order susceptibility have been accounted for. Spectroelectrochemical results were complemented by cyclic voltammetric measurements. The chief stress in this work has been placed on systematising and quantifying the interaction between the vibrational and electronic structures of the electrodic interfaces studied. The effects of adsorbates on the electronic structure of the adsorbing electrode, as a function of electrode alloy composition and applied potential are particularly critical for the understanding of Au-alloy electrochemistry in the presence of cyanide and cyanocomplexes. The systematic comparison of SFG and DFG spectra measured under the same electrochemical conditions for Au, Au-Cu and Au-Ag-Cu electrodes discloses a rich phenomenology related to the electronic structure of the interface.

  2. Non-invasive SFG spectroscopy: a tool to reveal the conformational change of grafted chains due to bacterial adhesion

    Science.gov (United States)

    Bulard, Emilie; Dubost, Henri; Fontaine-Aupart, Marie-Pierre; Zheng, Wanquan; Herry, Jean-Marie; Bellon-Fontaine, Marie-No"lle; Briandet, Romain; Bourguignon, Bernard

    2011-07-01

    In many fields such as biomedical or food industry, surface colonization by micro-organisms leads to biofilms formation that are tridimentional biostructures highly resistant to the action of antimicrobials, by mechanisms still unclear. In order to deepen our understanding of the initial interaction of bacteria cells with a solid surface, we analyze by in situ vibrational Sum Frequency Generation (SFG) spectroscopy the effect of the adhesion of hydrophilic Lactoccocus lactis bacteria and its hydrophobic mutants in distilled water on a self-assembled monolayer (SAM) of octadecanethiol (ODT) on a gold film. When a homogeneous bacterial monolayer is deposited on this ordered surface, SFG spectrum of the ODT SAM shows significant intensity changes from that in air or in water. Its modelling as a function of conformation allows to distinguish optical effects due to the water solution surrounding bacteria from conformational changes of the ODT SAM due to the presence of the bacteria cells. Futhermore, bacterial adhesion induces different measurable effects on the ODT SAM conformation, depending on the hydrophobic / hydrophilic character of the bacterial surface. Such a result deserves to be taken into account for the design of new materials with improved properties or to control biofilm formation.

  3. Mobile phone generated vibrations used to detect diabetic peripheral neuropathy.

    Science.gov (United States)

    May, Jonathan David; Morris, Matthew William John

    2017-12-01

    In the current United Kingdom population the incidence of diabetic peripheral neuropathy is increasing. The presence of diabetic neuropathy affects decision making and treatment options. This study seeks to evaluate if the vibrations generated from a mobile phone can be used to screen patients for diabetic peripheral neuropathy. This study comprised of 61 patients; a control group of 21 patients; a lower limb injury group of 19 patients; a diabetic peripheral neuropathy group of 21 patients. The control and injury group were recruited randomly from fracture clinics. The diabetic peripheral neuropathy group were randomly recruited from the diabetic foot clinic. The 61 patients were examined using a 10g Semmes-Weinstein monofilament, a 128Hz tuning fork and a vibrating mobile phone. The points tested were, index finger, patella, lateral malleoli, medial malleoli, heel, first and fifth metatarsal heads. The most accurate location of all the clinical tests was the head of the 1st metatarsal at 0.86. The overall accuracy of the tuning fork was 0.77, the ten gram monofilament 0.79 and the mobile phone accuracy was 0.88. The control group felt 420 of 441 tests (95%). The injury group felt 349 of 399 tests (87%). The neuropathic group felt 216 of 441 tests (48%). There is a significant difference in the number of tests felt between the control and both the injury and neuropathic groups. pperipheral neuropathy. The most accurate location to test for diabetic peripheral neuropathy is the head of the 1st metatarsal. Screening for diabetic peripheral neuropathy in the index finger and patella were inaccurate. An injury to the lower limb affects the patient's vibration sensation, we would therefore recommend screening the contralateral limb to the injury. This study represents level II evidence of a new diagnostic investigation. Copyright © 2016 European Foot and Ankle Society. All rights reserved.

  4. Diagnosis of excessive vibration signals of two-pole generator rotors in balancing

    International Nuclear Information System (INIS)

    Park, Jong Po

    2000-01-01

    Cause of excessive vibration with twice the rotational speed of a two-pole generator rotor for the fossil power plants was investigated. The two-pole generator rotor, treated as a typically asymmetric rotor in vibration analysis, produces asynchronous vibration with twice the rotational speed, sub-harmonic critical speeds, and potentially unstable operating zones due to its own inertia and/or stiffness asymmetry. This paper introduces a practical balancing procedure, and presents the results of the investigation on sources of the excessive vibration based on the experimental vibration data of the asymmetric two-pole rotor in balancing

  5. Surface restructuring behavior of various types of poly(dimethylsiloxane) in water detected by SFG.

    Science.gov (United States)

    Chen, Chunyan; Wang, Jie; Chen, Zhan

    2004-11-09

    Surface structures of several different poly(dimethylsiloxane) (PDMS) materials, tetraethoxysilane-cured hydroxy-terminated PDMS (TEOS-PDMS), platinum-cured vinyl-terminated PDMS (Pt-PDMS), platinum-cured vinyl-terminated poly(diphenylsiloxane)-co-poly(dimethylsiloxane) (PDPS-co-PDMS), and PDMS-co-polystyrene (PDMS-co-PS) copolymer in air and water have been investigated by sum frequency generation (SFG) vibrational spectroscopy. The SFG spectra collected from all PDMS surfaces in both air and water are dominated by methyl group stretches, indicating that all the surfaces are mainly covered by methyl groups. Other than surface-dominating methyl groups, some -Si-CH2-CH2- moieties on the Pt-PDMS surface have also been detected in air, which are present at cross-linking points. Information about the average orientation angle and angle distribution of the methyl groups on the PDMS surface has been evaluated. Surface restructuring of the methyl groups has been observed for all PDMS surfaces in water. Upon contacting water, the methyl groups on all PDMS surfaces tilt more toward the surface. The detailed restructuring behaviors of several PDMS surfaces in water and the effects of molecular weight on restructuring behaviors have been investigated. For comparison, in addition to air and water, surface structures of PDMS materials mentioned above in a nonpolar solvent, FC-75, have also been studied. By comparing the different response of phenyl groups to water on both PDPS-co-PDMS and PS-co-PDMS surfaces, we have demonstrated how the restructuring behaviors of surface phenyl groups are affected by the structural flexibility of the molecular chains where they are attached.

  6. Fueled viking generator S/N 106 acceptance vibration test report

    International Nuclear Information System (INIS)

    Anderson, C.; Brewer, C.O.; Abrahamson, S.G.

    1976-01-01

    The Viking Generator S/N 106 was vibrated to the Teledyne Isotope Flight Acceptance Schedule (Random Only) with no deviation from normal generator functional output. Radiographic analysis and power tests before and after the vibration test indicated no change in the condition of the generator. The work was conducted in the Alpha Fuels Environmental Test Facility at Mound Laboratory

  7. Vibration Spectrum Analysis for Indicating Damage on Turbine and Steam Generator Amurang Unit 1

    Directory of Open Access Journals (Sweden)

    Beny Cahyono

    2017-12-01

    Full Text Available Maintenance on machines is a mandatory asset management activity to maintain asset reliability in order to reduce losses due to failure. 89% of defects have random failure mode, the proper maintenance method is predictive maintenance. Predictive maintenance object in this research is Steam Generator Amurang Unit 1, which is predictive maintenance is done through condition monitoring in the form of vibration analysis. The conducting vibration analysis on Amurang Unit 1 Steam Generator is because vibration analysis is very effective on rotating objects. Vibration analysis is predicting the damage based on the vibration spectrum, where the vibration spectrum is the result of separating time-based vibrations and simplifying them into vibrations based on their frequency domain. The transformation of time-domain-wave into frequency-domain-wave is using the application of FFT, namely AMS Machinery. The measurement of vibration value is done on turbine bearings and steam generator of Unit 1 Amurang using Turbine Supervisory Instrument and CSI 2600 instrument. The result of this research indicates that vibration spectrum from Unit 1 Amurang Power Plant indicating that there is rotating looseness, even though the vibration value does not require the Unit 1 Amurang Power Plant to stop operating (shut down. This rotating looseness, at some point, can produce some indications that similar with the unbalance. In order to avoid more severe vibrations, it is necessary to do inspection on the bearings in the Amurang Unit 1 Power Plant.

  8. SFG study of platinum electrodes in perchloric acid solutions

    Science.gov (United States)

    Zheng, W. Q.; Pluchery, O.; Tadjeddine, A.

    2002-04-01

    Infrared-visible sum-frequency generation (SFG) spectroscopy has been used to study the structure of water molecules (and/or its derivatives OH -, H 3O + etc.) at aqueous electrolyte/electrode interfaces. For Pt(1 1 0) and Pt(1 0 0) electrodes in 0.1 M perchloric acid solution, we did not observe any significant O-H stretching resonance. In striking contrast to the resonant SFG signal, the nonresonant SFG (NRSFG) signal varies sensitively with the applied electrochemical potential, indicating that the interaction of water molecules with platinum electrodes is relatively weak as compared to that of H + and ClO 4- ions. From changes in the NRSFG signal and on the basis of an ionic adsorption model, we can also deduce that the potential of zero charge of Pt(1 1 0) in 0.1 M HClO 4 should be located at about 0.22 V (vs. NHE). This value is in good agreement with that measured recently by electrochemical method.

  9. Sfg

    Science.gov (United States)

    Fischer, R. X.; Baur, W. H.

    This document is part of Subvolume E `Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes RON to STI' of Volume 14 `Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV `Physical Chemistry'.

  10. Ultra-Broadband Infrared Pulses from a Potassium-Titanyl Phosphate Optical Parametric Amplifier for VIS-IR-SFG Spectroscopy

    Science.gov (United States)

    Isaienko, Oleksandr; Borguet, Eric

    A non-collinear KTP-OPA to provide ultra-broadband mid-infrared pulses was designed and characterized. With proper pulse-front and phase correction, the system has a potential for high-time resolution vibrational VIS-IR-SFG spectroscopy.

  11. Competition between SFG and two SHGs in broadband type-I QPM

    Science.gov (United States)

    Dang, Weirui; Chen, Yuping; Gong, Mingjun; Chen, Xianfeng

    2013-03-01

    In this paper, we have studied the characteristics of second-order nonlinear interactions with band-overlapped type-I quasi-phase-matching (QPM) second harmonic generation (SHG) and sum-frequency generation (SFG), and predicted a blue-shift with a band-narrowing of their bands and a sunken response in the SFG curve, which are due to the phase-matching-dependent competition between band-overlapped SHG and SFG processes. This prediction is then verified by the experiment in an 18-mm-long bulk MgO-doped periodically poled lithium niobate crystal (MgO:PPLN) and may provide the candidate solution to output controlling for flexible broadcast wavelength conversion, channel-selective wavelength conversion and all-optical logic gates by cascaded QPM second-order nonlinear processes.

  12. Anti vibration bars replacement in Vandellos II steam generators

    International Nuclear Information System (INIS)

    Vinyes, R.; Leal, R.

    1994-01-01

    C.N. Vandellos II is equipped with three steam generators Westinghouse model F. The number of tubes is 5626 each SG and the material Inconel 600TT. During the first inservice inspection, in 1989, tube wall thickness reductions were observed due to fretting in zones of contact with the tubes anti vibration bars. In the 2 nd shutdown for refueling (1990) all the tubes subject to this type of degradation were inspected by eddy currents, occurring a significative increase in number of tubes affected as well as the quantity of plugged tubes for that reason. Additionally, Westinghouse performed visual inspection and dimensional control of gaps in the tube bundles. Taking in account the results, the replacement with AVBs of new design was decided. AVBs new design is more complex than the original due to the combination of flexible and expandable bars in order to eliminate gaps between tubes an bars an assure proper bundle support. Given that the installation has to be done under water for shielding, all unions are bolted so that no welding is required. Each one of the bars, 333 per SG, is attached to a support structure consisting in 6 retaining plates and 4 bridge plates. (Author)

  13. Combined IR-Raman vs vibrational sum-frequency heterospectral correlation spectroscopy

    Science.gov (United States)

    Roy, Sandra; Beutier, Clémentine; Hore, Dennis K.

    2018-06-01

    Vibrational sum-frequency generation spectroscopy is a valuable probe of surface structure, particularly when the same molecules are present in one of the adjacent bulk solid or solution phases. As a result of the non-centrosymmetric requirement of SFG, the signal generated is a marker of the extent to which the molecules are ordered in an arrangement that breaks the up-down symmetry at the surface. In cases where the accompanying changes in the bulk are of interest in understanding and interpreting the surface structure, simultaneous analysis of the bulk IR absorption or bulk Raman scattering is helpful, and may be used in heterospectral surface-bulk two-dimensional correlation. We demonstrate that, in such cases, generating a new type of bulk spectrum that combines the IR and Raman amplitudes is a better candidate than the individual IR and Raman spectra for the purpose of correlation with the SFG signal.

  14. Time-domain SFG spectroscopy using mid-IR pulse shaping: practical and intrinsic advantages.

    Science.gov (United States)

    Laaser, Jennifer E; Xiong, Wei; Zanni, Martin T

    2011-03-24

    Sum-frequency generation (SFG) spectroscopy is a ubiquitous tool in the surface sciences. It provides infrared transition frequencies and line shapes that probe the structure and environment of molecules at interfaces. In this article, we apply techniques learned from the multidimensional spectroscopy community to SFG spectroscopy. We implement balanced heterodyne detection to remove scatter and the local oscillator background. Heterodyning also separates the resonant and nonresonant signals by acquiring both the real and imaginary parts of the spectrum. We utilize mid-IR pulse shaping to control the phase and delay of the mid-IR pump pulse. Pulse shaping allows phase cycling for data collection in the rotating frame and additional background subtraction. We also demonstrate time-domain data collection, which is a Fourier transform technique, and has many advantages in signal throughput, frequency resolution, and line shape accuracy over existing frequency domain methods. To demonstrate time-domain SFG spectroscopy, we study an aryl isocyanide on gold, and find that the system has an inhomogeneous structural distribution, in agreement with computational results, but which was not resolved by previous frequency-domain SFG studies. The ability to rapidly and actively manipulate the mid-IR pulse in an SFG pules sequence makes possible new experiments and more accurate spectra. © 2011 American Chemical Society

  15. ACO-Initialized Wavelet Neural Network for Vibration Fault Diagnosis of Hydroturbine Generating Unit

    Directory of Open Access Journals (Sweden)

    Zhihuai Xiao

    2015-01-01

    Full Text Available Considering the drawbacks of traditional wavelet neural network, such as low convergence speed and high sensitivity to initial parameters, an ant colony optimization- (ACO- initialized wavelet neural network is proposed in this paper for vibration fault diagnosis of a hydroturbine generating unit. In this method, parameters of the wavelet neural network are initialized by the ACO algorithm, and then the wavelet neural network is trained by the gradient descent algorithm. Amplitudes of the frequency components of the hydroturbine generating unit vibration signals are used as feature vectors for wavelet neural network training to realize mapping relationship from vibration features to fault types. A real vibration fault diagnosis case result of a hydroturbine generating unit shows that the proposed method has faster convergence speed and stronger generalization ability than the traditional wavelet neural network and ACO wavelet neural network. Thus it can provide an effective solution for online vibration fault diagnosis of a hydroturbine generating unit.

  16. Dicty_cDB: SFG168 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAAXXXXXXXXXXAATGTCCANATTTCCATANATGTGT...>SFG168Z.Seq ----------AATGTCCANATTTCCATANATGTGTTNAAANACGTGGTGGTATNTTAAGN TGTGAATTTNANCCNCCAAGACAACCAAGATCCC...GTAAAATCAATTTGTAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAA----------AATGTCCANATTTCCATANATGTGTTNAA ANACGTGG

  17. SFG study on potential-dependent structure of water at Pt electrode/electrolyte solution interface

    Energy Technology Data Exchange (ETDEWEB)

    Noguchi, Hidenori; Okada, Tsubasa; Uosaki, Kohei [Physical Chemistry Laboratory, Division of Chemistry, Graduate School of Science, Hokkaido University, Sapporo 060-0810 (Japan)

    2008-10-01

    Structure of water at Pt/electrolyte solution interface was investigated by sum frequency generation (SFG) spectroscopy. Two broad peaks were observed in OH stretching region at ca. 3200 cm{sup -1} and ca. 3400 cm{sup -1}, which are known to be due to the symmetric OH stretching (U{sub 1}) of tetrahedrally coordinated, i.e., strongly hydrogen bonded 'ice-like' water, and the asymmetric OH stretching (U{sub 3}) of water molecules in a more random arrangement, i.e., weakly hydrogen bonded 'liquid-like' water, respectively. The SFG intensity strongly depended on electrode potential. Several possibilities are suggested for the potential dependence of the SFG intensity. (author)

  18. Sum frequency generation spectroscopy of tetraalkylphosphonium ionic liquids at the air-liquid interface

    Science.gov (United States)

    Peñalber-Johnstone, Chariz; Adamová, Gabriela; Plechkova, Natalia V.; Bahrami, Maryam; Ghaed-Sharaf, Tahereh; Ghatee, Mohammad Hadi; Seddon, Kenneth R.; Baldelli, Steven

    2018-05-01

    Sum frequency generation (SFG) spectroscopy is a nonlinear vibrational spectroscopic technique used in the study of interfaces, due to its unique ability to distinguish surface molecules that have preferential ordering compared to the isotropic bulk. Here, a series of alkyltrioctylphosphonium chloride ionic liquids, systematically varied by cation structure, were characterized at the air-liquid interface by SFG. The effect on surface structure resulting from molecular variation (i.e., addition of cyano- and methoxy-functional groups) of the cation alkyl chain was investigated. SFG spectra in the C—H stretching region (2750-3100 cm-1) for [P8 8 8 n][Cl], where n = 4, 5, 8, 10, 12, or 14, showed characteristic changes as the alkyl chain length was increased. Spectral profiles for n = 4, 5, 8, or 10 appeared similar; however, when the fourth alkyl chain was sufficiently long (as in the case of n = 12 or n = 14), abrupt changes occurred in the spectra. Molecular dynamics (MD) simulation of a slab of each ionic liquid (with n = 8, 10, or 12) confirmed gauche defects, with enhancement for the long alkyl chain and an abrupt increase of gauche occurrence from n = 8 to n = 10. A comparison of the tilt angle distribution from the simulation and the SFG analysis show a broad distribution of angles. Using experimental SFG spectra in conjunction with MD simulations, a comprehensive molecular picture at the surface of this unique class of liquids is presented.

  19. In Situ and Real-Time SFG Measurements Revealing Organization and Transport of Cholesterol Analogue 6-Ketocholestanol in a Cell Membrane.

    Science.gov (United States)

    Ma, Sulan; Li, Hongchun; Tian, Kangzhen; Ye, Shuji; Luo, Yi

    2014-02-06

    Cholesterol organization and transport within a cell membrane are essential for human health and many cellular functions yet remain elusive so far. Using cholesterol analogue 6-ketocholestanol (6-KC) as a model, we have successfully exploited sum frequency generation vibrational spectroscopy (SFG-VS) to track the organization and transport of cholesterol in a membrane by combining achiral-sensitive ssp (ppp) and chiral-sensitive psp polarization measurements. It is found that 6-KC molecules are aligned at the outer leaflet of the DMPC lipid bilayer with a tilt angle of about 10°. 6-KC organizes itself by forming an α-β structure at low 6-KC concentration and most likely a β-β structure at high 6-KC concentration. Among all proposed models, our results favor the so-called umbrella model with formation of a 6-KC cluster. Moreover, we have found that the long anticipated flip-flop motion of 6-KC in the membrane takes time to occur, at least much longer than previously thought. All of these interesting findings indicate that it is critical to explore in situ, real-time, and label-free methodologies to obtain a precise molecular description of cholesterol's behavior in membranes. This study represents the first application of SFG to reveal the cholesterol-lipid interaction mechanism at the molecular level.

  20. Torsional vibration analysis in turbo-generator shaft due to mal-synchronization fault

    Science.gov (United States)

    Bangunde, Abhishek; Kumar, Tarun; Kumar, Rajeev; Jain, S. C.

    2018-03-01

    A rotor of turbo-generator shafting is many times subjected to torsional vibrations during its lifespan. The reasons behind these vibrations are three-Phase fault, two-phase fault, line to ground fault, faulty-mal synchronization etc. Sometimes these vibrations can cause complete failure of turbo-generator shafting system. To calculate moment variation during these faults on the shafting system vibration analysis is done using Finite Elements Methods to calculate mass and stiffness matrix. The electrical disturbance caused during Mal-synchronization is put on generator section, and corresponding second order equations are solved by using “Duhamel Integral”. From the moment variation plots at four sections critically loaded sections are identified.

  1. Fluid induced structural vibrations in steam generators and heat exchangers

    International Nuclear Information System (INIS)

    Catton, I.; Adinolfi, P.; Alquaddoomi, O.

    2003-01-01

    Fluid-elastic instability (FEI) in tube bundle heat exchangers was studied experimentally. The motion of an array of 15 stainless steel vibrating tubes (Φ 25.4mm) in water cross-flow, suspended using stainless steel piano wire has been recorded with a CCD camera. The individual motion and relative motion of the tubes are reported and can be used for computational model validation. The relative displacement of the tubes allows identification of the most potentially damaging patterns of tube bundle vibration. A critical reduced velocity may be determined by specification of an allowable limit on tube motion amplitude. Measurements were made for various tube array configurations, tube natural frequencies and flow conditions. (author)

  2. Detection of generator bearing inner race creep by means of vibration and temperature analysis

    DEFF Research Database (Denmark)

    Skrimpas, Georgios Alexandros; Dragiev, Ivaylo G.; Hilmisson, Reynir

    2015-01-01

    Vibration and temperature analysis are the two dominating condition monitoring techniques applied to fault detection of bearing failures in wind turbine generators. Relative movement between the bearing inner ring and generator axle is one of the most severe failure modes in terms of secondary...... damages and development. Detection of bearing creep can be achieved reliably based on continuous trending of the amplitude of vibration running speed harmonic and temperature absolute values. In order to decrease the number of condition indicators which need to be assessed, it is proposed to exploit...... a weighted average descriptor calculated based on the 3rd up to 6th harmonic orders. Two cases of different bearing creep severity are presented, showing the consistency of the combined vibration and temperature data utilization. In general, vibration monitoring reveals early signs of abnormality several...

  3. Research of hydroelectric generating set low-frequency vibration monitoring system based on optical fiber sensing

    Science.gov (United States)

    Min, Li; Zhang, Xiaolei; Zhang, Faxiang; Sun, Zhihui; Li, ShuJuan; Wang, Meng; Wang, Chang

    2017-10-01

    In order to satisfy hydroelectric generating set low-frequency vibration monitoring, the design of Passive low-frequency vibration monitoring system based on Optical fiber sensing in this paper. The hardware of the system adopts the passive optical fiber grating sensor and unbalanced-Michelson interferometer. The software system is used to programming by Labview software and finishing the control of system. The experiment show that this system has good performance on the standard vibration testing-platform and it meets system requirements. The frequency of the monitoring system can be as low as 0.2Hz and the resolution is 0.01Hz.

  4. Validation of DIVA: an expert system for the diagnostic of turbo-generator vibrations

    International Nuclear Information System (INIS)

    Chevalier, R.; Ricard, B.; Tiarri, J.P.; Bonnet, J.C.

    1990-01-01

    The project presented in this paper concerns the development of an expert system dealing with the diagnosis of turbo-generator vibrations. DIVA - Diagnosis of Shaft Line Vibrations - is a joint project which is carried out by ALSTHOM, Electricite de France and Laboratoire de Marcoussis, research centre of CGE. This article first presents the organisation of the system and then the goals and results of the tests already achieved [fr

  5. High-precision and low-cost vibration generator for low-frequency calibration system

    Science.gov (United States)

    Li, Rui-Jun; Lei, Ying-Jun; Zhang, Lian-Sheng; Chang, Zhen-Xin; Fan, Kuang-Chao; Cheng, Zhen-Ying; Hu, Peng-Hao

    2018-03-01

    Low-frequency vibration is one of the harmful factors that affect the accuracy of micro-/nano-measuring machines because its amplitude is significantly small and it is very difficult to avoid. In this paper, a low-cost and high-precision vibration generator was developed to calibrate an optical accelerometer, which is self-designed to detect low-frequency vibration. A piezoelectric actuator is used as vibration exciter, a leaf spring made of beryllium copper is used as an elastic component, and a high-resolution, low-thermal-drift eddy current sensor is applied to investigate the vibrator’s performance. Experimental results demonstrate that the vibration generator can achieve steady output displacement with frequency range from 0.6 Hz to 50 Hz, an analytical displacement resolution of 3.1 nm and an acceleration range from 3.72 mm s-2 to 1935.41 mm s-2 with a relative standard deviation less than 1.79%. The effectiveness of the high-precision and low-cost vibration generator was verified by calibrating our optical accelerometer.

  6. Analysis of generator bearing vibration data for diagnosing rotor circuit malfunction in DFIGs

    DEFF Research Database (Denmark)

    Skrimpas, Georgios Alexandros; Sweeney, Christian W.; Jensen, Bogi Bech

    2014-01-01

    Doubly fed induction generators (DFIGs) are the most popular configuration met in the wind energy sector occu- pying approximately 65 % of the total market share. Condition monitoring of wind turbine generators is performed based on vibration data collected from accelerometers mounted on the drive....... In this paper generator bearing vibration signature for a DFIG under operation with one rotor phase coil open is analysed and presented. Further this failure mode is compared to rotor dynamics fault, such as rotational looseness, and the difference in signature is discussed. Vibration data from a multi...... end and non-drive end bearings, meeting the requirements of numerous turbine operators for condition based maintenance. In a DFIG the voltage applied to the rotor is controlled by a converter, where electric connection between the two is accom- plished by using slip rings. Improper connection between...

  7. Support Effects in Catalysis Studied by in-situ Sum Frequency Generation Vibrational Spectroscopy and in-situ X-Ray Spectroscopies

    Science.gov (United States)

    Kennedy, Griffin John

    Kinetic measurements are paired with in-situ spectroscopic characterization tools to investigate colloidally based, supported Pt catalytic model systems in order to elucidate the mechanisms by which metal and support work in tandem to dictate activity and selectivity. The results demonstrate oxide support materials, while inactive in absence of Pt nanoparticles, possess unique active sites for the selective conversion of gas phase molecules when paired with an active metal catalyst. In order to establish a paradigm for metal-support interactions using colloidally synthesized Pt nanoparticles the ability of the organic capping agent to inhibit reactivity and interaction with the support must first be assessed. Pt nanoparticles capped by poly(vinylpyrrolidone) (PVP), and those from which the PVP is removed by UV light exposure, are investigated for two reactions, the hydrogenation of ethylene and the oxidation of methanol. It is shown that prior to PVP removal the particles are moderately active for both reactions. Following removal, the activity for the two reactions diverges, the ethylene hydrogenation rate increases 10-fold, while the methanol oxidation rate decreases 3-fold. To better understand this effect the capping agent prior to, and the residual carbon remaining after UV treatment are probed by sum frequency generation vibrational spectroscopy. Prior to removal no major differences are observed when the particles are exposed to alternating H2 and O2 environments. When the PVP is removed, carbonaceous fragments remain on the surface that dynamically restructure in H2 and O2. These fragments create a tightly bound shell in an oxygen environment and a porous coating of hydrogenated carbon in the hydrogen environment. Reaction rate measurements of thermally cleaned PVP and oleic acid capped particles show this effect to be independent of cleaning method or capping agent. In all this demonstrates the ability of the capping agent to mediate nanoparticle catalysis

  8. Detection and generation of first sound in4He by vibrating superleak transducers

    Science.gov (United States)

    Giordano, N.; Edison, N.

    1986-07-01

    Measurement is made of the first-sound generation and detection efficiencies of vibrating superleak transducers (VSTs) operated in superfluid4He. This is accomplished by using an ordinary pressure transducer to generate first sound with a VST as the detector, and by using a pressure transducer to detect the sound generated by a VST. The results are in reasonably good agreement with the current theory of VST operation.

  9. Detection and generation of first sound in 4He by vibrating superleak transducers

    International Nuclear Information System (INIS)

    Giordano, N.; Edison, N.

    1986-01-01

    Measurement is made of the first-sound generation and detection efficiencies of vibrating superleak transducers (VSTs) operated in superfluid 4 He. This is accomplished by using an ordinary pressure transducer to generate first sound with a VST as the detector, and by using a pressure transducer to detect the sound generated by a VST. The results are in reasonably good agreement with the current theory of VST operation

  10. Viscoelasticity of new generation thermoplastic polyurethane vibration isolators

    Science.gov (United States)

    Bek, Marko; Betjes, Joris; von Bernstorff, Bernd-Steffen; Emri, Igor

    2017-12-01

    This paper presents the analysis of pressure dependence of three thermoplastic polyurethane (TPU) materials on vibration isolation. The three TPU Elastollan® materials are 1190A, 1175A, and 1195D. The aim of this investigation was to analyze how much the performance of isolation can be enhanced using patented Dissipative bulk and granular systems technology. The technology uses granular polymeric materials to enhance materials properties (without changing its chemical or molecular composition) by exposing them to "self-pressurization," which shifts material energy absorption maxima toward lower frequencies, to match the excitation frequency of dynamic loading to which a mechanical system is exposed. Relaxation experiments on materials were performed at different isobaric and isothermal states to construct mastercurves, the time-temperature-pressure interrelation was modeled using the Fillers-Moonan-Tschoegl model. Dynamic material functions, related to isolation stiffness and energy absorption, were determined with the Schwarzl approximation. An increase in stiffness and energy absorption at selected hydrostatic pressure, compared to its stiffness and energy absorption at ambient conditions, is represented with κk(p, ω), defining the increase in stiffness and κd(p, ω), defining the increase in energy absorption. The study showed that close to the glassy state, moduli of 1190A and 1195D are about 6-9 times higher compared to 1175A, whereas their properties at ambient conditions are, for all practical purposes, the same. TPU 1190A turns out to be most sensitive to pressure: at 300 MPa its properties are shifted for 5.5 decades, while for 1195D and 1175A this shift is only 3.5 and 1.5 decades, respectively. In conclusion, the stiffness and energy absorption of isolation may be increased with pressure for about 100 times for 1190A and 1195D and for about 10 times for 1175A.

  11. Energy conversion by ‘T-shaped’ cantilever type electromagnetic vibration based micro power generator from low frequency vibration sources

    International Nuclear Information System (INIS)

    Siddique, Abu Raihan Mohammad; Mahmud, Shohel; Van Heyst, Bill

    2017-01-01

    Highlights: • A T-shaped cantilever type electromagnetic vibration based MPG has been described. • The designed EVMPG is useful for low frequency based vibration sources. • Both experimental tests and theoretical analysis have been performed. • The final compact prototype was tested at different conditions of human movements. • The prototype can generate 35.2 mV and 0.22 mW at 7 Hz with 5.6 Ω. - Abstract: The design, development, and analyses of low-frequency vibration based T-shaped cantilever type electromagnetic micro power generators (EVMPGs) are presented in this paper. Four different configurations (Configurations A to D) of EVMPGs were designed and fabricated and subsequently characterized using detailed experimental and limited analytical techniques. Configuration A and B consisted of a single and a double cylindrical moving magnets (NdFeB), respectively, while Configuration C consisted of four rectangular moving magnets with respect to a fixed copper coil. In contrast, Configuration D used a moving coil between four rectangular magnets with a back-iron bar. The open circuit RMS voltage output was observed to be a maximum from Configuration D (98.2 mV at 6.29 Hz) with a base vibration acceleration of 0.8 m s"−"2. Therefore, Configuration D was selected for further experimental investigations, which included changing the back-iron bar thickness, changing the base acceleration level, and changing the air gap separation between the magnets in order to optimize this configuration. The maximum load RMS voltage and power outputs of Configuration D were 105.4 mV and 1.35 mW at 6.29 Hz for load resistance 8.2 Ω and a base acceleration of 0.8 m s"−"2 with a 4.2 mm back-iron bar when the air gap between the magnets was 20 mm. Finally, a small portable EVMPG prototype was developed based on the Configuration D and was tested at different human movement conditions (i.e., walking, quick walking, and running). The developed EVMPG prototype was capable of

  12. Sum frequency and second harmonic generation from the surface of a liquid microjet

    Energy Technology Data Exchange (ETDEWEB)

    Smolentsev, Nikolay; Chen, Yixing; Roke, Sylvie, E-mail: sylvie.roke@epfl.ch [Laboratory for Fundamental Biophotonics (LBP), Institute of Bioengineering (IBI), School of Engineering STI, École Polytechnique Fédérale de Lausanne EPFL, 1015 Lausanne (Switzerland); Jena, Kailash C. [Laboratory for Fundamental Biophotonics (LBP), Institute of Bioengineering (IBI), School of Engineering STI, École Polytechnique Fédérale de Lausanne EPFL, 1015 Lausanne (Switzerland); Department of Physics, Indian Institute of Technology Ropar, Rupnagar, 140001 (India); Brown, Matthew A. [Laboratory for Surface Science and Technology, Department of Materials, ETH Zürich, CH-8093 Zurich (Switzerland)

    2014-11-14

    The use of a liquid microjet as a possible source of interest for Second Harmonic Generation (SHG) and Sum Frequency Generation (SFG) spectroscopy is examined. We measured non-resonant SHG scattering patterns from the air/water interface of a microjet of pure water and observe a strong enhancement of the SHG signal for certain scattering angles. These enhancements can be explained by the optical properties and the shape of the liquid microjet. SFG experiments at the surface of a liquid microjet of ethanol in air show that it is also possible to measure the coherent vibrational SFG spectrum of the ethanol/air interface in this way. Our findings are useful for future far-UV or X-ray based nonlinear optical surface experiments on liquid jets. In addition, combined X-ray photoelectron spectroscopy and SHG/SFG measurements are feasible, which will be very useful in improving our understanding of the molecular foundations of electrostatic and chemical surface properties and phenomena.

  13. Sum frequency and second harmonic generation from the surface of a liquid microjet

    Science.gov (United States)

    Smolentsev, Nikolay; Chen, Yixing; Jena, Kailash C.; Brown, Matthew A.; Roke, Sylvie

    2014-11-01

    The use of a liquid microjet as a possible source of interest for Second Harmonic Generation (SHG) and Sum Frequency Generation (SFG) spectroscopy is examined. We measured non-resonant SHG scattering patterns from the air/water interface of a microjet of pure water and observe a strong enhancement of the SHG signal for certain scattering angles. These enhancements can be explained by the optical properties and the shape of the liquid microjet. SFG experiments at the surface of a liquid microjet of ethanol in air show that it is also possible to measure the coherent vibrational SFG spectrum of the ethanol/air interface in this way. Our findings are useful for future far-UV or X-ray based nonlinear optical surface experiments on liquid jets. In addition, combined X-ray photoelectron spectroscopy and SHG/SFG measurements are feasible, which will be very useful in improving our understanding of the molecular foundations of electrostatic and chemical surface properties and phenomena.

  14. Sum frequency and second harmonic generation from the surface of a liquid microjet

    International Nuclear Information System (INIS)

    Smolentsev, Nikolay; Chen, Yixing; Roke, Sylvie; Jena, Kailash C.; Brown, Matthew A.

    2014-01-01

    The use of a liquid microjet as a possible source of interest for Second Harmonic Generation (SHG) and Sum Frequency Generation (SFG) spectroscopy is examined. We measured non-resonant SHG scattering patterns from the air/water interface of a microjet of pure water and observe a strong enhancement of the SHG signal for certain scattering angles. These enhancements can be explained by the optical properties and the shape of the liquid microjet. SFG experiments at the surface of a liquid microjet of ethanol in air show that it is also possible to measure the coherent vibrational SFG spectrum of the ethanol/air interface in this way. Our findings are useful for future far-UV or X-ray based nonlinear optical surface experiments on liquid jets. In addition, combined X-ray photoelectron spectroscopy and SHG/SFG measurements are feasible, which will be very useful in improving our understanding of the molecular foundations of electrostatic and chemical surface properties and phenomena

  15. A Novel SFG Structure for C-T Highpass Filters

    DEFF Research Database (Denmark)

    Nielsen, Ivan Riis

    1992-01-01

    This paper presents the design of a sixth order elliptic highpass filter having a passband frequency of 3.0KHz, a passband ripple of 1.0dB and a stopband attenuation of 50dB. The filter is based on a novel integrator based SFG describing a passive prototype filter; this SFG is simulated using...

  16. Self-assembled organic monolayers on gold nanoparticles: A study by sum-frequency generation combined with UV-vis spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Humbert, C. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France) and Laboratoire de Spectroscopie Moleculaire de Surface, University of Namur, 61 Rue de Bruxelles, B-5000 Namur (Belgium)]. E-mail: christophe.humbert@fundp.ac.be; Busson, B. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France); Abid, J.-P. [Ecole Polytechnique Federale de Lausanne, Laboratoire d' Electrochimie Physique et Analytique, CH-1015 Lausanne (Switzerland); Six, C. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France); Girault, H.H. [Ecole Polytechnique Federale de Lausanne, Laboratoire d' Electrochimie Physique et Analytique, CH-1015 Lausanne (Switzerland); Tadjeddine, A. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France)

    2005-05-20

    We use sum-frequency generation spectroscopy (SFG) in the infrared 2800-3000 cm{sup -1} spectral range and UV-vis spectroscopy (transmission) in the 450-650 nm spectral range in order to characterize vibrational and electronic properties of various interfaces composed of organic monolayers adsorbed on gold nanoparticles (AuNPs) with 19 nm average diameter. SFG signal is observed for AuNPs films deposited on glass substrates using the following silane intermediates: 3-(aminopropyl) triethoxysilane and 3-(mercaptopropyl) trimethoxysilane. The density of AuNPs and their aggregates are measured with a scanning electron microscope. For the samples showing a strong well-defined surface plasmon resonance (SPR), we also observe an enhancement of their non-linear optical properties. Furthermore, the SFG measurements show that 1-dodecanethiol films are rather well ordered on specific AuNPs substrates. In this way, the presence of the SFG signal, which comes from both the bulk electronic s-d interband transition and the vibrational states of the adsorbed molecules, depends on a SPR process. This phenomenon is evidenced on the AuNPs by the incident visible beam located at 532 nm, i.e. near the SPR energy maximum of these interfaces. These results open the door to experiments involving macromolecular and biological materials networks deposited on ultrathin metal electrodes in a controlled electrochemical environment.

  17. Self-assembled organic monolayers on gold nanoparticles: A study by sum-frequency generation combined with UV-vis spectroscopy

    International Nuclear Information System (INIS)

    Humbert, C.; Busson, B.; Abid, J.-P.; Six, C.; Girault, H.H.; Tadjeddine, A.

    2005-01-01

    We use sum-frequency generation spectroscopy (SFG) in the infrared 2800-3000 cm -1 spectral range and UV-vis spectroscopy (transmission) in the 450-650 nm spectral range in order to characterize vibrational and electronic properties of various interfaces composed of organic monolayers adsorbed on gold nanoparticles (AuNPs) with 19 nm average diameter. SFG signal is observed for AuNPs films deposited on glass substrates using the following silane intermediates: 3-(aminopropyl) triethoxysilane and 3-(mercaptopropyl) trimethoxysilane. The density of AuNPs and their aggregates are measured with a scanning electron microscope. For the samples showing a strong well-defined surface plasmon resonance (SPR), we also observe an enhancement of their non-linear optical properties. Furthermore, the SFG measurements show that 1-dodecanethiol films are rather well ordered on specific AuNPs substrates. In this way, the presence of the SFG signal, which comes from both the bulk electronic s-d interband transition and the vibrational states of the adsorbed molecules, depends on a SPR process. This phenomenon is evidenced on the AuNPs by the incident visible beam located at 532 nm, i.e. near the SPR energy maximum of these interfaces. These results open the door to experiments involving macromolecular and biological materials networks deposited on ultrathin metal electrodes in a controlled electrochemical environment

  18. Atmospheric pressure reaction cell for operando sum frequency generation spectroscopy of ultrahigh vacuum grown model catalysts

    Science.gov (United States)

    Roiaz, Matteo; Pramhaas, Verena; Li, Xia; Rameshan, Christoph; Rupprechter, Günther

    2018-04-01

    A new custom-designed ultrahigh vacuum (UHV) chamber coupled to a UHV and atmospheric-pressure-compatible spectroscopic and catalytic reaction cell is described, which allows us to perform IR-vis sum frequency generation (SFG) vibrational spectroscopy during catalytic (kinetic) measurements. SFG spectroscopy is an exceptional tool to study vibrational properties of surface adsorbates under operando conditions, close to those of technical catalysis. This versatile setup allows performing surface science, SFG spectroscopy, catalysis, and electrochemical investigations on model systems, including single crystals, thin films, and deposited metal nanoparticles, under well-controlled conditions of gas composition, pressure, temperature, and potential. The UHV chamber enables us to prepare the model catalysts and to analyze their surface structure and composition by low energy electron diffraction and Auger electron spectroscopy, respectively. Thereafter, a sample transfer mechanism moves samples under UHV to the spectroscopic cell, avoiding air exposure. In the catalytic cell, SFG spectroscopy and catalytic tests (reactant/product analysis by mass spectrometry or gas chromatography) are performed simultaneously. A dedicated sample manipulation stage allows the model catalysts to be examined from LN2 temperature to 1273 K, with gaseous reactants in a pressure range from UHV to atmospheric. For post-reaction analysis, the SFG cell is rapidly evacuated and samples are transferred back to the UHV chamber. The capabilities of this new setup are demonstrated by benchmark results of CO adsorption on Pt and Pd(111) single crystal surfaces and of CO adsorption and oxidation on a ZrO2 supported Pt nanoparticle model catalyst grown by atomic layer deposition.

  19. Flow-induced vibration analysis of heat exchanger and steam generator designs

    International Nuclear Information System (INIS)

    Pettigrew, M.J.; Sylvestre, Y.; Campagna, A.O.

    1977-08-01

    Tube and shell heat exchange components such as steam generators, heat exchangers and condensers are essential parts of CANDU nuclear power stations. Excessive flow-induced vibration may cause tube failures by fatigue or more likely by fretting-wear. Such failures may lead to station shutdowns that are very undesirable in terms of lost production. Hence good performance and reliability dictate a thorough flow-induced vibration analysis at the design stage. This paper presents our approach and techniques in this respect. (author)

  20. Vibration and wear prediction for steam generator tubes: Final report

    International Nuclear Information System (INIS)

    Rao, M.S.M.; Gupta, G.D.; Eisinger, F.L.

    1988-06-01

    As part of the overall EPRI program to develop a mechanistic model for tube fretting and wear prediction, Foster Wheeler Development Corporation undertook the responsibility of developing analytical models to predict structural response and wear in a multispan tube. The project objective was to develop the analytical capability to simulate the time-dependent motion of a multispan steam generator tube in the presence of the clearance gaps at each tube baffle or support. The models developed were to simulate nonlinear tube-to-tube support interaction by determining the impact force, the sliding distance, and the resultant tube wear. Other objectives of the project included: validate the models by comparing the analytical results with the EPRI tests done at Combustion Engineering (C-E) on single multispan tubes; test the models for simulating the U-bend region of the steam generator tube, including the antivibration bars; and develop simplified methods to treat the nonlinear dynamic problem of a multispan tube so that computing costs could be minimized. 15 refs., 53 figs., 27 tabs

  1. Two methods for damping torsional vibrations in DFIG-based wind generators using power converters

    Science.gov (United States)

    Zhao, Zuyi; Lu, Yupu; Xie, Da; Yu, Songtao; Wu, Wangping

    2017-01-01

    This paper proposes novel damping control algorithms by using static synchronous compensator (STATCOM) and energy storage system (ESS) to damp torsional vibrations in doubly fed induction generator (DFIG) based wind turbine systems. It first analyses the operating characteristics of STATCOM and ESS for regulating power variations to increase grid voltage stability. Then, new control strategies for STATCOM and ESS are introduced to damp the vibrations. It is followed by illustration of their effectiveness to damp the drive train torsional vibrations of wind turbines, which can be caused by grid disturbances, such as voltage sags and frequency fluctuations. Results suggest that STATCOM is a promising technology to mitigate the torsional vibrations caused by grid voltage sags. By contrast, the ESS connected to the point of common coupling (PCC) of wind turbine systems shows even obvious advantages because of its capability of absorbing/releasing both active and reactive power. It can thus be concluded that STATCOM is useful for stabilizing power system voltage fluctuations, and ESS is more effective both in regulating PCC voltage fluctuations and damping torsional vibrations caused by grid voltage frequency fluctuations.

  2. Improvement of force factor of magnetostrictive vibration power generator for high efficiency

    International Nuclear Information System (INIS)

    Kita, Shota; Ueno, Toshiyuki; Yamada, Sotoshi

    2015-01-01

    We develop high power magnetostrictive vibration power generator for battery-free wireless electronics. The generator is based on a cantilever of parallel beam structure consisting of coil-wound Galfenol and stainless plates with permanent magnet for bias. Oscillating force exerted on the tip bends the cantilever in vibration yields stress variation of Galfenol plate, which causes flux variation and generates voltage on coil due to the law of induction. This generator has advantages over conventional, such as piezoelectric or moving magnet types, in the point of high efficiency, highly robust, and low electrical impedance. Our concern is the improvement of energy conversion efficiency dependent on the dimension. Especially, force factor, the conversion ratio of the electromotive force (voltage) on the tip velocity in vibration, has an important role in energy conversion process. First, the theoretical value of the force factor is formulated and then the validity was verified by experiments, where we compare four types of prototype with parameters of the dimension using 7.0 × 1.5 × 50 mm beams of Galfenol with 1606-turn wound coil. In addition, the energy conversion efficiency of the prototypes depending on load resistance was measured. The most efficient prototype exhibits the maximum instantaneous power of 0.73 W and energy of 4.7 mJ at a free vibration of frequency of 202 Hz in the case of applied force is 25 N. Further, it was found that energy conversion efficiency depends not only on the force factor but also on the damping (mechanical loss) of the vibration

  3. Experimental characterization of cantilever-type piezoelectric generator operating at resonance for vibration energy harvesting

    Energy Technology Data Exchange (ETDEWEB)

    Montanini, Roberto, E-mail: rmontanini@unime.it; Quattrocchi, Antonino, E-mail: aquattrocchi@unime.it [University of Messina, Dept. of Engineering, Contrada di Dio, Messina (Italy)

    2016-06-28

    A cantilever-type resonant piezoelectric generator (RPG) has been designed by gluing a PZT patch working in d{sub 31} mode onto a glass fibre reinforced composite cantilever beam with a discrete mass applied on its free end. The electrical and dynamic behaviour of the RPG prototype has been investigated by carrying out laboratory tests aimed to assess the effect of definite design parameters, specifically the electric resistance load and the excitation frequency. Results showed that an optimum resistance load exists, at which power generation is maximized. Moreover, it has been showed that power generation is strongly influenced by the vibration frequency highlighting that, at resonance, output power can be increased by more than one order of magnitude. Possible applications include inertial resonant harvester for energy recovery from vibrating machines, sea waves or wind flux and self-powering of wireless sensor nodes.

  4. Condition monitoring of steam turbo generators of captive power plant at HWP (Manuguru) through vibration analysis

    International Nuclear Information System (INIS)

    Krishnareddy, G.; Chandramouli, M.; Gupta, R.V.

    2002-01-01

    Turbo Generator is a critical equipment in steam based power plant circuit. Any failure causes loss of production and hence as applicable to Heavy Water Plant, Manuguru, it results in loss of heavy water production as the captive power plant at Manuguru is solely designed to supply steam and power to Main Plant, which is meant for production of heavy water. Thereby condition monitoring is very much essential and required as part of predictive maintenance program for the turbo generators which are in continuous operation. This paper focuses on identification of the turbo generator system through vibration spectrum, characterising and differentiating the fault mechanisms, trending the faults through changes in vibration spectrums and orbit plots and subsequently planning for corrective actions/measures after evaluating the changes in machine conditions

  5. Anisotropic Formation of Quantum Turbulence Generated by a Vibrating Wire in Superfluid {}4{He}

    Science.gov (United States)

    Yano, H.; Ogawa, K.; Chiba, Y.; Obara, K.; Ishikawa, O.

    2017-06-01

    To investigate the formation of quantum turbulence in superfluid {}4{He}, we have studied the emission of vortex rings with a ring size of larger than 38 μm in diameter from turbulence generated by a vibrating wire. The emission rate of vortex rings from a turbulent region remains low until the beginning of high-rate emissions, suggesting that some of the vortex lines produced by the wire combine to form a vortex tangle, until an equilibrium is established between the rate of vortex line combination with the tangle and dissociation. The formation times of equilibrium turbulence are proportional to ɛ ^{-1.2} and ɛ ^{-0.6} in the directions perpendicular and parallel to the vibrating direction of the generator, respectively, indicating the anisotropic formation of turbulence. Here, ɛ is the generation power of the turbulence. This power dependence may be associated with the characteristics of quantum turbulence with a constant energy flux.

  6. Membrane interaction of antimicrobial peptides using E. coli lipid extract as model bacterial cell membranes and SFG spectroscopy.

    Science.gov (United States)

    Soblosky, Lauren; Ramamoorthy, Ayyalusamy; Chen, Zhan

    2015-04-01

    Supported lipid bilayers are used as a convenient model cell membrane system to study biologically important molecule-lipid interactions in situ. However, the lipid bilayer models are often simple and the acquired results with these models may not provide all pertinent information related to a real cell membrane. In this work, we use sum frequency generation (SFG) vibrational spectroscopy to study molecular-level interactions between the antimicrobial peptides (AMPs) MSI-594, ovispirin-1 G18, magainin 2 and a simple 1,2-dipalmitoyl-d62-sn-glycero-3-phosphoglycerol (dDPPG)/1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) bilayer. We compared such interactions to those between the AMPs and a more complex dDPPG/Escherichia coli (E. coli) polar lipid extract bilayer. We show that to fully understand more complex aspects of peptide-bilayer interaction, such as interaction kinetics, a heterogeneous lipid composition is required, such as the E. coli polar lipid extract. The discrepancy in peptide-bilayer interaction is likely due in part to the difference in bilayer charge between the two systems since highly negative charged lipids can promote more favorable electrostatic interactions between the peptide and lipid bilayer. Results presented in this paper indicate that more complex model bilayers are needed to accurately analyze peptide-cell membrane interactions and demonstrates the importance of using an appropriate lipid composition to study AMP interaction properties. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Effect of material constants on power output in piezoelectric vibration-based generators.

    Science.gov (United States)

    Takeda, Hiroaki; Mihara, Kensuke; Yoshimura, Tomohiro; Hoshina, Takuya; Tsurumi, Takaaki

    2011-09-01

    A possible power output estimation based on material constants in piezoelectric vibration-based generators is proposed. A modified equivalent circuit model of the generator was built and was validated by the measurement results in the generator fabricated using potassium sodium niobate-based and lead zirconate titanate (PZT) ceramics. Subsequently, generators with the same structure using other PZT-based and bismuth-layered structure ferroelectrics ceramics were fabricated and tested. The power outputs of these generators were expressed as a linear functions of the term composed of electromechanical coupling coefficients k(sys)(2) and mechanical quality factors Q*(m) of the generator. The relationship between device constants (k(sys)(2) and Q*(m)) and material constants (k(31)(2) and Q(m)) was clarified. Estimation of the power output using material constants is demonstrated and the appropriate piezoelectric material for the generator is suggested.

  8. Free vibration analysis of a steam generator tube bundle with and without lateral support

    International Nuclear Information System (INIS)

    King, D.M.

    1979-04-01

    The vibrational modes and frequency characteristics of a pressurized water reactor (PWR) steam generator tube bundle assembly with and without lateral support in a fluid environment are analyzed. The idealized half-model was constructed using the SAP-IV finite element code. Free vibration analyses were performed for an in-air case and a submerged in-water case, each with different constraint conditions at steam generator tube bundle assembly support plates 10 and 11. These constraint conditions included having both support plates free, having both support plates fixed, and having support plate 11 free while support plate 10 was fixed. It was found that as the support plate constraints were removed, the frequency range for each case increased significantly

  9. Distributed optical fiber vibration sensing using phase-generated carrier demodulation algorithm

    Science.gov (United States)

    Yu, Zhihua; Zhang, Qi; Zhang, Mingyu; Dai, Haolong; Zhang, Jingjing; Liu, Li; Zhang, Lijun; Jin, Xing; Wang, Gaifang; Qi, Guang

    2018-05-01

    A novel optical fiber-distributed vibration-sensing system is proposed, which is based on self-interference of Rayleigh backscattering with phase-generated carrier (PGC) demodulation algorithm. Pulsed lights are sent into the sensing fiber and the Rayleigh backscattering light from a certain position along the sensing fiber would interfere through an unbalanced Michelson interferometry to generate the interference light. An improved PGC demodulation algorithm is carried out to recover the phase information of the interference signal, which carries the sensing information. Three vibration events were applied simultaneously to different positions over 2000 m sensing fiber and demodulated correctly. The spatial resolution is 10 m, and the noise level of the Φ-OTDR system we proposed is about 10-3 rad/\\surd {Hz}, and the signal-to-noise ratio is about 30.34 dB.

  10. Lateral Vibration of Hydroelectric Generating Set with Different Supporting Condition of Thrust Pad

    OpenAIRE

    Si, Xiaohui; Lu, Wenxiu; Chu, Fulei

    2011-01-01

    The variations of the supporting condition, which change the stiffness of tilting pad thrust bearing, may alter the dynamic behavior of the rotor system. The effects of supporting condition of thrust pad on the lateral vibration of a hydroelectric generating set are investigated in this paper. The action of a thrust bearing is described as moments acting on the thrust collar, and the tilting stiffness coefficients of thrust bearing are calculated. A model based on typical beam finite element ...

  11. ACO-Initialized Wavelet Neural Network for Vibration Fault Diagnosis of Hydroturbine Generating Unit

    OpenAIRE

    Xiao, Zhihuai; He, Xinying; Fu, Xiangqian; Malik, O. P.

    2015-01-01

    Considering the drawbacks of traditional wavelet neural network, such as low convergence speed and high sensitivity to initial parameters, an ant colony optimization- (ACO-) initialized wavelet neural network is proposed in this paper for vibration fault diagnosis of a hydroturbine generating unit. In this method, parameters of the wavelet neural network are initialized by the ACO algorithm, and then the wavelet neural network is trained by the gradient descent algorithm. Amplitudes of the fr...

  12. Vibration Energy Harvesting on Vehicle Suspension Using Rotary and Linear Electromagnetic Generator

    Directory of Open Access Journals (Sweden)

    Arif Indro Sultoni

    2013-04-01

    Full Text Available In this paper, we discuss comparation of vehicle vibration energy harvesting between rotary and linear electromagnetic generator. We construct the two model of energy harvester mechanism and then analyze both of energy absorbtion and vehicle comfortability. Furthermore, we analyze both of energy absorbtion and vehicle comfortability. Vehicle is modeled as quarter car. Rotarty generator harvests 2.5 x 10-4 Watt. The other hand, linear generator has viscous characteristic and capable to generates 90 Watts with 12 Volt power supply for 0.03 m amplitude of bumpy road input. Linear generator reduces oscillation with 1.2 sec settling time. It is more comfort than the angular which has 3 sec in settling time. With unnevenees road input, mean power of this generator is 64 Watt.

  13. Scenario Focus Group Workshop Report (2nd SFG Meeting)

    OpenAIRE

    Water Futures and Solution Initiative, (WFaS)

    2016-01-01

    The Scenario Focus Group (SFG) is comprised of water policy and planning decision makers at the national and international level who collaborate within the Water Futures and Solutions Initiative, primarily by identifying key water management challenges, priorities, trends, options, and trade-offs within their regions and advising on where further systems analysis and investigation would be most helpful for understanding externalities and guiding planning decisions. The SFG guides the developm...

  14. Simultaneous rotational and vibrational CARS generation through a multiple-frequency combination technique

    International Nuclear Information System (INIS)

    Alden, M.; Bengtsson, P.E.; Edner, H.

    1987-01-01

    One most promising laser technique for probing combustion processes is coherent anti-Stokes Raman scattering (CARS), which due to its coherent nature and signal strength is applied in several real-world applications. Until today almost all CARS experiments are based on probing the population of molecular vibrational energy levels. However, there are several reasons rotational CARS, i.e. probing of rotational energy levels, may provide a complement to or even a better choice than vibrational CARS. Recently an alternative way to produce rotational CARS spectra is proposed, which is based on a multiple-frequency combination technique. The energy-level diagram for this process is presented. Two dye laser beams at ω/sub r/, and one fix frequency laser beam at ω/sub g/ are employed. ω/sub r,1/ and ω/sub r,2/ are two frequencies of many possible pairs with a frequency difference matching a rotational transition in a molecule. The excitation induced by ω/sub r,1/ and ω/sub r,2/ is then scattered by the narrowband ω/sub g/ beam resulting in a CARS beam ω/sub g/ at ω/sub g/ + ω/sub r,1/ - ω/sub r,2/. An interesting feature with this technique is that it is possible to generate simultaneously a rotational and vibrational CARS spectrum by using a double-folded boxcars phase matching approach. The authors believe that the proposed technique for producing rotational and vibration CARS spectra could be of interest, e.g., when measuring in highly turbulent flows. In this case the rotational CARS spectra could use for temperature measurements in the cooler parts, whereas vibrational CARS are to be preferred when measuring in the hotter parts

  15. Flow-induced vibration analysis of a helical coil steam generator experiment using large eddy simulation

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, Haomin; Solberg, Jerome; Merzari, Elia; Kraus, Adam; Grindeanu, Iulian

    2017-10-01

    This paper describes a numerical study of flow-induced vibration in a helical coil steam generator experiment conducted at Argonne National Laboratory in the 1980s. In the experiment, a half-scale sector model of a steam generator helical coil tube bank was subjected to still and flowing air and water, and the vibrational characteristics were recorded. The research detailed in this document utilizes the multi-physics simulation toolkit SHARP developed at Argonne National Laboratory, in cooperation with Lawrence Livermore National Laboratory, to simulate the experiment. SHARP uses the spectral element code Nek5000 for fluid dynamics analysis and the finite element code DIABLO for structural analysis. The flow around the coil tubes is modeled in Nek5000 by using a large eddy simulation turbulence model. Transient pressure data on the tube surfaces is sampled and transferred to DIABLO for the structural simulation. The structural response is simulated in DIABLO via an implicit time-marching algorithm and a combination of continuum elements and structural shells. Tube vibration data (acceleration and frequency) are sampled and compared with the experimental data. Currently, only one-way coupling is used, which means that pressure loads from the fluid simulation are transferred to the structural simulation but the resulting structural displacements are not fed back to the fluid simulation

  16. The vibrational behaviour of the generator support structure for Koeberg nuclear power station at high frequencies

    International Nuclear Information System (INIS)

    Lee, D.E.

    1988-06-01

    The vibrational behaviour of the generator support structure at Koeberg nuclear power station at frequencies primarily in the region of 80 Hz to 110 Hz was examined. The effect of soil-structure interaction and the change in stiffness of the foundation soil was investigated. Vibration tests were performed on the generator support structure and the results were compared with a theoretical finite element analysis of the structure. By varying the soil-cement foundation stiffness it was possible to demonstrate the change in dynamic behaviour of the structure in the higher frequency band 80 Hz to 110 Hz. Comment has been made on the design code DIN 4024 in view of the findings of this thesis. It was concluded that the empirical rules regarding the inclusion of the foundation in an analysis specified by the code do not cover all cases and greater cognisance of the effect of the foundation stiffness on the vibration behaviour of such machine foundations is necessary. Obvious machine frequencies higher than the operational frequencies should be analysed where it is considered necessary. 24 refs., 25 tabs., 83 figs

  17. Over-the-road shock and vibration testing of the radioisotope thermoelectric generator transportation system

    International Nuclear Information System (INIS)

    Becker, D.L.

    1997-01-01

    Radioisotope Thermoelectric Generators (RTG) convert heat generated by radioactive decay into electricity through the use of thermocouples. The RTGs have a long operating life, are reasonably lightweight, and require little or no maintenance, which make them particularly attractive for use in spacecraft. However, because RTGs contain significant quantities of radioactive materials, normally plutonium-238 and its decay products, they must be transported in packages built in accordance with Title 10, Code of Federal Regulations, Part 71 (10 CFR 71). To meet these regulations, a RTG Transportation System (RTGTS) that fully complies with 10 CFR 71 has been developed, which protects RTGs from adverse environmental conditions during normal conditions of transport (e.g., shock, vibration, and heat). To ensure the protection of RTGs from shock and vibration loadings during transport, extensive over-the-road testing was conducted on the RTG'S to obtain real-time recordings of accelerations of the air-ride suspension system trailer floor, packaging, and support structure. This paper provides an overview of the RTG'S, a discussion of the shock and vibration testing, and a comparison of the test results to the specified shock response spectra and power spectral density acceleration criteria

  18. Vibrational excitation of hydrogen molecules by two-photon absorption and third-harmonic generation

    Science.gov (United States)

    Miyamoto, Yuki; Hara, Hideaki; Hiraki, Takahiro; Masuda, Takahiko; Sasao, Noboru; Uetake, Satoshi; Yoshimi, Akihiro; Yoshimura, Koji; Yoshimura, Motohiko

    2018-01-01

    We report the coherent excitation of the vibrational state of hydrogen molecules by two-photon absorption and the resultant third-harmonic generation (THG). Parahydrogen molecules cooled by liquid nitrogen are irradiated by mid-infrared nanosecond pulses at 4.8 μm with a nearly Fourier-transform-limited linewidth. The first excited vibrational state of parahydrogen is populated by two-photon absorption of the mid-infrared photons. Because of the narrow linewidth of the mid-infrared pulses, coherence between the ground and excited states is sufficient to induce higher-order processes. Near-infrared photons from the THG are observed at 1.6 μm. The dependence of the intensity of the near-infrared radiation on mid-infrared pulse energy, target pressure, and cell length is determined. We used a simple formula for THG with consideration of realistic experimental conditions to explain the observed results.

  19. Broader energy distribution of CO adsorbed at polycrystalline Pt electrode in comparison with that at Pt(111) electrode in H_2SO_4 solution confirmed by potential dependent IR/visible double resonance sum frequency generation spectroscopy

    International Nuclear Information System (INIS)

    Yang, Shuo; Noguchi, Hidenori; Uosaki, Kohei

    2017-01-01

    Highlights: • Electrochemical SFG spectroscopy is an efficient in situ probe of electronic structure at electrochemical interface. • Electrooxidation performances of CO adsorbed on polycrystalline Pt and Pt(111) electrodes were compared. • The enhanced SFG signal of CO on Pt electrodes was observed due to a vibrational-electronic double resonance effect. • The broader energy distribution of 5sa state of CO on polycrystalline Pt than on Pt(111) is proved by SFG results. - Abstract: Electrochemical cyclic voltammetry and potential dependent double resonance sum frequency generation (DR-SFG) spectroscopy were performed on CO adsorbed on polycrystalline Pt and Pt(111) electrodes in H_2SO_4 solution to examine the effect of substrate on the electronic structure of CO. The dependence of SFG intensity on potential and visible energy for atop CO band was observed on both polycrystalline and single crystalline Pt electrodes. Enhancement of the SFG intensity was determined to be a direct result of a surface electronic resonance of the visible/SF light with the electronic transition from Fermi level of Pt to the 5σ_a anti-bonding state of adsorbed CO, in agreement with previous results. Interestingly, when compared to the Pt(111) electrode, the distribution width of the intensity enhancement region on polycrystalline Pt is broader than on Pt(111). This suggests that the energy distribution of the 5σ_a state of CO on polycrystalline Pt surface is broader than that on Pt(111) due to the complex surface structure of the polycrystalline Pt electrode.

  20. Synthesis and characterization of aromatic self-assembled monolayers containing methylene and ethyleneglycol entities by means of sum-frequency generation spectroscopy

    International Nuclear Information System (INIS)

    Dreesen, L.; Sartenaer, Y.; Peremans, A.; Thiry, P.A.; Humbert, C.; Grugier, J.; Marchand-Brynaert, J.

    2006-01-01

    We use infrared-visible sum-frequency generation (SFG) spectroscopy in order to investigate the adsorption properties on Pt(111) of molecules having CH 3 -C 6 H 4 -(O-CH 2 -CH 2 ) n -O-(CH 2 ) m -SH as general chemical formula. We synthesized three molecules defined by the values m = 5 n = 4, m = 11 n = 4, m = 11 n = 8 and characterized them by Nuclear Magnetic Resonance spectroscopy. Thanks to spectroscopic measurements, we show that these molecules build self-assembled monolayers on Pt(111). First, the weak SFG signals arising from the ad-layer indicate low order and surface coverage of the substrate by these molecules. Next, the vibrational fingerprints of the aforementioned molecules are determined between 2825 and 3125 cm - 1 and the observed SFG spectral features are ascribed on the basis of the analysis of shorter and simpler molecules (1-dodecanethiol, 4-methylbenzenethiol and CH 3 -C 6 H 4 -O-(CH 2 ) 11 -SH) also adsorbed on Pt(111). The occurrence of methylene vibration modes indicates a significant amount of chain defects whatever the n and m numbers are. Finally, the identification of a particular vibration mode, characteristic of the aromatic ring, enables us to qualitatively discuss the effect of the number of methylene and ethylene glycol entities on its orientation. More precisely, higher these numbers, more tilted (with respect to the substrate normal) the aromatic ring plane is

  1. Development of Design Criteria for Fluid Induced Structural Vibrations in Steam Generators and Heat Exchangers

    International Nuclear Information System (INIS)

    Catton, Ivan; Dhir, Vijay K.; Alquaddoomi, O.S.; Mitra, Deepanjan; Adinolfi, Pierangelo

    2004-01-01

    OAK-B135 Flow-induced vibration in heat exchangers has been a major cause of concern in the nuclear industry for several decades. Many incidents of failure of heat exchangers due to apparent flow-induced vibration have been reported through the USNRC incident reporting system. Almost all heat exchangers have to deal with this problem during their operation. The phenomenon has been studied since the 1970s and the database of experimental studies on flow-induced vibration is constantly updated with new findings and improved design criteria for heat exchangers. In the nuclear industry, steam generators are often affected by this problem. However, flow-induced vibration is not limited to nuclear power plants, but to any type of heat exchanger used in many industrial applications such as chemical processing, refrigeration and air conditioning. Specifically, shell and tube type heat exchangers experience flow-induced vibration due to the high velocity flow over the tube banks. Flow-induced vibration in these heat exchangers leads to equipment breakdown and hence expensive repair and process shutdown. The goal of this research is to provide accurate measurements that can help modelers to validate their models using the measured experimental parameters and thereby develop better design criteria for avoiding fluid-elastic instability in heat exchangers. The research is divided between two primary experimental efforts, the first conducted using water alone (single phase) and the second using a mixture of air or steam and water as the working fluid (two phase). The outline of this report is as follows: After the introduction to fluid-elastic instability, the experimental apparatus constructed to conduct the experiments is described in Chapter 2 along with the measurement procedures. Chapter 3 presents results obtained on the tube array and the flow loop, as well as techniques used in data processing. The project performance is described and evaluated in Chapter 4 followed by

  2. Dynamics and Control of Lateral Tower Vibrations in Offshore Wind Turbines by Means of Active Generator Torque

    Directory of Open Access Journals (Sweden)

    Zili Zhang

    2014-11-01

    Full Text Available Lateral tower vibrations of offshore wind turbines are normally lightly damped, and large amplitude vibrations induced by wind and wave loads in this direction may significantly shorten the fatigue life of the tower. This paper proposes the modeling and control of lateral tower vibrations in offshore wind turbines using active generator torque. To implement the active control algorithm, both the mechanical and power electronic aspects have been taken into consideration. A 13-degrees-of-freedom aeroelastic wind turbine model with generator and pitch controllers is derived using the Euler–Lagrangian approach. The model displays important features of wind turbines, such as mixed moving frame and fixed frame-defined degrees-of-freedom, couplings of the tower-blade-drivetrain vibrations, as well as aerodynamic damping present in different modes of motions. The load transfer mechanisms from the drivetrain and the generator to the nacelle are derived, and the interaction between the generator torque and the lateral tower vibration are presented in a generalized manner. A three-dimensional rotational sampled turbulence field is generated and applied to the rotor, and the tower is excited by a first order wave load in the lateral direction. Next, a simple active control algorithm is proposed based on active generator torques with feedback from the measured lateral tower vibrations. A full-scale power converter configuration with a cascaded loop control structure is also introduced to produce the feedback control torque in real time. Numerical simulations have been carried out using data calibrated to the referential 5-MW NREL (National Renewable Energy Laboratory offshore wind turbine. Cases of drivetrains with a gearbox and direct drive to the generator are considered using the same time series for the wave and turbulence loadings. Results show that by using active generator torque control, lateral tower vibrations can be significantly mitigated for

  3. Note: A simple vibrating orifice monodisperse droplet generator using a hard drive actuator arm

    Energy Technology Data Exchange (ETDEWEB)

    Kosch, Sebastian, E-mail: skosch@mie.utoronto.ca, E-mail: ashgriz@mie.utoronto.ca; Ashgriz, Nasser, E-mail: skosch@mie.utoronto.ca, E-mail: ashgriz@mie.utoronto.ca [Department of Industrial and Mechanical Engineering, University of Toronto, Toronto, Ontario M5S 3G8 (Canada)

    2015-04-15

    We propose that the rotary voice coil actuators found in magnetic hard drives are fit to supercede loudspeakers as expedient vibration sources in the laboratory setting. A specific use case is the excitation of a liquid jet to induce controlled breakup into monodisperse droplets. Like loudspeakers, which are typically used for prototyping such devices, hard drive actuators are cheap and ubiquitous, but they are less unwieldy and supply greater amplitudes without producing noise. Frequencies between 0 and 17 kHz, and likely beyond, can be reproduced reliably. No machining tools or amplifying electronics are needed for the construction and operation of the presented droplet generator.

  4. Vibration characteristics of a hydraulic generator unit rotor system with parallel misalignment and rub-impact

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Zhiwei; Zhou, Jianzhong; Yang, Mengqi; Zhang, Yongchuan [Huazhong University of Science and Technology, College of Hydraulic and Digitalization Engineering, Wuhan, Hubei Province (China)

    2011-07-15

    The object of this research aims at the hydraulic generator unit rotor system. According to fault problems of the generator rotor local rubbing caused by the parallel misalignment and mass eccentricity, a dynamic model for the rotor system coupled with misalignment and rub-impact is established. The dynamic behaviors of this system are investigated using numerical integral method, as the parallel misalignment, mass eccentricity and bearing stiffness vary. The nonlinear dynamic responses of the generator rotor and turbine rotor with coupling faults are analyzed by means of bifurcation diagrams, Poincare maps, axis orbits, time histories and amplitude spectrum diagrams. Various nonlinear phenomena in the system, such as periodic, three-periodic and quasi-periodic motions, are studied with the change of the parallel misalignment. The results reveal that vibration characteristics of the rotor system with coupling faults are extremely complex and there are some low frequencies with large amplitude in the 0.3-0.4 x components. As the increase in mass eccentricity, the interval of nonperiodic motions will be continuously moved forward. It suggests that the reduction in mass eccentricity or increase in bearing stiffness could preclude nonlinear vibration. These might provide some important theory references for safety operating and exact identification of the faults in rotating machinery. (orig.)

  5. Pairing vibrational and isospin rotational states in a particle number and isospin projected generator coordinate method

    International Nuclear Information System (INIS)

    Chen, H.T.; Muether, H.; Faessler, A.

    1978-01-01

    Pairing vibrational and isospin rotational states are described in different approximations based on particle number and isospin projected, proton-proton, neutron-neutron and proton-neutron pairing wave functions and on the generator coordinate method (GCM). The investigations are performed in models for which an exact group theoretical solution exists. It turns out that a particle number and isospin projection is essential to yield a good approximation to the ground state or isospin yrast state energies. For strong pairing correlations (pairing force constant equal to the single-particle level distance) isospin cranking (-ωTsub(x)) yields with particle number projected pairing wave function also good agreement with the exact energies. GCM wave functions generated by particle number and isospin projected BCS functions with different amounts of pairing correlations yield for the lowest T=0 and T=2 states energies which are practically indistinguishable from the exact solutions. But even the second and third lowest energies of charge-symmetric states are still very reliable. Thus it is concluded that also in realistic cases isospin rotational and pairing vibrational states may be described in the framework of the GCM method with isospin and particle number projected generating wave functions. (Auth.)

  6. Alkyl chain interaction at the surface of room temperature ionic liquids: systematic variation of alkyl chain length (R = C(1)-C(4), C(8)) in both cation and anion of [RMIM][R-OSO(3)] by sum frequency generation and surface tension.

    Science.gov (United States)

    Santos, Cherry S; Baldelli, Steven

    2009-01-29

    The gas-liquid interface of halide-free 1,3-dialkylimidazolium alkyl sulfates [RMIM][R-OSO(3)] with R chain length from C(1)-C(4) and C(8) has been studied systematically using the surface-specific sum frequency generation (SFG) vibrational spectroscopy and surface tension measurements. From the SFG spectra, vibrational modes from the methyl group of both cation and anion are observed for all ionic liquid samples considered in the present study. These results suggest the presence of both ions at the gas-liquid interface, which is further supported by surface tension measurements. Surface tension data show a decreasing trend as the alkyl chain in the imidazolium cation is varied from methyl to butyl chain, with a specific anion. A similar trend is observed when the alkyl chain of the anion is modified and the cation is fixed.

  7. An advanced tube wear and fatigue workstation to predict flow induced vibrations of steam generator tubes

    International Nuclear Information System (INIS)

    Gay, N.; Baratte, C.; Flesch, B.

    1997-01-01

    Flow induced tube vibration damage is a major concern for designers and operators of nuclear power plant steam generators (SG). The operating flow-induced vibrational behaviour has to be estimated accurately to allow a precise evaluation of the new safety margins in order to optimize the maintenance policy. For this purpose, an industrial 'Tube Wear and Fatigue Workstation', called 'GEVIBUS Workstation' and based on an advanced methodology for predictive analysis of flow-induced vibration of tube bundles subject to cross-flow has been developed at Electricite de France. The GEVIBUS Workstation is an interactive processor linking modules as: thermalhydraulic computation, parametric finite element builder, interface between finite element model, thermalhydraulic code and vibratory response computations, refining modelling of fluid-elastic and random forces, linear and non-linear dynamic response and the coupled fluid-structure system, evaluation of tube damage due to fatigue and wear, graphical outputs. Two practical applications are also presented in the paper; the first simulation refers to an experimental set-up consisting of a straight tube bundle subject to water cross-flow, while the second one deals with an industrial configuration which has been observed in some operating steam generators i.e., top tube support plate degradation. In the first case the GEVIBUS predictions in terms of tube displacement time histories and phase planes have been found in very good agreement with experiment. In the second application the GEVIBUS computation showed that a tube with localized degradation is much more stable than a tube located in an extended degradation zone. Important conclusions are also drawn concerning maintenance. (author)

  8. Difference frequency generation spectroscopy as a vibrational optical activity measurement tool.

    Science.gov (United States)

    Cheon, Sangheon; Cho, Minhaeng

    2009-03-19

    Vibrational optical activity (VOA) of chiral molecules in condensed phases can be studied by using vibrational circular dichroism and Raman optical activity measurement techniques. Recently, IR-vis sum frequency generation has shown to be an alternative VOA measurement method. Such a three-wave-mixing method employing a polarization modulation technique can be a potentially useful VOA measurement tool. Here, a theoretical description of difference frequency generation (DFG) employing circularly polarized visible radiations is presented. Frequency scanning to obtain a VOA-DFG spectrum is achieved by controlling the difference between the two electronically nonresonant incident radiation frequencies. If the two incident beams are linearly polarized and their polarization directions are perpendicular to each other, one can selectively measure the all-electric-dipole-allowed chiral component of the DFG susceptibility. In addition, by using circularly polarized beams and taking the DFG difference intensity signal, which is defined as the difference between left and right circularly polarized DFG signals, additional chiral susceptibility components originating from the electric quadrupole transition can be measured. The DFG as a novel VOA measurement technique for solution samples containing chiral molecules will therefore be a useful coherent spectroscopic tool for determining absolute configuration of chiral molecules in condensed phases.

  9. Optimal linear generator with Halbach array for harvesting of vibration energy during human walking

    Directory of Open Access Journals (Sweden)

    Joonsoo Jun

    2016-05-01

    Full Text Available In IT business, the capacity of the battery in smartphone was drastically improved to digest various functions such as communication, Internet, e-banking, and entertainment. Although the capacity of the battery is improved, it still needs to be upgraded due to customer’s demands. In this article, we optimize the design of the linear generator with the Halbach array to improve the efficiency of harvesting vibration energy during human walking for the battery capacitance. We propose the optimal design of the tubular permanent magnet with the linear generator that uses a Halbach array. The approximate model is established using generic algorithm. Furthermore, we performed electromagnetic finite element analysis to predict the induced voltage.

  10. Adding a dimension to the infrared spectra of interfaces: 2D SFG spectroscopy via mid-IR pulse shaping

    Science.gov (United States)

    Zanni, Martin

    2012-02-01

    Sum-frequency generation spectroscopy provides an infrared spectrum of interfaces and thus has widespread use in the materials and chemical sciences. In this presentation, I will present our recent work in developing a 2D pulse sequence to generate 2D SFG spectra of interfaces, in analogy to 2D infrared spectra used to measure bulk species. To develop this spectroscopy, we have utilized many of the tricks-of-the-trade developed in the 2D IR and 2D Vis communities in the last decade, including mid-IR pulse shaping. With mid-IR pulse shaping, the 2D pulse sequence is manipulated by computer programming in the desired frequency resolution, rotating frame, and signal pathway. We believe that 2D SFG will become an important tool in the interfacial sciences in an analogous way that 2D IR is now being used in many disciplines.

  11. Nonlinear vibrational spectroscopy of surfactants at liquid interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Miranda, Paulo B. [Univ. of California, Berkeley, CA (United States)

    1998-12-14

    Surfactants are widely used to modify physical and chemical properties of interfaces. They play an important role in many technological problems. Surfactant monolayer are also of great scientific interest because they are two-dimensional systems that may exhibit a very rich phase transition behavior and can also be considered as a model system for biological interfaces. In this Thesis, we use a second-order nonlinear optical technique (Sum-Frequency Generation - SFG) to obtain vibrational spectra of surfactant monolayer at Iiquidhapor and solid/liquid interfaces. The technique has several advantages: it is intrinsically surface-specific, can be applied to buried interfaces, has submonolayer sensitivity and is remarkably sensitive to the confirmational order of surfactant monolayers.

  12. A Novel SFG Structure for C-T Highpass Filters

    OpenAIRE

    Nielsen, Ivan Riis

    1992-01-01

    This paper presents the design of a sixth order elliptic highpass filter having a passband frequency of 3.0KHz, a passband ripple of 1.0dB and a stopband attenuation of 50dB. The filter is based on a novel integrator based SFG describing a passive prototype filter; this SFG is simulated using MOSFET-C building blocks. The noise performance is considerably enhanced when compared to other highpass filter structures. Well within the stopband the output noise is dominated by amplifier noise, but ...

  13. Sum-frequency generation from molecular monolayers using 14 μm radiation from the FELIX free-electron laser

    International Nuclear Information System (INIS)

    Van der Ham, E.W.M.; Vrehen, Q.H.F.; Eliel, E.R.

    1995-01-01

    Sum-frequency generation (SFG) has developed into a widely applied tool for study of surfaces and interfaces where molecules are present. It combines the surface specificity of a second-order nonlinear optical technique with the power of a spectroscopic method, and it can be used under widely varying experimental conditions ranging from UHV to electrochemical cells. The important characteristic of SFG is that it allows one to study the average spatial orientation of a molecular bond in a monolayer of molecules at an interface. Until recently SFG measurements were confined to the frequency interval Y μ > 1700 cm -1 because of a lack of suitable laser sources at wave-lengths λ > 6 μm. So for most molecules only a few vibrational modes and thus intramolecular bonds can be studied. We have developed a universal sum-frequency spectrometer around the FELIX free-electron law that covers the complete molecular fingerprint since we can generate any IR wavelength between 2.75 and 110 fμ at the FELIX facility. We have used this setup for a series of exploratory SFG experiments in a frequency range that was hitherto unexplored in the study of molecular monolayers. We have studied thiol monolayers chemisorbed on a variety of noble metals (Au, Ag, Pt) where we focussed on the C-S stretch vibration at ν = 702 cm -1 (λ = 14.3 μm). We have found spectroscopic features revealing the presence of both the trane and gauche conformers of the adsorbed molecules. The present measurements open a whole new wavelength range for nonlinear optical studies of interfaces

  14. Lateral Vibration of Hydroelectric Generating Set with Different Supporting Condition of Thrust Pad

    Directory of Open Access Journals (Sweden)

    Xiaohui Si

    2011-01-01

    Full Text Available The variations of the supporting condition, which change the stiffness of tilting pad thrust bearing, may alter the dynamic behavior of the rotor system. The effects of supporting condition of thrust pad on the lateral vibration of a hydroelectric generating set are investigated in this paper. The action of a thrust bearing is described as moments acting on the thrust collar, and the tilting stiffness coefficients of thrust bearing are calculated. A model based on typical beam finite element method is established to calculate the dynamic response, and the effects of supporting conditions such as elastic oil tank support, different heights of the thrust pads with rigid support are discussed. The results reveal that the influence of thrust bearing is small when the elastic oil tanks work normally. When the supporting conditions turn to be rigid due to the oil leakage, the differences of thrust pad heights have evident influence on the load distribution of the thrust pads; while the effects on the tilting stiffness of the thrust bearing and the amplitude of the lateral shaft vibration is small when the maximum load on thrust pads is smaller than the allowable value.

  15. Predictive analyses of flow-induced vibration and fretting wear in steam generator tubes

    International Nuclear Information System (INIS)

    Axisa, F.

    1989-01-01

    Maintaining the service life of PWR steam generators under highly reliable conditions requires a complex design to prevent various damaging processes, including those related to flow induced vibration. Predictive analyses have to rely on numerical tools to compute the vibratory response of multi-supported tubes in association with experimental data and semi-empirical relationships for quantifying flow-induced excitation mechanisms and tube damaging processes. In the presence of loose supports tube dynamics becomes highly nonlinear in nature. To deal with such problems CEA and FRAMATOME developed a computer program called GERBOISE. This paper provides a short description of an experimental program currently in progress at CEN Saclay to validate the numerical methods implemented in GERBOISE. According to the results obtained so far reasonable agreement is obtained between experiment and numerical simulation, especially as averaged quantities are concerned

  16. Influence of treatment by vibration in residual stress generated in the laser welding of HSLA and IF steels

    International Nuclear Information System (INIS)

    Chuvas, T.C.; Fonseca, M.P. Cindra; Castello, D.A.

    2010-01-01

    The stress relieving treatment by vibration is a new technology under development, which has many advantages over thermal methods. In this work was analyzed the surface residual stress generated in the laser welding of biphasic HSLA and IF steels, both used in the automotive industry. Residual stresses were measured by X-ray diffraction, by the sen 2 Ψ method. Residual stresses generated in the welding of the samples were tensile at all points measured. After welding, the samples were submitted to the mechanical vibration treatment. Some samples presented a significant reduction in the stress values. The welded joints were also characterized by optical microscopy. (author)

  17. CO dissociation and CO hydrogenation on smooth and ion-bombarded Pd(1 1 1): SFG and XPS spectroscopy at mbar pressures

    Science.gov (United States)

    Rupprechter, G.; Kaichev, V. V.; Unterhalt, H.; Morkel, M.; Bukhtiyarov, V. I.

    2004-07-01

    The CO dissociation probability on transition metals is often invoked to explain the product distribution (selectivity) of catalytic CO hydrogenation. Along these lines, we have investigated CO adsorption and dissociation on smooth and ion-bombarded Pd(1 1 1) at pressures up to 1 mbar using vibrational sum frequency generation (SFG) and X-ray photoelectron spectroscopy (XPS). Under high pressure, CO adsorbate structures were observed that were identical to high-coverage structures in UHV. On ion-bombarded surfaces an additional species was detected which was attributed to CO bridge bonded to defect (low-coordinated) sites. On both surfaces, no indications of CO dissociation were found even after hours of 0.1 mbar CO exposure. However, exposing CO/H 2 mixtures to ion-bombarded Pd(1 1 1) produced carbonaceous deposits suggesting CH xO species as precursors for CO bond cleavage and that the formation of CH xO is facilitated by surface defects. The relevance of the observations for CO hydrogenation on Pd catalysts is discussed.

  18. CO dissociation and CO hydrogenation on smooth and ion-bombarded Pd(1 1 1): SFG and XPS spectroscopy at mbar pressures

    Energy Technology Data Exchange (ETDEWEB)

    Rupprechter, G.; Kaichev, V.V.; Unterhalt, H.; Morkel, M.; Bukhtiyarov, V.I

    2004-07-31

    The CO dissociation probability on transition metals is often invoked to explain the product distribution (selectivity) of catalytic CO hydrogenation. Along these lines, we have investigated CO adsorption and dissociation on smooth and ion-bombarded Pd(1 1 1) at pressures up to 1 mbar using vibrational sum frequency generation (SFG) and X-ray photoelectron spectroscopy (XPS). Under high pressure, CO adsorbate structures were observed that were identical to high-coverage structures in UHV. On ion-bombarded surfaces an additional species was detected which was attributed to CO bridge bonded to defect (low-coordinated) sites. On both surfaces, no indications of CO dissociation were found even after hours of 0.1 mbar CO exposure. However, exposing CO/H{sub 2} mixtures to ion-bombarded Pd(1 1 1) produced carbonaceous deposits suggesting CH{sub x}O species as precursors for C---O bond cleavage and that the formation of CH{sub x}O is facilitated by surface defects. The relevance of the observations for CO hydrogenation on Pd catalysts is discussed.

  19. Numerical Research on Hydraulically Generated Vibration and Noise of a Centrifugal Pump Volute with Impeller Outlet Width Variation

    Directory of Open Access Journals (Sweden)

    Houlin Liu

    2014-01-01

    Full Text Available The impeller outlet width of centrifugal pumps is of significant importance for numbers of effects. In the paper, these effects including the performance, pressure pulsations, hydraulically generated vibration, and noise level are investigated. For the purpose, two approaches were used to predict the vibration and sound radiation of the volute under fluid excitation force. One approach is the combined CFD/FEM analysis for structure vibration, and then the structure response obtained from the FEM analysis is treated as the boundary condition for BEM analysis for sound radiation. The other is the combined CFD/FEM/BEM coupling method. Before the numerical methods were used, the simulation results were validated by the vibration acceleration of the monitoring points on the volute. The vibration and noise were analyzed and compared at three flow conditions. The analysis of the results shows that the influences of the sound pressure of centrifugal pumps on the structure appear insignificant. The relative outlet width b2* at nq(SI = 26.7 in this paper should be less than 0.06, based on an overall consideration of the pump characteristics, pressure pulsations, vibration and noise level.

  20. All-optical 40Gbit/s format conversion from NRZ to RZ based on SFG in a PPLN waveguide

    Science.gov (United States)

    Wang, Jian; Sun, Junqiang

    2006-01-01

    A novel all-optical 40Gbit/s NRZ-to-RZ data format conversion scheme based on sum-frequency generation (SFG) interaction in a periodically poled LiNbO 3 (PPLN) waveguide is presented for the first time, using a Mach-Zehnder interferometer (MZI). The conversion mechanism relies on the combination of attenuation and nonlinear phase shift Φ NL induced on the signal field. The performance of the conversion is numerically evaluated, with the result showing that it is more effective to yield Φ NL when appropriately phase mismatched for SFG process but Φ NL~0 when quasi-phase-matching (QPM). Compared with the cascaded second-order nonlinear interactions (SHG+DFG) with the influence of walk-off effect, a high conversion efficiency and good performance are achieved with peak power 500mw and width 2ps of the pump, which can be used in super high-speed situation (40Gbit/s and above). Finally, the inverse process of SFG and corresponding walk-off effect are analyzed and the optimum arrangement of power is proposed, showing that proper power, pump width, and waveguide length are necessary for achieving a satisfied conversion effect.

  1. Influence of water depth on the sound generated by air-bubble vibration in the water musical instrument

    Science.gov (United States)

    Ohuchi, Yoshito; Nakazono, Yoichi

    2014-06-01

    We have developed a water musical instrument that generates sound by the falling of water drops within resonance tubes. The instrument can give people who hear it the healing effect inherent in the sound of water. The sound produced by falling water drops arises from air- bubble vibrations. To investigate the impact of water depth on the air-bubble vibrations, we conducted experiments at varying values of water pressure and nozzle shape. We found that air-bubble vibration frequency does not change at a water depth of 50 mm or greater. Between 35 and 40 mm, however, the frequency decreases. At water depths of 30 mm or below, the air-bubble vibration frequency increases. In our tests, we varied the nozzle diameter from 2 to 4 mm. In addition, we discovered that the time taken for air-bubble vibration to start after the water drops start falling is constant at water depths of 40 mm or greater, but slower at depths below 40 mm.

  2. Operational Safety Assessment of Turbo Generators with Wavelet Rényi Entropy from Sensor-Dependent Vibration Signals

    Directory of Open Access Journals (Sweden)

    Xiaoli Zhang

    2015-04-01

    Full Text Available With the rapid development of sensor technology, various professional sensors are installed on modern machinery to monitor operational processes and assure operational safety, which play an important role in industry and society. In this work a new operational safety assessment approach with wavelet Rényi entropy utilizing sensor-dependent vibration signals is proposed. On the basis of a professional sensor and the corresponding system, sensor-dependent vibration signals are acquired and analyzed by a second generation wavelet package, which reflects time-varying operational characteristic of individual machinery. Derived from the sensor-dependent signals’ wavelet energy distribution over the observed signal frequency range, wavelet Rényi entropy is defined to compute the operational uncertainty of a turbo generator, which is then associated with its operational safety degree. The proposed method is applied in a 50 MW turbo generator, whereupon it is proved to be reasonable and effective for operation and maintenance.

  3. Theoretical vibrational sum-frequency generation spectroscopy of water near lipid and surfactant monolayer interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Roy, S.; Gruenbaum, S. M.; Skinner, J. L. [Theoretical Chemistry Institute and Department of Chemistry, 1101 University Ave., University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States)

    2014-11-14

    Understanding the structure of water near cell membranes is crucial for characterizing water-mediated events such as molecular transport. To obtain structural information of water near a membrane, it is useful to have a surface-selective technique that can probe only interfacial water molecules. One such technique is vibrational sum-frequency generation (VSFG) spectroscopy. As model systems for studying membrane headgroup/water interactions, in this paper we consider lipid and surfactant monolayers on water. We adopt a theoretical approach combining molecular dynamics simulations and phase-sensitive VSFG to investigate water structure near these interfaces. Our simulated spectra are in qualitative agreement with experiments and reveal orientational ordering of interfacial water molecules near cationic, anionic, and zwitterionic interfaces. OH bonds of water molecules point toward an anionic interface leading to a positive VSFG peak, whereas the water hydrogen atoms point away from a cationic interface leading to a negative VSFG peak. Coexistence of these two interfacial water species is observed near interfaces between water and mixtures of cationic and anionic lipids, as indicated by the presence of both negative and positive peaks in their VSFG spectra. In the case of a zwitterionic interface, OH orientation is toward the interface on the average, resulting in a positive VSFG peak.

  4. Design specifications to ensure flow-induced vibration and fretting-wear performance in CANDU steam generators and heat exchangers

    International Nuclear Information System (INIS)

    Janzen, V.P.; Han, Y.; Pettigrew, M.J.

    2009-01-01

    Preventing flow-induced vibration and fretting-wear problems in steam generators and heat exchangers requires design specifications that bring together specific guidelines, analysis methods, requirements and appropriate performance criteria. This paper outlines the steps required to generate and support such design specifications for CANDU nuclear steam generators and heat exchangers, and relates them to typical steam-generator design features and computer modeling capabilities. It also describes current issues that are driving changes to flow-induced vibration and fretting-wear specifications that can be applied to the design process for component refurbishment, replacement or new designs. These issues include recent experimental or field evidence for new excitation mechanisms, e.g., the possibility of in-plane fluidelastic instability of U-tubes, the demand for longer reactor and component lifetimes, the need for better predictions of dynamic properties and vibration response, e.g., two-phase random-turbulence excitation, and requirements to consider system 'excursions' or abnormal scenarios, e.g., a main steam line break in the case of steam generators. The paper describes steps being taken to resolve these issues. (author)

  5. Development of Design Criteria for Fluid Induced Structural Vibrations in Steam Generators and Heat Exchangers

    International Nuclear Information System (INIS)

    Uvan Catton; Dhir, Vijay K.; Deepanjan Mitra; Omar Alquaddoomi; Pierangelo Adinolfi

    2004-01-01

    Flow-induced vibration in heat exchangers has been a major cause of concern in the nuclear industry for several decades. Many incidents of failure of heat exchangers due to apparent flow-induced vibration have been reported through the USNRC incident reporting system. Almost all heat exchangers have to deal with this problem during their operation. The phenomenon has been studied since the 1970s and the database of experimental studies on flow-induced vibration is constantly updated with new findings and improved design criteria for heat exchangers

  6. Study on antilock brake system with elastic membrane vibration generated by controlled solenoid excitation

    International Nuclear Information System (INIS)

    Wibowo,; Zakaria,; Lambang, Lullus; Triyono,; Muhayat, Nurul

    2016-01-01

    The most effective chassis control system for improving vehicle safety during severe braking is anti-lock braking system (ABS). Antilock effect can be gained by vibrate the pad brake at 7 to 20 cycle per second. The aim of this study is to design a new method of antilock braking system with membrane elastic vibrated by solenoid. The influence of the pressure fluctuations of brake fluid is investigated. Vibration data is collected using a small portable accelerometer-slam stick. The experiment results that the vibration of brake pad caused by controlled solenoid excitation at 10 Hz is obtained by our new method. The result of measurements can be altered by varying brake fluid pressure.

  7. Study on antilock brake system with elastic membrane vibration generated by controlled solenoid excitation

    Energy Technology Data Exchange (ETDEWEB)

    Wibowo,, E-mail: wibowo-uns@yahoo.com; Zakaria,, E-mail: zakaaria27@gmail.com; Lambang, Lullus, E-mail: lulus-l@yahoo.com; Triyono,, E-mail: tyon-bila@yahoo.co.id; Muhayat, Nurul, E-mail: nurulmuhayat@ymail.com [Mechanical Engineering Department, Sebelas Maret University, Surakarta 57128 (Indonesia)

    2016-03-29

    The most effective chassis control system for improving vehicle safety during severe braking is anti-lock braking system (ABS). Antilock effect can be gained by vibrate the pad brake at 7 to 20 cycle per second. The aim of this study is to design a new method of antilock braking system with membrane elastic vibrated by solenoid. The influence of the pressure fluctuations of brake fluid is investigated. Vibration data is collected using a small portable accelerometer-slam stick. The experiment results that the vibration of brake pad caused by controlled solenoid excitation at 10 Hz is obtained by our new method. The result of measurements can be altered by varying brake fluid pressure.

  8. Performance of Different Sensors for Monitoring of the Vibration Generated during Thermosonic Non-destructive Testing

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Bu Byoung [Korea Railroad Research Institute, Uiwang (Korea, Republic of)

    2011-04-15

    Vibration monitoring is required for reliable thermosonic testing to decide whether sufficient vibration is achieved in each test for the detection of cracks. From a practical point of view, a cheaper and convenient monitoring method is better for the application to real tests. Therefore, the performance of different sensors for vibration monitoring was investigated and compared in this study to find a convenient and acceptable measurement method for thermosonics. Velocity measured by a laser vibrometer and strain provide an equivalent HI when measured at the same position. The microphone can provide a cheaper vibration monitoring device than the laser and the heating index calculated by a microphone signal shows similar characteristics to that calculated from velocity measured by the laser vibrometer. The microphone frequency response shows that it underestimates high frequency components but it is applicable to practical tests because it gives a conservative value of HI

  9. Application of flow-induced vibration predictive techniques to operating steam generators

    International Nuclear Information System (INIS)

    Sauve, R.G.; Tabatabai, M.; Morandin, G.; Kozluk, M.J.

    1998-01-01

    Analytical techniques for flow-induced vibration (FIV), such as those incorporated in available design tools, are routinely applied to process equipment at the initial design stage. Unfortunately, this does not always apply to the situation when problems, related to FIV, develop in crucial operating equipment, since design uses conservative methods, whereas in-service applications require more realistic assessments. Usually these problems appear in the form of severe through wall fret flaws or fatigue cracks that compromise the integrity of the tubes and possibly the complete unit. It is here where a somewhat different approach must be taken in the evaluation of tube response to FIV. Tube damage from fretting wear or fatigue crack growth must be estimated from actual in situ operating conditions. In this paper, an overview of the predictive methods used in the development and/or qualification of remedial measures for problems that occur in operating process equipment along with applications are described. The steps in the evaluation procedure, from the prediction of flow regimes, the development of the nonlinear computer models and associated fluid forcing functions through to the estimates of tube damage in operating heat exchangers and steam generators are presented. A probabilistic (i.e. Monte Carlo simulation) FIV approach that readily accommodates uncertainties associated with damage predictions is summarized. The efficacy of this approach comes from the fact that probabilistic methods facilitate the incorporation of field data, and that a large number of tubes and possible variations in geometry, process and support conditions, usually present in such equipment, can be addressed effectively. (author)

  10. Experimental modeling of flow-induced vibration of multi-span U-tubes in a CANDU steam generator

    International Nuclear Information System (INIS)

    Mohany, A.; Feenstra, P.; Janzen, V.P.; Richard, R.

    2009-01-01

    Flow-induced vibration of the tubes in a nuclear steam generator is a concern for designers who are trying to increase the life span of these units. The dominant excitation mechanisms are fluidelastic instability and random turbulence excitation. The outermost U-bend region of the tubes is of greatest concern because the flow is almost perpendicular to the tube axis and the unsupported span is relatively long. The support system in this region must be well designed in order to minimize fretting wear of the tubes at the support locations. Much of the previous testing was conducted on straight single-span or cantilevered tubes in cross-flow. However, the dynamic response of steam generator multi-span U-tubes with clearance supports is expected to be different. Accurate modeling of the tube dynamics is important to properly simulate the dynamic interaction of the tube and supports. This paper describes a test program that was developed to measure the dynamic response of a bundle of steam generator U-tubes with Anti-Vibration Bar (AVB) supports, subjected to Freon two-phase cross-flow. The tube bundle has similar geometrical conditions to those expected for future CANDU steam generators. Future steam generators will be larger than previous CANDU steam generators, nearly twice the heat transfer area, with significant changes in process conditions in the U-bend region, such as increased steam quality and a broader range of flow velocities. This test program was initiated at AECL to demonstrate that the tube support design for future CANDU steam generators will meet the stringent requirements associated with a 60 year design life. The main objective of the tests is to address the issue of in-plane and out-of-plane fluidelastic instability and random turbulent excitation of a U-tube bundle with Anti-Vibration Bar (AVB) supports. Details of the test rig, measurement techniques and preliminary instrumentation results are described in the paper. (author)

  11. Coupled-cluster sum-frequency generation nonlinear susceptibilities of methyl (CH3) and methylene (CH2) groups.

    Science.gov (United States)

    Tetsassi Feugmo, Conrard Giresse; Liégeois, Vincent; Champagne, Benoît

    2017-11-15

    The first vibrational sum frequency generation (SFG) spectra based on molecular properties calculated at the coupled cluster singles and doubles (CCSD) level of approximation have been simulated for interfacial model alkyl chains, providing benchmark data for comparisons with approximate methods, including density functional theory (DFT). The approach proceeds in three steps. In the first two steps, the molecular spectral properties are determined: the vibrational normal modes and frequencies and then the derivatives of the dipole moment and of the polarizability with respect to the normal coordinates. These derivatives are evaluated with a numerical differentiation approach, of which the accuracy was monitored using Romberg's procedure. Then, in the last step, a three-layer model is employed to evaluate the macroscopic second-order nonlinear optical responses and thereby the simulated SFG spectra of the alkyl interface. Results emphasize the following facts: (i) the dipole and polarizability derivatives calculated at the DFT level with the B3LYP exchange-correlation functional can differ, with respect to CCSD, by as much as ±10 to 20% and ±20 to 50% for the CH 3 and CH 2 vibrations, respectively; (ii) these differences are enhanced when considering the SFG intensities as well as their variations as a function of the experimental configuration (ppp versus ssp) and as a function of the tilt and rotation angles, defining the orientation of the alkyl chain at the interface; (iii) these differences originate from both the vibrational normal coordinates and the Cartesian derivatives of the dipole moment and polarizability; (iv) freezing the successive fragments of the alkyl chain strongly modifies the SFG spectrum and enables highlighting the delocalization effects between the terminal CH 3 group and its neighboring CH 2 units; and finally (v) going from the free chain to the free methyl model, and further to C 3v constraints on leads to large variations of two ratios

  12. Analysis of flow-induced vibration of heat exchanger and steam generator tube bundles using the AECL computer code PIPEAU-2

    International Nuclear Information System (INIS)

    Gorman, D.J.

    1983-12-01

    PIPEAU-2 is a computer code developed at the Chalk River Nuclear Laboratories for the flow-induced vibration analysis of heat exchanger and steam generator tube bundles. It can perform this analysis for straight and 'U' tubes. All the theoretical work underlying the code is analytical rather than numerical in nature. Highly accurate evaluation of the free vibration frequencies and mode shapes is therefore obtained. Using the latest experimentally determined parameters available, the free vibration analysis is followed by a forced vibration analysis. Tube response due to fluid turbulence and vortex shedding is determined, as well as critical fluid velocity associated with fluid-elastic instability

  13. ENIDINE: Vibration and seismic isolation technologies for power generation station applications

    International Nuclear Information System (INIS)

    Zemanek, T.A.

    1994-01-01

    ENIDINE Inc. is a world leader in the design and manufacture of shock and vibration mounts. Founded in 1966, the company has two manufacturing facilities, employs over 300 people and supports a worldwide network of distributors and representatives. ENIDINE Inc. is part of the ENIDINE Corporate Group which owns a number of companies that design and manufacture Hydraulic/Pneumatic cylinders, Electromechanical devices, Hydraulic Control Valves and a number of Industrial Distribution companies throughout Europe. In total, the ENIDINE Corporate Group has over 900 employees with annual sales of over $100 million. ENIDINE shock and vibration mounts are used to isolate the vibration of missiles from their guidance systems, pumps from hospital operating equipment and off shore oil rigs, from the shock energy of waves in the North Sea. ENIDINE products can be found on all Boeing and McDonnell Douglas aircraft, as well as many electronic and weapons systems on board Navy ships

  14. Experimental studies on flow-induced vibration to support steam generator design

    International Nuclear Information System (INIS)

    Pettigrew, M.J.; Gorman, D.J.

    1977-06-01

    Vibration experiments were done on small tube bundles of triangular and square lattice configurations in both liquid and two-phase (air-water) cross-flow. The effects of flow velocity, simulated steam quality, lattice orientation, tube location and tube frequency were explored. Tube response to random flow turbulence excitation and fluidelastic instability were observed in both liquid and two-phase cross-flow. Fluidelastic instability criteria and random forcing function characterizations are derived from this work. This information may be used in the vibration analysis of shell-and-tube heat exchanger components. (author)

  15. Sum Frequency Generation Vibrational Spectroscopy and Kinetic Study of 2-Methylfuran and 2,5-Dimethylfuran Hydrogenation over 7 nm Platinum Cubic Nanoparticles

    KAUST Repository

    Aliaga, Cesar; Tsung, Chia-Kuang; Alayoglu, Selim; Komvopoulos, Kyriakos; Yang, Peidong; Somorjai, Gabor A.

    2011-01-01

    Sum frequency generation vibrational spectroscopy and kinetic measurements obtained from gas chromatography were used to study the adsorption and hydrogenation of 2-methylfuran (MF) and 2,5-dimethylfuran (DMF) over cubic Pt nanoparticles of 7 nm

  16. Vibration reduction and power generation with piezoceramic sheets mounted to a flexible shaft

    NARCIS (Netherlands)

    Sloetjes, P.J.; de Boer, Andries

    2008-01-01

    A flexible shaft with surface-mounted piezoceramic sheets and strain sensors is considered which suffers from resonance and self-excited vibration. Frequency domain models, time domain simulations, and control experiments are used to analyze active modal damping and active modal balancing methods.

  17. Flow-induced vibration and fretting-wear specifications to ensure steam-generator and heat exchanger lifetime performance

    International Nuclear Information System (INIS)

    Janzen, V.P.; Han, Y.; Pettigrew, M.J.

    2008-01-01

    The current interest in refurbishment, life extension and new-build activity has meant a renewed emphasis on technical specifications that will ensure improved reliability and longer life. Preventing vibration and fretting-wear problems in steam generators and heat exchangers requires design specifications that bring together specific guidelines, analysis methods, requirements and appropriate performance criteria. The specifications must be firmly based on experimental data and field inspections. In addition, the specifications must be supported by theoretical analyses and fundamental scaling correlations, to cover conditions and geometries over the wide range applicable to existing components and probable future designs. The specifications are expected to evolve to meet changing industry requirements. This paper outlines the steps required to generate and support design specifications, and relates them to typical steam-generator design features and computer modeling capabilities. It also describes current issues that are driving changes to flow-induced vibration and fretting-wear specifications that can be applied to the design process for component refurbishment, replacement or new designs. These issues include recent experimental or field evidence for new excitation mechanisms, e.g., the possibility of in-plane fluidelastic instability of U-tubes, the demand for longer reactor and component lifetimes, the need for better predictions of dynamic properties and vibration response, e.g., two-phase random-turbulence excitation, and requirements to consider system 'excursions' or abnormal scenarios, e.g., a main steam line break in the case of steam generators. The paper describes steps being taken to resolve these issues. (author)

  18. Chemical Abundances in SFG and DLA

    OpenAIRE

    Schulte-Ladbeck, Regina E.; König, Brigitte; Cherinka, Brian

    2005-01-01

    We investigate the chemical abundances of local star-forming galaxies which cause Damped Lyman Alpha lines. A metallicity versus redshift diagram is constructed, on which the chemical abundances of low-redshift star-forming galaxy populations are compared with those of high-redshift Damped Lyman Alpha systems. We disucss two types of experiments on individual star-forming galaxies. In the first, the Damped Lyman Alpha line is created against an internal ultraviolet light source generated by a...

  19. Some causes of vibrations recorded by in-service diagnostic systems in steam generators of units 1 and 2 of Dukovany nuclear power plant

    International Nuclear Information System (INIS)

    Sadilek, J.; Matal, O.

    1989-01-01

    A brief description is presented of the design of the steam generators of the first and second units of the Dukovany nuclear power plant. Attention is also given to the feed water systems and the diagnostic systems. The causes are analyzed of the irregularly occurring vibrations in the steam generators in service. It is demonstrated that the source of the vibrations transmitted to the steam generators are the valves in the feeding tract. The vibrations are induced by dynamic forces from the feed water. Reducing the water pressure at the delivery of the electric feed pumps by reducing the size of the rotor, etc., does not remove all vibrations. It is therefore recommended that valves be ins+alled with better regulating characteristics. (Z.M.). 6 figs., 1 tab., 3 refs

  20. Vibrations Generated by Several Nickel-titanium Endodontic File Systems during Canal Shaping in an Ex Vivo Model.

    Science.gov (United States)

    Choi, Dong-Min; Kim, Jin-Woo; Park, Se-Hee; Cho, Kyung-Mo; Kwak, Sang Won; Kim, Hyeon-Cheol

    2017-07-01

    This study aimed to compare the vibration generated by several nickel-titanium (NiTi) file systems and transmitted to teeth under 2 different motions (continuous rotation motion and reciprocating motion). Sixty J-shaped resin blocks (Endo Training Bloc-J; Dentsply Maillefer, Ballaigues, Switzerland) were trimmed to a root-shaped form and divided into 2 groups according to the types of electric motors: WaveOne motor (WOM, Dentsply Maillefer) and X-Smart Plus motor (XSM, Dentsply Maillefer). Each group was further subdivided into 3 subgroups (n = 10 each) according to the designated file systems: ProTaper Next (PTN, Dentsply Maillefer), ProTaper Universal (PTU, Dentsply Maillefer), and WaveOne (WOP, Dentsply Maillefer) systems. Vibration was measured during the pecking motion using an accelerometer attached to a predetermined consistent position. The average vibration values were subjected to 2-way analysis of variance as well as the t test and Duncan test for post hoc comparison at the 95% confidence interval. Both motor types and instrument types produced significantly different ranges of average vibrations. Regardless of the instrument types, the WOM group generated greater vibration than the XSM group (P file system may generate greater vibration than the continuous rotation NiTi file systems. The motor type also has a significant effect to amplify the vibrations. Copyright © 2017 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  1. Vibrations as a contributor to the cracking of PGV-1000 steam generator cold collector

    International Nuclear Information System (INIS)

    Verezemskij, V.G.

    1997-01-01

    The results of multiple investigations of cold collector ruptures at NPPs with WWER-1000 reactor as a complex and multi-parameter process are generalized. It is shown that the temperature of cold collector operation (280-290 deg C) at which environment corrosion effects are maximum has an important role for revealing the factors causing the damage. When the reactor plant operates under stationary and transient conditions the primary coolant circuit equipment, main circulation pipelines and main steam lines become involved into vibrations with different intensities as a result of pressure pulsations at reverse and multiple frequencies of the main circulation pumps connected with formation of standing pressure waves in the primary circuit and steam lines. The analysis made gives an opportunity to conclude that dynamic loads (vibrations) play the leading part in reaching the limits of cold collector metal cyclic strength and its cracking. It means that the measures for cold collector service life increasing should be directed on vibration amplitude lowering and cyclic stress decreasing

  2. Heterogeneous Amyloid β-Sheet Polymorphs Identified on Hydrogen Bond Promoting Surfaces Using 2D SFG Spectroscopy.

    Science.gov (United States)

    Ho, Jia-Jung; Ghosh, Ayanjeet; Zhang, Tianqi O; Zanni, Martin T

    2018-02-08

    Two-dimensional sum-frequency generation spectroscopy (2D SFG) is used to study the structures of the pentapeptide FGAIL on hydrogen bond promoting surfaces. FGAIL is the most amyloidogenic portion of the human islet amyloid polypeptide (hIAPP or amylin). In the presence of a pure gold surface, FGAIL does not form ordered structures. When the gold is coated with a self-assembled monolayer of mercaptobenzoic acid (MBA), 2D SFG spectra reveal features associated with β-sheets. Also observed are cross peaks between the FGAIL peptides and the carboxylic acid groups of the MBA monolayer, indicating that the peptides are in close contact with the surface headgroups. In the second set of samples, FGAIL peptides chemically ligated to the MBA monolayer also exhibited β-sheet features but with a much simpler spectrum. From simulations of the experiments, we conclude that the hydrogen bond promoting surface catalyzes the formation of both parallel and antiparallel β-sheet structures with several different orientations. When ligated, parallel sheets with only a single orientation are the primary structure. Thus, this hydrogen bond promoting surface creates a heterogeneous distribution of polymorph structures, consistent with a concentration effect that allows nucleation of many different amyloid seeding structures. A single well-defined seed favors one polymorph over the others, showing that the concentrating influence of a membrane can be counterbalanced by factors that favor directed fiber growth. These experiments lay the foundation for the measurement and interpretation of β-sheet structures with heterodyne-detected 2D SFG spectroscopy. The results of this model system suggest that a heterogeneous distribution of polymorphs found in nature are an indication of nonselective amyloid aggregation whereas a narrow distribution of polymorph structures is consistent with a specific protein or lipid interaction that directs fiber growth.

  3. Transient responses of SFG spectra of D 2O ice/CO/Pt(1 1 1) interface with irradiation of ultra-short NIR pump pulses

    Science.gov (United States)

    Kubota, Jun; Wada, Akihide; Domen, Kazunari; Kano, Satoru S.

    2002-08-01

    The behavior of D 2O ice on CO/Pt(1 1 1) and Pt(1 1 1) under the irradiation of near-IR pulses (NIR) was studied by sum-frequency generation (SFG) spectroscopy. The peaks assigned to the O-D stretching modes of ice were obtained for the first 30 molecular layers on Pt(1 1 1). When the D2O/ CO/ Pt(1 1 1) was irradiated, the signal of D 2O was weakened after 500 ps, but that of CO was weakened immediately after the pumping. A similar time response was observed for the D 2O peak in D2O/ Pt(1 1 1) . The weakening of SFG is attributed to the broadening of bands due to thermal excitation. This indicates that the energy of the pump pulse is deposited on the Pt(1 1 1) surface and diffused into the layers of D 2O ice in the 500 ps timescale.

  4. Low frequency noise and air vibration generated by a simple cycle gas turbine installation

    Energy Technology Data Exchange (ETDEWEB)

    Giesbrecht, C.; Hertil, S. [ATCO Noise Management, Calgary, AB (Canada)

    2005-07-01

    Low-frequency noise refers to infrasound whose frequency is lower than the minimum human audible frequency of about 20 Hz. Recently, there have been serious complaints on noise pollution in the frequency range of 1-100 Hz. This presentation outlined ASHRAE noise criteria regions and discussed human perceptions to vibration. It also presented methods that ATCO used for measuring noise at a simple gas turbine installation, inside the site at the administration buildings, at the paths of vibration and noise propagation, and at noise sensitive receptors. A 70 dBC at the closes noise-sensitive receptor was used as a noise limit to minimize annoyance. In addition, 96 dBC was measured at 400 feet. It was noted that reducing the C-weighted sound level depends on reducing the stack noise emissions in the 16 and 31.5 band levels. ATCO evaluated silencer designs and recommended reactive silencers to achieve a 10 dB reduction in noise emitted by the 3 exhaust stacks. 6 figs.

  5. Deactivation of Pd particles supported on Nb 2O 5/Cu 3Au(1 0 0): SFG and TPD studies from UHV to 100 mbar

    Science.gov (United States)

    Höbel, Frank; Bandara, Athula; Rupprechter, Günther; Freund, Hans-Joachim

    2006-02-01

    Structural changes that occur on Pd-Nb 2O 5/Cu 3Au(1 0 0) model catalysts upon thermal annealing were followed by sum frequency generation (SFG) and temperature-programmed desorption (TPD) using CO as probe molecule. SFG experiments were performed both under ultrahigh vacuum and mbar pressure. Heating the catalyst to temperatures above 300 K lead to an irreversible 50% decrease in the CO adsorption capacity and modified the remaining adsorption sites. Alterations of the phase between resonant and non-resonant SFG signals upon annealing indicate a change in the electronic structure of the surface, which excludes Pd sintering or migration of Nb 2O 5 over Pd particles to cause the observed effect and rather suggests the formation of "mixed Pd-NbO x" sites. The same changes in surface properties also occur during CO hydrogenation at 1 bar and high temperature, pointing to an involvement of "mixed Pd-NbO x" sites in catalytic reactions.

  6. Conformational order of n-dodecanethiol and n-dodecaneselenol monolayers on polycrystalline copper investigated by PM-IRRAS and SFG spectroscopy

    Science.gov (United States)

    Fonder, G.; Cecchet, F.; Peremans, A.; Thiry, P. A.; Delhalle, J.; Mekhalif, Z.

    2009-08-01

    Self-assembled monolayers (SAMs) of n-dodecanethiol (C 12H 25SH) and n-dodecaneselenol (C 12H 25SeH) on polycrystalline copper have been elaborated with the purpose of achieving densely packed and crystalline-like assemblies. By combining the surface sensitivity of polarization modulation infrared reflection absorption spectroscopy (PM-IRRAS) and sum-frequency generation spectroscopy (SFG), the effect of the self-assembly time (15 min, 30 min, 1 h, 2 h and 24 h) on the formation of n-dodecanethiol and n-dodecaneselenol monolayers on untreated and electrochemically reduced polycrystalline copper has been investigated. On electrochemically reduced copper, PM-IRRAS spectroscopy shows that both molecules are able to form well organized layers. SFG spectroscopy indicates that the C 12H 25SeH SAMs are slightly better ordered than those achieved with C 12H 25SH. On untreated copper, the two molecules lead to different film organizations. Both PM-IRRAS and SFG indicate that C 12H 25SH SAMs are of the same film quality as those obtained on electrochemically reduced copper. On the contrary, C 12H 25SeH monolayers are invariably poorly organized at the molecular level.

  7. A novel SFG structure for C-T high-pass filters

    OpenAIRE

    Nielsen, Ivan Riis

    1993-01-01

    A signal flow graph (SFG) structure for simulating passive high-pass ladder filters, called the incremental integration structure, is proposed. The structure requires the use of integrators with nonintegrating inputs, and an implementation based on the MOSFET-C technique is discussed. The incremental integration structure is compared to the leapfrog and direct SFG simulation structures. Leapfrog high-pass filters are relatively simple and show good noise properties, but they are based on diff...

  8. Seroprevalence of spotted fever group (SFG) rickettsiae infection in domestic ruminants in Khartoum State, Sudan.

    Science.gov (United States)

    Eisawi, Nagwa M; Hassan, Dina A; Hussien, Mohammed O; Musa, Azza B; El Hussein, Abdel Rahim M

    2017-05-01

    Spotted fever group (SFG) rickettsiosis is caused by obligatory intracellular Gram-negative bacteria that belong to the genus Rickettsia . Ticks belonging to the family Ixodidae can act as vectors, reservoirs or amplifiers of SFG rickettsiae. This study was conducted to estimate the seroprevalence of SFG rickettsioses in cattle, sheep and goats from Khartoum State, Sudan. Blood samples were collected from a total of 600 animals (sheep, goats and cattle) from 32 different farms distributed in three locations in Khartoum State during the period January to December 2012. Sera were tested for antibodies against SFG rickettsiae using IFAT. The prevalence of seropositivity was 59.3% in sheep, 60.1% in goats and 64.4% in cattle. Season was significantly ( P <  0.05) associated with seroprevalence of SFG rickettsiae in cattle during winter. The SFG rickettsiae antibodies prevalence was significantly higher in female compared with male in sheep, but there were no significant differences between male and female in either cattle or goats. The prevalence was significantly higher in adult animals compared with young in both sheep and goats. With regard to management system, there was a significant difference in the prevalence in cattle raised in closed system compared with those raised in semi-intensive system. In contrast, there was significant difference in the seroprevalence of SFG in sheep where the prevalence was higher in the sheep raised in semi-intensive system compared with those raised in close system. There was no significant difference in the seroprevalence in goats with regard to management systems. The unexpected high prevalence of SFG rickettsia antibodies in domestic ruminants sera suggest that the veterinary and public health impact of these agents in Sudan need further evaluation especially in humans.

  9. Use of a magnetic force exciter to vibrate a piezocomposite generating element in a small-scale windmill

    International Nuclear Information System (INIS)

    Luong, Hung Truyen; Goo, Nam Seo

    2012-01-01

    A piezocomposite generating element (PCGE) can be used to convert ambient vibrations into electrical energy that can be stored and used to power other devices. This paper introduces a design of a magnetic force exciter for a small-scale windmill that vibrates a PCGE to convert wind energy into electrical energy. A small-scale windmill was designed to be sensitive to low-speed wind in urban regions for the purpose of collecting wind energy. The magnetic force exciter consists of exciting magnets attached to the device’s input rotor and a secondary magnet fixed at the tip of the PCGE. The PCGE is fixed to a clamp that can be adjusted to slide on the windmill’s frame in order to change the gap between exciting and secondary magnets. Under an applied wind force, the input rotor rotates to create a magnetic force interaction that excites the PCGE. The deformation of the PCGE enables it to generate electric power. Experiments were performed with different numbers of exciting magnets and different gaps between the exciting and secondary magnets to determine the optimal configuration for generating the peak voltage and harvesting the maximum wind energy for the same range of wind speeds. In a battery-charging test, the charging time for a 40 mA h battery was approximately 3 h for natural wind in an urban region. The experimental results show that the prototype can harvest energy in urban regions with low wind speeds and convert the wasted wind energy into electricity for city use. (paper)

  10. Generation of interior cavity noise due to window vibration excited by turbulent flows past a generic side-view mirror

    Science.gov (United States)

    Yao, Hua-Dong; Davidson, Lars

    2018-03-01

    We investigate the interior noise caused by turbulent flows past a generic side-view mirror. A rectangular glass window is placed downstream of the mirror. The window vibration is excited by the surface pressure fluctuations and emits the interior noise in a cuboid cavity. The turbulent flows are simulated using a compressible large eddy simulation method. The window vibration and interior noise are predicted with a finite element method. The wavenumber-frequency spectra of the surface pressure fluctuations are analyzed. The spectra are identified with some new features that cannot be explained by the Chase model for turbulent boundary layers. The spectra contain a minor hydrodynamic domain in addition to the hydrodynamic domain caused by the main convection of the turbulent boundary layer. The minor domain results from the local convection of the recirculating flow. These domains are formed in bent elliptic shapes. The spanwise expansion of the wake is found causing the bending. Based on the wavenumber-frequency relationships in the spectra, the surface pressure fluctuations are decomposed into hydrodynamic and acoustic components. The acoustic component is more efficient in the generation of the interior noise than the hydrodynamic component. However, the hydrodynamic component is still dominant at low frequencies below approximately 250 Hz since it has low transmission losses near the hydrodynamic critical frequency of the window. The structural modes of the window determine the low-frequency interior tonal noise. The combination of the mode shapes of the window and cavity greatly affects the magnitude distribution of the interior noise.

  11. Vibrational sum-frequency generation spectroscopy of lipid bilayers at repetition rates up to 100 kHz

    Science.gov (United States)

    Yesudas, Freeda; Mero, Mark; Kneipp, Janina; Heiner, Zsuzsanna

    2018-03-01

    Broadband vibrational sum-frequency generation (BB-VSFG) spectroscopy has become a well-established surface analytical tool capable of identifying the orientation and structure of molecular layers. A straightforward way to boost the sensitivity of the technique could be to increase the laser repetition rate beyond that of standard BB-VSFG spectrometers, which rely on Ti:sapphire lasers operating at repetition rates of 1-5 kHz. Nevertheless, possible thermally induced artifacts in the vibrational spectra due to higher laser average powers are unexplored. Here, we discuss laser power induced temperature accumulation effects that distort the BB-VSFG spectra of 1,2-diacyl-sn-glycero-3-phosphocholine at an interface between two transparent phases at repetition rates of 5, 10, 50, and 100 kHz at constant pulse energy. No heat-induced distortions were found in the spectra, suggesting that the increase in the laser repetition rate provides a feasible route to an improved signal-to-noise ratio or shorter data acquisition times in BB-VSFG spectroscopy for thin films on transparent substrates. The results have implications for future BB-VSFG spectrometers pushing the detection limit for molecular layers with low surface coverage.

  12. A MEMS electret generator with electrostatic levitation for vibration-driven energy-harvesting applications

    International Nuclear Information System (INIS)

    Suzuki, Yuji; Miki, Daigo; Edamoto, Masato; Honzumi, Makoto

    2010-01-01

    In this paper, we propose a passive gap-spacing control method in order to avoid stiction between top and bottom structures in in-plane sensor/actuator/generator applications. A patterned electret using a high-performance perfluoro polymer material is employed to induce a repulsive electrostatic force. An out-of-plane repulsive force is successfully demonstrated with our early prototype, in both air and liquid. By using the present electret-based levitation method to keep the air gap, a MEMS electret generator has been developed for energy-harvesting applications. A dual-phase electrode arrangement is adopted in order to reduce the horizontal electrostatic damping force. With the present prototype, about 0.5 µW is obtained for both phases of the generator, resulting in a total power output of 1.0 µW at an acceleration of 2 g with 63 Hz. With our electromechanical model of the generator, we have confirmed that the model can mimic the response of the generator prototype

  13. A novel SFG structure for C-T high-pass filters

    DEFF Research Database (Denmark)

    Nielsen, Ivan Riis

    1993-01-01

    A signal flow graph (SFG) structure for simulating passive high-pass ladder filters, called the incremental integration structure, is proposed. The structure requires the use of integrators with nonintegrating inputs, and an implementation based on the MOSFET-C technique is discussed. The increme......A signal flow graph (SFG) structure for simulating passive high-pass ladder filters, called the incremental integration structure, is proposed. The structure requires the use of integrators with nonintegrating inputs, and an implementation based on the MOSFET-C technique is discussed....... The incremental integration structure is compared to the leapfrog and direct SFG simulation structures. Leapfrog high-pass filters are relatively simple and show good noise properties, but they are based on differentiators and thus stability problems exist. The direct SFG simulation method is based on integrators...... and has good stability properties, but it leads to a relatively high circuit complexity and a high noise level. However, the incremental integration structure inherits the low-noise properties of the leapfrog structure and the good stability of the direct SFG simulation method. A sixth-order elliptic high...

  14. SFG and AFM Studies of Polymer Surface Monolayers

    Science.gov (United States)

    Somorjai, Gabor A.

    2003-03-01

    Sum frequency generation vibrational spectroscopy and atomic force microscopy techniques were utilized to study the structure and composition of polymer surfaces ranging from polyethylene and polypropylene to copolymers of polyurethane and polystyrene. The surface methyl groups aligned perpendicular to the surface above the glass transition temperature of polypropylene. Large side groups such as the phenyl group on polystyrene is also near the surface normal at the polymer-air interface. At the air interface hydrophobic groups are dominant on the polymer surface while at solid-water interface hydrophilic groups segregate to the surface. Minimizing surface energy is the cause of readjusting the surface composition at polymer-water interfaces as compared to polymer-air interfaces. Upon stretching the soft component of two-component polymer systems segregates to the surface and both the surface structure and the surface composition undergo reversible or irreversible changes depending on the magnitude of the stretch. Since the heart beat forces bio-polymers to stretch over 40 million times a year the molecular behavior due to stretching has important physiological consequences.

  15. Sum-Frequency-Generation-Based Laser Sidebands for Tunable Femtosecond Raman Spectroscopy in the Ultraviolet

    Directory of Open Access Journals (Sweden)

    Liangdong Zhu

    2015-04-01

    Full Text Available Femtosecond stimulated Raman spectroscopy (FSRS is an emerging molecular structural dynamics technique for functional materials characterization typically in the visible to near-IR range. To expand its applications we have developed a versatile FSRS setup in the ultraviolet region. We use the combination of a narrowband, ~400 nm Raman pump from a home-built second harmonic bandwidth compressor and a tunable broadband probe pulse from sum-frequency-generation-based cascaded four-wave mixing (SFG-CFWM laser sidebands in a thin BBO crystal. The ground state Raman spectrum of a laser dye Quinolon 390 in methanol that strongly absorbs at ~355 nm is systematically studied as a standard sample to provide previously unavailable spectroscopic characterization in the vibrational domain. Both the Stokes and anti-Stokes Raman spectra can be collected by selecting different orders of SFG-CFWM sidebands as the probe pulse. The stimulated Raman gain with the 402 nm Raman pump is >21 times larger than that with the 550 nm Raman pump when measured at the 1317 cm−1 peak for the aromatic ring deformation and ring-H rocking mode of the dye molecule, demonstrating that pre-resonance enhancement is effectively achieved in the unique UV-FSRS setup. This added tunability in the versatile and compact optical setup enables FSRS to better capture transient conformational snapshots of photosensitive molecules that absorb in the UV range.

  16. Flow-induced vibration of steam generator helical tubes subjected to external liquid cross flow and internal two-phase flow

    International Nuclear Information System (INIS)

    Jong Chull Jo; Myung Jo Jhung; Woong Sik Kim; Hho Jung Kim

    2005-01-01

    Full text of publication follows: This paper addresses the potential flow-induced vibration problems in a helically-coiled tube steam generator of integral-type nuclear reactor, of which the tubes are subjected to liquid cross flow externally and multi-phase flow externally. The thermal-hydraulic conditions of both tube side and shell side flow fields are predicted using a general purpose computational fluid dynamics code employing the finite volume element modeling. To get the natural frequency and corresponding mode shape of the helical type tubes with various conditions, a finite element analysis code is used. Based on the results of both helical coiled tube steam generator thermal-hydraulic and coiled tube modal analyses, turbulence-induced vibration and fluid-elastic instability analyses are performed. And then the potential for damages on the tubes due to either turbulence-induced vibration or fluid-elastic instability is assessed. In the assessment, special emphases are put on the detailed investigation for the effects of support conditions, coil diameter, and helix pitch on the modal, vibration amplitude and instability characteristics of tubes, from which a technical information and basis needed for designers and regulatory reviewers can be derived. (authors)

  17. Dynamics of optical degradation on LiB{sub 3}O{sub 5}-crystal surfaces during SFG

    Energy Technology Data Exchange (ETDEWEB)

    Moeller, Stefan; Andresen, Aenne; Imlau, Mirco [Department of Physics, University of Osnabrueck (Germany)

    2008-07-01

    We have investigated the phenomenon of optical degradation of LiB{sub 3}O{sub 5} single crystal surfaces during sum-frequency generation (SFG) of UV-light ({lambda}=355 nm) by a focused Q-switched Nd:YAG laser (f=20 kHz, {tau}{sub 1064}=10 ns, anti P{sub 1064}=1.5 W). The investigations were performed on timescales >100 h and UV-intensities below the light induced damage threshold of the crystals. The degradations were studied with optical and analytical methods. As a result we found a steady deposition of foreign material on the output crystal surface in the illuminated area. Here, XPS uncovered several foreign elements as Na,S,Si,Ca, C beside B and O depending on the composition of the ambient atmosphere during SFG. The temporal development of the degradation could be observed by measuring the beam profile behind the crystal. The beam divergence increased as a function of the deposition height, which led to a complex intensity profile in the far-field. Further illuminating lead to a catastrophic break-down of the surface and the beam profile. This is due to thermal damage originating from the UV-absorption of the deposited material. Three models for the deposition process are discussed: a) diffusion out of the LiB{sub 3}O{sub 5}-subsurface, b) deposition of atoms of the ambient atmosphere, c) chemical reactions of LiB{sub 3}O{sub 5}, water, and boric acid.

  18. Prevalence data of Rickettsia slovaca and other SFG Rickettsiae species in Dermacentor marginatus in the southeastern Iberian peninsula.

    Science.gov (United States)

    Márquez, F J; Rojas, A; Ibarra, V; Cantero, A; Rojas, J; Oteo, J A; Muniain, M A

    2006-10-01

    In southern Spain, Dermacentor marginatus ticks can be infected with several genospecies of spotted fever Group (SFG) Rickettsia. We developed a nested polymerase chain reaction assay by using a species-specific probe targeting the ompA gene to detect and differentiate between the two groups of rickettsiae previously described in D. marginatus. SFG rickettsia has been detected in 85.15% of ticks studied (26.7% of positives have been to R. slovaca, the causative agent of TIBOLA-DEBONEL, and 73.3% to SFG rickettsia closely related to strains RpA4-JL-02-DnS14-DnS28).

  19. Influence of bearing pre-load coefficient on shaft vibration and pad temperature in a hydroturbine generator unit. A case study

    Energy Technology Data Exchange (ETDEWEB)

    Feng Fuzhou; Chu Fulei; Guo Dan; Lu Wenxiu [Tsinghua Univ., Beijing, BJ (China). Dept. of Precision Instruments

    2001-07-01

    From data collected by an online condition monitoring and fault diagnosis system, a higher pad temperature at the upper guide bearing in a pumped storage power generator unit installed in Guangdong province(GPSPS), China, was found. And also a relatively intensive shaft vibration occurred at the lower guide bearing. By calculating the Reynolds equation and viscosity-temperature equation of the lubricant, a curve between the pre-load coefficient and the increment of pad temperature is obtained, which shows that the larger, the pre-load coefficient, the bigger, the increment of pad temperature. For a practical unit in GPSPS, by employing Transfer matrix method and Wilson-{theta} method to analyze shaft vibration at different pre-load coefficients of the whole bearing or ''pad pair'' bearings, the results show that the larger the pre-load coefficient is, the smaller the vibration amplitude is, the shorter the time for vibration to become steady is. And an uneven pre-load coefficient of the ''pad pair'' bearings will cause shaft orbit from a circle to an ellipse whose long axes is at the direction of the ''pad pair'' with the lowest pre-load coefficient. Finally, reasons of higher pad temperature of the upper guide bearing and larger shaft vibration at the lower guide bearing are due to the inconsistent relation of bearing assembling clearance or pre-load coefficient of the upper and lower guide bearing, and also due to the too small, uneven pre-load coefficient of ''pad pair'' bearings. After a scheme for adjusting the bearing clearance is given, data measured show that the analysis and simulation methods are correct and the adjustment scheme to the assembling clearance of the upper and lower guide bearings is feasible and can be used to guide the field maintenance conveniently. (orig.)

  20. A Multi-technique Characterization of Adsorbed Protein Films: Orientation and Structure by ToF-SIMS, NEXAFS, SFG, and XPS

    Science.gov (United States)

    Baio, Joseph E.

    There are many techniques that allow surface scientists to study interfaces. However, few are routinely applied to probe biological surfaces. The work presented here demonstrates how detailed information about the conformation, orientation, chemical state, and molecular structure of biological molecules immobilized onto a surface can be assessed by electron spectroscopy, mass spectrometry, and nonlinear vibrational spectroscopy techniques. This investigation began with the development of simple model systems (small proteins, and peptides) and evolved into a study of more complex --- real world systems. Initially, two model systems based on the chemical and electrostatic immobilization of a small rigid protein (Protein G B1 domain, 6kDa) were built to develop the capabilities of time-of-flight secondary ion mass spectrometry (ToFSIMS), near edge X-ray absorption fine structure spectroscopy (NEXAFS) and sum frequency generation (SFG) spectroscopy as tools to probe the structure of surface immobilized proteins. X-ray photoelectron spectroscopy (XPS) was used to measure the amount of immobilized protein and ToF-SIMS sampled the amino acid composition of the exposed surface of the protein film. Within the ToF-SIMS spectra, an enrichment of secondary ions from amino acids located at opposite ends of the proteins were used to describe protein orientation. SFG spectral peaks characteristic of ordered alpha-helix and beta-sheet elements were observed for both systems and the phase of the peaks indicated a predominantly upright orientation for both the covalent and electrostatic configurations. Polarization dependence of the NEXAFS signal from the N 1s to pi* transition of the peptide bonds that make up the beta-sheets also indicated protein ordering at the surface. Building upon the Protein G B1 studies, the orientation and structure of a surface immobilized antibody (HuLys Fv: variant of humanized anti-lysozyme variable fragment, 26kDa) was characterized across two

  1. Nonlinear generation of non-acoustic modes by low-frequency sound in a vibrationally relaxing gas

    International Nuclear Information System (INIS)

    Perelomova, A.

    2010-01-01

    Two dynamic equations referring to a weakly nonlinear and weakly dispersive flow of a gas in which molecular vibrational relaxation takes place, are derived. The first one governs an excess temperature associated with the thermal mode, and the second one describes variations in vibrational energy. Both quantities refer to non-wave types of gas motion. These variations are caused by the nonlinear transfer of acoustic energy into thermal mode and internal vibrational degrees of freedom of a relaxing gas. The final dynamic equations are instantaneous; they include a quadratic nonlinear acoustic source, reflecting the nonlinear character of interaction of low-frequency acoustic and non-acoustic motions of the fluid. All types of sound, periodic or aperiodic, may serve as an acoustic source of both phenomena. The low-frequency sound is considered in this study. Some conclusions about temporal behavior of non-acoustic modes caused by periodic and aperiodic sound are made. Under certain conditions, acoustic cooling takes place instead of heating. (author)

  2. A Novel (DDCC-SFG-Based Systematic Design Technique of Active Filters

    Directory of Open Access Journals (Sweden)

    M. Fakhfakh

    2013-09-01

    Full Text Available This paper proposes a novel idea for the synthesis of active filters that is based on the use of signal-flow graph (SFG stamps of differential difference current conveyors (DDCCs. On the basis of an RLC passive network or a filter symbolic transfer function, an equivalent SFG is constructed. DDCCs’ SFGs are identified inside the constructed ‘active’ graph, and thus the equivalent circuit can be easily synthesized. We show that the DDCC and its ‘derivatives’, i.e. differential voltage current conveyors and the conventional current conveyors, are the main basic building blocks in such design. The practicability of the proposed technique is showcased via three application examples. Spice simulations are given to show the viability of the proposed technique.

  3. Geographic variation in risk factors for SFG rickettsial and leptospiral exposure in Colombia.

    Science.gov (United States)

    Padmanabha, Harish; Hidalgo, Marylin; Valbuena, Gustavo; Castaneda, Elizabeth; Galeano, Armando; Puerta, Henry; Cantillo, Cesar; Mantilla, Gilma

    2009-10-01

    In order to characterize the patterns of human exposure to spotted fever group (SFG) rickettsial and leptospiral infection, IgG surveys were conducted on 642 residents of ten different areas of the rural district of Necoclí, Colombia. Areas were selected based on forest cover and human settlement pattern, and individual risk factors were elucidated through multivariate logistic models, controlling for variance clustering within communities. Overall, prevalence of high antibody titers indicating previous exposure to SFG rickettsia and leptospira was 29.2% and 35.6%, respectively, and both were most prevalent in the same peri-urban neighborhood. Forest cover .10% demonstrated the strongest independent association with leptospiral exposure, followed by homes with outdoor storage sheds. Isolated rural housing was the only variable independently associated with SFG rickettsia exposure. Community-level variables significantly modified the effects of individual risk factors. For both pathogens the eldest quartile was less exposed in periurban areas although there was no age effect overall for either. Females living in population settlements were more exposed to SFG rickettsiae but there was no sex association in isolated rural houses. Similarly, in sites with forest cover .10%, individuals working at home had higher leptospira seroprevalence, but place of work was not a risk factor in areas of forest cover ,10%. These data suggest that the patterns of maintenance and/or exposure to leptospira and rickettsia vary across different human created landscapes and settlement patterns. While contrasting risk factors may reflect the unique transmission cycles of each pathogen, the observed patterns of geographic variation suggest that both diseases may respond similarly larger scale human-ecological dynamics.

  4. Power-Generation Characteristics After Vibration and Thermal Stresses of Thermoelectric Unicouples with CoSb3/Ti/Mo(Cu) Interfaces

    Science.gov (United States)

    Bae, Kwang Ho; Choi, Soon-Mok; Kim, Kyung-Hun; Choi, Hyoung-Seuk; Seo, Won-Seon; Kim, Il-Ho; Lee, Soonil; Hwang, Hae Jin

    2015-06-01

    Reliability tests for thermoelectric unicouples were carried out to investigate the adhesion properties of CoSb3/Ti/Mo(Cu) interfaces. The n-type In0.25 Co3.95Ni0.05Sb12 and p-type In0.25Co3FeSb12 bulks were prepared for fabricating a thermoelectric unicouple (one p- n couple) by an induction melting and a spark plasma sintering process. Mo-Cu alloy was selected as an electrode for the unicouples due to its high melting temperature and proper work function value. Many thermoelectric unicouples with the CoSb3/Ti/Mo(Cu) interfaces were fabricated with the proper brazing materials by means of a repeated firing process. Reliability of the unicouples with the interfaces was evaluated by a vibration test and a thermal cycling test. After the thermal cycling and vibration tests, the power-generation characteristics of the unicouples were compared with the unicouples before the tests. Even after the vibration test, electrical power with a power density of 0.5 W/cm2 was generated. The Ti-interlayer is considered as a possible candidate for making a reliable unicouple with high adhesion strength. With the thermal cycling test, the resistance of the unicouple increased and the electrical power from the unicouple decreased. A failure mode by the thermal cycling test was ascribed to a complex effect of micro-cracks originated from the thermal stress and oxidation problem of the thermoelectric materials; that is, a thick oxide layer more than 300 μm was detected after a high-temperature durability test of n-type In0.25Co3.95Ni0.05Sb12 material at 773 K in air for 7 days.

  5. Vibration in car repair work.

    Science.gov (United States)

    Hansson, J E; Eklund, L; Kihlberg, S; Ostergren, C E

    1987-03-01

    The main objective of the study was to find efficient hand tools which caused only minor vibration loading. Vibration measurements were carried out under standardised working conditions. The time during which car body repairers in seven companies were exposed to vibration was determined. Chisel hammers, impact wrenches, sanders and saws were the types of tools which generated the highest vibration accelerations. The average daily exposure at the different garages ranged from 22 to 70 min. The risk of vibration injury is currently rated as high. The difference between the highest and lowest levels of vibration was considerable in most tool categories. Therefore the choice of tool has a major impact on the magnitude of vibration exposure. The importance of choosing the right tools and working methods is discussed and a counselling service on vibration is proposed.

  6. Correlation of molecular conformation with adhesion at AlOx/poly (ethylene terephthalate) interface studied by sum-frequency generation spectroscopy

    International Nuclear Information System (INIS)

    Miyamae, Takayuki; Nozoye, Hisakazu

    2004-01-01

    The interface between AlO x and poly(ethylene terephthalate) has been investigated by sum-frequency generation (SFG). A considerable improvement in adhesion strength was achieved by short time Ar plasma modification. The increase of the adhesion strength shows good correlation with the increase of the SFG peak strength. By depositing AlO x , the increase of SFG intensities and appearance of a new peak are observed, indicating the formation of a C=O···Al bond at the interface. Surface-modification and interfacial adhesion property are discussed

  7. Flow-induced vibration analysis of Three Mile Island Unit-2 once-through steam generator tubes. Volume 1. Final report

    International Nuclear Information System (INIS)

    Johnson, J.R.; Brown, J.C.; Harris, C.E.; McGuinn, E.J.; Simonis, J.C.; Thoren, D.E.

    1981-06-01

    Tube responses to flow-induced vibration were measured in the top two spans and the tenth span in the B once-through steam generator at Three Mile Island, Unit 2. This program evaluated the effects of flow-induced biration of OTSG tubes during steady-state and transient operation. Twenty-three tubes were instrumented with accelerometers and strain gages in tubes located along the open lane, in the bundle, and at the tenth span. Tube displacements, frequencies, dynamic strains, and mode shapes were determined during steady-state and transient operation. Pressure sensors were installed in the OTSG to measure pressure fluctuations and plant parameters, which were recorded for correlation with tube response. Data analysis results indicate that the steady-state tube response increases with increasing reactor power, with the maximum response (12 mils peak to peak at midspan) at the outer perimeter of the generator in the 16th span

  8. Coherent vibrational dynamics

    CERN Document Server

    Lanzani, Guglielmo; De Silvestri, Sandro

    2007-01-01

    Vibrational spectroscopy is a powerful investigation tool for a wide class of materials covering diverse areas in physics, chemistry and biology. The continuous development in the laser field regarding ultrashort pulse generation has led to the possibility of producing light pulses that can follow vibrational motion coupled to the electronic transitions in molecules and solids in real time. Aimed at researchers and graduate students using vibrational spectroscopy, this book provides both introductory chapters as well as more advanced contents reporting on recent progress. It also provides a good starting point for scientists seeking a sound introduction to ultrafast optics and spectroscopic techniques.

  9. Vibration mixer

    Energy Technology Data Exchange (ETDEWEB)

    Alekhin, S.A.; Chernov, V.S.; Denisenko, V.V.; Gorodnyanskiy, I.F.; Prokopov, L.I.; Tikhonov, Yu.P.

    1983-01-01

    The vibration mixer is proposed which contains a housing, vibration drive with rod installed in the upper part of the mixing mechanism made in the form of a hollow shaft with blades. In order to improve intensity of mixing and dispersion of the mud, the shaft with the blades is arranged on the rod of the vibrator and is equipped with a cam coupling whose drive disc is attached to the vibration rod. The rod is made helical, while the drive disc of the cam coupling is attached to the helical surface of the rod. In addition, the vibration mixer is equipped with perforated discs installed on the ends of the rods.

  10. 2D heterodyne-detected sum frequency generation study on the ultrafast vibrational dynamics of H{sub 2}O and HOD water at charged interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, Ken-ichi; Singh, Prashant C. [Molecular Spectroscopy Laboratory, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Nihonyanagi, Satoshi; Tahara, Tahei, E-mail: tahei@riken.jp [Molecular Spectroscopy Laboratory, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Ultrafast Spectroscopy Research Team, RIKEN Center for Advanced Photonics, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Yamaguchi, Shoichi [Molecular Spectroscopy Laboratory, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Department of Applied Chemistry, Saitama University, 255 Shimo-Okubo, Saitama 338-8570 (Japan)

    2015-06-07

    Two-dimensional heterodyne-detected vibrational sum-frequency generation (2D HD-VSFG) spectroscopy is applied to study the ultrafast vibrational dynamics of water at positively charged aqueous interfaces, and 2D HD-VSFG spectra of cetyltrimethylammonium bromide (CTAB)/water interfaces in the whole hydrogen-bonded OH stretch region (3000 cm{sup −1} ≤ ω{sub pump} ≤ 3600 cm{sup −1}) are measured. 2D HD-VSFG spectrum of the CTAB/isotopically diluted water (HOD-D{sub 2}O) interface exhibits a diagonally elongated bleaching lobe immediately after excitation, which becomes round with a time constant of ∼0.3 ps due to spectral diffusion. In contrast, 2D HD-VSFG spectrum of the CTAB/H{sub 2}O interface at 0.0 ps clearly shows two diagonal peaks and their cross peaks in the bleaching region, corresponding to the double peaks observed at 3230 cm{sup −1} and 3420 cm{sup −1} in the steady-state HD-VSFG spectrum. Horizontal slices of the 2D spectrum show that the relative intensity of the two peaks of the bleaching at the CTAB/H{sub 2}O interface gradually change with the change of the pump frequency. We simulate the pump-frequency dependence of the bleaching feature using a model that takes account of the Fermi resonance and inhomogeneity of the OH stretch vibration, and the simulated spectra reproduce the essential features of the 2D HD-VSFG spectra of the CTAB/H{sub 2}O interface. The present study demonstrates that heterodyne detection of the time-resolved VSFG is critically important for studying the ultrafast dynamics of water interfaces and for unveiling the underlying mechanism.

  11. Total internal reflection sum-frequency generation spectroscopy and dense gold nanoparticles monolayer: a route for probing adsorbed molecules

    International Nuclear Information System (INIS)

    Tourillon, Gerard; Dreesen, Laurent; Volcke, Cedric; Sartenaer, Yannick; Thiry, Paul A; Peremans, Andre

    2007-01-01

    We show that sum-frequency generation spectroscopy performed in the total internal reflection configuration (TIR-SFG) combined with a dense gold nanoparticles monolayer allows us to study, with an excellent signal to noise ratio and high signal to background ratio, the conformation of adsorbed molecules. Dodecanethiol (DDT) was used as probe molecules in order to assess the potentialities of the approach. An enhancement of more than one order of magnitude of the SFG signals arising from the adsorbed species is observed with the TIR geometry compared to the external reflection one while the SFG non-resonant contribution remains the same for both configurations. Although further work is required to fully understand the origin of the SFG process on nanoparticles, our work opens new possibilities for studying nanostructures

  12. Somatic growth of mussels Mytilus edulis in field studies compared to predictions using BEG, DEB, and SFG models

    DEFF Research Database (Denmark)

    Larsen, Poul Scheel; Filgueira, Ramón; Riisgård, Hans Ulrik

    2014-01-01

    Prediction of somatic growth of blue mussels, Mytilus edulis, based on the data from 2 field-growth studies of mussels in suspended net-bags in Danish waters was made by 3 models: the bioenergetic growth (BEG), the dynamic energy budget (DEB), and the scope for growth (SFG). Here, the standard BEG...... at nearly constant environmental conditions with a mean chl a concentration of C=2.7μgL−1, and the observed monotonous growth in the dry weight of soft parts was best predicted by DEB while BEG and SFG models produced lower growth. The second 165-day field study was affected by large variations in chl...... a and temperature, and the observed growth varied accordingly, but nevertheless, DEB and SFG predicted monotonous growth in good agreement with the mean pattern while BEG mimicked the field data in response to observed changes in chl a concentration and temperature. The general features of the models were that DEB...

  13. Sodium ferric gluconate (SFG) in complex with sucrose for IV infusion: bioequivalence of a new generic product with the branded product in healthy volunteers.

    Science.gov (United States)

    Baribeault, David

    2011-08-01

    Parenteral sodium ferric gluconate in complex (Ferrlecit [branded SFG]) is used to treat patients with iron deficiency anemia undergoing chronic hemodialysis and receiving supplemental epoetin. This comparative pharmacokinetic study (GeneraMedix, Inc., Study 17909) evaluates whether the recently approved generic product Nulecit (generic SFG) and the branded product Ferrlecit (branded SFG) are bioequivalent. In this open-label study, 240 healthy volunteers in a fasting state were assigned randomly to a single 10-min intravenous (IV) infusion of 125 mg of generic or branded SFG. Total and transferrin-bound iron concentrations were determined for the 36-h period after infusion and corrected for pretreatment levels. Maximum concentration (Cmax) and area under the concentration-time curve of 0 to 36 h (AUC[0-36]) were compared between the two products. Demonstration of bioequivalence required that the 90% confidence intervals of each parameter evaluated for generic SFG were within 80% to 125% of the corresponding values for branded SFG. Uncorrected and baseline-corrected mean serum concentrations of total serum iron during the 36-h assessment period were similar for generic and branded SFG. For total serum iron, the geometric mean ratios of corrected Cmax and AUC[0-36] were 100%. For transferrin-bound iron, the geometric mean ratios were 87% for corrected Cmax and 92% for corrected AUC[0-36]. All associated 90% confidence intervals were within the range of 80% to 125%. A new generic SFG in complex for IV infusion is bioequivalent to the branded SFG in complex for IV infusion. The generic SFG is AB rated by the FDA and considered therapeutically equivalent to the branded product.

  14. Sum Frequency Generation Vibrational Spectroscopy and Kinetic Study of 2-Methylfuran and 2,5-Dimethylfuran Hydrogenation over 7 nm Platinum Cubic Nanoparticles

    KAUST Repository

    Aliaga, Cesar

    2011-04-28

    Sum frequency generation vibrational spectroscopy and kinetic measurements obtained from gas chromatography were used to study the adsorption and hydrogenation of 2-methylfuran (MF) and 2,5-dimethylfuran (DMF) over cubic Pt nanoparticles of 7 nm average size, synthesized by colloidal methods and cleaned by ultraviolet light and ozone treatment. Reactions carried out at atmospheric pressure in the temperature range of 20-120 °C produced dihydro and tetrahydro species, as well as ring-opening products (alcohols) and ring-cracking products, showing high selectivity toward ring opening throughout the entire temperature range. The aromatic rings (MF and DMF) adsorbed parallel to the nanoparticle surface. Results yield insight into various surface reaction intermediates and the reason for the significantly lower selectivity for ring cracking in DMF hydrogenation compared to MF hydrogenation. © 2011 American Chemical Society.

  15. Time-resolved study of formate on Ni( 1 1 1 ) by picosecond SFG spectroscopy

    Science.gov (United States)

    Kusafuka, K.; Noguchi, H.; Onda, K.; Kubota, J.; Domen, K.; Hirose, C.; Wada, A.

    2002-04-01

    Time-resolved vibrational measurements were carried out on formate (HCOO) adsorbed on Ni(1 1 1) surface by combining the sum-frequency generation method and picosecond laser system (time resolution of 6 ps). Rapid intensity decrease (within the time resolution) followed by intensity recovery (time constant of several tens of ps) of CH stretching signal was observed when picosecond 800 nm pulse was irradiated on the sample surface. From the results of temperature and pump fluence dependences of temporal behaviour of signal intensity, we concluded that the observed intensity change was induced by non-thermal process. Mechanism of the temporal intensity change was discussed.

  16. Vibration damping method and apparatus

    Science.gov (United States)

    Redmond, James M.; Barney, Patrick S.; Parker, Gordon G.; Smith, David A.

    1999-01-01

    The present invention provides vibration damping method and apparatus that can damp vibration in more than one direction without requiring disassembly, that can accommodate varying tool dimensions without requiring re-tuning, and that does not interfere with tool tip operations and cooling. The present invention provides active dampening by generating bending moments internal to a structure such as a boring bar to dampen vibration thereof.

  17. Design of a generator of harmonic vibrations for rotary unbalance; Diseno de un generador de vibraciones armonicas por desbalance rotatorio

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez Vazquez, Ely Edmundo [Grupo de Investigacion Aplicada, Queretaro, Queretaro (Mexico); Silva Navarro, Gerardo [Cinvestav, IPN, Mexico, D.F. (Mexico); Zuniga Osorio, Helen Janeth [CIATEQ, Queretaro, Queretaro (Mexico)

    2007-11-15

    In this paper is presented the experimental development of an integral system for the monitoring and acquisition of involved physical variables in the performance analysis of the turbo-machinery. The integral system has been denominated SMD Turbo (System of Monitoring and Diagnosis for turbo-machinery) and has as fundamental intention to realize the analysis and diagnosis (on the basis of mathematical and graphical tools) of the performance of a machine through the physical measurement of physical variables such as pressure, temperature and vibration. The system is able to realize the analysis of the information in real time and to store it for its later processing of diagnosis by means of specialized software with which the calculations of the performance will be able to be realized. Preliminary results of the proposal are presented that confirm the viability of the proposal. [Spanish] En este trabajo se presenta el desarrollo experimental de un sistema integral para el monitoreo y adquisicion de variables fisicas involucradas en el analisis del rendimiento de la turbomaquinaria. El sistema integral se ha denominado SMD Turbo (Sistema de Monitoreo y Diagnostico para trubomaquinaria) y tiene como proposito fundamental realizar el analisis y diagnostico (en base a herramientas matematicas y graficas) del rendimiento de la turbo maquina a traves de la medicion de variable fisicas como por ejemplo, presion, temperatura y vibracion. El sistema es capaz de realizar el analisis de la informacion en tiempo real y almacenarla para su posterior proceso de diagnostico mediante un software especializado con el cual se podran realizar los calculos del rendimiento. Se presentan resultados preliminares de la propuesta que confirman la viabilidad de la propuesta.

  18. Experimental demonstration of novel cascaded SFG+DFG wavelength conversion of picosecond pulses in LiNbO 3 waveguides

    Science.gov (United States)

    Wang, Jian; Sun, Junqiang; Luo, Chuanhong

    2006-06-01

    A novel cascaded χ (2) wavelength conversion of picosecond pulses based on sum frequency generation and difference frequency generation (SFG+DFG) is proposed and experimentally demonstrated in LiNbO 3 waveguides. The signal pulse with 40-GHz repetition rate and 1.57-ps pulse width is adopted. First of all, high conversion efficiency about -18.93dB can be achieved with low power level required for both two pump lights, which is greatly enhanced approximately 8dB compared with the conventional cascaded second-order nonlinear interactions (SHG+DFG) with a single and much higher power pump. Secondly, the wavelength of the converted idler wave can be tuned from 1527.4 to 1540.5nm when the signal wavelength is changed from 1561.9 to 1548.4nm, and about 13.1nm converted idler bandwidth is achieved with the conversion efficiency higher than -31dB. Thirdly, two pump wavelengths can be separated as large as 17.3nm. Meanwhile, when one pump wavelength is fixed at 1549.1nm, the other can be tuned within a wide wavelength range about 7.6nm with the conversion efficiency higher than -34dB, which is much larger than that in the SHG+DFG situation. Finally, the temporal waveform of the converted idler pulse is observed with rather clear appearance achieved, and no obvious changes of the pulse shape and width are found compared with its corresponding original injected signal, showing that our proposed scheme exhibits a very good conversion performance.

  19. Results of trial operation of new generation assemblies with improved vibration stability for WWER-440 reactors of V-230 and V-213 plants

    International Nuclear Information System (INIS)

    Vasilchenko, I.; Lushin, V.; Shumeev, A.

    2006-01-01

    The main task in developing a fuel design of new generation for WWER-440 power units (particularly for power units of V-213 type) is to increase the effectiveness of fuel utilization. For this purpose the following design solutions were realized: 1) increase of fuel loading (increase of fuel stack in a fuel rod); 2) optimization of the water-uranium relation (at the cost of some decrease of outside diameter of a fuel rod from 9,1 mm to 9,07 mm and increase of fuel rod pitch in a bundle from 12,2 mm up to 12,3 mm); 3) decrease of harmful absorption of neutrons (due to decrease of hafnium content in zirconium materials from 0,05 % to 0,01 % and decrease of zirconium in transition to thickness of FA casing of ERC assembly - 1,5 mm). The parallel task is to increase vibration stability of fuel assemblies based on the verification and justification of the following technical solutions: 1)improvement of vibration stability due to SG rearrangement along the fuel rod bundle height and increasement of height of the first three grids along the course of coolant flow; 2) decreasement of backlashes in the assembly 'fuel rod - support grid' due to introduction of a new elastic tip of fuel rods; 3) introduction of a stiffening rib under the support grid and attachment of the central tube in the support grid by welding; 4) introduction of special sleeve in the protective grid, which permits to fasten a bundle against radial displacements in its upper part; 5) introduction of slots, located at different height marks of the central tube, permits to exclude distortion and destruction of spacing grids as a result of increase of fuel rod temperature; 6) installation of filters at the inlet. According to design considerations with due regard for statistics of fuel assemblies damage, the filters will be mounted at the working assembly (WA) inlet. In new generation fuel assemblies, the problem of decrease of local flash-up of neutrons in the WA peripheral fuel rods, surrounding the CPS

  20. Ship Vibrations

    DEFF Research Database (Denmark)

    Sørensen, Herman

    1997-01-01

    Methods for calculating natural frequencies for ship hulls and for plates and panels.Evaluation of the risk for inconvenient vibrations on board......Methods for calculating natural frequencies for ship hulls and for plates and panels.Evaluation of the risk for inconvenient vibrations on board...

  1. Single-frequency blue light generation by single-pass sum-frequency generation in a coupled ring cavity tapered laser

    DEFF Research Database (Denmark)

    Jensen, Ole Bjarlin; Petersen, Paul Michael

    2013-01-01

    A generic approach for generation of tunable single frequency light is presented. 340 mW of near diffraction limited, single-frequency, and tunable blue light around 459 nm is generated by sum-frequency generation (SFG) between two tunable tapered diode lasers. One diode laser is operated in a ring...... cavity and another tapered diode laser is single-passed through a nonlinear crystal which is contained in the coupled ring cavity. Using this method, the single-pass conversion efficiency is more than 25%. In contrast to SFG in an external cavity, the system is entirely self-stabilized with no electronic...

  2. Nonlinear vibrational spectroscopy of surfactants at liquid interfaces

    Science.gov (United States)

    Miranda, Paulo Barbeitas

    Surfactants are widely used to modify physical and chemical properties of interfaces. They play an important role in many technological problems. Surfactant monolayers are also of great scientific interest because they are two-dimensional systems that may exhibit a very rich phase transition behavior and can also be considered as a model system for biological interfaces. In this Thesis, we use a second-order nonlinear optical technique (Sum-Frequency Generation - SFG) to obtain vibrational spectra of surfactant monolayers at liquid/vapor and solid/liquid interfaces. The technique has several advantages: it is intrinsically surface-specific, can be applied to buried interfaces, has submonolayer sensitivity and is remarkably sensitive to the conformational order of surfactant monolayers. The first part of the Thesis is concerned with surfactant monolayers at the air/water interface (Langmuir films). Surface crystallization of an alcohol Langmuir film and of liquid alkanes are studied and their phase transition behaviors are found to be of different nature, although driven by similar intermolecular interactions. The effect of crystalline order of Langmuir monolayers on the interfacial water structure is also investigated. It is shown that water forms a well-ordered hydrogen-bonded network underneath an alcohol monolayer, in contrast to a fatty acid monolayer which induces a more disordered structure. In the latter case, ionization of the monolayer becomes more significant with increase of the water pH value, leading to an electric-field-induced ordering of interfacial water molecules. We also show that the orientation and conformation of fairly complicated molecules in a Langmuir monolayer can be completely mapped out using a combination of SFG and second harmonic generation (SHG). For a quantitative analysis of molecular orientation at an interface, local-field corrections must be included. The second part is a study of self-assembled surfactant monolayers at the

  3. Detection of spotted fever group (SFG) rickettsiae in Dermacentor reticulatus (Acari: Ixodidae) in Poland.

    Science.gov (United States)

    Stańczak, Joanna

    2006-05-01

    Dermacentor reticulatus ticks from Poland were investigated by molecular methods for the presence of rickettsiae. During 2003/2004, a total of 285 adult ticks was assayed using primers RpCS.877 and RpCS.1258 derived from the citrate synthase (gltA) gene, and 116 samples (40.7%) were positive for rickettsial DNA. Ten out of these positive samples were further assayed using SLO1F and SLO1R primers derived form the rOmpA-encoding gene to confirm that detected rickettsiae belong to the spotted fever group (SFG). The obtained sequence of a fragment of the gltA gene of Rickettsia sp. isolated from Polish D. reticulatus demonstrated 96-98% similarities to Rickettsia slovaca, Rickettsia sibirica, Rickettsia honei, and other SFG rickettsiae. The nucleotide sequences of the amplified fragments of the ompA gene were 98% homologous to RpA4 Rickettsia sp. reported from ticks collected in territories of the former Soviet Union.

  4. Sum frequency generation for studying plasma-wall interactions

    International Nuclear Information System (INIS)

    Roke, Sylvie

    2010-01-01

    Interaction of a plasma with a surface results in chemical and physical restructuring of the surface as well as the plasma in the vicinity of the surface. Studying such a reorganization of the atoms and molecules in the surface layer requires optical tools that can penetrate the plasma environment. At the same time, surface specificity is required. Sum Frequency Generation (SFG) is an optical method that fulfills these requirements. SFG has been developed into a surface specific probe during the eighties and nineties. Nowadays SFG is routinely applied in the research of complex interfaces. In such experiments, liquid/gas, solid/gas, solid/liquid, or liquid/liquid interfaces are probed, and the chemical surface composition, orientational distribution, order and chirality can be retrieved. An application to investigate plasma-wall interactions is feasible too.

  5. Direct comparison of phase-sensitive vibrational sum frequency generation with maximum entropy method: case study of water.

    Science.gov (United States)

    de Beer, Alex G F; Samson, Jean-Sebastièn; Hua, Wei; Huang, Zishuai; Chen, Xiangke; Allen, Heather C; Roke, Sylvie

    2011-12-14

    We present a direct comparison of phase sensitive sum-frequency generation experiments with phase reconstruction obtained by the maximum entropy method. We show that both methods lead to the same complex spectrum. Furthermore, we discuss the strengths and weaknesses of each of these methods, analyzing possible sources of experimental and analytical errors. A simulation program for maximum entropy phase reconstruction is available at: http://lbp.epfl.ch/. © 2011 American Institute of Physics

  6. The Concept of Limitation of the Vibration Generated by Rail-Vehicles at Railway Stations and Railway Crossings

    Science.gov (United States)

    Adamczyk, Jan; Targosz, Jan

    2011-03-01

    One of the possibilities of limitation of effects of dynamic influence of the rail-vehicles is the application of the complex objects of vibroinsulation when the mass of the vibroinsulating element is significant, and that is the case of the transporting machines and devices, when the geometric dimensions of the elements of vibroinsulation system are similar to the slab, where the process of modelling of the vibroinsulation mechanism as a discrete system, creates extreme hazards. The article presents the concept of limitation of effects of dynamic influence of the rail-vehicles and tram-vehicles, mainly in the railway tracks located at the railway stations, tram-stops and other engineering structures. The digital model was developed for simulation regarding the propagation of the vibration to the environment. The results of simulation were the basis for development of the vibroinsulation system for the rail-tracks located at the engineering structures such as railway stations, viaducts. The second part of the article presents the approach for controlling of the tension as a function of load of the railway crossing, which was modelled as discrete-continous model. The continuous systems consist of two elements, that is of the support made of elastomer and of the tension members with controlled tension depending on the crossing load. Together with development and more popular application of tension member systems in engineering structures, among others in vibroinsulation systems, it is important to include into calculations and experiments the dynamic loads of the tension member with the mass attached to it. In case of complex objects of vibroinsulation when the mass of the vibroinsulator is significant, and that is the case of the transporting machines and devices, when the geometric dimensions of the elements of vibroinsulation system are similar to the slab, where the process of modelling of the vibroinsulation mechanism as a discrete system, creates extreme

  7. Relationship between physiological measurements (SFG -scope for growth-) and the functionality of the digestive gland in Mytilus galloprovincialis.

    Science.gov (United States)

    Albentosa, Marina; Sánchez-Hernández, Miriam; Campillo, Juan Antonio; Moyano, Francisco Javier

    2012-11-01

    The present study was aimed to establish the relationship between the functionality of the digestive gland and physiological rates including SFG (scope for growth) in wild mussels, Mytilus galloprovincilis. The experimental set-up consisted in the evaluation of changes in the morphology of the gland, as well as in the activity of some key digestive enzymes (amylase, laminarinase, cellulase and protease) within a broad range of SFG obtained through manipulation of food ration. The higher SFG values were correlated to an increase in both the size of the digestive gland and the activities of enzymes when expressed in relation to individual. In contrast, no clear relations were observed when the activity of enzymes was expressed in relation to soluble protein, with the exception to amylase. The higher protease activities measured in mussels showing lower SFG may reflect an initial stage of catabolic processes intended to compensate the energy deficit produced by food restriction. The potential use of parameters measured in digestive glands in studies of marine pollution was discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Somatic growth of mussels Mytilus edulis in field studies compared to predictions using BEG, DEB, and SFG models

    Science.gov (United States)

    Larsen, Poul S.; Filgueira, Ramón; Riisgård, Hans Ulrik

    2014-04-01

    Prediction of somatic growth of blue mussels, Mytilus edulis, based on the data from 2 field-growth studies of mussels in suspended net-bags in Danish waters was made by 3 models: the bioenergetic growth (BEG), the dynamic energy budget (DEB), and the scope for growth (SFG). Here, the standard BEG model has been expanded to include the temperature dependence of filtration rate and respiration and an ad hoc modification to ensure a smooth transition to zero ingestion as chlorophyll a (chl a) concentration approaches zero, both guided by published data. The first 21-day field study was conducted at nearly constant environmental conditions with a mean chl a concentration of C = 2.7 μg L- 1, and the observed monotonous growth in the dry weight of soft parts was best predicted by DEB while BEG and SFG models produced lower growth. The second 165-day field study was affected by large variations in chl a and temperature, and the observed growth varied accordingly, but nevertheless, DEB and SFG predicted monotonous growth in good agreement with the mean pattern while BEG mimicked the field data in response to observed changes in chl a concentration and temperature. The general features of the models were that DEB produced the best average predictions, SFG mostly underestimated growth, whereas only BEG was sensitive to variations in chl a concentration and temperature. DEB and SFG models rely on the calibration of the half-saturation coefficient to optimize the food ingestion function term to that of observed growth, and BEG is independent of observed actual growth as its predictions solely rely on the time history of the local chl a concentration and temperature.

  9. Novel active vibration absorber with magnetorheological fluid

    Energy Technology Data Exchange (ETDEWEB)

    Gerlach, T; Ehrlich, J; Boese, H [Fraunhofer-Institut fuer Silicatforschung ISC, Neunerplatz 2, D-97082 Wuerzburg (Germany)], E-mail: thomas.gerlach@isc.fraunhofer.de

    2009-02-01

    Disturbing vibrations diminish the performance of technical high precision devices significantly. In search of a suitable solution for reducing these vibrations, a novel concept of active vibration reduction was developed which exploits the special properties of magnetorheological fluids. In order to evaluate the concept of such an active vibration absorber (AVA) a demonstrator was designed and manufactured. This demonstrator generates a force which counteracts the motion of the vibrating body. Since the counterforce is generated by a centrifugal exciter, the AVA provides the capability to compensate vibrations even in two dimensions. To control the strength of the force transmitted to the vibrating body, the exciter is based on a tunable MR coupling. The AVA was integrated in an appropriate testing device to investigate its performance. The recorded results show a significant reduction of the vibration amplitudes by an order of magnitude.

  10. Urban vibrations

    DEFF Research Database (Denmark)

    Morrison, Ann; Knudsen, L.; Andersen, Hans Jørgen

    2012-01-01

    In   this   paper   we   describe   a   field   study   conducted   with   a   wearable   vibration   belt   where   we   test   to   determine   the   vibration   intensity   sensitivity   ranges   on   a   large   diverse   group   of   participants   with   evenly   distributed  ages  and...

  11. Water Orientation at Ceramide/Water Interfaces Studied by Heterodyne-Detected Vibrational Sum Frequency Generation Spectroscopy and Molecular Dynamics Simulation

    KAUST Repository

    Adhikari, Aniruddha

    2016-10-10

    Lipid/water interaction is essential for many biological processes. The water structure at the nonionic lipid interface remains little known, and there is no scope of a priori prediction of water orientation at nonionic interfaces, either. Here, we report our study combining advanced nonlinear spectroscopy and molecular dynamics simulation on the water orientation at the ceramide/water interface. We measured χ spectrum in the OH stretch region of ceramide/isotopically diluted water interface using heterodyne-detected vibrational sum-frequency generation spectroscopy and found that the interfacial water prefers an overall hydrogen-up orientation. Molecular dynamics simulation indicates that this preferred hydrogen-up orientation of water is determined by a delicate balance between hydrogen-up and hydrogen-down orientation induced by lipid-water and intralipid hydrogen bonds. This mechanism also suggests that water orientation at neutral lipid interfaces depends highly on the chemical structure of the lipid headgroup, in contrast to the charged lipid interfaces where the net water orientation is determined solely by the charge of the lipid headgroup.

  12. Experimental evidence for an optical interference model for vibrational sum frequency generation on multilayer organic thin film systems. I. Electric dipole approximation

    International Nuclear Information System (INIS)

    O’Brien, Daniel B.; Massari, Aaron M.

    2015-01-01

    In the field of vibrational sum frequency generation spectroscopy (VSFG) applied to organic thin film systems, a significant challenge to data analysis is in the accurate description of optical interference effects. Herein, we provide experimental evidence that a model recently developed in our lab provides an accurate description of this phenomenon. We studied the organic small molecule N,N′-dioctyl-3,4,9,10-perylenedicarboximide vapor deposited as a thickness gradient on silicon wafer substrates with two oxide thicknesses and two surface preps. VSFG data were obtained using the ssp and the sps polarization combinations in the imide carbonyl stretching region as a function of organic thickness. In this first of two reports, the data are modeled and interpreted within the ubiquitous electric dipole approximation for VSFG. The intrinsic sample responses are parameterized during the fitting routines while optical interference effects are simply calculated from the model using known refractive indices, thin film thicknesses, and beam angles. The results indicate that the thin film model provides a good description of optical interferences, indicating that interfacial terms are significant. Inconsistencies between the fitting results within the bounds of the electric dipole response motivate deliberation for additional effects to be considered in the second report

  13. Experimental evidence for an optical interference model for vibrational sum frequency generation on multilayer organic thin film systems. I. Electric dipole approximation.

    Science.gov (United States)

    O'Brien, Daniel B; Massari, Aaron M

    2015-01-14

    In the field of vibrational sum frequency generation spectroscopy (VSFG) applied to organic thin film systems, a significant challenge to data analysis is in the accurate description of optical interference effects. Herein, we provide experimental evidence that a model recently developed in our lab provides an accurate description of this phenomenon. We studied the organic small molecule N,N'-dioctyl-3,4,9,10-perylenedicarboximide vapor deposited as a thickness gradient on silicon wafer substrates with two oxide thicknesses and two surface preps. VSFG data were obtained using the ssp and the sps polarization combinations in the imide carbonyl stretching region as a function of organic thickness. In this first of two reports, the data are modeled and interpreted within the ubiquitous electric dipole approximation for VSFG. The intrinsic sample responses are parameterized during the fitting routines while optical interference effects are simply calculated from the model using known refractive indices, thin film thicknesses, and beam angles. The results indicate that the thin film model provides a good description of optical interferences, indicating that interfacial terms are significant. Inconsistencies between the fitting results within the bounds of the electric dipole response motivate deliberation for additional effects to be considered in the second report.

  14. Experimental evidence for an optical interference model for vibrational sum frequency generation on multilayer organic thin film systems. I. Electric dipole approximation

    Energy Technology Data Exchange (ETDEWEB)

    O’Brien, Daniel B.; Massari, Aaron M., E-mail: massari@umn.edu [Department of Chemistry, University of Minnesota—Twin Cities, 207 Pleasant Street SE, Minneapolis, Minnesota 55455 (United States)

    2015-01-14

    In the field of vibrational sum frequency generation spectroscopy (VSFG) applied to organic thin film systems, a significant challenge to data analysis is in the accurate description of optical interference effects. Herein, we provide experimental evidence that a model recently developed in our lab provides an accurate description of this phenomenon. We studied the organic small molecule N,N′-dioctyl-3,4,9,10-perylenedicarboximide vapor deposited as a thickness gradient on silicon wafer substrates with two oxide thicknesses and two surface preps. VSFG data were obtained using the ssp and the sps polarization combinations in the imide carbonyl stretching region as a function of organic thickness. In this first of two reports, the data are modeled and interpreted within the ubiquitous electric dipole approximation for VSFG. The intrinsic sample responses are parameterized during the fitting routines while optical interference effects are simply calculated from the model using known refractive indices, thin film thicknesses, and beam angles. The results indicate that the thin film model provides a good description of optical interferences, indicating that interfacial terms are significant. Inconsistencies between the fitting results within the bounds of the electric dipole response motivate deliberation for additional effects to be considered in the second report.

  15. Laser-heating-induced displacement of surfactants on the water surface

    NARCIS (Netherlands)

    Backus, E.H.G.; Bonn, D.; Cantin, S.; Roke, S.; Bonn, M.

    2012-01-01

    We report a combined vibrational sum-frequency generation (SFG) spectroscopy, Brewster angle microscopy (BAM), and ellipsometry study of different surfactants on water as a function of surfactant density. Vibrational SFG spectra of surfactants on the water surface in a Langmuir trough have been

  16. HOW SFG INCREASE STUDENTS ABILITY TO PRODUCE AND ANALYSE TEXT MEDIA

    Directory of Open Access Journals (Sweden)

    Abd. Ghofur

    2013-05-01

    Full Text Available This article explores the use of Systemic Functional Grammar for students of english language teaching entitled Analysing Media Texts. This is aims at assisting students to produce their own texts and to help them develop an understanding of the linguistic choices they make. Students are introduced to the key principles of CDA and to Halliday’s SFG to provide them with tools to assist them to understand the social and constructed nature of discourses, especially those typically found in media texts. This article focuses on students’ interpretation of media texts, their ability to read with greater understanding and to apply key concepts that they had learnt to their analyses. The students demonstrated clearly that they had developed an understanding of CDA, acquired the basic metalanguage necessary for Hallidayan analysis and some of them could produce much more rigorous textual analyses than before.

  17. Signal displacement in spiral-in acquisitions: simulations and implications for imaging in SFG regions.

    Science.gov (United States)

    Brewer, Kimberly D; Rioux, James A; Klassen, Martyn; Bowen, Chris V; Beyea, Steven D

    2012-07-01

    Susceptibility field gradients (SFGs) cause problems for functional magnetic resonance imaging (fMRI) in regions like the orbital frontal lobes, leading to signal loss and image artifacts (signal displacement and "pile-up"). Pulse sequences with spiral-in k-space trajectories are often used when acquiring fMRI in SFG regions such as inferior/medial temporal cortex because it is believed that they have improved signal recovery and decreased signal displacement properties. Previously postulated theories explain differing reasons why spiral-in appears to perform better than spiral-out; however it is clear that multiple mechanisms are occurring in parallel. This study explores differences in spiral-in and spiral-out images using human and phantom empirical data, as well as simulations consistent with the phantom model. Using image simulations, the displacement of signal was characterized using point spread functions (PSFs) and target maps, the latter of which are conceptually inverse PSFs describing which spatial locations contribute signal to a particular voxel. The magnitude of both PSFs and target maps was found to be identical for spiral-out and spiral-in acquisitions, with signal in target maps being displaced from distant regions in both cases. However, differences in the phase of the signal displacement patterns that consequently lead to changes in the intervoxel phase coherence were found to be a significant mechanism explaining differences between the spiral sequences. The results demonstrate that spiral-in trajectories do preserve more total signal in SFG regions than spiral-out; however, spiral-in does not in fact exhibit decreased signal displacement. Given that this signal can be displaced by significant distances, its recovery may not be preferable for all fMRI applications. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Vibrating minds

    CERN Multimedia

    2009-01-01

    Ed Witten is one of the leading scientists in the field of string theory, the theory that describes elementary particles as vibrating strings. This week he leaves CERN after having spent a few months here on sabbatical. His wish is that the LHC will unveil supersymmetry.

  19. Vibrational spectroscopy

    Science.gov (United States)

    Umesh P. Agarwal; Rajai Atalla

    2010-01-01

    Vibrational spectroscopy is an important tool in modern chemistry. In the past two decades, thanks to significant improvements in instrumentation and the development of new interpretive tools, it has become increasingly important for studies of lignin. This chapter presents the three important instrumental methods-Raman spectroscopy, infrared (IR) spectroscopy, and...

  20. SFG spectroscopy from 10 -8 to 1000 mbar: less-ordered CO structures and coadsorption on Pd (1 1 1)

    Science.gov (United States)

    Morkel, Matthias; Unterhalt, Holger; Salmeron, Miquel; Rupprechter, Günther; Freund, Hans-Joachim

    2003-06-01

    Vibrational sum frequency generation spectroscopy was employed to study "less-ordered" phases resulting from low-temperature CO exposure on Pd(1 1 1). Such imperfect structures may also occur under catalytic reaction conditions up to 1000 mbar and originate from the superposition of ordered structures when the CO mobility and flux were insufficient. The effect of coadsorbed hydrogen and water was also examined.

  1. Heat exchanger vibration

    International Nuclear Information System (INIS)

    Richards, D.J.W.

    1977-01-01

    The heat exchangers of various types are common items of plant in the generation and transmission of electricity. The amount of attention given to the flow-induced vibrations of heat exchangers by designers is usually related to the operational history of similar items of plant. Consequently, if a particular design procedure yields items of plant which behave in a satisfactory manner during their operational life, there is little incentive to improve or refine the design procedure. On the other hand, failures of heat exchangers clearly indicate deficiencies in the design procedures or in the data available to the designer. When such failures are attributable to flow-induced vibrations, the identification of the mechanisms involved is a prime importance. Ideally, basic research work provides the background understanding and the techniques necessary to be able to identify the important mechanisms. In practice, the investigation of a flow-induced vibration problem may identify the presence of mechanisms but may not be able to quantify their effects adequately. In these circumstances the need for additional work is established and the objectives of the research programme emerge. The purpose of this paper is to outline the background to the current research programme at C.E.R.L. on heat exchanger vibration

  2. Heat exchanger vibration

    Energy Technology Data Exchange (ETDEWEB)

    Richards, D J.W. [CERL, CEGB, Leatherhead, Surrey (United Kingdom)

    1977-12-01

    The heat exchangers of various types are common items of plant in the generation and transmission of electricity. The amount of attention given to the flow-induced vibrations of heat exchangers by designers is usually related to the operational history of similar items of plant. Consequently, if a particular design procedure yields items of plant which behave in a satisfactory manner during their operational life, there is little incentive to improve or refine the design procedure. On the other hand, failures of heat exchangers clearly indicate deficiencies in the design procedures or in the data available to the designer. When such failures are attributable to flow-induced vibrations, the identification of the mechanisms involved is a prime importance. Ideally, basic research work provides the background understanding and the techniques necessary to be able to identify the important mechanisms. In practice, the investigation of a flow-induced vibration problem may identify the presence of mechanisms but may not be able to quantify their effects adequately. In these circumstances the need for additional work is established and the objectives of the research programme emerge. The purpose of this paper is to outline the background to the current research programme at C.E.R.L. on heat exchanger vibration.

  3. Time-resolved SFG study of formate on a Ni( 1 1 1 ) surface under irradiation of picosecond laser pulses

    Science.gov (United States)

    Noguchi, H.; Okada, T.; Onda, K.; Kano, S. S.; Wada, A.; Domen, K.

    2003-03-01

    Time-resolved sum-frequency generation spectroscopy was carried out on a deuterated formate (DCOO) adsorbed on Ni(1 1 1) surface to investigate the surface reaction dynamics under instantaneous surface temperature jump induced by the irradiation by picosecond laser pulses. The irradiation of pump pulse (800 nm) caused the rapid intensity decrease of both CD and OCO stretching modes of bridged formate on Ni(1 1 1). Different temporal behaviors of intensity recovery between these two vibrational modes were observed, i.e., CD stretching mode recovered faster than OCO. This is the first result to show that the dynamics of adsorbates on metals strongly depends on the observed vibrational mode. From the results of temperature and pump fluence dependence, we concluded that the observed intensity change was not due to the decomposition or desorption, but was induced by a non-thermal process.

  4. Human prevalence of the spotted fever group (SFG) rickettsiae in endemic zones of Northwestern Colombia.

    Science.gov (United States)

    Londoño, Andrés F; Acevedo-Gutiérrez, Leidy Y; Marín, Diana; Contreras, Verónica; Díaz, Francisco J; Valbuena, Gustavo; Labruna, Marcelo B; Hidalgo, Marylin; Arboleda, Margarita; Mattar, Salim; Solari, Sergio; Rodas, Juan D

    2017-06-01

    In February 2006, an outbreak of human rickettsiosis occurred in the municipality of Necoclí Colombia, with 35% of lethality. This episode was, followed by two more, one in the municipality of Los Cordobas in 2007 with a 54% of lethality and the other one in the municipality of Turbo in 2008 with 27% of lethality. The aim of this study was to perform serological tests in healthy persons to determine the seroprevalence of antibodies against spotted fever group (SFG) rickettsiae and develop a survey to study some infection risk-related factors. A cross-sectional study was performed in 2011 and 2012. A blood sample and survey of associated factors was performed in healthy persons. A prevalence of 32%-41% was found in healthy people. From the multivariate analysis, we found that people living more than 16 years in these sites had a 79% higher risk of being seropositive and a 46% higher risk when they reported having birds in their houses if the variable of having a horse was included in the model. In conclusion, this study shows endemicity of at least one spotted fever group Rickettsia in the study zone. Copyright © 2017 Elsevier GmbH. All rights reserved.

  5. Studies of Interfacial Regions by Sum-Frequency Generation with a Free-Electron Laser

    NARCIS (Netherlands)

    Eliel, E. R.; van der Ham, E. W. M.; Vrehen, Q. H. F.; Thooft, G. W.; Barmentlo, M.; Auerhammer, J. M.; van der Meer, A. F. G.; van Amersfoort, P. W.

    1995-01-01

    The use of a Free-Electron Laser (FEL) allows the study of (non)linear optical properties of materials over unsurpassed large spectral intervals. As an example, we report on the use of a FEL as the infrared source in spectroscopic infrared-visible Sum-Frequency Generation (SFG). Employing the

  6. Generation of rotary vibrations in internal combustion engines with elastically coupled electric power systems; Erzeugung von verbrennungsmotorischen Drehschwingungen mit elastisch gekoppelten elektrischen Antrieben

    Energy Technology Data Exchange (ETDEWEB)

    Falkenstein, Jens Werner [Rostock Univ. (Germany). Inst. fuer Antriebstechnik und Mechatronik

    2004-07-01

    The design of motor car powertrains requires simulations as well as prototype tests. For the simulations, prototype parameters must be identified on test rigs, simulation results must be verified, and life tests must be carried out. This necessitates realistic and reproducible excitation of vibrations. Thee book describes the development and construction of a test rig which, with the aid of electric power systems, induces rotary vibrations like those which may occur in internal combustion engines due to gas forces and unbalanced mass forces. In combination with excess resonance, the test stand achieves high dynamics with average rotary momenta up to 600 Nm. The development process is documented, from test stand design with specially developed servo-engines to the control hardware to modelling, control element design, and commissioning. (orig.)

  7. Hot Ground Vibration Tests

    Data.gov (United States)

    National Aeronautics and Space Administration — Ground vibration tests or modal surveys are routinely conducted to support flutter analysis for subsonic and supersonic vehicles. However, vibration testing...

  8. Pickin’ up good vibrations

    CERN Multimedia

    Katarina Anthony

    2015-01-01

    In preparation for the civil engineering work on the HL-LHC, vibration measurements were carried out at the LHC’s Point 1 last month. These measurements will help evaluate how civil engineering work could impact the beam, and will provide crucial details about the site’s geological make-up before construction begins.   A seismic truck at Point 1 generated wave-like vibrations measured by EN/MME. From carrying out R&D to produce state-of-the-art magnets to developing innovative, robust materials capable of withstanding beam impact, the HL-LHC is a multi-faceted project involving many groups and teams across CERN’s departments. It was in this framework that the project management mandated CERN's Mechanical and Materials Engineering (EN/MME) group to measure the propagation of vibrations around Point 1. Their question: can civil engineering work for the HL-LHC – the bulk of which is scheduled for LS2 – begin while the LHC is running? Alth...

  9. General vibration monitoring: Utility Building, August 1992

    International Nuclear Information System (INIS)

    Jendrzejczyk, J.A.; Wambsganss, M.W.; Smith, R.K.

    1993-01-01

    This vibration data was generated from measurements made on 8/12/92. The contents are self explanatory. They are baseline measurements and no exceptionally large vibration amplitude or response was observed. These measurements represent baseline measurements, i.e., measurements with no driving forces active, made on the utility building, a service building for the Advanced Photon Source at Argonne National Laboratory

  10. Experimental evaluation of vibrations in heat exchangers

    International Nuclear Information System (INIS)

    Martin Ghiselli, A.

    1997-01-01

    Flow induced vibrations may produce damage of heat exchangers, condensers and steam generators tubes. To evaluate this problem a set of tests were developed to know the real support state of the tubes, which have great influence on the vibration response. This paper include a description of the tests and the results obtained applying them on a heat exchanger equipment. (author) [es

  11. Vibrations in pipelines of nuclear power plants

    International Nuclear Information System (INIS)

    Leal, M.R.L.V.; Bevilacqua, L.

    1984-01-01

    It is presented the main causes of vibrations in nuclear power plants pipelines to allow the identification of critical areas and correct the errors during the specification design. The methods of vibration analysis to give subsidies in the determination of the corrective providences when the problem appears during the commissioning or the generation energy, are also presented. (M.C.K.) [pt

  12. Theory of vibration protection

    CERN Document Server

    Karnovsky, Igor A

    2016-01-01

    This text is an advancement of the theory of vibration protection of mechanical systems with lumped and distributed parameters. The book offers various concepts and methods of solving vibration protection problems, discusses the advantages and disadvantages of different methods, and the fields of their effective applications. Fundamental approaches of vibration protection, which are considered in this book, are the passive, parametric and optimal active vibration protection. The passive vibration protection is based on vibration isolation, vibration damping and dynamic absorbers. Parametric vibration protection theory is based on the Shchipanov-Luzin invariance principle. Optimal active vibration protection theory is based on the Pontryagin principle and the Krein moment method. The book also contains special topics such as suppression of vibrations at the source of their occurrence and the harmful influence of vibrations on humans. Numerous examples, which illustrate the theoretical ideas of each chapter, ar...

  13. Adaptive Piezoelectric Absorber for Active Vibration Control

    Directory of Open Access Journals (Sweden)

    Sven Herold

    2016-02-01

    Full Text Available Passive vibration control solutions are often limited to working reliably at one design point. Especially applied to lightweight structures, which tend to have unwanted vibration, active vibration control approaches can outperform passive solutions. To generate dynamic forces in a narrow frequency band, passive single-degree-of-freedom oscillators are frequently used as vibration absorbers and neutralizers. In order to respond to changes in system properties and/or the frequency of excitation forces, in this work, adaptive vibration compensation by a tunable piezoelectric vibration absorber is investigated. A special design containing piezoelectric stack actuators is used to cover a large tuning range for the natural frequency of the adaptive vibration absorber, while also the utilization as an active dynamic inertial mass actuator for active control concepts is possible, which can help to implement a broadband vibration control system. An analytical model is set up to derive general design rules for the system. An absorber prototype is set up and validated experimentally for both use cases of an adaptive vibration absorber and inertial mass actuator. Finally, the adaptive vibration control system is installed and tested with a basic truss structure in the laboratory, using both the possibility to adjust the properties of the absorber and active control.

  14. Experimental and theoretical evidence for bilayer-by-bilayer surface melting of crystalline ice

    DEFF Research Database (Denmark)

    Sánchez, M. Alejandra; Kling, Tanja; Ishiyama, Tatsuya

    2017-01-01

    , and its nature, we investigate the surface melting of hexagonal ice by combining noncontact, surfacespecific vibrational sum frequency generation (SFG) spectroscopy and spectra calculated from molecular dynamics simulations. Using SFG, we probe the outermost water layers of distinct single crystalline ice...

  15. Cross sections for the vibrational excitation of the H2 X 1Σ+g(v) levels generated by electron collisional excitation of the higher singlet states

    International Nuclear Information System (INIS)

    Hiskes, J.R.

    1991-01-01

    The excitation cross sections, σ(v,v double-prime), for an H 2 molecule initially in any one of the 15 vibrational levels, v belonging to the ground electronic state and excited to a final vibrational level, v double-prime are evaluated for direct excitations via all members of the excited electronic singlet spectrum. Account is taken of predissociation, autoionization, and radiative decay of the excited electronic spectrum that leads to a final population distribution for the ground electronic state, X 1 Σ + g (v double-prime). For v=0, account is taken explicitly of transitions via the B, C, B', and D electronic states in evaluating the cross sections. The additional contribution of excitations via all Rydberg states lying above the D state enhances these cross sections by approximately 10%. For v>0, cross sections are evaluated taking explicit account of transitions through the B and C states; higher singlet excitations enhance these values by 25%. The choice of the reference total cross sections remains a subjective one, causing the values calculated here to have a possible uncertainty of +20% -30% . For excitations occurring within a hydrogen discharge, collisional excitation-ionization events among the intermediate singlet states will effectively quench the v, v double-prime excitation process for discharge densities in excess of the range 10 15 --10 16 electrons/cm -3

  16. Mechanism of bubble detachment from vibrating walls

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dongjun; Park, Jun Kwon, E-mail: junkeun@postech.ac.kr; Kang, Kwan Hyoung [Department of Mechanical Engineering, Pohang University of Science and Technology (POSTECH), San 31, Hyoja-dong, Pohang 790-784 (Korea, Republic of); Kang, In Seok [Department of Chemical Engineering, Pohang University of Science and Technology (POSTECH), San 31, Hyoja-dong, Pohang 790-784 (Korea, Republic of)

    2013-11-15

    We discovered a previously unobserved mechanism by which air bubbles detach from vibrating walls in glasses containing water. Chaotic oscillation and subsequent water jets appeared when a wall vibrated at greater than a critical level. Wave forms were developed at water-air interface of the bubble by the wall vibration, and water jets were formed when sufficiently grown wave-curvatures were collapsing. Droplets were pinched off from the tip of jets and fell to the surface of the glass. When the solid-air interface at the bubble-wall attachment point was completely covered with water, the bubble detached from the wall. The water jets were mainly generated by subharmonic waves and were generated most vigorously when the wall vibrated at the volume resonant frequency of the bubble. Bubbles of specific size can be removed by adjusting the frequency of the wall's vibration.

  17. Vibration of machine

    International Nuclear Information System (INIS)

    Kwak, Mun Gyu; Na, Sung Su; Baek, Gwang Hyeon; Song, Chul Gi; Han, Sang Bo

    2001-09-01

    This book deals with vibration of machine which gives descriptions of free vibration using SDOF system, forced vibration using SDOF system, vibration of multi-degree of freedom system like introduction and normal form, distribution system such as introduction, free vibration of bar and practice problem, approximate solution like lumped approximations and Raleigh's quotient, engineering by intuition and experience, real problem and experimental method such as technology of signal, fourier transform analysis, frequency analysis and sensor and actuator.

  18. SFG study of methanol dissociative adsorption at Pt(1 0 0), Pt(1 1 0) and Pt(1 1 1) electrodes surfaces

    Science.gov (United States)

    Vidal, F.; Busson, B.; Six, C.; Pluchery, O.; Tadjeddine, A.

    2002-04-01

    The Pt( hkl)/methanol in acidic solution interface which constitutes a model of the anodic part of a fuel cell is studied by infrared-visible sum frequency generation vibrational spectroscopy. Methanol dissociative adsorption leads to CO poisoning of the Pt electrode surfaces. The structure of the CO/Pt( hkl) interface depends strongly on the orientation of the surface electrode.

  19. Enhanced vibration diagnostics using vibration signature analysis

    International Nuclear Information System (INIS)

    Ahmed, S.; Shehzad, K.; Zahoor, Y.; Mahmood, A.; Bibi, A.

    2001-01-01

    Symptoms will appear in equipment, as well as in human beings. when 'suffering from sickness. Symptoms of abnormality in equipment are vibration, noise, deformation, temperature, pressure, electric current, crack, wearing, leakage etc. these are called modes of failure. If the mode of failure is vibration then the vibration signature analysis can be effectively used in order to diagnose the machinery problems. Much valuable information is contained within these vibration 'Spectra' or 'Signatures' but is only of use if the analyst can unlock its 'Secrets'. This paper documents a vibration problem in the motor of a centrifugal pump (Type ETA). It focuses mainly on the roll of modern vibration monitoring system in problem analysis. The problem experienced was the motor unstability and noise due to high vibration. Using enhanced vibration signature data, the problem was analyzed. which suggested that the rotor eccentricity was the cause of excessive noise and vibration in the motor. In conclusion, advanced electronic monitoring and diagnostic systems provide powerful information for machine's condition assessment and problem analysis. Appropriate interpretation and use of this information is important for accurate and effective vibration analysis. (author)

  20. General vibration monitoring: Experimental hall

    International Nuclear Information System (INIS)

    Jendrzejczyk, J.A.; Wambsganss, M.W.; Smith, R.K.

    1993-01-01

    The reported vibration data were generated from measurements made on the experimental hall floor on December 2, 1992. At the time of the measurements, the ESRF hydrolevel was set-up in the Early Assembly Area (EAA) of the experimental hall and was being used to measure static displacement (settlement) of the floor. The vibration measurement area was on and adjacent to the EAA, in the vicinity of the ESRF hydrolevel test which was in progress. This report summarizes the objectives, instrumentation, measurement locations, observations, and conclusions, and provides selected results in the form of RMS vs. time plots, and power spectral densities from which frequency information can be derived. Measured response amplitudes were within the vibration criteria established for the APS

  1. PC based vibration monitoring system

    International Nuclear Information System (INIS)

    Jain, Sanjay K.; Roy, D.A.; Pithawa, C.K.; Patil, R.K.

    2004-01-01

    Health of large rotating machinery gets reflected in the vibration signature of the rotor and supporting structures and proper recording of these signals and their analysis can give a clear picture of the health of the machine. Using these data and their trending, it is possible to predict an impending trouble in the machine so that preventive action can be taken in time and catastrophic failure can be avoided. Continuous monitoring and analysis can give quick warning and enable operator to take preventive measures. Reactor Control Division, BARC is developing a PC based Vibration monitoring system for turbo generator machinery. The System can acquire 20 vibration signals at a rate of 5000 samples per second and also 15 process signals at a rate of 100 samples/ sec. The software for vibration monitoring system includes acquisition modules, analysis modules and Graphical User Interface module. The acquisition module involves initialization, setting of required parameters and acquiring the data from PC-based data acquisition cards. The acquired raw vibration data is then stored for analysis using various software packages. The display and analysis of acquired data is done in LabVIEW 7.0 where the data is displayed in time as well as frequency domain along with the RMS value of the signal. (author)

  2. [Occupational standing vibration rate and vibrational diseases].

    Science.gov (United States)

    Karnaukh, N G; Vyshchipan, V F; Haumenko, B S

    2003-12-01

    Occupational standing vibration rate is proposed in evaluating a degree of impairment of an organism activity. It will allow more widely to introduce specification of quality and quantity in assessment of the development of vibrational disease. According out-patient and inpatient obtained data we have established criterial values of functional changes in accordance with accumulated occupational standing vibration rate. The nomogram was worked out for defining a risk of the development of vibrational disease in mine workers. This nomogram more objectively can help in diagnostics of the disease.

  3. On the neutron noise diagnostics of pressurized water reactor control rod vibrations II. Stochastic vibrations

    International Nuclear Information System (INIS)

    Pazsit, I.; Glockler, O.

    1984-01-01

    In an earlier publication, using the theory of neutron fluctuations induced by a vibrating control rod, a complete formal solution of rod vibration diagnostics based on neutron noise measurements was given in terms of Fourier-transformed neutron detector time signals. The suggested procedure was checked in numerical simulation tests where only periodic vibrations could be considered. The procedure and its numerical testing are elaborated for stochastic two-dimensional vibrations. A simple stochastic theory of two-dimensional flow-induced vibrations is given; then the diagnostic method is formulated in the stochastic case, that is, in terms of neutron detector auto- and crosspower spectra. A previously suggested approximate rod localization technique is also formulated in the stochastic case. Applicability of the methods is then investigated in numerical simulation tests, using the proposed model of stochastic two-dimensional vibrations when generating neutron detector spectra that simulate measured data

  4. A Solid-State Deuterium NMR and SFG Study of the Side Chain Dynamics of Peptides Adsorbed onto Surfaces

    Science.gov (United States)

    Breen, Nicholas F.; Weidner, Tobias; Li, Kun; Castner, David G.; Drobny, Gary P.

    2011-01-01

    The artificial amphiphilic peptide LKα14 adopts a helical structure at interfaces, with opposite orientation of its leucine (L, hydrophobic) and lysine (K, hydrophilic) side chains. When adsorbed onto surfaces, different residue side chains necessarily have different proximities to the surface, depending on both their position in the helix and the composition of the surface itself. Deuterating the individual leucine residues (isopropyl-d7) permits the use of solid-state deuterium NMR as a site-specific probe of side chain dynamics. In conjunction with SFG as a probe of the peptide binding face, we demonstrate that the mobility of specific leucine side chains at the interface is quantifiable in terms of their surface proximity. PMID:19764755

  5. SFG synthesis of general high-order all-pass and all-pole current transfer functions using CFTAs.

    Science.gov (United States)

    Tangsrirat, Worapong

    2014-01-01

    An approach of using the signal flow graph (SFG) technique to synthesize general high-order all-pass and all-pole current transfer functions with current follower transconductance amplifiers (CFTAs) and grounded capacitors has been presented. For general nth-order systems, the realized all-pass structure contains at most n + 1 CFTAs and n grounded capacitors, while the all-pole lowpass circuit requires only n CFTAs and n grounded capacitors. The resulting circuits obtained from the synthesis procedure are resistor-less structures and especially suitable for integration. They also exhibit low-input and high-output impedances and also convenient electronic controllability through the g m-value of the CFTA. Simulation results using real transistor model parameters ALA400 are also included to confirm the theory.

  6. SFG Synthesis of General High-Order All-Pass and All-Pole Current Transfer Functions Using CFTAs

    Directory of Open Access Journals (Sweden)

    Worapong Tangsrirat

    2014-01-01

    Full Text Available An approach of using the signal flow graph (SFG technique to synthesize general high-order all-pass and all-pole current transfer functions with current follower transconductance amplifiers (CFTAs and grounded capacitors has been presented. For general nth-order systems, the realized all-pass structure contains at most n + 1 CFTAs and n grounded capacitors, while the all-pole lowpass circuit requires only n CFTAs and n grounded capacitors. The resulting circuits obtained from the synthesis procedure are resistor-less structures and especially suitable for integration. They also exhibit low-input and high-output impedances and also convenient electronic controllability through the gm-value of the CFTA. Simulation results using real transistor model parameters ALA400 are also included to confirm the theory.

  7. In situ electrochemical SFG/DFG study of CN- and nitrile adsorption at Au from 1-butyl-1-methyl-pyrrolidinium bis(trifluoromethylsulfonyl) amide ionic liquid([BMP][TFSA]) containing 4-{2-[1-(2-cyanoethyl)-1,2,3,4-tetrahydroquinolin-6-yl]diazenyl} benzonitrile (CTDB) and K[Au(CN)₂].

    Science.gov (United States)

    Bozzini, Benedetto; Busson, Bertrand; Gayral, Audrey; Humbert, Christophe; Mele, Claudio; Six, Catherine; Tadjeddine, Abderrahmane

    2012-06-25

    In this paper we report an in situ electrochemical Sum-/Difference Frequency Generation (SFG/DFG) spectroscopy investigation of the adsorption of nitrile and CN⁻ from the ionic liquid 1-butyl-1-methyl-pyrrolidinium bis(trifluoromethylsulfonyl) amide ([BMP][TFSA]) containing 4-{2-[1-(2-cyanoethyl)-1,2,3,4-tetrahydroquinolin-6-yl]-diazenyl}benzonitrile (CTDB) at Au electrodes in the absence and in the presence of the Au-electrodeposition process from K[Au(CN)₂]. The adsorption of nitrile and its coadsorption with CN⁻ resulting either from the cathodic decomposition of the dye or from ligand release from the Au(I) cyanocomplex yield potential-dependent single or double SFG bands in the range 2,125-2,140 cm⁻¹, exhibiting Stark tuning values of ca. 3 and 1 cm⁻¹ V⁻¹ in the absence and presence of electrodeposition, respectively. The low Stark tuning found during electrodeposition correlates with the cathodic inhibiting effect of CTDB, giving rise to its levelling properties. The essential insensitivity of the other DFG parameters to the electrodeposition process is due to the growth of smooth Au.

  8. Portable vibration exciter

    Science.gov (United States)

    Beecher, L. C.; Williams, F. T.

    1970-01-01

    Gas-driven vibration exciter produces a sinusoidal excitation function controllable in frequency and in amplitude. It allows direct vibration testing of components under normal loads, removing the possibility of component damage due to high static pressure.

  9. Vibrations and Eigenvalues

    Indian Academy of Sciences (India)

    We make music by causing strings, membranes, or air columns to vibrate. Engineers design safe structures by control- ling vibrations. I will describe to you a very simple vibrating system and the mathematics needed to analyse it. The ideas were born in the work of Joseph-Louis Lagrange (1736–1813), and I begin by quot-.

  10. Vibration Measurement with PULSE and DSPACE Equipment

    Directory of Open Access Journals (Sweden)

    Radim KLEČKA

    2009-06-01

    Full Text Available This contribution describes techniques and results of measurement with TIRA vibration generator. A method of experimental modal analysis allows next restore of vibration data. The goal is check validity of head expanders and screw connection. This process is based to using ME’scope environment. Another goal is check possibilities of dSPACE platform to vibration measurement. This task includes design of connection between dSPACE system and power amplifier, creating of graphical user interface and analyzing main configuration parameters to improve quality of drive signal.

  11. Vibration of hydraulic machinery

    CERN Document Server

    Wu, Yulin; Liu, Shuhong; Dou, Hua-Shu; Qian, Zhongdong

    2013-01-01

    Vibration of Hydraulic Machinery deals with the vibration problem which has significant influence on the safety and reliable operation of hydraulic machinery. It provides new achievements and the latest developments in these areas, even in the basic areas of this subject. The present book covers the fundamentals of mechanical vibration and rotordynamics as well as their main numerical models and analysis methods for the vibration prediction. The mechanical and hydraulic excitations to the vibration are analyzed, and the pressure fluctuations induced by the unsteady turbulent flow is predicted in order to obtain the unsteady loads. This book also discusses the loads, constraint conditions and the elastic and damping characters of the mechanical system, the structure dynamic analysis, the rotor dynamic analysis and the system instability of hydraulic machines, including the illustration of monitoring system for the instability and the vibration in hydraulic units. All the problems are necessary for vibration pr...

  12. Anti-vibration gloves?

    Science.gov (United States)

    Hewitt, Sue; Dong, Ren G; Welcome, Daniel E; McDowell, Thomas W

    2015-03-01

    For exposure to hand-transmitted vibration (HTV), personal protective equipment is sold in the form of anti-vibration (AV) gloves, but it remains unclear how much these gloves actually reduce vibration exposure or prevent the development of hand-arm vibration syndrome in the workplace. This commentary describes some of the issues that surround the classification of AV gloves, the assessment of their effectiveness and their applicability in the workplace. The available information shows that AV gloves are unreliable as devices for controlling HTV exposures. Other means of vibration control, such as using alternative production techniques, low-vibration machinery, routine preventative maintenance regimes, and controlling exposure durations are far more likely to deliver effective vibration reductions and should be implemented. Furthermore, AV gloves may introduce some adverse effects such as increasing grip force and reducing manual dexterity. Therefore, one should balance the benefits of AV gloves and their potential adverse effects if their use is considered. © Crown copyright 2014.

  13. A THEORETICAL STUDY AND 3D MODELING OF NONLINEAR PASSIVE VIBRATION ISOLATOR

    OpenAIRE

    Sabyasachi Mukherjee

    2017-01-01

    The study of sound and vibration are closely related. Sound or "pressure waves" are generated by vibrating structures (e.g. vocal cords); these pressure waves can also induce the vibration of structures (e.g. ear drum). Hence, when trying to reduce noise it is often a problem in trying to reduce vibration. The high speed engines and machines when mounted on foundations and supports cause vibrations of excessive amplitude because of unbalance forces setup during their working. These are the di...

  14. Energy scavenging from environmental vibration.

    Energy Technology Data Exchange (ETDEWEB)

    Galchev, Tzeno (University of Michigan); Apblett, Christopher Alan; Najafi, Khalil (University of Michigan)

    2009-10-01

    The goal of this project is to develop an efficient energy scavenger for converting ambient low-frequency vibrations into electrical power. In order to achieve this a novel inertial micro power generator architecture has been developed that utilizes the bi-stable motion of a mechanical mass to convert a broad range of low-frequency (< 30Hz), and large-deflection (>250 {micro}m) ambient vibrations into high-frequency electrical output energy. The generator incorporates a bi-stable mechanical structure to initiate high-frequency mechanical oscillations in an electromagnetic scavenger. This frequency up-conversion technique enhances the electromechanical coupling and increases the generated power. This architecture is called the Parametric Frequency Increased Generator (PFIG). Three generations of the device have been fabricated. It was first demonstrated using a larger bench-top prototype that had a functional volume of 3.7cm3. It generated a peak power of 558{micro}W and an average power of 39.5{micro}W at an input acceleration of 1g applied at 10 Hz. The performance of this device has still not been matched by any other reported work. It yielded the best power density and efficiency for any scavenger operating from low-frequency (<10Hz) vibrations. A second-generation device was then fabricated. It generated a peak power of 288{micro}W and an average power of 5.8{micro}W from an input acceleration of 9.8m/s{sup 2} at 10Hz. The device operates over a frequency range of 20Hz. The internal volume of the generator is 2.1cm{sup 3} (3.7cm{sup 3} including casing), half of a standard AA battery. Lastly, a piezoelectric version of the PFIG is currently being developed. This device clearly demonstrates one of the key features of the PFIG architecture, namely that it is suitable for MEMS integration, more so than resonant generators, by incorporating a brittle bulk piezoelectric ceramic. This is the first micro-scale piezoelectric generator capable of <10Hz operation. The

  15. Review of Energy Harvesters Utilizing Bridge Vibrations

    Directory of Open Access Journals (Sweden)

    Farid Ullah Khan

    2016-01-01

    Full Text Available For health monitoring of bridges, wireless acceleration sensor nodes (WASNs are normally used. In bridge environment, several forms of energy are available for operating WASNs that include wind, solar, acoustic, and vibration energy. However, only bridge vibration has the tendency to be utilized for embedded WASNs application in bridge structures. This paper reports on the recent advancements in the area of vibration energy harvesters (VEHs utilizing bridge oscillations. The bridge vibration is narrowband (1 to 40 Hz with low acceleration levels (0.01 to 3.8 g. For utilization of bridge vibration, electromagnetic based vibration energy harvesters (EM-VEHs and piezoelectric based vibration energy harvesters (PE-VEHs have been developed. The power generation of the reported EM-VEHs is in the range from 0.7 to 1450000 μW. However, the power production by the developed PE-VEHs ranges from 0.6 to 7700 μW. The overall size of most of the bridge VEHs is quite comparable and is in mesoscale. The resonant frequencies of EM-VEHs are on the lower side (0.13 to 27 Hz in comparison to PE-VEHs (1 to 120 Hz. The power densities reported for these bridge VEHs range from 0.01 to 9539.5 μW/cm3 and are quite enough to operate most of the commercial WASNs.

  16. Bevel Gearbox Fault Diagnosis using Vibration Measurements

    Directory of Open Access Journals (Sweden)

    Hartono Dennis

    2016-01-01

    Full Text Available The use of vibration measurementanalysis has been proven to be effective for gearbox fault diagnosis. However, the complexity of vibration signals observed from a gearbox makes it difficult to accurately detectfaults in the gearbox. This work is based on a comparative studyof several time-frequency signal processing methods that can be used to extract information from transient vibration signals containing useful diagnostic information. Experiments were performed on a bevel gearbox test rig using vibration measurements obtained from accelerometers. Initially, thediscrete wavelet transform was implementedfor vibration signal analysis to extract the frequency content of signal from the relevant frequency region. Several time-frequency signal processing methods werethen incorporated to extract the fault features of vibration signals and their diagnostic performances were compared. It was shown thatthe Short Time Fourier Transform (STFT could not offer a good time resolution to detect the periodicity of the faulty gear tooth due the difficulty in choosing an appropriate window length to capture the impulse signal. The Continuous Wavelet Transform (CWT, on the other hand, was suitable to detection of vibration transients generated by localized fault from a gearbox due to its multi-scale property. However, both methods still require a thorough visual inspection. In contrast, it was shown from the experiments that the diagnostic method using the Cepstrumanalysis could provide a direct indication of the faulty tooth without the need of a thorough visual inspection as required by CWT and STFT.

  17. Bandshapes in vibrational spectroscopy

    International Nuclear Information System (INIS)

    Dijkman, F.G.

    1978-01-01

    A detailed account is given of the development of modern bandshape theories since 1965. An investigation into the relative contributions of statistical irreversible relaxation processes is described, for a series of molecules in which gradually the length of one molecular axis is increased. An investigation into the theoretical and experimental investigation of the broadening brought about by the effect of fluctuating intermolecular potentials on the vibrational frequency is also described. The effect of an intermolecular perturbative potential on anharmonic and Morse oscillators is discussed and the results are presented of a computation on the broadening of the vibrational band of some diatomic molecules in a rigid lattice type solvent. The broadening of the OH-stretching vibration in a number of aliphatic alcohols, the vibrational bandshapes of the acetylenic C-H stretching vibration and of the symmetric methyl stretching vibration are investigated. (Auth./ C.F.)

  18. Substrate vibrations during courtship in three Drosophila species.

    Directory of Open Access Journals (Sweden)

    Valerio Mazzoni

    Full Text Available While a plethora of studies have focused on the role of visual, chemical and near-field airborne signals in courtship of Drosophila fruit flies, the existence of substrate-borne vibrational signals has been almost completely overlooked. Here we describe substrate vibrations generated during courtship in three species of the D. melanogaster group, from the allegedly mute species D. suzukii, its sister species D. biarmipes, and from D. melanogaster. In all species, we recorded several types of substrate vibrations which were generated by locomotion, abdominal vibrations and most likely through the activity of thoracic wing muscles. In D. melanogaster and D. suzukii, all substrate vibrations described in intact males were also recorded in males with amputated wings. Evidence suggests that vibrational signalling may be widespread among Drosophila species, and fruit flies may provide an ideal model to study various aspects of this widespread form of animal communication.

  19. Transfer vibration through spine

    OpenAIRE

    Benyovszky, Adam

    2012-01-01

    Transfer Vibration through Spine Abstract In the bachelor project we deal with the topic of Transfer Vibration through Spine. The problem of TVS is trying to be solved by the critical review method. We analyse some diagnostic methods and methods of treatment based on this principle. Close attention is paid to the method of Transfer Vibration through Spine that is being currently solved by The Research Institute of Thermomechanics in The Czech Academy of Sciences in cooperation with Faculty of...

  20. Behavior of Cell on Vibrating Micro Ridges

    Directory of Open Access Journals (Sweden)

    Haruka Hino

    2015-06-01

    Full Text Available The effect of micro ridges on cells cultured at a vibrating scaffold has been studied in vitro. Several parallel lines of micro ridges have been made on a disk of transparent polydimethylsiloxane for a scaffold. To apply the vibration on the cultured cells, a piezoelectric element was attached on the outside surface of the bottom of the scaffold. The piezoelectric element was vibrated by the sinusoidal alternating voltage (Vp-p < 16 V at 1.0 MHz generated by a function generator. Four kinds of cells were used in the test: L929 (fibroblast connective tissue of C3H mouse, Hepa1-6 (mouse hepatoma, C2C12 (mouse myoblast, 3T3-L1 (mouse fat precursor cells. The cells were seeded on the micro pattern at the density of 2000 cells/cm2 in the medium containing 10% FBS (fetal bovine serum and 1% penicillin/ streptomycin. After the adhesion of cells in several hours, the cells are exposed to the ultrasonic vibration for several hours. The cells were observed with a phase contrast microscope. The experimental results show that the cells adhere, deform and migrate on the scaffold with micro patterns regardless of the ultrasonic vibration. The effects of the vibration and the micro pattern depend on the kind of cells.

  1. Conformation, orientation and interaction in molecular monolayers: A surface second harmonic and sum frequency generation study

    International Nuclear Information System (INIS)

    Superfine, R.; Huang, J.Y.; Shen, Y.R.

    1988-12-01

    We have used sum frequency generation (SFG) to study the order in a silane monolayer before and after the deposition of a coadsorbed liquid crystal monolayer. We observe an increase in the order of the chain of the silane molecule induced by the interpenetration of the liquid crystal molecules. By using second harmonic generation (SHG) and SFG, we have studied the orientation and conformation of the liquid crystal molecule on clean and silane coated glass surfaces. On both surfaces, the biphenyl group is tilted by 70 degree with the alkyl chain end pointing away from the surface. The shift in the C-H stretch frequencies in the coadsorbed system indicates a significant interaction between molecules. 9 refs., 3 figs

  2. Probing a molecular electronic transition by two-colour sum-frequency generation spectroscopy

    International Nuclear Information System (INIS)

    Humbert, C.; Dreesen, L.; Nihonyanagi, S.; Masuda, T.; Kondo, T.; Mani, A.A.; Uosaki, K.; Thiry, P.A.; Peremans, A.

    2003-01-01

    We demonstrate that a new emerging technique, two-colour sum-frequency generation (SFG) spectroscopy, can be used to probe the molecular electronic properties of self-assembled monolayers (SAMs). In the CH spectral range (2800-3200 cm -1 ), we show that the sum-frequency generation signal of a porphyrin alkanethiol derivative adsorbed on Pt(1 1 1) reaches a maximum intensity at ∼435 nm SFG wavelength. This wavelength corresponds to the porphyrin moiety specific π-π* molecular electronic transition which is called the Soret or B band. This resonant behaviour is not observed for 1-dodecanethiol SAMs, which are devoid of molecular electronic transition in the investigated visible spectral range

  3. 14th International Conference on Acoustics and Vibration of Mechanical Structures

    CERN Document Server

    Marinca, Vasile

    2018-01-01

    This book is a collection of papers presented at Acoustics and Vibration of Mechanical Structures 2017 – AVMS 2017 – highlighting the current trends and state-of-the-art developments in the field. It covers a broad range of topics, such as noise and vibration control, noise and vibration generation and propagation, the effects of noise and vibration, condition monitoring and vibration testing, modeling, prediction and simulation of noise and vibration, environmental and occupational noise and vibration, noise and vibration attenuators, as well as biomechanics and bioacoustics. The book also presents analytical, numerical and experimental techniques for evaluating linear and non-linear noise and vibration problems (including strong nonlinearity). It is primarily intended for academics, researchers and professionals, as well as PhD students in various fields of the acoustics and vibration of mechanical structures.

  4. Cases of coupled vibrations and prametric instability in rotating machines

    OpenAIRE

    Luneno, Jean-Claude

    2012-01-01

    The principal task in this research project was to analyse the causes and consequences of coupled vibrations and parametric instability in hydropower rotors; where both horizontal and vertical machines are involved. Vibration is a well-known undesirable behavior of dynamical systems characterised by persistent periodic, quasi-periodic or chaotic motions. Vibrations generate noise and cause fatigue, which initiates cracks in mechanical structures. Motions coupling can in some cases augment the...

  5. Integrated predictive maintenance program vibration and lube oil analysis: Part I - history and the vibration program

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, H.

    1996-12-01

    This paper is the first of two papers which describe the Predictive Maintenance Program for rotating machines at the Palo Verde Nuclear Generating Station. The organization has recently been restructured and significant benefits have been realized by the interaction, or {open_quotes}synergy{close_quotes} between the Vibration Program and the Lube Oil Analysis Program. This paper starts with the oldest part of the program - the Vibration Program and discusses the evolution of the program to its current state. The {open_quotes}Vibration{close_quotes} view of the combined program is then presented.

  6. A comparison of scope for growth (SFG) and dynamic energy budget (DEB) models applied to the blue mussel ( Mytilus edulis)

    Science.gov (United States)

    Filgueira, Ramón; Rosland, Rune; Grant, Jon

    2011-11-01

    Growth of Mytilus edulis was simulated using individual based models following both Scope For Growth (SFG) and Dynamic Energy Budget (DEB) approaches. These models were parameterized using independent studies and calibrated for each dataset by adjusting the half-saturation coefficient of the food ingestion function term, XK, a common parameter in both approaches related to feeding behavior. Auto-calibration was carried out using an optimization tool, which provides an objective way of tuning the model. Both approaches yielded similar performance, suggesting that although the basis for constructing the models is different, both can successfully reproduce M. edulis growth. The good performance of both models in different environments achieved by adjusting a single parameter, XK, highlights the potential of these models for (1) producing prospective analysis of mussel growth and (2) investigating mussel feeding response in different ecosystems. Finally, we emphasize that the convergence of two different modeling approaches via calibration of XK, indicates the importance of the feeding behavior and local trophic conditions for bivalve growth performance. Consequently, further investigations should be conducted to explore the relationship of XK to environmental variables and/or to the sophistication of the functional response to food availability with the final objective of creating a general model that can be applied to different ecosystems without the need for calibration.

  7. The occurrence of Spotted Fever Group (SFG) Rickettsiae in Ixodes ricinus ticks (Acari: Ixodidae) in northern Poland.

    Science.gov (United States)

    Stańczak, Joanna

    2006-10-01

    Ixodes ricinus, the most commonly observed tick species in Poland, is known vector of microorganisms pathogenic for humans as TBE virus, Borrelia burgdorferi s.1., Anaplasma phagocytophilum and Babesia sp. in this country. Our study aimed to find out whether this tick can also transmit also rickettsiae of the spotted fever group (SFG). DNA extracts from 560 ticks (28 females, 34 males, and 488 nymphs) collected in different wooded areas in northern Poland were examined by PCR for the detection of Rickettsia sp., using a primer set RpCS.877p and RpCS.1258n designated to amplify a 381-bp fragment of gltA gene. A total of 2.9% ticks was found to be positive. The percentage of infected females and males was comparable (10.5% and 11.8%, respectively) and 6.6-7.6 times higher than in nymphs (1.6%). Sequences of four PCR-derived DNA fragments (acc. no. DQ672603) demonstrated 99% similarity with the sequence of Rickettsia helvetica deposited in GenBank. The results obtained suggest the possible role of I. ricinus as a source of a microorganism, which recently has been identified as an agent of human rickettsioses in Europe.

  8. SFG study of the ethanol in an acidic medium--Pt(110) interface: effects of the alcohol concentration.

    Science.gov (United States)

    Gomes, Janaina F; Busson, Bertrand; Tadjeddine, Abderrahmane

    2006-03-23

    Ethanol in an acidic solution-Pt(110) interface was studied by SFG spectroscopy (between 1820 and 2325 cm(-1)) to explore primarily the effects of the alcohol concentration. Stretching bands of H-Pt (ca. 1970 or 2050 cm(-1)) and CO (ca. 1980 and 2040 cm(-1)) species, produced by the ethanol oxidation, were detected during the adsorption and oxidation of 0-1 mol L(-1) ethanol in a 0.1 mol L(-1) HClO(4) solution on the electrode surface. Hydrogen and CO coadsorb stably on Pt(110) between 0.05 and 0.15 V in ethanol-containing solutions. In this potential range, the blue shift of the hydrogen resonance (ca. 80 cm(-1)) reveals a weakening of the hydrogen bonding between adsorbed hydrogen and water molecules in the double layer. After the hydrogen desorption (0.15 V), the formation of compact CO islands, depending on the ethanol concentration, lifts the Pt(110) surface reconstruction. In ethanol-free solution, the surface remains reconstructed. The lower-frequency CO band is assigned to the CO species adsorbed on (1 x 2) reconstructed Pt(110) domains, having smaller local coverages, while the higher-frequency CO band is attributed to the close-packed CO species adsorbed on (1 x 1) patches. The reaction pathway forming CO(2) is less favored with increasing ethanol concentration.

  9. Fluid dynamic forces acting on a circular tube bundle in cross flow. Proposals of generation condition of vortex-induced vibration and correlation equation of turbulence-induced exciting force

    International Nuclear Information System (INIS)

    Inada, Fumio; Yoneda, Kimitoshi; Yasuo, Akira; Nishihara, Takashi

    2000-01-01

    In the circular tube bundle immersed in the crossflow, the exciting force induced by the turbulence and periodically discharged vortices becomes large, and it is necessary to confirm a long-term integrity to the flow induced vibration. In this report, the local fluid exciting force and the correlation length in the direction of tube axis were measured. The exciting force acting on the first row was smaller than that inside the tube bundle, and the exciting force was almost saturated at the third row. As for vortex induced vibration, there could be an influence when a dimensionless frequency was 0.4 or less. When vortex induced vibration did not affect the vibration, a correlation composed of a correlation length and power spectrum density of the local fluid exciting force were proposed, with which we could estimate the amplitude of the vibration. A computer program to estimate the vibration amplitude and maximum stress was made using the flow velocity distribution and the mode of vibration. (author)

  10. Mechanical vibration and shock analysis, sinusoidal vibration

    CERN Document Server

    Lalanne, Christian

    2014-01-01

    Everything engineers need to know about mechanical vibration and shock...in one authoritative reference work! This fully updated and revised 3rd edition addresses the entire field of mechanical vibration and shock as one of the most important types of load and stress applied to structures, machines and components in the real world. Examples include everything from the regular and predictable loads applied to turbines, motors or helicopters by the spinning of their constituent parts to the ability of buildings to withstand damage from wind loads or explosions, and the need for cars to m

  11. Hydroelastic Vibrations of Ships

    DEFF Research Database (Denmark)

    Jensen, Jørgen Juncher; Folsø, Rasmus

    2002-01-01

    A formula for the necessary hull girder bending stiffness required to avoid serious springing vibrations is derived. The expression takes into account the zero crossing period of the waves, the ship speed and main dimensions. For whipping vibrations the probability of exceedance for the combined...

  12. Surface vibrational spectroscopy

    International Nuclear Information System (INIS)

    Erskine, J.L.

    1984-01-01

    A brief review of recent studies which combine measurements of surface vibrational energies with lattice dynamical calculations is presented. These results suggest that surface vibrational spectroscopy offers interesting prospects for use as a molecular-level probe of surface geometry, adsorbate bond distances and molecular orientations

  13. Gearbox vibration diagnostic analyzer

    Science.gov (United States)

    1992-01-01

    This report describes the Gearbox Vibration Diagnostic Analyzer installed in the NASA Lewis Research Center's 500 HP Helicopter Transmission Test Stand to monitor gearbox testing. The vibration of the gearbox is analyzed using diagnostic algorithms to calculate a parameter indicating damaged components.

  14. Structure Sensitivity in Pt Nanoparticle Catalysts for Hydrogenation of 1,3-Butadiene: In Situ Study of Reaction Intermediates Using SFG Vibrational Spectroscopy

    KAUST Repository

    Michalak, William D.; Krier, James M.; Komvopoulos, Kyriakos; Somorjai, Gabor A.

    2013-01-01

    hydrogenation and the nanoparticle size affects the kinetic preference for the two pathways. The reaction pathway through the metallocycle intermediate on the small nanoparticles is likely due to the presence of low-coordinated sites. © 2012 American Chemical

  15. Determination of the two methyl group orientations at vapor/acetone interface with polarization null angle method in SFG vibrational spectroscopy

    Science.gov (United States)

    Chen, Hua; Gan, Wei; Wu, Bao-hua; Wu, Dan; Zhang, Zhen; Wang, Hong-fei

    2005-06-01

    We report a direct measurement of the orientation of the two CH 3 groups of acetone molecule at the vapor/acetone interface. The interfacial acetone molecule is found well-ordered, with one methyl group points away around 14.4° ± 1.9° and another into the bulk liquid around 102.8° ± 1.9° from the interface normal, and thus the C dbnd O group points into the bulk around 135.8° ± 1.9°. These results directly confirmed the highly ordered and even crystal like interfacial structure of the vapor/acetone interface from previous MD simulation. The general formulation and accurate determination of the orientational parameter D can be used to treat interfaces with complex molecular orientations.

  16. Handbook Of Noise And Vibration

    International Nuclear Information System (INIS)

    1995-12-01

    This book is about noise and vibration. The first chapter has explanations of noise such as basic of sound, influence of noise, assessment of noise, measurement of prevention of noise and technology, case of noise measurement and soundproof. The second chapter describes vibration with outline, theory of vibration, interpretation of vibration, measurement for reduction of vibration, case of design of protection against vibration. It deals with related regulation and method of measurement.

  17. Aqueous heterogeneity at the air/water interface revealed by 2D-HD-SFG spectroscopy.

    Science.gov (United States)

    Hsieh, Cho-Shuen; Okuno, Masanari; Hunger, Johannes; Backus, Ellen H G; Nagata, Yuki; Bonn, Mischa

    2014-07-28

    Water molecules interact strongly with each other through hydrogen bonds. This efficient intermolecular coupling causes strong delocalization of molecular vibrations in bulk water. We study intermolecular coupling at the air/water interface and find intermolecular coupling 1) to be significantly reduced and 2) to vary strongly for different water molecules at the interface--whereas in bulk water the coupling is homogeneous. For strongly hydrogen-bonded OH groups, coupling is roughly half of that of bulk water, due to the lower density in the near-surface region. For weakly hydrogen-bonded OH groups that absorb around 3500 cm(-1), which are assigned to the outermost, yet hydrogen-bonded OH groups pointing towards the liquid, coupling is further reduced by an additional factor of 2. Remarkably, despite the reduced structural constraints imposed by the interfacial hydrogen-bond environment, the structural relaxation is slow and the intermolecular coupling of these water molecules is weak. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. CaSO4 Scale Formation on Vibrated Piping System in the Presence Citric Acid

    Science.gov (United States)

    Mangestiyono, W.; Jamari, J.; Muryanto, S.; Bayuseno, A. P.

    2018-02-01

    Vibration in many industries commonly generated by the operation mechanical equipment such as extruder, mixer, blower, compressor, turbine, generator etc. Vibration propagates into the floor and attacks the pipe around those mechanical equipment. In this paper, the influence of vibration in a pipe on the CaSO4 scale formation was investigated to understand the effect of vibration on the kinetics, mass of scale, crystal phases and crystal polymorph. To generate vibration force, mechanical equipment was prepared consisted of electrical motor, crankshaft, connecting rod and a vibration table at where test pipe section mounted. Deposition rate increased significantly when the vibration affected to the system i.e. 0.5997 and 1.6705 gr/hr for vibration frequency 4.00 and 8.00 Hz. The addition 10.00 ppm of citric acid declined the deposition rate of 8 Hz experiment from 3.4599 gr/hr to 2.2865 gr/hr.

  19. Vibration insensitive interferometry

    Science.gov (United States)

    Millerd, James; Brock, Neal; Hayes, John; Kimbrough, Brad; North-Morris, Michael; Wyant, James C.

    2017-11-01

    The largest limitation of phase-shifting interferometry for optical testing is the sensitivity to the environment, both vibration and air turbulence. An interferometer using temporal phase-shifting is very sensitive to vibration because the various phase shifted frames of interferometric data are taken at different times and vibration causes the phase shifts between the data frames to be different from what is desired. Vibration effects can be reduced by taking all the phase shifted frames simultaneously and turbulence effects can be reduced by averaging many measurements. There are several techniques for simultaneously obtaining several phase-shifted interferograms and this paper will discuss two such techniques: 1) Simultaneous phase-shifting interferometry on a single detector array (PhaseCam) and 2) Micropolarizer phase-shifting array. The application of these techniques for the testing of large optical components, measurement of vibrational modes, the phasing of segmented optical components, and the measurement of deformations of large diffuse structures is described.

  20. Vibrations of rotating machinery

    CERN Document Server

    Matsushita, Osami; Kanki, Hiroshi; Kobayashi, Masao; Keogh, Patrick

    2017-01-01

    This book opens with an explanation of the vibrations of a single degree-of-freedom (dof) system for all beginners. Subsequently, vibration analysis of multi-dof systems is explained by modal analysis. Mode synthesis modeling is then introduced for system reduction, which aids understanding in a simplified manner of how complicated rotors behave. Rotor balancing techniques are offered for rigid and flexible rotors through several examples. Consideration of gyroscopic influences on the rotordynamics is then provided and vibration evaluation of a rotor-bearing system is emphasized in terms of forward and backward whirl rotor motions through eigenvalue (natural frequency and damping ratio) analysis. In addition to these rotordynamics concerning rotating shaft vibration measured in a stationary reference frame, blade vibrations are analyzed with Coriolis forces expressed in a rotating reference frame. Other phenomena that may be assessed in stationary and rotating reference frames include stability characteristic...

  1. Interfacial instabilities in vibrated fluids

    Science.gov (United States)

    Porter, Jeff; Laverón-Simavilla, Ana; Tinao Perez-Miravete, Ignacio; Fernandez Fraile, Jose Javier

    2016-07-01

    Vibrations induce a range of different interfacial phenomena in fluid systems depending on the frequency and orientation of the forcing. With gravity, (large) interfaces are approximately flat and there is a qualitative difference between vertical and horizontal forcing. Sufficient vertical forcing produces subharmonic standing waves (Faraday waves) that extend over the whole interface. Horizontal forcing can excite both localized and extended interfacial phenomena. The vibrating solid boundaries act as wavemakers to excite traveling waves (or sloshing modes at low frequencies) but they also drive evanescent bulk modes whose oscillatory pressure gradient can parametrically excite subharmonic surface waves like cross-waves. Depending on the magnitude of the damping and the aspect ratio of the container, these locally generated surfaces waves may interact in the interior resulting in temporal modulation and other complex dynamics. In the case where the interface separates two fluids of different density in, for example, a rectangular container, the mass transfer due to vertical motion near the endwalls requires a counterflow in the interior region that can lead to a Kelvin-Helmholtz type instability and a ``frozen wave" pattern. In microgravity, the dominance of surface forces favors non-flat equilibrium configurations and the distinction between vertical and horizontal applied forcing can be lost. Hysteresis and multiplicity of solutions are more common, especially in non-wetting systems where disconnected (partial) volumes of fluid can be established. Furthermore, the vibrational field contributes a dynamic pressure term that competes with surface tension to select the (time averaged) shape of the surface. These new (quasi-static) surface configurations, known as vibroequilibria, can differ substantially from the hydrostatic state. There is a tendency for the interface to orient perpendicular to the vibrational axis and, in some cases, a bulge or cavity is induced

  2. Construction of a Vibration Monitoring System for HANARO's Rotating Machinery and Analysis of Pump Vibration Signals

    International Nuclear Information System (INIS)

    Ryu, Jeong Soo; Yoon, Doo Byung

    2005-01-01

    HANARO is an open-tank-in-pool type research reactor with a thermal power of 30MW. In order to remove the heat generated by the reactor core and the reflector vessel, primary cooling pumps and reflector cooling pumps circulate coolant. These pumps are installed at the RCI(Reactor Concrete Island) which is covered by heavy concrete hatches. For the prevention of an abnormal operation of these pumps in the RCI, it is necessary to construct a vibration monitoring system that provides an alarm signal to the reactor control room when the rotating speed or the vibration level exceeds the allowable limit. The first objective of this work is to construct a vibration monitoring system for HANARO's rotating machinery. The second objective is to verify the possibility of condition monitoring of the rotating machinery. To construct a vibration monitoring system, as a first step, the standards and references related to the vibration monitoring system were investigated. In addition, to determine the number and the location of sensors that can effectively characterize the overall vibration of a pump, the vibration of the primary cooling pumps and the reflector cooling pumps were measured. Based on these results, detailed construction plans for the vibration monitoring system for HANARO were established. Then, in accordance with the construction plans, the vibration monitoring system for HANARO's rotating machinery was manufactured and installed at HANARO. To achieve the second objective, FFT analysis and bearing fault detection of the measured vibration signals were performed. The analysis results demonstrate that the accelerometers mounted at the bearing locations of the pumps can effectively monitor the pump condition

  3. Non-traditional vibration mitigation methods for reciprocating compressor system

    NARCIS (Netherlands)

    Eijk, A.; Lange, T.J. de; Vreugd, J. de; Slis, E.J.P.

    2016-01-01

    Reciprocating compressors generate vibrations caused by pulsation-induced forces, mechanical (unbalanced) free forces and moments, crosshead guide forces and cylinder stretch forces. The traditional way of mitigating the vibration and cyclic stress levels to avoid fatigue failure of parts of the

  4. VibroCav : Hydrodynamic Vibration and Cavitation Technology

    NARCIS (Netherlands)

    Bakker, T.W.

    2012-01-01

    Vibration and cavitation can be generated in many ways and serve many useful purposes. This study describes physical aspects of useful vibration and cavitation for a broad spectrum of applications at atmospheric or elevated pressures. After a review of available devices, hydrodynamic

  5. Vibration monitoring and fault diagnostics of a thermal power plant

    International Nuclear Information System (INIS)

    Hafeez, T.; Ghani, R.; Chohan, G.Y.; Amir, M.

    2003-01-01

    A thermal power plant was monitored from HP-turbine to the generator end. The vibration data at different plant locations was obtained with the help of a data collector/analyzer. The spectra of-all locations generate the symptoms for different problems of moderate and high vibration levels like bent shaft, misalignment in the exciter rotor and three couplings, mechanical looseness on generator and exciter sides. The possible causes of these faults are discussed on the basis of presented vibration spectra in this paper. The faults were later on rectified on the basis of this diagnostics. (author)

  6. No Telescoping Effect with Dual Tendon Vibration.

    Directory of Open Access Journals (Sweden)

    Valeria Bellan

    Full Text Available The tendon vibration illusion has been extensively used to manipulate the perceived position of one's own body part. However, findings from previous research do not seem conclusive sregarding the perceptual effect of the concurrent stimulation of both agonist and antagonist tendons over one joint. On the basis of recent data, it has been suggested that this paired stimulation generates an inconsistent signal about the limb position, which leads to a perceived shrinkage of the limb. However, this interesting effect has never been replicated. The aim of the present study was to clarify the effect of a simultaneous and equal vibration of the biceps and triceps tendons on the perceived location of the hand. Experiment 1 replicated and extended the previous findings. We compared a dual tendon stimulation condition with single tendon stimulation conditions and with a control condition (no vibration on both 'upward-downward' and 'towards-away from the elbow' planes. Our results show a mislocalisation towards the elbow of the position of the vibrated arm during dual vibration, in line with previous results; however, this did not clarify whether the effect was due to arm representation contraction (i.e., a 'telescoping' effect. Therefore, in Experiment 2 we investigated explicitly and implicitly the perceived arm length during the same conditions. Our results clearly suggest that in all the vibration conditions there was a mislocalisation of the entire arm (including the elbow, but no evidence of a contraction of the perceived arm length.

  7. In Situ Electrochemical SFG/DFG Study of CN and Nitrile Adsorption at Au from 1-Butyl-1-methyl-pyrrolidinium Bis(trifluoromethylsulfonyl Amide Ionic Liquid ([BMP][TFSA] Containing 4-{2-[1-(2-Cyanoethyl-1,2,3,4-tetrahydroquinolin-6-yl]diazenyl} Benzonitrile (CTDB and K[Au(CN2

    Directory of Open Access Journals (Sweden)

    Benedetto Bozzini

    2012-06-01

    Full Text Available In this paper we report an in situ electrochemical Sum-/Difference Frequency Generation (SFG/DFG spectroscopy investigation of the adsorption of nitrile and CN from the ionic liquid 1-butyl-1-methyl-pyrrolidinium bis(trifluoromethylsulfonyl amide ([BMP][TFSA] containing 4-{2-[1-(2-cyanoethyl-1,2,3,4-tetrahydroquinolin-6-yl]- diazenyl}benzonitrile (CTDB at Au electrodes in the absence and in the presence of the Au-electrodeposition process from K[Au(CN2]. The adsorption of nitrile and its coadsorption with CN resulting either from the cathodic decomposition of the dye or from ligand release from the Au(I cyanocomplex yield potential-dependent single or double SFG bands in the range 2,125–2,140 cm1, exhibiting Stark tuning values of ca. 3 and 1 cm1 V1 in the absence and presence of electrodeposition, respectively. The low Stark tuning found during electrodeposition correlates with the cathodic inhibiting effect of CTDB, giving rise to its levelling properties. The essential insensitivity of the other DFG parameters to the electrodeposition process is due to the growth of smooth Au.

  8. Particular aspects regarding the effects of whole body vibration exposure

    Directory of Open Access Journals (Sweden)

    Picu Mihaela

    2018-01-01

    Full Text Available This paper analyses the influence of whole-body vibrations on human performance; for this it was investigated how a group of men (20-29 years of age and a group of woman (21–31 years of age answered to specific requirements after being subjected to vertical vibrations under controlled laboratory conditions for 10-25 min. The vibrations were generated by a vibrant system with known amplitudes and frequencies. Accelerations were measured with NetdB - complex system for measuring and analysing human vibration and they were found in the range 0.4 - 3.1m/s2. The subjects’ performances were determined for each vibration level using specific tests. It can be concluded that exposure to vibrations higher than those recommended by ISO 2631 significantly disrupts how subjects responded to tests requirements.

  9. Experimental Research on Vibrations of Double Harmonic Gear Transmission

    Directory of Open Access Journals (Sweden)

    Sava Ianici

    2017-11-01

    Full Text Available Gears transmission can be important sources of vibration in the mechanical system structures and can have a significant share in the overall vibration level. The current trend of significant increase in powers and speeds transmitted by modern mechanical systems, along with the size reduction, may cause a worsening of the behaviour of transmissions with gears in terms of vibration, especially when the optimization criteria were not respected in the design, execution and installation phase. This paper presents a study of vibrations that occur in a double harmonic gear transmission (DHGT, based on experimental research. The experimental researches revealed that in a double harmonic gear transmission the vibrations are initiated and develop in the multipara harmonics engagement of the teeth and in the kinematic couplings materialized between the wave generator and the flexible toothed wheel. These vibrations are later transmitted by means of the shafts and bearings to the transmission housing, respectively, through the walls of it, propagating in the air.

  10. CRBRP flow induced vibration program

    Energy Technology Data Exchange (ETDEWEB)

    Novendstern, E H [Westinghouse Advanced Reactor Division, Madison, PA (United States); Grochowski, F A; Yang, T M [General Electric Co., Fast Breeder Reactor Department, Sunnyvale, CA (United States); Ryan, J A; Mulcahy, T M

    1977-12-01

    The program to assure the structural adequacy of Clinch River Breeder Reactor (CRBRP) components during its planned 30 years of operation is described. The program includes (1) an assessment of reactor components relative to their susceptibility to FIV, (2) designing to minimize component excitation due to Fluid induced vibrations (FIV), (3) scale model tests to measure structural response during simulated operating conditions and (4) preoperational tests. An overview of the CRBRP test program is described. Additionally, details of scale model testing of reactor internals and the steam generator is described in more detail. (author)

  11. Silicon micromachined vibrating gyroscopes

    Science.gov (United States)

    Voss, Ralf

    1997-09-01

    This work gives an overview of silicon micromachined vibrating gyroscopes. Market perspectives and fields of application are pointed out. The advantage of using silicon micromachining is discussed and estimations of the desired performance, especially for automobiles are given. The general principle of vibrating gyroscopes is explained. Vibrating silicon gyroscopes can be divided into seven classes. for each class the characteristic principle is presented and examples are given. Finally a specific sensor, based on a tuning fork for automotive applications with a sensitivity of 250(mu) V/degrees is described in detail.

  12. System Detects Vibrational Instabilities

    Science.gov (United States)

    Bozeman, Richard J., Jr.

    1990-01-01

    Sustained vibrations at two critical frequencies trigger diagnostic response or shutdown. Vibration-analyzing electronic system detects instabilities of combustion in rocket engine. Controls pulse-mode firing of engine and identifies vibrations above threshold amplitude at 5.9 and/or 12kHz. Adapted to other detection and/or control schemes involving simultaneous real-time detection of signals above or below preset amplitudes at two or more specified frequencies. Potential applications include rotating machinery and encoders and decoders in security systems.

  13. Análisis de la eficiencia del sistema de aislamiento de vibraciones de grupos electrógenos MAN 18 V48/60 B // Efficiency analysis of vibration isolation system installed on engine generator sets type MAN 18 V48/60 b

    Directory of Open Access Journals (Sweden)

    Evelio Palomino‐Marín

    2011-01-01

    all the engine generator sets type MAN 18 V48/60 B which are installed in aCuban Power Plant. Cracks with unknown cause have been present on an engine and after a priorevaluation; the vibroisolation system seems to be a possible cause. That’s why vibration spectrawhere registered over and under each vibration isolator, evaluating isolation efficiency in a bandwidthof interest. As preliminary results it was found that some frequencies do not exhibit well efficiencylevels having on this paper an alternate methodology for similar researches.Key words: vibration isolators, vibration isolation, engine generator sets.

  14. Review of vibration effect during piling installation to adjacent structure

    Science.gov (United States)

    Rahman, Nurul Aishah Abd; Musir, Adhilla Ainun; Dahalan, Nurol Huda; Ghani, Abdul Naser Abdul; Khalil, Muhamad Kasimi Abd

    2017-12-01

    Basically, many major structures across the world such as towers, high rise building, houses and bridges utilize pile as a support material. The use of pile is important to strengthen the structures. However, this has led to another problem to the nearest surrounding structures resulted from pile driving. As part of a construction work, unavoidable pile driving activity generates a vibration towards the surrounding structures if uncontrolled may cause damage to the adjacent structure. As the current construction works are frequently located in urban areas where the distance between the nearest building structures is not far, vibration may cause damage to nearby structures. Knowing which part of the building that is mostly affected by various vibration patterns from the impact of pile driving is crucial. Thus, it is very important to predict the impact of vibration during piling installation work. This paper reviews the vibrations generated by piling activity toward surrounding structures in terms sources of vibration, impact of piling installation, pile-soil interaction, and factors affecting the vibration impact of building as well as to study the parameters involved in vibration generation during piling works.

  15. PREFACE: Vibrations at surfaces Vibrations at surfaces

    Science.gov (United States)

    Rahman, Talat S.

    2011-12-01

    This special issue is dedicated to the phenomenon of vibrations at surfaces—a topic that was indispensible a couple of decades ago, since it was one of the few phenomena capable of revealing the nature of binding at solid surfaces. For clean surfaces, the frequencies of modes with characteristic displacement patterns revealed how surface geometry, as well as the nature of binding between atoms in the surface layers, could be different from that in the bulk solid. Dispersion of the surface phonons provided further measures of interatomic interactions. For chemisorbed molecules on surfaces, frequencies and dispersion of the vibrational modes were also critical for determining adsorption sites. In other words, vibrations at surfaces served as a reliable means of extracting information about surface structure, chemisorption and overlayer formation. Experimental techniques, such as electron energy loss spectroscopy and helium-atom-surface scattering, coupled with infra-red spectroscopy, were continually refined and their resolutions enhanced to capture subtleties in the dynamics of atoms and molecules at surfaces. Theoretical methods, whether based on empirical and semi-empirical interatomic potential or on ab initio electronic structure calculations, helped decipher experimental observations and provide deeper insights into the nature of the bond between atoms and molecules in regions of reduced symmetry, as encountered on solid surfaces. Vibrations at surfaces were thus an integral part of the set of phenomena that characterized surface science. Dedicated workshops and conferences were held to explore the variety of interesting and puzzling features revealed in experimental and theoretical investigations of surface vibrational modes and their dispersion. One such conference, Vibrations at Surfaces, first organized by Harald Ibach in Juelich in 1980, continues to this day. The 13th International Conference on Vibrations at Surfaces was held at the University of

  16. Vibration Theory, Vol. 3

    DEFF Research Database (Denmark)

    Nielsen, Søren R. K.

    The present textbook has been written based on previous lecture notes for a course on stochastic vibration theory that is being given on the 9th semester at Aalborg University for M. Sc. students in structural engineering. The present 4th edition of this textbook on linear stochastic vibration th...... theory is unchanged in comparison to the 3rd edition. Only a few errors have been corrected.......The present textbook has been written based on previous lecture notes for a course on stochastic vibration theory that is being given on the 9th semester at Aalborg University for M. Sc. students in structural engineering. The present 4th edition of this textbook on linear stochastic vibration...

  17. Improved Laser Vibration Radar

    National Research Council Canada - National Science Library

    Hilaire, Pierre

    1998-01-01

    .... This thesis reconfigured an existing CO2 laboratory laser radar system that is capable of measuring the frequencies of vibration of a simulated target into a more compact and rugged form for field testing...

  18. NIF Ambient Vibration Measurements

    International Nuclear Information System (INIS)

    Noble, C.R.; Hoehler, M.S.; S.C. Sommer

    1999-01-01

    LLNL has an ongoing research and development project that includes developing data acquisition systems with remote wireless communication for monitoring the vibrations of large civil engineering structures. In order to establish the capability of performing remote sensing over an extended period of time, the researchers needed to apply this technology to a real structure. The construction of the National Ignition Facility provided an opportunity to test the data acquisition system on a large structure to monitor whether the facility is remaining within the strict ambient vibration guidelines. This document will briefly discuss the NIF ambient vibration requirements and summarize the vibration measurements performed during the Spring and Summer of 1999. In addition, a brief description of the sensors and the data acquisition systems will be provided in Appendix B

  19. A vibration sieve

    Energy Technology Data Exchange (ETDEWEB)

    Alekhin, S.A.; Denisenko, V.V.; Dzhalalov, M.G.; Kirichek, F.P.; Pitatel, Yu.A.; Prokopov, L.I.; Tikhonov, Yu.P.

    1982-01-01

    A vibration sieve is proposed which includes a vibration drive, a body and a screen installed on shock absorbers, a device for washing out the screen, and a subassembly for loading the material. To increase the operational reliability and effectiveness of the vibration sieve by improving the cleaning of the screen, the loading subassembly is equipped with a baffle with a lever which is hinged to it. The device for washing out the screen is made in the form of an electromagnet with a connecting rod, a switch and an eccentric, a friction ratchet mechanism and sprinkling systems. Here, the latter are interconnected, using a connecting rod, while the sprinkling system is installed on rollers under the screen. The electromagnetic switch is installed under the lever. The body is made with grooves for installing the sprinkling system. The vibration sieve is equipped with a switch which interacts with the connecting rod. The friction ratchet mechanism is equipped with a lug.

  20. Distributed bearing fault diagnosis based on vibration analysis

    Science.gov (United States)

    Dolenc, Boštjan; Boškoski, Pavle; Juričić, Đani

    2016-01-01

    Distributed bearing faults appear under various circumstances, for example due to electroerosion or the progression of localized faults. Bearings with distributed faults tend to generate more complex vibration patterns than those with localized faults. Despite the frequent occurrence of such faults, their diagnosis has attracted limited attention. This paper examines a method for the diagnosis of distributed bearing faults employing vibration analysis. The vibrational patterns generated are modeled by incorporating the geometrical imperfections of the bearing components. Comparing envelope spectra of vibration signals shows that one can distinguish between localized and distributed faults. Furthermore, a diagnostic procedure for the detection of distributed faults is proposed. This is evaluated on several bearings with naturally born distributed faults, which are compared with fault-free bearings and bearings with localized faults. It is shown experimentally that features extracted from vibrations in fault-free, localized and distributed fault conditions form clearly separable clusters, thus enabling diagnosis.

  1. Experimental Study on Piezoelectric Energy Harvesting from Vortex-Induced Vibrations and Wake-Induced Vibrations

    Directory of Open Access Journals (Sweden)

    Min Zhang

    2016-01-01

    Full Text Available A rigid circular cylinder with two piezoelectric beams attached on has been tested through vortex-induced vibrations (VIV and wake-induced vibrations (WIV by installing a big cylinder fixed upstream, in order to study the influence of the different flow-induced vibrations (FIV types. The VIV test shows that the output voltage increases with the increases of load resistance; an optimal load resistance exists for the maximum output power. The WIV test shows that the vibration of the small cylinder is controlled by the vortex frequency of the large one. There is an optimal gap of the cylinders that can obtain the maximum output voltage and power. For a same energy harvesting device, WIV has higher power generation capacity; then the piezoelectric output characteristics can be effectively improved.

  2. Structural Stability and Vibration

    DEFF Research Database (Denmark)

    Wiggers, Sine Leergaard; Pedersen, Pauli

    This book offers an integrated introduction to the topic of stability and vibration. Strikingly, it describes stability as a function of boundary conditions and eigenfrequency as a function of both boundary conditions and column force. Based on a post graduate course held by the author at the Uni...... and their derivation, thus stimulating them to write interactive and dynamic programs to analyze instability and vibrational modes....

  3. 2008 Vibrational Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Philip J. Reid

    2009-09-21

    The conference focuses on using vibrational spectroscopy to probe structure and dynamics of molecules in gases, liquids, and interfaces. The goal is to bring together a collection of researchers who share common interests and who will gain from discussing work at the forefront of several connected areas. The intent is to emphasize the insights and understanding that studies of vibrations provide about a variety of systems.

  4. Vibration Energy Harvesting Potential for Turbomachinery Applications

    Directory of Open Access Journals (Sweden)

    Adrian STOICESCU

    2018-03-01

    Full Text Available The vibration energy harvesting process represents one of the research directions for increasing power efficiency of electric systems, increasing instrumentation nodes autonomy in hard to reach locations and decreasing total system mass by eliminating cables and higher-power adapters. Research based on the possibility of converting vibration energy into useful electric energy is used to evaluate the potential of its use on turbomachinery applications. Aspects such as the structure and characteristics of piezoelectric generators, harvesting networks, their setup and optimization, are considered. Finally, performance test results are shown using piezoelectric systems on a turbine engine.

  5. Vibrational spectroscopic study of fluticasone propionate

    Science.gov (United States)

    Ali, H. R. H.; Edwards, H. G. M.; Kendrick, J.; Scowen, I. J.

    2009-03-01

    Fluticasone propionate is a synthetic glucocorticoid with potent anti-inflammatory activity that has been used effectively in the treatment of chronic asthma. The present work reports a vibrational spectroscopic study of fluticasone propionate and gives proposed molecular assignments on the basis of ab initio calculations using BLYP density functional theory with a 6-31G* basis set and vibrational frequencies predicted within the quasi-harmonic approximation. Several spectral features and band intensities are explained. This study generated a library of information that can be employed to aid the process monitoring of fluticasone propionate.

  6. Sensitivity improvement techniques for micromechanical vibrating accelerometers

    Directory of Open Access Journals (Sweden)

    Vtorushin Sergey

    2016-01-01

    Full Text Available The paper presents the problems of detecting a desired signal generated by micromechanical vibrating accelerometer. Three detection methods, namely frequency, amplitude and phase are considered in this paper. These methods are used in micromechanical vibrating accelerometers that incorporate a force sensitive element which transforms measured acceleration into the output signal. Investigations are carried out using the ANSYS finite element program and MATLAB/Simulink support package. Investigation results include the comparative analysis of the output signal characteristics obtained by the different detection methods.

  7. Mechanical vibration to electrical energy converter

    Science.gov (United States)

    Kellogg, Rick Allen [Tijeras, NM; Brotz, Jay Kristoffer [Albuquerque, NM

    2009-03-03

    Electromechanical devices that generate an electrical signal in response to an external source of mechanical vibrations can operate as a sensor of vibrations and as an energy harvester for converting mechanical vibration to electrical energy. The devices incorporate a magnet that is movable through a gap in a ferromagnetic circuit, wherein a coil is wound around a portion of the ferromagnetic circuit. A flexible coupling is used to attach the magnet to a frame for providing alignment of the magnet as it moves or oscillates through the gap in the ferromagnetic circuit. The motion of the magnet can be constrained to occur within a substantially linear range of magnetostatic force that develops due to the motion of the magnet. The devices can have ferromagnetic circuits with multiple arms, an array of magnets having alternating polarity and, encompass micro-electromechanical (MEM) devices.

  8. Femtosecond noncollinear SFG dynamics in autocorrelator setup at low level of photons

    Science.gov (United States)

    Tenishev, Vladimir P.; Persson, A.; Larsson, J.

    2004-06-01

    We report here the characteristics of noncollinear sum frequency generation in nonlinear KDP crystals by ultrashort (80 fsec) IR pulses irradiated by the intense Ti:Sapphire laser and their behavior in single shot auto-crosscorrelator (ACC) configuration. In particular we study the case where one of the beams is very weak. Our aim is to develop a procedure to provide delay time signal between light pulses for time resolved pump probe experiments based on the extraction of the phase-matched SHG spatial distribution by means of pulse shape analysis technique. We intend to apply these results to synchronize a weak short-pulse source and an intense Ti:Sapphire laser and to measure the pulse time jitter between them.

  9. Vibration transducer calibration techniques

    Science.gov (United States)

    Brinkley, D. J.

    1980-09-01

    Techniques for the calibration of vibration transducers used in the Aeronautical Quality Assurance Directorate of the British Ministry of Defence are presented. Following a review of the types of measurements necessary in the calibration of vibration transducers, the performance requirements of vibration transducers, which can be used to measure acceleration, velocity or vibration amplitude, are discussed, with particular attention given to the piezoelectric accelerometer. Techniques for the accurate measurement of sinusoidal vibration amplitude in reference-grade transducers are then considered, including the use of a position sensitive photocell and the use of a Michelson laser interferometer. Means of comparing the output of working-grade accelerometers with that of previously calibrated reference-grade devices are then outlined, with attention given to a method employing a capacitance bridge technique and a method to be used at temperatures between -50 and 200 C. Automatic calibration procedures developed to speed up the calibration process are outlined, and future possible extensions of system software are indicated.

  10. Flow induced vibrations of piping

    International Nuclear Information System (INIS)

    Gibert, R.J.; Axisa, F.

    1977-01-01

    In order to design the supports of piping systems, estimations of the vibrations induced by the fluid conveyed through the pipes are generally needed. For that purpose it is necessary to calculate the model parameters of liquid containing pipes. In most computer codes, fluid effects are accounted for just by adding the fluid mass to the structure. This may lead to serious errors. This paper presents a method to take into account these effects, by solving a coupled mechanical-acoustical problem: the computer code TEDEL of the C.E.A /D.E.M.T. System, based on the finite-elements method, has been extended to calculate simultaneously the pressure fluctuations in the fluid and the vibrations of the pipe. By this way the mechanical-acoustical coupled eigenmodes of any piping system can be obtained. These eigenmodes are used to determine the response of the system to various sources. Equations have been written in the hypohesis that acoustical wave lengths remain large compared to the diameter of the pipe. The method has been checked by an experiment performed on the GASCOGNE loop at D.E.M.T. The piping system under test consists of a tube with four elbows. The circuit is ended at each extremity by a large vessel which performs acoustical isolation by generating modes for the pressure. Excitation of the circuit is caused by a valve located near the downstream vessel. This provides an efficient localised broad band acoustical source. The comparison between the test results and the calculations has shown that the low frequency resonant characteristics of the pipe and the vibrational amplitude at various flow-rates can be correctly predicted

  11. Nonlinear resonance ultrasonic vibrations in Czochralski-silicon wafers

    Science.gov (United States)

    Ostapenko, S.; Tarasov, I.

    2000-04-01

    A resonance effect of generation of subharmonic acoustic vibrations is observed in as-grown, oxidized, and epitaxial silicon wafers. Ultrasonic vibrations were generated into a standard 200 mm Czochralski-silicon (Cz-Si) wafer using a circular ultrasound transducer with major frequency of the radial vibrations at about 26 kHz. By tuning frequency (f) of the transducer within a resonance curve, we observed a generation of intense f/2 subharmonic acoustic mode assigned as a "whistle." The whistle mode has a threshold amplitude behavior and narrow frequency band. The whistle is attributed to a nonlinear acoustic vibration of a silicon plate. It is demonstrated that characteristics of the whistle mode are sensitive to internal stress and can be used for quality control and in-line diagnostics of oxidized and epitaxial Cz-Si wafers.

  12. Recovering Intrinsic Fragmental Vibrations Using the Generalized Subsystem Vibrational Analysis.

    Science.gov (United States)

    Tao, Yunwen; Tian, Chuan; Verma, Niraj; Zou, Wenli; Wang, Chao; Cremer, Dieter; Kraka, Elfi

    2018-05-08

    Normal vibrational modes are generally delocalized over the molecular system, which makes it difficult to assign certain vibrations to specific fragments or functional groups. We introduce a new approach, the Generalized Subsystem Vibrational Analysis (GSVA), to extract the intrinsic fragmental vibrations of any fragment/subsystem from the whole system via the evaluation of the corresponding effective Hessian matrix. The retention of the curvature information with regard to the potential energy surface for the effective Hessian matrix endows our approach with a concrete physical basis and enables the normal vibrational modes of different molecular systems to be legitimately comparable. Furthermore, the intrinsic fragmental vibrations act as a new link between the Konkoli-Cremer local vibrational modes and the normal vibrational modes.

  13. Vibrations in orthopedics.

    Science.gov (United States)

    Nokes, L D; Thorne, G C

    1988-01-01

    Measurements of various mechanical properties of skeletal material using vibration techniques have been reported. The purposes of such investigations include the monitoring of pathogenic disorders such as osteoporosis, the rate and extent of fracture healing, and the status of internal fixations. Early investigations pioneered the application of conventional vibration measurement equipment to biological systems. The more recent advent of the microcomputer has made available to research groups more sophisticated techniques for data acquisition and analysis. The economical advantages of such equipment has led to the development of portable research instrumentation which lends itself to use in a clinical environment. This review article reports on the developments and progression of the various vibrational techniques and theories as applied to musculoskeletal systems.

  14. Observation of sum-frequency-generation-induced cascaded four-wave mixing using two crossing femtosecond laser pulses in a 0.1 mm beta-barium-borate crystal.

    Science.gov (United States)

    Liu, Weimin; Zhu, Liangdong; Fang, Chong

    2012-09-15

    We demonstrate the simultaneous generation of multicolor femtosecond laser pulses spanning the wavelength range from UV to near IR in a 0.1 mm Type I beta-barium borate crystal from 800 nm fundamental and weak IR super-continuum white light (SCWL) pulses. The multicolor broadband laser pulses observed are attributed to two concomitant cascaded four-wave mixing (CFWM) processes as corroborated by calculation: (1) directly from the two incident laser pulses; (2) by the sum-frequency generation (SFG) induced CFWM process (SFGFWM). The latter signal arises from the interaction between the frequency-doubled fundamental pulse (400 nm) and the SFG pulse generated in between the fundamental and IR-SCWL pulses. The versatility and simplicity of this spatially dispersed multicolor self-compressed laser pulse generation offer compact and attractive methods to conduct femtosecond stimulated Raman spectroscopy and time-resolved multicolor spectroscopy.

  15. Vibrational spectra of aminoacetonitrile

    International Nuclear Information System (INIS)

    Bak, B.; Hansen, E.L.; Nicolaisen, F.M.; Nielsen, O.F.

    1975-01-01

    The preparation of pure, stable aminoacetonitrile(1-amino, 1'-cyanomethane)CH 2 NH 2 CN (1) is described. The Raman spectrum, now complete, and a novel infrared spectrum extending over the 50-3600 cm -1 region are reported. A tentative normal vibration analysis is presented and supported by Raman and infrared data from the spectra of CH 2 NHDCN (2) and CH 2 ND 2 CN (3). The predominance of the trans rotamer may be attributed to intramolecular hydrogen bonding but this is too unimportant to influence the vibrational frequencies of gaseous 1, 2, and 3. However, large gas/liquid frequency shifts occur. (author)

  16. Vibrations and waves

    CERN Document Server

    Kaliski, S

    2013-01-01

    This book gives a comprehensive overview of wave phenomena in different media with interacting mechanical, electromagnetic and other fields. Equations describing wave propagation in linear and non-linear elastic media are followed by equations of rheological models, models with internal rotational degrees of freedom and non-local interactions. Equations for coupled fields: thermal, elastic, electromagnetic, piezoelectric, and magneto-spin with adequate boundary conditions are also included. Together with its companion volume Vibrations and Waves. Part A: Vibrations this work provides a wealth

  17. Vibration Theory, Vol. 3

    DEFF Research Database (Denmark)

    Nielsen, Søren R. K.

    The present textbook has been written based on previous lecture notes for a course on stochastic vibration theory that is being given on the 9th semester at Aalborg University for M. Sc. students in structural engineering. The present 2nd edition of this textbook on linear stochastic vibration th...... theory is basically unchanged in comparison to the 1st edition. Only section 4.2 on single input - single output systems and chapter 6 on offshore structures have been modified in order to enhance the clearness....

  18. Vibration analysis for trending ageing in rotating machinery

    International Nuclear Information System (INIS)

    Sinha, S.K.; Rama Rao, A.

    2006-01-01

    The need for condition monitoring system for important equipment and machinery is a growing requirement in every industry and more so in the nuclear power plants because of stringent safety requirements. This is largely because of the inherent benefit of being able to promote predictive maintenance practice rather than uneconomical preventive maintenance practice in the plant. Forerunner among the condition monitoring parameter is vibration signatures measured on a rotating machine. It is known that every moving element in a rotating machine generates vibration signal that is uniquely its own. Detection of such signals and monitoring the changing conditions in a machine through vibration analysis is a technique involving the knowledge of engineering art and the mathematical theory. This blend of sound engineering judgement and vibration data interpretation skill is in fact the basis of vibration diagnostic techniques. (author)

  19. Researches Concerning to Minimize Vibrations when Processing Normal Lathe

    Directory of Open Access Journals (Sweden)

    Lenuța Cîndea

    2015-09-01

    Full Text Available In the cutting process, vibration is inevitable appearance, and in situations where the amplitude exceeds the limits of precision dimensional and shape of the surfaces generated vibrator phenomenon is detrimental.Field vibration is an issue of increasingly developed, so the futures will a better understanding of them and their use even in other sectors.The paper developed experimental measurement of vibrations at the lathe machining normal. The scheme described kinematical machine tool, cutting tool, cutting conditions, presenting experimental facility for measuring vibration occurring at turning. Experimental results have followed measurement of amplitude, which occurs during interior turning the knife without silencer incorporated. The tests were performed continuously for different speed, feed and depth of cut.

  20. Experimental Analysis of a Piezoelectric Energy Harvesting System for Harmonic, Random, and Sine on Random Vibration

    Directory of Open Access Journals (Sweden)

    Jackson W. Cryns

    2013-01-01

    Full Text Available Harvesting power with a piezoelectric vibration powered generator using a full-wave rectifier conditioning circuit is experimentally compared for varying sinusoidal, random, and sine on random (SOR input vibration scenarios; the implications of source vibration characteristics on harvester design are discussed. The rise in popularity of harvesting energy from ambient vibrations has made compact, energy dense piezoelectric generators commercially available. Much of the available literature focuses on maximizing harvested power through nonlinear processing circuits that require accurate knowledge of generator internal mechanical and electrical characteristics and idealization of the input vibration source, which cannot be assumed in general application. Variations in source vibration and load resistance are explored for a commercially available piezoelectric generator. The results agree with numerical and theoretical predictions in the previous literature for optimal power harvesting in sinusoidal and flat broadband vibration scenarios. Going beyond idealized steady-state sinusoidal and flat random vibration input, experimental SOR testing allows for more accurate representation of real world ambient vibration. It is shown that characteristic interactions from more complex vibration sources significantly alter power generation and processing requirements by varying harvested power, shifting optimal conditioning impedance, inducing voltage fluctuations, and ultimately rendering idealized sinusoidal and random analyses incorrect.

  1. Heterogeneous Dynamics of Coupled Vibrations

    NARCIS (Netherlands)

    Cringus, Dan; Jansen, Thomas I. C.; Pshenichnikov, Maxim S.; Schoenlein, RW; Corkum, P; DeSilvestri, S; Nelson, KA; Riedle, E

    2009-01-01

    Frequency-dependent dynamics of coupled stretch vibrations of a water molecule are revealed by 2D IR correlation spectroscopy. These are caused by non-Gaussian fluctuations of the environment around the individual OH stretch vibrations.

  2. Vibration-induced particle formation during yogurt fermentation - Industrial vibration measurements and development of an experimental setup.

    Science.gov (United States)

    Körzendörfer, Adrian; Temme, Philipp; Nöbel, Stefan; Schlücker, Eberhard; Hinrichs, Jörg

    2016-07-01

    The aim of the study was to investigate the effects of vibrations during yogurt fermentation. Machinery such as pumps and switching valves generate vibrations that may disturb the gelation by inducing large particles. Oscillation measurements on an industrial yogurt production line showed that oscillations are transferred from pumps right up to the fermentation tanks. An experimental setup (20L) was developed to study the effect of vibrations systematically. The fermenters were decoupled with air springs to enable reference fermentations under idle conditions. A vibration exciter was used to stimulate the fermenters. Frequency sweeps (25-1005Hz, periodic time 10s) for 20min from pH5.4 induced large particles. The number of visible particles was significantly increased from 35±4 (reference) to 89±9 particles per 100g yogurt. Rheological parameters of the stirred yogurt samples were not influenced by vibrations. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Structural Stability and Vibration

    DEFF Research Database (Denmark)

    Wiggers, Sine Leergaard; Pedersen, Pauli

    at the University of Southern Denmark, it reports on fundamental formulas and makes uses of graphical representation to promote understanding. Thanks to the emphasis put on analytical methods and numerical results, the book is meant to make students and engineers familiar with all fundamental equations...... and their derivation, thus stimulating them to write interactive and dynamic programs to analyze instability and vibrational modes....

  4. Vibrational Spectroscopy and Astrobiology

    Science.gov (United States)

    Chaban, Galina M.; Kwak, D. (Technical Monitor)

    2001-01-01

    Role of vibrational spectroscopy in solving problems related to astrobiology will be discussed. Vibrational (infrared) spectroscopy is a very sensitive tool for identifying molecules. Theoretical approach used in this work is based on direct computation of anharmonic vibrational frequencies and intensities from electronic structure codes. One of the applications of this computational technique is possible identification of biological building blocks (amino acids, small peptides, DNA bases) in the interstellar medium (ISM). Identifying small biological molecules in the ISM is very important from the point of view of origin of life. Hybrid (quantum mechanics/molecular mechanics) theoretical techniques will be discussed that may allow to obtain accurate vibrational spectra of biomolecular building blocks and to create a database of spectroscopic signatures that can assist observations of these molecules in space. Another application of the direct computational spectroscopy technique is to help to design and analyze experimental observations of ice surfaces of one of the Jupiter's moons, Europa, that possibly contains hydrated salts. The presence of hydrated salts on the surface can be an indication of a subsurface ocean and the possible existence of life forms inhabiting such an ocean.

  5. Vibrations and Eigenvalues

    Indian Academy of Sciences (India)

    The vibrating string problem is the source of much mathe- matics and physics. ... ing this science [mechanics],and the art of solving the problems pertaining to it, to .... used tools for finding maxima and minima of functions of several variables.

  6. Man-Induced Vibrations

    DEFF Research Database (Denmark)

    Jönsson, Jeppe; Hansen, Lars Pilegaard

    1994-01-01

    work has been done on the measurement of the exact load functions and related reponse analysis. A recent work using a spectral description has been performed by Per-Erik Erikson and includes a good literature survey. Bachmann and Ammann give a good overview of vibrations caused by human activity. Other...

  7. General principles of vibrational spectroscopies

    NARCIS (Netherlands)

    Weckhuysen, B.M.; Schoonheydt, R.A.

    2000-01-01

    Atoms in molecules and solids do not remain in fixed relative positions, but vibrate about some mean position. This vibrational motion is quantized and at room temperature, most of the molecules in a given sample are in their lowest vibrational state. Absorption of electromagnetic radiation with

  8. High-Temperature Vibration Damper

    Science.gov (United States)

    Clarke, Alan; Litwin, Joel; Krauss, Harold

    1987-01-01

    Device for damping vibrations functions at temperatures up to 400 degrees F. Dampens vibrational torque loads as high as 1,000 lb-in. but compact enough to be part of helicopter rotor hub. Rotary damper absorbs energy from vibrating rod, dissipating it in turbulent motion of viscous hydraulic fluid forced by moving vanes through small orifices.

  9. Effect of Ultrasonic Vibration on Proliferation and Differentiation of Cells

    Directory of Open Access Journals (Sweden)

    Haruka Hino

    2016-12-01

    Full Text Available The effect of mechanical stimulation of vibration on proliferation and differentiation of cells has been studied in vitro. To apply the vibration on the cells, a piezoelectric element was attached on the outside surface of the bottom of the culture plate of six wells. The piezoelectric element was vibrated by sinusoidally alternating voltage at 1.0 MHz generated by a function generator. Five kinds of cells were used in the experiment: C2C12 (mouse myoblast cell, L929 (fibroblast connective tissue of mouse, Hepa1-6 (mouse hepatoma cell, HUVEC (human umbilical vein endothelial cell, and Neuro-2a (mouse neural crest-derived cell line. After the incubation for 24 hours, cells were exposed to the ultrasonic vibration intermittently for three days: for thirty minutes per day. At the end of the experiment, the number of cells was counted by colorimetric method with a microplate photometer. In the case of Neuro-2a, the total length of the neurite was calculated at the microscopic image. The experimental study shows following results. Cells are exfoliated by the strong vibration. Proliferation and differentiation of cells are accelerated with mild vibration. The optimum intensity of vibration depends on the kind of cells.

  10. Detection of the high vibration origin in the body of an electrical generator driven by steam turbine applying diagnostic techniques; Deteccion del origen de alta vibracion en el cuerpo de un generador electrico accionado por turbinas de vapor aplicando tecnicas de diagnostico

    Energy Technology Data Exchange (ETDEWEB)

    Martinez Bravo, Fernando (Mexico)

    2007-11-15

    One of the problems that electric generators present is the high vibration due to causes that can go from simple mechanical unbalance, misalignment, mechanical relaxation, resonance or some other interaction that can influence in the system. In this document is presented the vibration analysis of an electric generator with a capacity of 350 MW, driven by a steam turbine composed of three stages (high pressure, intermediate pressure and low pressure) connected to the electric generator through a rigid connection. [Spanish] Uno de los problemas que se presentan en los generadores electricos es la alta vibracion debida a causas que pueden ir desde un simple desbalance mecanico, desalineamiento, aflojamiento mecanico, resonancia o alguna otra interaccion que pueda influir en el sistema. Se presenta en este documento el analisis de vibracion de un generador electrico con una capacidad de 350 MW, impulsado por una turbina de vapor compuesta de tres etapas (alta presion, presion intermedia y baja presion) acopladas al generador electrico a traves de un acoplamiento rigido.

  11. Integrated predictive maintenance program vibration and lube oil analysis: Part I - history and the vibration program

    International Nuclear Information System (INIS)

    Maxwell, H.

    1996-01-01

    This paper is the first of two papers which describe the Predictive Maintenance Program for rotating machines at the Palo Verde Nuclear Generating Station. The organization has recently been restructured and significant benefits have been realized by the interaction, or open-quotes synergyclose quotes between the Vibration Program and the Lube Oil Analysis Program. This paper starts with the oldest part of the program - the Vibration Program and discusses the evolution of the program to its current state. The open-quotes Vibrationclose quotes view of the combined program is then presented

  12. Universality in the dynamical properties of seismic vibrations

    Science.gov (United States)

    Chatterjee, Soumya; Barat, P.; Mukherjee, Indranil

    2018-02-01

    We have studied the statistical properties of the observed magnitudes of seismic vibration data in discrete time in an attempt to understand the underlying complex dynamical processes. The observed magnitude data are taken from six different geographical locations. All possible magnitudes are considered in the analysis including catastrophic vibrations, foreshocks, aftershocks and commonplace daily vibrations. The probability distribution functions of these data sets obey scaling law and display a certain universality characteristic. To investigate the universality features in the observed data generated by a complex process, we applied Random Matrix Theory (RMT) in the framework of Gaussian Orthogonal Ensemble (GOE). For all these six places the observed data show a close fit with the predictions of RMT. This reinforces the idea of universality in the dynamical processes generating seismic vibrations.

  13. A Novel Ropes-DrivenWideband Piezoelectric Vibration Energy Harvester

    Directory of Open Access Journals (Sweden)

    Jinhui Zhang

    2016-12-01

    Full Text Available This paper presents a novel piezoelectric vibration energy harvester (PVEH in which a high-frequency generating beam (HFGB is driven by an array of low-frequency driving beams (LFDBs using ropes. Two mechanisms based on frequency upconversion and multimodal harvesting work together to broaden the frequency bandwidth of the proposed vibration energy harvester (VEH. The experimental results show that the output power of generating beam (GB remains unchanged with the increasing number of driving beams (DBs, compared with the traditional arrays of beams vibration energy harvester (AB-VEH, and the output power and bandwidth behavior can be adjusted by parameters such as acceleration, rope margin, and stiffness of LFDBs, which shows the potential to achieve unlimited wideband vibration energy-harvesting for a variable environment.

  14. The effects of vibration-reducing gloves on finger vibration

    Science.gov (United States)

    Welcome, Daniel E.; Dong, Ren G.; Xu, Xueyan S.; Warren, Christopher; McDowell, Thomas W.

    2015-01-01

    Vibration-reducing (VR) gloves have been used to reduce the hand-transmitted vibration exposures from machines and powered hand tools but their effectiveness remains unclear, especially for finger protection. The objectives of this study are to determine whether VR gloves can attenuate the vibration transmitted to the fingers and to enhance the understanding of the mechanisms of how these gloves work. Seven adult male subjects participated in the experiment. The fixed factors evaluated include hand force (four levels), glove condition (gel-filled, air bladder, no gloves), and location of the finger vibration measurement. A 3-D laser vibrometer was used to measure the vibrations on the fingers with and without wearing a glove on a 3-D hand-arm vibration test system. This study finds that the effect of VR gloves on the finger vibration depends on not only the gloves but also their influence on the distribution of the finger contact stiffness and the grip effort. As a result, the gloves increase the vibration in the fingertip area but marginally reduce the vibration in the proximal area at some frequencies below 100 Hz. On average, the gloves reduce the vibration of the entire fingers by less than 3% at frequencies below 80 Hz but increase at frequencies from 80 to 400 Hz. At higher frequencies, the gel-filled glove is more effective at reducing the finger vibration than the air bladder-filled glove. The implications of these findings are discussed. Relevance to industry Prolonged, intensive exposure to hand-transmitted vibration can cause hand-arm vibration syndrome. Vibration-reducing gloves have been used as an alternative approach to reduce the vibration exposure. However, their effectiveness for reducing finger-transmitted vibrations remains unclear. This study enhanced the understanding of the glove effects on finger vibration and provided useful information on the effectiveness of typical VR gloves at reducing the vibration transmitted to the fingers. The new

  15. Environmental vibration reduction utilizing an array of mass scatterers

    DEFF Research Database (Denmark)

    Peplow, Andrew; Andersen, Lars Vabbersgaard; Bucinskas, Paulius

    2017-01-01

    .g. concrete or stone blocks, specially designed brick walls, etc.). The natural frequencies of vibration for such blocks depend on the local ground stiffness and on the mass of the blocks which can be chosen to provide resonance at specified frequencies. This work concerns the effectiveness of such “blocking......Ground vibration generated by rail and road traffic is a major source of environmental noise and vibration pollution in the low-frequency range. A promising and cost effective mitigation method can be the use of heavy masses placed as a periodic array on the ground surface near the road or track (e...

  16. DOE/ANL/HTRI heat exchanger tube vibration data bank

    International Nuclear Information System (INIS)

    Halle, H.; Chenoweth, J.M.; Wambsganss, M.W.

    1980-02-01

    Development of a new heat exchanger tube vibration data bank at Argonne National Laboratory is described. Comprehensive case histories on heat exchangers that have experienced tube-vibration problems and units that have been trouble-free are accumulated and this information is rendered available for evaluation, improvement, and development of vibration-prediction methods and design guidelines. Discussions include difficulties in generating a data bank, data form development, and solicitation efforts. Also included are 15 case histories upon which the data bank will be built. As new case histories are received, they will be assembled and published as addenda to this report

  17. Gerotor and bearing system for whirling mass orbital vibrator

    Energy Technology Data Exchange (ETDEWEB)

    Brett, James Ford; Westermark, Robert Victor; Turner, Jr., Joey Earl; Lovin, Samuel Scott; Cole, Jack Howard; Myers, Will

    2007-02-27

    A gerotor and bearing apparatus for a whirling mass orbital vibrator which generates vibration in a borehole. The apparatus includes a gerotor with an inner gear rotated by a shaft having one less lobe than an outer gear. A whirling mass is attached to the shaft. At least one bearing is attached to the shaft so that the bearing engages at least one sleeve. A mechanism is provided to rotate the inner gear, the mass and the bearing in a selected rotational direction in order to cause the mass, the inner gear, and the bearing to backwards whirl in an opposite rotational direction. The backwards whirling mass creates seismic vibrations.

  18. Multi-Exciter Vibroacoustic Simulation of Hypersonic Flight Vibration

    International Nuclear Information System (INIS)

    GREGORY, DANNY LYNN; CAP, JEROME S.; TOGAMI, THOMAS C.; NUSSER, MICHAEL A.; HOLLINGSHEAD, JAMES RONALD

    1999-01-01

    Many aerospace structures must survive severe high frequency, hypersonic, random vibration during their flights. The random vibrations are generated by the turbulent boundary layer developed along the exterior of the structures during flight. These environments have not been simulated very well in the past using a fixed-based, single exciter input with an upper frequency range of 2 kHz. This study investigates the possibility of using acoustic ardor independently controlled multiple exciters to more accurately simulate hypersonic flight vibration. The test configuration, equipment, and methodology are described. Comparisons with actual flight measurements and previous single exciter simulations are also presented

  19. Experimental Analysis of a Piezoelectric Energy Harvesting System for Harmonic, Random, and Sine on Random Vibration

    Energy Technology Data Exchange (ETDEWEB)

    Cryns, Jackson W.; Hatchell, Brian K.; Santiago-Rojas, Emiliano; Silvers, Kurt L.

    2013-07-01

    Formal journal article Experimental analysis of a piezoelectric energy harvesting system for harmonic, random, and sine on random vibration Abstract: Harvesting power with a piezoelectric vibration powered generator using a full-wave rectifier conditioning circuit is experimentally compared for varying sinusoidal, random and sine on random (SOR) input vibration scenarios. Additionally, the implications of source vibration characteristics on harvester design are discussed. Studies in vibration harvesting have yielded numerous alternatives for harvesting electrical energy from vibrations but piezoceramics arose as the most compact, energy dense means of energy transduction. The rise in popularity of harvesting energy from ambient vibrations has made piezoelectric generators commercially available. Much of the available literature focuses on maximizing harvested power through nonlinear processing circuits that require accurate knowledge of generator internal mechanical and electrical characteristics and idealization of the input vibration source, which cannot be assumed in general application. In this manuscript, variations in source vibration and load resistance are explored for a commercially available piezoelectric generator. We characterize the source vibration by its acceleration response for repeatability and transcription to general application. The results agree with numerical and theoretical predictions for in previous literature that load optimal resistance varies with transducer natural frequency and source type, and the findings demonstrate that significant gains are seen with lower tuned transducer natural frequencies for similar source amplitudes. Going beyond idealized steady state sinusoidal and simplified random vibration input, SOR testing allows for more accurate representation of real world ambient vibration. It is shown that characteristic interactions from more complex vibrational sources significantly alter power generation and power processing

  20. Wireless Inductive Power Device Suppresses Blade Vibrations

    Science.gov (United States)

    Morrison, Carlos R.; Provenza, Andrew J.; Choi, Benjamin B.; Bakhle, Milind A.; Min, James B.; Stefko, George L.; Duffy, Kirsten P.; Fougers, Alan J.

    2011-01-01

    Vibration in turbomachinery can cause blade failures and leads to the use of heavier, thicker blades that result in lower aerodynamic efficiency and increased noise. Metal and/or composite fatigue in the blades of jet engines has resulted in blade destruction and loss of lives. Techniques for suppressing low-frequency blade vibration, such as gtuned circuit resistive dissipation of vibratory energy, h or simply "passive damping," can require electronics incorporating coils of unwieldy dimensions and adding unwanted weight to the rotor. Other approaches, using vibration-dampening devices or damping material, could add undesirable weight to the blades or hub, making them less efficient. A wireless inductive power device (WIPD) was designed, fabricated, and developed for use in the NASA Glenn's "Dynamic Spin Rig" (DSR) facility. The DSR is used to simulate the functionality of turbomachinery. The relatively small and lightweight device [10 lb (approx.=4.5 kg)] replaces the existing venerable and bulky slip-ring. The goal is the eventual integration of this technology into actual turbomachinery such as jet engines or electric power generators, wherein the device will facilitate the suppression of potentially destructive vibrations in fan blades. This technology obviates slip rings, which require cooling and can prove unreliable or be problematic over time. The WIPD consists of two parts: a remote element, which is positioned on the rotor and provides up to 100 W of electrical power to thin, lightweight piezoelectric patches strategically placed on/in fan blades; and a stationary base unit that wirelessly communicates with the remote unit. The base unit supplies inductive power, and also acts as an input and output corridor for wireless measurement, and active control command to the remote unit. Efficient engine operation necessitates minimal disturbance to the gas flow across the turbine blades in any effort to moderate blade vibration. This innovation makes it

  1. Friction interface mechanics and self-induced vibrations

    OpenAIRE

    Wernitz, Boris Alexander

    2013-01-01

    Vibrations in braking systems have been studied since the beginning of the last century and despite several insights, still many phenomena, particularly in the area of friction induced vibrations, are not fully understood. The objective of the actual study was the identification of the complex dynamics in the friction interface of a dry friction brake system. In this context, particular consideration was given to the generation of instabilities and brake squeal. In work presently being ...

  2. Vibration-reducing gloves: transmissibility at the palm of the hand in three orthogonal directions.

    Science.gov (United States)

    McDowell, Thomas W; Dong, Ren G; Welcome, Daniel E; Xu, Xueyan S; Warren, Christopher

    2013-01-01

    Vibration-reducing (VR) gloves are commonly used as a means to help control exposures to hand-transmitted vibrations generated by powered hand tools. The objective of this study was to characterise the vibration transmissibility spectra and frequency-weighted vibration transmissibility of VR gloves at the palm of the hand in three orthogonal directions. Seven adult males participated in the evaluation of seven glove models using a three-dimensional hand-arm vibration test system. Three levels of hand coupling force were applied in the experiment. This study found that, in general, VR gloves are most effective at reducing vibrations transmitted to the palm along the forearm direction. Gloves that are found to be superior at reducing vibrations in the forearm direction may not be more effective in the other directions when compared with other VR gloves. This casts doubts on the validity of the standardised glove screening test. Practitioner Summary: This study used human subjects to measure three-dimensional vibration transmissibility of vibration-reducing gloves at the palm and identified their vibration attenuation characteristics. This study found the gloves to be most effective at reducing vibrations along the forearm direction. These gloves did not effectively attenuate vibration along the handle axial direction.

  3. Natural vibration experimental analysis of Novovoronezhskaya NPP main building

    International Nuclear Information System (INIS)

    Zoubkov, D.; Isaikin, A.; Shablinsky, G.; Lopanchuk, A.; Nefedov, S.

    2005-01-01

    1. Natural vibration frequencies are main characteristics of buildings and structures which allow to give integral estimation of their in-service state. Even relatively small changes of these frequencies as compared to the initially registered values point to serious defects of building structures. In this paper we analyzed natural vibration frequencies and natural modes of the main building (MB) of Novovoronezhskaya NPP operating nuclear unit with WWER-440 type reactor. The MB consists of a reactor compartment (RC), a machine room (MR) and an electric device (ED) unit positioned in between. 2. Natural vibration frequencies and natural modes of the MB were determined experimentally by analyzing its microvibrations caused by operation of basic equipment (turbines, pumps, etc.). Microvibrations of the main building were measured at 12 points. At each point measurements were carried out along two or three mutually perpendicular vibration directions. Spectral analysis of vibration records has been conducted. Identification of natural vibration frequencies was carried out on the basis of the spectral peaks and plotted vibration modes (taking into account operating frequencies of the basic equipment of the power generating unit). On the basis of the measurement results three transverse modes and corresponding natural vibration frequencies of the MB, one longitudinal mode and corresponding natural vibration frequency of the MB and two natural frequencies of vertical vibrations of RC and MR floor trusses (1st and 2nd symmetric forms) were determined. Dynamic characteristics of the main building of NV NPP resulting from full scale researches are supposed to be used as one of building structure stability criteria. (authors)

  4. Flow-induced vibration -- 1994. PVP-Volume 273

    International Nuclear Information System (INIS)

    Au-Yang, M.K.; Fujita, K.

    1994-01-01

    Flow-induced vibration is a subject of practical interest to many engineering disciplines, including the power generation, process, and petrochemical industries. In the nuclear industry, flow-induced vibration reaches a higher level of concern because of safety issues and the huge cost associated with down time and site repair. Not surprisingly, during the last 25 years a tremendous amount of effort has been spent in the study of flow-induced vibration phenomena related to nuclear plant components, notably nuclear steam generator tube banks and nuclear fuel bundles. Yet, in spite of this concentrated effort, the industry is still not free from flow-induced vibration-related problems. This explains why in this volume almost half of the papers address the issue of cross-flow induced vibration in tube bundles, with applications to the nuclear steam generator and nuclear fuel bundles in mind. Unlike 10 or 15 years ago, when flow-induced vibration studies almost always involved experimentation and empirical studies, the advent of high-speed computers has enabled numerical calculation and simulation of this complex phenomenon to take place. Separate abstracts were prepared for 27 papers in this volume

  5. Time-varying output performances of piezoelectric vibration energy harvesting under nonstationary random vibrations

    Science.gov (United States)

    Yoon, Heonjun; Kim, Miso; Park, Choon-Su; Youn, Byeng D.

    2018-01-01

    Piezoelectric vibration energy harvesting (PVEH) has received much attention as a potential solution that could ultimately realize self-powered wireless sensor networks. Since most ambient vibrations in nature are inherently random and nonstationary, the output performances of PVEH devices also randomly change with time. However, little attention has been paid to investigating the randomly time-varying electroelastic behaviors of PVEH systems both analytically and experimentally. The objective of this study is thus to make a step forward towards a deep understanding of the time-varying performances of PVEH devices under nonstationary random vibrations. Two typical cases of nonstationary random vibration signals are considered: (1) randomly-varying amplitude (amplitude modulation; AM) and (2) randomly-varying amplitude with randomly-varying instantaneous frequency (amplitude and frequency modulation; AM-FM). In both cases, this study pursues well-balanced correlations of analytical predictions and experimental observations to deduce the relationships between the time-varying output performances of the PVEH device and two primary input parameters, such as a central frequency and an external electrical resistance. We introduce three correlation metrics to quantitatively compare analytical prediction and experimental observation, including the normalized root mean square error, the correlation coefficient, and the weighted integrated factor. Analytical predictions are in an excellent agreement with experimental observations both mechanically and electrically. This study provides insightful guidelines for designing PVEH devices to reliably generate electric power under nonstationary random vibrations.

  6. Vibration Suppression of Electronic Box by a Dual Function Piezoelectric Energy Harvester-Tuned Vibration Absorber

    Directory of Open Access Journals (Sweden)

    Sajid Rafique

    2014-04-01

    Full Text Available Over the past few years, remarkable developments in piezoelectric materials have motivated many researchers to work in the field of vibration energy harvesting by using piezoelectric beam like smart structures. This paper aimed to present the most recent application of a dual function piezoelectric device which can suppress vibration and harvest vibration energy simultaneously and a brief illustration of conventional mechanical and electrical TVAs (Tuned Vibration Absorber. It is shown that the proposed dual function device combines the benefits of conventional mechanical and electrical TVAs and reduces their relative disadvantages. Conversion of mechanical energy into electrical energy introduces damping and, hence, the optimal damping required by this TVA is generated by the energy harvesting effects. This paper presents the methodology of implementing the theory of 'electromechanical' TVAs to suppress the response of any real world structure. The work also illustrates the prospect of extensive applications of such novel "electromechanical" TVAs in defence and industry. The results show that the optimum degree of vibration suppression of an electronic box is achieved by this dual function TVA through suitable tuning of the attached electrical circuitry

  7. Vibration suppression of electronic box by a dual function piezoelectric energy harvester-tuned vibration absorber

    International Nuclear Information System (INIS)

    Rafique, S.; Shah, S.

    2014-01-01

    Over the past few years, remarkable developments in piezoelectric materials have motivated many researchers to work in the field of vibration energy harvesting by using piezoelectric beam like smart structures. This paper aimed to present the most recent application of a dual function piezoelectric device which can suppress vibration and harvest vibration energy simultaneously and a brief illustration of conventional mechanical and electrical TVAs (Tuned Vibration Absorber). It is shown that the proposed dual function device combines the benefits of conventional mechanical and electrical TVAs and reduces their relative disadvantages. Conversion of mechanical energy into electrical energy introduces damping and, hence, the optimal damping required by this TVA is generated by the energy harvesting effects. This paper presents the methodology of implementing the theory of electromechanical TVAs to suppress the response of any real world structure. The work also illustrates the prospect of extensive applications of such novel electromechanical TVAs in defence and industry. The results show that the optimum degree of vibration suppression of an electronic box is achieved by this dual function TVA through suitable tuning of the attached electrical circuitry. (author)

  8. Vibration of fuel bundles

    International Nuclear Information System (INIS)

    Chen, S.S.

    1975-06-01

    Several mathematical models have been proposed for calculating fuel rod responses in axial flows based on a single rod consideration. The spacing between fuel rods in liquid metal fast breeder reactors is small; hence fuel rods will interact with one another due to fluid coupling. The objective of this paper is to study the coupled vibration of fuel bundles. To account for the fluid coupling, a computer code, AMASS, is developed to calculate added mass coefficients for a group of circular cylinders based on the potential flow theory. The equations of motion for rod bundles are then derived including hydrodynamic forces, drag forces, fluid pressure, gravity effect, axial tension, and damping. Based on the equations, a method of analysis is presented to study the free and forced vibrations of rod bundles. Finally, the method is applied to a typical LMFBR fuel bundle consisting of seven rods

  9. Systemic functional grammar in natural language generation linguistic description and computational representation

    CERN Document Server

    Teich, Elke

    1999-01-01

    This volume deals with the computational application of systemic functional grammar (SFG) for natural language generation. In particular, it describes the implementation of a fragment of the grammar of German in the computational framework of KOMET-PENMAN for multilingual generation. The text also presents a specification of explicit well-formedness constraints on syntagmatic structure which are defined in the form of typed feature structures. It thus achieves a model of systemic functional grammar that unites both the strengths of systemics, such as stratification, functional diversification

  10. Vibrational stability of graphene

    Directory of Open Access Journals (Sweden)

    Yangfan Hu

    2013-05-01

    Full Text Available The mechanical stability of graphene as temperature rises is analyzed based on three different self-consistent phonon (SCP models. Compared with three-dimensional (3-D materials, the critical temperature Ti at which instability occurs for graphene is much closer to its melting temperature Tm obtained from Monte Carlo simulation (Ti ≃ 2Tm, K. V. Zakharchenko, A. Fasolino, J. H. Los, and M. I. Katsnelson, J. Phys. Condens. Matter 23, 202202. This suggests that thermal vibration plays a significant role in melting of graphene while melting for 3-D materials is often dominated by topologic defects. This peculiar property of graphene derives from its high structural anisotropy, which is characterized by the vibrational anisotropic coefficient (VAC, defined upon its Lindermann ratios in different directions. For any carbon based material with a graphene-like structure, the VAC value must be smaller than 5.4 to maintain its stability. It is also found that the high VAC value of graphene is responsible for its negative thermal expansion coefficient at low temperature range. We believe that the VAC can be regarded as a new criterion concerning the vibrational stability of any low-dimensional (low-D materials.

  11. Structure from Dynamics: Vibrational Dynamics of Interfacial Water as a Probe of Aqueous Heterogeneity

    Science.gov (United States)

    2018-01-01

    The structural heterogeneity of water at various interfaces can be revealed by time-resolved sum-frequency generation spectroscopy. The vibrational dynamics of the O–H stretch vibration of interfacial water can reflect structural variations. Specifically, the vibrational lifetime is typically found to increase with increasing frequency of the O–H stretch vibration, which can report on the hydrogen-bonding heterogeneity of water. We compare and contrast vibrational dynamics of water in contact with various surfaces, including vapor, biomolecules, and solid interfaces. The results reveal that variations in the vibrational lifetime with vibrational frequency are very typical, and can frequently be accounted for by the bulk-like heterogeneous response of interfacial water. Specific interfaces exist, however, for which the behavior is less straightforward. These insights into the heterogeneity of interfacial water thus obtained contribute to a better understanding of complex phenomena taking place at aqueous interfaces, such as photocatalytic reactions and protein folding. PMID:29490138

  12. Vibration Disturbance Damping System Design to Protect Payload of the Rocket

    Directory of Open Access Journals (Sweden)

    Sutisno Sutisno

    2012-12-01

    Full Text Available Rocket motor generates vibrations acting on whole rocket body including its contents. Part of the body which is sensitive to disturbance is the rocket payload. The payload consists of various electronic instruments including: transmitter, various sensors, accelerometer, gyro, the embedded controller system, and others. This paper presents research on rocket vibration influence to the payload and the method to avoid disturbance. Avoiding influence of vibration disturbance can be done using silicone gel material whose typical damping factors are relatively high. The rocket vibration was simulated using electromagnetic motor, and the vibrations were measured using an accelerometer sensor. The measurement results were displayed in the form of curve, indicating the vibration level on some parts of the tested material. Some measurement results can be applied to determine the good material to attenuate vibration disturbance on the instruments of the payload.

  13. Optimization design of high power ultrasonic circular ring radiator in coupled vibration.

    Science.gov (United States)

    Xu, Long; Lin, Shuyu; Hu, Wenxu

    2011-10-01

    This paper presents a new high power ultrasonic (HPU) radiator, which consists of a transducer, an ultrasonic horn, and a metal circular ring. Both the transducer and horn in longitudinal vibrations are used to drive a metal circular ring in a radial-axial coupled vibration. This coupled vibration cannot only generate ultrasound in both the radial and axial directions, but also focus the ultrasound inside the circular ring. Except for the radial-axial coupled vibration mode, the third longitudinal harmonic vibration mode with relative large vibration amplitude is also detected, which can be used as another operation mode. Overall, the HPU with these two vibration modes should have good potential to be applied in liquid processing, such as sonochemistry, ultrasonic cleaning, and Chinese herbal medicine extraction. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Narrow-line, cw orange light generation in a diode-pumped Nd:YVO4 laser using volume Bragg gratings.

    Science.gov (United States)

    Chen, Y L; Chen, W W; Du, C E; Chang, W K; Wang, J L; Chung, T Y; Chen, Y H

    2009-12-07

    We report on the demonstration of a narrow-line, cw orange 593-nm laser achieved via intracavity sum-frequency generation (SFG) of a diode-pumped dual-wavelength (1064 and 1342 nm) Nd:YVO(4) laser using two volume Bragg grating (VBG) reflectors. At diode pump power of up to 3.6 W, the 593-nm intracavity SFG laser radiates at the single longitudinal mode of spectral linewidth as narrow as approximately 15 MHz. More than 23-mW single-longitudinal-mode or 40-mW, diode pump power) 593-nm orange lights can be obtained from this compact laser system. Spectral tuning of the orange light was performed via the temperature tuning of the two VBGs in this system, achieving an effective tuning rate of ~5 pm/degrees C.

  15. Review of Micro Magnetic Generator

    OpenAIRE

    Lin DU; Gengchen SHI; Jingjing ZHAO

    2014-01-01

    This paper discusses the research progress of micro magnetic generator systems. Micro magnetic generator systems convert energy from the environment to electric energy with advantages as high reliability, high power density, long life time and can be applied to extreme environment. This paper summarizes methods for improving generator performance of micro magnetic generator, including rotational magnetic generator, vibrational magnetic generator and hybrid magnetic generator, analyzes and com...

  16. Random vibrations theory and practice

    CERN Document Server

    Wirsching, Paul H; Ortiz, Keith

    1995-01-01

    Random Vibrations: Theory and Practice covers the theory and analysis of mechanical and structural systems undergoing random oscillations due to any number of phenomena— from engine noise, turbulent flow, and acoustic noise to wind, ocean waves, earthquakes, and rough pavement. For systems operating in such environments, a random vibration analysis is essential to the safety and reliability of the system. By far the most comprehensive text available on random vibrations, Random Vibrations: Theory and Practice is designed for readers who are new to the subject as well as those who are familiar with the fundamentals and wish to study a particular topic or use the text as an authoritative reference. It is divided into three major sections: fundamental background, random vibration development and applications to design, and random signal analysis. Introductory chapters cover topics in probability, statistics, and random processes that prepare the reader for the development of the theory of random vibrations a...

  17. VIBRATION ISOLATION SYSTEM PROBABILITY ANALYSIS

    Directory of Open Access Journals (Sweden)

    Smirnov Vladimir Alexandrovich

    2012-10-01

    Full Text Available The article deals with the probability analysis for a vibration isolation system of high-precision equipment, which is extremely sensitive to low-frequency oscillations even of submicron amplitude. The external sources of low-frequency vibrations may include the natural city background or internal low-frequency sources inside buildings (pedestrian activity, HVAC. Taking Gauss distribution into account, the author estimates the probability of the relative displacement of the isolated mass being still lower than the vibration criteria. This problem is being solved in the three dimensional space, evolved by the system parameters, including damping and natural frequency. According to this probability distribution, the chance of exceeding the vibration criteria for a vibration isolation system is evaluated. Optimal system parameters - damping and natural frequency - are being developed, thus the possibility of exceeding vibration criteria VC-E and VC-D is assumed to be less than 0.04.

  18. Intracellular recording from a spider vibration receptor.

    Science.gov (United States)

    Gingl, Ewald; Burger, Anna-M; Barth, Friedrich G

    2006-05-01

    The present study introduces a new preparation of a spider vibration receptor that allows intracellular recording of responses to natural mechanical or electrical stimulation of the associated mechanoreceptor cells. The spider vibration receptor is a lyriform slit sense organ made up of 21 cuticular slits located on the distal end of the metatarsus of each walking leg. The organ is stimulated when the tarsus receives substrate vibrations, which it transmits to the organ's cuticular structures, reducing the displacement to about one tenth due to geometrical reasons. Current clamp recording was used to record action potentials generated by electrical or mechanical stimuli. Square pulse stimulation identified two groups of sensory cells, the first being single-spike cells which generated only one or two action potentials and the second being multi-spike cells which produced bursts of action potentials. When the more natural mechanical sinusoidal stimulation was applied, differences in adaptation rate between the two cell types remained. In agreement with prior extracellular recordings, both cell types showed a decrease in the threshold tarsus deflection with increasing stimulus frequency. Off-responses to mechanical stimuli have also been seen in the metatarsal organ for the first time.

  19. Control of noise and structural vibration a MATLAB-based approach

    CERN Document Server

    Mao, Qibo

    2013-01-01

    Control of Noise and Structural Vibration presents a MATLAB®-based approach to solving the problems of undesirable noise generation and transmission by structures and of undesirable vibration within structures in response to environmental or operational forces. The fundamentals of acoustics, vibration and coupling between vibrating structures and the sound fields they generate are introduced including a discussion of the finite element method for vibration analysis. Following this, the treatment of sound and vibration control begins, illustrated by example systems such as beams, plates and double plate structures. Sensor and actuator placement is explained as is the idea of modal sensor–actuators. The design of appropriate feedback systems includes consideration of basic stability criteria and robust active structural acoustic control. Single and multi-mode positive position feedback (PPF) control systems are also described in the context of loudspeaker–duct model with non-collocated loudspeaker–microp...

  20. Atomic beams probe surface vibrations

    International Nuclear Information System (INIS)

    Robinson, A.L.

    1982-01-01

    In the last two years, surface scientist have begun trying to obtain the vibrational frequencies of surface atoms in both insulating and metallic crystals from beams of helium atoms. It is the inelastic scattering that researchers use to probe surface vibrations. Inelastic atomic beam scattering has only been used to obtain vibrational frequency spectra from clean surfaces. Several experiments using helium beams are cited. (SC)

  1. Flow-Induced Vibration of Circular Cylindrical Structures

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Shoei-Sheng [Argonne National Lab. (ANL), Argonne, IL (United States). Components Technology Division

    1985-06-01

    Flow-induced vibration is a term to denote those phenomena associated with the response of structures placed in or conveying fluid flow. More specifically, the terra covers those cases in which an interaction develops between fluid-dynamic forces and the inertia, damping or elastic forces in the structures. The study of these phenomena draws on three disciplines: (1) structural mechanics, (2) mechanical vibration, and (3) fluid dynamics. The vibration of circular cylinders subject to flow has been known to man since ancient times; the vibration of a wire at its natural frequency in response to vortex shedding was known in ancient Greece as aeolian tones. But systematic studies of the problem were not made until a century ago when Strouhal established the relationship between vortex shedding frequency and flow velocity for a given cylinder diameter. The early research in this area has beer summarized by Zdravkovich (1985) and Goldstein (1965). Flow-induced structural vibration has been experienced in numerous fields, including the aerospace industry, power generation/transmission (turbine blades, heat exchanger tubes, nuclear reactor components), civil engineering (bridges, building, smoke stacks), and undersea technology. The problems have usually been encountered or created accidentally through improper design. In most cases, a structural or mechanical component, designed to meet specific objectives, develops problems when the undesired effects of flow field have not been accounted for in the design. When a flow-induced vibration problem is noted in the design stage, the engineer has different options to eliminate the detrimental vibration. Unfortunately, in many situations, the problems occur after the components are already in operation; the "fix" usually is very costly. Flow-induced vibration comprises complex and diverse phenomena; subcritical vibration of nuclear fuel assemblies, galloping of transmission lines, flutter of pipes conveying fluid, and whirling

  2. A study on the evaluation of vibration effect and the development of vibration reduction method for Wolsung unit 1 main steam piping

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyun; Kim, Yeon Whan [Korea Electric Power Corp. (KEPCO), Taejon (Korea, Republic of). Research Center; Kim, Tae Ryong; Park, Jin Ho [Korea Atomic Energy Research Inst., Daeduk (Korea, Republic of)

    1996-08-01

    The main steam piping of nuclear power plant which runs between steam generator and high pressure turbine has been experienced to have a severe effect on the safe operation of the plant due to the vibration induced by the steam flowing inside the piping. The imposed cyclic loads by the vibration could result in the degradation of the related structures such as connection parts between main instruments, valves, pipe supports and building. The objective of the study is to reduce the vibration level of Wolsung nuclear power plant unit 1 main steam pipeline by analyzing vibration characteristics of the piping, identifying sources of the vibration and developing a vibration reduction method .The location of the maximum vibration is piping between the main steam header and steam chest .The stress level was found to be within the allowable limit .The main vibration frequency was found to be 4{approx}6 Hz which is the same as the natural frequency from model test .A vibration reduction method using pipe supports of energy absorbing type(WEAR)is selected .The measured vibration level after WEAR installation was reduced about 36{approx}77% in displacement unit (author). 36 refs., 188 figs.

  3. Digital analysis of vibrations

    International Nuclear Information System (INIS)

    Bohnstedt, H.J.; Walter, G.

    1982-01-01

    Vibrational measurements, e.g. on turbomachinery, can be evaluated rapidly and economically with the aid of a combination of the following instruments: a desk-top computer, a two-channel vector filter and a FFT spectral analyzer. This equipment combination is available within the Allianz Centre for Technology and has also been used for mobile, on-site investigations during the last year. It enables calculation and display of time functions, kinetic shaft orbits, displacement diagrams. Bode plots, polar-coordinate plots, cascade diagrams and histograms. (orig.) [de

  4. Turbine blade vibration dampening

    Science.gov (United States)

    Cornelius, C.C.; Pytanowski, G.P.; Vendituoli, J.S.

    1997-07-08

    The present turbine wheel assembly increases component life and turbine engine longevity. The combination of the strap and the opening combined with the preestablished area of the outer surface of the opening and the preestablished area of the outer circumferential surface of the strap and the friction between the strap and the opening increases the life and longevity of the turbine wheel assembly. Furthermore, the mass ``M`` or combined mass ``CM`` of the strap or straps and the centrifugal force assist in controlling vibrations and damping characteristics. 5 figs.

  5. Lattice Vibrations in Chlorobenzenes:

    DEFF Research Database (Denmark)

    Reynolds, P. A.; Kjems, Jørgen; White, J. W.

    1974-01-01

    Lattice vibrational dispersion curves for the ``intermolecular'' modes in the triclinic, one molecule per unit cell β phase of p‐C6D4Cl2 and p‐C6H4Cl2 have been obtained by inelastic neutron scattering. The deuterated sample was investigated at 295 and at 90°K and a linear extrapolation to 0°K...... was applied in order to correct for anharmonic effects. Calculations based on the atom‐atom model for van der Waals' interaction and on general potential parameters for the aromatic compounds agree reasonably well with the experimental observations. There is no substantial improvement in fit obtained either...

  6. Vibration control, machine diagnostics

    International Nuclear Information System (INIS)

    1990-01-01

    Changing vibrations announce damage in the form of wear or cracks on components of, e.g., engine rotors, pumps, power plant turbo sets, rounding-up tools, or marine diesel engines. Therefore, machine diagnostics use frequency analyses, system tests, trend analyses as well as expert systems to localize or estimate the causes of these damages and malfunctions. Data acquisistion, including not only sensors, but also reliable and redundant data processing systems and analyzing systems, play an important role. The lectures pertaining to the data base are covered in detail. (DG) [de

  7. Controlling coupled bending-twisting vibrations of anisotropic composite wing

    Science.gov (United States)

    Ryabov, Victor; Yartsev, Boris

    2018-05-01

    The paper discusses the possibility to control coupled bending-twisting vibrations of anisotropic composite wing by means of the monoclinic structures in the reinforcement of the plating. Decomposing the potential straining energy and kinetic energy of natural vibration modes into interacting and non-interacting parts, it became possible to introduce the two coefficients that integrally consider the effect of geometry and reinforcement structure upon the dynamic response parameters of the wing. The first of these coefficients describes the elastic coupling of the natural vibration modes, the second coefficient describes the inertial one. The paper describes the numerical studies showing how the orientation of considerably anisotropic CRP layers in the plating affects natural frequencies, loss factors, coefficients of elastic and inertial coupling for several lower tones of natural bending-twisting vibrations of the wing. Besides, for each vibration mode, partial values of the above mentioned dynamic response parameters were determined by means of the relationships for orthotropic structures where instead of "free" shearing modulus in the reinforcement plant, "pure" shearing modulus is used. Joint analysis of the obtained results has shown that each pair of bending-twisting vibration modes has its orientation angle ranges of the reinforcing layers where the inertial coupling caused by asymmetry of the cross-section profile with respect to the main axes of inertia decreases, down to the complete extinction, due to the generation of the elastic coupling in the plating material. These ranges are characterized by the two main features: 1) the difference in the natural frequencies of the investigated pair of bending-twisting vibration modes is the minimum and 2) natural frequencies of bending-twisting vibrations belong to a stretch restricted by corresponding partial natural frequencies of the investigated pair of vibration modes. This result is of practical importance

  8. A modern concept for status oriented vibration monitoring of big turbogenerators

    International Nuclear Information System (INIS)

    Herz, F.; Theodor, P.

    1997-01-01

    The investigation of mechanical vibrations is an excellent method of showing the current condition of a machine. This paper deals with the vibrations monitoring of large turbo-generators. First the general aspects of monitoring, as well as diagnostic strategies and impact on the operation of the installation is discussed. An example of a condition-oriented vibration monitoring is the description of the 'Vibroview' system recently developed and installed in the Leibstadt nuclear power plant. (author) 16 figs., tabs., refs

  9. Off-axis Modal Active Vibration Control Of Rotational Vibrations

    NARCIS (Netherlands)

    Babakhani, B.; de Vries, Theodorus J.A.; van Amerongen, J.

    Collocated active vibration control is an effective and robustly stable way of adding damping to the performance limiting vibrations of a plant. Besides the physical parameters of the Active Damping Unit (ADU) containing the collocated actuator and sensor, its location with respect to the

  10. Dissipation in vibrating superleak second sound transducers

    International Nuclear Information System (INIS)

    Giordano, N.

    1985-01-01

    We have performed an experimental study of the generation and detection of second sound in 4 He using vibrating superleak second sound transducers. At temperatures well below T/sub lambda/ and for low driving amplitudes, the magnitude of the generated second sound wave is proportional to the drive amplitude. However, near T/sub lambda/ and for high drive amplitudes this is no longer the case--instead, the second sound amplitude saturates. In this regime we also find that overtones of the drive frequency are generated. Our results suggest that this behavior is due to critical velocity effects in the pores of the superleak in the generator transducer. This type of measurement may prove to be a useful way in which to study critical velocity effects in confined geometries

  11. Prediction of vibration level in tunnel blasting; Tonneru kusshin happa ni yotte reiki sareru shindo no reberu yosoku ho

    Energy Technology Data Exchange (ETDEWEB)

    Hirata, A. [Kumamoto Industries Univ, Kumamoto (Japan); Yamamoto, M. [Asahi Chemical Industry Co. Ltd., Tokyo (Japan); Inaba, C. [Nishimatsu Construction Co. Ltd., Kanagawa (Japan); Kaneko, K. [Hokkaido Univ (Japan)

    1997-08-01

    For avoiding the generation of public hazard due to ground vibration causes by blasting in tunneling, it is important to devise a blasting method for ensuring the level of the ground vibration caused thereby under a limit, and an exact predication of ground vibration before blasting is desirable. In this study, the characteristics of the ground vibration caused by tunnel blasting are analyzed, and a summary of amplitude spectra calculating method is described. A theoretical analysis method for predicting the vibration level is proposed based on spectrum-multiplicative method. Vibration caused by multistage blasting in tunneling is most strong and deemed as important. When observing the process of elastic wave motion caused by multistage blasting being measured, the process can be divided into three element processes in frequency area as vibration source spectrum, transmission attenuation spectrum and frequency response function vibrating test, and, with the multiplication of them, the amplitude spectra at an observation portion can be estimated. 12 refs., 12 figs.

  12. Vibrational spectra of ordered perovskites

    NARCIS (Netherlands)

    Corsmit, A.F.; Hoefdraad, H.E.; Blasse, G.

    1972-01-01

    The vibrational spectra of the molecular M6+O6 (M = Mo, Te, W) group in ordered perovskites of the type Ba2M2+M6+O6 are reported. These groups have symmetry Oh, whereas their site symmetry is also Oh. An assignment of the internal vibrations is presented.

  13. Vibrations and Stability: Solved Problems

    DEFF Research Database (Denmark)

    Thomsen, Jon Juel

    Worked out solutions for exercise problems in J. J. Thomsen 'Vibrations and Stability: Advanced Theory, Analysis, and Tools', Springer, Berlin - Heidelberg, 2003.......Worked out solutions for exercise problems in J. J. Thomsen 'Vibrations and Stability: Advanced Theory, Analysis, and Tools', Springer, Berlin - Heidelberg, 2003....

  14. Low Cost Digital Vibration Meter.

    Science.gov (United States)

    Payne, W Vance; Geist, Jon

    2007-01-01

    This report describes the development of a low cost, digital Micro Electro Mechanical System (MEMS) vibration meter that reports an approximation to the RMS acceleration of the vibration to which the vibration meter is subjected. The major mechanical element of this vibration meter is a cantilever beam, which is on the order of 500 µm in length, with a piezoresistor deposited at its base. Vibration of the device in the plane perpendicular to the cantilever beam causes it to bend, which produces a measurable change in the resistance of a piezoresistor. These changes in resistance along with a unique signal-processing scheme are used to determine an approximation to the RMS acceleration sensed by the device.

  15. Tunable, continuous-wave, ultraviolet source based on intracavity sum-frequency-generation in an optical parametric oscillator using BiB₃O₆.

    Science.gov (United States)

    Devi, Kavita; Kumar, S Chaitanya; Ebrahim-Zadeh, M

    2013-10-21

    We report a continuous-wave (cw) source of tunable radiation across 333-345 nm in the ultraviolet (UV) using bismuth triborate, BiB₃O₆ (BIBO) as the nonlinear gain material. The source is based on internal sum-frequency-generation (SFG) in a cw singly-resonant optical parametric oscillator (OPO) pumped at 532 nm. The compact tunable source employs a 30-mm-long MgO:sPPLT crystal as the OPO gain medium and a 5-mm-long BIBO crystal for intracavity SFG of the signal and pump, providing up to 21.6 mW of UV power at 339.7 nm, with >15 mW over 64% of the SFG tuning range. The cw OPO is also tunable across 1158-1312 nm in the idler, delivering as much as 1.7 W at 1247 nm, with >1W over 65% of the tuning range. The UV output at maximum power exhibits passive power stability better than 3.4% rms and frequency stability of 193 GHz over more than one minute.

  16. Translational, rotational and vibrational temperatures of a gliding arc discharge at atmospheric pressure air

    DEFF Research Database (Denmark)

    Zhu, Jiajian; Gao, Jinlong; Ehn, Andreas

    2014-01-01

    and vibrational temperatures of a gliding arc generated at atmospheric pressure air are investigated. Translational temperatures (about 1100 K) were measured by laser-induced Rayleigh scattering, and two-dimensional temperature imaging was performed. Rotational and vibrational temperatures (about 3600 K and 6700...

  17. Energy-Saving Vibration Impulse Coal Degradation at Finely Dispersed Coal-Water Slurry Preparation

    Directory of Open Access Journals (Sweden)

    Moiseev V.A.

    2015-01-01

    Full Text Available Theoretical and experimental research results of processes of finely dispersed coal-water slurry preparation for further generation of energetic gas in direct flow and vortex gas generator plants have been presented. It has been stated that frequency parameters of parabolic vibration impulse mill influence degradation degree. Pressure influence on coal parameters in grinding cavity has been proven. Experimental researches have proven efficiency of vibration impulse mill with unbalanced mass vibrator generator development. Conditions of development on intergranular walls of coal cracks have been defined.

  18. Lattice vibration spectra. 16

    International Nuclear Information System (INIS)

    Lutz, H.D.; Willich, P.

    1977-01-01

    The FIR absorption spectra of pyrite type compounds RuS 2 , RuSsub(2-x)Sesub(x), RuSe 2 , RuTe 2 , OsS 2 , OsSe 2 , and PtP 2 as well as loellingite type phosphides FeP 2 , RuP 2 , and OsP 2 are reported. For RuS 2 , RuSe 2 , RuTe 2 , OsS 2 , and PtP 2 all of the five infrared allowed modes (k = 0) are observed. As a first result of a numerical normal coordinate treatment vibration forms of pyrite structure are communicated. The spectra show that lattice forces of corresponding sulfides, tellurides, and phosphides are about the same strength, but increase strongly by substitution of iron by ruthenium and especially of ruthenium by osmium. The lattice constants of the RuSsub(2-x)Sesub(x) solid solution obey Vegard's rule. (author)

  19. Structure-borne sound structural vibrations and sound radiation at audio frequencies

    CERN Document Server

    Cremer, L; Petersson, Björn AT

    2005-01-01

    Structure-Borne Sound"" is a thorough introduction to structural vibrations with emphasis on audio frequencies and the associated radiation of sound. The book presents in-depth discussions of fundamental principles and basic problems, in order to enable the reader to understand and solve his own problems. It includes chapters dealing with measurement and generation of vibrations and sound, various types of structural wave motion, structural damping and its effects, impedances and vibration responses of the important types of structures, as well as with attenuation of vibrations, and sound radi

  20. Flow induced vibrations in gas tube assembly of centrifuge

    International Nuclear Information System (INIS)

    Alam, M.; Atta, M.A.; Mirza, J.A.; Khan, A.Q.

    1986-01-01

    A centrifuge essentially consists of a rotor rotating at very high speed. Gas tube assembly, located at the center of the rotor, is used to introduce feed gas into the rotor and remove product and waste streams from it. The gas tube assembly is thus a static component, the product and waste scoops of which are lying in the high pressure region of a fluid rotating at very high speed. This can cause flow induced vibrations in the gas tube assembly. Such vibrations affect not only the mechanical stability of the gas tube assembly but may also reduce the separative power of the centrifuge. In a cascade, if some of the centrifuges have gas tube vibration, then cascade performance will be affected. A theoretical analysis of the effect of waste tube vibrations on product and waste flow rates and pressures in the centrifuge is presented. A simple stage consisting of two centrifuges, in which one has tube vibration, is considered for this purpose. The results are compared with experiment. It is shown that waste tube vibration generates oscillations in waste and product flow rates that are observable outside the centrifuge. (author)

  1. Evaluation of blast-induced vibration effects on structures 1

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jong Rim; Jeon, Gyu Shick; Lee, Dae Soo; Joo, Kwang Ho; Lee, Woong Keon [Korea Electrotechnology Research Inst., Changwon (Korea, Republic of); Ryu, Chang Ha; Chung, So Keul; Lee, Kyung Won; Shin, Hee Soon; Chun, Sun Woo; Park, Yeon Jun; Synn, Joong Ho; Choi, Byung Hee [Korea Inst. of Geology Mining and Materials, Taejon (Korea, Republic of)

    1995-12-31

    Due to the difficulties of obtaining construction site for new plants, following ones are inevitably being built in the site adjacent to existing power plants. Therefore considerable thought has been recently given to the dynamic loading generated by blasting works near the plants to maintain the safety of structures and facilities in power plants. Our own standard for safety level of blast vibration is not prepared yet, and foreign standards have been generally employed without theoretical and experimental verification. Safety-related structures of power plants and facilities have to be protected against the effects of possible hazards due to blast vibration. Earthquakes have been considered a major dynamic design loading as a requirement of plant design, but the effects of blast-induced vibration are not. In order to ensure the safety, rational safe criterion should be established and blast design should be satisfy it, which requires the development of a model for prediction of vibration level through more systematic measurement and analysis. The main objectives of the study are : to provide background data for establishing the rational safe vibration limits, to develop models for prediction of blast vibration level, to establish safe blast design criterion, and to accumulate techniques for field measurements, data acquisition and analysis (author). 80 refs., 347 figs.

  2. Vibration aging of diesel-engine mounted electrical equipment

    International Nuclear Information System (INIS)

    Lee, B.J.; Morton, W.C.

    1994-01-01

    The Emergency Diesel Generator (EDG) in a Nuclear Power Plant is considered to be a component which is essential to safe plant operation. Failures of auxiliary equipment directly mounted on the EDG creates costly repairs, and compromises the engine's availability and reliability. Although IEEE-323 requires addressing of safety-related components due to mechanically induced vibration, very few guidelines exist in the nuclear industry to show how this may be accounted for. Most engine vendors rely on the empirical experience data as the basis of their evaluation for vibration. Upgrade of engine controls, addition of monitoring devices and other engine modifications require design and installation of new equipment to be mounted directly on the engine. This necessitates the evaluation for engine-induced vibration which is considered to be one of the most severe design parameters. This paper discusses the engine vibration characteristics, and the acquisition of extensive field vibration data on the diesel engine under operating conditions. The data is then used to develop life cycle vibration qualification test profiles that can be applied with confidence in a laboratory environment to qualify engine-mounted equipment. The intent is to validate a product's ability to survive under worst case, extended service on-engine conditions. This paper describes the procedures and approaches used to achieve those goals, and provides developed profile examples and test results

  3. Blasting vibrations control: The shortcomings of traditional methods

    Energy Technology Data Exchange (ETDEWEB)

    Vuillaume, P.M.; Kiszlo, M. [Institut National de l`Environnement Industriel et des Risques, Verneuil en Halatte (France); Bernard, T. [Compagnie Nouvelle de Scientifiques, Nice (France)

    1996-12-31

    In the context of its studies for the French ministry of the environment and for the French national coal board, INERIS (the French institute for the industrial environment and hazards, formerly CERCHAR) has made a complete critical survey of the methods generally used to reduce the levels of blasting vibrations. It is generally acknowledged that the main parameter to control vibrations is the so-called instantaneous charge, or charge per delay. This should be reduced as much as possible in order to diminish vibration levels. On account of this, the use of a new generation of blasting devices, such as non-electric detonators or electronic sequential timers has been developed since the seventies. INERIS has collected data from about 900 blasts in 2 quarries and 3 open pit mines. These data include input parameters such as borehole diameter, burden, spacing, charge per hole, charge per delay, total fired charge, etc ... They also include output measurements, such as vibration peak particle velocities, and main frequencies. These data have been analyzed with the help of multi variable statistical tools. Blasting tests were undertaken to evaluate new methods of vibrations control, such as the superposition of vibration signals. These methods appear to be accurate in many critical cases, but certainly would be highly improved with a better accuracy of firing delays. The development of electronic detonators seems to be the way of the future for a better blasting control.

  4. Energy harvesting from vibration using a piezoelectric membrane

    Energy Technology Data Exchange (ETDEWEB)

    Ericka, M.; Vasic, D.; Costa, F.; Tliba, S. [Ecole Normale Superieure de Cachan, Systemes et Applications des Technologies de l' Information et de l' Energie (SATIE, UMR 8029), 94 - Cachan (France); Poulin, G. [Ecole Nationale Superieure d' Ingenieurs Electriciens de Grenoble, Laboratoire d' Automatique de Grenoble, 38 (France)

    2005-09-01

    In this paper we investigate the capability of harvesting the electric energy from mechanical vibrations in a dynamic environment through a piezoelectric membrane transducer. This transducer consists of 2 layers lead zirconate titanate (PZT)/brass, the brass layer is embedded over the whole circumference by epoxy adhesive. A very small vibration gives a consequent deformation of the membrane which generates electric energy. Due to the impedance matrices connecting the efforts and flows of the membrane, we have established the dynamic electric equivalent circuit of the transducer. In a first study and in order to validate theoretical results, we performed experiments with a vibrating machine moving a macroscopic 25 mm diameter piezoelectric membrane. A power of 1.8 mW was generated at the resonance frequency (2.58 kHz) across a 56 k{omega} optimal resistor and for a 2 g acceleration. (authors)

  5. On the control of vibrations using synchrophasing

    Science.gov (United States)

    Dench, M. R.; Brennan, M. J.; Ferguson, N. S.

    2013-09-01

    This paper describes the application of a technique, known as synchrophasing, to the control of machinery vibration. It is applicable to machinery installations, in which several synchronous machines, such as those driven by electrical motors, are fitted to an isolated common structure known as a machinery raft. To reduce the vibration transmitted to the host structure to which the machinery raft is attached, the phase of the electrical supply to the motors is adjusted so that the net transmitted force to the host structure is minimised. It is shown that while this is relatively simple for an installation consisting of two machines, it is more complicated for installations in which there are more than two machines, because of the interaction between the forces generated by each machine. The development of a synchrophasing scheme, which has been applied to propeller aircraft, and is known as Propeller Signature Theory (PST) is discussed. It is shown both theoretically and experimentally, that this is an efficient way of controlling the phase of multiple machines. It is also shown that synchrophasing is a worthwhile vibration control technique, which has the potential to suppress vibration transmitted to the host structure by up to 20 dB at certain frequencies. Although the principle of synchronisation has been demonstrated on a one-dimensional structure, it is believed that this captures the key features of the approach. However, it should be realised that the mode-shapes of a machinery raft may be more complex than that of a one-dimensional structure and this may need to be taken into account in a real application.

  6. Vibration measurements of high-heat-load monochromators for DESY PETRA III extension

    Energy Technology Data Exchange (ETDEWEB)

    Kristiansen, Paw, E-mail: paw.kristiansen@fmb-oxford.com [FMB Oxford Ltd, Unit 1 Ferry Mills, Oxford OX2 0ES (United Kingdom); Horbach, Jan; Döhrmann, Ralph; Heuer, Joachim [DESY, Deutsches Elektronen-Synchrotron Hamburg, Notkestrasse 85, 22607 Hamburg (Germany)

    2015-05-09

    Vibration measurements of a cryocooled double-crystal monochromator are presented. The origins of the vibrations are identified. The minimum achieved vibration of the relative pitch between the two crystals is 48 nrad RMS and the minimum achieved absolute vibration of the second crystal is 82 nrad RMS. The requirement for vibrational stability of beamline optics continues to evolve rapidly to comply with the demands created by the improved brilliance of the third-generation low-emittance storage rings around the world. The challenge is to quantify the performance of the instrument before it is installed at the beamline. In this article, measurement techniques are presented that directly and accurately measure (i) the relative vibration between the two crystals of a double-crystal monochromator (DCM) and (ii) the absolute vibration of the second-crystal cage of a DCM. Excluding a synchrotron beam, the measurements are conducted under in situ conditions, connected to a liquid-nitrogen cryocooler. The investigated DCM utilizes a direct-drive (no gearing) goniometer for the Bragg rotation. The main causes of the DCM vibration are found to be the servoing of the direct-drive goniometer and the flexibility in the crystal cage motion stages. It is found that the investigated DCM can offer relative pitch vibration down to 48 nrad RMS (capacitive sensors, 0–5 kHz bandwidth) and absolute pitch vibration down to 82 nrad RMS (laser interferometer, 0–50 kHz bandwidth), with the Bragg axis brake engaged.

  7. Correlating the vibrational spectra of structurally related molecules: A spectroscopic measure of similarity.

    Science.gov (United States)

    Tao, Yunwen; Zou, Wenli; Cremer, Dieter; Kraka, Elfi

    2018-03-05

    Using catastrophe theory and the concept of a mutation path, an algorithm is developed that leads to the direct correlation of the normal vibrational modes of two structurally related molecules. The mutation path is defined by weighted incremental changes in mass and geometry of the molecules in question, which are successively applied to mutate a molecule into a structurally related molecule and thus continuously converting their normal vibrational spectra from one into the other. Correlation diagrams are generated that accurately relate the normal vibrational modes to each other by utilizing mode-mode overlap criteria and resolving allowed and avoided crossings of vibrational eigenstates. The limitations of normal mode correlation, however, foster the correlation of local vibrational modes, which offer a novel vibrational measure of similarity. It will be shown how this will open new avenues for chemical studies. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  8. Acoustic Levitation Transportation of Small Objects Using a Ring-type Vibrator

    Science.gov (United States)

    Thomas, Gilles P. L.; Andrade, Marco A. B.; Adamowski, Julio C.; Silva, Eḿílio C. N.

    A new device for noncontact transportation of small solid objects is presented here. Ultrasonic flexural vibrations are generated along the ring shaped vibrator using two Langevin transducers and by using a reflector parallel to the vibrator, small particles are trapped at the nodal points of the resulting acoustic standing wave. The particles are then moved by generating a traveling wave along the vibrator, which can be done by modulating the vibration amplitude of the transducers. The working principle of the traveling wave along the vibrator has been modeled by the superposition of two orthogonal standing waves, and the position of the particles can be predicted by using finite element analysis of the vibrator and the resulting acoustic field. A prototype consisting of a 3 mm thick, 220 mm long, 50 mm wide and 52 mm radius aluminum ring-type vibrator and a reflector of the same length and width was built and small polystyrene spheres have been successfully transported along the straight parts of the vibrator.

  9. Evaluation of the Perceptual Characteristics of a Force Induced by Asymmetric Vibrations.

    Science.gov (United States)

    Tanabe, Takeshi; Yano, Hiroaki; Iwata, Hiroo

    2017-08-29

    This paper describes the properties of proprioceptive sensations induced by asymmetric vibration using a vibration speaker-type non-grounded haptic interface. We confirm that the vibration speaker generates a perceived force that pulls or pushes a user's hand in a particular direction when an asymmetric amplitude signal that is generated by inverting a part of a sine wave is input. In this paper, to verify the system with respect to various factors of force perception caused by asymmetric vibration, we conducted six experiments and the following results were obtained. (1) The force vector can be controlled by reversing the asymmetric waves. (2) By investigating the physical characteristics of the vibration, asymmetric vibration was confirmed. (3) The presentation of vibration in the shear direction on the finger pad is effective. (4) The point of subjective equality of the perceived force can be controlled by up to 0.43 N by changing the amplitude voltage of the input signals. (5) The minimum stimulation time required for force perception is 66.7 ms. (6) When the vibration is continuously presented for 40 to 50 s, the perceived force decreases because of adaptation. Hence, we confirmed that we can control both the direction and magnitude of the reaction force by changing the input signal of the vibration speaker.

  10. Vibrational Spectroscopy of Ionic Liquids.

    Science.gov (United States)

    Paschoal, Vitor H; Faria, Luiz F O; Ribeiro, Mauro C C

    2017-05-24

    Vibrational spectroscopy has continued use as a powerful tool to characterize ionic liquids since the literature on room temperature molten salts experienced the rapid increase in number of publications in the 1990's. In the past years, infrared (IR) and Raman spectroscopies have provided insights on ionic interactions and the resulting liquid structure in ionic liquids. A large body of information is now available concerning vibrational spectra of ionic liquids made of many different combinations of anions and cations, but reviews on this literature are scarce. This review is an attempt at filling this gap. Some basic care needed while recording IR or Raman spectra of ionic liquids is explained. We have reviewed the conceptual basis of theoretical frameworks which have been used to interpret vibrational spectra of ionic liquids, helping the reader to distinguish the scope of application of different methods of calculation. Vibrational frequencies observed in IR and Raman spectra of ionic liquids based on different anions and cations are discussed and eventual disagreements between different sources are critically reviewed. The aim is that the reader can use this information while assigning vibrational spectra of an ionic liquid containing another particular combination of anions and cations. Different applications of IR and Raman spectroscopies are given for both pure ionic liquids and solutions. Further issues addressed in this review are the intermolecular vibrations that are more directly probed by the low-frequency range of IR and Raman spectra and the applications of vibrational spectroscopy in studying phase transitions of ionic liquids.

  11. Survey of vibration amplitudes throughout the linac

    International Nuclear Information System (INIS)

    Werner, K.L.

    1984-01-01

    The magnitude of vibrations of the Linac structure due to on site disturbances, such as cooling towers, pumps, generators, Highway 280 overpass traffic, is of interest. CN-263, for example, discusses tolerances of random (i.e., uncorrelated) quad jitter and suggests that amplitudes should not exceed 0.7 microns rms. This note describes the results of a series of measurements carried out in the summer of 1983. In general, the tolerance is not exceeded, but there appears not to be a good safety factor at low frequencies

  12. Unusual motions of a vibrating string

    Science.gov (United States)

    Hanson, Roger J.

    2003-10-01

    The actual motions of a sinusoidally driven vibrating string can be very complex due to nonlinear effects resulting from varying tension and longitudinal motion not included in simple linear theory. Commonly observed effects are: generation of motion perpendicular to the driving force, sudden jumps in amplitude, hysteresis, and generation of higher harmonics. In addition, these effects are profoundly influenced by wire asymmetries which in a brass harpsichord wire can cause a small splitting of each natural frequency of free vibration into two closely spaced frequencies (relative separation ~0.2% to 2%), each associated with transverse motion along two orthogonal characteristic wire axes. Some unusual resulting patterns of complex motions of a point on the wire are exhibited on videotape. Examples include: sudden changes of harmonic content, generation of subharmonics, and motion which appears nearly chaotic but which has a pattern period of over 10 s. Another unusual phenomenon due to entirely different causes can occur when a violin string is bowed with a higher than normal force resulting in sounds ranging from about a musical third to a twelfth lower than the sound produced when the string is plucked.

  13. An electromagnetic inerter-based vibration suppression device

    International Nuclear Information System (INIS)

    Gonzalez-Buelga, A; Clare, L R; Neild, S A; Jiang, J Z; Inman, D J

    2015-01-01

    This paper describes how an inerter-based device for structural vibration suppression can be realized using an electromagnetic transducer such as a linear motor. When the motor shaft moves, a difference of voltage is generated across the transducer coil. The voltage difference is proportional to the relative velocity between its two terminals. The electromagnetic transducer will exert a force proportional to current following the Lorentz principle if the circuit is closed around the transducer coil. If an electronic circuit consisting of a capacitor, an inductance and a resistance with the appropriate configuration is connected, the resulting force reflected back into the mechanical domain is equivalent to that achieved by a mechanical inerter-based device. The proposed configuration is easy to implement and very versatile, provided a high quality conversion system with negligible losses. With the use of electromagnetic devices, a new generation of vibration absorbers can be realized, for example in the electrical domain it would be relatively uncomplicated to synthesize multi-frequency or real time tunable vibration absorbers by adding electrical components in parallel. In addition by using resistance emulators in the electrical circuits, part of the absorbed vibration energy can be converted into usable power. Here an electromagnetic tuned inerter damper (E-TID) is tested experimentally using real time dynamic substructuring. A voltage compensation unit was developed in order to compensate for coil losses. This voltage compensation unit requires power, which is acquired through harvesting from the vibration energy using a resistance emulator. A power balance analysis was developed in order to ensure the device can be self sufficient. Promising experimental results, using this approach, have been obtained and are presented in this paper. The ultimate goal of this research is the development of autonomous electromagnetic vibration absorbers, able to harvest energy

  14. Molecular vibrations the theory of infrared and Raman vibrational spectra

    CERN Document Server

    Wilson, E Bright; Cross, Paul C

    1980-01-01

    Pedagogical classic and essential reference focuses on mathematics of detailed vibrational analyses of polyatomic molecules, advancing from application of wave mechanics to potential functions and methods of solving secular determinant.

  15. Reducing vibration transfer from power plants by active methods

    Science.gov (United States)

    Kiryukhin, A. V.; Milman, O. O.; Ptakhin, A. V.

    2017-12-01

    The possibility of applying the methods of active damping of vibration and pressure pulsations for reducing their transfer from power plants into the environment, the seating, and the industrial premises are considered. The results of experimental works implemented by the authors on the active broadband damping of vibration and dynamic forces after shock-absorption up to 15 dB in the frequency band up to 150 Hz, of water pressure pulsations in the pipeline up to 20 dB in the frequency band up to 600 Hz, and of spatial low-frequency air noise indoors of a diesel generator at discrete frequency up to 20 dB are presented. It is shown that a reduction of vibration transfer through a vibration-isolating junction (expansion joints) of pipelines with liquid is the most complicated and has hardly been developed so far. This problem is essential for vibration isolation of power equipment from the seating and the environment through pipelines with water and steam in the power and transport engineering, shipbuilding, and in oil and gas pipelines in pumping stations. For improving efficiency, reducing the energy consumption, and decreasing the overall dimensions of equipment, it is advisable to combine the work of an active system with passive damping means, the use of which is not always sufficient. The executive component of the systems of active damping should be placed behind the vibration isolators (expansion joints). It is shown that the existence of working medium and connection of vibration with pressure pulsations in existing designs of pipeline expansion joints lead to growth of vibration stiffness of the expansion joint with the environment by two and more orders as compared with the static stiffness and makes difficulties for using the active methods. For active damping of vibration transfer through expansion joints of pipelines with a liquid, it is necessary to develop expansion joint structures with minimal connection of vibrations and pulsations and minimal

  16. MR Damper Controlled Vibration Absorber for Enhanced Mitigation of Harmonic Vibrations

    Directory of Open Access Journals (Sweden)

    Felix Weber

    2016-12-01

    Full Text Available This paper describes a semi-active vibration absorber (SVA concept based on a real-time controlled magnetorheological damper (MR-SVA for the enhanced mitigation of structural vibrations due to harmonic disturbing forces. The force of the MR damper is controlled in real-time to generate the frequency and damping controls according to the behaviour of the undamped vibration absorber for the actual frequency of vibration. As stiffness and damping emulations in semi-active actuators are coupled quantities the control is formulated to prioritize the frequency control by the controlled stiffness. The control algorithm is augmented by a stiffness correction method ensuring precise frequency control when the desired control force is constrained by the semi-active restriction and residual force of the MR damper. The force tracking task is solved by a model-based feed forward with feedback correction. The MR-SVA is numerically and experimentally validated for the primary structure with nominal eigenfrequency and when de-tuning of −10%, −5%, +5% and +10% is present. Both validations demonstrate that the MR-SVA improves the vibration reduction in the primary structure by up to 55% compared to the passive tuned mass damper (TMD. Furthermore, it is shown that the MR-SVA with only 80% of tuned mass leads to approximately the same enhanced performance while the associated increased relative motion amplitude of the tuned mass is more than compensated be the reduced dimensions of the mass. Therefore, the MR-SVA is an appropriate solution for the mitigation of tall buildings where the pendulum mass can be up to several thousands of metric tonnes and space for the pendulum damper is limited.

  17. Elbow joint position sense after neuromuscular training with handheld vibration.

    Science.gov (United States)

    Tripp, Brady L; Faust, Donald; Jacobs, Patrick

    2009-01-01

    Clinicians use neuromuscular control exercises to enhance joint position sense (JPS); however, because standardizing such exercises is difficult, validations of their use are limited. To evaluate the acute effects of a neuromuscular training exercise with a handheld vibrating dumbbell on elbow JPS acuity. Crossover study. University athletic training research laboratory. Thirty-one healthy, college-aged volunteers (16 men, 15 women, age = 23 + or - 3 years, height = 173 + or - 8 cm, mass = 76 + or - 14 kg). We measured and trained elbow JPS using an electromagnetic tracking device that provided auditory and visual biofeedback. For JPS testing, participants held a dumbbell and actively identified the target elbow flexion angle (90 degrees ) using the software-generated biofeedback, followed by 3 repositioning trials without feedback. Each neuromuscular training protocol included 3 exercises during which participants held a 2.55-kg dumbbell vibrating at 15, 5, or 0 Hz and used software-generated biofeedback to locate and maintain the target elbow flexion angle for 15 seconds. We calculated absolute (accuracy) and variable (variability) errors using the differences between target and reproduced angles. Training protocols using 15-Hz vibration enhanced accuracy and decreased variability of elbow JPS (P or = .200). Our results suggest these neuromuscular control exercises, which included low-magnitude, low-frequency handheld vibration, may enhance elbow JPS. Future researchers should examine vibration of various durations and frequencies, should include injured participants and functional multijoint and multiplanar measures, and should examine long-term effects of training protocols on JPS and injury.

  18. Ultrafast Vibrational Spectrometer for Engineered Nanometric Energetic Materials

    National Research Council Canada - National Science Library

    Dlott, Dana

    2002-01-01

    .... The needed equipment was ordered and installed, and assembled into a working SFG set up that has been tested on a model system consisting of a self assembled monolayer of alkane on gold. The next step will be to finish integrating the carbon dioxide laser system and to begin looking at aluminum based energetic materials.

  19. Generalized qubits of the vibrational motion of a trapped ion

    International Nuclear Information System (INIS)

    Arevalo Aguilar, L.M.; Moya-Cessa, H.

    2002-01-01

    We present a method to generate qubits of the vibrational motion of an ion. The method is developed in the non-rotating-wave-approximation regime, therefore we consider regimes where the dynamics has not been studied. Because the solutions are valid for a more extended range of parameters we call them generalized qubits

  20. Putting a damper on drilling's bad vibrations

    Energy Technology Data Exchange (ETDEWEB)

    Jardine, S [Sedco forex, Montrouge (France); Malone, D [Anadrill, Sugar Land, TX (United States); Sheppard, M [Schlumberger Cambridge Research, Cambridge (United Kingdom)

    1994-01-01

    Harmful drilling vibrations are costing the industry dearly. Three main vibration types (axial, torsional and transverse) are explained and its causes discussed. Technology exists to eliminate most vibrations, but requires more systematic deployment than is usual. Hardware that eliminates vibrations is reviewed, including downhole shock measurement, torque feedback shock guards and antiwhirl bits. 9 figs., 11 refs.

  1. Electronic energy transfer through non-adiabatic vibrational-electronic resonance. II. 1D spectra for a dimer

    Science.gov (United States)

    Tiwari, Vivek; Jonas, David M.

    2018-02-01

    Vibrational-electronic resonance in photosynthetic pigment-protein complexes invalidates Förster's adiabatic framework for interpreting spectra and energy transfer, thus complicating determination of how the surrounding protein affects pigment properties. This paper considers the combined effects of vibrational-electronic resonance and inhomogeneous variations in the electronic excitation energies of pigments at different sites on absorption, emission, circular dichroism, and hole-burning spectra for a non-degenerate homodimer. The non-degenerate homodimer has identical pigments in different sites that generate differences in electronic energies, with parameters loosely based on bacteriochlorophyll a pigments in the Fenna-Matthews-Olson antenna protein. To explain the intensity borrowing, the excited state vibrational-electronic eigenvectors are discussed in terms of the vibrational basis localized on the individual pigments, as well as the correlated/anti-correlated vibrational basis delocalized over both pigments. Compared to those in the isolated pigment, vibrational satellites for the correlated vibration have the same frequency and precisely a factor of 2 intensity reduction through vibrational delocalization in both absorption and emission. Vibrational satellites for anti-correlated vibrations have their relaxed emission intensity reduced by over a factor 2 through vibrational and excitonic delocalization. In absorption, anti-correlated vibrational satellites borrow excitonic intensity but can be broadened away by the combination of vibronic resonance and site inhomogeneity; in parallel, their vibronically resonant excitonic partners are also broadened away. These considerations are consistent with photosynthetic antenna hole-burning spectra, where sharp vibrational and excitonic satellites are absent. Vibrational-excitonic resonance barely alters the inhomogeneously broadened linear absorption, emission, and circular dichroism spectra from those for a

  2. Particularidades de la medición de presión sonora y vibraciones en grupos electrógenos MAN 18 V48/60 B // Distinctive features for sound pressure level and vibration measurements over engine generator sets type MAN 18 v48/60 b

    Directory of Open Access Journals (Sweden)

    Yanexi Cepero‐Aguilera

    2011-01-01

    Full Text Available Como parte de las líneas de investigación del Centro de Estudios en Ingeniería de Mantenimiento, sedesarrolla un proyecto de investigación encaminado a establecer las pautas para la evaluación de lacondición de grupos electrógenos. El presente artículo muestra las particularidades de la mediciónde sonido y vibraciones sobre un Grupo Electrógeno MAN 18 V48/60 B. Se analiza lo indicado en elestándar ISO 3744 concluyéndose con la imposibilidad práctica de su aplicación en el entornoindustrial y para grandes máquinas como lo es el caso de los grupos electrógenos MAN 18 V48/60 B.El interés de esta investigación se enfoca al generador del grupo electrógeno y por ello no obstante,se efectuaron mediciones de presión sonora orientando el micrófono hacia los cojinetes de este,sobre los cuales también se registraron sus vibraciones siguiendo lo indicado en el estándar ISO8528-9. El análisis comparativo de los registros espectrales de presión sonora y de vibracionesobligó a convertir los espectros FFT en espectros de ancho de banda proporcional constante. Comoresultado fundamental se obtiene la no correlación de las frecuencias espectrales de presión sonoracon las de vibraciones y una evaluación preliminar del generador exhibiendo una condición normal.Palabras claves: nivel de presión sonora, medición de vibraciones, ancho de banda proporcionalconstante, grupos electrógenos._________________________________________________________________AbstractA research project for condition monitoring of engine generator sets is developed as part of mainresearches at Maintenance Engineering Research Center. Sound pressure level and vibrationmeasurements over an engine generator set MAN 18 V48/60 B are made with the goal of identifythose frequencies present in both, sound pressure level and vibration spectra which could give thepossibility to use sound pressure level as a symptom parameter because of the continuous feature ofthis kind of

  3. Vibration measurements of automobile catalyst

    Science.gov (United States)

    Aatola, Seppo

    1994-09-01

    Vibration of catalyst cell, which is inside the casing of the catalyst, is difficult to measure with usual measuring instrumentation. When catalyst is in use, there is hot exhaust gas flow though the catalyst cell and temperature of the cell is approximately +900 degree(s)C. Therefore non-contact Laser- Doppler-Vibrometer was used to measure vibration velocity of the catalyst cell. The laser beam was directed towards the cell through pipe which was put through and welded to the casing of the catalyst. The outer end of the pipe was screw down with a tempered class to prevent exhaust gas flow from the pipe. The inner end of the pipe was open and few millimeters away from the measuring point. Catalyst was attached to the engine with two ways, rigidly close to the engine and flexible under the engine. The engine was running in test bench under controlled conditions. Vibration measurements were carried out during constant running speeds of the engine. Vibration signals were captured and analyzed with FFT-analyzer. Vibration of catalyst cell was strongest at running speed of 5000 rpm, from 10 to 20 g (1 g equals 9.81 ms-2), when catalyst was attached rigidly close to the engine. At running speed of 3000 rpm, vibration of catalyst cell was from 2 to 3 g in most cases, when catalyst was attached either rigidly or flexible to the engine. It is estimated that in real life, i.e. when catalyst is attached to car with same engine, vibration of catalyst cell at running speed of 5000 rpm is somewhere between 1 and 10 g. At running speed of 3000 rpm, which may be more often used when driving car (car speed approximately 100 kmh-1), vibration of catalyst cell is probably few g's.

  4. Smart accelerometer. [vibration damage detection

    Science.gov (United States)

    Bozeman, Richard J., Jr. (Inventor)

    1994-01-01

    The invention discloses methods and apparatus for detecting vibrations from machines which indicate an impending malfunction for the purpose of preventing additional damage and allowing for an orderly shutdown or a change in mode of operation. The method and apparatus is especially suited for reliable operation in providing thruster control data concerning unstable vibration in an electrical environment which is typically noisy and in which unrecognized ground loops may exist.

  5. Vibrational excitation from heterogeneous catalysis

    International Nuclear Information System (INIS)

    Purvis, G.D. III; Redmon, M.J.; Woken, G. Jr.

    1979-01-01

    Classical trajectories have been used by numerous researchers to investigate the dynamics of exothermic chemical reactions (atom + diatom) with a view toward understanding what leads to vibrational excitation of the product molecule. Unlike these studies, the case where the reaction is catalyzed by a solid surface is considered. The trajectory studies indicate that there should be conditions under which considerable vibrational energy appears in the product molecules without being lost to the solid during the course of the reaction. 2 figures, 3 tables

  6. Vibrational Spectral Studies of Gemfibrozil

    Science.gov (United States)

    Benitta, T. Asenath; Balendiran, G. K.; James, C.

    2008-11-01

    The Fourier Transform Raman and infrared spectra of the crystallized drug molecule 5-(2,5-Dimethylphenoxy)-2,2-dimethylpentanoic acid (Gemfibrozil) have been recorded and analyzed. Quantum chemical computational methods have been employed using Gaussian 03 software package based on Hartree Fock method for theoretically modeling the grown molecule. The optimized geometry and vibrational frequencies have been predicted. Observed vibrational modes have been assigned with the aid of normal coordinate analysis.

  7. Accuracy of electromagnetic tracking with a prototype field generator in an interventional OR setting

    International Nuclear Information System (INIS)

    Boe, Lars Eirik; Leira, Haakon Olav; Tangen, Geir Arne; Hofstad, Erlend Fagertun; Amundsen, Tore; Langoe, Thomas

    2012-01-01

    Purpose: The authors have studied the accuracy and robustness of a prototype electromagnetic window field generator (WFG) in an interventional radiology suite with a robotic C-arm. The overall purpose is the development of guidance systems combining real-time imaging with tracking of flexible instruments for bronchoscopy, laparoscopic ultrasound, endoluminal surgery, endovascular therapy, and spinal surgery. Methods: The WFG has a torus shape, which facilitates x-ray imaging through its centre. The authors compared the performance of the WFG to that of a standard field generator (SFG) under the influence of the C-arm. Both accuracy and robustness measurements were performed with the C-arm in different positions and poses. Results: The system was deemed robust for both field generators, but the accuracy was notably influenced as the C-arm was moved into the electromagnetic field. The SFG provided a smaller root-mean-square position error but was more influenced by the C-arm than the WFG. The WFG also produced smaller maximum and variance of the error. Conclusions: Electromagnetic (EM) tracking with the new WFG during C-arm based fluoroscopy guidance seems to be a step forward, and with a correction scheme implemented it should be feasible.

  8. Generation and tunable enhancement of a sum-frequency signal in lithium niobate nanowires

    Science.gov (United States)

    Sergeyev, Anton; Reig Escalé, Marc; Grange, Rachel

    2017-02-01

    Recent developments in the fabrication of lithium niobate (LiNbO3) structures down to the nanoscale opens up novel applications of this versatile material in nonlinear optics. Current nonlinear optical studies in sub-micron waveguides are mainly restricted to the generation of second and third harmonics. In this work, we demonstrate the generation and waveguiding of the sum-frequency generation (SFG) signal in a single LiNbO3 nanowire with a cross-section of 517 nm  ×  654 nm. Furthermore, we enhance the guided SFG signal 17.9 times by means of modal phase matching. We also display tuning of the phase-matched wavelength by varying the nanowire cross-section and changing the polarization of the incident laser. The results prove that LiNbO3 nanowires can be successfully used for nonlinear wave-mixing applications and assisting the miniaturization of optical devices. , which features invited work from the best early-career researchers working within the scope of J Phys D. This project is part of the Journal of Physics series’ 50th anniversary celebrations in 2017. Rachel Grange was selected by the Editorial Board of J Phys D as an Emerging Leader.

  9. Tomographic elastography of contracting skeletal muscles from their natural vibrations

    Science.gov (United States)

    Sabra, Karim G.; Archer, Akibi

    2009-11-01

    Conventional elastography techniques require an external mechanical or radiation excitation to measure noninvasively the viscoelastic properties of skeletal muscles and thus monitor human motor functions. We developed instead a passive elastography technique using only an array of skin-mounted accelerometers to record the low-frequency vibrations of the biceps brachii muscle naturally generated during voluntary contractions and to determine their two-dimensional directionality. Cross-correlating these recordings provided travel-times measurements of these muscle vibrations between multiple sensor pairs. Travel-time tomographic inversions yielded spatial variations of their propagation velocity during isometric elbow flexions which indicated a nonuniform longitudinal stiffening of the biceps.

  10. Vibrational spectroscopy at high external pressures the diamond anvil cell

    CERN Document Server

    Ferraro, John R

    1984-01-01

    Vibrational Spectroscopy at High External Pressures: The Diamond Anvil Cell presents the effects of high pressure on the vibrational properties of materials as accomplished in a diamond anvil cell (DAC). The DAC serves the dual purpose of generating the pressures and being transparent to infrared radiation, allowing the observation of changes caused by pressure. The optical probes highlighted will deal principally with infrared and Raman scattering, although some observations in the visible region will also be presented. The book begins with a discussion of the effects of pressure and pres

  11. Calculation of ground vibration spectra from heavy military vehicles

    Science.gov (United States)

    Krylov, V. V.; Pickup, S.; McNuff, J.

    2010-07-01

    The demand for reliable autonomous systems capable to detect and identify heavy military vehicles becomes an important issue for UN peacekeeping forces in the current delicate political climate. A promising method of detection and identification is the one using the information extracted from ground vibration spectra generated by heavy military vehicles, often termed as their seismic signatures. This paper presents the results of the theoretical investigation of ground vibration spectra generated by heavy military vehicles, such as tanks and armed personnel carriers. A simple quarter car model is considered to identify the resulting dynamic forces applied from a vehicle to the ground. Then the obtained analytical expressions for vehicle dynamic forces are used for calculations of generated ground vibrations, predominantly Rayleigh surface waves, using Green's function method. A comparison of the obtained theoretical results with the published experimental data shows that analytical techniques based on the simplified quarter car vehicle model are capable of producing ground vibration spectra of heavy military vehicles that reproduce basic properties of experimental spectra.

  12. Structural impact response for assessing railway vibration induced on buildings

    Science.gov (United States)

    Kouroussis, Georges; Mouzakis, Harris P.; Vogiatzis, Konstantinos E.

    2018-03-01

    Over the syears, the rapid growth in railway infrastructure has led to numerous environmental challenges. One such significant issue, particularly in urban areas, is ground-borne vibration. A common source of ground-borne vibration is caused by local defects (e.g. rail joints, switches, turnouts, etc.) that generate large amplitude excitations at isolated locations. Modelling these excitation sources is particularly challenging and requires the use of complex and extensive computational efforts. For some situations, the use of experiments and measured data offers a rapid way to estimate the effect of such defects and to evaluate the railway vibration levels using a scoping approach. In this paper, the problem of railway-induced ground vibrations is presented along with experimental studies to assess the ground vibration and ground borne noise levels, with a particular focus on the structural response of sensitive buildings. The behaviour of particular building foundations is evaluated through experimental data collected in Brussels Region, by presenting the expected frequency responses for various types of buildings, taking into account both the soil-structure interaction and the tramway track response. A second study is dedicated to the Athens metro, where transmissibility functions are used to analyse the effect of various Athenian building face to metro network trough comprehensive measurement campaigns. This allows the verification of appropriate vibration mitigation measures. These benchmark applications based on experimental results have been proved to be efficient to treat a complex problem encountered in practice in urban areas, where the urban rail network interacts with important local defects and where the rise of railway ground vibration problems has clearly been identified.

  13. Vibrational spectroscopy of proteins

    International Nuclear Information System (INIS)

    Schwaighofer, A.

    2013-01-01

    Two important steps for the development of a biosensor are the immobilization of the biological component (e.g. protein) on a surface and the enhancement of the signal to improve the sensitivity of detection. To address these subjects, the present work describes Fourier transform infrared (FTIR) investigations of several proteins bound to the surface of an attenuated total reflection (ATR) crystal. Furthermore, new nanostructured surfaces for signal enhancement were developed for use in FTIR microscopy. The mitochondrial redox-protein cytochrome c oxidase (CcO) was incorporated into a protein-tethered bilayer lipid membrane (ptBLM) on an ATR crystal featuring a roughened two-layer gold surface for signal enhancement. Electrochemical excitation by periodic potential pulses at different modulation frequencies was followed by time-resolved FTIR spectroscopy. Phase sensitive detection was used for deconvolution of the IR spectra into vibrational components. A model based on protonation-dependent chemical reaction kinetics could be fitted to the time evolution of IR bands attributed to several different redox centers of the CcO. Further investigations involved the odorant binding protein 14 (OBP14) of the honey bee (Apis mellifera), which was studied using ATR-FTIR spectroscopy and circular dichroism. OBP14 was found to be thermally stable up to 45 °C, thus permitting the potential application of this protein for the fabrication of biosensors. Thermal denaturation measurements showed that odorant binding increases the thermal stability of the OBP-odorant complex. In another project, plasmonic nanostructures were fabricated that enhance the absorbance in FTIR microscopy measurements. The nanostructures are composed of an array of round-shaped insulator and gold discs on top of a continuous gold layer. Enhancement factors of up to ⁓125 could be observed with self-assembled monolayers of dodecanethiol molecules immobilized on the gold surface (author) [de

  14. Coupling vibration research on Vehicle-bridge system

    Science.gov (United States)

    Zhou, Jiguo; Wang, Guihua

    2018-01-01

    The vehicle-bridge coupling system forms when vehicle running on a bridge. It will generate a relatively large influence on the driving comfort and driving safe when the vibration of the vehicle is bigger. A three-dimensional vehicle-bridge system with biaxial seven degrees of freedom has been establish in this paper based on finite numerical simulation. Adopting the finite element transient numerical simulation to realize the numerical simulation of vehicle-bridge system coupling vibration. Then, analyze the dynamic response of vehicle and bridge while different numbers of vehicles running on the bridge. Got the variation rule of vertical vibration of car body and bridge, and that of the contact force between the wheel and bridge deck. The research results have a reference value for the analysis about the vehicle running on a large-span cabled bridge.

  15. Performance Study of Diagonally Segmented Piezoelectric Vibration Energy Harvester

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jae Eun [Catholic Univ. of Daegu, Daegu (Korea, Republic of)

    2013-08-15

    This study proposes a piezoelectric vibration energy harvester composed of two diagonally segmented energy harvesting units. An auxiliary structural unit is attached to the tip of a host structural unit cantilevered to a vibrating base, where the two components have beam axes in opposite directions from each other and matched short-circuit resonant frequencies. Contrary to the usual observations in two resonant frequency-matched structures, the proposed structure shows little eigenfrequency separation and yields a mode sequence change between the first two modes. These lead to maximum power generation around a specific frequency. By using commercial finite element software, it is shown that the magnitude of the output power from the proposed vibration energy harvester can be substantially improved in comparison with those from conventional cantilevered energy harvesters with the same footprint area and magnitude of a tip mass.

  16. Application of Sub-Micrometer Vibrations to Mitigate Bacterial Adhesion

    Directory of Open Access Journals (Sweden)

    Will R. Paces

    2014-03-01

    Full Text Available As a prominent concern regarding implantable devices, eliminating the threat of opportunistic bacterial infection represents a significant benefit to both patient health and device function. Current treatment options focus on chemical approaches to negate bacterial adhesion, however, these methods are in some ways limited. The scope of this study was to assess the efficacy of a novel means of modulating bacterial adhesion through the application of vibrations using magnetoelastic materials. Magnetoelastic materials possess unique magnetostrictive property that can convert a magnetic field stimulus into a mechanical deformation. In vitro experiments demonstrated that vibrational loads generated by the magnetoelastic materials significantly reduced the number of adherent bacteria on samples exposed to Escherichia coli, Staphylococcus epidermidis and Staphylococcus aureus suspensions. These experiments demonstrate that vibrational loads from magnetoelastic materials can be used as a post-deployment activated means to deter bacterial adhesion and device infection.

  17. All-solid-state quasi-CW yellow laser with intracavity self-Raman conversion and sum frequency generation

    International Nuclear Information System (INIS)

    Kananovich, A; Grabtchikov, A; Orlovich, V; Demidovich, A; Danailov, M

    2010-01-01

    Quasi continuous-wave (qCW) yellow emission (pulse duration 5 ms, repetition rate 20 Hz) at 559 nm is demonstrated through intracavity sum frequency generation (SFG) of Stokes and fundamental fields in Nd:YVO 4 diode pumped self-Raman laser for the first time. Average in pulse output power at 559 nm was 0.47 W for 22 W of pump power, which corresponds to 2.1% of diode-to-yellow efficiency. The pulsed mode of operation was due to diode pump modulation and was used to reduce thermal stress of the crystal

  18. Built-up edge investigation in vibration drilling of Al2024-T6.

    Science.gov (United States)

    Barani, A; Amini, S; Paktinat, H; Fadaei Tehrani, A

    2014-07-01

    Adding ultrasonic vibrations to drilling process results in an advanced hybrid machining process, entitled "vibration drilling". This study presents the design and fabrication of a vibration drilling tool by which both rotary and vibrating motions are applied to drill simultaneously. High frequency and low amplitude vibrations were generated by an ultrasonic transducer with frequency of 19.65 kHz. Ultrasonic transducer was controlled by a MPI ultrasonic generator with 3 kW power. The drilling tool and workpiece material were HSS two-flute twist drill and Al2024-T6, respectively. The aim of this study was investigating on the effect of ultrasonic vibrations on built-up edge, surface quality, chip morphology and wear mechanisms of drill edges. Therefore, these factors were studied in both vibration and ordinary drilling. Based on the achieved results, vibration drilling offers less built-up edge and better surface quality compared to ordinary drilling. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Development of varying magnetic field analysis technology caused by vibration of MRI apparatus

    International Nuclear Information System (INIS)

    Imamura, Yukinobu; Motoshiromizu, Hirofumi; Abe, Mitsushi; Watanabe, Hiroyuki; Takeuchi, Hiroyuki

    2015-01-01

    In Magnetic Resonance Imaging (MRI) apparatus, pulse current is energized to the gradient coils in a strong static magnetic field generated by the static magnetic poles. Since electromagnetic force (i.e. Lorentz force) is generated in the gradient coils, the MRI magnet system vibrates. On the other hand, vibration of the MRI magnet system is affected by electromagnetic force caused by static magnetic poles vibration. As the vibration of MRI magnet system causes magnetic field disturbance (so-called 'error magnetic field') and affect image quality, it is important to evaluate them in the design process. In this study, a varying magnetic field evaluation method for MRI magnet system was developed. Vibration and electromagnetic force is considered in the weak coupling formation using the Modal Magnetic Dumping (MMD) method. In the eddy current analysis by vibration, the displacement was considered in the magnetic field changes in the finite elements. Error magnetic field caused by equipment vibration was obtained by superposition of the static magnetic field fluctuation and the eddy current magnetic field. Then open type MRI magnet was evaluated by the proposed methodology. A a result, vibration of static magnet poles were suppressed by magnetic dumping at 50 Hz or less and eddy current magnetic field was dominant at 50 Hz or more. (author)

  20. Study of confinement and sliding friction of fluids using sum frequency generation spectroscopy

    Science.gov (United States)

    Nanjundiah, Kumar

    2007-12-01

    Friction and wear are important technologically. Tires on wet roads, windshield wipers and human joints are examples where nanometer-thick liquids are confined between flexible-rigid contact interfaces. Fundamental understanding of the structure of these liquids can assist in the design of products such as artificial joints and lubricants for Micro-electromechanical systems [MEMS]. Prior force measurements have suggested an increase in apparent viscosity of confined liquid and sometimes solid-like responses. But, these have not given the state of molecules under confinement. In the present study, we have used a surface sensitive, non-linear optical technique (infrared-visible sum frequency generation spectroscopy [SFG]) to investigate molecular structure at hidden interfaces. SFG can identify chemical groups, concentration and orientation of molecules at an interface. A friction cell was developed to study sliding of a smooth elastomeric lens against a sapphire surface. Experiments were done with dry sliding as well as lubricated sliding in the presence of linear alkane liquids. SFG spectra at the alkane/sapphire interface revealed ordering of the confined alkane molecules. These were more ordered than alkane liquid, but less ordered than alkane crystal. Cooling of the confined alkane below its melting temperature [TM] led to molecular orientation that was different from that of bulk crystal next to a sapphire surface. Molecules were oriented with their symmetry axis parallel to the surface normal. In addition, the melting temperature [Tconf] under confinement for a series of linear alkanes (n =15--27) showed a surprising trend. Intermediate molecular weights showed melting point depression. The T conf values suggested that melting started at the alkane/sapphire interface. In another investigation, confinement of water between an elastomeric PDMS lens and sapphire was studied. SFG spectra at the sapphire/water/PDMS interface revealed a heterogeneous morphology. The