Phase transition behaviors of the supported DPPC bilayer investigated by sum frequency generation (SFG) vibrational spectroscopy and atomic force microscopy (AFM).

Science.gov (United States)

Wu, Heng-Liang; Tong, Yujin; Peng, Qiling; Li, Na; Ye, Shen

2016-01-21

The phase transition behaviors of a supported bilayer of dipalmitoylphosphatidyl-choline (DPPC) have been systematically evaluated by in situ sum frequency generation (SFG) vibrational spectroscopy and atomic force microscopy (AFM). By using an asymmetric bilayer composed of per-deuterated and per-protonated monolayers, i.e., DPPC-d75/DPPC and a symmetric bilayer of DPPC/DPPC, we were able to probe the molecular structural changes during the phase transition process of the lipid bilayer by SFG spectroscopy. It was found that the DPPC bilayer is sequentially melted from the top (adjacent to the solution) to bottom leaflet (adjacent to the substrate) over a wide temperature range. The conformational ordering of the supported bilayer does not decrease (even slightly increases) during the phase transition process. The conformational defects in the bilayer can be removed after the complete melting process. The phase transition enthalpy for the bottom leaflet was found to be approximately three times greater than that for the top leaflet, indicating a strong interaction of the lipids with the substrate. The present SFG and AFM observations revealed similar temperature dependent profiles. Based on these results, the temperature-induced structural changes in the supported lipid bilayer during its phase transition process are discussed in comparison with previous studies.

Circularly polarized infrared and visible sum-frequency-generation spectroscopy: Vibrational optical activity measurement

International Nuclear Information System (INIS)

Cheon, Sangheon; Cho, Minhaeng

2005-01-01

Vibrational optical activity spectroscopies utilizing either circularly polarized ir or circularly polarized visible beams were theoretically investigated by considering the infrared and visible sum-frequency-generation (IV-SFG) schemes. In addition to the purely electric dipole-allowed chiral component of the IV-SFG susceptibility, the polarizability-electric quadrupole hyperpolarizability term also contributes to the vibrationally resonant IV-SFG susceptibility. The circular-intensity-difference signal is shown to be determined by the interferences between the all-electric dipole-allowed chiral component and the polarizability-electric-dipole or electric-dipole-electric-quadrupole Raman optical activity tensor components. The circularly polarized SFG methods are shown to be potentially useful coherent spectroscopic tools for determining absolute configurations of chiral molecules in condensed phases

Sum frequency generation of CO on (III) and polycrystalline platinum electrode surfaces: Evidence for SFG invisible surface CO

Energy Technology Data Exchange (ETDEWEB)

Baldelli, S.; Markovic, N.; Ross, P.; Shen, Y.R.; Somorjai, G.

1999-10-21

The vibrational spectroscopy sum frequency generation (SFG) is used to investigate the adsorption of carbon monoxide on the single crystal (111) and polycrystalline platinum surfaces. By varying the frequency and polarization of the light beams, different surface species of CO species are probed. SFG signal intensities for different polarization indicate that adsorbed CO polarizability is significantly perturbed from the gas-phase molecule. The SFG signal of CO disappears well below the main oxidation potential of CO to CO{sub 2}. The disappearance of the CO signal is interpreted as a transformation in the CO layer to a state which is invisible to SFG. The invisible state is suggested to be CO with the bond axis nearly parallel to the platinum surface.

Self-assembled organic and fullerene monolayers characterisation by two-colour SFG spectroscopy: a pathway to meet doubly resonant SFG process

OpenAIRE

Humbert, C.; Caudano, Y.; Dreesen, Laurent; Sartenaer, Y.; Mani, A. A.; Silien, C.; Lemaire, J.-J.; Thiry, P. A.; Peremans, A.

2004-01-01

Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C60/Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces...

Theory of sum-frequency generation spectroscopy of adsorbed molecules using the density matrix method-broadband vibrational sum-frequency generation and applications

International Nuclear Information System (INIS)

Bonn, M; Ueba, H; Wolf, M

2005-01-01

A generalized theory of frequency- and time-resolved vibrational sum-frequency generation (SFG) spectroscopy of adsorbates at surfaces is presented using the density matrix formalism. Our theoretical treatment is specifically aimed at addressing issues that accompany the relatively novel SFG approach using broadband infrared pulses. The ultrashort duration of these pulses makes them ideally suited for time-resolved investigations, for which we present a complete theoretical treatment. A second key characteristic of these pulses is their large bandwidth and high intensity, which allow for highly non-linear effects, including vibrational ladder climbing of surface vibrations. We derive general expressions relating the density matrix to SFG spectra, and apply these expressions to specific experimental results by solving the coupled optical Bloch equations of the density matrix elements. Thus, we can theoretically reproduce recent experimentally demonstrated hot band SFG spectra using femtosecond broadband infrared excitation of carbon monoxide (CO) on a Ru(001) surface

IR and SFG vibrational spectroscopy of the water bend in the bulk liquid and at the liquid-vapor interface, respectively

Energy Technology Data Exchange (ETDEWEB)

Ni, Yicun; Skinner, J. L. [Theoretical Chemistry Institute and Department of Chemistry, University of Wisconsin, Madison, Wisconsin 53706 (United States)

2015-07-07

Vibrational spectroscopy of the water bending mode has been investigated experimentally to study the structure of water in condensed phases. In the present work, we calculate the theoretical infrared (IR) and sum-frequency generation (SFG) spectra of the HOH bend in liquid water and at the water liquid/vapor interface using a mixed quantum/classical approach. Classical molecular dynamics simulation is performed by using a recently developed water model that explicitly includes three-body interactions and yields a better description of the water surface. Ab-initio-based transition frequency, dipole, polarizability, and intermolecular coupling maps are developed for the spectral calculations. The calculated IR and SFG spectra show good agreement with the experimental measurements. In the theoretical imaginary part of the SFG susceptibility for the water liquid/vapor interface, we find two features: a negative band centered at 1615 cm{sup −1} and a positive band centered at 1670 cm{sup −1}. We analyze this spectrum in terms of the contributions from molecules in different hydrogen-bond classes to the SFG spectral density and also compare to SFG results for the OH stretch. SFG of the water bending mode provides a complementary picture of the heterogeneous hydrogen-bond configurations at the water surface.

IR and SFG vibrational spectroscopy of the water bend in the bulk liquid and at the liquid-vapor interface, respectively

Science.gov (United States)

Ni, Yicun; Skinner, J. L.

2015-07-01

Vibrational spectroscopy of the water bending mode has been investigated experimentally to study the structure of water in condensed phases. In the present work, we calculate the theoretical infrared (IR) and sum-frequency generation (SFG) spectra of the HOH bend in liquid water and at the water liquid/vapor interface using a mixed quantum/classical approach. Classical molecular dynamics simulation is performed by using a recently developed water model that explicitly includes three-body interactions and yields a better description of the water surface. Ab-initio-based transition frequency, dipole, polarizability, and intermolecular coupling maps are developed for the spectral calculations. The calculated IR and SFG spectra show good agreement with the experimental measurements. In the theoretical imaginary part of the SFG susceptibility for the water liquid/vapor interface, we find two features: a negative band centered at 1615 cm-1 and a positive band centered at 1670 cm-1. We analyze this spectrum in terms of the contributions from molecules in different hydrogen-bond classes to the SFG spectral density and also compare to SFG results for the OH stretch. SFG of the water bending mode provides a complementary picture of the heterogeneous hydrogen-bond configurations at the water surface.

Structure Sensitivity in Pt Nanoparticle Catalysts for Hydrogenation of 1,3-Butadiene: In Situ Study of Reaction Intermediates Using SFG Vibrational Spectroscopy

KAUST Repository

Michalak, William D.

2013-01-31

The product selectivity during 1,3-butadiene hydrogenation on monodisperse, colloidally synthesized, Pt nanoparticles was studied under reaction conditions with kinetic measurements and in situ sum frequency generation (SFG) vibrational spectroscopy. SFG was performed with the capping ligands intact in order to maintain nanoparticle size by reduced sintering. Four products are formed at 75 C: 1-butene, cis-2-butene, trans-2-butene, and n-butane. Ensembles of Pt nanoparticles with average diameters of 0.9 and 1.8 nm exhibit a ∼30% and ∼20% increase in the full hydrogenation products, respectively, as compared to Pt nanoparticles with average diameters of 4.6 and 6.7 nm. Methyl and methylene vibrational stretches of reaction intermediates observed under working conditions using SFG were used to correlate the stable reaction intermediates with the product distribution. Kinetic and SFG results correlate with previous DFT predictions for two parallel reaction pathways of 1,3-butadiene hydrogenation. Hydrogenation of 1,3-butadiene can initiate with H-addition at internal or terminal carbons leading to the formation of 1-buten-4-yl radical (metallocycle) and 2-buten-1-yl radical intermediates, respectively. Small (0.9 and 1.8 nm) nanoparticles exhibited vibrational resonances originating from both intermediates, while the large (4.6 and 6.7 nm) particles exhibited vibrational resonances originating predominately from the 2-buten-1-yl radical. This suggests each reaction pathway competes for partial and full hydrogenation and the nanoparticle size affects the kinetic preference for the two pathways. The reaction pathway through the metallocycle intermediate on the small nanoparticles is likely due to the presence of low-coordinated sites. © 2012 American Chemical Society.

Hydration of Sulphobetaine (SB) and Tetra(ethylene glycol) (EG4)-Terminated Self-Assembled Monolayers Studied by Sum Frequency Generation (SFG) Vibrational Spectroscopy

Science.gov (United States)

Stein, M. Jeanette; Weidner, Tobias; McCrea, Keith; Castner, David G.; Ratner, Buddy D.

2010-01-01

Sum frequency generation (SFG) vibrational spectroscopy is used to study the surface and the underlying substrate of both homogeneous and mixed self-assembled monolayers (SAMs) of 11-mercaptoundecyl-1-sulphobetainethiol (HS(CH2)11N+(CH3)2(CH2)3SO3−, SB) and 1-mercapto-11-undecyl tetra(ethylene glycol) (HS(CH2)11O(CH2CH2O)4OH, EG4) with an 11-mercapto-1-undecanol (HS(CH2)11OH, MCU) diluent. SFG results on the C–H region of the dry and hydrated SAMs gave an in situ look into the molecular orientation and suggested an approach to maximize signal-to-noise ratio on these difficult to analyze hydrophilic SAMs. Vibrational fingerprint studies in the 3000–3600 cm−1 spectral range for the SAMs exposed serially to air, water, and deuterated water revealed that a layer of tightly-bound structured water was associated with the surface of a non-fouling monolayer but was not present on a hydrophobic N-undecylmercaptan (HS(CH2)10CH3, UnD) control. The percentage of water retained upon submersion in D2O correlated well with the relative amount of protein that was previously shown to absorb onto the monolayers. These results provide evidence supporting the current theory regarding the role of a tightly-bound vicinal water layer in the protein resistance of a non-fouling group. PMID:19639981

Detection of amide I signals of interfacial proteins in situ using SFG.

Science.gov (United States)

Wang, Jie; Even, Mark A; Chen, Xiaoyun; Schmaier, Alvin H; Waite, J Herbert; Chen, Zhan

2003-08-20

In this Communication, we demonstrate the novel observation that it is feasible to collect amide signals from polymer/protein solution interfaces in situ using sum frequency generation (SFG) vibrational spectroscopy. Such SFG amide signals allow for acquisition of more detailed molecular level information of entire interfacial protein structures. Proteins investigated include bovine serum albumin, mussel protein mefp-2, factor XIIa, and ubiquitin. Our studies indicate that different proteins generate different SFG amide signals at the polystyrene/protein solution interface, showing that they have different interfacial coverage, secondary structure, or orientation.

Self-assembled organic and fullerene monolayers characterisation by two-colour SFG spectroscopy: a pathway to meet doubly resonant SFG process

International Nuclear Information System (INIS)

Humbert, C.; Caudano, Y.; Dreesen, L.; Sartenaer, Y.; Mani, A.A.; Silien, C.; Lemaire, J.-J.; Thiry, P.A.; Peremans, A.

2004-01-01

Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C 60 /Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces is explained in terms of metal interband transition, molecular electronic transition and of electron-phonon coupling, respectively

Self-assembled organic and fullerene monolayers characterisation by two-colour SFG spectroscopy: a pathway to meet doubly resonant SFG process

Science.gov (United States)

Humbert, C.; Caudano, Y.; Dreesen, L.; Sartenaer, Y.; Mani, A. A.; Silien, C.; Lemaire, J.-J.; Thiry, P. A.; Peremans, A.

2004-10-01

Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[ p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C 60/Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces is explained in terms of metal interband transition, molecular electronic transition and of electron-phonon coupling, respectively.

Characterization of polymer surface structure and surface mechanical behaviour by sum frequency generation surface vibrational spectroscopy and atomic force microscopy

International Nuclear Information System (INIS)

Opdahl, Aric; Koffas, Telly S; Amitay-Sadovsky, Ella; Kim, Joonyeong; Somorjai, Gabor A

2004-01-01

Sum frequency generation (SFG) vibrational spectroscopy and atomic force microscopy (AFM) have been used to study polymer surface structure and surface mechanical behaviour, specifically to study the relationships between the surface properties of polymers and their bulk compositions and the environment to which the polymer is exposed. The combination of SFG surface vibrational spectroscopy and AFM has been used to study surface segregation behaviour of polyolefin blends at the polymer/air and polymer/solid interfaces. SFG surface vibrational spectroscopy and AFM experiments have also been performed to characterize the properties of polymer/liquid and polymer/polymer interfaces, focusing on hydrogel materials. A method was developed to study the surface properties of hydrogel contact lens materials at various hydration conditions. Finally, the effect of mechanical stretching on the surface composition and surface mechanical behaviour of phase-separated polyurethanes, used in biomedical implant devices, has been studied by both SFG surface vibrational spectroscopy and AFM. (topical review)

Interpreting intensities in vibrational sum frequency generation (SFG) spectroscopy: CO adsorption on Pd surfaces

Science.gov (United States)

Morkel, M.; Unterhalt, H.; Klüner, T.; Rupprechter, G.; Freund, H.-J.

2005-07-01

The lineshape and intensity of SFG signals of CO adsorbed on supported Pd nanoparticles and Pd(1 1 1) are analyzed. For CO/Pd(1 1 1) nearly symmetric lorentzian lineshapes were observed. Applying two different visible wavelengths for excitation, asymmetric lineshapes observed for the CO/Pd/Al 2O 3/NiAl(1 1 0) system are explained by a lower resonant and a higher non-resonant SFG signal and a change in the phase between resonant and non-resonant signals, most likely originating from an interband transition in the NiAl substrate. The relative intensity of different CO species (hollow, bridge, on-top) was modeled by DFT calculations of IR transition moments and Raman activities. While the (experimental) sensitivity of SFG towards different CO species strongly varies, the calculated IR and Raman activities are rather similar. The inability to exactly reproduce experimental SFG intensities suggests a strong coverage dependence of Raman activities or that non-linear effects occur that can currently not be properly accounted for.

Self-assembled organic and fullerene monolayers characterisation by two-colour SFG spectroscopy: a pathway to meet doubly resonant SFG process

Energy Technology Data Exchange (ETDEWEB)

Humbert, C.; Caudano, Y.; Dreesen, L.; Sartenaer, Y.; Mani, A.A.; Silien, C.; Lemaire, J.-J.; Thiry, P.A.; Peremans, A

2004-10-15

Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C{sub 60}/Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces is explained in terms of metal interband transition, molecular electronic transition and of electron-phonon coupling, respectively.

Probing electronic and vibrational properties at the electrochemical interface using SFG spectroscopy: Methanol electro-oxidation on Pt(1 1 0)

Science.gov (United States)

Vidal, F.; Busson, B.; Tadjeddine, A.

2005-02-01

We report the study of methanol electro-oxidation on Pt(1 1 0) using infrared-visible sum-frequency generation (SFG) vibrational spectroscopy. The use of this technique enables to probe the vibrational and electronic properties of the interface simultaneously in situ. We have investigated the vibrational properties of the interface in the CO ads internal stretch spectral region (1700-2150 cm -1) over a wide range of potentials. The analysis of the evolution of the C-O stretch line shape, which is related to the interference between the vibrational and electronic parts of the non-linear response, with the potential allows us to show that the onset of bulk methanol oxidation corresponds to the transition from a negatively to a positively charged surface.

Sum Frequency Generation Vibrational Spectroscopy of Colloidal Platinum Nanoparticle Catalysts: Disordering versus Removal of Organic Capping

KAUST Repository

Krier, James M.

2012-08-23

Recent work with nanoparticle catalysts shows that size and shape control on the nanometer scale influences reaction rate and selectivity. Sum frequency generation (SFG) vibrational spectroscopy is a powerful tool for studying heterogeneous catalysis because it enables the observation of surface intermediates during catalytic reactions. To control the size and shape of catalytic nanoparticles, an organic ligand was used as a capping agent to stabilize nanoparticles during synthesis. However, the presence of an organic capping agent presents two major challenges in SFG and catalytic reaction studies: it blocks a significant fraction of active surface sites and produces a strong signal that prevents the detection of reaction intermediates with SFG. Two methods for cleaning Pt nanoparticles capped with poly (vinylpyrrolidone) (PVP) are examined in this study: solvent cleaning and UV cleaning. Solvent cleaning leaves more PVP intact and relies on disordering with hydrogen gas to reduce the SFG signal of PVP. In contrast, UV cleaning depends on nearly complete removal of PVP to reduce SFG signal. Both UV and solvent cleaning enable the detection of reaction intermediates by SFG. However, solvent cleaning also yields nanoparticles that are stable under reaction conditions, whereas UV cleaning results in aggregation during reaction. The results of this study indicate that solvent cleaning is more advantageous for studying the effects of nanoparticle size and shape on catalytic selectivity by SFG vibrational spectroscopy. © 2012 American Chemical Society.

Sum Frequency Generation Vibrational Spectroscopy of Adsorbed Amino Acids, Peptides and Proteins of Hydrophilic and Hydrophobic Solid-Water Interfaces

Energy Technology Data Exchange (ETDEWEB)

Holinga IV, George Joseph [Univ. of California, Berkeley, CA (United States)

2010-09-01

Sum frequency generation (SFG) vibrational spectroscopy was used to investigate the interfacial properties of several amino acids, peptides, and proteins adsorbed at the hydrophilic polystyrene solid-liquid and the hydrophobic silica solid-liquid interfaces. The influence of experimental geometry on the sensitivity and resolution of the SFG vibrational spectroscopy technique was investigated both theoretically and experimentally. SFG was implemented to investigate the adsorption and organization of eight individual amino acids at model hydrophilic and hydrophobic surfaces under physiological conditions. Biointerface studies were conducted using a combination of SFG and quartz crystal microbalance (QCM) comparing the interfacial structure and concentration of two amino acids and their corresponding homopeptides at two model liquid-solid interfaces as a function of their concentration in aqueous solutions. The influence of temperature, concentration, equilibration time, and electrical bias on the extent of adsorption and interfacial structure of biomolecules were explored at the liquid-solid interface via QCM and SFG. QCM was utilized to quantify the biological activity of heparin functionalized surfaces. A novel optical parametric amplifier was developed and utilized in SFG experiments to investigate the secondary structure of an adsorbed model peptide at the solid-liquid interface.

An SFG study of interfacial amino acids at the hydrophilic SiO2 and hydrophobic deuterated polystyrene surfaces.

Science.gov (United States)

Holinga, George J; York, Roger L; Onorato, Robert M; Thompson, Christopher M; Webb, Nic E; Yoon, Alfred P; Somorjai, Gabor A

2011-04-27

Sum frequency generation (SFG) vibrational spectroscopy was employed to characterize the interfacial structure of eight individual amino acids--L-phenylalanine, L-leucine, glycine, L-lysine, L-arginine, L-cysteine, L-alanine, and L-proline--in aqueous solution adsorbed at model hydrophilic and hydrophobic surfaces. Specifically, SFG vibrational spectra were obtained for the amino acids at the solid-liquid interface between both hydrophobic d(8)-polystyrene (d(8)-PS) and SiO(2) model surfaces and phosphate buffered saline (PBS) at pH 7.4. At the hydrophobic d(8)-PS surface, seven of the amino acids solutions investigated showed clear and identifiable C-H vibrational modes, with the exception being l-alanine. In the SFG spectra obtained at the hydrophilic SiO(2) surface, no C-H vibrational modes were observed from any of the amino acids studied. However, it was confirmed by quartz crystal microbalance that amino acids do adsorb to the SiO(2) interface, and the amino acid solutions were found to have a detectable and widely varying influence on the magnitude of SFG signal from water at the SiO(2)/PBS interface. This study provides the first known SFG spectra of several individual amino acids in aqueous solution at the solid-liquid interface and under physiological conditions.

Sum Frequency Generation Vibrational Spectroscopy of Colloidal Platinum Nanoparticle Catalysts: Disordering versus Removal of Organic Capping

KAUST Repository

Krier, James M.; Michalak, William D.; Baker, L. Robert; An, Kwangjin; Komvopoulos, Kyriakos; Somorjai, Gabor A.

2012-01-01

Recent work with nanoparticle catalysts shows that size and shape control on the nanometer scale influences reaction rate and selectivity. Sum frequency generation (SFG) vibrational spectroscopy is a powerful tool for studying heterogeneous

Probing alpha-helical and beta-sheet structures of peptides at solid/liquid interfaces with SFG.

Science.gov (United States)

Chen, Xiaoyun; Wang, Jie; Sniadecki, Jason J; Even, Mark A; Chen, Zhan

2005-03-29

We demonstrated that sum frequency generation (SFG) vibrational spectroscopy can distinguish different secondary structures of proteins or peptides adsorbed at solid/liquid interfaces. The SFG spectrum for tachyplesin I at the polystyrene (PS)/solution interface has a fingerprint peak corresponding to the B1/B3 mode of the antiparallel beta-sheet. This peak disappeared upon the addition of dithiothreitol, which can disrupt the beta-sheet structure. The SFG spectrum indicative of the MSI594 alpha-helical structure was observed at the PS/MSI594 solution interface. This research validates SFG as a powerful technique for revealing detailed secondary structures of interfacial proteins and peptides.

The molecular orientation of CO on Pd(1 1 1): a polarization-dependent SFG study

Science.gov (United States)

Galletto, Paolo; Unterhalt, Holger; Rupprechter, Günther

2003-01-01

The molecular orientation of carbon monoxide adsorbed on Pd(1 1 1) was examined by sum frequency generation (SFG) vibrational spectroscopy utilizing different polarization combinations of the visible and SFG light. This allows to determine the CO tilt angle with respect to the substrate, provided that a proper optical model for the interface can be defined. It is demonstrated that it is essential to invoke the βaac hyperpolarizability into the analysis and that polarization-dependent SFG of CO/Pd(1 1 1) yields information on βaac/ βccc rather than the tilt angle.

Probing organic field effect transistors in situ during operation using SFG.

Science.gov (United States)

Ye, Hongke; Abu-Akeel, Ashraf; Huang, Jia; Katz, Howard E; Gracias, David H

2006-05-24

In this communication, we report results obtained using surface-sensitive IR+Visible Sum Frequency Generation (SFG) nonlinear optical spectroscopy on interfaces of organic field effect transistors during operation. We observe remarkable correlations between trends in the surface vibrational spectra and electrical properties of the transistor, with changes in gate voltage (VG). These results suggest that field effects on electronic conduction in thin film organic semiconductor devices are correlated to interfacial nonlinear optical characteristics and point to the possibility of using SFG spectroscopy to monitor electronic properties of OFETs.

Quantitative Surface Chirality Detection with Sum Frequency Generation Vibrational Spectroscopy: Twin Polarization Angle Approach

International Nuclear Information System (INIS)

Wei, Feng; Xu, Yanyan; Guo, Yuan; Liu, Shi-lin; Wang, Hongfei

2009-01-01

Here we report a novel twin polarization angle (TPA) approach in the quantitative chirality detection with the surface sum-frequency generation vibrational spectroscopy (SFG-VS). Generally, the achiral contribution dominates the surface SFG-VS signal, and the pure chiral signal is usually two or three orders of magnitude smaller. Therefore, it has been difficult to make quantitative detection and analysis of the chiral contributions to the surface SFG-VS signal. In the TPA method, by varying together the polarization angles of the incoming visible light and the sum frequency signal at fixed s or p polarization of the incoming infrared beam, the polarization dependent SFG signal can give not only direct signature of the chiral contribution in the total SFG-VS signal, but also the accurate measurement of the chiral and achiral components in the surface SFG signal. The general description of the TPA method is presented and the experiment test of the TPA approach is also presented for the SFG-VS from the S- and R-limonene chiral liquid surfaces. The most accurate degree of chiral excess values thus obtained for the 2878 cm -1 spectral peak of the S- and R-limonene liquid surfaces are (23.7±0.4)% and (25.4±1.3)%, respectively.

Vibrational Dynamics of Interfacial Water by Free Induction Decay Sum Frequency Generation (FID-SFG) at the Al2O3(1120)/H2O Interface.

Science.gov (United States)

Boulesbaa, Abdelaziz; Borguet, Eric

2014-02-06

The dephasing dynamics of a vibrational coherence may reveal the interactions of chemical functional groups with their environment. To investigate this process at a surface, we employ free induction decay sum frequency generation (FID-SFG) to measure the time that it takes for free OH stretch oscillators at the charged (pH ≈ 13, KOH) interface of alumina/water (Al2O3/H2O) to lose their collective coherence. By employing noncollinear optical parametric amplification (NOPA) technology and nonlinear vibrational spectroscopy, we showed that the single free OH peak actually corresponds to two distinct oscillators oriented opposite to each other and measured the total dephasing time, T2, of the free OH stretch modes at the Al2O3/H2O interface with a sub-40 fs temporal resolution. Our results suggested that the free OH oscillators associated with interfacial water dephase on the time scale of 89.4 ± 6.9 fs, whereas the homogeneous dephasing of interfacial alumina hydroxyls is an order of magnitude slower.

SFG studies on interactions between antimicrobial peptides and supported lipid bilayers.

Science.gov (United States)

Chen, Xiaoyun; Chen, Zhan

2006-09-01

The mode of action of antimicrobial peptides (AMPs) in disrupting cell membrane bilayers is of fundamental importance in understanding the efficiency of different AMPs, which is crucial to design antibiotics with improved properties. Recent developments in the field of sum frequency generation (SFG) vibrational spectroscopy have made it a powerful and unique biophysical technique in investigating the interactions between AMPs and a single substrate supported planar lipid bilayer. We will review some of the recent progress in applying SFG to study membrane lipid bilayers and discuss how SFG can provide novel information such as real-time bilayer structure change and AMP orientation during AMP-lipid bilayer interactions in a very biologically relevant manner. Several examples of applying SFG to monitor such interactions between AMPs and a dipalmitoyl phosphatidylglycerol (DPPG) bilayer are presented. Different modes of actions are observed for melittin, tachyplesin I, d-magainin 2, MSI-843, and a synthetic antibacterial oligomer, demonstrating that SFG is very effective in the study of AMPs and AMP-lipid bilayer interactions.

Chemical imaging of structured SAMs with a novel SFG microscope

Science.gov (United States)

Hoffmann, Dominik M. P.; Kuhnke, Klaus; Kern, Klaus

2002-11-01

We present a newly developed microscope for sum frequency generation (SFG) imaging of opaque and reflecting interfaces. The sample is viewed at an angle of 60° with respect to the surface normal in order to increase the collected SFG intensity. Our setup is designed to keep the whole field of view (FOV) in focus and to compensate for the distortion usually related to oblique imaging by means of a blazed grating. The separation of the SFG intensity and the reflected visible beam is accomplished by a suitable combination of spectral filters. The sum frequency microscope (SFM) is capable of in-situ chemically selective imaging by tuning the IR-beam to vibrational transitions of the respective molecules. The SFM is applied to imaging of structured self-assembled monolayers (SAM) of thiol molecules on a gold surface.

Dynamics of Dangling Od-Stretch at the Air/water Interface by Heterodyne-Detected Sfg Spectroscopy

Science.gov (United States)

Stiopkin, I. V.; Weeraman, C.; Shalhout, F.; Benderskii, A. V.

2009-06-01

SFG spectra of dangling OD-stretch at the air/water interface contain information on vibrational dephasing dynamics, ultrafast reorientational molecular motion, and vibrational energy transfer. To better separate these processes we conducted heterodyne-detected SFG experiments to measure real and imaginary contributions of the SFG spectrum of the dangling OD-stretch at the air/D_2O interface for SSP, PPP, and SPS polarizations. Variations in the temporal profiles of the SFG signals for these three polarizations will be also discussed.

The structure of oleamide films at the aluminum/oil interface and aluminum/air interface studied by Sum Frequency Generation (SFG) vibrational spectroscopy and Reflection Absorption Infrared Spectroscopy (RAIRS).

Science.gov (United States)

Casford, Michael T L; Davies, Paul B

2009-08-01

The structure of oleamide (cis-9-octadecenamide) films on aluminum has been investigated by sum frequency generation vibrational spectroscopy (SFG) and reflection absorption infrared spectroscopy (RAIRS). Three different film deposition strategies were investigated: (i) films formed by equilibrium adsorption from oleamide solutions in oil, (ii) Langmuir-Blodgett films cast at 1 and 25 mN m(-1), (iii) thick spin-cast films. Both L-B and spin-cast films were examined in air and under oil. The adsorbate formed in the 1 mN m(-1) film in air showed little orientational order. For this film, the spectroscopic results and the ellipsometric thickness point to a relatively conformationally disordered monolayer that is oriented principally in the plane of the interface. Direct adsorption to the metal interface from oil results in SFG spectra of oleamide that are comparable to those observed for the 1 mN m(-1) L-B film in air. In contrast, SFG and RAIRS results for the 25 mN m(-1) film in air and SFG spectra of the spin-cast film in air both show strong conformational ordering and orientational alignment normal to the interface. The 25 mN m(-1) film has an ellipsometric thickness almost twice that of the 1 mN m(-1) L-B film. Taken in combination with the spectroscopic results, this is indicative of a well packed monolayer in air in which the hydrocarbon chain is in an essentially defect-free extended conformation with the methyl terminus oriented away from the surface. A similar structure is also deduced for the surface of the spin-cast film in air. Upon immersion of the 25 mN m(-1) L-B film in oil the SFG spectra show that this film rapidly adopts a relatively disordered structure similar to that seen for the 1 mN m(-1) L-B film in air. Immersion of the spin-cast film in oil results in the gradual disordering of the amide film over a period of several days until the observed spectra become essentially identical to those observed for direct adsorption of oleamide from oil.

Interfacial structure of soft matter probed by SFG spectroscopy.

Science.gov (United States)

Ye, Shen; Tong, Yujin; Ge, Aimin; Qiao, Lin; Davies, Paul B

2014-10-01

Sum frequency generation (SFG) vibrational spectroscopy, an interface-specific technique in contrast to, for example, attenuated total reflectance spectroscopy, which is only interface sensitive, has been employed to investigate the surface and interface structure of soft matter on a molecular scale. The experimental arrangement required to carry out SFG spectroscopy, with particular reference to soft matter, and the analytical methods developed to interpret the spectra are described. The elucidation of the interfacial structure of soft matter systems is an essential prerequisite in order to understand and eventually control the surface properties of these important functional materials. Copyright © 2014 The Chemical Society of Japan and Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Coherent Raman Imaging of Live Muscle Sarcomeres Assisted by SFG Microscopy.

Science.gov (United States)

Kim, Hyunmin; Kim, Do-Young; Joo, Kyung-Il; Kim, Jung-Hye; Jeong, Soon Moon; Lee, Eun Seong; Hahm, Jeong-Hoon; Kim, Kyuhyung; Moon, Dae Woon

2017-08-23

In this study, we used spectrally focused coherent anti-Stokes Raman scattering (spCARS) microscopy assisted by sum-frequency generation (SFG) to monitor the variations in the structural morphology and molecular vibrations of a live muscle of Caenorhabditis elegans. The subunits of the muscle sarcomeres, such as the M-line, myosin, dense body, and α-actinin, were alternatively observed using spCARS microscopy for different sample orientations, with the guidance of a myosin positional marker captured by SFG microscopy. Interestingly enough, the beam polarization dependence of the spCARS contrasts for two parallel subunits (dense body and myosin) showed a ~90° phase difference. The chemically sensitive spCARS spectra induced by the time-varying overlap of two pulses allowed (after a robust subtraction of the non-resonant background using a modified Kramers-Krönig transformation method) high-fidelity detection of various genetically modified muscle sarcomeres tuned to the C-H vibration (2800-3100 cm -1 ). Conversely, SFG image mapping assisted by phase-retrieved spCARS spectra also facilitated label-free monitoring of the changes in the muscle content of C. elegans that are associated with aging, based on the hypothesis that the C-H vibrational modes could serve as qualitative chemical markers sensitive to the amount and/or structural modulation of the muscle.

Intrinsic Chirality and Prochirality at Air/R-(+)- and S-(-)-Limonene Interfaces: Spectral Signatures with Interference Chiral Sum-Frequency Generation Vibrational Spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Fu, Li; Zhang, Yun; Wei, Zhehao; Wang, Hongfei

2014-06-04

We report in this work detailed measurements on the chiral and achiral sum-frequency vibrational spectra in the C-H stretching vibration region (2800-3050cm-1) of the air/liquid interfaces of R-limonene and S-limonene, using the recently developed high-resolution broadband sum-frequency generation vibrational spectroscopy (HR-BB-SFG-VS). The achiral SFG spectra of R-limonene and S-limonene, as well as the equal amount (50/50) racemic mixture show that the enantiomers are with the same interfacial orientations. The interference chiral SFG spectra of the limonene enantiomers exhibit spectral signature from chiral response of the Cα-H stretching mode, and spectral signature from prochiral response of the CH2 asymmetric stretching mode, respectively. The chiral spectral feature of the Cα-H stretching mode changes sign from R-limonene to S-limonene, and disappears for the 50/50 racemic mixture. While the prochiral spectral feature of the CH2 asymmetric stretching mode is the same for R-limonene and S-limonene, and also surprisingly remains the same for the 50/50 racemic mixture. These results provided detail information in understanding the structure and chirality of molecular interfaces, and demonstrated the sensitivity and potential of SFG-VS as unique spectroscopic tool for chirality characterization and chiral recognition at the molecular interface.

Sensibility to Changes of Vibrational Modes of Excited Electron: Sum Frequency Signals Versus Difference Frequency Signals

International Nuclear Information System (INIS)

Gu Anna; Liang Xianting

2011-01-01

In this paper, we investigate a two electronic level system with vibrational modes coupled to a Brownian oscillator bath. The difference frequency generation (DFG) signals and sum frequency generation (SFG) signals are calculated. It is shown that, for the same model, the SFG signals are more sensitive than the DFG signals to the changes of the vibrational modes of the electronic two-level system. Because the SFG conversion efficiency can be improved by using the time-delay method, the findings in this paper predict that the SFG spectrum may probe the changes of the microstructure more effectively. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

Spectrally- and Time-Resolved Sum Frequency Generation (STiR-SFG): a new tool for ultrafast hydrogen bond dynamics at interfaces.

Science.gov (United States)

Benderskii, Alexander; Bordenyuk, Andrey; Weeraman, Champika

2006-03-01

The recently developed spectrally- and time-resolved Sum Frequency Generation (STiR-SFG) is a surface-selective 3-wave mixing (IR+visible) spectroscopic technique capable of measuring ultrafast spectral evolution of vibrational coherences. A detailed description of this measurement will be presented, and a noniterative method or deconvolving the laser pulses will be introduced to obtain the molecular response function. STiR-SFG, combined with the frequency-domain SFG spectroscopy, was applied to study hydrogen bonding dynamics at aqueous interfaces (D2O/CaF2). Spectral dynamics of the OD-stretch on the 50-150 fs time scale provides real-time observation of ultrafast H-bond rearrangement. Tuning the IR wavelength to the blue or red side of the OD-stretch transition, we selectively monitor the dynamics of different sub-ensembles in the distribution of the H-bond structures. The blue-side excitation (weaker H-bonding) shows monotonic red-shift of the OD-frequency. In contrast, the red-side excitation (stronger H-bonding structures) produces a blue-shift and a recursion, which may indicate the presence of an underdamped intermolecular mode of interfacial water. Effect of electrolyte concentration on the H-bond dynamics will be discussed.

Physiologically-Relevant Modes of Membrane Interactions by the Human Antimicrobial Peptide, LL-37, Revealed by SFG Experiments

Science.gov (United States)

Ding, Bei; Soblosky, Lauren; Nguyen, Khoi; Geng, Junqing; Yu, Xinglong; Ramamoorthy, Ayyalusamy; Chen, Zhan

2013-05-01

Antimicrobial peptides (AMPs) could become the next generation antibiotic compounds which can overcome bacterial resistance by disrupting cell membranes and it is essential to determine the factors underlying its mechanism of action. Although high-resolution NMR and other biological studies have provided valuable insights, it has been a major challenge to follow the AMP-membrane interactions at physiologically-relevant low peptide concentrations. In this study, we demonstrate a novel approach to overcome this major limitation by performing Sum Frequency Generation (SFG) vibrational spectroscopic experiments on lipid bilayers containing an AMP, LL-37. Our results demonstrate the power of SFG to study non-linear helical peptides and also infer that lipid-peptide interaction and the peptide orientation depend on the lipid membrane composition. The observed SFG signal changes capture the aggregating process of LL-37 on membrane. In addition, our SFG results on cholesterol-containing lipid bilayers indicate the inhibition effect of cholesterol on peptide-induced membrane permeation process.

Sum Frequency Generation Vibrational Spectroscopy of 1,3-Butadiene Hydrogenation on 4 nm Pt@SiO 2 , Pd@SiO 2 , and Rh@SiO 2 Core–Shell Catalysts

KAUST Repository

Krier, James M.

2015-01-14

© 2014 American Chemical Society. 1,3-Butadiene (1,3-BD) hydrogenation was performed on 4 nm Pt, Pd, and Rh nanoparticles (NPs) encapsulated in SiO2 shells at 20, 60, and 100 °C. The core-shells were grown around polyvinylpyrrolidone (PVP) coated NPs (Stöber encapsulation) prepared by colloidal synthesis. Sum frequency generation (SFG) vibrational spectroscopy was performed to correlate surface intermediates observed in situ with reaction selectivity. It is shown that calcination is effective in removing PVP, and the SFG signal can be generated from the metal surface. Using SFG, it is possible to compare the surface vibrational spectrum of Pt@SiO2 (1,3-BD is hydrogenated through multiple paths and produces butane, 1-butene, and cis/trans-2-butene) to Pd@SiO2 (1,3-BD favors one path and produces 1-butene and cis/trans-2-butene). In contrast to Pt@SiO2 and Pd@SiO2, SFG and kinetic experiments of Rh@SiO2 show a permanent accumulation of organic material.

Adding a dimension to the infrared spectra of interfaces using heterodyne detected 2D sum-frequency generation (HD 2D SFG) spectroscopy.

Science.gov (United States)

Xiong, Wei; Laaser, Jennifer E; Mehlenbacher, Randy D; Zanni, Martin T

2011-12-27

In the last ten years, two-dimensional infrared spectroscopy has become an important technique for studying molecular structures and dynamics. We report the implementation of heterodyne detected two-dimensional sum-frequency generation (HD 2D SFG) spectroscopy, which is the analog of 2D infrared (2D IR) spectroscopy, but is selective to noncentrosymmetric systems such as interfaces. We implement the technique using mid-IR pulse shaping, which enables rapid scanning, phase cycling, and automatic phasing. Absorptive spectra are obtained, that have the highest frequency resolution possible, from which we extract the rephasing and nonrephasing signals that are sometimes preferred. Using this technique, we measure the vibrational mode of CO adsorbed on a polycrystalline Pt surface. The 2D spectrum reveals a significant inhomogenous contribution to the spectral line shape, which is quantified by simulations. This observation indicates that the surface conformation and environment of CO molecules is more complicated than the simple "atop" configuration assumed in previous work. Our method can be straightforwardly incorporated into many existing SFG spectrometers. The technique enables one to quantify inhomogeneity, vibrational couplings, spectral diffusion, chemical exchange, and many other properties analogous to 2D IR spectroscopy, but specifically for interfaces.

Deducing 2D crystal structure at the liquid/solid interface with atomic resolution: a combined STM and SFG study.

Science.gov (United States)

McClelland, Arthur A; Ahn, Seokhoon; Matzger, Adam J; Chen, Zhan

2009-11-17

Sum frequency generation vibrational spectroscopy (SFG) has been applied to study two-dimensional (2D) crystals formed by an isophthalic acid diester on the surface of highly oriented pyrolytic graphite, providing complementary measurements to scanning tunneling microscopy (STM) and computational modeling. SFG results indicate that both aromatic and C=O groups in the 2D crystal tilt from the surface. This study demonstrates that a combination of SFG and STM techniques can be used to gain a more complete picture of 2D crystal structure, and it is necessary to consider solvent-2D crystal interactions and dynamics in the computer models to achieve an accurate representation of interfacial structure.

SFG and SPR Study of Sodium Dodecyl Sulfate Film Assembly on Positively Charged Surfaces

Science.gov (United States)

Song, Sanghun; Weidner, Tobias; Wagner, Matthew; Castner, David

2012-02-01

This study uses sum frequency generation (SFG) vibrational spectroscopy and surface plasmon resonance (SPR) sensing to investigate the structure of sodium dodecyl sulfate (SDS) films formed on positively charged and hydrophilic surfaces. The SPR signals show a good surface coverage suggesting that full monolayer coverage is reached at 1 mM. SFG spectra of SDS adsorbed exhibits well resolved CH3 peaks and OH peaks. At both 0.2 mM and 1 mM SDS concentration the intensity of both the CH3 and OH peaks decreased close to background levels. We found that the loss of SFG signal at 0.2 mM occurs at this concentration independent of surface charge density. It is more likely that the loss of signal is related to structural inhomogeneity induced by a striped phase - stand-up phase transition. This is supported by a distinct change of the relative SFG phase between CH3/OH near 0.2 mM. The second intensity minimum might be related to charge compensation effects. We observed a substrate dependence for the high concentration transition. We also observed distinct SFG signal phase changes for water molecules associated with SDS layers at different SDS solution concentrations indicating that the orientation of bound water changed with SDS surface structure.

Structure and orientation of interfacial proteins determined by sum frequency generation vibrational spectroscopy: method and application.

Science.gov (United States)

Ye, Shuji; Wei, Feng; Li, Hongchun; Tian, Kangzhen; Luo, Yi

2013-01-01

In situ and real-time characterization of molecular structures and orientation of proteins at interfaces is essential to understand the nature of interfacial protein interaction. Such work will undoubtedly provide important clues to control biointerface in a desired manner. Sum frequency generation vibrational spectroscopy (SFG-VS) has been demonstrated to be a powerful technique to study the interfacial structures and interactions at the molecular level. This paper first systematically introduced the methods for the calculation of the Raman polarizability tensor, infrared transition dipole moment, and SFG molecular hyperpolarizability tensor elements of proteins/peptides with the secondary structures of α-helix, 310-helix, antiparallel β-sheet, and parallel β-sheet, as well as the methodology to determine the orientation of interfacial protein secondary structures using SFG amide I spectra. After that, recent progresses on the determination of protein structure and orientation at different interfaces by SFG-VS were then reviewed, which provides a molecular-level understanding of the structures and interactions of interfacial proteins, specially understanding the nature of driving force behind such interactions. Although this review has focused on analysis of amide I spectra, it will be expected to offer a basic idea for the spectral analysis of amide III SFG signals and other complicated molecular systems such as RNA and DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

A trough for improved SFG spectroscopy of lipid monolayers

Science.gov (United States)

Franz, Johannes; van Zadel, Marc-Jan; Weidner, Tobias

2017-05-01

Lipid monolayers are indispensable model systems for biological membranes. The main advantage over bilayer model systems is that the surface pressure within the layer can be directly and reliably controlled. The sensitive interplay between surface pressure and temperature determines the molecular order within a model membrane and consequently determines the membrane phase behavior. The lipid phase is of crucial importance for a range of membrane functions such as protein interactions and membrane permeability. A very reliable method to probe the structure of lipid monolayers is sum frequency generation (SFG) vibrational spectroscopy. Not only is SFG extremely surface sensitive but it can also directly access critical parameters such as lipid order and orientation, and it can provide valuable information about protein interactions along with interfacial hydration. However, recent studies have shown that temperature gradients caused by high power laser beams perturb the lipid layers and potentially obscure the spectroscopic results. Here we demonstrate how the local heating problem can be effectively reduced by spatially distributing the laser pulses on the sample surface using a translating Langmuir trough for SFG experiments at lipid monolayers. The efficiency of the trough is illustrated by the detection of enhanced molecular order due to reduced heat load.

Demonstrating the feasibility of monitoring the molecular-level structures of moving polymer/silane interfaces during silane diffusion using SFG.

Science.gov (United States)

Chen, Chunyan; Wang, Jie; Loch, Cheryl L; Ahn, Dongchan; Chen, Zhan

2004-02-04

In this paper, the feasibility of monitoring molecular structures at a moving polymer/liquid interface by sum frequency generation (SFG) vibrational spectroscopy has been demonstrated. N-(2-Aminoethyl)-3-aminopropyltrimethoxysilane (AATM, NH2(CH2)2NH(CH2)3Si(OCH3)3) has been brought into contact with a deuterated poly(methyl methacrylate) (d-PMMA) film, and the interfacial silane structure has been monitored using SFG. Upon initial contact, the SFG spectra can be detected, but as time progresses, the spectral intensity changes and finally disappears. Additional experiments indicate that these silane molecules can diffuse into the polymer film and the detected SFG signals are actually from the moving polymer/silane interface. Our results show that the molecular order of the polymer/silane interface exists during the entire diffusion process and is lost when the silane molecules traverse through the thickness of the d-PMMA film. The loss of the SFG signal is due to the formation of a new disordered substrate/silane interface, which contributes no detectable SFG signal. The kinetics of the diffusion of the silane into the polymer have been deduced from the time-dependent SFG signals detected from the AATM molecules as they diffuse through polymer films of different thickness.

SFG experiment and ab initio study of the chemisorption of CN - on low-index platinum surfaces

Science.gov (United States)

Tadjeddine, M.; Flament, J.-P.; Le Rille, A.; Tadjeddine, A.

2006-05-01

A dual analysis is proposed in order to have a better understanding of the adsorption of the cyanide ions on a platinum electrode. The SFG (Sum Frequency Generation) spectroscopy allows the in situ vibrational study and the SFG spectra of the CN - species adsorbed on single crystal Pt electrode allow a systematic study of the low-index platinum surfaces. This experimental work is supported by ab initio calculations using density functional theory and cluster models. For each surface orientation and each geometry, a cluster model of 20-30 Pt atoms has been built in order to interpret the chemisorption of the CN - ions through four kinds of adsorption geometry: on-top or bridge site, bonding via C or N atoms. Geometries have been optimized and adsorption energies, electronic properties and vibrational frequencies have been computed. From the electronic properties, we can propose an analysis of the bonding mechanism for each studied kind of adsorption. The SFG spectra of the CN -/Pt(1 1 1) system present an unique resonance owing to the top C adsorption. It is mainly the same for the CN -/Pt(1 0 0) system. It is also the case for the SFG spectra of the CN -/Pt(1 1 0) system recorded at negative electrochemical voltage; at more positive voltage, a second resonance appears at a lower frequency, owing to the top N adsorption. Experimental and theoretical values of the C-N stretching frequencies are in excellent agreement.

Sum Frequency Generation Vibrational Spectroscopy of 1,3-Butadiene Hydrogenation on 4 nm Pt@SiO 2 , Pd@SiO 2 , and Rh@SiO 2 Core–Shell Catalysts

KAUST Repository

Krier, James M.; Michalak, William D.; Cai, Xiaojun; Carl, Lindsay; Komvopoulos, Kyriakos; Somorjai, Gabor A.

2015-01-01

NPs (Stöber encapsulation) prepared by colloidal synthesis. Sum frequency generation (SFG) vibrational spectroscopy was performed to correlate surface intermediates observed in situ with reaction selectivity. It is shown that calcination is effective

Hydrogenation of the alpha,beta-Unsaturated Aldehydes Acrolein, Crotonaldehyde, and Prenal over Pt Single Crystals: A Kinetic and Sum-Frequency Generation Vibrational Spectroscopy Study

Energy Technology Data Exchange (ETDEWEB)

Kliewer, C.J.; Somorjai, G.A.

2008-11-26

Sum-frequency generation vibrational spectroscopy (SFG-VS) and kinetic measurements using gas chromatography have been used to study the surface reaction intermediates during the hydrogenation of three {alpha},{beta}-unsaturated aldehydes, acrolein, crotonaldehyde, and prenal, over Pt(111) at Torr pressures (1 Torr aldehyde, 100 Torr hydrogen) in the temperature range of 295K to 415K. SFG-VS data showed that acrolein has mixed adsorption species of {eta}{sub 2}-di-{sigma}(CC)-trans, {eta}{sub 2}-di-{sigma}(CC)-cis as well as highly coordinated {eta}{sub 3} or {eta}{sub 4} species. Crotonaldehyde adsorbed to Pt(111) as {eta}{sub 2} surface intermediates. SFG-VS during prenal hydrogenation also suggested the presence of the {eta}{sub 2} adsorption species, and became more highly coordinated as the temperature was raised to 415K, in agreement with its enhanced C=O hydrogenation. The effect of catalyst surface structure was clarified by carrying out the hydrogenation of crotonaldehyde over both Pt(111) and Pt(100) single crystals while acquiring the SFG-VS spectra in situ. Both the kinetics and SFG-VS showed little structure sensitivity. Pt(100) generated more decarbonylation 'cracking' product while Pt(111) had a higher selectivity for the formation of the desired unsaturated alcohol, crotylalcohol.

NOLM-based all-optical 40 Gbit/s format conversion through sum-frequency generation (SFG) in a PPLN waveguide

Science.gov (United States)

Wang, Jian; Sun, Junqiang

2005-11-01

A novel all-optical format conversion scheme from NRZ to RZ based on sum-frequency generation (SFG) in a periodically poled LiNbO 3 (PPLN) waveguide is proposed, using a nonlinear optical loop mirror (NOLM). The conversion mechanism relies on the combination of attenuation and nonlinear phase shift induced on the clockwise signal field during the SFG process. The SFG between pump, and co- and counter- propagating signals in the PPLN waveguide are numerically studied, showing that counter-propagating SFG can be ignored when quasi-phase matching (QPM) for SFG during co-propagating interaction. The nonlinear phase shift induced on the clockwise signal field is analyzed in detail, showing that it is more effective to yield large values for nonlinear phase shift when appropriately phase mismatched for the SFG process. Two tuning schemes are proposed depend on whether the sum-frequency wavelength is variable or fixed. It is found that the latter has a rather wide 3dB signal conversion bandwidth approximately 154nm. Finally, the influence of reversible process of SFG is discussed and the optimum arrangement of pump and signal peak powers is theoretically demonstrated. The result shows that proper power arrangement, pump width, and waveguide length are necessary for achieving a good conversion effect.

Sum-Frequency Generation from Chiral Media and Interfaces

Energy Technology Data Exchange (ETDEWEB)

Ji, Na [Univ. of California, Berkeley, CA (United States)

2006-02-13

Sum frequency generation (SFG), a second-order nonlinear optical process, is electric-dipole forbidden in systems with inversion symmetry. As a result, it has been used to study chiral media and interfaces, systems intrinsically lacking inversion symmetry. This thesis describes recent progresses in the applications of and new insights into SFG from chiral media and interfaces. SFG from solutions of chiral amino acids is investigated, and a theoretical model explaining the origin and the strength of the chiral signal in electronic-resonance SFG spectroscopy is discussed. An interference scheme that allows us to distinguish enantiomers by measuring both the magnitude and the phase of the chiral SFG response is described, as well as a chiral SFG microscope producing chirality-sensitive images with sub-micron resolution. Exploiting atomic and molecular parity nonconservation, the SFG process is also used to solve the Ozma problems. Sum frequency vibrational spectroscopy is used to obtain the adsorption behavior of leucine molecules at air-water interfaces. With poly(tetrafluoroethylene) as a model system, we extend the application of this surface-sensitive vibrational spectroscopy to fluorine-containing polymers.

Sum-Frequency Generation from Chiral Media and Interfaces

International Nuclear Information System (INIS)

Ji, Na

2006-01-01

Sum frequency generation (SFG), a second-order nonlinear optical process, is electric-dipole forbidden in systems with inversion symmetry. As a result, it has been used to study chiral media and interfaces, systems intrinsically lacking inversion symmetry. This thesis describes recent progresses in the applications of and new insights into SFG from chiral media and interfaces. SFG from solutions of chiral amino acids is investigated, and a theoretical model explaining the origin and the strength of the chiral signal in electronic-resonance SFG spectroscopy is discussed. An interference scheme that allows us to distinguish enantiomers by measuring both the magnitude and the phase of the chiral SFG response is described, as well as a chiral SFG microscope producing chirality-sensitive images with sub-micron resolution. Exploiting atomic and molecular parity nonconservation, the SFG process is also used to solve the Ozma problems. Sum frequency vibrational spectroscopy is used to obtain the adsorption behavior of leucine molecules at air-water interfaces. With poly(tetrafluoroethylene) as a model system, we extend the application of this surface-sensitive vibrational spectroscopy to fluorine-containing polymers

Two-dimensional sum-frequency generation (2D SFG) reveals structure and dynamics of a surface-bound peptide

Science.gov (United States)

Laaser, Jennifer E.; Skoff, David R.; Ho, Jia-Jung; Joo, Yongho; Serrano, Arnaldo L.; Steinkruger, Jay D.; Gopalan, Padma; Gellman, Samuel H.; Zanni, Martin T.

2014-01-01

Surface-bound polypeptides and proteins are increasingly used to functionalize inorganic interfaces such as electrodes, but their structural characterization is exceedingly difficult with standard technologies. In this paper, we report the first two-dimensional sum-frequency generation (2D SFG) spectra of a peptide monolayer, which is collected by adding a mid-IR pulse shaper to a standard femtosecond SFG spectrometer. On a gold surface, standard FTIR spectroscopy is inconclusive about the peptide structure because of solvation-induced frequency shifts, but the 2D lineshapes, anharmonic shifts, and lifetimes obtained from 2D SFG reveal that the peptide is largely α-helical and upright. Random coil residues are also observed, which do not themselves appear in SFG spectra due to their isotropic structural distribution, but which still absorb infrared light and so can be detected by cross-peaks in 2D SFG spectra. We discuss these results in the context of peptide design. Because of the similar way in which the spectra are collected, these 2D SFG spectra can be directly compared to 2D IR spectra, thereby enabling structural interpretations of surface-bound peptides and biomolecules based on the well-studied structure/2D IR spectra relationships established from soluble proteins. PMID:24372101

Intrinsic chirality and prochirality at Air/R-(+)- and S-(-)-limonene interfaces: spectral signatures with interference chiral sum-frequency generation vibrational spectroscopy.

Science.gov (United States)

Fu, Li; Zhang, Yun; Wei, Zhe-Hao; Wang, Hong-Fei

2014-09-01

We report in this work detailed measurements of the chiral and achiral sum-frequency vibrational spectra in the C-H stretching vibration region (2800-3050 cm(-1)) of the air/liquid interfaces of R-(+)-limonene and S-(-)-limonene, using the recently developed high-resolution broadband sum-frequency generation vibrational spectroscopy (HR-BB-SFG-VS). The achiral SFG spectra of R-limonene and S-limonene, as well as the RS racemic mixture (50/50 equal amount mixture), show that the corresponding molecular groups of the R and S enantiomers are with the same interfacial orientations. The interference chiral SFG spectra of the limonene enantiomers exhibit a spectral signature from the chiral response of the Cα-H stretching mode, and a spectral signature from the prochiral response of the CH(2) asymmetric stretching mode, respectively. The chiral spectral feature of the Cα-H stretching mode changes sign from R-(+)-limonene to S-(-)-limonene surfaces, and disappears for the RS racemic mixture surface. While the prochiral spectral feature of the CH(2) asymmetric stretching mode is the same for R-(+)-limonene and S-(-)-limonene surfaces, and also surprisingly remains the same for the RS racemic mixture surface. Therefore, the structures of the R-(+)-limonene and the S-(-)-limonene at the liquid interfaces are nevertheless not mirror images to each other, even though the corresponding groups have the same tilt angle from the interfacial normal, i.e., the R-(+)-limonene and the S-(-)-limonene at the surface are diastereomeric instead of enantiomeric. These results provide detailed information in understanding the structure and chirality of molecular interfaces and demonstrate the sensitivity and potential of SFG-VS as a unique spectroscopic tool for chirality characterization and chiral recognition at the molecular interface. © 2014 Wiley Periodicals, Inc.

Site-specific Orientation of an α-helical Peptide Ovispirin-1 from Isotope Labeled SFG Spectroscopy

Science.gov (United States)

Ding, Bei; Laaser, Jennifer E.; Liu, Yuwei; Wang, Pengrui; Zanni, Martin T.; Chen, Zhan

2013-01-01

Sum-frequency generation (SFG) vibrational spectroscopy is often used to probe the backbone structures and orientations of polypeptides at surfaces. Using the ovispirin-1 polypeptide at the solid/liquid interface of polystyrene, we demonstrate for the first time that SFG can probe the polarization response of a single isotope labeled residue. To interpret the spectral intensities, we simulated the spectra using an excitonic Hamiltonian approach. We show that the polarization dependence of either the label or the unlabeled amide I band alone does not provide sufficient structural constraints to obtain both the tilt and the twist of the ovispirin helix at a solid/liquid interface, but that both can be determined from the polarization dependence of the complete spectrum. For ovispirin, the detailed analysis of the polarized SFG experimental data shows that the helix axis is tilted at roughly 138 degrees from the surface normal, and the transition dipole of the isotope labeled C=O group is tilted at 23 degrees from the surface normal, with the hydrophobic region facing the polystyrene surface. We further demonstrated that the Hamiltonian approach is able to address the coupling effect and the structural disorder. For comparison, we also collected the FTIR spectrum of ovispirin under similar conditions, which reveals the enhanced sensitivity of SFG for structural studies of single monolayer peptide surfaces. Our study provides insight into how structural and environmental effects appear in SFG spectra of the amide I band and establishes that SFG of isotope labeled peptides will be a powerful technique for elucidating secondary structures with residue-by-residue resolution. PMID:24228619

Site-specific orientation of an α-helical peptide ovispirin-1 from isotope-labeled SFG spectroscopy.

Science.gov (United States)

Ding, Bei; Laaser, Jennifer E; Liu, Yuwei; Wang, Pengrui; Zanni, Martin T; Chen, Zhan

2013-11-27

Sum-frequency generation (SFG) vibrational spectroscopy is often used to probe the backbone structures and orientations of polypeptides at surfaces. Using the ovispirin-1 polypeptide at the solid/liquid interface of polystyrene, we demonstrate for the first time that SFG can probe the polarization response of a single-isotope-labeled residue. To interpret the spectral intensities, we simulated the spectra using an excitonic Hamiltonian approach. We show that the polarization dependence of either the label or the unlabeled amide I band alone does not provide sufficient structural constraints to obtain both the tilt and the twist of the ovispirin helix at a solid/liquid interface, but that both can be determined from the polarization dependence of the complete spectrum. For ovispirin, the detailed analysis of the polarized SFG experimental data shows that the helix axis is tilted at roughly 138° from the surface normal, and the transition dipole of the isotope-labeled C═O group is tilted at 23° from the surface normal, with the hydrophobic region facing the polystyrene surface. We further demonstrate that the Hamiltonian approach is able to address the coupling effect and the structural disorder. For comparison, we also collected the FTIR spectrum of ovispirin under similar conditions, which reveals the enhanced sensitivity of SFG for structural studies of single monolayer peptide surfaces. Our study provides insight into how structural and environmental effects appear in SFG spectra of the amide I band and establishes that SFG of isotope-labeled peptides will be a powerful technique for elucidating secondary structures with residue-by-residue resolution.

Sum Frequency Generation Vibrational Spectroscopy Studies on ModelPeptide Adsorption at the Hydrophobic Solid-Water and HydrophilicSolid-Water Interfaces

Energy Technology Data Exchange (ETDEWEB)

York, Roger L. [Univ. of California, Berkeley, CA (United States)

2007-01-01

Sum frequency generation (SFG) vibrational spectroscopy has been used to study the interfacial structure of several polypeptides and amino acids adsorbed to hydrophobic and hydrophilic surfaces under a variety of experimental conditions. Peptide sequence, peptide chain length, peptide hydrophobicity, peptide side-chain type, surface hydrophobicity, and solution ionic strength all affect an adsorbed peptide's interfacial structure. Herein, it is demonstrated that with the choice of simple, model peptides and amino acids, surface specific SFG vibrational spectroscopy can be a powerful tool to elucidate the interfacial structure of these adsorbates. Herein, four experiments are described. In one, a series of isosequential amphiphilic peptides are synthesized and studied when adsorbed to both hydrophobic and hydrophilic surfaces. On hydrophobic surfaces of deuterated polystyrene, it was determined that the hydrophobic part of the peptide is ordered at the solid-liquid interface, while the hydrophilic part of the peptide appears to have a random orientation at this interface. On a hydrophilic surface of silica, it was determined that an ordered peptide was only observed if a peptide had stable secondary structure in solution. In another experiment, the interfacial structure of a model amphiphilic peptide was studied as a function of the ionic strength of the solution, a parameter that could change the peptide's secondary structure in solution. It was determined that on a hydrophobic surface, the peptide's interfacial structure was independent of its structure in solution. This was in contrast to the adsorbed structure on a hydrophilic surface, where the peptide's interfacial structure showed a strong dependence on its solution secondary structure. In a third experiment, the SFG spectra of lysine and proline amino acids on both hydrophobic and hydrophilic surfaces were obtained by using a different experimental geometry that increases the SFG signal

Two-dimensional sum-frequency generation (2D SFG) spectroscopy: summary of principles and its application to amyloid fiber monolayers.

Science.gov (United States)

Ghosh, Ayanjeet; Ho, Jia-Jung; Serrano, Arnaldo L; Skoff, David R; Zhang, Tianqi; Zanni, Martin T

2015-01-01

By adding a mid-infrared pulse shaper to a sum-frequency generation (SFG) spectrometer, we have built a 2D SFG spectrometer capable of measuring spectra analogous to 2D IR spectra but with monolayer sensitivity and SFG selection rules. In this paper, we describe the experimental apparatus and provide an introduction to 2D SFG spectroscopy to help the reader interpret 2D SFG spectra. The main aim of this manuscript is to report 2D SFG spectra of the amyloid forming peptide FGAIL. FGAIL is a critical segment of the human islet amyloid polypeptide (hIAPP or amylin) that aggregates in people with type 2 diabetes. FGAIL is catalyzed into amyloid fibers by many types of surfaces. Here, we study the structure of FGAIL upon deposition onto a gold surface covered with a self-assembled monolayer of methyl-4-mercaptobenzoate (MMB) that produces an ester coating. FGAIL deposited on bare gold does not form ordered layers. The measured 2D SFG spectrum is consistent with amyloid fiber formation, exhibiting both the parallel (a+) and perpendicular (a-) symmetry modes associated with amyloid β-sheets. Cross peaks are observed between the ester stretches of the coating and the FGAIL peptides. Simulations are presented for two possible structures of FGAIL amyloid β-sheets that illustrate the sensitivity of the 2D SFG spectra to structure and orientation. These results provide some of the first molecular insights into surface catalyzed amyloid fiber structure.

Orientations of nonlocal vibrational modes from combined experimental and theoretical sum frequency spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Chase, Hilary M.; Chen, Shunli; Fu, Li; Upshur, Mary Alice; Rudshteyn, Benjamin; Thomson, Regan J.; Wang, Hong-Fei; Batista, Victor S.; Geiger, Franz M.

2017-09-01

Inferring molecular orientations from vibrational sum frequency generation (SFG) spectra is challenging in polarization combinations that result in low signal intensities, or when the local point group symmetry approximation fails. While combining experiments with density functional theory (DFT) could overcome this problem, the scope of the combined method has yet to be established. Here, we assess its feasibility of determining the distributions of molecular orientations for one monobasic ester, two epoxides and three alcohols at the vapor/fused silica interface. We find that molecular orientations of nonlocal vibrational modes cannot be determined using polarization-resolved SFG measurements alone.

Catalyzed hydrogenation of nitrogen and ethylene on metal (Fe, Pt) single crystal surfaces and effects of coadsorption: A sum frequency generation vibrational spectroscopy study

Energy Technology Data Exchange (ETDEWEB)

Westerberg, Staffan Per Gustav [Univ. of California, Berkeley, CA (United States)

2004-01-01

High-pressure catalytic reactions and associated processes, such as adsorption have been studied on a molecular level on single crystal surfaces. Sum Frequency Generation (SFG) vibrational spectroscopy together with Auger Electron Spectroscopy (AES), Temperature Programmed Desorption (TPD) and Gas Chromatography (GC) were used to investigate the nature of species on catalytic surfaces and to measure the catalytic reaction rates. Special attention has been directed at studying high-pressure reactions and in particular, ammonia synthesis in order to identify reaction intermediates and the influence of adsorbates on the surface during reaction conditions. The adsorption of gases N₂, H₂, O₂ and NH₃ that play a role in ammonia synthesis have been studied on the Fe(111) crystal surface by sum frequency generation vibrational spectroscopy using an integrated Ultra-High Vacuum (UHV)/high-pressure system. SFG spectra are presented for the dissociation intermediates, NH₂ (~3325 cm^-1) and NH (~3235 cm^-1) under high pressure of ammonia (200 Torr) on the clean Fe(111) surface. Addition of 0.5 Torr of oxygen to 200 Torr of ammonia does not significantly change the bonding of dissociation intermediates to the surface. However, it leads to a phase change of nearly 180° between the resonant and non-resonant second order non-linear susceptibility of the surface, demonstrated by the reversal of the SFG spectral features. Heating the surface in the presence of 200 Torr ammonia and 0.5 Torr oxygen reduces the oxygen coverage, which can be seen from the SFG spectra as another relative phase change of 180°. The reduction of the oxide is also supported by Auger electron spectroscopy. The result suggests that the phase change of the spectral features could serve as a sensitive indicator of the chemical environment of the adsorbates.

Orientational analysis of dodecanethiol and p-nitrothiophenol SAMs on metals with polarisation-dependent SFG spectroscopy.

Science.gov (United States)

Cecchet, Francesca; Lis, Dan; Guthmuller, Julien; Champagne, Benoît; Caudano, Yves; Silien, Christophe; Mani, Alaa Addin; Thiry, Paul A; Peremans, André

2010-02-22

Polarisation-dependent sum frequency generation (SFG) spectroscopy is used to investigate the orientation of molecules on metallic surfaces. In particular, self-assembled monolayers (SAMs) of dodecanethiol (DDT) and of p-nitrothiophenol (p-NTP), grown on Pt and on Au, have been chosen as models to highlight the ability of combining ppp and ssp polarisations sets (representing the polarisation of the involved beams in the conventional order of SFG, Vis and IR beam) to infer orientational information at metallic interfaces. Indeed, using only the ppp set of data, as it is usually done for metallic surfaces, is not sufficient to determine the full molecular orientation. We show here that simply combining ppp and ssp polarisations enables both the tilt and rotation angles of methyl groups in DDT SAMs to be determined. Moreover, for p-NTP, while the SFG active vibrations detected with the ppp polarisation alone provide no orientational information, however, the combination with ssp spectra enables to retrieve the tilt angle of the p-NTP 1,4 axis. Though orientational information obtained by polarisation-dependent measurements has been extensively used at insulating interfaces, we report here their first application to metallic surfaces.

Orientational Analysis of Dodecanethiol and P-Nitrothiophenol SAMs on Metals with Polarisation - dependent SFG spectroscopy

International Nuclear Information System (INIS)

Manea, A.

2011-01-01

Polarisation-dependent sum frequency generation (SFG) spectroscopy is used to investigate the orientation of molecules on metallic surfaces. In particular, self-assembled monolayers (SAMs) of dodecanethiol (DDT) and of p-nitro thiophenol (p-NTP), grown on Pt and on Au, have been chosen as models to highlight the ability of combining ppp and ssp polarizations sets (representing the polarisation of the involved beams in the conventional order of SFG, Vis and IR beam) to infer orientational information at metallic interfaces. Indeed, using only the ppp set of data, as it is usually done for metallic surfaces, is not sufficient to determine the full molecular orientation. We show here that simply combining ppp and ssp polarizations enables both the tilt and rotation angles of methyl groups in DDT SAMs to be determined. Moreover, for p-NTP, while the SFG active vibrations detected with the ppp polarisation alone provide no orientational information, however, the combination with ssp spectra enables to retrieve the tilt angle of the p-NTP 1,4 axis. Though orientational information obtained by polarisation-dependent measurements has been extensively used at insulating interfaces, we report here their first application to metallic surfaces. (author)

SFG characterization of a cationic ONLO dye in biological thin films

Science.gov (United States)

Johnson, Lewis E.; Casford, Michael T.; Elder, Delwin L.; Davies, Paul B.; Johal, Malkiat S.

2013-10-01

Biopolymer-based thin films, such as those composed of CTMA-DNA, can be used as a host material for NLOactive dyes for applications such as electro-optic (EO) switching and second harmonic generation. Previous work by Heckman et al. (Proc. SPIE 6401, 640108-2) has demonstrated functioning DNA-based EO modulators. Improved performance requires optimization of both the first hyperpolarizabilities (β) and degree of acentric ordering exhibited by the chromophores. The cationic dye DANPY-1 (Proc. SPIE 8464, 846409-D) has a high affinity for DNA and a substantial hyperpolarizability; however, its macroscopic ordering has not been previously characterized. We have characterized the acentric ordering of the dye using sum-frequency generation (SFG) vibrational spectroscopy in surface-immobilized DNA and on planar metal and dielectric surfaces.

Elucidation of Compression-Induced Surface Crystallization in Amorphous Tablets Using Sum Frequency Generation (SFG) Microscopy.

Science.gov (United States)

Mah, Pei T; Novakovic, Dunja; Saarinen, Jukka; Van Landeghem, Stijn; Peltonen, Leena; Laaksonen, Timo; Isomäki, Antti; Strachan, Clare J

2017-05-01

To investigate the effect of compression on the crystallization behavior in amorphous tablets using sum frequency generation (SFG) microscopy imaging and more established analytical methods. Tablets containing neat amorphous griseofulvin with/without excipients (silica, hydroxypropyl methylcellulose acetate succinate (HPMCAS), microcrystalline cellulose (MCC) and polyethylene glycol (PEG)) were prepared. They were analyzed upon preparation and storage using attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectroscopy, scanning electron microscopy (SEM) and SFG microscopy. Compression-induced crystallization occurred predominantly on the surface of the neat amorphous griseofulvin tablets, with minimal crystallinity being detected in the core of the tablets. The presence of various types of excipients was not able to mitigate the compression-induced surface crystallization of the amorphous griseofulvin tablets. However, the excipients affected the crystallization rate of amorphous griseofulvin in the core of the tablet upon compression and storage. SFG microscopy can be used in combination with ATR-FTIR spectroscopy and SEM to understand the crystallization behaviour of amorphous tablets upon compression and storage. When selecting excipients for amorphous formulations, it is important to consider the effect of the excipients on the physical stability of the amorphous formulations.

Effect of surface structure on catalytic reactions: A sum frequency generation surface vibrational spectroscopy study

International Nuclear Information System (INIS)

McCrea, Keith R.

2001-01-01

In the results discussed above, it is clear that Sum Frequency Generation (SFG) is a unique tool that allows the detection of vibrational spectra of adsorbed molecules present on single crystal surfaces under catalytic reaction conditions. Not only is it possible to detect active surface intermediates, it is also possible to detect spectator species which are not responsible for the measured turnover rates. By correlating high-pressure SFG spectra under reaction conditions and gas chromatography (GC) kinetic data, it is possible to determine which species are important under reaction intermediates. Because of the flexibility of this technique for studying surface intermediates, it is possible to determine how the structures of single crystal surfaces affect the observed rates of catalytic reactions. As an example of a structure insensitive reaction, ethylene hydrogenation was explored on both Pt(111) and Pt(100). The rates were determined to be essentially the same. It was observed that both ethylidyne and di-(sigma) bonded ethylene were present on the surface under reaction conditions on both crystals, although in different concentrations. This result shows that these two species are not responsible for the measured turnover rate, as it would be expected that one of the two crystals would be more active than the other, since the concentration of the surface intermediate would be different on the two crystals. The most likely active intermediates are weakly adsorbed molecules such as(pi)-bonded ethylene and ethyl. These species are not easily detected because their concentration lies at the detection limit of SFG. The SFG spectra and GC data essentially show that ethylene hydrogenation is structure insensitive for Pt(111) and Pt(100). SFG has proven to be a unique and excellent technique for studying adsorbed species on single crystal surfaces under high-pressure catalytic reactions. Coupled with kinetic data obtained from gas chromatography measurements, it can

Adsorption of 1- and 2-butylimidazoles at the copper/air and steel/air interfaces studied by sum frequency generation vibrational spectroscopy.

Science.gov (United States)

Casford, Michael T L; Davies, Paul B

2012-07-24

The structure of thin films of 1- and 2-butylimidazoles adsorbed on copper and steel surfaces under air was examined using sum frequency generation (SFG) vibrational spectroscopy in the ppp and ssp polarizations. Additionally, the SFG spectra of both isomers were recorded at 55 °C at the liquid imidazole/air interface for reference. Complementary bulk infrared, reflection-absorption infrared spectroscopy (RAIRS), and Raman spectra of both imidazoles were recorded for assignment purposes. The SFG spectra in the C-H stretching region at the liquid/air interface are dominated by resonances from the methyl end group of the butyl side chain of the imidazoles, indicating that they are aligned parallel or closely parallel to the surface normal. These are also the most prominent features in the SFG spectra on copper and steel. In addition, both the ppp and ssp spectra on copper show resonances from the C-H stretching modes of the imidazole ring for both isomers. The ring C-H resonances are completely absent from the spectra on steel and at the liquid/air interface. The relative intensities of the SFG spectra can be interpreted as showing that, on copper, under air, both butylimidazoles are adsorbed with their butyl side chains perpendicular to the interface and with the ring significantly inclined away from the surface plane and toward the surface normal. The SFG spectra of both imidazoles on steel indicate an orientation where the imidazole rings are parallel or nearly parallel to the surface. The weak C-H resonances from the ring at the liquid/air interface suggest that the tilt angle of the ring from the surface normal at this interface is significantly greater than it is on copper.

Studies of Heterogeneously Catalyzed Liquid-Phase Alcohol Oxidation on Platinum bySum-frequency Generation Vibrational Spectroscopy and Reaction Rate Measurements

Energy Technology Data Exchange (ETDEWEB)

Thompson, Christopher [Univ. of California, Berkeley, CA (United States)

2014-05-15

Compared to many branches of chemistry, the molecular level study of catalytically active surfaces is young. Only with the invention of ultrahigh vacuum technology in the past half century has it been possible to carry out experiments that yield useful molecular information about the reactive occurrences at a surface. The reason is two-fold: low pressure is necessary to keep a surface clean for an amount of time long enough to perform an experiment, and most atomic scale techniques that are surface speci c (x-ray photoelectron spectroscopy, electron energy loss spectroscopy, Auger electron spectroscopy, etc.) cannot be used at ambient pressures, because electrons, which act as chemical probes in these techniques, are easily scattered by molecules. Sum-frequency generation (SFG) vibrational spectroscopy is one technique that can provide molecular level information from the surface without the necessity for high vacuum. Since the advent of SFG as a surface spectroscopic tool it has proved its worth in the studies of surface catalyzed reactions in the gas phase, with numerous reactions in the gas phase having been investigated on a multitude of surfaces. However, in situ SFG characterization of catalysis at the solid-liquid interface has yet to be thoroughly pursued despite the broad interest in the use of heterogeneous catalysts in the liquid phase as replacements for homogeneous counterparts. This work describes an attempt to move in that direction, applying SFG to study the solid-liquid interface under conditions of catalytic alcohol oxidation on platinum.

Amide or Amine: Determining the Origin of the 3300 cm−1 NH Mode in Protein SFG Spectra Using 15N Isotope Labels

Science.gov (United States)

Weidner, Tobias; Breen, Nicholas F.; Drobny, Gary P.; Castner, David G.

2009-01-01

Sum frequency generation (SFG) vibrational spectroscopy has been employed in biomaterials research and protein adsorption studies with growing success in recent years. A number of studies focusing on understanding SFG spectra of proteins and peptides at different interfaces have laid the foundation for future, more complex studies. In many cases a strong NH mode near 3300 cm−1 is observed in the SFG spectra, but the relationship of this mode to the peptide structure is uncertain since it has been assigned to either a backbone amide mode or a side chain related amine resonance. A thorough understanding of the SFG spectra of these first model systems is an important first step for future experiments. To clarify the origin of the NH SFG mode we studied 15N isotopically labeled 14-amino acid amphiphilic model peptides composed of lysine (K) and leucine (L) in an α-helical secondary structure (LKα14) that were adsorbed onto charged surfaces in situ at the solid-liquid interface. 15N substitution at the terminal amine group of the lysine side chains resulted in a red-shift of the NH mode of 9 cm−1 on SiO2 and 13 cm−1 on CaF2. This clearly shows the 3300 cm−1 NH feature is associated with side chain NH stretches and not with backbone amide modes. PMID:19873996

Amide or amine: determining the origin of the 3300 cm(-1) NH mode in protein SFG spectra using 15N isotope labels.

Science.gov (United States)

Weidner, Tobias; Breen, Nicholas F; Drobny, Gary P; Castner, David G

2009-11-26

Sum frequency generation (SFG) vibrational spectroscopy has been employed in biomaterials research and protein adsorption studies with growing success in recent years. A number of studies focusing on understanding SFG spectra of proteins and peptides at different interfaces have laid the foundation for future, more complex studies. In many cases, a strong NH mode near 3300 cm(-1) is observed in the SFG spectra, but the relationship of this mode to the peptide structure is uncertain, since it has been assigned to either a backbone amide mode or a side chain related amine resonance. A thorough understanding of the SFG spectra of these first model systems is an important first step for future experiments. To clarify the origin of the NH SFG mode, we studied (15)N isotopically labeled 14-amino acid amphiphilic model peptides composed of lysine (K) and leucine (L) in an alpha-helical secondary structure (LKalpha14) that were adsorbed onto charged surfaces in situ at the solid-liquid interface. (15)N substitution at the terminal amine group of the lysine side chains resulted in a red-shift of the NH mode of 9 cm(-1) on SiO(2) and 13 cm(-1) on CaF(2). This clearly shows the 3300 cm(-1) NH feature is associated with side chain NH stretches and not with backbone amide modes.

In Situ Adsorption Studies at the Solid/Liquid Interface: Characterization of Biological Surfaces and Interfaces Using Sum Frequency Generation Vibrational Spectroscopy, Atomic Force Microscopy, and Quartz Crystal Microbalance

International Nuclear Information System (INIS)

Phillips, D.C.

2006-01-01

Sum frequency generation (SFG) vibrational spectroscopy, atomic force microscopy (AFM), and quartz crystal microbalance (QCM) have been used to study the molecular surface structure, surface topography and mechanical properties, and quantitative adsorbed amount of biological molecules at the solid-liquid interface. The molecular-level behavior of designed peptides adsorbed on hydrophobic polystyrene and hydrophilic silica substrates has been examined as a model of protein adsorption on polymeric biomaterial surfaces. Proteins are such large and complex molecules that it is difficult to identify the features in their structure that lead to adsorption and interaction with solid surfaces. Designed peptides which possess secondary structure provide simple model systems for understanding protein adsorption. Depending on the amino acid sequence of a peptide, different secondary structures (α-helix and β-sheet) can be induced at apolar (air/liquid or air/solid) interfaces. Having a well-defined secondary structure allows experiments to be carried out under controlled conditions, where it is possible to investigate the affects of peptide amino acid sequence and chain length, concentration, buffering effects, etc. on adsorbed peptide structure. The experiments presented in this dissertation demonstrate that SFG vibrational spectroscopy can be used to directly probe the interaction of adsorbing biomolecules with a surface or interface. The use of well designed model systems aided in isolation of the SFG signal of the adsorbing species, and showed that surface functional groups of the substrate are sensitive to surface adsorbates. The complementary techniques of AFM and QCM allowed for deconvolution of the effects of surface topography and coverage from the observed SFG spectra. Initial studies of biologically relevant surfaces are also presented: SFG spectroscopy was used to study the surface composition of common soil bacteria for use in bioremediation of nuclear waste

In Situ Adsorption Studies at the Solid/Liquid Interface:Characterization of Biological Surfaces and Interfaces Using SumFrequency Generation Vibrational Spectroscopy, Atomic Force Microscopy,and Quartz Crystal Microbalance

Energy Technology Data Exchange (ETDEWEB)

Phillips, Diana Christine [Univ. of California, Berkeley, CA (United States)

2006-01-01

Sum frequency generation (SFG) vibrational spectroscopy, atomic force microscopy (AFM), and quartz crystal microbalance (QCM) have been used to study the molecular surface structure, surface topography and mechanical properties, and quantitative adsorbed amount of biological molecules at the solid-liquid interface. The molecular-level behavior of designed peptides adsorbed on hydrophobic polystyrene and hydrophilic silica substrates has been examined as a model of protein adsorption on polymeric biomaterial surfaces. Proteins are such large and complex molecules that it is difficult to identify the features in their structure that lead to adsorption and interaction with solid surfaces. Designed peptides which possess secondary structure provide simple model systems for understanding protein adsorption. Depending on the amino acid sequence of a peptide, different secondary structures (α-helix and β-sheet) can be induced at apolar (air/liquid or air/solid) interfaces. Having a well-defined secondary structure allows experiments to be carried out under controlled conditions, where it is possible to investigate the affects of peptide amino acid sequence and chain length, concentration, buffering effects, etc. on adsorbed peptide structure. The experiments presented in this dissertation demonstrate that SFG vibrational spectroscopy can be used to directly probe the interaction of adsorbing biomolecules with a surface or interface. The use of well designed model systems aided in isolation of the SFG signal of the adsorbing species, and showed that surface functional groups of the substrate are sensitive to surface adsorbates. The complementary techniques of AFM and QCM allowed for deconvolution of the effects of surface topography and coverage from the observed SFG spectra. Initial studies of biologically relevant surfaces are also presented: SFG spectroscopy was used to study the surface composition of common soil bacteria for use in bioremediation of nuclear waste.

Sum Frequency Generation Studies of Hydrogenation Reactions on Platinum Nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Krier, James M. [Univ. of California, Berkeley, CA (United States)

2013-08-31

Sum Frequency Generation (SFG) vibrational spectroscopy is used to characterize intermediate species of hydrogenation reactions on the surface of platinum nanoparticle catalysts. In contrast to other spectroscopy techniques which operate in ultra-high vacuum or probe surface species after reaction, SFG collects information under normal conditions as the reaction is taking place. Several systems have been studied previously using SFG on single crystals, notably alkene hydrogenation on Pt(111). In this thesis, many aspects of SFG experiments on colloidal nanoparticles are explored for the first time. To address spectral interference by the capping agent (PVP), three procedures are proposed: UV cleaning, H2 induced disordering and calcination (core-shell nanoparticles). UV cleaning and calcination physically destroy organic capping while disordering reduces SFG signal through a reversible structural change by PVP.

Toward a simple molecular understanding of sum frequency generation at air-water interfaces

Energy Technology Data Exchange (ETDEWEB)

Noah-Vanhoucke, Joyce; Smith, Jared D.; Geissler, Phillip L.

2009-01-13

Second-order vibrational spectroscopies successfully isolate signals from interfaces, but they report on intermolecular structure in a complicated and indirect way. Here we adapt a perspective on vibrational response developed for bulk spectroscopies to explore the microscopic fluctuations to which sum frequency generation (SFG), a popular surface-specific measurement, is most sensitive. We focus exclusively on inhomogeneous broadening of spectral susceptibilities for OH stretching of HOD as a dilute solute in D{sub 2}O. Exploiting a simple connection between vibrational frequency shifts and an electric field variable, we identify several functions of molecular orientation whose averages govern SFG. The frequency-dependence of these quantities is well captured by a pair of averages, involving alignment of OH and OD bonds with the surface normal at corresponding values of the electric field. The approximate form we obtain for SFG susceptibility highlights a dramatic sensitivity to the way a simulated liquid slab is partitioned for calculating second-order response.

Competition between SFG and two SHGs in broadband type-I QPM

Science.gov (United States)

Dang, Weirui; Chen, Yuping; Gong, Mingjun; Chen, Xianfeng

2013-03-01

In this paper, we have studied the characteristics of second-order nonlinear interactions with band-overlapped type-I quasi-phase-matching (QPM) second harmonic generation (SHG) and sum-frequency generation (SFG), and predicted a blue-shift with a band-narrowing of their bands and a sunken response in the SFG curve, which are due to the phase-matching-dependent competition between band-overlapped SHG and SFG processes. This prediction is then verified by the experiment in an 18-mm-long bulk MgO-doped periodically poled lithium niobate crystal (MgO:PPLN) and may provide the candidate solution to output controlling for flexible broadcast wavelength conversion, channel-selective wavelength conversion and all-optical logic gates by cascaded QPM second-order nonlinear processes.

Cooperative Effects of Zwitterionic-Ionic Surfactant Mixtures on the Interfacial Water Structure Revealed by Sum Frequency Generation Vibrational Spectroscopy.

Science.gov (United States)

Pan, Xuecong; Yang, Fangyuan; Chen, Shunli; Zhu, Xuefeng; Wang, Chuanyi

2018-05-08

Cooperative effects of a series of equimolar binary zwitterionic-ionic surfactant mixtures on the interfacial water structure at the air-water interfaces have been studied by sum frequency generation vibrational spectroscopy (SFG-VS). For zwitterionic surfactant palmityl sulfobetaine (SNC 16 ), anionic surfactant sodium hexadecyl sulfate (SHS), and cationic surfactant cetyltrimethylammonium bromide (CTAB) with the same length of alkyl chain, significantly enhanced ordering of interfacial water molecules was observed for the zwitterionic-anionic surfactant mixtures SNC 16 -SHS, indicating that SNC 16 interacts more strongly with SHS than with CTAB because of the strong headgroup-headgroup electrostatic attraction for SNC 16 -SHS. Meanwhile, the SFG amplitude ratio of methyl and methylene symmetric stretching modes was used to verify the stronger interaction between SNC 16 and SHS. The conformational order indicator increased from 0.64 for SNC 16 to 7.17 for SNC 16 -SHS but only 0.94 for SNC 16 -CTAB. In addition, another anionic surfactant sodium dodecyl sulfate (SDS) was introduced to study the influence of chain-chain interaction. Decreased SFG amplitude of interfacial water molecules for SNC 16 -SDS was observed. Therefore, both the headgroup-headgroup electrostatic interaction and chain-chain van der Waals attractive interaction of the surfactants play an important role in enhancing the ordering of interfacial water molecules. The results provided experimental and theoretical bases for practical applications of the surfactants.

Model Catalysis of Ammonia Synthesis ad Iron-Water Interfaces - ASum Frequency Generation Vibrational Spectroscopic Study of Solid-GasInterfaces and Anion Photoelectron Spectroscopic Study of Selected Anionclusters

Energy Technology Data Exchange (ETDEWEB)

Ferguson, Michael James [Univ. of California, Berkeley, CA (United States)

2005-01-01

The ammonia synthesis reaction has been studied using single crystal model catalysis combined with sum frequency generation (SFG) vibrational spectroscopy. The adsorption of gases N₂, H₂, O₂ and NH₃ that play a role in ammonia synthesis have been studied on the Fe(111) crystal surface by sum frequency generation vibrational spectroscopy using an integrated Ultra-High Vacuum (UHV)/high-pressure system. SFG spectra are presented for the dissociation intermediates, NH₂ (~3325 cm^-1) and NH (~3235 cm^-1) under high pressure of ammonia or equilibrium concentrations of reactants and products on Fe(111) surfaces. Special attention was paid to understand how potassium promotion of the iron catalyst affects the intermediates of ammonia synthesis. An Fe(111) surface promoted with 0.2 monolayers of potassium red shifts the vibrational frequencies of the reactive surface intermediates, NH and NH₂, providing evidence for weakened the nitrogen-hydrogen bonds relative to clean Fe(111). Spectral features of these surface intermediates persisted to higher temperatures for promoted iron surfaces than for clean Fe(111) surfaces implying that nitrogen-iron bonds are stronger for the promoted surface. The ratio of the NH to NH₂ signal changed for promoted surfaces in the presence of equilibrium concentrations of reactants and products. The order of adding oxygen and potassium to promoted surfaces does not alter the spectra indicating that ammonia induces surface reconstruction of the catalyst to produce the same surface morphology. When oxygen is co-adsorbed with nitrogen, hydrogen, ammonia or potassium on Fe(111), a relative phase shift of the spectra occurs as compared to the presence of adsorbates on clean iron surfaces. Water adsorption on iron was also probed using SFG vibrational spectroscopy. For both H₂O and D₂O, the only spectral feature was in the range of

Ultra-Broadband Infrared Pulses from a Potassium-Titanyl Phosphate Optical Parametric Amplifier for VIS-IR-SFG Spectroscopy

Science.gov (United States)

Isaienko, Oleksandr; Borguet, Eric

A non-collinear KTP-OPA to provide ultra-broadband mid-infrared pulses was designed and characterized. With proper pulse-front and phase correction, the system has a potential for high-time resolution vibrational VIS-IR-SFG spectroscopy.

Combined IR-Raman vs vibrational sum-frequency heterospectral correlation spectroscopy

Science.gov (United States)

Roy, Sandra; Beutier, Clémentine; Hore, Dennis K.

2018-06-01

Vibrational sum-frequency generation spectroscopy is a valuable probe of surface structure, particularly when the same molecules are present in one of the adjacent bulk solid or solution phases. As a result of the non-centrosymmetric requirement of SFG, the signal generated is a marker of the extent to which the molecules are ordered in an arrangement that breaks the up-down symmetry at the surface. In cases where the accompanying changes in the bulk are of interest in understanding and interpreting the surface structure, simultaneous analysis of the bulk IR absorption or bulk Raman scattering is helpful, and may be used in heterospectral surface-bulk two-dimensional correlation. We demonstrate that, in such cases, generating a new type of bulk spectrum that combines the IR and Raman amplitudes is a better candidate than the individual IR and Raman spectra for the purpose of correlation with the SFG signal.

Deducing 2D Crystal Structure at the Solid/Liquid Interface with Atomic Resolution by Combined STM and SFG Study

Science.gov (United States)

McClelland, Arthur; Ahn, Seokhoon; Matzger, Adam J.; Chen, Zhan

2009-03-01

Supplemented by computed models, Scanning Tunneling Microscopy (STM) can provide detailed structure of 2D crystals formed at the liquid/solid interface with atomic resolution. However, some structural information such as functional group orientations in such 2D crystals needs to be tested experimentally to ensure the accuracy of the deduced structures. Due to the limited sensitivity, many other experimental techniques such as Raman and infrared spectroscopy have not been allowed to provide such structural information of 2D crystals. Here we showed that Sum Frequency Generation Vibrational Spectroscopy (SFG) can measure average orientation of functional groups in such 2D crystals, or physisorbed monolayers, providing key experimental data to aid in the modeling and interpretation of the STM images. The usefulness of combining these two techniques is demonstrated with a phthalate diesters monolayer formed at the 1-phenyloctane/ highly oriented pyrolytic graphite (HOPG) interface. The spatial orientation of the ester C=O of the monolayer was successfully determined using SFG.

An SFG and DFG investigation of polycrystalline Au, Au-Cu and Au-Ag-Cu electrodes in contact with aqueous solutions containing KCN

International Nuclear Information System (INIS)

Bozzini, Benedetto; Busson, Bertrand; De Gaudenzi, Gian Pietro; Mele, Claudio; Tadjeddine, Abderrahmane

2007-01-01

In this paper, the behaviour of polycrystalline Au, Au-Cu (Cu 25%) and Au-Ag-Cu (Ag 10%, Cu 15%) electrodes in contact with neutral aqueous solutions of KCN has been studied as a function of potential by means of in situ sum frequency generation (SFG) and difference frequency generation (DFG) spectroscopies. The potential-dependent spectra have been analysed quantitatively with a model for the second-order non-linear susceptibility accounting for vibrational and electronic effects. The potential-dependence of the CN - stretching band position and of the free-electron contribution to the real part of the non-resonant component of the second-order susceptibility have been accounted for. Spectroelectrochemical results were complemented by cyclic voltammetric measurements. The chief stress in this work has been placed on systematising and quantifying the interaction between the vibrational and electronic structures of the electrodic interfaces studied. The effects of adsorbates on the electronic structure of the adsorbing electrode, as a function of electrode alloy composition and applied potential are particularly critical for the understanding of Au-alloy electrochemistry in the presence of cyanide and cyanocomplexes. The systematic comparison of SFG and DFG spectra measured under the same electrochemical conditions for Au, Au-Cu and Au-Ag-Cu electrodes discloses a rich phenomenology related to the electronic structure of the interface

An SFG and DFG investigation of polycrystalline Au, Au-Cu and Au-Ag-Cu electrodes in contact with aqueous solutions containing KCN

Energy Technology Data Exchange (ETDEWEB)

Bozzini, Benedetto [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy)]. E-mail: benedetto.bozzini@unile.it; Busson, Bertrand [CLIO-LCP, Universite Paris-Sud, 91405 Orsay Cedex (France); De Gaudenzi, Gian Pietro [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Mele, Claudio [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Tadjeddine, Abderrahmane [UDIL-CNRS, Bat. 201, Centre Universitaire Paris-Sud, BP 34, 91898 Orsay Cedex (France)

2007-01-16

In this paper, the behaviour of polycrystalline Au, Au-Cu (Cu 25%) and Au-Ag-Cu (Ag 10%, Cu 15%) electrodes in contact with neutral aqueous solutions of KCN has been studied as a function of potential by means of in situ sum frequency generation (SFG) and difference frequency generation (DFG) spectroscopies. The potential-dependent spectra have been analysed quantitatively with a model for the second-order non-linear susceptibility accounting for vibrational and electronic effects. The potential-dependence of the CN{sup -} stretching band position and of the free-electron contribution to the real part of the non-resonant component of the second-order susceptibility have been accounted for. Spectroelectrochemical results were complemented by cyclic voltammetric measurements. The chief stress in this work has been placed on systematising and quantifying the interaction between the vibrational and electronic structures of the electrodic interfaces studied. The effects of adsorbates on the electronic structure of the adsorbing electrode, as a function of electrode alloy composition and applied potential are particularly critical for the understanding of Au-alloy electrochemistry in the presence of cyanide and cyanocomplexes. The systematic comparison of SFG and DFG spectra measured under the same electrochemical conditions for Au, Au-Cu and Au-Ag-Cu electrodes discloses a rich phenomenology related to the electronic structure of the interface.

Sum frequency and second harmonic generation from the surface of a liquid microjet

International Nuclear Information System (INIS)

Smolentsev, Nikolay; Chen, Yixing; Roke, Sylvie; Jena, Kailash C.; Brown, Matthew A.

2014-01-01

The use of a liquid microjet as a possible source of interest for Second Harmonic Generation (SHG) and Sum Frequency Generation (SFG) spectroscopy is examined. We measured non-resonant SHG scattering patterns from the air/water interface of a microjet of pure water and observe a strong enhancement of the SHG signal for certain scattering angles. These enhancements can be explained by the optical properties and the shape of the liquid microjet. SFG experiments at the surface of a liquid microjet of ethanol in air show that it is also possible to measure the coherent vibrational SFG spectrum of the ethanol/air interface in this way. Our findings are useful for future far-UV or X-ray based nonlinear optical surface experiments on liquid jets. In addition, combined X-ray photoelectron spectroscopy and SHG/SFG measurements are feasible, which will be very useful in improving our understanding of the molecular foundations of electrostatic and chemical surface properties and phenomena

Sum frequency and second harmonic generation from the surface of a liquid microjet

Energy Technology Data Exchange (ETDEWEB)

Smolentsev, Nikolay; Chen, Yixing; Roke, Sylvie, E-mail: sylvie.roke@epfl.ch [Laboratory for Fundamental Biophotonics (LBP), Institute of Bioengineering (IBI), School of Engineering STI, École Polytechnique Fédérale de Lausanne EPFL, 1015 Lausanne (Switzerland); Jena, Kailash C. [Laboratory for Fundamental Biophotonics (LBP), Institute of Bioengineering (IBI), School of Engineering STI, École Polytechnique Fédérale de Lausanne EPFL, 1015 Lausanne (Switzerland); Department of Physics, Indian Institute of Technology Ropar, Rupnagar, 140001 (India); Brown, Matthew A. [Laboratory for Surface Science and Technology, Department of Materials, ETH Zürich, CH-8093 Zurich (Switzerland)

2014-11-14

The use of a liquid microjet as a possible source of interest for Second Harmonic Generation (SHG) and Sum Frequency Generation (SFG) spectroscopy is examined. We measured non-resonant SHG scattering patterns from the air/water interface of a microjet of pure water and observe a strong enhancement of the SHG signal for certain scattering angles. These enhancements can be explained by the optical properties and the shape of the liquid microjet. SFG experiments at the surface of a liquid microjet of ethanol in air show that it is also possible to measure the coherent vibrational SFG spectrum of the ethanol/air interface in this way. Our findings are useful for future far-UV or X-ray based nonlinear optical surface experiments on liquid jets. In addition, combined X-ray photoelectron spectroscopy and SHG/SFG measurements are feasible, which will be very useful in improving our understanding of the molecular foundations of electrostatic and chemical surface properties and phenomena.

Sum frequency and second harmonic generation from the surface of a liquid microjet

Science.gov (United States)

Smolentsev, Nikolay; Chen, Yixing; Jena, Kailash C.; Brown, Matthew A.; Roke, Sylvie

2014-11-01

The use of a liquid microjet as a possible source of interest for Second Harmonic Generation (SHG) and Sum Frequency Generation (SFG) spectroscopy is examined. We measured non-resonant SHG scattering patterns from the air/water interface of a microjet of pure water and observe a strong enhancement of the SHG signal for certain scattering angles. These enhancements can be explained by the optical properties and the shape of the liquid microjet. SFG experiments at the surface of a liquid microjet of ethanol in air show that it is also possible to measure the coherent vibrational SFG spectrum of the ethanol/air interface in this way. Our findings are useful for future far-UV or X-ray based nonlinear optical surface experiments on liquid jets. In addition, combined X-ray photoelectron spectroscopy and SHG/SFG measurements are feasible, which will be very useful in improving our understanding of the molecular foundations of electrostatic and chemical surface properties and phenomena.

A compact OPO/SFG laser for ultraviolet biological sensing

Science.gov (United States)

Tiihonen, Mikael; Pasiskevicius, Valdas; Laurell, Fredrik; Jonsson, Per; Lindgren, Mikael

2004-07-01

A compact parametric oscillator (OPO) with intracavity sum-frequency generation (SFG) to generate 293 nm UV laser irradiation, was developed. The OPO/SFG device was pumped by a 100 Hz Nd:YAG laser (1064 nm) of own design, including subsequent second harmonic generation (SHG) in an external periodically poled KTiOPO4 (KTP) crystal. The whole system could be used to deliver more than 30 μJ laser irradiation per pulse (100 Hz) at 293 nm. The UV laser light was introduced in an optical fiber attached to a sample compartment allowing detection of fluorescence emission using a commercial spectrometer. Aqueous samples containing biomolecules (ovalbumin) or bacteria spores (Bacillus subtilis) were excited by the UV-light at 293 nm resulting in strong fluorescence emission in the range 325 - 600 nm.

An SFG and ERS investigation of the corrosion of CoW0.013C0.001 alloys and WC-Co cermets in CN--containing aqueous solutions

International Nuclear Information System (INIS)

Bozzini, Benedetto; Busson, Bertrand; De Gaudenzi, Gian Pietro; D'Urzo, Lucia; Mele, Claudio; Tadjeddine, Abderrahmane

2007-01-01

In order to increase the knowledge of the corrosion mechanism, in situ spectroelectrochemical methodologies were employed in the investigation of the electrochemical interface of WC-Co hardmetals. Together with standard cyclic voltammetries (CV), ElectroReflectance Spectroscopy (ERS) and Sum Frequency Generation (SFG) spectroscopy measurements were performed both on a Co-base alloy, simulating the metallic binder of hardmetal composites, and on a model WC-Co system. A cyanide solution, encountered in the gold extraction industry, was employed as electrolyte. Electrochemical cells and experimental apparatuses were designed to allow in situ experiments. CV measurements showed corrosion attack to run at potentials more anodic than -500 mV vs. Ag/AgCl, both for the alloy and the composite. The high reactivity of the alloy in cyanide environment was witnessed by the time-dependence of the surface vibrational (SFG) and electronic (SFG and ERS) properties under cathodic polarisation. Furthermore, SFG measurements highlighted two different adsorbation sites for cyanide ion, probably α- and ε-Co. The WC-Co system showed a pseudo-passivation peak, typical of the corrosion behaviour of this material, due to precipitation of corrosion products. ERS data at 532 nm showed an ennobling of the potential at which the reflectivity increase was recorded

An SFG and ERS investigation of the corrosion of CoW{sub 0.013}C{sub 0.001} alloys and WC-Co cermets in CN{sup -}-containing aqueous solutions

Energy Technology Data Exchange (ETDEWEB)

Bozzini, Benedetto [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy)]. E-mail: benedetto.bozzini@unile.it; Busson, Bertrand [CLIO-LCP, Batiment 201P2, Universitaire Paris Sud 11, 91420 Orsay Cedex (France); De Gaudenzi, Gian Pietro [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); D' Urzo, Lucia [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Mele, Claudio [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Tadjeddine, Abderrahmane [UDIL-CNRS, Batiment 201P1, BP34, 91898 Orsay, Cedex (France)

2007-05-15

In order to increase the knowledge of the corrosion mechanism, in situ spectroelectrochemical methodologies were employed in the investigation of the electrochemical interface of WC-Co hardmetals. Together with standard cyclic voltammetries (CV), ElectroReflectance Spectroscopy (ERS) and Sum Frequency Generation (SFG) spectroscopy measurements were performed both on a Co-base alloy, simulating the metallic binder of hardmetal composites, and on a model WC-Co system. A cyanide solution, encountered in the gold extraction industry, was employed as electrolyte. Electrochemical cells and experimental apparatuses were designed to allow in situ experiments. CV measurements showed corrosion attack to run at potentials more anodic than -500 mV vs. Ag/AgCl, both for the alloy and the composite. The high reactivity of the alloy in cyanide environment was witnessed by the time-dependence of the surface vibrational (SFG) and electronic (SFG and ERS) properties under cathodic polarisation. Furthermore, SFG measurements highlighted two different adsorbation sites for cyanide ion, probably {alpha}- and {epsilon}-Co. The WC-Co system showed a pseudo-passivation peak, typical of the corrosion behaviour of this material, due to precipitation of corrosion products. ERS data at 532 nm showed an ennobling of the potential at which the reflectivity increase was recorded.

SFG study of platinum electrodes in perchloric acid solutions

Science.gov (United States)

Zheng, W. Q.; Pluchery, O.; Tadjeddine, A.

2002-04-01

Infrared-visible sum-frequency generation (SFG) spectroscopy has been used to study the structure of water molecules (and/or its derivatives OH -, H 3O + etc.) at aqueous electrolyte/electrode interfaces. For Pt(1 1 0) and Pt(1 0 0) electrodes in 0.1 M perchloric acid solution, we did not observe any significant O-H stretching resonance. In striking contrast to the resonant SFG signal, the nonresonant SFG (NRSFG) signal varies sensitively with the applied electrochemical potential, indicating that the interaction of water molecules with platinum electrodes is relatively weak as compared to that of H + and ClO 4- ions. From changes in the NRSFG signal and on the basis of an ionic adsorption model, we can also deduce that the potential of zero charge of Pt(1 1 0) in 0.1 M HClO 4 should be located at about 0.22 V (vs. NHE). This value is in good agreement with that measured recently by electrochemical method.

SFG analysis of the molecular structures at the surfaces and buried interfaces of PECVD ultralow-dielectric constant pSiCOH

Science.gov (United States)

Zhang, Xiaoxian; Myers, John N.; Huang, Huai; Shobha, Hosadurga; Chen, Zhan; Grill, Alfred

2016-02-01

PECVD deposited porous SiCOH with ultralow dielectric constant has been successfully integrated as the insulator in advanced interconnects to decrease the RC delay. The effects of NH3 plasma treatment and the effectiveness of the dielectric repair on molecular structures at the surface and buried interface of a pSiCOH film deposited on top of a SiCNH film on a Si wafer were fully characterized using sum frequency generation vibrational spectroscopy (SFG), supplemented by X-ray photoelectron spectroscopy. After exposure to NH3 plasma for 18 s, about 40% of the methyl groups were removed from the pSiCOH surface, and the average orientation of surface methyl groups tilted more towards the surface. The repair method used here effectively repaired the molecular structures at the pSiCOH surface but did not totally recover the entire plasma-damaged layer. Additionally, simulated SFG spectra with various average orientations of methyl groups at the SiCNH/pSiCOH buried interface were compared with the experimental SFG spectra collected using three different laser input angles to determine the molecular structural information at the SiCNH/pSiCOH buried interface after NH3 plasma treatment and repair. The molecular structures including the coverage and the average orientation of methyl groups at the buried interface were found to be unchanged by NH3 plasma treatment and repair.

High-Pressure Catalytic Reactions of C6 Hydrocarbons on PlatinumSingle-Crystals and nanoparticles: A Sum Frequency Generation VibrationalSpectroscopic and Kinetic Study

Energy Technology Data Exchange (ETDEWEB)

Bratlie, Kaitlin [Univ. of California, Berkeley, CA (United States)

2007-01-01

Catalytic reactions of cyclohexene, benzene, n-hexane, 2-methylpentane, 3-methylpentane, and 1-hexene on platinum catalysts were monitored in situ via sum frequency generation (SFG) vibrational spectroscopy and gas chromatography (GC). SFG is a surface specific vibrational spectroscopic tool capable of monitoring submonolayer coverages under reaction conditions without gas-phase interference. SFG was used to identify the surface intermediates present during catalytic processes on Pt(111) and Pt(100) single-crystals and on cubic and cuboctahedra Pt nanoparticles in the Torr pressure regime and at high temperatures (300K-450K). At low pressures (<10^-6 Torr), cyclohexene hydrogenated and dehydrogenates to form cyclohexyl (C₆H₁₁) and π-allyl C₆H₉, respectively, on Pt(100). Increasing pressures to 1.5 Torr form cyclohexyl, π-allyl C₆H₉, and 1,4-cyclohexadiene, illustrating the necessity to investigate catalytic reactions at high-pressures. Simultaneously, GC was used to acquire turnover rates that were correlated to reactive intermediates observed spectroscopically. Benzene hydrogenation on Pt(111) and Pt(100) illustrated structure sensitivity via both vibrational spectroscopy and kinetics. Both cyclohexane and cyclohexene were produced on Pt(111), while only cyclohexane was formed on Pt(100). Additionally, π-allyl c-C₆H₉ was found only on Pt(100), indicating that cyclohexene rapidly dehydrogenates on the (100) surface. The structure insensitive production of cyclohexane was found to exhibit a compensation effect and was analyzed using the selective energy transfer (SET) model. The SET model suggests that the Pt-H system donates energy to the E_2u mode of free benzene, which leads to catalysis. Linear C₆ (n-hexane, 2-methylpentane, 3-methylpentane, and 1-hexene) hydrocarbons were also investigated in the presence and absence of excess hydrogen on Pt

SFG investigation of adsorbed CO and NO on NiO(111) surface

Energy Technology Data Exchange (ETDEWEB)

Bandara, Athula; Dobashi, Shinsaku; Kubota, Jun; Onda, Ken; Wada, Akihide; Domen, Kazunari; Hirose, Chiaki [Tokyo Inst. of Tech., Yokohama (Japan). Research Lab. of Resources Utilization; Kano, S.S.

1997-07-01

Adsorption structures of CO and NO on the NiO(111) film grown on Ni(111) crystal have been investigated by sum frequency generation (SFG) spectroscopy and infrared reflection absorption spectroscopy (IRAS). The CO stretching band of adsorbed CO on NiO(111) was observed at 2144 cm{sup -1} on the SFG spectra for both p- and s-polarized visible light. However, adsorbed NO on NiO(111) was observed at 1805 cm{sup -1} on the SFG spectra only for the p-polarized visible light. The results suggest that the adsorbed CO molecule was tilted from the surface normal but the NO molecule was perpendicular to the surface. These orientations of CO and NO reflect the surface structure of NiO(111) which has (2 x 2)-reconstructed microfacets. Adsorption of CO on Ni(111) instead of NiO(111) was also examined by SFG and IRAS. Absorption bands due to linear and bridged CO were observed at 2076 and 1918 cm{sup -1}, respectively, by IRAS. On the other hand, the linear CO molecules on Ni(111) gave an SFG peak at 2076 cm{sup -1} only for the p-polarized visible light indicating the CO molecules are perpendicular to the surface, and bridged CO molecules did not give any SFG signal. The absence of the bridged CO signal is believed to be due to the smaller Raman tensor of bridged CO. (author)

SFG investigation of adsorbed CO and NO on NiO(111) surface

International Nuclear Information System (INIS)

Bandara, Athula; Dobashi, Shinsaku; Kubota, Jun; Onda, Ken; Wada, Akihide; Domen, Kazunari; Hirose, Chiaki; Kano, S.S.

1997-01-01

Adsorption structures of CO and NO on the NiO(111) film grown on Ni(111) crystal have been investigated by sum frequency generation (SFG) spectroscopy and infrared reflection absorption spectroscopy (IRAS). The CO stretching band of adsorbed CO on NiO(111) was observed at 2144 cm -1 on the SFG spectra for both p- and s-polarized visible light. However, adsorbed NO on NiO(111) was observed at 1805 cm -1 on the SFG spectra only for the p-polarized visible light. The results suggest that the adsorbed CO molecule was tilted from the surface normal but the NO molecule was perpendicular to the surface. These orientations of CO and NO reflect the surface structure of NiO(111) which has (2 x 2)-reconstructed microfacets. Adsorption of CO on Ni(111) instead of NiO(111) was also examined by SFG and IRAS. Absorption bands due to linear and bridged CO were observed at 2076 and 1918 cm -1 , respectively, by IRAS. On the other hand, the linear CO molecules on Ni(111) gave an SFG peak at 2076 cm -1 only for the p-polarized visible light indicating the CO molecules are perpendicular to the surface, and bridged CO molecules did not give any SFG signal. The absence of the bridged CO signal is believed to be due to the smaller Raman tensor of bridged CO. (author)

AFM and SFG studies of pHEMA-based hydrogel contact lens surfaces in saline solution: adhesion, friction, and the presence of non-crosslinked polymer chains at the surface.

Science.gov (United States)

Kim, Seong Han; Opdahl, Aric; Marmo, Chris; Somorjai, Gabor A

2002-04-01

The surfaces of two types of soft contact lenses neutral and ionic hydrogels--were characterized by atomic force microscopy (AFM) and sum-frequency-generation (SFG) vibrational spectroscopy. AFM measurements in saline solution showed that the presence of ionic functional groups at the surface lowered the friction and adhesion to a hydrophobic polystyrene tip. This was attributed to the specific interactions of water and the molecular orientation of hydrogel chains at the surface. Friction and adhesion behavior also revealed the presence of domains of non-crosslinked polymer chains at the lens surface. SFG showed that the lens surface became partially dehydrated upon exposure to air. On this partially dehydrated lens surface, the non-crosslinked domains exhibited low friction and adhesion in AFM. Fully hydrated in saline solution, the non-crosslinked domains extended more than tens of nanometers into solution and were mobile.

Non-invasive SFG spectroscopy: a tool to reveal the conformational change of grafted chains due to bacterial adhesion

Science.gov (United States)

Bulard, Emilie; Dubost, Henri; Fontaine-Aupart, Marie-Pierre; Zheng, Wanquan; Herry, Jean-Marie; Bellon-Fontaine, Marie-No"lle; Briandet, Romain; Bourguignon, Bernard

2011-07-01

In many fields such as biomedical or food industry, surface colonization by micro-organisms leads to biofilms formation that are tridimentional biostructures highly resistant to the action of antimicrobials, by mechanisms still unclear. In order to deepen our understanding of the initial interaction of bacteria cells with a solid surface, we analyze by in situ vibrational Sum Frequency Generation (SFG) spectroscopy the effect of the adhesion of hydrophilic Lactoccocus lactis bacteria and its hydrophobic mutants in distilled water on a self-assembled monolayer (SAM) of octadecanethiol (ODT) on a gold film. When a homogeneous bacterial monolayer is deposited on this ordered surface, SFG spectrum of the ODT SAM shows significant intensity changes from that in air or in water. Its modelling as a function of conformation allows to distinguish optical effects due to the water solution surrounding bacteria from conformational changes of the ODT SAM due to the presence of the bacteria cells. Futhermore, bacterial adhesion induces different measurable effects on the ODT SAM conformation, depending on the hydrophobic / hydrophilic character of the bacterial surface. Such a result deserves to be taken into account for the design of new materials with improved properties or to control biofilm formation.

Time-domain SFG spectroscopy using mid-IR pulse shaping: practical and intrinsic advantages.

Science.gov (United States)

Laaser, Jennifer E; Xiong, Wei; Zanni, Martin T

2011-03-24

Sum-frequency generation (SFG) spectroscopy is a ubiquitous tool in the surface sciences. It provides infrared transition frequencies and line shapes that probe the structure and environment of molecules at interfaces. In this article, we apply techniques learned from the multidimensional spectroscopy community to SFG spectroscopy. We implement balanced heterodyne detection to remove scatter and the local oscillator background. Heterodyning also separates the resonant and nonresonant signals by acquiring both the real and imaginary parts of the spectrum. We utilize mid-IR pulse shaping to control the phase and delay of the mid-IR pump pulse. Pulse shaping allows phase cycling for data collection in the rotating frame and additional background subtraction. We also demonstrate time-domain data collection, which is a Fourier transform technique, and has many advantages in signal throughput, frequency resolution, and line shape accuracy over existing frequency domain methods. To demonstrate time-domain SFG spectroscopy, we study an aryl isocyanide on gold, and find that the system has an inhomogeneous structural distribution, in agreement with computational results, but which was not resolved by previous frequency-domain SFG studies. The ability to rapidly and actively manipulate the mid-IR pulse in an SFG pules sequence makes possible new experiments and more accurate spectra. © 2011 American Chemical Society

SFG study on potential-dependent structure of water at Pt electrode/electrolyte solution interface

Energy Technology Data Exchange (ETDEWEB)

Noguchi, Hidenori; Okada, Tsubasa; Uosaki, Kohei [Physical Chemistry Laboratory, Division of Chemistry, Graduate School of Science, Hokkaido University, Sapporo 060-0810 (Japan)

2008-10-01

Structure of water at Pt/electrolyte solution interface was investigated by sum frequency generation (SFG) spectroscopy. Two broad peaks were observed in OH stretching region at ca. 3200 cm{sup -1} and ca. 3400 cm{sup -1}, which are known to be due to the symmetric OH stretching (U{sub 1}) of tetrahedrally coordinated, i.e., strongly hydrogen bonded 'ice-like' water, and the asymmetric OH stretching (U{sub 3}) of water molecules in a more random arrangement, i.e., weakly hydrogen bonded 'liquid-like' water, respectively. The SFG intensity strongly depended on electrode potential. Several possibilities are suggested for the potential dependence of the SFG intensity. (author)

Laser-heating-induced displacement of surfactants on the water surface

NARCIS (Netherlands)

Backus, E.H.G.; Bonn, D.; Cantin, S.; Roke, S.; Bonn, M.

2012-01-01

We report a combined vibrational sum-frequency generation (SFG) spectroscopy, Brewster angle microscopy (BAM), and ellipsometry study of different surfactants on water as a function of surfactant density. Vibrational SFG spectra of surfactants on the water surface in a Langmuir trough have been

Sum-frequency generation from molecular monolayers using 14 μm radiation from the FELIX free-electron laser

International Nuclear Information System (INIS)

Van der Ham, E.W.M.; Vrehen, Q.H.F.; Eliel, E.R.

1995-01-01

Sum-frequency generation (SFG) has developed into a widely applied tool for study of surfaces and interfaces where molecules are present. It combines the surface specificity of a second-order nonlinear optical technique with the power of a spectroscopic method, and it can be used under widely varying experimental conditions ranging from UHV to electrochemical cells. The important characteristic of SFG is that it allows one to study the average spatial orientation of a molecular bond in a monolayer of molecules at an interface. Until recently SFG measurements were confined to the frequency interval Y μ > 1700 cm -1 because of a lack of suitable laser sources at wave-lengths λ > 6 μm. So for most molecules only a few vibrational modes and thus intramolecular bonds can be studied. We have developed a universal sum-frequency spectrometer around the FELIX free-electron law that covers the complete molecular fingerprint since we can generate any IR wavelength between 2.75 and 110 fμ at the FELIX facility. We have used this setup for a series of exploratory SFG experiments in a frequency range that was hitherto unexplored in the study of molecular monolayers. We have studied thiol monolayers chemisorbed on a variety of noble metals (Au, Ag, Pt) where we focussed on the C-S stretch vibration at ν = 702 cm -1 (λ = 14.3 μm). We have found spectroscopic features revealing the presence of both the trane and gauche conformers of the adsorbed molecules. The present measurements open a whole new wavelength range for nonlinear optical studies of interfaces

Atmospheric pressure reaction cell for operando sum frequency generation spectroscopy of ultrahigh vacuum grown model catalysts

Science.gov (United States)

Roiaz, Matteo; Pramhaas, Verena; Li, Xia; Rameshan, Christoph; Rupprechter, Günther

2018-04-01

A new custom-designed ultrahigh vacuum (UHV) chamber coupled to a UHV and atmospheric-pressure-compatible spectroscopic and catalytic reaction cell is described, which allows us to perform IR-vis sum frequency generation (SFG) vibrational spectroscopy during catalytic (kinetic) measurements. SFG spectroscopy is an exceptional tool to study vibrational properties of surface adsorbates under operando conditions, close to those of technical catalysis. This versatile setup allows performing surface science, SFG spectroscopy, catalysis, and electrochemical investigations on model systems, including single crystals, thin films, and deposited metal nanoparticles, under well-controlled conditions of gas composition, pressure, temperature, and potential. The UHV chamber enables us to prepare the model catalysts and to analyze their surface structure and composition by low energy electron diffraction and Auger electron spectroscopy, respectively. Thereafter, a sample transfer mechanism moves samples under UHV to the spectroscopic cell, avoiding air exposure. In the catalytic cell, SFG spectroscopy and catalytic tests (reactant/product analysis by mass spectrometry or gas chromatography) are performed simultaneously. A dedicated sample manipulation stage allows the model catalysts to be examined from LN2 temperature to 1273 K, with gaseous reactants in a pressure range from UHV to atmospheric. For post-reaction analysis, the SFG cell is rapidly evacuated and samples are transferred back to the UHV chamber. The capabilities of this new setup are demonstrated by benchmark results of CO adsorption on Pt and Pd(111) single crystal surfaces and of CO adsorption and oxidation on a ZrO2 supported Pt nanoparticle model catalyst grown by atomic layer deposition.

SFG analysis of the molecular structures at the surfaces and buried interfaces of PECVD ultralow-dielectric constant pSiCOH: Reactive ion etching and dielectric recovery

Science.gov (United States)

Myers, John N.; Zhang, Xiaoxian; Huang, Huai; Shobha, Hosadurga; Grill, Alfred; Chen, Zhan

2017-05-01

Molecular structures at the surface and buried interface of an amorphous ultralow-k pSiCOH dielectric film were quantitatively characterized before and after reactive ion etching (RIE) and subsequent dielectric repair using sum frequency generation (SFG) vibrational spectroscopy and Auger electron spectroscopy. SFG results indicated that RIE treatment of the pSiCOH film resulted in a depletion of ˜66% of the surface methyl groups and changed the orientation of surface methyl groups from ˜47° to ˜40°. After a dielectric recovery process that followed the RIE treatment, the surface molecular structure was dominated by methyl groups with an orientation of ˜55° and the methyl surface coverage at the repaired surface was 271% relative to the pristine surface. Auger depth profiling indicated that the RIE treatment altered the top ˜25 nm of the film and that the dielectric recovery treatment repaired the top ˜9 nm of the film. Both SFG and Auger profiling results indicated that the buried SiCNH/pSiCOH interface was not affected by the RIE or the dielectric recovery process. Beyond characterizing low-k materials, the developed methodology is general and can be used to distinguish and characterize different molecular structures and elemental compositions at the surface, in the bulk, and at the buried interface of many different polymer or organic thin films.

Coupled-cluster sum-frequency generation nonlinear susceptibilities of methyl (CH3) and methylene (CH2) groups.

Science.gov (United States)

Tetsassi Feugmo, Conrard Giresse; Liégeois, Vincent; Champagne, Benoît

2017-11-15

The first vibrational sum frequency generation (SFG) spectra based on molecular properties calculated at the coupled cluster singles and doubles (CCSD) level of approximation have been simulated for interfacial model alkyl chains, providing benchmark data for comparisons with approximate methods, including density functional theory (DFT). The approach proceeds in three steps. In the first two steps, the molecular spectral properties are determined: the vibrational normal modes and frequencies and then the derivatives of the dipole moment and of the polarizability with respect to the normal coordinates. These derivatives are evaluated with a numerical differentiation approach, of which the accuracy was monitored using Romberg's procedure. Then, in the last step, a three-layer model is employed to evaluate the macroscopic second-order nonlinear optical responses and thereby the simulated SFG spectra of the alkyl interface. Results emphasize the following facts: (i) the dipole and polarizability derivatives calculated at the DFT level with the B3LYP exchange-correlation functional can differ, with respect to CCSD, by as much as ±10 to 20% and ±20 to 50% for the CH 3 and CH 2 vibrations, respectively; (ii) these differences are enhanced when considering the SFG intensities as well as their variations as a function of the experimental configuration (ppp versus ssp) and as a function of the tilt and rotation angles, defining the orientation of the alkyl chain at the interface; (iii) these differences originate from both the vibrational normal coordinates and the Cartesian derivatives of the dipole moment and polarizability; (iv) freezing the successive fragments of the alkyl chain strongly modifies the SFG spectrum and enables highlighting the delocalization effects between the terminal CH 3 group and its neighboring CH 2 units; and finally (v) going from the free chain to the free methyl model, and further to C 3v constraints on leads to large variations of two ratios

Self-assembled organic monolayers on gold nanoparticles: A study by sum-frequency generation combined with UV-vis spectroscopy

International Nuclear Information System (INIS)

Humbert, C.; Busson, B.; Abid, J.-P.; Six, C.; Girault, H.H.; Tadjeddine, A.

2005-01-01

We use sum-frequency generation spectroscopy (SFG) in the infrared 2800-3000 cm -1 spectral range and UV-vis spectroscopy (transmission) in the 450-650 nm spectral range in order to characterize vibrational and electronic properties of various interfaces composed of organic monolayers adsorbed on gold nanoparticles (AuNPs) with 19 nm average diameter. SFG signal is observed for AuNPs films deposited on glass substrates using the following silane intermediates: 3-(aminopropyl) triethoxysilane and 3-(mercaptopropyl) trimethoxysilane. The density of AuNPs and their aggregates are measured with a scanning electron microscope. For the samples showing a strong well-defined surface plasmon resonance (SPR), we also observe an enhancement of their non-linear optical properties. Furthermore, the SFG measurements show that 1-dodecanethiol films are rather well ordered on specific AuNPs substrates. In this way, the presence of the SFG signal, which comes from both the bulk electronic s-d interband transition and the vibrational states of the adsorbed molecules, depends on a SPR process. This phenomenon is evidenced on the AuNPs by the incident visible beam located at 532 nm, i.e. near the SPR energy maximum of these interfaces. These results open the door to experiments involving macromolecular and biological materials networks deposited on ultrathin metal electrodes in a controlled electrochemical environment

Self-assembled organic monolayers on gold nanoparticles: A study by sum-frequency generation combined with UV-vis spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Humbert, C. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France) and Laboratoire de Spectroscopie Moleculaire de Surface, University of Namur, 61 Rue de Bruxelles, B-5000 Namur (Belgium)]. E-mail: christophe.humbert@fundp.ac.be; Busson, B. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France); Abid, J.-P. [Ecole Polytechnique Federale de Lausanne, Laboratoire d' Electrochimie Physique et Analytique, CH-1015 Lausanne (Switzerland); Six, C. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France); Girault, H.H. [Ecole Polytechnique Federale de Lausanne, Laboratoire d' Electrochimie Physique et Analytique, CH-1015 Lausanne (Switzerland); Tadjeddine, A. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France)

2005-05-20

We use sum-frequency generation spectroscopy (SFG) in the infrared 2800-3000 cm{sup -1} spectral range and UV-vis spectroscopy (transmission) in the 450-650 nm spectral range in order to characterize vibrational and electronic properties of various interfaces composed of organic monolayers adsorbed on gold nanoparticles (AuNPs) with 19 nm average diameter. SFG signal is observed for AuNPs films deposited on glass substrates using the following silane intermediates: 3-(aminopropyl) triethoxysilane and 3-(mercaptopropyl) trimethoxysilane. The density of AuNPs and their aggregates are measured with a scanning electron microscope. For the samples showing a strong well-defined surface plasmon resonance (SPR), we also observe an enhancement of their non-linear optical properties. Furthermore, the SFG measurements show that 1-dodecanethiol films are rather well ordered on specific AuNPs substrates. In this way, the presence of the SFG signal, which comes from both the bulk electronic s-d interband transition and the vibrational states of the adsorbed molecules, depends on a SPR process. This phenomenon is evidenced on the AuNPs by the incident visible beam located at 532 nm, i.e. near the SPR energy maximum of these interfaces. These results open the door to experiments involving macromolecular and biological materials networks deposited on ultrathin metal electrodes in a controlled electrochemical environment.

Surface restructuring behavior of various types of poly(dimethylsiloxane) in water detected by SFG.

Science.gov (United States)

Chen, Chunyan; Wang, Jie; Chen, Zhan

2004-11-09

Surface structures of several different poly(dimethylsiloxane) (PDMS) materials, tetraethoxysilane-cured hydroxy-terminated PDMS (TEOS-PDMS), platinum-cured vinyl-terminated PDMS (Pt-PDMS), platinum-cured vinyl-terminated poly(diphenylsiloxane)-co-poly(dimethylsiloxane) (PDPS-co-PDMS), and PDMS-co-polystyrene (PDMS-co-PS) copolymer in air and water have been investigated by sum frequency generation (SFG) vibrational spectroscopy. The SFG spectra collected from all PDMS surfaces in both air and water are dominated by methyl group stretches, indicating that all the surfaces are mainly covered by methyl groups. Other than surface-dominating methyl groups, some -Si-CH2-CH2- moieties on the Pt-PDMS surface have also been detected in air, which are present at cross-linking points. Information about the average orientation angle and angle distribution of the methyl groups on the PDMS surface has been evaluated. Surface restructuring of the methyl groups has been observed for all PDMS surfaces in water. Upon contacting water, the methyl groups on all PDMS surfaces tilt more toward the surface. The detailed restructuring behaviors of several PDMS surfaces in water and the effects of molecular weight on restructuring behaviors have been investigated. For comparison, in addition to air and water, surface structures of PDMS materials mentioned above in a nonpolar solvent, FC-75, have also been studied. By comparing the different response of phenyl groups to water on both PDPS-co-PDMS and PS-co-PDMS surfaces, we have demonstrated how the restructuring behaviors of surface phenyl groups are affected by the structural flexibility of the molecular chains where they are attached.

Wavelength tunable CW red laser generated based on an intracavity-SFG composite cavity

Science.gov (United States)

Zhang, Z. N.; Bai, Y.; Lei, G. Z.; Bai, B.; Sun, Y. X.; Hu, M. X.; Wang, C.; Bai, J. T.

2016-12-01

We report a wavelength-tunable watt-level continuous wave (CW) red laser that uses a composite cavity based on an intracavity sum-frequency generation (SFG). The composite cavity is composed of a LD side-pumped Nd: GdVO4 p-polarized 1062.9 nm resonant cavity and a resonant optical parametric oscillator (SRO) of s-polarized signal light using a periodically poled crystal MgO: PPLN. Based on the temperature tuning from 30 °C to 200 °C, the CW red laser beams are obtained in a tunable waveband from 634.4 nm to 649.1 nm, corresponding to a tunable output waveband from 3278.0 nm to 2940.2 nm of the mid-infrared idler lights. The maximum CW output power of the red laser at 634.4 nm and the idler light at 3278.0 nm reach 3.03 W and 4.13 W under 30 °C, respectively.

Vibration monitoring of large generator stator and-winding

International Nuclear Information System (INIS)

Duffeau, F.; Bernard, P.

1999-01-01

Large generators of French Nuclear Power plants are equipped with a standardised vibration monitoring system. The first aim of these new systems is to protect the machines by generating alarms in the control room when predefined vibration thresholds have been over-passed. Secondly, this specially designed instrumentation permits to create a National data base allowing to compare different generators of the same technology. Additionally, statistical methods have been developed in order to 'guess' vibration level at several locations of the stator end-windings, depending on the actual operating parameters of the generator, i.e. reactive and active power load. So this paper presents the general concept of the vibration monitoring of EDF large generator stators and deals with a new method to predict vibrations in different locations under control. (authors)

Ultrahigh vacuum and high-pressure coadsorption of CO and H2 on Pd(111): A combined SFG, TDS, and LEED study

Science.gov (United States)

Morkel, Matthias; Rupprechter, Günther; Freund, Hans-Joachim

2003-11-01

Sum frequency generation (SFG) vibrational spectroscopy was carried out in conjunction with thermal desorption spectroscopy, low-energy electron diffraction, and Auger electron spectroscopy to examine the coadsorption of CO and H2 on Pd(111). Sequential dosing as well as various CO/H2 mixtures was utilized to study intermolecular interactions between CO and H2. Preadsorbed CO effectively prevented the dissociative adsorption of hydrogen for CO coverages ⩾0.33 ML. While preadsorbed hydrogen was able to hinder CO adsorption at low temperature (100 K), hydrogen was replaced from the surface by CO at 150 K. When 1:1 mixtures of CO/H2 were used at 100 K, hydrogen selectively hindered CO adsorption on on-top sites, while above ˜125 K no blocking of CO adsorption was observed. The observations are explained in terms of mutual site blocking, of a CO-H phase separation, and of a CO-assisted hydrogen dissolution in the Pd bulk. The temperature-dependent site blocking effect of hydrogen is attributed to the ability (inability) of surface hydrogen to diffuse into the Pd bulk above (below) ˜125 K. Nonlinear optical SFG spectroscopy allowed us to study these effects not only in ultrahigh vacuum but also in a high-pressure environment. Using an SFG-compatible ultrahigh vacuum-high-pressure cell, spectra of 1:10 CO/H2 mixtures were acquired up to 55 mbar and 550 K, with simultaneous gas chromatographic and mass spectrometric gas phase analysis. Under reaction conditions, CO coverages ⩾0.5 ML were observed which strongly limit H2 adsorption and thus may be partly responsible for the low CO hydrogenation rate. The high-pressure and high-temperature SFG spectra also showed indications of a reversible surface roughening or a highly dynamic (not perfectly ordered) CO adsorbate phase. Implications of the observed adsorbate structures on catalytic CO hydrogenation on supported Pd nanoparticles are discussed.

Ultrahigh vacuum and high-pressure coadsorption of CO and H2 on Pd(111): A combined SFG, TDS, and LEED study

International Nuclear Information System (INIS)

Morkel, Matthias; Rupprechter, Guenther; Freund, Hans-Joachim

2003-01-01

Sum frequency generation (SFG) vibrational spectroscopy was carried out in conjunction with thermal desorption spectroscopy, low-energy electron diffraction, and Auger electron spectroscopy to examine the coadsorption of CO and H 2 on Pd(111). Sequential dosing as well as various CO/H 2 mixtures was utilized to study intermolecular interactions between CO and H 2 . Preadsorbed CO effectively prevented the dissociative adsorption of hydrogen for CO coverages ≥0.33 ML. While preadsorbed hydrogen was able to hinder CO adsorption at low temperature (100 K), hydrogen was replaced from the surface by CO at 150 K. When 1:1 mixtures of CO/H 2 were used at 100 K, hydrogen selectively hindered CO adsorption on on-top sites, while above ∼125 K no blocking of CO adsorption was observed. The observations are explained in terms of mutual site blocking, of a CO-H phase separation, and of a CO-assisted hydrogen dissolution in the Pd bulk. The temperature-dependent site blocking effect of hydrogen is attributed to the ability (inability) of surface hydrogen to diffuse into the Pd bulk above (below) ∼125 K. Nonlinear optical SFG spectroscopy allowed us to study these effects not only in ultrahigh vacuum but also in a high-pressure environment. Using an SFG-compatible ultrahigh vacuum-high-pressure cell, spectra of 1:10 CO/H 2 mixtures were acquired up to 55 mbar and 550 K, with simultaneous gas chromatographic and mass spectrometric gas phase analysis. Under reaction conditions, CO coverages ≥0.5 ML were observed which strongly limit H 2 adsorption and thus may be partly responsible for the low CO hydrogenation rate. The high-pressure and high-temperature SFG spectra also showed indications of a reversible surface roughening or a highly dynamic (not perfectly ordered) CO adsorbate phase. Implications of the observed adsorbate structures on catalytic CO hydrogenation on supported Pd nanoparticles are discussed

Dependence of steam generator vibrations on feedwater pressure

International Nuclear Information System (INIS)

Sadilek, J.

1989-01-01

Vibration sensors are attached to the bottom of the steam generator jacket between the input and output primary circuit collectors. The effective vibration value is recorded daily. Several times higher vibrations were observed at irregular intervals; their causes were sought, and the relation between the steam generator vibrations measured at the bottom of its vessel and the feedwater pressure was established. The source of the vibrations was found to be in the feedwater tract of the steam generator. The feedwater tract is described and its hydraulic characteristics are given. Vibrations were measured on the S02 valve. It is concluded that vibrations can be eliminated by reducing the water pressure before the control valves and by replacing the control valves with ones with more suitable control characteristics. (E.J.). 3 figs., 1 tab., 3 refs

In-situ Studies of the Reactions of Bifunctional and Heterocyclic Molecules over Noble Metal Single Crystal and Nanoparticle Catalysts Studied with Kinetics and Sum-Frequency Generation Vibrational Spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Kliewer, Christopher J. [Univ. of California, Berkeley, CA (United States)

2009-06-30

Sum frequency generation surface vibrational spectroscopy (SFG-VS) in combination with gas chromatography (GC) was used in-situ to monitor surface bound reaction intermediates and reaction selectivities for the hydrogenation reactions of pyrrole, furan, pyridine, acrolein, crotonaldehyde, and prenal over Pt(111), Pt(100), Rh(111), and platinum nanoparticles under Torr reactant pressures and temperatures of 300K to 450K. The focus of this work is the correlation between the SFG-VS observed surface bound reaction intermediates and adsorption modes with the reaction selectivity, and how this is affected by catalyst structure and temperature. Pyrrole hydrogenation was investigated over Pt(111) and Rh(111) single crystals at Torr pressures. It was found that pyrrole adsorbs to Pt(111) perpendicularly by cleaving the N-H bond and binding through the nitrogen. However, over Rh(111) pyrrole adsorbs in a tilted geometry binding through the {pi}-aromatic orbitals. A surface-bound pyrroline reaction intermediate was detected over both surfaces with SFG-VS. It was found that the ring-cracking product butylamine is a reaction poison over both surfaces studied. Furan hydrogenation was studied over Pt(111), Pt(100), 10 nm cubic platinum nanoparticles and 1 nm platinum nanoparticles. The product distribution was observed to be highly structure sensitive and the acquired SFG-VS spectra reflected this sensitivity. Pt(100) exhibited more ring-cracking to form butanol than Pt(111), while the nanoparticles yielded higher selectivities for the partially saturated ring dihydrofuran. Pyridine hydrogenation was investigated over Pt(111) and Pt(100). The α-pyridyl surface adsorption mode was observed with SFG-VS over both surfaces. 1,4-dihydropyridine was seen as a surface intermediate over Pt(100) but not Pt(111). Upon heating the surfaces to 350K, the adsorbed pyridine changes to a flat-lying adsorption mode. No evidence was found for the pyridinium cation. The hydrogenation of the �

A novel SFG structure for C-T high-pass filters

DEFF Research Database (Denmark)

Nielsen, Ivan Riis

1993-01-01

A signal flow graph (SFG) structure for simulating passive high-pass ladder filters, called the incremental integration structure, is proposed. The structure requires the use of integrators with nonintegrating inputs, and an implementation based on the MOSFET-C technique is discussed. The increme......A signal flow graph (SFG) structure for simulating passive high-pass ladder filters, called the incremental integration structure, is proposed. The structure requires the use of integrators with nonintegrating inputs, and an implementation based on the MOSFET-C technique is discussed....... The incremental integration structure is compared to the leapfrog and direct SFG simulation structures. Leapfrog high-pass filters are relatively simple and show good noise properties, but they are based on differentiators and thus stability problems exist. The direct SFG simulation method is based on integrators...... and has good stability properties, but it leads to a relatively high circuit complexity and a high noise level. However, the incremental integration structure inherits the low-noise properties of the leapfrog structure and the good stability of the direct SFG simulation method. A sixth-order elliptic high...

In Situ and Real-Time SFG Measurements Revealing Organization and Transport of Cholesterol Analogue 6-Ketocholestanol in a Cell Membrane.

Science.gov (United States)

Ma, Sulan; Li, Hongchun; Tian, Kangzhen; Ye, Shuji; Luo, Yi

2014-02-06

Cholesterol organization and transport within a cell membrane are essential for human health and many cellular functions yet remain elusive so far. Using cholesterol analogue 6-ketocholestanol (6-KC) as a model, we have successfully exploited sum frequency generation vibrational spectroscopy (SFG-VS) to track the organization and transport of cholesterol in a membrane by combining achiral-sensitive ssp (ppp) and chiral-sensitive psp polarization measurements. It is found that 6-KC molecules are aligned at the outer leaflet of the DMPC lipid bilayer with a tilt angle of about 10°. 6-KC organizes itself by forming an α-β structure at low 6-KC concentration and most likely a β-β structure at high 6-KC concentration. Among all proposed models, our results favor the so-called umbrella model with formation of a 6-KC cluster. Moreover, we have found that the long anticipated flip-flop motion of 6-KC in the membrane takes time to occur, at least much longer than previously thought. All of these interesting findings indicate that it is critical to explore in situ, real-time, and label-free methodologies to obtain a precise molecular description of cholesterol's behavior in membranes. This study represents the first application of SFG to reveal the cholesterol-lipid interaction mechanism at the molecular level.

Nonlinear vibrational spectroscopy of surfactants at liquid interfaces

Energy Technology Data Exchange (ETDEWEB)

Miranda, Paulo B. [Univ. of California, Berkeley, CA (United States)

1998-12-14

Surfactants are widely used to modify physical and chemical properties of interfaces. They play an important role in many technological problems. Surfactant monolayer are also of great scientific interest because they are two-dimensional systems that may exhibit a very rich phase transition behavior and can also be considered as a model system for biological interfaces. In this Thesis, we use a second-order nonlinear optical technique (Sum-Frequency Generation - SFG) to obtain vibrational spectra of surfactant monolayer at Iiquidhapor and solid/liquid interfaces. The technique has several advantages: it is intrinsically surface-specific, can be applied to buried interfaces, has submonolayer sensitivity and is remarkably sensitive to the confirmational order of surfactant monolayers.

Surface and buried interfacial structures of epoxy resins used as underfills studied by sum frequency generation vibrational spectroscopy.

Science.gov (United States)

Vázquez, Anne V; Holden, Brad; Kristalyn, Cornelius; Fuller, Mike; Wilkerson, Brett; Chen, Zhan

2011-05-01

Flip chip technology has greatly improved the performance of semiconductor devices, but relies heavily on the performance of epoxy underfill adhesives. Because epoxy underfills are cured in situ in flip chip semiconductor devices, understanding their surface and interfacial structures is critical for understanding their adhesion to various substrates. Here, sum frequency generation (SFG) vibrational spectroscopy was used to study surface and buried interfacial structures of two model epoxy resins used as underfills in flip chip devices, bisphenol A digylcidyl ether (BADGE) and 1,4-butanediol diglycidyl ether (BDDGE). The surface structures of these epoxies were compared before and after cure, and the orientations of their surface functional groups were deduced to understand how surface structural changes during cure may affect adhesion properties. Further, the effect of moisture exposure, a known cause of adhesion failure, on surface structures was studied. It was found that the BADGE surface significantly restructured upon moisture exposure while the BDDGE surface did not, showing that BADGE adhesives may be more prone to moisture-induced delamination. Lastly, although surface structure can give some insight into adhesion, buried interfacial structures more directly correspond to adhesion properties of polymers. SFG was used to study buried interfaces between deuterated polystyrene (d-PS) and the epoxies before and after moisture exposure. It was shown that moisture exposure acted to disorder the buried interfaces, most likely due to swelling. These results correlated with lap shear adhesion testing showing a decrease in adhesion strength after moisture exposure. The presented work showed that surface and interfacial structures can be correlated to adhesive strength and may be helpful in understanding and designing optimized epoxy underfill adhesives.

Chemische Reaktionen auf Oberflächen - eine SFG Studie

OpenAIRE

Kirsch, Harald

2014-01-01

This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...

5.5 W of Diffraction-Limited Green Light Generated by SFG of Tapered Diode Lasers in a Cascade of Nonlinear Crystals

DEFF Research Database (Denmark)

Hansen, Anders Kragh; Jensen, Ole Bjarlin; Andersen, Peter Eskil

2015-01-01

Diode-based high power visible lasers are perfect pump sources for, e.g., titaniumsapphire lasers. The combination of favorable scaling laws in both SFG and cascading of nonlinear crystals allows access to unprecedented powers in diode-based systems.......Diode-based high power visible lasers are perfect pump sources for, e.g., titaniumsapphire lasers. The combination of favorable scaling laws in both SFG and cascading of nonlinear crystals allows access to unprecedented powers in diode-based systems....

A Novel SFG Structure for C-T Highpass Filters

DEFF Research Database (Denmark)

Nielsen, Ivan Riis

1992-01-01

This paper presents the design of a sixth order elliptic highpass filter having a passband frequency of 3.0KHz, a passband ripple of 1.0dB and a stopband attenuation of 50dB. The filter is based on a novel integrator based SFG describing a passive prototype filter; this SFG is simulated using...

Synthesis and characterization of aromatic self-assembled monolayers containing methylene and ethyleneglycol entities by means of sum-frequency generation spectroscopy

International Nuclear Information System (INIS)

Dreesen, L.; Sartenaer, Y.; Peremans, A.; Thiry, P.A.; Humbert, C.; Grugier, J.; Marchand-Brynaert, J.

2006-01-01

We use infrared-visible sum-frequency generation (SFG) spectroscopy in order to investigate the adsorption properties on Pt(111) of molecules having CH 3 -C 6 H 4 -(O-CH 2 -CH 2 ) n -O-(CH 2 ) m -SH as general chemical formula. We synthesized three molecules defined by the values m = 5 n = 4, m = 11 n = 4, m = 11 n = 8 and characterized them by Nuclear Magnetic Resonance spectroscopy. Thanks to spectroscopic measurements, we show that these molecules build self-assembled monolayers on Pt(111). First, the weak SFG signals arising from the ad-layer indicate low order and surface coverage of the substrate by these molecules. Next, the vibrational fingerprints of the aforementioned molecules are determined between 2825 and 3125 cm - 1 and the observed SFG spectral features are ascribed on the basis of the analysis of shorter and simpler molecules (1-dodecanethiol, 4-methylbenzenethiol and CH 3 -C 6 H 4 -O-(CH 2 ) 11 -SH) also adsorbed on Pt(111). The occurrence of methylene vibration modes indicates a significant amount of chain defects whatever the n and m numbers are. Finally, the identification of a particular vibration mode, characteristic of the aromatic ring, enables us to qualitatively discuss the effect of the number of methylene and ethylene glycol entities on its orientation. More precisely, higher these numbers, more tilted (with respect to the substrate normal) the aromatic ring plane is

Anti-vibration bars for nuclear steam generators

International Nuclear Information System (INIS)

Gowda, B.V.; Wilson, R.M.; Wepfer, R.M.

1986-01-01

A method of installing tubular anti-vibration bars into a tube bundle of a steam generator wherein the tube bundle comprises rows of tubes, with the anti-vibration bars received between adjacent rows of the tube bundle for stabilizing the tubes against vibration. The anti-vibration bars are first inserted between adjacent rows of the tube bundle and a pressurized fluid is then introduced into the anti-vibration bars which are thus expanded into contact with the tubes of the adjacent rows for support

Experimental and theoretical evidence for bilayer-by-bilayer surface melting of crystalline ice

DEFF Research Database (Denmark)

Sánchez, M. Alejandra; Kling, Tanja; Ishiyama, Tatsuya

2017-01-01

, and its nature, we investigate the surface melting of hexagonal ice by combining noncontact, surfacespecific vibrational sum frequency generation (SFG) spectroscopy and spectra calculated from molecular dynamics simulations. Using SFG, we probe the outermost water layers of distinct single crystalline ice...

Sum frequency generation spectroscopy of tetraalkylphosphonium ionic liquids at the air-liquid interface

Science.gov (United States)

Peñalber-Johnstone, Chariz; Adamová, Gabriela; Plechkova, Natalia V.; Bahrami, Maryam; Ghaed-Sharaf, Tahereh; Ghatee, Mohammad Hadi; Seddon, Kenneth R.; Baldelli, Steven

2018-05-01

Sum frequency generation (SFG) spectroscopy is a nonlinear vibrational spectroscopic technique used in the study of interfaces, due to its unique ability to distinguish surface molecules that have preferential ordering compared to the isotropic bulk. Here, a series of alkyltrioctylphosphonium chloride ionic liquids, systematically varied by cation structure, were characterized at the air-liquid interface by SFG. The effect on surface structure resulting from molecular variation (i.e., addition of cyano- and methoxy-functional groups) of the cation alkyl chain was investigated. SFG spectra in the C—H stretching region (2750-3100 cm-1) for [P8 8 8 n][Cl], where n = 4, 5, 8, 10, 12, or 14, showed characteristic changes as the alkyl chain length was increased. Spectral profiles for n = 4, 5, 8, or 10 appeared similar; however, when the fourth alkyl chain was sufficiently long (as in the case of n = 12 or n = 14), abrupt changes occurred in the spectra. Molecular dynamics (MD) simulation of a slab of each ionic liquid (with n = 8, 10, or 12) confirmed gauche defects, with enhancement for the long alkyl chain and an abrupt increase of gauche occurrence from n = 8 to n = 10. A comparison of the tilt angle distribution from the simulation and the SFG analysis show a broad distribution of angles. Using experimental SFG spectra in conjunction with MD simulations, a comprehensive molecular picture at the surface of this unique class of liquids is presented.

Scenario Focus Group Workshop Report (2nd SFG Meeting)

OpenAIRE

Water Futures and Solution Initiative, (WFaS)

2016-01-01

The Scenario Focus Group (SFG) is comprised of water policy and planning decision makers at the national and international level who collaborate within the Water Futures and Solutions Initiative, primarily by identifying key water management challenges, priorities, trends, options, and trade-offs within their regions and advising on where further systems analysis and investigation would be most helpful for understanding externalities and guiding planning decisions. The SFG guides the developm...

Characterization of the molecular structure and mechanical properties of polymer surfaces and protein/polymer interfaces by sum frequency generation vibrational spectroscopy and atomic force microscopy

Energy Technology Data Exchange (ETDEWEB)

Koffas, Telly Stelianos [Univ. of California, Berkeley, CA (United States)

2004-01-01

Sum frequency generation (SFG) vibrational spectroscopy, atomic force microscopy (AFM), and other complementary surface-sensitive techniques have been used to study the surface molecular structure and surface mechanical behavior of biologically-relevant polymer systems. SFG and AFM have emerged as powerful analytical tools to deduce structure/property relationships, in situ, for polymers at air, liquid and solid interfaces. The experiments described in this dissertation have been performed to understand how polymer surface properties are linked to polymer bulk composition, substrate hydrophobicity, changes in the ambient environment (e.g., humidity and temperature), or the adsorption of macromolecules. The correlation of spectroscopic and mechanical data by SFG and AFM can become a powerful methodology to study and engineer materials with tailored surface properties. The overarching theme of this research is the interrogation of systems of increasing structural complexity, which allows us to extend conclusions made on simpler model systems. We begin by systematically describing the surface molecular composition and mechanical properties of polymers, copolymers, and blends having simple linear architectures. Subsequent chapters focus on networked hydrogel materials used as soft contact lenses and the adsorption of protein and surfactant at the polymer/liquid interface. The power of SFG is immediately demonstrated in experiments which identify the chemical parameters that influence the molecular composition and ordering of a polymer chain's side groups at the polymer/air and polymer/liquid interfaces. In general, side groups with increasingly greater hydrophobic character will be more surface active in air. Larger side groups impose steric restrictions, thus they will tend to be more randomly ordered than smaller hydrophobic groups. If exposed to a hydrophilic environment, such as water, the polymer chain will attempt to orient more of its hydrophilic groups to

Dicty_cDB: SFG168 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available TAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAAXXXXXXXXXXAATGTCCANATTTCCATANATGTGT...>SFG168Z.Seq ----------AATGTCCANATTTCCATANATGTGTTNAAANACGTGGTGGTATNTTAAGN TGTGAATTTNANCCNCCAAGACAACCAAGATCCC...GTAAAATCAATTTGTAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAA----------AATGTCCANATTTCCATANATGTGTTNAA ANACGTGG

Capacitance-based frequency adjustment of micro piezoelectric vibration generator.

Science.gov (United States)

Mao, Xinhua; He, Qing; Li, Hong; Chu, Dongliang

2014-01-01

Micro piezoelectric vibration generator has a wide application in the field of microelectronics. Its natural frequency is unchanged after being manufactured. However, resonance cannot occur when the natural frequencies of a piezoelectric generator and the source of vibration frequency are not consistent. Output voltage of the piezoelectric generator will sharply decline. It cannot normally supply power for electronic devices. In order to make the natural frequency of the generator approach the frequency of vibration source, the capacitance FM technology is adopted in this paper. Different capacitance FM schemes are designed by different locations of the adjustment layer. The corresponding capacitance FM models have been established. Characteristic and effect of the capacitance FM have been simulated by the FM model. Experimental results show that the natural frequency of the generator could vary from 46.5 Hz to 42.4 Hz when the bypass capacitance value increases from 0 nF to 30 nF. The natural frequency of a piezoelectric vibration generator could be continuously adjusted by this method.

Capacitance-Based Frequency Adjustment of Micro Piezoelectric Vibration Generator

Directory of Open Access Journals (Sweden)

Xinhua Mao

2014-01-01

Full Text Available Micro piezoelectric vibration generator has a wide application in the field of microelectronics. Its natural frequency is unchanged after being manufactured. However, resonance cannot occur when the natural frequencies of a piezoelectric generator and the source of vibration frequency are not consistent. Output voltage of the piezoelectric generator will sharply decline. It cannot normally supply power for electronic devices. In order to make the natural frequency of the generator approach the frequency of vibration source, the capacitance FM technology is adopted in this paper. Different capacitance FM schemes are designed by different locations of the adjustment layer. The corresponding capacitance FM models have been established. Characteristic and effect of the capacitance FM have been simulated by the FM model. Experimental results show that the natural frequency of the generator could vary from 46.5 Hz to 42.4 Hz when the bypass capacitance value increases from 0 nF to 30 nF. The natural frequency of a piezoelectric vibration generator could be continuously adjusted by this method.

A Novel SFG Structure for C-T Highpass Filters

OpenAIRE

Nielsen, Ivan Riis

1992-01-01

This paper presents the design of a sixth order elliptic highpass filter having a passband frequency of 3.0KHz, a passband ripple of 1.0dB and a stopband attenuation of 50dB. The filter is based on a novel integrator based SFG describing a passive prototype filter; this SFG is simulated using MOSFET-C building blocks. The noise performance is considerably enhanced when compared to other highpass filter structures. Well within the stopband the output noise is dominated by amplifier noise, but ...

Alkyl chain interaction at the surface of room temperature ionic liquids: systematic variation of alkyl chain length (R = C(1)-C(4), C(8)) in both cation and anion of [RMIM][R-OSO(3)] by sum frequency generation and surface tension.

Science.gov (United States)

Santos, Cherry S; Baldelli, Steven

2009-01-29

The gas-liquid interface of halide-free 1,3-dialkylimidazolium alkyl sulfates [RMIM][R-OSO(3)] with R chain length from C(1)-C(4) and C(8) has been studied systematically using the surface-specific sum frequency generation (SFG) vibrational spectroscopy and surface tension measurements. From the SFG spectra, vibrational modes from the methyl group of both cation and anion are observed for all ionic liquid samples considered in the present study. These results suggest the presence of both ions at the gas-liquid interface, which is further supported by surface tension measurements. Surface tension data show a decreasing trend as the alkyl chain in the imidazolium cation is varied from methyl to butyl chain, with a specific anion. A similar trend is observed when the alkyl chain of the anion is modified and the cation is fixed.

A novel SFG structure for C-T high-pass filters

OpenAIRE

Nielsen, Ivan Riis

1993-01-01

A signal flow graph (SFG) structure for simulating passive high-pass ladder filters, called the incremental integration structure, is proposed. The structure requires the use of integrators with nonintegrating inputs, and an implementation based on the MOSFET-C technique is discussed. The incremental integration structure is compared to the leapfrog and direct SFG simulation structures. Leapfrog high-pass filters are relatively simple and show good noise properties, but they are based on diff...

Nonlinear spectroscopic studies of interfacial molecular ordering

International Nuclear Information System (INIS)

Superfine, R.

1991-07-01

The second order nonlinear optical processes of second harmonic generation and sum frequency generation are powerful new probes of surfaces. They possess unusual surface sensitivity due to the symmetry properties of the nonlinear susceptibility. In particular, infrared-visible sum frequency generation (SFG) can obtain the vibrational spectrum of sub-monolayer coverages of molecules. In this thesis, we explore the unique information that can be obtained from SFG. We take advantage of the sensitivity of SFG to the conformation of alkane chains to study the interaction between adsorbed liquid crystal molecules and surfactant treated surfaces. The sign of the SFG susceptibility depends on the sign of the molecular polarizability and the orientation, up or down, of the molecule. We experimentally determine the sign of the susceptibility and use it to determine the absolute orientation to obtain the sign of the molecular polarizability and show that this quantity contains important information about the dynamics of molecular charge distributions. Finally, we study the vibrational spectra and the molecular orientation at the pure liquid/vapor interface of methanol and water and present the most detailed evidence yet obtained for the structure of the pure water surface. 32 refs., 4 figs., 2 tabs

Seroprevalence of spotted fever group (SFG) rickettsiae infection in domestic ruminants in Khartoum State, Sudan.

Science.gov (United States)

Eisawi, Nagwa M; Hassan, Dina A; Hussien, Mohammed O; Musa, Azza B; El Hussein, Abdel Rahim M

2017-05-01

Spotted fever group (SFG) rickettsiosis is caused by obligatory intracellular Gram-negative bacteria that belong to the genus Rickettsia . Ticks belonging to the family Ixodidae can act as vectors, reservoirs or amplifiers of SFG rickettsiae. This study was conducted to estimate the seroprevalence of SFG rickettsioses in cattle, sheep and goats from Khartoum State, Sudan. Blood samples were collected from a total of 600 animals (sheep, goats and cattle) from 32 different farms distributed in three locations in Khartoum State during the period January to December 2012. Sera were tested for antibodies against SFG rickettsiae using IFAT. The prevalence of seropositivity was 59.3% in sheep, 60.1% in goats and 64.4% in cattle. Season was significantly ( P <  0.05) associated with seroprevalence of SFG rickettsiae in cattle during winter. The SFG rickettsiae antibodies prevalence was significantly higher in female compared with male in sheep, but there were no significant differences between male and female in either cattle or goats. The prevalence was significantly higher in adult animals compared with young in both sheep and goats. With regard to management system, there was a significant difference in the prevalence in cattle raised in closed system compared with those raised in semi-intensive system. In contrast, there was significant difference in the seroprevalence of SFG in sheep where the prevalence was higher in the sheep raised in semi-intensive system compared with those raised in close system. There was no significant difference in the seroprevalence in goats with regard to management systems. The unexpected high prevalence of SFG rickettsia antibodies in domestic ruminants sera suggest that the veterinary and public health impact of these agents in Sudan need further evaluation especially in humans.

Fueled viking generator S/N 106 acceptance vibration test report

International Nuclear Information System (INIS)

Anderson, C.; Brewer, C.O.; Abrahamson, S.G.

1976-01-01

The Viking Generator S/N 106 was vibrated to the Teledyne Isotope Flight Acceptance Schedule (Random Only) with no deviation from normal generator functional output. Radiographic analysis and power tests before and after the vibration test indicated no change in the condition of the generator. The work was conducted in the Alpha Fuels Environmental Test Facility at Mound Laboratory

Flow-induced vibration in LMFBR steam generators: a state-of-the-art review

International Nuclear Information System (INIS)

Shin, Y.S.; Wambsganss, M.W.

1975-05-01

This state-of-the-art review identifies and discusses existing methods of flow-induced vibration analysis applicable to steam generators, their limitations, and base-technology needs. Also included are discussions of five different LMFBR steam-generator configurations and important design considerations, failure experiences, possible flow-induced excitation mechanisms, vibration testing, and available methods of vibration analysis. The objectives are to aid LMFBR steam-generator designers in making the best possible evaluation of potential vibration in steam-generator internals, and to provide the basis for development of design guidelines to avoid detrimental flow-induced vibration

Effect of mechanical vibration generated in oscillating/vibratory ...

African Journals Online (AJOL)

Background: Whole body vibration (WBV) exercise has been used in health sciences. Authors have reported that changes on the concentration of plasma biomarkers could be associated with the WBV effects. The aim of this investigation is to assess the consequences of exposition of 25 Hz mechanical vibration generated ...

Adding a dimension to the infrared spectra of interfaces: 2D SFG spectroscopy via mid-IR pulse shaping

Science.gov (United States)

Zanni, Martin

2012-02-01

Sum-frequency generation spectroscopy provides an infrared spectrum of interfaces and thus has widespread use in the materials and chemical sciences. In this presentation, I will present our recent work in developing a 2D pulse sequence to generate 2D SFG spectra of interfaces, in analogy to 2D infrared spectra used to measure bulk species. To develop this spectroscopy, we have utilized many of the tricks-of-the-trade developed in the 2D IR and 2D Vis communities in the last decade, including mid-IR pulse shaping. With mid-IR pulse shaping, the 2D pulse sequence is manipulated by computer programming in the desired frequency resolution, rotating frame, and signal pathway. We believe that 2D SFG will become an important tool in the interfacial sciences in an analogous way that 2D IR is now being used in many disciplines.

Vibration analysis of a hydro generator for different operating regimes

Science.gov (United States)

Haţiegan, C.; Pădureanu, I.; Jurcu, M.; Nedeloni, M. D.; Hamat, C. O.; Chioncel, C. P.; Trocaru, S.; Vasile, O.; Bădescu, O.; Micliuc, D.; (Filip Nedeloni, L.; Băra, A.; (Barboni Haţiegan, L.

2017-01-01

Based on experimental measurements, this paper presents the vibration analysis of a hydro generator that equips a Kaplan hydraulic turbine of a Hydropower plant in Romania. This analysis means vibrations measurement to different operating regimes of the hydro generator respectively before installing it and into operation, namely putting off load mode (unexcited and excited) respectively putting on load mode. By comparing, through the experimental results obtained before and after the operation of hydro aggregates are observed vibrations improvements.

Two-phase flow induced vibrations in CANDU steam generators

International Nuclear Information System (INIS)

Gidi, A.

2009-01-01

The U-Bend region of nuclear steam generators tube bundles have suffered from two-phase cross flow induced vibrations. Tubes in this region have experienced high amplitude vibrations leading to catastrophic failures. Turbulent buffeting and fluid-elastic instability has been identified as the main causes. Previous investigations have focused on flow regime and two-phase flow damping ratio. However, tube bundles in steam generators have vapour generated on the surface of the tubes, which might affect the flow regime, void fraction distribution, turbulent intensity levels and tube-flow interaction, all of which have the potential to change the tube vibration response. A cantilevered tube bundle made of electric cartridges heaters was built and tested in a Freon-11 flow loop at McMaster University. Tubes were arranged in a parallel triangular configuration. The bundle was exposed to two-phase cross flows consisting of different combinations of void from two sources, void generated upstream of the bundle and void generated at the surface of the tubes. Tube tip vibration response was measured optically and void fraction was measured by gamma densitometry technique. It was found that tube vibration amplitude in the transverse direction was reduced by a factor of eight for void fraction generated at the tube surfaces only, when compared to the upstream only void generation case. The main explanation for this effect is a reduction in the correlation length of the turbulent buffeting forcing function. Theoretical calculations of the tube vibration response due to turbulent buffeting under the same experimental conditions predicted a similar reduction in tube amplitude. The void fraction for the fluid-elastic instability threshold in the presence of tube bundle void fraction generation was higher than that for the upstream void fraction generation case. The first explanation of this difference is the level of turbulent buffeting forces the tube bundle was exposed to

Theoretical and experimental study of vibration, generated by monorail trains

Science.gov (United States)

Rybak, Samuil A.; Makhortykh, Sergey A.; Kostarev, Stanislav A.

2002-11-01

Monorail transport as all other city transport vehicles is the source of high noise and vibration levels. It is less widespread than cars or underground transport but its influence in modern cities enhances. Now in Moscow the first monorail road with trains on tires is designed, therefore the problem of vibration and noise assessments and prediction of its impact on the residential region appears. To assess the levels of generated vibration a physical model of interaction in the system wagon-tire-road coating-viaduct-soil has been proposed and then numerically analyzed. The model is based on the known from publications facts of automobile transport vibration and our own practice concerning underground trains vibration generation. To verify computer simulation results and adjust model parameters the series of measurements of noise and vibration near experimental monorail road was carried out. In the report the results of calculations and measurements will be presented and some outcomes of possible acoustical ecologic situation near monorail roads will be proposed.

Simulation Study on Material Property of Cantilever Piezoelectric Vibration Generator

Directory of Open Access Journals (Sweden)

Yan Zhen

2014-06-01

Full Text Available For increasing generating capacity of cantilever piezoelectric vibration generator with limited volume, relation between output voltage, inherent frequency and material parameter of unimorph, bimorph in series type and bimorph in parallel type piezoelectric vibration generator is analyzed respectively by mechanical model and finite element modeling. The results indicate PZT-4, PZT- 5A and PZT-5H piezoelectric materials and stainless steel, nickel alloy substrate material should be firstly chosen.

All-optical 40Gbit/s format conversion from NRZ to RZ based on SFG in a PPLN waveguide

Science.gov (United States)

Wang, Jian; Sun, Junqiang

2006-01-01

A novel all-optical 40Gbit/s NRZ-to-RZ data format conversion scheme based on sum-frequency generation (SFG) interaction in a periodically poled LiNbO 3 (PPLN) waveguide is presented for the first time, using a Mach-Zehnder interferometer (MZI). The conversion mechanism relies on the combination of attenuation and nonlinear phase shift Φ NL induced on the signal field. The performance of the conversion is numerically evaluated, with the result showing that it is more effective to yield Φ NL when appropriately phase mismatched for SFG process but Φ NL~0 when quasi-phase-matching (QPM). Compared with the cascaded second-order nonlinear interactions (SHG+DFG) with the influence of walk-off effect, a high conversion efficiency and good performance are achieved with peak power 500mw and width 2ps of the pump, which can be used in super high-speed situation (40Gbit/s and above). Finally, the inverse process of SFG and corresponding walk-off effect are analyzed and the optimum arrangement of power is proposed, showing that proper power, pump width, and waveguide length are necessary for achieving a satisfied conversion effect.

Substantiation of vibration strength of nuclear reactor and steam generator internals. Main problems

International Nuclear Information System (INIS)

Fyodorov, V.G.; Sinyavasky, V.F.

1977-01-01

The report details the scope and priority of studies necessary for substantiation of vibration strength of steam generator tube bundles and reactor fuel assemblies, and design modifications helping to reduce flow-induced vibration of the internals specified. Steam generator tube bundles are studied on the basis of a standard establishing vibration requirements at various stages of design, manufacture and operation of a steam generator at a nuclear power station. The main vibration characteristics of tubes obtained through model and full-scale tests are compared with calculation results. Results are provided concerning test-stand vibration tests of fuel elements and fuel assemblies. (author)

Diagnosis of excessive vibration signals of two-pole generator rotors in balancing

International Nuclear Information System (INIS)

Park, Jong Po

2000-01-01

Cause of excessive vibration with twice the rotational speed of a two-pole generator rotor for the fossil power plants was investigated. The two-pole generator rotor, treated as a typically asymmetric rotor in vibration analysis, produces asynchronous vibration with twice the rotational speed, sub-harmonic critical speeds, and potentially unstable operating zones due to its own inertia and/or stiffness asymmetry. This paper introduces a practical balancing procedure, and presents the results of the investigation on sources of the excessive vibration based on the experimental vibration data of the asymmetric two-pole rotor in balancing

Torsional vibration analysis in turbo-generator shaft due to mal-synchronization fault

Science.gov (United States)

Bangunde, Abhishek; Kumar, Tarun; Kumar, Rajeev; Jain, S. C.

2018-03-01

A rotor of turbo-generator shafting is many times subjected to torsional vibrations during its lifespan. The reasons behind these vibrations are three-Phase fault, two-phase fault, line to ground fault, faulty-mal synchronization etc. Sometimes these vibrations can cause complete failure of turbo-generator shafting system. To calculate moment variation during these faults on the shafting system vibration analysis is done using Finite Elements Methods to calculate mass and stiffness matrix. The electrical disturbance caused during Mal-synchronization is put on generator section, and corresponding second order equations are solved by using “Duhamel Integral”. From the moment variation plots at four sections critically loaded sections are identified.

Conformational order of n-dodecanethiol and n-dodecaneselenol monolayers on polycrystalline copper investigated by PM-IRRAS and SFG spectroscopy

Science.gov (United States)

Fonder, G.; Cecchet, F.; Peremans, A.; Thiry, P. A.; Delhalle, J.; Mekhalif, Z.

2009-08-01

Self-assembled monolayers (SAMs) of n-dodecanethiol (C 12H 25SH) and n-dodecaneselenol (C 12H 25SeH) on polycrystalline copper have been elaborated with the purpose of achieving densely packed and crystalline-like assemblies. By combining the surface sensitivity of polarization modulation infrared reflection absorption spectroscopy (PM-IRRAS) and sum-frequency generation spectroscopy (SFG), the effect of the self-assembly time (15 min, 30 min, 1 h, 2 h and 24 h) on the formation of n-dodecanethiol and n-dodecaneselenol monolayers on untreated and electrochemically reduced polycrystalline copper has been investigated. On electrochemically reduced copper, PM-IRRAS spectroscopy shows that both molecules are able to form well organized layers. SFG spectroscopy indicates that the C 12H 25SeH SAMs are slightly better ordered than those achieved with C 12H 25SH. On untreated copper, the two molecules lead to different film organizations. Both PM-IRRAS and SFG indicate that C 12H 25SH SAMs are of the same film quality as those obtained on electrochemically reduced copper. On the contrary, C 12H 25SeH monolayers are invariably poorly organized at the molecular level.

CO dissociation and CO hydrogenation on smooth and ion-bombarded Pd(1 1 1): SFG and XPS spectroscopy at mbar pressures

Science.gov (United States)

Rupprechter, G.; Kaichev, V. V.; Unterhalt, H.; Morkel, M.; Bukhtiyarov, V. I.

2004-07-01

The CO dissociation probability on transition metals is often invoked to explain the product distribution (selectivity) of catalytic CO hydrogenation. Along these lines, we have investigated CO adsorption and dissociation on smooth and ion-bombarded Pd(1 1 1) at pressures up to 1 mbar using vibrational sum frequency generation (SFG) and X-ray photoelectron spectroscopy (XPS). Under high pressure, CO adsorbate structures were observed that were identical to high-coverage structures in UHV. On ion-bombarded surfaces an additional species was detected which was attributed to CO bridge bonded to defect (low-coordinated) sites. On both surfaces, no indications of CO dissociation were found even after hours of 0.1 mbar CO exposure. However, exposing CO/H 2 mixtures to ion-bombarded Pd(1 1 1) produced carbonaceous deposits suggesting CH xO species as precursors for CO bond cleavage and that the formation of CH xO is facilitated by surface defects. The relevance of the observations for CO hydrogenation on Pd catalysts is discussed.

CO dissociation and CO hydrogenation on smooth and ion-bombarded Pd(1 1 1): SFG and XPS spectroscopy at mbar pressures

Energy Technology Data Exchange (ETDEWEB)

Rupprechter, G.; Kaichev, V.V.; Unterhalt, H.; Morkel, M.; Bukhtiyarov, V.I

2004-07-31

The CO dissociation probability on transition metals is often invoked to explain the product distribution (selectivity) of catalytic CO hydrogenation. Along these lines, we have investigated CO adsorption and dissociation on smooth and ion-bombarded Pd(1 1 1) at pressures up to 1 mbar using vibrational sum frequency generation (SFG) and X-ray photoelectron spectroscopy (XPS). Under high pressure, CO adsorbate structures were observed that were identical to high-coverage structures in UHV. On ion-bombarded surfaces an additional species was detected which was attributed to CO bridge bonded to defect (low-coordinated) sites. On both surfaces, no indications of CO dissociation were found even after hours of 0.1 mbar CO exposure. However, exposing CO/H{sub 2} mixtures to ion-bombarded Pd(1 1 1) produced carbonaceous deposits suggesting CH{sub x}O species as precursors for C---O bond cleavage and that the formation of CH{sub x}O is facilitated by surface defects. The relevance of the observations for CO hydrogenation on Pd catalysts is discussed.

Analysis of tube vibrations in D-4 steam generator

International Nuclear Information System (INIS)

Mavko, B.; Peterlin, G.; Boltezar, M.

1983-01-01

Accelerometer data for the most exposed tube in steam generator D-4 were recorded on magnetic tape. Procedures for calculations of the most characteristic parameters were prepared for spectral analyzer on SD 360. Parameters which most satisfactorily describe the vibrations are power spectral densities peak to peak acceleration volume and root mean square displacement. Computer program was written to calculate the natural frequencies of a multispaned tube. Procedures and the computer program will be used for independent analysis of tube vibrations in Krsko D-4 type steam generator. (author)

High-precision and low-cost vibration generator for low-frequency calibration system

Science.gov (United States)

Li, Rui-Jun; Lei, Ying-Jun; Zhang, Lian-Sheng; Chang, Zhen-Xin; Fan, Kuang-Chao; Cheng, Zhen-Ying; Hu, Peng-Hao

2018-03-01

Low-frequency vibration is one of the harmful factors that affect the accuracy of micro-/nano-measuring machines because its amplitude is significantly small and it is very difficult to avoid. In this paper, a low-cost and high-precision vibration generator was developed to calibrate an optical accelerometer, which is self-designed to detect low-frequency vibration. A piezoelectric actuator is used as vibration exciter, a leaf spring made of beryllium copper is used as an elastic component, and a high-resolution, low-thermal-drift eddy current sensor is applied to investigate the vibrator’s performance. Experimental results demonstrate that the vibration generator can achieve steady output displacement with frequency range from 0.6 Hz to 50 Hz, an analytical displacement resolution of 3.1 nm and an acceleration range from 3.72 mm s-2 to 1935.41 mm s-2 with a relative standard deviation less than 1.79%. The effectiveness of the high-precision and low-cost vibration generator was verified by calibrating our optical accelerometer.

Experimental demonstration of wavelength conversion between ps-pulses based on cascaded sum- and difference frequency generation (SFG+DFG) in LiNbO3 waveguides

Science.gov (United States)

Wang, Jian; Sun, Junqiang; Lou, Chuanhong; Sun, Qizhen

2005-09-01

All-optical wavelength conversion between ps-pulses based on cascaded sum- and difference frequency generation (SFG+DFG) is proposed and experimentally demonstrated in periodically poled LiNbO3 (PPLN) waveguides. The signal pulse with 40-GHz repetition rate and 1.57- ps pulse width is adopted. The converted idler wavelength can be tuned from 1527.4 to 1540.5nm as the signal wavelength is varied from 1561.9 to 1548.4nm. No obvious changes of the pulse shape and width, also no chirp are observed in the converted idler pulse. The results imply that single-to-multiple channel wavelength conversions can be achieved by appropriately tuning the two pump wavelengths.

Nonlinear spectroscopic studies of chiral media

International Nuclear Information System (INIS)

Belkin, Mikhail Alexandrovich

2004-01-01

Molecular chirality plays an important role in chemistry, biology, and medicine. Traditional optical techniques for probing chirality, such as circular dichroism and Raman optical activity rely on electric-dipole forbidden transitions. As a result, their intrinsic low sensitivity limits their use to probe bulk chirality rather than chiral surfaces, monolayers or thin films often important for chemical or biological systems. Contrary to the traditional chirality probes, chiral signal in sum-frequency generation (SFG) is electric-dipole allowed both on chiral surface and in chiral bulk making it a much more promising tool for probing molecular chirality. SFG from a chiral medium was first proposed in 1965, but had never been experimentally confirmed until this thesis work was performed. This thesis describes a set of experiments successfully demonstrating that chiral SFG responses from chiral monolayers and liquids are observable. It shows that, with tunable inputs, SFG can be used as a sensitive spectroscopic tool to probe chirality in both electronic and vibrational resonances of chiral molecules. The monolayer sensitivity is feasible in both cases. It also discusses the relevant theoretical models explaining the origin and the strength of the chiral signal in vibrational and electronic SFG spectroscopies

Broader energy distribution of CO adsorbed at polycrystalline Pt electrode in comparison with that at Pt(111) electrode in H_2SO_4 solution confirmed by potential dependent IR/visible double resonance sum frequency generation spectroscopy

International Nuclear Information System (INIS)

Yang, Shuo; Noguchi, Hidenori; Uosaki, Kohei

2017-01-01

Highlights: • Electrochemical SFG spectroscopy is an efficient in situ probe of electronic structure at electrochemical interface. • Electrooxidation performances of CO adsorbed on polycrystalline Pt and Pt(111) electrodes were compared. • The enhanced SFG signal of CO on Pt electrodes was observed due to a vibrational-electronic double resonance effect. • The broader energy distribution of 5sa state of CO on polycrystalline Pt than on Pt(111) is proved by SFG results. - Abstract: Electrochemical cyclic voltammetry and potential dependent double resonance sum frequency generation (DR-SFG) spectroscopy were performed on CO adsorbed on polycrystalline Pt and Pt(111) electrodes in H_2SO_4 solution to examine the effect of substrate on the electronic structure of CO. The dependence of SFG intensity on potential and visible energy for atop CO band was observed on both polycrystalline and single crystalline Pt electrodes. Enhancement of the SFG intensity was determined to be a direct result of a surface electronic resonance of the visible/SF light with the electronic transition from Fermi level of Pt to the 5σ_a anti-bonding state of adsorbed CO, in agreement with previous results. Interestingly, when compared to the Pt(111) electrode, the distribution width of the intensity enhancement region on polycrystalline Pt is broader than on Pt(111). This suggests that the energy distribution of the 5σ_a state of CO on polycrystalline Pt surface is broader than that on Pt(111) due to the complex surface structure of the polycrystalline Pt electrode.

ACO-Initialized Wavelet Neural Network for Vibration Fault Diagnosis of Hydroturbine Generating Unit

Directory of Open Access Journals (Sweden)

Zhihuai Xiao

2015-01-01

Full Text Available Considering the drawbacks of traditional wavelet neural network, such as low convergence speed and high sensitivity to initial parameters, an ant colony optimization- (ACO- initialized wavelet neural network is proposed in this paper for vibration fault diagnosis of a hydroturbine generating unit. In this method, parameters of the wavelet neural network are initialized by the ACO algorithm, and then the wavelet neural network is trained by the gradient descent algorithm. Amplitudes of the frequency components of the hydroturbine generating unit vibration signals are used as feature vectors for wavelet neural network training to realize mapping relationship from vibration features to fault types. A real vibration fault diagnosis case result of a hydroturbine generating unit shows that the proposed method has faster convergence speed and stronger generalization ability than the traditional wavelet neural network and ACO wavelet neural network. Thus it can provide an effective solution for online vibration fault diagnosis of a hydroturbine generating unit.

Resolution of torsional vibration issue for large turbine generators

International Nuclear Information System (INIS)

Evans, D.G.; Giesecke, H.D.; Willman, E.C.; Moffitt, S.P.

1995-01-01

The excitation of turbine generator torsional natural frequencies in the region near 120 Hz by electrical transients in the power system has resulted in blade failures for several large 1,800 rpm nuclear turbines. At Cleveland Electric's Perry Nuclear Power plant a combination of advanced measurement techniques and analyses were used to identify and resolve a potential torsional vibration problem without adverse impact on the plant availability. The Perry turbine generator consists of a high pressure turbine, three low pressure turbines with 43 inch last stage blades, and a 1,250 MWe four pole generator operating at 1,800 rpm. Torsional vibration measurements obtained from random vibration during operation were acquired just prior to the 1994 refueling outage. The measurements indicated that the 26th torsional mode of vibration was just under 120 Hz and within the range of frequencies for which the manufacturer recommends modifying the unit to shift the problem torsional natural frequency. Extensive analytical modeling was used to design a modification to shift the torsional natural frequencies away from 120 Hertz and the modification was implemented during the refueling outage without affecting outage critical path. An off-line ramp test and additional on-line monitoring performed at the conclusion of the outage confirmed that the on-line method provided accurate measurements of the torsional natural frequencies and demonstrated that, with the modification, the torsional natural frequencies were sufficiently removed from 120 Hertz to allow turbine generator operation. The modification, which involved brazing of the tie wires on all last stage blades, also significantly reduces the stress on the last stage blades that result from negative sequence currents, further increasing the operating margin of the turbine generator with respect to electrical transients and faults

Vibration power generator for a linear MR damper

International Nuclear Information System (INIS)

Sapiński, Bogdan

2010-01-01

The paper describes the structure and the results of numerical calculations and experimental tests of a newly developed vibration power generator for a linear magnetorheological (MR) damper. The generator consists of permanent magnets and coil with foil winding. The device produces electrical energy according to Faraday's law of electromagnetic induction. This energy is applied to vary the damping characteristics of the MR damper attached to the generator by the input current produced by the device. The objective of the numerical calculations was to determine the magnetic field distribution in the generator as well as the electric potential and current density in the generator's coil during the idle run and under the load applied to the MR damper control coil. The results of the calculations were used during the design and manufacturing stages of the device. The objective of the experimental tests carried out on a dynamic testing machine was to evaluate the generator's efficiency and to compare the experimental and predicted data. The experimental results demonstrate that the engineered device enables a change in the kinetic energy of the reciprocal motion of the MR damper which leads to variations in the damping characteristics. That is why the generator may be used to build up MR damper based vibration control systems which require no external power

Anti-vibration bars for nuclear steam generators

International Nuclear Information System (INIS)

Gowda, B.V.; Wilson, R.M.; Wepfer, R.M.

1988-01-01

This patent describes anti-vibrations bars structurally supporting tubes carrying high-temperature coolant in a steam generator, the antivibration bars being disposed between adjacent rows of tubes and expanded from a rest state to an expanded state as pressure is applied to the interior of the anti-vibration bars, each of the anti-vibration bars being configured as a hollow member of a rectangular shape. The rectangular shape comprising a pair of opposing wall lengths and a pair of opposing wall widths, each of the wall lengths have a thickness greater than that of the wall widths to facilitate expansion of the opposing wall lengths away from each other and into contact respectively with tubes of adjacent rows, the wall lengths having sufficient rigidity to resist deformation as the bars are expanded to their expanded state so that the wall lengths make a line contact with their respective tubes

Deactivation of Pd particles supported on Nb 2O 5/Cu 3Au(1 0 0): SFG and TPD studies from UHV to 100 mbar

Science.gov (United States)

Höbel, Frank; Bandara, Athula; Rupprechter, Günther; Freund, Hans-Joachim

2006-02-01

Structural changes that occur on Pd-Nb 2O 5/Cu 3Au(1 0 0) model catalysts upon thermal annealing were followed by sum frequency generation (SFG) and temperature-programmed desorption (TPD) using CO as probe molecule. SFG experiments were performed both under ultrahigh vacuum and mbar pressure. Heating the catalyst to temperatures above 300 K lead to an irreversible 50% decrease in the CO adsorption capacity and modified the remaining adsorption sites. Alterations of the phase between resonant and non-resonant SFG signals upon annealing indicate a change in the electronic structure of the surface, which excludes Pd sintering or migration of Nb 2O 5 over Pd particles to cause the observed effect and rather suggests the formation of "mixed Pd-NbO x" sites. The same changes in surface properties also occur during CO hydrogenation at 1 bar and high temperature, pointing to an involvement of "mixed Pd-NbO x" sites in catalytic reactions.

Vibrations measurement at the Embalse nuclear power plant's electrical generator

International Nuclear Information System (INIS)

Salomoni, R.C.; Belinco, C.G.; Pastorini, A.J.; Sacchi, M.A.

1987-01-01

After the modifications made at the Embalse nuclear power plant's electrical generator to reduce its vibration level produced by electromagnetic phenomena, it was necessary to perform measurements at the new levels, under different areas and power conditions. To this purpose, a work was performed jointly with the 'Vibrations Team' of the ANSALDO Company (the generator constructor) and the Hydrodynamic Assays Division under the coordination and supervision of the plant's electrical maintenance responsible. This paper includes the main results obtained and the instrumentation criteria and analysis performed. (Author)

Single-frequency blue light generation by single-pass sum-frequency generation in a coupled ring cavity tapered laser

DEFF Research Database (Denmark)

Jensen, Ole Bjarlin; Petersen, Paul Michael

2013-01-01

A generic approach for generation of tunable single frequency light is presented. 340 mW of near diffraction limited, single-frequency, and tunable blue light around 459 nm is generated by sum-frequency generation (SFG) between two tunable tapered diode lasers. One diode laser is operated in a ring...... cavity and another tapered diode laser is single-passed through a nonlinear crystal which is contained in the coupled ring cavity. Using this method, the single-pass conversion efficiency is more than 25%. In contrast to SFG in an external cavity, the system is entirely self-stabilized with no electronic...

Vibration Spectrum Analysis for Indicating Damage on Turbine and Steam Generator Amurang Unit 1

Directory of Open Access Journals (Sweden)

Beny Cahyono

2017-12-01

Full Text Available Maintenance on machines is a mandatory asset management activity to maintain asset reliability in order to reduce losses due to failure. 89% of defects have random failure mode, the proper maintenance method is predictive maintenance. Predictive maintenance object in this research is Steam Generator Amurang Unit 1, which is predictive maintenance is done through condition monitoring in the form of vibration analysis. The conducting vibration analysis on Amurang Unit 1 Steam Generator is because vibration analysis is very effective on rotating objects. Vibration analysis is predicting the damage based on the vibration spectrum, where the vibration spectrum is the result of separating time-based vibrations and simplifying them into vibrations based on their frequency domain. The transformation of time-domain-wave into frequency-domain-wave is using the application of FFT, namely AMS Machinery. The measurement of vibration value is done on turbine bearings and steam generator of Unit 1 Amurang using Turbine Supervisory Instrument and CSI 2600 instrument. The result of this research indicates that vibration spectrum from Unit 1 Amurang Power Plant indicating that there is rotating looseness, even though the vibration value does not require the Unit 1 Amurang Power Plant to stop operating (shut down. This rotating looseness, at some point, can produce some indications that similar with the unbalance. In order to avoid more severe vibrations, it is necessary to do inspection on the bearings in the Amurang Unit 1 Power Plant.

Vibration Analysis for Steam Dryer of APR1400 Steam Generator

Energy Technology Data Exchange (ETDEWEB)

Han, Sung-heum; Ko, Doyoung [KHNP CRI, Daejeon (Korea, Republic of); Cho, Minki [Doosan Heavy Industry, Changwon (Korea, Republic of)

2016-10-15

This paper is related to comprehensive vibration assessment program for APR1400 steam generator internals. According to U.S. Nuclear Regulatory Commission, Regulatory Guide 1.20 (Rev.3, March 2007), we conducted vibration analysis for a steam dryer as the second steam separator of steam generator internals. The vibration analysis was performed at the 100 % power operating condition as the normal operation condition. The random hydraulic loads were calculated by the computational fluid dynamics and the structural responses were predicted by power spectral density analysis for the probabilistic method. In order to meet the recently revised U.S. NRC RG 1.20 Rev.3, the CVAP against the potential adverse flow effects in APR1400 SG internals should be performed. This study conducted the vibration response analysis for the SG steam dryer as the second moisture separator at the 100% power condition, and evaluated the structural integrity. The predicted alternating stress intensities were evaluated to have more than 17.78 times fatigue margin compared to the endurance limit.

Sodium ferric gluconate (SFG) in complex with sucrose for IV infusion: bioequivalence of a new generic product with the branded product in healthy volunteers.

Science.gov (United States)

Baribeault, David

2011-08-01

Parenteral sodium ferric gluconate in complex (Ferrlecit [branded SFG]) is used to treat patients with iron deficiency anemia undergoing chronic hemodialysis and receiving supplemental epoetin. This comparative pharmacokinetic study (GeneraMedix, Inc., Study 17909) evaluates whether the recently approved generic product Nulecit (generic SFG) and the branded product Ferrlecit (branded SFG) are bioequivalent. In this open-label study, 240 healthy volunteers in a fasting state were assigned randomly to a single 10-min intravenous (IV) infusion of 125 mg of generic or branded SFG. Total and transferrin-bound iron concentrations were determined for the 36-h period after infusion and corrected for pretreatment levels. Maximum concentration (Cmax) and area under the concentration-time curve of 0 to 36 h (AUC[0-36]) were compared between the two products. Demonstration of bioequivalence required that the 90% confidence intervals of each parameter evaluated for generic SFG were within 80% to 125% of the corresponding values for branded SFG. Uncorrected and baseline-corrected mean serum concentrations of total serum iron during the 36-h assessment period were similar for generic and branded SFG. For total serum iron, the geometric mean ratios of corrected Cmax and AUC[0-36] were 100%. For transferrin-bound iron, the geometric mean ratios were 87% for corrected Cmax and 92% for corrected AUC[0-36]. All associated 90% confidence intervals were within the range of 80% to 125%. A new generic SFG in complex for IV infusion is bioequivalent to the branded SFG in complex for IV infusion. The generic SFG is AB rated by the FDA and considered therapeutically equivalent to the branded product.

Non-linear optical studies of adsorbates: Spectroscopy and dynamics

Energy Technology Data Exchange (ETDEWEB)

Zhu, Xiangdong.

1989-08-01

In the first part of this thesis, we have established a systematic procedure to apply the surface optical second-harmonic generation (SHG) technique to study surface dynamics of adsorbates. In particular, we have developed a novel technique for studies of molecular surface diffusions. In this technique, the laser-induced desorption with two interfering laser beams is used to produce a monolayer grating of adsorbates. The monolayer grating is detected with diffractions of optical SHG. By monitoring the first-order second-harmonic diffraction, we can follow the time evolution of the grating modulation from which we are able to deduce the diffusion constant of the adsorbates on the surface. We have successfully applied this technique to investigate the surface diffusion of CO on Ni(111). The unique advantages of this novel technique will enable us to readily study anisotropy of a surface diffusion with variable grating orientation, and to investigate diffusion processes of a large dynamic range with variable grating spacings. In the second part of this work, we demonstrate that optical infrared-visible sum-frequency generation (SFG) from surfaces can be used as a viable surface vibrational spectroscopic technique. We have successfully recorded the first vibrational spectrum of a monolayer of adsorbates using optical infrared-visible SFG. The qualitative and quantitative correlation of optical SFG with infrared absorption and Raman scattering spectroscopies are examined and experimentally demonstrated. We have further investigated the possibility to use transient infrared-visible SFG to probe vibrational transients and ultrafast relaxations on surfaces. 146 refs.

Non-linear optical studies of adsorbates: Spectroscopy and dynamics

International Nuclear Information System (INIS)

Zhu, Xiangdong.

1989-08-01

In the first part of this thesis, we have established a systematic procedure to apply the surface optical second-harmonic generation (SHG) technique to study surface dynamics of adsorbates. In particular, we have developed a novel technique for studies of molecular surface diffusions. In this technique, the laser-induced desorption with two interfering laser beams is used to produce a monolayer grating of adsorbates. The monolayer grating is detected with diffractions of optical SHG. By monitoring the first-order second-harmonic diffraction, we can follow the time evolution of the grating modulation from which we are able to deduce the diffusion constant of the adsorbates on the surface. We have successfully applied this technique to investigate the surface diffusion of CO on Ni(111). The unique advantages of this novel technique will enable us to readily study anisotropy of a surface diffusion with variable grating orientation, and to investigate diffusion processes of a large dynamic range with variable grating spacings. In the second part of this work, we demonstrate that optical infrared-visible sum-frequency generation (SFG) from surfaces can be used as a viable surface vibrational spectroscopic technique. We have successfully recorded the first vibrational spectrum of a monolayer of adsorbates using optical infrared-visible SFG. The qualitative and quantitative correlation of optical SFG with infrared absorption and Raman scattering spectroscopies are examined and experimentally demonstrated. We have further investigated the possibility to use transient infrared-visible SFG to probe vibrational transients and ultrafast relaxations on surfaces. 146 refs

Conformation, orientation and interaction in molecular monolayers

International Nuclear Information System (INIS)

Superfine, R.; Huang, J.Y.; Shen, Y.R.

1989-01-01

Knowledge of the conformation and ordering of molecular monolayers is essential for a detailed understanding of a wide variety of surface and interfacial phenomena. Over the past several years, surface second harmonic generation (SHG) has proven to be a valuable and versatile probe of monolayer systems. Our group has recently extended the technique to infrared-visible sum frequency generation (SFG) which has unique capabilities for surface vibrational spectroscopy. Like second harmonic generation, SFG is highly surface specific with submonolayer sensitivity at all interfaces accessible by light. The orientation of individual groups within an adsorbate molecule can be deduced by a polarization analysis of the SFG signal from the vibrational modes of the groups. The authors have used SHG and SFG to study orientations and conformations of surfactant and liquid crystal (LC) monolayers and their interaction on a substrate. The interfacial properties of LC are of great interest to many researchers for both basic science understanding and practical application to LC devices. It is well known that the bulk alignment of a liquid crystal in a cell is strongly affected by the surface treatment of the cell walls. The reason behind it is not yet clear. The theoretical background and experimental arrangement of SHG and SFG have been described elsewhere. In the setup, a 30 psec. Nd:YAG mode-locked laser system together with nonlinear accessories generates a visible beam at .532μm and an infrared beam tunable about 3.4μm. Both beams are focused to a common spot of 300μm dia. The typical signal off the surface from a compact ordered alkyl chain monolayer is ∼500 photons per pulse, easily detected with a photomultiplier tube

Prevalence data of Rickettsia slovaca and other SFG Rickettsiae species in Dermacentor marginatus in the southeastern Iberian peninsula.

Science.gov (United States)

Márquez, F J; Rojas, A; Ibarra, V; Cantero, A; Rojas, J; Oteo, J A; Muniain, M A

2006-10-01

In southern Spain, Dermacentor marginatus ticks can be infected with several genospecies of spotted fever Group (SFG) Rickettsia. We developed a nested polymerase chain reaction assay by using a species-specific probe targeting the ompA gene to detect and differentiate between the two groups of rickettsiae previously described in D. marginatus. SFG rickettsia has been detected in 85.15% of ticks studied (26.7% of positives have been to R. slovaca, the causative agent of TIBOLA-DEBONEL, and 73.3% to SFG rickettsia closely related to strains RpA4-JL-02-DnS14-DnS28).

A Novel (DDCC-SFG-Based Systematic Design Technique of Active Filters

Directory of Open Access Journals (Sweden)

M. Fakhfakh

2013-09-01

Full Text Available This paper proposes a novel idea for the synthesis of active filters that is based on the use of signal-flow graph (SFG stamps of differential difference current conveyors (DDCCs. On the basis of an RLC passive network or a filter symbolic transfer function, an equivalent SFG is constructed. DDCCs’ SFGs are identified inside the constructed ‘active’ graph, and thus the equivalent circuit can be easily synthesized. We show that the DDCC and its ‘derivatives’, i.e. differential voltage current conveyors and the conventional current conveyors, are the main basic building blocks in such design. The practicability of the proposed technique is showcased via three application examples. Spice simulations are given to show the viability of the proposed technique.

Geographic variation in risk factors for SFG rickettsial and leptospiral exposure in Colombia.

Science.gov (United States)

Padmanabha, Harish; Hidalgo, Marylin; Valbuena, Gustavo; Castaneda, Elizabeth; Galeano, Armando; Puerta, Henry; Cantillo, Cesar; Mantilla, Gilma

2009-10-01

In order to characterize the patterns of human exposure to spotted fever group (SFG) rickettsial and leptospiral infection, IgG surveys were conducted on 642 residents of ten different areas of the rural district of Necoclí, Colombia. Areas were selected based on forest cover and human settlement pattern, and individual risk factors were elucidated through multivariate logistic models, controlling for variance clustering within communities. Overall, prevalence of high antibody titers indicating previous exposure to SFG rickettsia and leptospira was 29.2% and 35.6%, respectively, and both were most prevalent in the same peri-urban neighborhood. Forest cover .10% demonstrated the strongest independent association with leptospiral exposure, followed by homes with outdoor storage sheds. Isolated rural housing was the only variable independently associated with SFG rickettsia exposure. Community-level variables significantly modified the effects of individual risk factors. For both pathogens the eldest quartile was less exposed in periurban areas although there was no age effect overall for either. Females living in population settlements were more exposed to SFG rickettsiae but there was no sex association in isolated rural houses. Similarly, in sites with forest cover .10%, individuals working at home had higher leptospira seroprevalence, but place of work was not a risk factor in areas of forest cover ,10%. These data suggest that the patterns of maintenance and/or exposure to leptospira and rickettsia vary across different human created landscapes and settlement patterns. While contrasting risk factors may reflect the unique transmission cycles of each pathogen, the observed patterns of geographic variation suggest that both diseases may respond similarly larger scale human-ecological dynamics.

Synchronous-flux-generator (SFG)

Energy Technology Data Exchange (ETDEWEB)

Zweygbergk, S.V.; Ljungstroem, O. (ed.)

1976-01-01

The synchronous machine is the most common rotating electric machine for producing electric energy in a large scale, but it is also used for other purposes. One well known everyday example is its use as driving motor in the electric synchronous clock. One has in this connection made full use of one of the main qualities of this kind of machine--its rotating speed is bound to the frequency of the feeding voltage, either if it is working as a motor or as a generator. Characteristics are discussed.

Relationship between physiological measurements (SFG -scope for growth-) and the functionality of the digestive gland in Mytilus galloprovincialis.

Science.gov (United States)

Albentosa, Marina; Sánchez-Hernández, Miriam; Campillo, Juan Antonio; Moyano, Francisco Javier

2012-11-01

The present study was aimed to establish the relationship between the functionality of the digestive gland and physiological rates including SFG (scope for growth) in wild mussels, Mytilus galloprovincilis. The experimental set-up consisted in the evaluation of changes in the morphology of the gland, as well as in the activity of some key digestive enzymes (amylase, laminarinase, cellulase and protease) within a broad range of SFG obtained through manipulation of food ration. The higher SFG values were correlated to an increase in both the size of the digestive gland and the activities of enzymes when expressed in relation to individual. In contrast, no clear relations were observed when the activity of enzymes was expressed in relation to soluble protein, with the exception to amylase. The higher protease activities measured in mussels showing lower SFG may reflect an initial stage of catabolic processes intended to compensate the energy deficit produced by food restriction. The potential use of parameters measured in digestive glands in studies of marine pollution was discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

Improvement of force factor of magnetostrictive vibration power generator for high efficiency

International Nuclear Information System (INIS)

Kita, Shota; Ueno, Toshiyuki; Yamada, Sotoshi

2015-01-01

We develop high power magnetostrictive vibration power generator for battery-free wireless electronics. The generator is based on a cantilever of parallel beam structure consisting of coil-wound Galfenol and stainless plates with permanent magnet for bias. Oscillating force exerted on the tip bends the cantilever in vibration yields stress variation of Galfenol plate, which causes flux variation and generates voltage on coil due to the law of induction. This generator has advantages over conventional, such as piezoelectric or moving magnet types, in the point of high efficiency, highly robust, and low electrical impedance. Our concern is the improvement of energy conversion efficiency dependent on the dimension. Especially, force factor, the conversion ratio of the electromotive force (voltage) on the tip velocity in vibration, has an important role in energy conversion process. First, the theoretical value of the force factor is formulated and then the validity was verified by experiments, where we compare four types of prototype with parameters of the dimension using 7.0 × 1.5 × 50 mm beams of Galfenol with 1606-turn wound coil. In addition, the energy conversion efficiency of the prototypes depending on load resistance was measured. The most efficient prototype exhibits the maximum instantaneous power of 0.73 W and energy of 4.7 mJ at a free vibration of frequency of 202 Hz in the case of applied force is 25 N. Further, it was found that energy conversion efficiency depends not only on the force factor but also on the damping (mechanical loss) of the vibration

Heterogeneous Amyloid β-Sheet Polymorphs Identified on Hydrogen Bond Promoting Surfaces Using 2D SFG Spectroscopy.

Science.gov (United States)

Ho, Jia-Jung; Ghosh, Ayanjeet; Zhang, Tianqi O; Zanni, Martin T

2018-02-08

Two-dimensional sum-frequency generation spectroscopy (2D SFG) is used to study the structures of the pentapeptide FGAIL on hydrogen bond promoting surfaces. FGAIL is the most amyloidogenic portion of the human islet amyloid polypeptide (hIAPP or amylin). In the presence of a pure gold surface, FGAIL does not form ordered structures. When the gold is coated with a self-assembled monolayer of mercaptobenzoic acid (MBA), 2D SFG spectra reveal features associated with β-sheets. Also observed are cross peaks between the FGAIL peptides and the carboxylic acid groups of the MBA monolayer, indicating that the peptides are in close contact with the surface headgroups. In the second set of samples, FGAIL peptides chemically ligated to the MBA monolayer also exhibited β-sheet features but with a much simpler spectrum. From simulations of the experiments, we conclude that the hydrogen bond promoting surface catalyzes the formation of both parallel and antiparallel β-sheet structures with several different orientations. When ligated, parallel sheets with only a single orientation are the primary structure. Thus, this hydrogen bond promoting surface creates a heterogeneous distribution of polymorph structures, consistent with a concentration effect that allows nucleation of many different amyloid seeding structures. A single well-defined seed favors one polymorph over the others, showing that the concentrating influence of a membrane can be counterbalanced by factors that favor directed fiber growth. These experiments lay the foundation for the measurement and interpretation of β-sheet structures with heterodyne-detected 2D SFG spectroscopy. The results of this model system suggest that a heterogeneous distribution of polymorphs found in nature are an indication of nonselective amyloid aggregation whereas a narrow distribution of polymorph structures is consistent with a specific protein or lipid interaction that directs fiber growth.

Analysis of generator bearing vibration data for diagnosing rotor circuit malfunction in DFIGs

DEFF Research Database (Denmark)

Skrimpas, Georgios Alexandros; Sweeney, Christian W.; Jensen, Bogi Bech

2014-01-01

Doubly fed induction generators (DFIGs) are the most popular configuration met in the wind energy sector occu- pying approximately 65 % of the total market share. Condition monitoring of wind turbine generators is performed based on vibration data collected from accelerometers mounted on the drive....... In this paper generator bearing vibration signature for a DFIG under operation with one rotor phase coil open is analysed and presented. Further this failure mode is compared to rotor dynamics fault, such as rotational looseness, and the difference in signature is discussed. Vibration data from a multi...... end and non-drive end bearings, meeting the requirements of numerous turbine operators for condition based maintenance. In a DFIG the voltage applied to the rotor is controlled by a converter, where electric connection between the two is accom- plished by using slip rings. Improper connection between...

Laboratory evaluation of a vibrating orifice monodisperse aerosol generator

International Nuclear Information System (INIS)

Everitt, N.M.; Snelling, K.W.

1985-02-01

The Berglund-Liu vibrating orifice aerosol generator is capable of producing monodisperse particles in the diameter range 5 to 50 μm. Experiments have been carried out to set up and evaluate such a generator for the preparation of standard liquid (olive oil) and solid (methylene blue) aerosols in the size range 8 to 13 μm. Modifications have been made to the apparatus to improve its performance and increase its particle output. (author)

Detection of generator bearing inner race creep by means of vibration and temperature analysis

DEFF Research Database (Denmark)

Skrimpas, Georgios Alexandros; Dragiev, Ivaylo G.; Hilmisson, Reynir

2015-01-01

Vibration and temperature analysis are the two dominating condition monitoring techniques applied to fault detection of bearing failures in wind turbine generators. Relative movement between the bearing inner ring and generator axle is one of the most severe failure modes in terms of secondary...... damages and development. Detection of bearing creep can be achieved reliably based on continuous trending of the amplitude of vibration running speed harmonic and temperature absolute values. In order to decrease the number of condition indicators which need to be assessed, it is proposed to exploit...... a weighted average descriptor calculated based on the 3rd up to 6th harmonic orders. Two cases of different bearing creep severity are presented, showing the consistency of the combined vibration and temperature data utilization. In general, vibration monitoring reveals early signs of abnormality several...

Somatic growth of mussels Mytilus edulis in field studies compared to predictions using BEG, DEB, and SFG models

Science.gov (United States)

Larsen, Poul S.; Filgueira, Ramón; Riisgård, Hans Ulrik

2014-04-01

Prediction of somatic growth of blue mussels, Mytilus edulis, based on the data from 2 field-growth studies of mussels in suspended net-bags in Danish waters was made by 3 models: the bioenergetic growth (BEG), the dynamic energy budget (DEB), and the scope for growth (SFG). Here, the standard BEG model has been expanded to include the temperature dependence of filtration rate and respiration and an ad hoc modification to ensure a smooth transition to zero ingestion as chlorophyll a (chl a) concentration approaches zero, both guided by published data. The first 21-day field study was conducted at nearly constant environmental conditions with a mean chl a concentration of C = 2.7 μg L- 1, and the observed monotonous growth in the dry weight of soft parts was best predicted by DEB while BEG and SFG models produced lower growth. The second 165-day field study was affected by large variations in chl a and temperature, and the observed growth varied accordingly, but nevertheless, DEB and SFG predicted monotonous growth in good agreement with the mean pattern while BEG mimicked the field data in response to observed changes in chl a concentration and temperature. The general features of the models were that DEB produced the best average predictions, SFG mostly underestimated growth, whereas only BEG was sensitive to variations in chl a concentration and temperature. DEB and SFG models rely on the calibration of the half-saturation coefficient to optimize the food ingestion function term to that of observed growth, and BEG is independent of observed actual growth as its predictions solely rely on the time history of the local chl a concentration and temperature.

Ultrafast spectroscopy of model biological membranes

NARCIS (Netherlands)

Ghosh, Avishek

2009-01-01

In this PhD thesis, I have described the novel time-resolved sum-frequency generation (TR-SFG) spectroscopic technique that I developed during the course of my PhD research and used it study the ultrafast vibrational, structural and orientational dynamics of water molecules at model biological

Membrane interaction of antimicrobial peptides using E. coli lipid extract as model bacterial cell membranes and SFG spectroscopy.

Science.gov (United States)

Soblosky, Lauren; Ramamoorthy, Ayyalusamy; Chen, Zhan

2015-04-01

Supported lipid bilayers are used as a convenient model cell membrane system to study biologically important molecule-lipid interactions in situ. However, the lipid bilayer models are often simple and the acquired results with these models may not provide all pertinent information related to a real cell membrane. In this work, we use sum frequency generation (SFG) vibrational spectroscopy to study molecular-level interactions between the antimicrobial peptides (AMPs) MSI-594, ovispirin-1 G18, magainin 2 and a simple 1,2-dipalmitoyl-d62-sn-glycero-3-phosphoglycerol (dDPPG)/1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) bilayer. We compared such interactions to those between the AMPs and a more complex dDPPG/Escherichia coli (E. coli) polar lipid extract bilayer. We show that to fully understand more complex aspects of peptide-bilayer interaction, such as interaction kinetics, a heterogeneous lipid composition is required, such as the E. coli polar lipid extract. The discrepancy in peptide-bilayer interaction is likely due in part to the difference in bilayer charge between the two systems since highly negative charged lipids can promote more favorable electrostatic interactions between the peptide and lipid bilayer. Results presented in this paper indicate that more complex model bilayers are needed to accurately analyze peptide-cell membrane interactions and demonstrates the importance of using an appropriate lipid composition to study AMP interaction properties. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Sum frequency generation for studying plasma-wall interactions

International Nuclear Information System (INIS)

Roke, Sylvie

2010-01-01

Interaction of a plasma with a surface results in chemical and physical restructuring of the surface as well as the plasma in the vicinity of the surface. Studying such a reorganization of the atoms and molecules in the surface layer requires optical tools that can penetrate the plasma environment. At the same time, surface specificity is required. Sum Frequency Generation (SFG) is an optical method that fulfills these requirements. SFG has been developed into a surface specific probe during the eighties and nineties. Nowadays SFG is routinely applied in the research of complex interfaces. In such experiments, liquid/gas, solid/gas, solid/liquid, or liquid/liquid interfaces are probed, and the chemical surface composition, orientational distribution, order and chirality can be retrieved. An application to investigate plasma-wall interactions is feasible too.

Dynamics and Control of Lateral Tower Vibrations in Offshore Wind Turbines by Means of Active Generator Torque

Directory of Open Access Journals (Sweden)

Zili Zhang

2014-11-01

Full Text Available Lateral tower vibrations of offshore wind turbines are normally lightly damped, and large amplitude vibrations induced by wind and wave loads in this direction may significantly shorten the fatigue life of the tower. This paper proposes the modeling and control of lateral tower vibrations in offshore wind turbines using active generator torque. To implement the active control algorithm, both the mechanical and power electronic aspects have been taken into consideration. A 13-degrees-of-freedom aeroelastic wind turbine model with generator and pitch controllers is derived using the Euler–Lagrangian approach. The model displays important features of wind turbines, such as mixed moving frame and fixed frame-defined degrees-of-freedom, couplings of the tower-blade-drivetrain vibrations, as well as aerodynamic damping present in different modes of motions. The load transfer mechanisms from the drivetrain and the generator to the nacelle are derived, and the interaction between the generator torque and the lateral tower vibration are presented in a generalized manner. A three-dimensional rotational sampled turbulence field is generated and applied to the rotor, and the tower is excited by a first order wave load in the lateral direction. Next, a simple active control algorithm is proposed based on active generator torques with feedback from the measured lateral tower vibrations. A full-scale power converter configuration with a cascaded loop control structure is also introduced to produce the feedback control torque in real time. Numerical simulations have been carried out using data calibrated to the referential 5-MW NREL (National Renewable Energy Laboratory offshore wind turbine. Cases of drivetrains with a gearbox and direct drive to the generator are considered using the same time series for the wave and turbulence loadings. Results show that by using active generator torque control, lateral tower vibrations can be significantly mitigated for

Flow-induced vibration analysis of heat exchanger and steam generator designs

International Nuclear Information System (INIS)

Pettigrew, M.J.; Sylvestre, Y.; Campagna, A.O.

1977-08-01

Tube and shell heat exchange components such as steam generators, heat exchangers and condensers are essential parts of CANDU nuclear power stations. Excessive flow-induced vibration may cause tube failures by fatigue or more likely by fretting-wear. Such failures may lead to station shutdowns that are very undesirable in terms of lost production. Hence good performance and reliability dictate a thorough flow-induced vibration analysis at the design stage. This paper presents our approach and techniques in this respect. (author)

Support Effects in Catalysis Studied by in-situ Sum Frequency Generation Vibrational Spectroscopy and in-situ X-Ray Spectroscopies

Science.gov (United States)

Kennedy, Griffin John

Kinetic measurements are paired with in-situ spectroscopic characterization tools to investigate colloidally based, supported Pt catalytic model systems in order to elucidate the mechanisms by which metal and support work in tandem to dictate activity and selectivity. The results demonstrate oxide support materials, while inactive in absence of Pt nanoparticles, possess unique active sites for the selective conversion of gas phase molecules when paired with an active metal catalyst. In order to establish a paradigm for metal-support interactions using colloidally synthesized Pt nanoparticles the ability of the organic capping agent to inhibit reactivity and interaction with the support must first be assessed. Pt nanoparticles capped by poly(vinylpyrrolidone) (PVP), and those from which the PVP is removed by UV light exposure, are investigated for two reactions, the hydrogenation of ethylene and the oxidation of methanol. It is shown that prior to PVP removal the particles are moderately active for both reactions. Following removal, the activity for the two reactions diverges, the ethylene hydrogenation rate increases 10-fold, while the methanol oxidation rate decreases 3-fold. To better understand this effect the capping agent prior to, and the residual carbon remaining after UV treatment are probed by sum frequency generation vibrational spectroscopy. Prior to removal no major differences are observed when the particles are exposed to alternating H2 and O2 environments. When the PVP is removed, carbonaceous fragments remain on the surface that dynamically restructure in H2 and O2. These fragments create a tightly bound shell in an oxygen environment and a porous coating of hydrogenated carbon in the hydrogen environment. Reaction rate measurements of thermally cleaned PVP and oleic acid capped particles show this effect to be independent of cleaning method or capping agent. In all this demonstrates the ability of the capping agent to mediate nanoparticle catalysis

Vibration and wear characteristics of steam generator tubes

International Nuclear Information System (INIS)

Choi, Young Hwan

2003-06-01

This study investigates the fluid elastic instability characteristics of Steam Generator (SG) U-tubes with defect and the safety assessment of the potential for fretting-wear damages on Steam Generator (SG) U-tubes caused by foreign object in operating nuclear power plants. The operating SG shell-side flow field conditions for determining the fluid elastic instability or fretting-wear parameters such as damping ratio, added mass and flow velocity are obtained from three-dimensional SG flow calculation using the ATHOS3 code. To get the natural frequency, corresponding mode shape and participation factor, modal analyses are performed for the U-tubes either with axial or circumferential flaw with different sizes. Special emphases are on the effects of flaw orientation and size on the modal and instability characteristics of tubes, which are expressed in terms of the natural frequency, corresponding mode shape and stability ratio. Also, the wear rate of U-tube caused by foreign object is calculated using the Archard formula and the remaining life of the tube is predicted, and discussed in this study is the effect of the flow velocity and vibration of the tube on the remaining life of the tube. In addition, addressed is the effect of the internal pressure on the vibration and fretting-wear characteristics of the tube

Distributed optical fiber vibration sensing using phase-generated carrier demodulation algorithm

Science.gov (United States)

Yu, Zhihua; Zhang, Qi; Zhang, Mingyu; Dai, Haolong; Zhang, Jingjing; Liu, Li; Zhang, Lijun; Jin, Xing; Wang, Gaifang; Qi, Guang

2018-05-01

A novel optical fiber-distributed vibration-sensing system is proposed, which is based on self-interference of Rayleigh backscattering with phase-generated carrier (PGC) demodulation algorithm. Pulsed lights are sent into the sensing fiber and the Rayleigh backscattering light from a certain position along the sensing fiber would interfere through an unbalanced Michelson interferometry to generate the interference light. An improved PGC demodulation algorithm is carried out to recover the phase information of the interference signal, which carries the sensing information. Three vibration events were applied simultaneously to different positions over 2000 m sensing fiber and demodulated correctly. The spatial resolution is 10 m, and the noise level of the Φ-OTDR system we proposed is about 10-3 rad/\\surd {Hz}, and the signal-to-noise ratio is about 30.34 dB.

Vibrational dynamics of adsorbed molecules under conditions of photodesorption: Pump-probe SFG spectra of CO/Pt(111)

Science.gov (United States)

Fournier, Frédéric; Zheng, Wanquan; Carrez, Serge; Dubost, Henri; Bourguignon, Bernard

2004-09-01

Interaction of CO adsorbed on Pt(111) with electrons and phonons is studied experimentally by means of a pump-probe experiment where CO is probed by IR+visible sum frequency generation under a pump laser intensity that allows photodesorption. Vibrational spectra of CO internal stretch are obtained as a function of pump-probe delay. A two-temperature and anharmonic coupling model is used to extract from the spectra the real time variations of CO peak frequency and dephasing time. The main conclusions are the following: (i) The CO stretch is perturbed by two low-frequency modes, assigned to frustrated rotation and frustrated translation. (ii) The frustrated rotation is directly coupled to electrons photoexcited in Pt(111) by the pump laser. (iii) There is no evidence of Pt-CO stretch excitation in the spectra. The implications for the photodesorption dynamics are discussed.

Somatic growth of mussels Mytilus edulis in field studies compared to predictions using BEG, DEB, and SFG models

DEFF Research Database (Denmark)

Larsen, Poul Scheel; Filgueira, Ramón; Riisgård, Hans Ulrik

2014-01-01

Prediction of somatic growth of blue mussels, Mytilus edulis, based on the data from 2 field-growth studies of mussels in suspended net-bags in Danish waters was made by 3 models: the bioenergetic growth (BEG), the dynamic energy budget (DEB), and the scope for growth (SFG). Here, the standard BEG...... at nearly constant environmental conditions with a mean chl a concentration of C=2.7μgL−1, and the observed monotonous growth in the dry weight of soft parts was best predicted by DEB while BEG and SFG models produced lower growth. The second 165-day field study was affected by large variations in chl...... a and temperature, and the observed growth varied accordingly, but nevertheless, DEB and SFG predicted monotonous growth in good agreement with the mean pattern while BEG mimicked the field data in response to observed changes in chl a concentration and temperature. The general features of the models were that DEB...

Generation of three-mode nonclassical vibrational states of ions

International Nuclear Information System (INIS)

Nguyen Ba An; Truong Minh Duc

2002-01-01

We propose using eight lasers with appropriate orientations and conditions to generate stable trio coherent states of an ion in a three-dimensional isotropic trap. Seven lasers whose orientations are important should be detuned to the third lower sideband of the ion vibrational motion. The eighth laser whose direction is not important should be in resonance with the ionic transition

Transient responses of SFG spectra of D 2O ice/CO/Pt(1 1 1) interface with irradiation of ultra-short NIR pump pulses

Science.gov (United States)

Kubota, Jun; Wada, Akihide; Domen, Kazunari; Kano, Satoru S.

2002-08-01

The behavior of D 2O ice on CO/Pt(1 1 1) and Pt(1 1 1) under the irradiation of near-IR pulses (NIR) was studied by sum-frequency generation (SFG) spectroscopy. The peaks assigned to the O-D stretching modes of ice were obtained for the first 30 molecular layers on Pt(1 1 1). When the D2O/ CO/ Pt(1 1 1) was irradiated, the signal of D 2O was weakened after 500 ps, but that of CO was weakened immediately after the pumping. A similar time response was observed for the D 2O peak in D2O/ Pt(1 1 1) . The weakening of SFG is attributed to the broadening of bands due to thermal excitation. This indicates that the energy of the pump pulse is deposited on the Pt(1 1 1) surface and diffused into the layers of D 2O ice in the 500 ps timescale.

Sum-Frequency-Generation-Based Laser Sidebands for Tunable Femtosecond Raman Spectroscopy in the Ultraviolet

Directory of Open Access Journals (Sweden)

Liangdong Zhu

2015-04-01

Full Text Available Femtosecond stimulated Raman spectroscopy (FSRS is an emerging molecular structural dynamics technique for functional materials characterization typically in the visible to near-IR range. To expand its applications we have developed a versatile FSRS setup in the ultraviolet region. We use the combination of a narrowband, ~400 nm Raman pump from a home-built second harmonic bandwidth compressor and a tunable broadband probe pulse from sum-frequency-generation-based cascaded four-wave mixing (SFG-CFWM laser sidebands in a thin BBO crystal. The ground state Raman spectrum of a laser dye Quinolon 390 in methanol that strongly absorbs at ~355 nm is systematically studied as a standard sample to provide previously unavailable spectroscopic characterization in the vibrational domain. Both the Stokes and anti-Stokes Raman spectra can be collected by selecting different orders of SFG-CFWM sidebands as the probe pulse. The stimulated Raman gain with the 402 nm Raman pump is >21 times larger than that with the 550 nm Raman pump when measured at the 1317 cm−1 peak for the aromatic ring deformation and ring-H rocking mode of the dye molecule, demonstrating that pre-resonance enhancement is effectively achieved in the unique UV-FSRS setup. This added tunability in the versatile and compact optical setup enables FSRS to better capture transient conformational snapshots of photosensitive molecules that absorb in the UV range.

Total internal reflection sum-frequency generation spectroscopy and dense gold nanoparticles monolayer: a route for probing adsorbed molecules

International Nuclear Information System (INIS)

Tourillon, Gerard; Dreesen, Laurent; Volcke, Cedric; Sartenaer, Yannick; Thiry, Paul A; Peremans, Andre

2007-01-01

We show that sum-frequency generation spectroscopy performed in the total internal reflection configuration (TIR-SFG) combined with a dense gold nanoparticles monolayer allows us to study, with an excellent signal to noise ratio and high signal to background ratio, the conformation of adsorbed molecules. Dodecanethiol (DDT) was used as probe molecules in order to assess the potentialities of the approach. An enhancement of more than one order of magnitude of the SFG signals arising from the adsorbed species is observed with the TIR geometry compared to the external reflection one while the SFG non-resonant contribution remains the same for both configurations. Although further work is required to fully understand the origin of the SFG process on nanoparticles, our work opens new possibilities for studying nanostructures

Validation of DIVA: an expert system for the diagnostic of turbo-generator vibrations

International Nuclear Information System (INIS)

Chevalier, R.; Ricard, B.; Tiarri, J.P.; Bonnet, J.C.

1990-01-01

The project presented in this paper concerns the development of an expert system dealing with the diagnosis of turbo-generator vibrations. DIVA - Diagnosis of Shaft Line Vibrations - is a joint project which is carried out by ALSTHOM, Electricite de France and Laboratoire de Marcoussis, research centre of CGE. This article first presents the organisation of the system and then the goals and results of the tests already achieved [fr

Correlation of molecular conformation with adhesion at AlOx/poly (ethylene terephthalate) interface studied by sum-frequency generation spectroscopy

International Nuclear Information System (INIS)

Miyamae, Takayuki; Nozoye, Hisakazu

2004-01-01

The interface between AlO x and poly(ethylene terephthalate) has been investigated by sum-frequency generation (SFG). A considerable improvement in adhesion strength was achieved by short time Ar plasma modification. The increase of the adhesion strength shows good correlation with the increase of the SFG peak strength. By depositing AlO x , the increase of SFG intensities and appearance of a new peak are observed, indicating the formation of a C=O···Al bond at the interface. Surface-modification and interfacial adhesion property are discussed

Dynamics of optical degradation on LiB{sub 3}O{sub 5}-crystal surfaces during SFG

Energy Technology Data Exchange (ETDEWEB)

Moeller, Stefan; Andresen, Aenne; Imlau, Mirco [Department of Physics, University of Osnabrueck (Germany)

2008-07-01

We have investigated the phenomenon of optical degradation of LiB{sub 3}O{sub 5} single crystal surfaces during sum-frequency generation (SFG) of UV-light ({lambda}=355 nm) by a focused Q-switched Nd:YAG laser (f=20 kHz, {tau}{sub 1064}=10 ns, anti P{sub 1064}=1.5 W). The investigations were performed on timescales >100 h and UV-intensities below the light induced damage threshold of the crystals. The degradations were studied with optical and analytical methods. As a result we found a steady deposition of foreign material on the output crystal surface in the illuminated area. Here, XPS uncovered several foreign elements as Na,S,Si,Ca, C beside B and O depending on the composition of the ambient atmosphere during SFG. The temporal development of the degradation could be observed by measuring the beam profile behind the crystal. The beam divergence increased as a function of the deposition height, which led to a complex intensity profile in the far-field. Further illuminating lead to a catastrophic break-down of the surface and the beam profile. This is due to thermal damage originating from the UV-absorption of the deposited material. Three models for the deposition process are discussed: a) diffusion out of the LiB{sub 3}O{sub 5}-subsurface, b) deposition of atoms of the ambient atmosphere, c) chemical reactions of LiB{sub 3}O{sub 5}, water, and boric acid.

Limerick Nuclear Generating Station vibration monitoring system

International Nuclear Information System (INIS)

Mikulski, R.

1988-01-01

Philadelphia Electric Company utilizes a vibration monitoring computer system at its Limerick Nuclear Generating Station to evaluate machine performance. Performance can be evaluated through instantaneous sampling, online static and transient data. The system functions as an alarm monitor, displaying timely alarm data to the control area. The passage of time since the system's inception has been a learning period. Evaluation through continuous use has led to many enhancements in alarm handling and in the acquisition and display of machine data. Due to the system's sophistication, a routine maintenance program is a necessity. This paper describes the system's diagnostic tools and current utilization. System development and maintenance techniques will also be discussed

Probing a molecular electronic transition by two-colour sum-frequency generation spectroscopy

International Nuclear Information System (INIS)

Humbert, C.; Dreesen, L.; Nihonyanagi, S.; Masuda, T.; Kondo, T.; Mani, A.A.; Uosaki, K.; Thiry, P.A.; Peremans, A.

2003-01-01

We demonstrate that a new emerging technique, two-colour sum-frequency generation (SFG) spectroscopy, can be used to probe the molecular electronic properties of self-assembled monolayers (SAMs). In the CH spectral range (2800-3200 cm -1 ), we show that the sum-frequency generation signal of a porphyrin alkanethiol derivative adsorbed on Pt(1 1 1) reaches a maximum intensity at ∼435 nm SFG wavelength. This wavelength corresponds to the porphyrin moiety specific π-π* molecular electronic transition which is called the Soret or B band. This resonant behaviour is not observed for 1-dodecanethiol SAMs, which are devoid of molecular electronic transition in the investigated visible spectral range

Detection and generation of first sound in4He by vibrating superleak transducers

Science.gov (United States)

Giordano, N.; Edison, N.

1986-07-01

Measurement is made of the first-sound generation and detection efficiencies of vibrating superleak transducers (VSTs) operated in superfluid4He. This is accomplished by using an ordinary pressure transducer to generate first sound with a VST as the detector, and by using a pressure transducer to detect the sound generated by a VST. The results are in reasonably good agreement with the current theory of VST operation.

Detection and generation of first sound in 4He by vibrating superleak transducers

International Nuclear Information System (INIS)

Giordano, N.; Edison, N.

1986-01-01

Measurement is made of the first-sound generation and detection efficiencies of vibrating superleak transducers (VSTs) operated in superfluid 4 He. This is accomplished by using an ordinary pressure transducer to generate first sound with a VST as the detector, and by using a pressure transducer to detect the sound generated by a VST. The results are in reasonably good agreement with the current theory of VST operation

Detection of spotted fever group (SFG) rickettsiae in Dermacentor reticulatus (Acari: Ixodidae) in Poland.

Science.gov (United States)

Stańczak, Joanna

2006-05-01

Dermacentor reticulatus ticks from Poland were investigated by molecular methods for the presence of rickettsiae. During 2003/2004, a total of 285 adult ticks was assayed using primers RpCS.877 and RpCS.1258 derived from the citrate synthase (gltA) gene, and 116 samples (40.7%) were positive for rickettsial DNA. Ten out of these positive samples were further assayed using SLO1F and SLO1R primers derived form the rOmpA-encoding gene to confirm that detected rickettsiae belong to the spotted fever group (SFG). The obtained sequence of a fragment of the gltA gene of Rickettsia sp. isolated from Polish D. reticulatus demonstrated 96-98% similarities to Rickettsia slovaca, Rickettsia sibirica, Rickettsia honei, and other SFG rickettsiae. The nucleotide sequences of the amplified fragments of the ompA gene were 98% homologous to RpA4 Rickettsia sp. reported from ticks collected in territories of the former Soviet Union.

Vibrations Generated by Several Nickel-titanium Endodontic File Systems during Canal Shaping in an Ex Vivo Model.

Science.gov (United States)

Choi, Dong-Min; Kim, Jin-Woo; Park, Se-Hee; Cho, Kyung-Mo; Kwak, Sang Won; Kim, Hyeon-Cheol

2017-07-01

This study aimed to compare the vibration generated by several nickel-titanium (NiTi) file systems and transmitted to teeth under 2 different motions (continuous rotation motion and reciprocating motion). Sixty J-shaped resin blocks (Endo Training Bloc-J; Dentsply Maillefer, Ballaigues, Switzerland) were trimmed to a root-shaped form and divided into 2 groups according to the types of electric motors: WaveOne motor (WOM, Dentsply Maillefer) and X-Smart Plus motor (XSM, Dentsply Maillefer). Each group was further subdivided into 3 subgroups (n = 10 each) according to the designated file systems: ProTaper Next (PTN, Dentsply Maillefer), ProTaper Universal (PTU, Dentsply Maillefer), and WaveOne (WOP, Dentsply Maillefer) systems. Vibration was measured during the pecking motion using an accelerometer attached to a predetermined consistent position. The average vibration values were subjected to 2-way analysis of variance as well as the t test and Duncan test for post hoc comparison at the 95% confidence interval. Both motor types and instrument types produced significantly different ranges of average vibrations. Regardless of the instrument types, the WOM group generated greater vibration than the XSM group (P file system may generate greater vibration than the continuous rotation NiTi file systems. The motor type also has a significant effect to amplify the vibrations. Copyright © 2017 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Experimental characterization of cantilever-type piezoelectric generator operating at resonance for vibration energy harvesting

Energy Technology Data Exchange (ETDEWEB)

Montanini, Roberto, E-mail: rmontanini@unime.it; Quattrocchi, Antonino, E-mail: aquattrocchi@unime.it [University of Messina, Dept. of Engineering, Contrada di Dio, Messina (Italy)

2016-06-28

A cantilever-type resonant piezoelectric generator (RPG) has been designed by gluing a PZT patch working in d{sub 31} mode onto a glass fibre reinforced composite cantilever beam with a discrete mass applied on its free end. The electrical and dynamic behaviour of the RPG prototype has been investigated by carrying out laboratory tests aimed to assess the effect of definite design parameters, specifically the electric resistance load and the excitation frequency. Results showed that an optimum resistance load exists, at which power generation is maximized. Moreover, it has been showed that power generation is strongly influenced by the vibration frequency highlighting that, at resonance, output power can be increased by more than one order of magnitude. Possible applications include inertial resonant harvester for energy recovery from vibrating machines, sea waves or wind flux and self-powering of wireless sensor nodes.

Free vibration analysis of a steam generator tube bundle with and without lateral support

International Nuclear Information System (INIS)

King, D.M.

1979-04-01

The vibrational modes and frequency characteristics of a pressurized water reactor (PWR) steam generator tube bundle assembly with and without lateral support in a fluid environment are analyzed. The idealized half-model was constructed using the SAP-IV finite element code. Free vibration analyses were performed for an in-air case and a submerged in-water case, each with different constraint conditions at steam generator tube bundle assembly support plates 10 and 11. These constraint conditions included having both support plates free, having both support plates fixed, and having support plate 11 free while support plate 10 was fixed. It was found that as the support plate constraints were removed, the frequency range for each case increased significantly

Research of hydroelectric generating set low-frequency vibration monitoring system based on optical fiber sensing

Science.gov (United States)

Min, Li; Zhang, Xiaolei; Zhang, Faxiang; Sun, Zhihui; Li, ShuJuan; Wang, Meng; Wang, Chang

2017-10-01

In order to satisfy hydroelectric generating set low-frequency vibration monitoring, the design of Passive low-frequency vibration monitoring system based on Optical fiber sensing in this paper. The hardware of the system adopts the passive optical fiber grating sensor and unbalanced-Michelson interferometer. The software system is used to programming by Labview software and finishing the control of system. The experiment show that this system has good performance on the standard vibration testing-platform and it meets system requirements. The frequency of the monitoring system can be as low as 0.2Hz and the resolution is 0.01Hz.

Two methods for damping torsional vibrations in DFIG-based wind generators using power converters

Science.gov (United States)

Zhao, Zuyi; Lu, Yupu; Xie, Da; Yu, Songtao; Wu, Wangping

2017-01-01

This paper proposes novel damping control algorithms by using static synchronous compensator (STATCOM) and energy storage system (ESS) to damp torsional vibrations in doubly fed induction generator (DFIG) based wind turbine systems. It first analyses the operating characteristics of STATCOM and ESS for regulating power variations to increase grid voltage stability. Then, new control strategies for STATCOM and ESS are introduced to damp the vibrations. It is followed by illustration of their effectiveness to damp the drive train torsional vibrations of wind turbines, which can be caused by grid disturbances, such as voltage sags and frequency fluctuations. Results suggest that STATCOM is a promising technology to mitigate the torsional vibrations caused by grid voltage sags. By contrast, the ESS connected to the point of common coupling (PCC) of wind turbine systems shows even obvious advantages because of its capability of absorbing/releasing both active and reactive power. It can thus be concluded that STATCOM is useful for stabilizing power system voltage fluctuations, and ESS is more effective both in regulating PCC voltage fluctuations and damping torsional vibrations caused by grid voltage frequency fluctuations.

Design specifications to ensure flow-induced vibration and fretting-wear performance in CANDU steam generators and heat exchangers

International Nuclear Information System (INIS)

Janzen, V.P.; Han, Y.; Pettigrew, M.J.

2009-01-01

Preventing flow-induced vibration and fretting-wear problems in steam generators and heat exchangers requires design specifications that bring together specific guidelines, analysis methods, requirements and appropriate performance criteria. This paper outlines the steps required to generate and support such design specifications for CANDU nuclear steam generators and heat exchangers, and relates them to typical steam-generator design features and computer modeling capabilities. It also describes current issues that are driving changes to flow-induced vibration and fretting-wear specifications that can be applied to the design process for component refurbishment, replacement or new designs. These issues include recent experimental or field evidence for new excitation mechanisms, e.g., the possibility of in-plane fluidelastic instability of U-tubes, the demand for longer reactor and component lifetimes, the need for better predictions of dynamic properties and vibration response, e.g., two-phase random-turbulence excitation, and requirements to consider system 'excursions' or abnormal scenarios, e.g., a main steam line break in the case of steam generators. The paper describes steps being taken to resolve these issues. (author)

Anisotropic Formation of Quantum Turbulence Generated by a Vibrating Wire in Superfluid {}4{He}

Science.gov (United States)

Yano, H.; Ogawa, K.; Chiba, Y.; Obara, K.; Ishikawa, O.

2017-06-01

To investigate the formation of quantum turbulence in superfluid {}4{He}, we have studied the emission of vortex rings with a ring size of larger than 38 μm in diameter from turbulence generated by a vibrating wire. The emission rate of vortex rings from a turbulent region remains low until the beginning of high-rate emissions, suggesting that some of the vortex lines produced by the wire combine to form a vortex tangle, until an equilibrium is established between the rate of vortex line combination with the tangle and dissociation. The formation times of equilibrium turbulence are proportional to ɛ ^{-1.2} and ɛ ^{-0.6} in the directions perpendicular and parallel to the vibrating direction of the generator, respectively, indicating the anisotropic formation of turbulence. Here, ɛ is the generation power of the turbulence. This power dependence may be associated with the characteristics of quantum turbulence with a constant energy flux.

Over-the-road shock and vibration testing of the radioisotope thermoelectric generator transportation system

International Nuclear Information System (INIS)

Becker, D.L.

1997-01-01

Radioisotope Thermoelectric Generators (RTG) convert heat generated by radioactive decay into electricity through the use of thermocouples. The RTGs have a long operating life, are reasonably lightweight, and require little or no maintenance, which make them particularly attractive for use in spacecraft. However, because RTGs contain significant quantities of radioactive materials, normally plutonium-238 and its decay products, they must be transported in packages built in accordance with Title 10, Code of Federal Regulations, Part 71 (10 CFR 71). To meet these regulations, a RTG Transportation System (RTGTS) that fully complies with 10 CFR 71 has been developed, which protects RTGs from adverse environmental conditions during normal conditions of transport (e.g., shock, vibration, and heat). To ensure the protection of RTGs from shock and vibration loadings during transport, extensive over-the-road testing was conducted on the RTG'S to obtain real-time recordings of accelerations of the air-ride suspension system trailer floor, packaging, and support structure. This paper provides an overview of the RTG'S, a discussion of the shock and vibration testing, and a comparison of the test results to the specified shock response spectra and power spectral density acceleration criteria

Vibration Energy Harvesting on Vehicle Suspension Using Rotary and Linear Electromagnetic Generator

Directory of Open Access Journals (Sweden)

Arif Indro Sultoni

2013-04-01

Full Text Available In this paper, we discuss comparation of vehicle vibration energy harvesting between rotary and linear electromagnetic generator. We construct the two model of energy harvester mechanism and then analyze both of energy absorbtion and vehicle comfortability. Furthermore, we analyze both of energy absorbtion and vehicle comfortability. Vehicle is modeled as quarter car. Rotarty generator harvests 2.5 x 10-4 Watt. The other hand, linear generator has viscous characteristic and capable to generates 90 Watts with 12 Volt power supply for 0.03 m amplitude of bumpy road input. Linear generator reduces oscillation with 1.2 sec settling time. It is more comfort than the angular which has 3 sec in settling time. With unnevenees road input, mean power of this generator is 64 Watt.

A Multi-technique Characterization of Adsorbed Protein Films: Orientation and Structure by ToF-SIMS, NEXAFS, SFG, and XPS

Science.gov (United States)

Baio, Joseph E.

There are many techniques that allow surface scientists to study interfaces. However, few are routinely applied to probe biological surfaces. The work presented here demonstrates how detailed information about the conformation, orientation, chemical state, and molecular structure of biological molecules immobilized onto a surface can be assessed by electron spectroscopy, mass spectrometry, and nonlinear vibrational spectroscopy techniques. This investigation began with the development of simple model systems (small proteins, and peptides) and evolved into a study of more complex --- real world systems. Initially, two model systems based on the chemical and electrostatic immobilization of a small rigid protein (Protein G B1 domain, 6kDa) were built to develop the capabilities of time-of-flight secondary ion mass spectrometry (ToFSIMS), near edge X-ray absorption fine structure spectroscopy (NEXAFS) and sum frequency generation (SFG) spectroscopy as tools to probe the structure of surface immobilized proteins. X-ray photoelectron spectroscopy (XPS) was used to measure the amount of immobilized protein and ToF-SIMS sampled the amino acid composition of the exposed surface of the protein film. Within the ToF-SIMS spectra, an enrichment of secondary ions from amino acids located at opposite ends of the proteins were used to describe protein orientation. SFG spectral peaks characteristic of ordered alpha-helix and beta-sheet elements were observed for both systems and the phase of the peaks indicated a predominantly upright orientation for both the covalent and electrostatic configurations. Polarization dependence of the NEXAFS signal from the N 1s to pi* transition of the peptide bonds that make up the beta-sheets also indicated protein ordering at the surface. Building upon the Protein G B1 studies, the orientation and structure of a surface immobilized antibody (HuLys Fv: variant of humanized anti-lysozyme variable fragment, 26kDa) was characterized across two

Effect of material constants on power output in piezoelectric vibration-based generators.

Science.gov (United States)

Takeda, Hiroaki; Mihara, Kensuke; Yoshimura, Tomohiro; Hoshina, Takuya; Tsurumi, Takaaki

2011-09-01

A possible power output estimation based on material constants in piezoelectric vibration-based generators is proposed. A modified equivalent circuit model of the generator was built and was validated by the measurement results in the generator fabricated using potassium sodium niobate-based and lead zirconate titanate (PZT) ceramics. Subsequently, generators with the same structure using other PZT-based and bismuth-layered structure ferroelectrics ceramics were fabricated and tested. The power outputs of these generators were expressed as a linear functions of the term composed of electromechanical coupling coefficients k(sys)(2) and mechanical quality factors Q*(m) of the generator. The relationship between device constants (k(sys)(2) and Q*(m)) and material constants (k(31)(2) and Q(m)) was clarified. Estimation of the power output using material constants is demonstrated and the appropriate piezoelectric material for the generator is suggested.

Condition monitoring of steam turbo generators of captive power plant at HWP (Manuguru) through vibration analysis

International Nuclear Information System (INIS)

Krishnareddy, G.; Chandramouli, M.; Gupta, R.V.

2002-01-01

Turbo Generator is a critical equipment in steam based power plant circuit. Any failure causes loss of production and hence as applicable to Heavy Water Plant, Manuguru, it results in loss of heavy water production as the captive power plant at Manuguru is solely designed to supply steam and power to Main Plant, which is meant for production of heavy water. Thereby condition monitoring is very much essential and required as part of predictive maintenance program for the turbo generators which are in continuous operation. This paper focuses on identification of the turbo generator system through vibration spectrum, characterising and differentiating the fault mechanisms, trending the faults through changes in vibration spectrums and orbit plots and subsequently planning for corrective actions/measures after evaluating the changes in machine conditions

Difference frequency generation spectroscopy as a vibrational optical activity measurement tool.

Science.gov (United States)

Cheon, Sangheon; Cho, Minhaeng

2009-03-19

Vibrational optical activity (VOA) of chiral molecules in condensed phases can be studied by using vibrational circular dichroism and Raman optical activity measurement techniques. Recently, IR-vis sum frequency generation has shown to be an alternative VOA measurement method. Such a three-wave-mixing method employing a polarization modulation technique can be a potentially useful VOA measurement tool. Here, a theoretical description of difference frequency generation (DFG) employing circularly polarized visible radiations is presented. Frequency scanning to obtain a VOA-DFG spectrum is achieved by controlling the difference between the two electronically nonresonant incident radiation frequencies. If the two incident beams are linearly polarized and their polarization directions are perpendicular to each other, one can selectively measure the all-electric-dipole-allowed chiral component of the DFG susceptibility. In addition, by using circularly polarized beams and taking the DFG difference intensity signal, which is defined as the difference between left and right circularly polarized DFG signals, additional chiral susceptibility components originating from the electric quadrupole transition can be measured. The DFG as a novel VOA measurement technique for solution samples containing chiral molecules will therefore be a useful coherent spectroscopic tool for determining absolute configuration of chiral molecules in condensed phases.

Conformation, orientation and interaction in molecular monolayers: A surface second harmonic and sum frequency generation study

International Nuclear Information System (INIS)

Superfine, R.; Huang, J.Y.; Shen, Y.R.

1988-12-01

We have used sum frequency generation (SFG) to study the order in a silane monolayer before and after the deposition of a coadsorbed liquid crystal monolayer. We observe an increase in the order of the chain of the silane molecule induced by the interpenetration of the liquid crystal molecules. By using second harmonic generation (SHG) and SFG, we have studied the orientation and conformation of the liquid crystal molecule on clean and silane coated glass surfaces. On both surfaces, the biphenyl group is tilted by 70 degree with the alkyl chain end pointing away from the surface. The shift in the C-H stretch frequencies in the coadsorbed system indicates a significant interaction between molecules. 9 refs., 3 figs

In-Situ Measurement of Chirality of Molecules and Molecular Assemblies with Surface Nonlinear Spectroscopy

International Nuclear Information System (INIS)

Wang, Hongfei

2012-01-01

Developments in quantitative measurement and analysis in nonlinear surface spectroscopy, namely, second harmonic generation linear dichroism (SHG-LD) and sum frequency generation vibrational spectroscopy linear dichroism (SFG-VS-LD), provide new opportunities for probing the surface chirality of monolayers and thin films. In this book chapter, the up-to-date theoretical background and experimental methodology, as well as examples and future perspectives on the developments with surface nonlinear spectroscopy in surface chirality studies are to be summarized and outlined for general readers.

Simultaneous rotational and vibrational CARS generation through a multiple-frequency combination technique

International Nuclear Information System (INIS)

Alden, M.; Bengtsson, P.E.; Edner, H.

1987-01-01

One most promising laser technique for probing combustion processes is coherent anti-Stokes Raman scattering (CARS), which due to its coherent nature and signal strength is applied in several real-world applications. Until today almost all CARS experiments are based on probing the population of molecular vibrational energy levels. However, there are several reasons rotational CARS, i.e. probing of rotational energy levels, may provide a complement to or even a better choice than vibrational CARS. Recently an alternative way to produce rotational CARS spectra is proposed, which is based on a multiple-frequency combination technique. The energy-level diagram for this process is presented. Two dye laser beams at ω/sub r/, and one fix frequency laser beam at ω/sub g/ are employed. ω/sub r,1/ and ω/sub r,2/ are two frequencies of many possible pairs with a frequency difference matching a rotational transition in a molecule. The excitation induced by ω/sub r,1/ and ω/sub r,2/ is then scattered by the narrowband ω/sub g/ beam resulting in a CARS beam ω/sub g/ at ω/sub g/ + ω/sub r,1/ - ω/sub r,2/. An interesting feature with this technique is that it is possible to generate simultaneously a rotational and vibrational CARS spectrum by using a double-folded boxcars phase matching approach. The authors believe that the proposed technique for producing rotational and vibration CARS spectra could be of interest, e.g., when measuring in highly turbulent flows. In this case the rotational CARS spectra could use for temperature measurements in the cooler parts, whereas vibrational CARS are to be preferred when measuring in the hotter parts

Energy conversion by ‘T-shaped’ cantilever type electromagnetic vibration based micro power generator from low frequency vibration sources

International Nuclear Information System (INIS)

Siddique, Abu Raihan Mohammad; Mahmud, Shohel; Van Heyst, Bill

2017-01-01

Highlights: • A T-shaped cantilever type electromagnetic vibration based MPG has been described. • The designed EVMPG is useful for low frequency based vibration sources. • Both experimental tests and theoretical analysis have been performed. • The final compact prototype was tested at different conditions of human movements. • The prototype can generate 35.2 mV and 0.22 mW at 7 Hz with 5.6 Ω. - Abstract: The design, development, and analyses of low-frequency vibration based T-shaped cantilever type electromagnetic micro power generators (EVMPGs) are presented in this paper. Four different configurations (Configurations A to D) of EVMPGs were designed and fabricated and subsequently characterized using detailed experimental and limited analytical techniques. Configuration A and B consisted of a single and a double cylindrical moving magnets (NdFeB), respectively, while Configuration C consisted of four rectangular moving magnets with respect to a fixed copper coil. In contrast, Configuration D used a moving coil between four rectangular magnets with a back-iron bar. The open circuit RMS voltage output was observed to be a maximum from Configuration D (98.2 mV at 6.29 Hz) with a base vibration acceleration of 0.8 m s"−"2. Therefore, Configuration D was selected for further experimental investigations, which included changing the back-iron bar thickness, changing the base acceleration level, and changing the air gap separation between the magnets in order to optimize this configuration. The maximum load RMS voltage and power outputs of Configuration D were 105.4 mV and 1.35 mW at 6.29 Hz for load resistance 8.2 Ω and a base acceleration of 0.8 m s"−"2 with a 4.2 mm back-iron bar when the air gap between the magnets was 20 mm. Finally, a small portable EVMPG prototype was developed based on the Configuration D and was tested at different human movement conditions (i.e., walking, quick walking, and running). The developed EVMPG prototype was capable of

The vibrational behaviour of the generator support structure for Koeberg nuclear power station at high frequencies

International Nuclear Information System (INIS)

Lee, D.E.

1988-06-01

The vibrational behaviour of the generator support structure at Koeberg nuclear power station at frequencies primarily in the region of 80 Hz to 110 Hz was examined. The effect of soil-structure interaction and the change in stiffness of the foundation soil was investigated. Vibration tests were performed on the generator support structure and the results were compared with a theoretical finite element analysis of the structure. By varying the soil-cement foundation stiffness it was possible to demonstrate the change in dynamic behaviour of the structure in the higher frequency band 80 Hz to 110 Hz. Comment has been made on the design code DIN 4024 in view of the findings of this thesis. It was concluded that the empirical rules regarding the inclusion of the foundation in an analysis specified by the code do not cover all cases and greater cognisance of the effect of the foundation stiffness on the vibration behaviour of such machine foundations is necessary. Obvious machine frequencies higher than the operational frequencies should be analysed where it is considered necessary. 24 refs., 25 tabs., 83 figs

Some causes of vibrations recorded by in-service diagnostic systems in steam generators of units 1 and 2 of Dukovany nuclear power plant

International Nuclear Information System (INIS)

Sadilek, J.; Matal, O.

1989-01-01

A brief description is presented of the design of the steam generators of the first and second units of the Dukovany nuclear power plant. Attention is also given to the feed water systems and the diagnostic systems. The causes are analyzed of the irregularly occurring vibrations in the steam generators in service. It is demonstrated that the source of the vibrations transmitted to the steam generators are the valves in the feeding tract. The vibrations are induced by dynamic forces from the feed water. Reducing the water pressure at the delivery of the electric feed pumps by reducing the size of the rotor, etc., does not remove all vibrations. It is therefore recommended that valves be ins+alled with better regulating characteristics. (Z.M.). 6 figs., 1 tab., 3 refs

Hydrogen-Bonding Network and OH Stretch Vibration of Cellulose: Comparison of Computational Modeling with Polarized IR and SFG Spectra.

Science.gov (United States)

Lee, Christopher M; Kubicki, James D; Fan, Bingxin; Zhong, Linghao; Jarvis, Michael C; Kim, Seong H

2015-12-10

Hydrogen bonds play critical roles in noncovalent directional interactions determining the crystal structure of cellulose. Although diffraction studies accurately determined the coordinates of carbon and oxygen atoms in crystalline cellulose, the structural information on hydrogen atoms involved in hydrogen-bonding is still elusive. This could be complemented by vibrational spectroscopy; but the assignment of the OH stretch peaks has been controversial. In this study, we performed calculations using density functional theory with dispersion corrections (DFT-D2) for the cellulose Iβ crystal lattices with the experimentally determined carbon and oxygen coordinates. DFT-D2 calculations revealed that the OH stretch vibrations of cellulose are highly coupled and delocalized through intra- and interchain hydrogen bonds involving all OH groups in the crystal. Additionally, molecular dynamics (MD) simulations of a single cellulose microfibril showed that the conformations of OH groups exposed at the microfibril surface are not well-defined. Comparison of the computation results with the experimentally determined IR dichroism of uniaxially aligned cellulose microfibrils and the peak positions of various cellulose crystals allowed unambiguous identification of OH stretch modes observed in the vibrational spectra of cellulose.

Influence of water depth on the sound generated by air-bubble vibration in the water musical instrument

Science.gov (United States)

Ohuchi, Yoshito; Nakazono, Yoichi

2014-06-01

We have developed a water musical instrument that generates sound by the falling of water drops within resonance tubes. The instrument can give people who hear it the healing effect inherent in the sound of water. The sound produced by falling water drops arises from air- bubble vibrations. To investigate the impact of water depth on the air-bubble vibrations, we conducted experiments at varying values of water pressure and nozzle shape. We found that air-bubble vibration frequency does not change at a water depth of 50 mm or greater. Between 35 and 40 mm, however, the frequency decreases. At water depths of 30 mm or below, the air-bubble vibration frequency increases. In our tests, we varied the nozzle diameter from 2 to 4 mm. In addition, we discovered that the time taken for air-bubble vibration to start after the water drops start falling is constant at water depths of 40 mm or greater, but slower at depths below 40 mm.

Nonlinear vibrational spectroscopy of surfactants at liquid interfaces

Science.gov (United States)

Miranda, Paulo Barbeitas

Surfactants are widely used to modify physical and chemical properties of interfaces. They play an important role in many technological problems. Surfactant monolayers are also of great scientific interest because they are two-dimensional systems that may exhibit a very rich phase transition behavior and can also be considered as a model system for biological interfaces. In this Thesis, we use a second-order nonlinear optical technique (Sum-Frequency Generation - SFG) to obtain vibrational spectra of surfactant monolayers at liquid/vapor and solid/liquid interfaces. The technique has several advantages: it is intrinsically surface-specific, can be applied to buried interfaces, has submonolayer sensitivity and is remarkably sensitive to the conformational order of surfactant monolayers. The first part of the Thesis is concerned with surfactant monolayers at the air/water interface (Langmuir films). Surface crystallization of an alcohol Langmuir film and of liquid alkanes are studied and their phase transition behaviors are found to be of different nature, although driven by similar intermolecular interactions. The effect of crystalline order of Langmuir monolayers on the interfacial water structure is also investigated. It is shown that water forms a well-ordered hydrogen-bonded network underneath an alcohol monolayer, in contrast to a fatty acid monolayer which induces a more disordered structure. In the latter case, ionization of the monolayer becomes more significant with increase of the water pH value, leading to an electric-field-induced ordering of interfacial water molecules. We also show that the orientation and conformation of fairly complicated molecules in a Langmuir monolayer can be completely mapped out using a combination of SFG and second harmonic generation (SHG). For a quantitative analysis of molecular orientation at an interface, local-field corrections must be included. The second part is a study of self-assembled surfactant monolayers at the

On Surface Order and Disorder of α-Pinene-Derived Secondary Organic Material

Energy Technology Data Exchange (ETDEWEB)

Shrestha, Mona; Zhang, Yue; Upshur, Mary Alice; Liu, Pengfei; Blair, Sandra L.; Wang, Hongfei; Nizkorodov, Sergey; Thomson, Regan; Martin, Scot T.; Geiger, Franz M.

2015-05-14

The surfaces of secondary organic aerosol particles are notoriously difficult to access experimentally, even though they are the key location where exchange between the aerosol particle phase and its gas phase occurs. Here, we overcome this difficulty by applying standard and sub 1-cm-1 resolution vibrational sum frequency generation (SFG) spectroscopy to detect C–H oscillators at the surfaces of secondary organic material (SOM) prepared from the ozonolysis of α-pinene at Harvard University and at the University of California, Irvine that were subsequently collected on Teflon filters as well as CaF2 windows using electrostatic deposition. We find both samples yield comparable SFG spectra featuring an intense peak at 2940 cm-1 that are independent of spectral resolution and location or method of preparation. We hypothesize that the SFG spectra are due to surface-active C–H oscillators associated with the four-membered ring motif of α-pinene, which produces an unresolvable spectral continuum of approximately 50 cm-1 width reminiscent of the similar, albeit much broader, O–H stretching continuum observed in the SFG spectra of aqueous surfaces. Upon subjecting the SOM samples to cycles in relative humidity (RH) between <2% RH and 95% RH, we observe reversible changes in the SFG signal intensity across the entire spectral range surveyed for a polarization combination probing components of the vibrational transition dipole moments that are oriented parallel to the plane of incidence, but no signal intensity changes for any other polarization combination investigated. These results support the notion that the C–H oscillators at the surfaces of α-pinene-derived SOM deposited on CaF2 windows shift back and forth between two different molecular orientation distributions as the RH is lowered (more ordered) or raised (less ordered). The findings thus point towards the presence of a reversible surface switch for hindering (more ordered, <2%RH) and promoting (less

Label-free imaging of arterial cells and extracellular matrix using a multimodal CARS microscope

Science.gov (United States)

Wang, Han-Wei; Le, Thuc T.; Cheng, Ji-Xin

2008-04-01

A multimodal nonlinear optical imaging system that integrates coherent anti-Stokes Raman scattering (CARS), sum-frequency generation (SFG), and two-photon excitation fluorescence (TPEF) on the same platform was developed and applied to visualize single cells and extracellular matrix in fresh carotid arteries. CARS signals arising from CH 2-rich membranes allowed visualization of endothelial cells and smooth muscle cells of the arterial wall. Additionally, CARS microscopy allowed vibrational imaging of elastin and collagen fibrils which are also rich in CH 2 bonds. The extracellular matrix organization was further confirmed by TPEF signals arising from elastin's autofluorescence and SFG signals arising from collagen fibrils' non-centrosymmetric structure. Label-free imaging of significant components of arterial tissues suggests the potential application of multimodal nonlinear optical microscopy to monitor onset and progression of arterial diseases.

Operational Safety Assessment of Turbo Generators with Wavelet Rényi Entropy from Sensor-Dependent Vibration Signals

Directory of Open Access Journals (Sweden)

Xiaoli Zhang

2015-04-01

Full Text Available With the rapid development of sensor technology, various professional sensors are installed on modern machinery to monitor operational processes and assure operational safety, which play an important role in industry and society. In this work a new operational safety assessment approach with wavelet Rényi entropy utilizing sensor-dependent vibration signals is proposed. On the basis of a professional sensor and the corresponding system, sensor-dependent vibration signals are acquired and analyzed by a second generation wavelet package, which reflects time-varying operational characteristic of individual machinery. Derived from the sensor-dependent signals’ wavelet energy distribution over the observed signal frequency range, wavelet Rényi entropy is defined to compute the operational uncertainty of a turbo generator, which is then associated with its operational safety degree. The proposed method is applied in a 50 MW turbo generator, whereupon it is proved to be reasonable and effective for operation and maintenance.

Flow-induced vibration analysis of a helical coil steam generator experiment using large eddy simulation

Energy Technology Data Exchange (ETDEWEB)

Yuan, Haomin; Solberg, Jerome; Merzari, Elia; Kraus, Adam; Grindeanu, Iulian

2017-10-01

This paper describes a numerical study of flow-induced vibration in a helical coil steam generator experiment conducted at Argonne National Laboratory in the 1980s. In the experiment, a half-scale sector model of a steam generator helical coil tube bank was subjected to still and flowing air and water, and the vibrational characteristics were recorded. The research detailed in this document utilizes the multi-physics simulation toolkit SHARP developed at Argonne National Laboratory, in cooperation with Lawrence Livermore National Laboratory, to simulate the experiment. SHARP uses the spectral element code Nek5000 for fluid dynamics analysis and the finite element code DIABLO for structural analysis. The flow around the coil tubes is modeled in Nek5000 by using a large eddy simulation turbulence model. Transient pressure data on the tube surfaces is sampled and transferred to DIABLO for the structural simulation. The structural response is simulated in DIABLO via an implicit time-marching algorithm and a combination of continuum elements and structural shells. Tube vibration data (acceleration and frequency) are sampled and compared with the experimental data. Currently, only one-way coupling is used, which means that pressure loads from the fluid simulation are transferred to the structural simulation but the resulting structural displacements are not fed back to the fluid simulation

Flow-induced vibration and fretting-wear specifications to ensure steam-generator and heat exchanger lifetime performance

International Nuclear Information System (INIS)

Janzen, V.P.; Han, Y.; Pettigrew, M.J.

2008-01-01

The current interest in refurbishment, life extension and new-build activity has meant a renewed emphasis on technical specifications that will ensure improved reliability and longer life. Preventing vibration and fretting-wear problems in steam generators and heat exchangers requires design specifications that bring together specific guidelines, analysis methods, requirements and appropriate performance criteria. The specifications must be firmly based on experimental data and field inspections. In addition, the specifications must be supported by theoretical analyses and fundamental scaling correlations, to cover conditions and geometries over the wide range applicable to existing components and probable future designs. The specifications are expected to evolve to meet changing industry requirements. This paper outlines the steps required to generate and support design specifications, and relates them to typical steam-generator design features and computer modeling capabilities. It also describes current issues that are driving changes to flow-induced vibration and fretting-wear specifications that can be applied to the design process for component refurbishment, replacement or new designs. These issues include recent experimental or field evidence for new excitation mechanisms, e.g., the possibility of in-plane fluidelastic instability of U-tubes, the demand for longer reactor and component lifetimes, the need for better predictions of dynamic properties and vibration response, e.g., two-phase random-turbulence excitation, and requirements to consider system 'excursions' or abnormal scenarios, e.g., a main steam line break in the case of steam generators. The paper describes steps being taken to resolve these issues. (author)

Influence of treatment by vibration in residual stress generated in the laser welding of HSLA and IF steels

International Nuclear Information System (INIS)

Chuvas, T.C.; Fonseca, M.P. Cindra; Castello, D.A.

2010-01-01

The stress relieving treatment by vibration is a new technology under development, which has many advantages over thermal methods. In this work was analyzed the surface residual stress generated in the laser welding of biphasic HSLA and IF steels, both used in the automotive industry. Residual stresses were measured by X-ray diffraction, by the sen 2 Ψ method. Residual stresses generated in the welding of the samples were tensile at all points measured. After welding, the samples were submitted to the mechanical vibration treatment. Some samples presented a significant reduction in the stress values. The welded joints were also characterized by optical microscopy. (author)

Experimental modeling of flow-induced vibration of multi-span U-tubes in a CANDU steam generator

International Nuclear Information System (INIS)

Mohany, A.; Feenstra, P.; Janzen, V.P.; Richard, R.

2009-01-01

Flow-induced vibration of the tubes in a nuclear steam generator is a concern for designers who are trying to increase the life span of these units. The dominant excitation mechanisms are fluidelastic instability and random turbulence excitation. The outermost U-bend region of the tubes is of greatest concern because the flow is almost perpendicular to the tube axis and the unsupported span is relatively long. The support system in this region must be well designed in order to minimize fretting wear of the tubes at the support locations. Much of the previous testing was conducted on straight single-span or cantilevered tubes in cross-flow. However, the dynamic response of steam generator multi-span U-tubes with clearance supports is expected to be different. Accurate modeling of the tube dynamics is important to properly simulate the dynamic interaction of the tube and supports. This paper describes a test program that was developed to measure the dynamic response of a bundle of steam generator U-tubes with Anti-Vibration Bar (AVB) supports, subjected to Freon two-phase cross-flow. The tube bundle has similar geometrical conditions to those expected for future CANDU steam generators. Future steam generators will be larger than previous CANDU steam generators, nearly twice the heat transfer area, with significant changes in process conditions in the U-bend region, such as increased steam quality and a broader range of flow velocities. This test program was initiated at AECL to demonstrate that the tube support design for future CANDU steam generators will meet the stringent requirements associated with a 60 year design life. The main objective of the tests is to address the issue of in-plane and out-of-plane fluidelastic instability and random turbulent excitation of a U-tube bundle with Anti-Vibration Bar (AVB) supports. Details of the test rig, measurement techniques and preliminary instrumentation results are described in the paper. (author)

Analysis of flow-induced vibration of heat exchanger and steam generator tube bundles using the AECL computer code PIPEAU-2

International Nuclear Information System (INIS)

Gorman, D.J.

1983-12-01

PIPEAU-2 is a computer code developed at the Chalk River Nuclear Laboratories for the flow-induced vibration analysis of heat exchanger and steam generator tube bundles. It can perform this analysis for straight and 'U' tubes. All the theoretical work underlying the code is analytical rather than numerical in nature. Highly accurate evaluation of the free vibration frequencies and mode shapes is therefore obtained. Using the latest experimentally determined parameters available, the free vibration analysis is followed by a forced vibration analysis. Tube response due to fluid turbulence and vortex shedding is determined, as well as critical fluid velocity associated with fluid-elastic instability

Vibrational excitation of hydrogen molecules by two-photon absorption and third-harmonic generation

Science.gov (United States)

Miyamoto, Yuki; Hara, Hideaki; Hiraki, Takahiro; Masuda, Takahiko; Sasao, Noboru; Uetake, Satoshi; Yoshimi, Akihiro; Yoshimura, Koji; Yoshimura, Motohiko

2018-01-01

We report the coherent excitation of the vibrational state of hydrogen molecules by two-photon absorption and the resultant third-harmonic generation (THG). Parahydrogen molecules cooled by liquid nitrogen are irradiated by mid-infrared nanosecond pulses at 4.8 μm with a nearly Fourier-transform-limited linewidth. The first excited vibrational state of parahydrogen is populated by two-photon absorption of the mid-infrared photons. Because of the narrow linewidth of the mid-infrared pulses, coherence between the ground and excited states is sufficient to induce higher-order processes. Near-infrared photons from the THG are observed at 1.6 μm. The dependence of the intensity of the near-infrared radiation on mid-infrared pulse energy, target pressure, and cell length is determined. We used a simple formula for THG with consideration of realistic experimental conditions to explain the observed results.

Flow-induced vibration of steam generator helical tubes subjected to external liquid cross flow and internal two-phase flow

International Nuclear Information System (INIS)

Jong Chull Jo; Myung Jo Jhung; Woong Sik Kim; Hho Jung Kim

2005-01-01

Full text of publication follows: This paper addresses the potential flow-induced vibration problems in a helically-coiled tube steam generator of integral-type nuclear reactor, of which the tubes are subjected to liquid cross flow externally and multi-phase flow externally. The thermal-hydraulic conditions of both tube side and shell side flow fields are predicted using a general purpose computational fluid dynamics code employing the finite volume element modeling. To get the natural frequency and corresponding mode shape of the helical type tubes with various conditions, a finite element analysis code is used. Based on the results of both helical coiled tube steam generator thermal-hydraulic and coiled tube modal analyses, turbulence-induced vibration and fluid-elastic instability analyses are performed. And then the potential for damages on the tubes due to either turbulence-induced vibration or fluid-elastic instability is assessed. In the assessment, special emphases are put on the detailed investigation for the effects of support conditions, coil diameter, and helix pitch on the modal, vibration amplitude and instability characteristics of tubes, from which a technical information and basis needed for designers and regulatory reviewers can be derived. (authors)

Mobile phone generated vibrations used to detect diabetic peripheral neuropathy.

Science.gov (United States)

May, Jonathan David; Morris, Matthew William John

2017-12-01

In the current United Kingdom population the incidence of diabetic peripheral neuropathy is increasing. The presence of diabetic neuropathy affects decision making and treatment options. This study seeks to evaluate if the vibrations generated from a mobile phone can be used to screen patients for diabetic peripheral neuropathy. This study comprised of 61 patients; a control group of 21 patients; a lower limb injury group of 19 patients; a diabetic peripheral neuropathy group of 21 patients. The control and injury group were recruited randomly from fracture clinics. The diabetic peripheral neuropathy group were randomly recruited from the diabetic foot clinic. The 61 patients were examined using a 10g Semmes-Weinstein monofilament, a 128Hz tuning fork and a vibrating mobile phone. The points tested were, index finger, patella, lateral malleoli, medial malleoli, heel, first and fifth metatarsal heads. The most accurate location of all the clinical tests was the head of the 1st metatarsal at 0.86. The overall accuracy of the tuning fork was 0.77, the ten gram monofilament 0.79 and the mobile phone accuracy was 0.88. The control group felt 420 of 441 tests (95%). The injury group felt 349 of 399 tests (87%). The neuropathic group felt 216 of 441 tests (48%). There is a significant difference in the number of tests felt between the control and both the injury and neuropathic groups. pperipheral neuropathy. The most accurate location to test for diabetic peripheral neuropathy is the head of the 1st metatarsal. Screening for diabetic peripheral neuropathy in the index finger and patella were inaccurate. An injury to the lower limb affects the patient's vibration sensation, we would therefore recommend screening the contralateral limb to the injury. This study represents level II evidence of a new diagnostic investigation. Copyright © 2016 European Foot and Ankle Society. All rights reserved.

Numerical Research on Hydraulically Generated Vibration and Noise of a Centrifugal Pump Volute with Impeller Outlet Width Variation

Directory of Open Access Journals (Sweden)

Houlin Liu

2014-01-01

Full Text Available The impeller outlet width of centrifugal pumps is of significant importance for numbers of effects. In the paper, these effects including the performance, pressure pulsations, hydraulically generated vibration, and noise level are investigated. For the purpose, two approaches were used to predict the vibration and sound radiation of the volute under fluid excitation force. One approach is the combined CFD/FEM analysis for structure vibration, and then the structure response obtained from the FEM analysis is treated as the boundary condition for BEM analysis for sound radiation. The other is the combined CFD/FEM/BEM coupling method. Before the numerical methods were used, the simulation results were validated by the vibration acceleration of the monitoring points on the volute. The vibration and noise were analyzed and compared at three flow conditions. The analysis of the results shows that the influences of the sound pressure of centrifugal pumps on the structure appear insignificant. The relative outlet width b2* at nq(SI = 26.7 in this paper should be less than 0.06, based on an overall consideration of the pump characteristics, pressure pulsations, vibration and noise level.

Atomic Origins of the Self-Healing Function in Cement–Polymer Composites

Energy Technology Data Exchange (ETDEWEB)

Nguyen, Manh Thuong; Wang, Zheming; Rod, Kenton A.; Childers, Matthew I.; Fernandez, Carlos A.; Koech, Phillip K.; Bennett, Wendy D.; Rousseau, Roger J.; Glezakou, Vassiliki-Alexandra

2018-01-09

Motivated by recent advances in self-healing cement and epoxy polymer composites, we present a combined ab initio molecular dynamics and sum frequency generation (SFG) spectroscopy study of a calcium-silicate-hydrate/polymer interface. On stable, low-defect surfaces, the polymer only weakly adheres through coordination and hydrogen bonding interactions and can be easily mobilized towards defected surfaces. Conversely, on fractured surfaces, the polymer strongly anchors through ionic Ca-O bonds resulting from the deprotonation of polymer hydroxyl groups. In addition, polymer S-S groups are turned away from the cement/polymer interface, allowing for the self-healing function within the polymer. The overall elasticity and healing properties of these composites stem from a flexible hydrogen bonding network that can readily adapt to surface morphology. The theoretical vibrational signals associated with the proposed cement-polymer interfacial chemistry were confirmed experimentally by SFG spectroscopy.

Novel active vibration absorber with magnetorheological fluid

Energy Technology Data Exchange (ETDEWEB)

Gerlach, T; Ehrlich, J; Boese, H [Fraunhofer-Institut fuer Silicatforschung ISC, Neunerplatz 2, D-97082 Wuerzburg (Germany)], E-mail: thomas.gerlach@isc.fraunhofer.de

2009-02-01

Disturbing vibrations diminish the performance of technical high precision devices significantly. In search of a suitable solution for reducing these vibrations, a novel concept of active vibration reduction was developed which exploits the special properties of magnetorheological fluids. In order to evaluate the concept of such an active vibration absorber (AVA) a demonstrator was designed and manufactured. This demonstrator generates a force which counteracts the motion of the vibrating body. Since the counterforce is generated by a centrifugal exciter, the AVA provides the capability to compensate vibrations even in two dimensions. To control the strength of the force transmitted to the vibrating body, the exciter is based on a tunable MR coupling. The AVA was integrated in an appropriate testing device to investigate its performance. The recorded results show a significant reduction of the vibration amplitudes by an order of magnitude.

ACO-Initialized Wavelet Neural Network for Vibration Fault Diagnosis of Hydroturbine Generating Unit

OpenAIRE

Xiao, Zhihuai; He, Xinying; Fu, Xiangqian; Malik, O. P.

2015-01-01

Considering the drawbacks of traditional wavelet neural network, such as low convergence speed and high sensitivity to initial parameters, an ant colony optimization- (ACO-) initialized wavelet neural network is proposed in this paper for vibration fault diagnosis of a hydroturbine generating unit. In this method, parameters of the wavelet neural network are initialized by the ACO algorithm, and then the wavelet neural network is trained by the gradient descent algorithm. Amplitudes of the fr...

Vibration characteristics of a hydraulic generator unit rotor system with parallel misalignment and rub-impact

Energy Technology Data Exchange (ETDEWEB)

Huang, Zhiwei; Zhou, Jianzhong; Yang, Mengqi; Zhang, Yongchuan [Huazhong University of Science and Technology, College of Hydraulic and Digitalization Engineering, Wuhan, Hubei Province (China)

2011-07-15

The object of this research aims at the hydraulic generator unit rotor system. According to fault problems of the generator rotor local rubbing caused by the parallel misalignment and mass eccentricity, a dynamic model for the rotor system coupled with misalignment and rub-impact is established. The dynamic behaviors of this system are investigated using numerical integral method, as the parallel misalignment, mass eccentricity and bearing stiffness vary. The nonlinear dynamic responses of the generator rotor and turbine rotor with coupling faults are analyzed by means of bifurcation diagrams, Poincare maps, axis orbits, time histories and amplitude spectrum diagrams. Various nonlinear phenomena in the system, such as periodic, three-periodic and quasi-periodic motions, are studied with the change of the parallel misalignment. The results reveal that vibration characteristics of the rotor system with coupling faults are extremely complex and there are some low frequencies with large amplitude in the 0.3-0.4 x components. As the increase in mass eccentricity, the interval of nonperiodic motions will be continuously moved forward. It suggests that the reduction in mass eccentricity or increase in bearing stiffness could preclude nonlinear vibration. These might provide some important theory references for safety operating and exact identification of the faults in rotating machinery. (orig.)

Observation of sum-frequency-generation-induced cascaded four-wave mixing using two crossing femtosecond laser pulses in a 0.1 mm beta-barium-borate crystal.

Science.gov (United States)

Liu, Weimin; Zhu, Liangdong; Fang, Chong

2012-09-15

We demonstrate the simultaneous generation of multicolor femtosecond laser pulses spanning the wavelength range from UV to near IR in a 0.1 mm Type I beta-barium borate crystal from 800 nm fundamental and weak IR super-continuum white light (SCWL) pulses. The multicolor broadband laser pulses observed are attributed to two concomitant cascaded four-wave mixing (CFWM) processes as corroborated by calculation: (1) directly from the two incident laser pulses; (2) by the sum-frequency generation (SFG) induced CFWM process (SFGFWM). The latter signal arises from the interaction between the frequency-doubled fundamental pulse (400 nm) and the SFG pulse generated in between the fundamental and IR-SCWL pulses. The versatility and simplicity of this spatially dispersed multicolor self-compressed laser pulse generation offer compact and attractive methods to conduct femtosecond stimulated Raman spectroscopy and time-resolved multicolor spectroscopy.

Sum-frequency spectroscopic studies: I. Surface melting of ice, II. Surface alignment of polymers

Energy Technology Data Exchange (ETDEWEB)

Wei, Xing [Univ. of California, Berkeley, CA (United States)

2000-01-01

Surface vibrational spectroscopy via infrared-visible sum-frequency generation (SFG) has been established as a useful tool to study the structures of different kinds of surfaces and interfaces. This technique was used to study the (0001) face of hexagonal ice (Ih). SFG spectra in the O-H stretch frequency range were obtained at various sample temperatures. For the vapor(air)/ice interface, the degree of orientational order of the dangling OH bonds at the surface was measured as a function of temperature. Disordering sets in around 200 K and increases dramatically with temperature, which is strong evidence of surface melting of ice. For the other ice interfaces (silica/OTS/ice and silica/ice), a similar temperature dependence of the hydrogen bonded OH stretch peak was observed; the free OH stretch mode, however, appears to be different from that of the vapor (air)/ice interface due to interactions at the interfaces. The technique was also used to measure the orientational distributions of the polymer chains on a rubbed polyvinyl alcohol surface. Results show that the polymer chains at the surface appear to be well aligned by rubbing, and the adsorbed liquid crystal molecules are aligned, in turn, by the surface polymer chains. A strong correlation exists between the orientational distributions of the polymer chains and the liquid crystal molecules, indicating that the surface-induced bulk alignment of a liquid crystal film by rubbed polymer surfaces is via an orientational epitaxy-like mechanism. This thesis also contains studies on some related issues that are crucial to the above applications. An experiment was designed to measure SFG spectra in both reflection and transmission. The result confirms that SFG in reflection is generally dominated by the surface contribution. Another issue is the motional effect due to fast orientational motion of molecules at a surface or interface. Calculations show that the effect is significant if the molecular orientation varies

Studies of Interfacial Regions by Sum-Frequency Generation with a Free-Electron Laser

NARCIS (Netherlands)

Eliel, E. R.; van der Ham, E. W. M.; Vrehen, Q. H. F.; Thooft, G. W.; Barmentlo, M.; Auerhammer, J. M.; van der Meer, A. F. G.; van Amersfoort, P. W.

1995-01-01

The use of a Free-Electron Laser (FEL) allows the study of (non)linear optical properties of materials over unsurpassed large spectral intervals. As an example, we report on the use of a FEL as the infrared source in spectroscopic infrared-visible Sum-Frequency Generation (SFG). Employing the

IR visible sum-frequency vibrational spectroscopy of Biphenyl-3 methylene thiol monolayer on gold and silver: effect of the visible wavelength on the SFG spectrum

Science.gov (United States)

Humbert, C.; Dreesen, L.; Mani, A. A.; Caudano, Y.; Lemaire, J.-J.; Thiry, P. A.; Peremans, A.

2002-04-01

We measured IR-visible sum-frequency generation spectra of CH 3-(C 6H 4) 2-(CH 2) 3-S-H (Biphenyl-3) self-assembled monolayers on a silver and a gold substrate. For the latter substrate, we observed different interference patterns between the resonant signal of the CH vibration and the non-resonant contribution of the substrate as a function of the visible beam wavelength. The non-linear response of the gold substrate is enhanced around 480 nm corresponding to the s-d interband transition. Such effect is not observed for the silver substrate the interband transition of which is located out of the investigated visible spectral range of 450-700 nm.

Pairing vibrational and isospin rotational states in a particle number and isospin projected generator coordinate method

International Nuclear Information System (INIS)

Chen, H.T.; Muether, H.; Faessler, A.

1978-01-01

Pairing vibrational and isospin rotational states are described in different approximations based on particle number and isospin projected, proton-proton, neutron-neutron and proton-neutron pairing wave functions and on the generator coordinate method (GCM). The investigations are performed in models for which an exact group theoretical solution exists. It turns out that a particle number and isospin projection is essential to yield a good approximation to the ground state or isospin yrast state energies. For strong pairing correlations (pairing force constant equal to the single-particle level distance) isospin cranking (-ωTsub(x)) yields with particle number projected pairing wave function also good agreement with the exact energies. GCM wave functions generated by particle number and isospin projected BCS functions with different amounts of pairing correlations yield for the lowest T=0 and T=2 states energies which are practically indistinguishable from the exact solutions. But even the second and third lowest energies of charge-symmetric states are still very reliable. Thus it is concluded that also in realistic cases isospin rotational and pairing vibrational states may be described in the framework of the GCM method with isospin and particle number projected generating wave functions. (Auth.)

Lateral Vibration of Hydroelectric Generating Set with Different Supporting Condition of Thrust Pad

OpenAIRE

Si, Xiaohui; Lu, Wenxiu; Chu, Fulei

2011-01-01

The variations of the supporting condition, which change the stiffness of tilting pad thrust bearing, may alter the dynamic behavior of the rotor system. The effects of supporting condition of thrust pad on the lateral vibration of a hydroelectric generating set are investigated in this paper. The action of a thrust bearing is described as moments acting on the thrust collar, and the tilting stiffness coefficients of thrust bearing are calculated. A model based on typical beam finite element ...

Vibration in car repair work.

Science.gov (United States)

Hansson, J E; Eklund, L; Kihlberg, S; Ostergren, C E

1987-03-01

The main objective of the study was to find efficient hand tools which caused only minor vibration loading. Vibration measurements were carried out under standardised working conditions. The time during which car body repairers in seven companies were exposed to vibration was determined. Chisel hammers, impact wrenches, sanders and saws were the types of tools which generated the highest vibration accelerations. The average daily exposure at the different garages ranged from 22 to 70 min. The risk of vibration injury is currently rated as high. The difference between the highest and lowest levels of vibration was considerable in most tool categories. Therefore the choice of tool has a major impact on the magnitude of vibration exposure. The importance of choosing the right tools and working methods is discussed and a counselling service on vibration is proposed.

Coherent vibrational dynamics

CERN Document Server

Lanzani, Guglielmo; De Silvestri, Sandro

2007-01-01

Vibrational spectroscopy is a powerful investigation tool for a wide class of materials covering diverse areas in physics, chemistry and biology. The continuous development in the laser field regarding ultrashort pulse generation has led to the possibility of producing light pulses that can follow vibrational motion coupled to the electronic transitions in molecules and solids in real time. Aimed at researchers and graduate students using vibrational spectroscopy, this book provides both introductory chapters as well as more advanced contents reporting on recent progress. It also provides a good starting point for scientists seeking a sound introduction to ultrafast optics and spectroscopic techniques.

Vibration damping method and apparatus

Science.gov (United States)

Redmond, James M.; Barney, Patrick S.; Parker, Gordon G.; Smith, David A.

1999-01-01

The present invention provides vibration damping method and apparatus that can damp vibration in more than one direction without requiring disassembly, that can accommodate varying tool dimensions without requiring re-tuning, and that does not interfere with tool tip operations and cooling. The present invention provides active dampening by generating bending moments internal to a structure such as a boring bar to dampen vibration thereof.

Development of Design Criteria for Fluid Induced Structural Vibrations in Steam Generators and Heat Exchangers

International Nuclear Information System (INIS)

Catton, Ivan; Dhir, Vijay K.; Alquaddoomi, O.S.; Mitra, Deepanjan; Adinolfi, Pierangelo

2004-01-01

OAK-B135 Flow-induced vibration in heat exchangers has been a major cause of concern in the nuclear industry for several decades. Many incidents of failure of heat exchangers due to apparent flow-induced vibration have been reported through the USNRC incident reporting system. Almost all heat exchangers have to deal with this problem during their operation. The phenomenon has been studied since the 1970s and the database of experimental studies on flow-induced vibration is constantly updated with new findings and improved design criteria for heat exchangers. In the nuclear industry, steam generators are often affected by this problem. However, flow-induced vibration is not limited to nuclear power plants, but to any type of heat exchanger used in many industrial applications such as chemical processing, refrigeration and air conditioning. Specifically, shell and tube type heat exchangers experience flow-induced vibration due to the high velocity flow over the tube banks. Flow-induced vibration in these heat exchangers leads to equipment breakdown and hence expensive repair and process shutdown. The goal of this research is to provide accurate measurements that can help modelers to validate their models using the measured experimental parameters and thereby develop better design criteria for avoiding fluid-elastic instability in heat exchangers. The research is divided between two primary experimental efforts, the first conducted using water alone (single phase) and the second using a mixture of air or steam and water as the working fluid (two phase). The outline of this report is as follows: After the introduction to fluid-elastic instability, the experimental apparatus constructed to conduct the experiments is described in Chapter 2 along with the measurement procedures. Chapter 3 presents results obtained on the tube array and the flow loop, as well as techniques used in data processing. The project performance is described and evaluated in Chapter 4 followed by

Flow-induced vibration -- 1994. PVP-Volume 273

International Nuclear Information System (INIS)

Au-Yang, M.K.; Fujita, K.

1994-01-01

Flow-induced vibration is a subject of practical interest to many engineering disciplines, including the power generation, process, and petrochemical industries. In the nuclear industry, flow-induced vibration reaches a higher level of concern because of safety issues and the huge cost associated with down time and site repair. Not surprisingly, during the last 25 years a tremendous amount of effort has been spent in the study of flow-induced vibration phenomena related to nuclear plant components, notably nuclear steam generator tube banks and nuclear fuel bundles. Yet, in spite of this concentrated effort, the industry is still not free from flow-induced vibration-related problems. This explains why in this volume almost half of the papers address the issue of cross-flow induced vibration in tube bundles, with applications to the nuclear steam generator and nuclear fuel bundles in mind. Unlike 10 or 15 years ago, when flow-induced vibration studies almost always involved experimentation and empirical studies, the advent of high-speed computers has enabled numerical calculation and simulation of this complex phenomenon to take place. Separate abstracts were prepared for 27 papers in this volume

Accuracy of electromagnetic tracking with a prototype field generator in an interventional OR setting

International Nuclear Information System (INIS)

Boe, Lars Eirik; Leira, Haakon Olav; Tangen, Geir Arne; Hofstad, Erlend Fagertun; Amundsen, Tore; Langoe, Thomas

2012-01-01

Purpose: The authors have studied the accuracy and robustness of a prototype electromagnetic window field generator (WFG) in an interventional radiology suite with a robotic C-arm. The overall purpose is the development of guidance systems combining real-time imaging with tracking of flexible instruments for bronchoscopy, laparoscopic ultrasound, endoluminal surgery, endovascular therapy, and spinal surgery. Methods: The WFG has a torus shape, which facilitates x-ray imaging through its centre. The authors compared the performance of the WFG to that of a standard field generator (SFG) under the influence of the C-arm. Both accuracy and robustness measurements were performed with the C-arm in different positions and poses. Results: The system was deemed robust for both field generators, but the accuracy was notably influenced as the C-arm was moved into the electromagnetic field. The SFG provided a smaller root-mean-square position error but was more influenced by the C-arm than the WFG. The WFG also produced smaller maximum and variance of the error. Conclusions: Electromagnetic (EM) tracking with the new WFG during C-arm based fluoroscopy guidance seems to be a step forward, and with a correction scheme implemented it should be feasible.

Optimal linear generator with Halbach array for harvesting of vibration energy during human walking

Directory of Open Access Journals (Sweden)

Joonsoo Jun

2016-05-01

Full Text Available In IT business, the capacity of the battery in smartphone was drastically improved to digest various functions such as communication, Internet, e-banking, and entertainment. Although the capacity of the battery is improved, it still needs to be upgraded due to customer’s demands. In this article, we optimize the design of the linear generator with the Halbach array to improve the efficiency of harvesting vibration energy during human walking for the battery capacitance. We propose the optimal design of the tubular permanent magnet with the linear generator that uses a Halbach array. The approximate model is established using generic algorithm. Furthermore, we performed electromagnetic finite element analysis to predict the induced voltage.

An advanced tube wear and fatigue workstation to predict flow induced vibrations of steam generator tubes

International Nuclear Information System (INIS)

Gay, N.; Baratte, C.; Flesch, B.

1997-01-01

Flow induced tube vibration damage is a major concern for designers and operators of nuclear power plant steam generators (SG). The operating flow-induced vibrational behaviour has to be estimated accurately to allow a precise evaluation of the new safety margins in order to optimize the maintenance policy. For this purpose, an industrial 'Tube Wear and Fatigue Workstation', called 'GEVIBUS Workstation' and based on an advanced methodology for predictive analysis of flow-induced vibration of tube bundles subject to cross-flow has been developed at Electricite de France. The GEVIBUS Workstation is an interactive processor linking modules as: thermalhydraulic computation, parametric finite element builder, interface between finite element model, thermalhydraulic code and vibratory response computations, refining modelling of fluid-elastic and random forces, linear and non-linear dynamic response and the coupled fluid-structure system, evaluation of tube damage due to fatigue and wear, graphical outputs. Two practical applications are also presented in the paper; the first simulation refers to an experimental set-up consisting of a straight tube bundle subject to water cross-flow, while the second one deals with an industrial configuration which has been observed in some operating steam generators i.e., top tube support plate degradation. In the first case the GEVIBUS predictions in terms of tube displacement time histories and phase planes have been found in very good agreement with experiment. In the second application the GEVIBUS computation showed that a tube with localized degradation is much more stable than a tube located in an extended degradation zone. Important conclusions are also drawn concerning maintenance. (author)

Advancing the Frontiers in Nanocatalysis, Biointerfaces, and Renewable Energy Conversion by Innovations of Surface Techniques

Energy Technology Data Exchange (ETDEWEB)

Somorjai, G.A.; Frei, H.; Park, J.Y.

2009-07-23

The challenge of chemistry in the 21st century is to achieve 100% selectivity of the desired product molecule in multipath reactions ('green chemistry') and develop renewable energy based processes. Surface chemistry and catalysis play key roles in this enterprise. Development of in situ surface techniques such as high-pressure scanning tunneling microscopy, sum frequency generation (SFG) vibrational spectroscopy, time-resolved Fourier transform infrared methods, and ambient pressure X-ray photoelectron spectroscopy enabled the rapid advancement of three fields: nanocatalysts, biointerfaces, and renewable energy conversion chemistry. In materials nanoscience, synthetic methods have been developed to produce monodisperse metal and oxide nanoparticles (NPs) in the 0.8-10 nm range with controlled shape, oxidation states, and composition; these NPs can be used as selective catalysts since chemical selectivity appears to be dependent on all of these experimental parameters. New spectroscopic and microscopic techniques have been developed that operate under reaction conditions and reveal the dynamic change of molecular structure of catalysts and adsorbed molecules as the reactions proceed with changes in reaction intermediates, catalyst composition, and oxidation states. SFG vibrational spectroscopy detects amino acids, peptides, and proteins adsorbed at hydrophobic and hydrophilic interfaces and monitors the change of surface structure and interactions with coadsorbed water. Exothermic reactions and photons generate hot electrons in metal NPs that may be utilized in chemical energy conversion. The photosplitting of water and carbon dioxide, an important research direction in renewable energy conversion, is discussed.

Tunable, continuous-wave, ultraviolet source based on intracavity sum-frequency-generation in an optical parametric oscillator using BiB₃O₆.

Science.gov (United States)

Devi, Kavita; Kumar, S Chaitanya; Ebrahim-Zadeh, M

2013-10-21

We report a continuous-wave (cw) source of tunable radiation across 333-345 nm in the ultraviolet (UV) using bismuth triborate, BiB₃O₆ (BIBO) as the nonlinear gain material. The source is based on internal sum-frequency-generation (SFG) in a cw singly-resonant optical parametric oscillator (OPO) pumped at 532 nm. The compact tunable source employs a 30-mm-long MgO:sPPLT crystal as the OPO gain medium and a 5-mm-long BIBO crystal for intracavity SFG of the signal and pump, providing up to 21.6 mW of UV power at 339.7 nm, with >15 mW over 64% of the SFG tuning range. The cw OPO is also tunable across 1158-1312 nm in the idler, delivering as much as 1.7 W at 1247 nm, with >1W over 65% of the tuning range. The UV output at maximum power exhibits passive power stability better than 3.4% rms and frequency stability of 193 GHz over more than one minute.

Nonlinear resonance ultrasonic vibrations in Czochralski-silicon wafers

Science.gov (United States)

Ostapenko, S.; Tarasov, I.

2000-04-01

A resonance effect of generation of subharmonic acoustic vibrations is observed in as-grown, oxidized, and epitaxial silicon wafers. Ultrasonic vibrations were generated into a standard 200 mm Czochralski-silicon (Cz-Si) wafer using a circular ultrasound transducer with major frequency of the radial vibrations at about 26 kHz. By tuning frequency (f) of the transducer within a resonance curve, we observed a generation of intense f/2 subharmonic acoustic mode assigned as a "whistle." The whistle mode has a threshold amplitude behavior and narrow frequency band. The whistle is attributed to a nonlinear acoustic vibration of a silicon plate. It is demonstrated that characteristics of the whistle mode are sensitive to internal stress and can be used for quality control and in-line diagnostics of oxidized and epitaxial Cz-Si wafers.

Shock compression and flash-heating of molecular adsorbates on the picosecond time scale

Science.gov (United States)

Berg, Christopher Michael

An ultrafast nonlinear coherent laser spectroscopy termed broadband multiplex vibrational sum-frequency generation (SFG) with nonresonant suppression was employed to monitor vibrational transitions of molecular adsorbates on metallic substrates during laser-driven shock compression and flash-heating. Adsorbates were in the form of well-ordered self-assembled monolayers (SAMs) and included molecular explosive simulants, such as nitroaromatics, and long chain-length alkanethiols. Based on reflectance measurements of the metallic substrates, femtosecond flash-heating pulses were capable of producing large-amplitude temperature jumps with DeltaT = 500 K. Laser-driven shock compression of SAMs produced pressures up to 2 GPa, where 1 GPa ≈ 1 x 104 atm. Shock pressures were estimated via comparison with frequency shifts observed in the monolayer vibrational transitions during hydrostatic pressure measurements in a SiC anvil cell. Molecular dynamics during flash-heating and shock loading were probed with vibrational SFG spectroscopy with picosecond temporal resolution and sub-nanometer spatial resolution. Flash-heating studies of 4-nitrobenzenethiolate (NBT) on Au provided insight into effects from hot-electron excitation of the molecular adsorbates at early pump-probe delay times. At longer delay times, effects from the excitation of SAM lattice modes and lower-energy NBT vibrations were shown. In addition, flash-heating studies of alkanethiolates demonstrated chain disordering behaviors as well as interface thermal conductances across the Au-SAM junction, which was of specific interest within the context of molecular electronics. Shock compression studies of molecular explosive simulants, such as 4-nitrobenzoate (NBA), demonstrated the proficiency of this technique to observe shock-induced molecular dynamics, in this case orientational dynamics, on the picosecond time scale. Results validated the utilization of these refined shock loading techniques to probe the shock

Mechanism of bubble detachment from vibrating walls

Energy Technology Data Exchange (ETDEWEB)

Kim, Dongjun; Park, Jun Kwon, E-mail: junkeun@postech.ac.kr; Kang, Kwan Hyoung [Department of Mechanical Engineering, Pohang University of Science and Technology (POSTECH), San 31, Hyoja-dong, Pohang 790-784 (Korea, Republic of); Kang, In Seok [Department of Chemical Engineering, Pohang University of Science and Technology (POSTECH), San 31, Hyoja-dong, Pohang 790-784 (Korea, Republic of)

2013-11-15

We discovered a previously unobserved mechanism by which air bubbles detach from vibrating walls in glasses containing water. Chaotic oscillation and subsequent water jets appeared when a wall vibrated at greater than a critical level. Wave forms were developed at water-air interface of the bubble by the wall vibration, and water jets were formed when sufficiently grown wave-curvatures were collapsing. Droplets were pinched off from the tip of jets and fell to the surface of the glass. When the solid-air interface at the bubble-wall attachment point was completely covered with water, the bubble detached from the wall. The water jets were mainly generated by subharmonic waves and were generated most vigorously when the wall vibrated at the volume resonant frequency of the bubble. Bubbles of specific size can be removed by adjusting the frequency of the wall's vibration.

Substrate vibrations during courtship in three Drosophila species.

Directory of Open Access Journals (Sweden)

Valerio Mazzoni

Full Text Available While a plethora of studies have focused on the role of visual, chemical and near-field airborne signals in courtship of Drosophila fruit flies, the existence of substrate-borne vibrational signals has been almost completely overlooked. Here we describe substrate vibrations generated during courtship in three species of the D. melanogaster group, from the allegedly mute species D. suzukii, its sister species D. biarmipes, and from D. melanogaster. In all species, we recorded several types of substrate vibrations which were generated by locomotion, abdominal vibrations and most likely through the activity of thoracic wing muscles. In D. melanogaster and D. suzukii, all substrate vibrations described in intact males were also recorded in males with amputated wings. Evidence suggests that vibrational signalling may be widespread among Drosophila species, and fruit flies may provide an ideal model to study various aspects of this widespread form of animal communication.

Generation and tunable enhancement of a sum-frequency signal in lithium niobate nanowires

Science.gov (United States)

Sergeyev, Anton; Reig Escalé, Marc; Grange, Rachel

2017-02-01

Recent developments in the fabrication of lithium niobate (LiNbO3) structures down to the nanoscale opens up novel applications of this versatile material in nonlinear optics. Current nonlinear optical studies in sub-micron waveguides are mainly restricted to the generation of second and third harmonics. In this work, we demonstrate the generation and waveguiding of the sum-frequency generation (SFG) signal in a single LiNbO3 nanowire with a cross-section of 517 nm  ×  654 nm. Furthermore, we enhance the guided SFG signal 17.9 times by means of modal phase matching. We also display tuning of the phase-matched wavelength by varying the nanowire cross-section and changing the polarization of the incident laser. The results prove that LiNbO3 nanowires can be successfully used for nonlinear wave-mixing applications and assisting the miniaturization of optical devices. , which features invited work from the best early-career researchers working within the scope of J Phys D. This project is part of the Journal of Physics series’ 50th anniversary celebrations in 2017. Rachel Grange was selected by the Editorial Board of J Phys D as an Emerging Leader.

Lateral Vibration of Hydroelectric Generating Set with Different Supporting Condition of Thrust Pad

Directory of Open Access Journals (Sweden)

Xiaohui Si

2011-01-01

Full Text Available The variations of the supporting condition, which change the stiffness of tilting pad thrust bearing, may alter the dynamic behavior of the rotor system. The effects of supporting condition of thrust pad on the lateral vibration of a hydroelectric generating set are investigated in this paper. The action of a thrust bearing is described as moments acting on the thrust collar, and the tilting stiffness coefficients of thrust bearing are calculated. A model based on typical beam finite element method is established to calculate the dynamic response, and the effects of supporting conditions such as elastic oil tank support, different heights of the thrust pads with rigid support are discussed. The results reveal that the influence of thrust bearing is small when the elastic oil tanks work normally. When the supporting conditions turn to be rigid due to the oil leakage, the differences of thrust pad heights have evident influence on the load distribution of the thrust pads; while the effects on the tilting stiffness of the thrust bearing and the amplitude of the lateral shaft vibration is small when the maximum load on thrust pads is smaller than the allowable value.

Review of vibration effect during piling installation to adjacent structure

Science.gov (United States)

Rahman, Nurul Aishah Abd; Musir, Adhilla Ainun; Dahalan, Nurol Huda; Ghani, Abdul Naser Abdul; Khalil, Muhamad Kasimi Abd

2017-12-01

Basically, many major structures across the world such as towers, high rise building, houses and bridges utilize pile as a support material. The use of pile is important to strengthen the structures. However, this has led to another problem to the nearest surrounding structures resulted from pile driving. As part of a construction work, unavoidable pile driving activity generates a vibration towards the surrounding structures if uncontrolled may cause damage to the adjacent structure. As the current construction works are frequently located in urban areas where the distance between the nearest building structures is not far, vibration may cause damage to nearby structures. Knowing which part of the building that is mostly affected by various vibration patterns from the impact of pile driving is crucial. Thus, it is very important to predict the impact of vibration during piling installation work. This paper reviews the vibrations generated by piling activity toward surrounding structures in terms sources of vibration, impact of piling installation, pile-soil interaction, and factors affecting the vibration impact of building as well as to study the parameters involved in vibration generation during piling works.

Systemic functional grammar in natural language generation linguistic description and computational representation

CERN Document Server

Teich, Elke

1999-01-01

This volume deals with the computational application of systemic functional grammar (SFG) for natural language generation. In particular, it describes the implementation of a fragment of the grammar of German in the computational framework of KOMET-PENMAN for multilingual generation. The text also presents a specification of explicit well-formedness constraints on syntagmatic structure which are defined in the form of typed feature structures. It thus achieves a model of systemic functional grammar that unites both the strengths of systemics, such as stratification, functional diversification

On the neutron noise diagnostics of pressurized water reactor control rod vibrations II. Stochastic vibrations

International Nuclear Information System (INIS)

Pazsit, I.; Glockler, O.

1984-01-01

In an earlier publication, using the theory of neutron fluctuations induced by a vibrating control rod, a complete formal solution of rod vibration diagnostics based on neutron noise measurements was given in terms of Fourier-transformed neutron detector time signals. The suggested procedure was checked in numerical simulation tests where only periodic vibrations could be considered. The procedure and its numerical testing are elaborated for stochastic two-dimensional vibrations. A simple stochastic theory of two-dimensional flow-induced vibrations is given; then the diagnostic method is formulated in the stochastic case, that is, in terms of neutron detector auto- and crosspower spectra. A previously suggested approximate rod localization technique is also formulated in the stochastic case. Applicability of the methods is then investigated in numerical simulation tests, using the proposed model of stochastic two-dimensional vibrations when generating neutron detector spectra that simulate measured data

HOW SFG INCREASE STUDENTS ABILITY TO PRODUCE AND ANALYSE TEXT MEDIA

Directory of Open Access Journals (Sweden)

Abd. Ghofur

2013-05-01

Full Text Available This article explores the use of Systemic Functional Grammar for students of english language teaching entitled Analysing Media Texts. This is aims at assisting students to produce their own texts and to help them develop an understanding of the linguistic choices they make. Students are introduced to the key principles of CDA and to Halliday’s SFG to provide them with tools to assist them to understand the social and constructed nature of discourses, especially those typically found in media texts. This article focuses on students’ interpretation of media texts, their ability to read with greater understanding and to apply key concepts that they had learnt to their analyses. The students demonstrated clearly that they had developed an understanding of CDA, acquired the basic metalanguage necessary for Hallidayan analysis and some of them could produce much more rigorous textual analyses than before.

Signal displacement in spiral-in acquisitions: simulations and implications for imaging in SFG regions.

Science.gov (United States)

Brewer, Kimberly D; Rioux, James A; Klassen, Martyn; Bowen, Chris V; Beyea, Steven D

2012-07-01

Susceptibility field gradients (SFGs) cause problems for functional magnetic resonance imaging (fMRI) in regions like the orbital frontal lobes, leading to signal loss and image artifacts (signal displacement and "pile-up"). Pulse sequences with spiral-in k-space trajectories are often used when acquiring fMRI in SFG regions such as inferior/medial temporal cortex because it is believed that they have improved signal recovery and decreased signal displacement properties. Previously postulated theories explain differing reasons why spiral-in appears to perform better than spiral-out; however it is clear that multiple mechanisms are occurring in parallel. This study explores differences in spiral-in and spiral-out images using human and phantom empirical data, as well as simulations consistent with the phantom model. Using image simulations, the displacement of signal was characterized using point spread functions (PSFs) and target maps, the latter of which are conceptually inverse PSFs describing which spatial locations contribute signal to a particular voxel. The magnitude of both PSFs and target maps was found to be identical for spiral-out and spiral-in acquisitions, with signal in target maps being displaced from distant regions in both cases. However, differences in the phase of the signal displacement patterns that consequently lead to changes in the intervoxel phase coherence were found to be a significant mechanism explaining differences between the spiral sequences. The results demonstrate that spiral-in trajectories do preserve more total signal in SFG regions than spiral-out; however, spiral-in does not in fact exhibit decreased signal displacement. Given that this signal can be displaced by significant distances, its recovery may not be preferable for all fMRI applications. Copyright © 2012 Elsevier Inc. All rights reserved.

Narrow-line, cw orange light generation in a diode-pumped Nd:YVO4 laser using volume Bragg gratings.

Science.gov (United States)

Chen, Y L; Chen, W W; Du, C E; Chang, W K; Wang, J L; Chung, T Y; Chen, Y H

2009-12-07

We report on the demonstration of a narrow-line, cw orange 593-nm laser achieved via intracavity sum-frequency generation (SFG) of a diode-pumped dual-wavelength (1064 and 1342 nm) Nd:YVO(4) laser using two volume Bragg grating (VBG) reflectors. At diode pump power of up to 3.6 W, the 593-nm intracavity SFG laser radiates at the single longitudinal mode of spectral linewidth as narrow as approximately 15 MHz. More than 23-mW single-longitudinal-mode or 40-mW, diode pump power) 593-nm orange lights can be obtained from this compact laser system. Spectral tuning of the orange light was performed via the temperature tuning of the two VBGs in this system, achieving an effective tuning rate of ~5 pm/degrees C.

Vibration energy harvesting system for railroad safety based on running vehicles

International Nuclear Information System (INIS)

Tianchen, Yuan; Jian, Yang; Ruigang, Song; Xiaowei, Liu

2014-01-01

This research is focused on energy harvesting from track vibration in order to provide power for the wireless sensors which monitor railroad health. Considering that track vibration has vibration energy, a new method is proposed in the paper to harvest energy based on the piezoelectric effect. The piezoelectric generator called drum transducer is the key part for track vibration energy harvesting. The model of drum transducer is established and the simulation results show that it can generate 100 mW in real track situation. In addition, an experiment rig is developed and its vibration model is also established. The simulation and experiment results show that peak open-circuit voltage of piezoelectric generator is about 50–70 V at the full load of the train. The whole track vibration energy harvesting system is analytically modeled, numerically simulated, and experimentally realized to demonstrate the feasibility and the reliability of the theoretical model. This paper is the theoretical basis of harvesting, recovering and recycling of the track vibration energy for track safety. (paper)

Acoustic Levitation Transportation of Small Objects Using a Ring-type Vibrator

Science.gov (United States)

Thomas, Gilles P. L.; Andrade, Marco A. B.; Adamowski, Julio C.; Silva, Eḿílio C. N.

A new device for noncontact transportation of small solid objects is presented here. Ultrasonic flexural vibrations are generated along the ring shaped vibrator using two Langevin transducers and by using a reflector parallel to the vibrator, small particles are trapped at the nodal points of the resulting acoustic standing wave. The particles are then moved by generating a traveling wave along the vibrator, which can be done by modulating the vibration amplitude of the transducers. The working principle of the traveling wave along the vibrator has been modeled by the superposition of two orthogonal standing waves, and the position of the particles can be predicted by using finite element analysis of the vibrator and the resulting acoustic field. A prototype consisting of a 3 mm thick, 220 mm long, 50 mm wide and 52 mm radius aluminum ring-type vibrator and a reflector of the same length and width was built and small polystyrene spheres have been successfully transported along the straight parts of the vibrator.

Experimental Study on Piezoelectric Energy Harvesting from Vortex-Induced Vibrations and Wake-Induced Vibrations

Directory of Open Access Journals (Sweden)

Min Zhang

2016-01-01

Full Text Available A rigid circular cylinder with two piezoelectric beams attached on has been tested through vortex-induced vibrations (VIV and wake-induced vibrations (WIV by installing a big cylinder fixed upstream, in order to study the influence of the different flow-induced vibrations (FIV types. The VIV test shows that the output voltage increases with the increases of load resistance; an optimal load resistance exists for the maximum output power. The WIV test shows that the vibration of the small cylinder is controlled by the vortex frequency of the large one. There is an optimal gap of the cylinders that can obtain the maximum output voltage and power. For a same energy harvesting device, WIV has higher power generation capacity; then the piezoelectric output characteristics can be effectively improved.

VibroCav : Hydrodynamic Vibration and Cavitation Technology

NARCIS (Netherlands)

Bakker, T.W.

2012-01-01

Vibration and cavitation can be generated in many ways and serve many useful purposes. This study describes physical aspects of useful vibration and cavitation for a broad spectrum of applications at atmospheric or elevated pressures. After a review of available devices, hydrodynamic

Distributed bearing fault diagnosis based on vibration analysis

Science.gov (United States)

Dolenc, Boštjan; Boškoski, Pavle; Juričić, Đani

2016-01-01

Distributed bearing faults appear under various circumstances, for example due to electroerosion or the progression of localized faults. Bearings with distributed faults tend to generate more complex vibration patterns than those with localized faults. Despite the frequent occurrence of such faults, their diagnosis has attracted limited attention. This paper examines a method for the diagnosis of distributed bearing faults employing vibration analysis. The vibrational patterns generated are modeled by incorporating the geometrical imperfections of the bearing components. Comparing envelope spectra of vibration signals shows that one can distinguish between localized and distributed faults. Furthermore, a diagnostic procedure for the detection of distributed faults is proposed. This is evaluated on several bearings with naturally born distributed faults, which are compared with fault-free bearings and bearings with localized faults. It is shown experimentally that features extracted from vibrations in fault-free, localized and distributed fault conditions form clearly separable clusters, thus enabling diagnosis.

Universality in the dynamical properties of seismic vibrations

Science.gov (United States)

Chatterjee, Soumya; Barat, P.; Mukherjee, Indranil

2018-02-01

We have studied the statistical properties of the observed magnitudes of seismic vibration data in discrete time in an attempt to understand the underlying complex dynamical processes. The observed magnitude data are taken from six different geographical locations. All possible magnitudes are considered in the analysis including catastrophic vibrations, foreshocks, aftershocks and commonplace daily vibrations. The probability distribution functions of these data sets obey scaling law and display a certain universality characteristic. To investigate the universality features in the observed data generated by a complex process, we applied Random Matrix Theory (RMT) in the framework of Gaussian Orthogonal Ensemble (GOE). For all these six places the observed data show a close fit with the predictions of RMT. This reinforces the idea of universality in the dynamical processes generating seismic vibrations.

Vibration monitoring and fault diagnostics of a thermal power plant

International Nuclear Information System (INIS)

Hafeez, T.; Ghani, R.; Chohan, G.Y.; Amir, M.

2003-01-01

A thermal power plant was monitored from HP-turbine to the generator end. The vibration data at different plant locations was obtained with the help of a data collector/analyzer. The spectra of-all locations generate the symptoms for different problems of moderate and high vibration levels like bent shaft, misalignment in the exciter rotor and three couplings, mechanical looseness on generator and exciter sides. The possible causes of these faults are discussed on the basis of presented vibration spectra in this paper. The faults were later on rectified on the basis of this diagnostics. (author)

Integrated predictive maintenance program vibration and lube oil analysis: Part I - history and the vibration program

Energy Technology Data Exchange (ETDEWEB)

Maxwell, H.

1996-12-01

This paper is the first of two papers which describe the Predictive Maintenance Program for rotating machines at the Palo Verde Nuclear Generating Station. The organization has recently been restructured and significant benefits have been realized by the interaction, or {open_quotes}synergy{close_quotes} between the Vibration Program and the Lube Oil Analysis Program. This paper starts with the oldest part of the program - the Vibration Program and discusses the evolution of the program to its current state. The {open_quotes}Vibration{close_quotes} view of the combined program is then presented.

In situ electrochemical SFG/DFG study of CN- and nitrile adsorption at Au from 1-butyl-1-methyl-pyrrolidinium bis(trifluoromethylsulfonyl) amide ionic liquid([BMP][TFSA]) containing 4-{2-[1-(2-cyanoethyl)-1,2,3,4-tetrahydroquinolin-6-yl]diazenyl} benzonitrile (CTDB) and K[Au(CN)₂].

Science.gov (United States)

Bozzini, Benedetto; Busson, Bertrand; Gayral, Audrey; Humbert, Christophe; Mele, Claudio; Six, Catherine; Tadjeddine, Abderrahmane

2012-06-25

In this paper we report an in situ electrochemical Sum-/Difference Frequency Generation (SFG/DFG) spectroscopy investigation of the adsorption of nitrile and CN⁻ from the ionic liquid 1-butyl-1-methyl-pyrrolidinium bis(trifluoromethylsulfonyl) amide ([BMP][TFSA]) containing 4-{2-[1-(2-cyanoethyl)-1,2,3,4-tetrahydroquinolin-6-yl]-diazenyl}benzonitrile (CTDB) at Au electrodes in the absence and in the presence of the Au-electrodeposition process from K[Au(CN)₂]. The adsorption of nitrile and its coadsorption with CN⁻ resulting either from the cathodic decomposition of the dye or from ligand release from the Au(I) cyanocomplex yield potential-dependent single or double SFG bands in the range 2,125-2,140 cm⁻¹, exhibiting Stark tuning values of ca. 3 and 1 cm⁻¹ V⁻¹ in the absence and presence of electrodeposition, respectively. The low Stark tuning found during electrodeposition correlates with the cathodic inhibiting effect of CTDB, giving rise to its levelling properties. The essential insensitivity of the other DFG parameters to the electrodeposition process is due to the growth of smooth Au.

Study of confinement and sliding friction of fluids using sum frequency generation spectroscopy

Science.gov (United States)

Nanjundiah, Kumar

2007-12-01

Friction and wear are important technologically. Tires on wet roads, windshield wipers and human joints are examples where nanometer-thick liquids are confined between flexible-rigid contact interfaces. Fundamental understanding of the structure of these liquids can assist in the design of products such as artificial joints and lubricants for Micro-electromechanical systems [MEMS]. Prior force measurements have suggested an increase in apparent viscosity of confined liquid and sometimes solid-like responses. But, these have not given the state of molecules under confinement. In the present study, we have used a surface sensitive, non-linear optical technique (infrared-visible sum frequency generation spectroscopy [SFG]) to investigate molecular structure at hidden interfaces. SFG can identify chemical groups, concentration and orientation of molecules at an interface. A friction cell was developed to study sliding of a smooth elastomeric lens against a sapphire surface. Experiments were done with dry sliding as well as lubricated sliding in the presence of linear alkane liquids. SFG spectra at the alkane/sapphire interface revealed ordering of the confined alkane molecules. These were more ordered than alkane liquid, but less ordered than alkane crystal. Cooling of the confined alkane below its melting temperature [TM] led to molecular orientation that was different from that of bulk crystal next to a sapphire surface. Molecules were oriented with their symmetry axis parallel to the surface normal. In addition, the melting temperature [Tconf] under confinement for a series of linear alkanes (n =15--27) showed a surprising trend. Intermediate molecular weights showed melting point depression. The T conf values suggested that melting started at the alkane/sapphire interface. In another investigation, confinement of water between an elastomeric PDMS lens and sapphire was studied. SFG spectra at the sapphire/water/PDMS interface revealed a heterogeneous morphology. The

CaSO4 Scale Formation on Vibrated Piping System in the Presence Citric Acid

Science.gov (United States)

Mangestiyono, W.; Jamari, J.; Muryanto, S.; Bayuseno, A. P.

2018-02-01

Vibration in many industries commonly generated by the operation mechanical equipment such as extruder, mixer, blower, compressor, turbine, generator etc. Vibration propagates into the floor and attacks the pipe around those mechanical equipment. In this paper, the influence of vibration in a pipe on the CaSO4 scale formation was investigated to understand the effect of vibration on the kinetics, mass of scale, crystal phases and crystal polymorph. To generate vibration force, mechanical equipment was prepared consisted of electrical motor, crankshaft, connecting rod and a vibration table at where test pipe section mounted. Deposition rate increased significantly when the vibration affected to the system i.e. 0.5997 and 1.6705 gr/hr for vibration frequency 4.00 and 8.00 Hz. The addition 10.00 ppm of citric acid declined the deposition rate of 8 Hz experiment from 3.4599 gr/hr to 2.2865 gr/hr.

Control of noise and structural vibration a MATLAB-based approach

CERN Document Server

Mao, Qibo

2013-01-01

Control of Noise and Structural Vibration presents a MATLAB®-based approach to solving the problems of undesirable noise generation and transmission by structures and of undesirable vibration within structures in response to environmental or operational forces. The fundamentals of acoustics, vibration and coupling between vibrating structures and the sound fields they generate are introduced including a discussion of the finite element method for vibration analysis. Following this, the treatment of sound and vibration control begins, illustrated by example systems such as beams, plates and double plate structures. Sensor and actuator placement is explained as is the idea of modal sensor–actuators. The design of appropriate feedback systems includes consideration of basic stability criteria and robust active structural acoustic control. Single and multi-mode positive position feedback (PPF) control systems are also described in the context of loudspeaker–duct model with non-collocated loudspeaker–microp...

Sum Frequency Generation Vibrational Spectroscopy and Kinetic Study of 2-Methylfuran and 2,5-Dimethylfuran Hydrogenation over 7 nm Platinum Cubic Nanoparticles

KAUST Repository

Aliaga, Cesar; Tsung, Chia-Kuang; Alayoglu, Selim; Komvopoulos, Kyriakos; Yang, Peidong; Somorjai, Gabor A.

2011-01-01

Sum frequency generation vibrational spectroscopy and kinetic measurements obtained from gas chromatography were used to study the adsorption and hydrogenation of 2-methylfuran (MF) and 2,5-dimethylfuran (DMF) over cubic Pt nanoparticles of 7 nm

A Novel Ropes-DrivenWideband Piezoelectric Vibration Energy Harvester

Directory of Open Access Journals (Sweden)

Jinhui Zhang

2016-12-01

Full Text Available This paper presents a novel piezoelectric vibration energy harvester (PVEH in which a high-frequency generating beam (HFGB is driven by an array of low-frequency driving beams (LFDBs using ropes. Two mechanisms based on frequency upconversion and multimodal harvesting work together to broaden the frequency bandwidth of the proposed vibration energy harvester (VEH. The experimental results show that the output power of generating beam (GB remains unchanged with the increasing number of driving beams (DBs, compared with the traditional arrays of beams vibration energy harvester (AB-VEH, and the output power and bandwidth behavior can be adjusted by parameters such as acceleration, rope margin, and stiffness of LFDBs, which shows the potential to achieve unlimited wideband vibration energy-harvesting for a variable environment.

Note: A simple vibrating orifice monodisperse droplet generator using a hard drive actuator arm

Energy Technology Data Exchange (ETDEWEB)

Kosch, Sebastian, E-mail: skosch@mie.utoronto.ca, E-mail: ashgriz@mie.utoronto.ca; Ashgriz, Nasser, E-mail: skosch@mie.utoronto.ca, E-mail: ashgriz@mie.utoronto.ca [Department of Industrial and Mechanical Engineering, University of Toronto, Toronto, Ontario M5S 3G8 (Canada)

2015-04-15

We propose that the rotary voice coil actuators found in magnetic hard drives are fit to supercede loudspeakers as expedient vibration sources in the laboratory setting. A specific use case is the excitation of a liquid jet to induce controlled breakup into monodisperse droplets. Like loudspeakers, which are typically used for prototyping such devices, hard drive actuators are cheap and ubiquitous, but they are less unwieldy and supply greater amplitudes without producing noise. Frequencies between 0 and 17 kHz, and likely beyond, can be reproduced reliably. No machining tools or amplifying electronics are needed for the construction and operation of the presented droplet generator.

Experimental Analysis of a Piezoelectric Energy Harvesting System for Harmonic, Random, and Sine on Random Vibration

Directory of Open Access Journals (Sweden)

Jackson W. Cryns

2013-01-01

Full Text Available Harvesting power with a piezoelectric vibration powered generator using a full-wave rectifier conditioning circuit is experimentally compared for varying sinusoidal, random, and sine on random (SOR input vibration scenarios; the implications of source vibration characteristics on harvester design are discussed. The rise in popularity of harvesting energy from ambient vibrations has made compact, energy dense piezoelectric generators commercially available. Much of the available literature focuses on maximizing harvested power through nonlinear processing circuits that require accurate knowledge of generator internal mechanical and electrical characteristics and idealization of the input vibration source, which cannot be assumed in general application. Variations in source vibration and load resistance are explored for a commercially available piezoelectric generator. The results agree with numerical and theoretical predictions in the previous literature for optimal power harvesting in sinusoidal and flat broadband vibration scenarios. Going beyond idealized steady-state sinusoidal and flat random vibration input, experimental SOR testing allows for more accurate representation of real world ambient vibration. It is shown that characteristic interactions from more complex vibration sources significantly alter power generation and processing requirements by varying harvested power, shifting optimal conditioning impedance, inducing voltage fluctuations, and ultimately rendering idealized sinusoidal and random analyses incorrect.

Surface-segregated monolayers: a new type of ordered monolayer for surface modification of organic semiconductors.

Science.gov (United States)

Wei, Qingshuo; Tajima, Keisuke; Tong, Yujin; Ye, Shen; Hashimoto, Kazuhito

2009-12-09

We report a new type of ordered monolayer for the surface modification of organic semiconductors. Fullerene derivatives with fluorocarbon chains ([6,6]-phenyl-C(61)-buryric acid 1H,1H-perfluoro-1-alkyl ester or FC(n)) spontaneously segregated as a monolayer on the surface of a [6,6]-phenyl-C(61)-butyric acid methyl ester (PCBM) film during a spin-coating process from the mixture solutions, as confirmed by X-ray photoelectron spectroscopy (XPS). Ultraviolet photoelectron spectroscopy (UPS) showed the shift of ionization potentials (IPs) depending on the fluorocarbon chain length, indicating the formation of surface dipole moments. Surface-sensitive vibrational spectroscopy, sum frequency generation (SFG) revealed the ordered molecular orientations of the C(60) moiety in the surface FC(n) layers. The intensity of the SFG signals from FC(n) on the surface showed a clear odd-even effect when the length of the fluorocarbon chain was changed. This new concept of the surface-segregated monolayer provides a facile and versatile approach to modifying the surface of organic semiconductors and is applicable to various organic optoelectronic devices.

Behavior of Cell on Vibrating Micro Ridges

Directory of Open Access Journals (Sweden)

Haruka Hino

2015-06-01

Full Text Available The effect of micro ridges on cells cultured at a vibrating scaffold has been studied in vitro. Several parallel lines of micro ridges have been made on a disk of transparent polydimethylsiloxane for a scaffold. To apply the vibration on the cultured cells, a piezoelectric element was attached on the outside surface of the bottom of the scaffold. The piezoelectric element was vibrated by the sinusoidal alternating voltage (Vp-p < 16 V at 1.0 MHz generated by a function generator. Four kinds of cells were used in the test: L929 (fibroblast connective tissue of C3H mouse, Hepa1-6 (mouse hepatoma, C2C12 (mouse myoblast, 3T3-L1 (mouse fat precursor cells. The cells were seeded on the micro pattern at the density of 2000 cells/cm2 in the medium containing 10% FBS (fetal bovine serum and 1% penicillin/ streptomycin. After the adhesion of cells in several hours, the cells are exposed to the ultrasonic vibration for several hours. The cells were observed with a phase contrast microscope. The experimental results show that the cells adhere, deform and migrate on the scaffold with micro patterns regardless of the ultrasonic vibration. The effects of the vibration and the micro pattern depend on the kind of cells.

ENIDINE: Vibration and seismic isolation technologies for power generation station applications

International Nuclear Information System (INIS)

Zemanek, T.A.

1994-01-01

ENIDINE Inc. is a world leader in the design and manufacture of shock and vibration mounts. Founded in 1966, the company has two manufacturing facilities, employs over 300 people and supports a worldwide network of distributors and representatives. ENIDINE Inc. is part of the ENIDINE Corporate Group which owns a number of companies that design and manufacture Hydraulic/Pneumatic cylinders, Electromechanical devices, Hydraulic Control Valves and a number of Industrial Distribution companies throughout Europe. In total, the ENIDINE Corporate Group has over 900 employees with annual sales of over $100 million. ENIDINE shock and vibration mounts are used to isolate the vibration of missiles from their guidance systems, pumps from hospital operating equipment and off shore oil rigs, from the shock energy of waves in the North Sea. ENIDINE products can be found on all Boeing and McDonnell Douglas aircraft, as well as many electronic and weapons systems on board Navy ships

Anti vibration bars replacement in Vandellos II steam generators

International Nuclear Information System (INIS)

Vinyes, R.; Leal, R.

1994-01-01

C.N. Vandellos II is equipped with three steam generators Westinghouse model F. The number of tubes is 5626 each SG and the material Inconel 600TT. During the first inservice inspection, in 1989, tube wall thickness reductions were observed due to fretting in zones of contact with the tubes anti vibration bars. In the 2 nd shutdown for refueling (1990) all the tubes subject to this type of degradation were inspected by eddy currents, occurring a significative increase in number of tubes affected as well as the quantity of plugged tubes for that reason. Additionally, Westinghouse performed visual inspection and dimensional control of gaps in the tube bundles. Taking in account the results, the replacement with AVBs of new design was decided. AVBs new design is more complex than the original due to the combination of flexible and expandable bars in order to eliminate gaps between tubes an bars an assure proper bundle support. Given that the installation has to be done under water for shielding, all unions are bolted so that no welding is required. Each one of the bars, 333 per SG, is attached to a support structure consisting in 6 retaining plates and 4 bridge plates. (Author)

Photochemistry at Interfaces

Energy Technology Data Exchange (ETDEWEB)

Eisenthal, Kenneth B [Columbia Univ., New York, NY (United States)

2015-02-24

We have advanced our capabilities to investigate ultrafast excited state dynamics at a liquid interface using a pump to excite molecules to higher electronic states and then probe the subsequent time evolution of the interfacial molecules with femtosecond time delayed vibrational SFG.

Use of a magnetic force exciter to vibrate a piezocomposite generating element in a small-scale windmill

International Nuclear Information System (INIS)

Luong, Hung Truyen; Goo, Nam Seo

2012-01-01

A piezocomposite generating element (PCGE) can be used to convert ambient vibrations into electrical energy that can be stored and used to power other devices. This paper introduces a design of a magnetic force exciter for a small-scale windmill that vibrates a PCGE to convert wind energy into electrical energy. A small-scale windmill was designed to be sensitive to low-speed wind in urban regions for the purpose of collecting wind energy. The magnetic force exciter consists of exciting magnets attached to the device’s input rotor and a secondary magnet fixed at the tip of the PCGE. The PCGE is fixed to a clamp that can be adjusted to slide on the windmill’s frame in order to change the gap between exciting and secondary magnets. Under an applied wind force, the input rotor rotates to create a magnetic force interaction that excites the PCGE. The deformation of the PCGE enables it to generate electric power. Experiments were performed with different numbers of exciting magnets and different gaps between the exciting and secondary magnets to determine the optimal configuration for generating the peak voltage and harvesting the maximum wind energy for the same range of wind speeds. In a battery-charging test, the charging time for a 40 mA h battery was approximately 3 h for natural wind in an urban region. The experimental results show that the prototype can harvest energy in urban regions with low wind speeds and convert the wasted wind energy into electricity for city use. (paper)

Fluid induced structural vibrations in steam generators and heat exchangers

International Nuclear Information System (INIS)

Catton, I.; Adinolfi, P.; Alquaddoomi, O.

2003-01-01

Fluid-elastic instability (FEI) in tube bundle heat exchangers was studied experimentally. The motion of an array of 15 stainless steel vibrating tubes (Φ 25.4mm) in water cross-flow, suspended using stainless steel piano wire has been recorded with a CCD camera. The individual motion and relative motion of the tubes are reported and can be used for computational model validation. The relative displacement of the tubes allows identification of the most potentially damaging patterns of tube bundle vibration. A critical reduced velocity may be determined by specification of an allowable limit on tube motion amplitude. Measurements were made for various tube array configurations, tube natural frequencies and flow conditions. (author)

Vibration-induced particle formation during yogurt fermentation - Industrial vibration measurements and development of an experimental setup.

Science.gov (United States)

Körzendörfer, Adrian; Temme, Philipp; Nöbel, Stefan; Schlücker, Eberhard; Hinrichs, Jörg

2016-07-01

The aim of the study was to investigate the effects of vibrations during yogurt fermentation. Machinery such as pumps and switching valves generate vibrations that may disturb the gelation by inducing large particles. Oscillation measurements on an industrial yogurt production line showed that oscillations are transferred from pumps right up to the fermentation tanks. An experimental setup (20L) was developed to study the effect of vibrations systematically. The fermenters were decoupled with air springs to enable reference fermentations under idle conditions. A vibration exciter was used to stimulate the fermenters. Frequency sweeps (25-1005Hz, periodic time 10s) for 20min from pH5.4 induced large particles. The number of visible particles was significantly increased from 35±4 (reference) to 89±9 particles per 100g yogurt. Rheological parameters of the stirred yogurt samples were not influenced by vibrations. Copyright © 2016 Elsevier Ltd. All rights reserved.

Built-up edge investigation in vibration drilling of Al2024-T6.

Science.gov (United States)

Barani, A; Amini, S; Paktinat, H; Fadaei Tehrani, A

2014-07-01

Adding ultrasonic vibrations to drilling process results in an advanced hybrid machining process, entitled "vibration drilling". This study presents the design and fabrication of a vibration drilling tool by which both rotary and vibrating motions are applied to drill simultaneously. High frequency and low amplitude vibrations were generated by an ultrasonic transducer with frequency of 19.65 kHz. Ultrasonic transducer was controlled by a MPI ultrasonic generator with 3 kW power. The drilling tool and workpiece material were HSS two-flute twist drill and Al2024-T6, respectively. The aim of this study was investigating on the effect of ultrasonic vibrations on built-up edge, surface quality, chip morphology and wear mechanisms of drill edges. Therefore, these factors were studied in both vibration and ordinary drilling. Based on the achieved results, vibration drilling offers less built-up edge and better surface quality compared to ordinary drilling. Copyright © 2014 Elsevier B.V. All rights reserved.

Experimental studies on flow-induced vibration to support steam generator design

International Nuclear Information System (INIS)

Pettigrew, M.J.; Gorman, D.J.

1977-06-01

Vibration experiments were done on small tube bundles of triangular and square lattice configurations in both liquid and two-phase (air-water) cross-flow. The effects of flow velocity, simulated steam quality, lattice orientation, tube location and tube frequency were explored. Tube response to random flow turbulence excitation and fluidelastic instability were observed in both liquid and two-phase cross-flow. Fluidelastic instability criteria and random forcing function characterizations are derived from this work. This information may be used in the vibration analysis of shell-and-tube heat exchanger components. (author)

Adaptive Piezoelectric Absorber for Active Vibration Control

Directory of Open Access Journals (Sweden)

Sven Herold

2016-02-01

Full Text Available Passive vibration control solutions are often limited to working reliably at one design point. Especially applied to lightweight structures, which tend to have unwanted vibration, active vibration control approaches can outperform passive solutions. To generate dynamic forces in a narrow frequency band, passive single-degree-of-freedom oscillators are frequently used as vibration absorbers and neutralizers. In order to respond to changes in system properties and/or the frequency of excitation forces, in this work, adaptive vibration compensation by a tunable piezoelectric vibration absorber is investigated. A special design containing piezoelectric stack actuators is used to cover a large tuning range for the natural frequency of the adaptive vibration absorber, while also the utilization as an active dynamic inertial mass actuator for active control concepts is possible, which can help to implement a broadband vibration control system. An analytical model is set up to derive general design rules for the system. An absorber prototype is set up and validated experimentally for both use cases of an adaptive vibration absorber and inertial mass actuator. Finally, the adaptive vibration control system is installed and tested with a basic truss structure in the laboratory, using both the possibility to adjust the properties of the absorber and active control.

Generation of green frequency comb from chirped χ{sup (2)} nonlinear photonic crystals

Energy Technology Data Exchange (ETDEWEB)

Lai, C.-M. [Department of Electronic Engineering, Ming Chuan University, Taoyuan, Taiwan (China); Chang, K.-H.; Yang, Z.-Y.; Fu, S.-H.; Tsai, S.-T.; Hsu, C.-W.; Peng, L.-H. [Department of Electrical Engineering and Graduate Institute of Photonics and Optoelectronics, National Taiwan University, Taipei, Taiwan (China); Yu, N. E. [Advanced Photonics Research Institute, Gwangju Institute of Science and Technology, Gwangju (Korea, Republic of); Boudrioua, A. [LPL, CNRS - UMR 7538, Université Paris 13, Sorbone Paris Cité (France); Kung, A. H. [Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei, Taiwan (China); Institute of Photonics Technologies, National Tsing Hua University, Hsinchu, Taiwan (China)

2014-12-01

Spectrally broad frequency comb generation over 510–555 nm range was reported on chirped quasi-phase-matching (QPM) χ{sup (2)} nonlinear photonic crystals of 12 mm length with periodicity stepwise increased from 5.9 μm to 7.1 μm. When pumped with nanosecond infrared (IR) frequency comb derived from a QPM optical parametric oscillator (OPO) and spanned over 1040 nm to 1090 nm wavelength range, the 520 nm to 545 nm up-converted green spectra were shown to consist of contributions from (a) second-harmonic generation among the signal or the idler modes, and (b) sum-frequency generation (SFG) from the neighboring pairs of the signal or the idler modes. These mechanisms led the up-converted green frequency comb to have the same mode spacing of 450 GHz as that in the IR-OPO pump comb. As the pump was further detuned from the aforementioned near-degeneracy point and moved toward the signal (1020–1040 nm) and the idler (1090–1110 nm) spectral range, the above QPM parametric processes were preserved in the chirped QPM devices to support up-converted green generation in the 510–520 nm and the 545–555 nm spectral regime. Additional 530–535 nm green spectral generation was also observed due to concurrence of multi-wavelength SFG processes between the (signal, idler) mode pairs. These mechanisms facilitate the chirped QPM device to support a single-pass up-conversion efficiency ∼10% when subject to an IR-OPO pump comb with 200 mW average power operated near- or off- the degeneracy point.

Calculation of ground vibration spectra from heavy military vehicles

Science.gov (United States)

Krylov, V. V.; Pickup, S.; McNuff, J.

2010-07-01

The demand for reliable autonomous systems capable to detect and identify heavy military vehicles becomes an important issue for UN peacekeeping forces in the current delicate political climate. A promising method of detection and identification is the one using the information extracted from ground vibration spectra generated by heavy military vehicles, often termed as their seismic signatures. This paper presents the results of the theoretical investigation of ground vibration spectra generated by heavy military vehicles, such as tanks and armed personnel carriers. A simple quarter car model is considered to identify the resulting dynamic forces applied from a vehicle to the ground. Then the obtained analytical expressions for vehicle dynamic forces are used for calculations of generated ground vibrations, predominantly Rayleigh surface waves, using Green's function method. A comparison of the obtained theoretical results with the published experimental data shows that analytical techniques based on the simplified quarter car vehicle model are capable of producing ground vibration spectra of heavy military vehicles that reproduce basic properties of experimental spectra.

Study on antilock brake system with elastic membrane vibration generated by controlled solenoid excitation

International Nuclear Information System (INIS)

Wibowo,; Zakaria,; Lambang, Lullus; Triyono,; Muhayat, Nurul

2016-01-01

The most effective chassis control system for improving vehicle safety during severe braking is anti-lock braking system (ABS). Antilock effect can be gained by vibrate the pad brake at 7 to 20 cycle per second. The aim of this study is to design a new method of antilock braking system with membrane elastic vibrated by solenoid. The influence of the pressure fluctuations of brake fluid is investigated. Vibration data is collected using a small portable accelerometer-slam stick. The experiment results that the vibration of brake pad caused by controlled solenoid excitation at 10 Hz is obtained by our new method. The result of measurements can be altered by varying brake fluid pressure.

Study on antilock brake system with elastic membrane vibration generated by controlled solenoid excitation

Energy Technology Data Exchange (ETDEWEB)

Wibowo,, E-mail: wibowo-uns@yahoo.com; Zakaria,, E-mail: zakaaria27@gmail.com; Lambang, Lullus, E-mail: lulus-l@yahoo.com; Triyono,, E-mail: tyon-bila@yahoo.co.id; Muhayat, Nurul, E-mail: nurulmuhayat@ymail.com [Mechanical Engineering Department, Sebelas Maret University, Surakarta 57128 (Indonesia)

2016-03-29

The most effective chassis control system for improving vehicle safety during severe braking is anti-lock braking system (ABS). Antilock effect can be gained by vibrate the pad brake at 7 to 20 cycle per second. The aim of this study is to design a new method of antilock braking system with membrane elastic vibrated by solenoid. The influence of the pressure fluctuations of brake fluid is investigated. Vibration data is collected using a small portable accelerometer-slam stick. The experiment results that the vibration of brake pad caused by controlled solenoid excitation at 10 Hz is obtained by our new method. The result of measurements can be altered by varying brake fluid pressure.

Protein adsorption at the electrified air-water interface: implications on foam stability.

Science.gov (United States)

Engelhardt, Kathrin; Rumpel, Armin; Walter, Johannes; Dombrowski, Jannika; Kulozik, Ulrich; Braunschweig, Björn; Peukert, Wolfgang

2012-05-22

The surface chemistry of ions, water molecules, and proteins as well as their ability to form stable networks in foams can influence and control macroscopic properties such as taste and texture of dairy products considerably. Despite the significant relevance of protein adsorption at liquid interfaces, a molecular level understanding on the arrangement of proteins at interfaces and their interactions has been elusive. Therefore, we have addressed the adsorption of the model protein bovine serum albumin (BSA) at the air-water interface with vibrational sum-frequency generation (SFG) and ellipsometry. SFG provides specific information on the composition and average orientation of molecules at interfaces, while complementary information on the thickness of the adsorbed layer can be obtained with ellipsometry. Adsorption of charged BSA proteins at the water surface leads to an electrified interface, pH dependent charging, and electric field-induced polar ordering of interfacial H(2)O and BSA. Varying the bulk pH of protein solutions changes the intensities of the protein related vibrational bands substantially, while dramatic changes in vibrational bands of interfacial H(2)O are simultaneously observed. These observations have allowed us to determine the isoelectric point of BSA directly at the electrolyte-air interface for the first time. BSA covered air-water interfaces with a pH near the isoelectric point form an amorphous network of possibly agglomerated BSA proteins. Finally, we provide a direct correlation of the molecular structure of BSA interfaces with foam stability and new information on the link between microscopic properties of BSA at water surfaces and macroscopic properties such as the stability of protein foams.

Correlation of operating parameters on turbine shaft vibrations

Science.gov (United States)

Dixit, Harsh Kumar; Rajora, Rajeev

2016-05-01

The new generation of condition monitoring and diagnostics system plays an important role in efficient functioning of power plants. In most of the rotating machine, defects can be detected by such a system much before dangerous situation occurs. It allows the efficient use of stationary on-line continuous monitoring system for condition monitoring and diagnostics as well. Condition monitoring of turbine shaft can not only reduce expenses of maintenance of turbo generator of power plants but also prevents likely shutdown of plant, thereby increases plant load factor. Turbo visionary parameters are essential part of health diagnosis system of turbo generator. Particularly steam pressure, steam temperature and lube oil temperature are important parameters to monitor because they are having much influence on turbine shaft vibration and also governing systems are available for change values of those parameters. This paper includes influence of turbo visionary parameters i.e., steam temperature, steam pressure, lube oil temperature, turbine speed and load on turbine shaft vibration at turbo generator at 195 MW unit-6,Kota Super Thermal Power Station by measuring vibration amplitude and analyze them in MATLAB.

High-Power, Solid-State, Deep Ultraviolet Laser Generation

Directory of Open Access Journals (Sweden)

Hongwen Xuan

2018-02-01

Full Text Available At present, deep ultraviolet (DUV lasers at the wavelength of fourth harmonics of 1 μm (266 nm/258 nm and at the wavelength of 193 nm are widely utilized in science and industry. We review the generation of these DUV lasers by nonlinear frequency conversion processes using solid-state/fiber lasers as the fundamental frequency. A DUV laser at 258 nm by fourth harmonics generation (FHG could achieve an average power of 10 W with a beam quality of M2 < 1.5. Moreover, 1 W of average power at 193 nm was obtained by sum-frequency generation (SFG. A new concept of 193-nm DUV laser generation by use of the diamond Raman laser is also introduced. A proof-of-principle experiment of the diamond Raman laser is reported with the conversion efficiency of 23% from the pump to the second Stokes wavelength, which implies the potential to generate a higher power 193 nm DUV laser in the future.

Ultrafast Vibrational Spectrometer for Engineered Nanometric Energetic Materials

National Research Council Canada - National Science Library

Dlott, Dana

2002-01-01

.... The needed equipment was ordered and installed, and assembled into a working SFG set up that has been tested on a model system consisting of a self assembled monolayer of alkane on gold. The next step will be to finish integrating the carbon dioxide laser system and to begin looking at aluminum based energetic materials.

Vibration Measurement with PULSE and DSPACE Equipment

Directory of Open Access Journals (Sweden)

Radim KLEČKA

2009-06-01

Full Text Available This contribution describes techniques and results of measurement with TIRA vibration generator. A method of experimental modal analysis allows next restore of vibration data. The goal is check validity of head expanders and screw connection. This process is based to using ME’scope environment. Another goal is check possibilities of dSPACE platform to vibration measurement. This task includes design of connection between dSPACE system and power amplifier, creating of graphical user interface and analyzing main configuration parameters to improve quality of drive signal.

Energy-Saving Vibration Impulse Coal Degradation at Finely Dispersed Coal-Water Slurry Preparation

Directory of Open Access Journals (Sweden)

Moiseev V.A.

2015-01-01

Full Text Available Theoretical and experimental research results of processes of finely dispersed coal-water slurry preparation for further generation of energetic gas in direct flow and vortex gas generator plants have been presented. It has been stated that frequency parameters of parabolic vibration impulse mill influence degradation degree. Pressure influence on coal parameters in grinding cavity has been proven. Experimental researches have proven efficiency of vibration impulse mill with unbalanced mass vibrator generator development. Conditions of development on intergranular walls of coal cracks have been defined.

Heat exchanger vibration

International Nuclear Information System (INIS)

Richards, D.J.W.

1977-01-01

The heat exchangers of various types are common items of plant in the generation and transmission of electricity. The amount of attention given to the flow-induced vibrations of heat exchangers by designers is usually related to the operational history of similar items of plant. Consequently, if a particular design procedure yields items of plant which behave in a satisfactory manner during their operational life, there is little incentive to improve or refine the design procedure. On the other hand, failures of heat exchangers clearly indicate deficiencies in the design procedures or in the data available to the designer. When such failures are attributable to flow-induced vibrations, the identification of the mechanisms involved is a prime importance. Ideally, basic research work provides the background understanding and the techniques necessary to be able to identify the important mechanisms. In practice, the investigation of a flow-induced vibration problem may identify the presence of mechanisms but may not be able to quantify their effects adequately. In these circumstances the need for additional work is established and the objectives of the research programme emerge. The purpose of this paper is to outline the background to the current research programme at C.E.R.L. on heat exchanger vibration

Heat exchanger vibration

Energy Technology Data Exchange (ETDEWEB)

Richards, D J.W. [CERL, CEGB, Leatherhead, Surrey (United Kingdom)

1977-12-01

The heat exchangers of various types are common items of plant in the generation and transmission of electricity. The amount of attention given to the flow-induced vibrations of heat exchangers by designers is usually related to the operational history of similar items of plant. Consequently, if a particular design procedure yields items of plant which behave in a satisfactory manner during their operational life, there is little incentive to improve or refine the design procedure. On the other hand, failures of heat exchangers clearly indicate deficiencies in the design procedures or in the data available to the designer. When such failures are attributable to flow-induced vibrations, the identification of the mechanisms involved is a prime importance. Ideally, basic research work provides the background understanding and the techniques necessary to be able to identify the important mechanisms. In practice, the investigation of a flow-induced vibration problem may identify the presence of mechanisms but may not be able to quantify their effects adequately. In these circumstances the need for additional work is established and the objectives of the research programme emerge. The purpose of this paper is to outline the background to the current research programme at C.E.R.L. on heat exchanger vibration.

Non-traditional vibration mitigation methods for reciprocating compressor system

NARCIS (Netherlands)

Eijk, A.; Lange, T.J. de; Vreugd, J. de; Slis, E.J.P.

2016-01-01

Reciprocating compressors generate vibrations caused by pulsation-induced forces, mechanical (unbalanced) free forces and moments, crosshead guide forces and cylinder stretch forces. The traditional way of mitigating the vibration and cyclic stress levels to avoid fatigue failure of parts of the

SFG and AFM Studies of Polymer Surface Monolayers

Science.gov (United States)

Somorjai, Gabor A.

2003-03-01

Sum frequency generation vibrational spectroscopy and atomic force microscopy techniques were utilized to study the structure and composition of polymer surfaces ranging from polyethylene and polypropylene to copolymers of polyurethane and polystyrene. The surface methyl groups aligned perpendicular to the surface above the glass transition temperature of polypropylene. Large side groups such as the phenyl group on polystyrene is also near the surface normal at the polymer-air interface. At the air interface hydrophobic groups are dominant on the polymer surface while at solid-water interface hydrophilic groups segregate to the surface. Minimizing surface energy is the cause of readjusting the surface composition at polymer-water interfaces as compared to polymer-air interfaces. Upon stretching the soft component of two-component polymer systems segregates to the surface and both the surface structure and the surface composition undergo reversible or irreversible changes depending on the magnitude of the stretch. Since the heart beat forces bio-polymers to stretch over 40 million times a year the molecular behavior due to stretching has important physiological consequences.

General vibration monitoring: Experimental hall

International Nuclear Information System (INIS)

Jendrzejczyk, J.A.; Wambsganss, M.W.; Smith, R.K.

1993-01-01

The reported vibration data were generated from measurements made on the experimental hall floor on December 2, 1992. At the time of the measurements, the ESRF hydrolevel was set-up in the Early Assembly Area (EAA) of the experimental hall and was being used to measure static displacement (settlement) of the floor. The vibration measurement area was on and adjacent to the EAA, in the vicinity of the ESRF hydrolevel test which was in progress. This report summarizes the objectives, instrumentation, measurement locations, observations, and conclusions, and provides selected results in the form of RMS vs. time plots, and power spectral densities from which frequency information can be derived. Measured response amplitudes were within the vibration criteria established for the APS

Experimental Analysis of a Piezoelectric Energy Harvesting System for Harmonic, Random, and Sine on Random Vibration

Energy Technology Data Exchange (ETDEWEB)

Cryns, Jackson W.; Hatchell, Brian K.; Santiago-Rojas, Emiliano; Silvers, Kurt L.

2013-07-01

Formal journal article Experimental analysis of a piezoelectric energy harvesting system for harmonic, random, and sine on random vibration Abstract: Harvesting power with a piezoelectric vibration powered generator using a full-wave rectifier conditioning circuit is experimentally compared for varying sinusoidal, random and sine on random (SOR) input vibration scenarios. Additionally, the implications of source vibration characteristics on harvester design are discussed. Studies in vibration harvesting have yielded numerous alternatives for harvesting electrical energy from vibrations but piezoceramics arose as the most compact, energy dense means of energy transduction. The rise in popularity of harvesting energy from ambient vibrations has made piezoelectric generators commercially available. Much of the available literature focuses on maximizing harvested power through nonlinear processing circuits that require accurate knowledge of generator internal mechanical and electrical characteristics and idealization of the input vibration source, which cannot be assumed in general application. In this manuscript, variations in source vibration and load resistance are explored for a commercially available piezoelectric generator. We characterize the source vibration by its acceleration response for repeatability and transcription to general application. The results agree with numerical and theoretical predictions for in previous literature that load optimal resistance varies with transducer natural frequency and source type, and the findings demonstrate that significant gains are seen with lower tuned transducer natural frequencies for similar source amplitudes. Going beyond idealized steady state sinusoidal and simplified random vibration input, SOR testing allows for more accurate representation of real world ambient vibration. It is shown that characteristic interactions from more complex vibrational sources significantly alter power generation and power processing

Experimental demonstration of novel cascaded SFG+DFG wavelength conversion of picosecond pulses in LiNbO 3 waveguides

Science.gov (United States)

Wang, Jian; Sun, Junqiang; Luo, Chuanhong

2006-06-01

A novel cascaded χ (2) wavelength conversion of picosecond pulses based on sum frequency generation and difference frequency generation (SFG+DFG) is proposed and experimentally demonstrated in LiNbO 3 waveguides. The signal pulse with 40-GHz repetition rate and 1.57-ps pulse width is adopted. First of all, high conversion efficiency about -18.93dB can be achieved with low power level required for both two pump lights, which is greatly enhanced approximately 8dB compared with the conventional cascaded second-order nonlinear interactions (SHG+DFG) with a single and much higher power pump. Secondly, the wavelength of the converted idler wave can be tuned from 1527.4 to 1540.5nm when the signal wavelength is changed from 1561.9 to 1548.4nm, and about 13.1nm converted idler bandwidth is achieved with the conversion efficiency higher than -31dB. Thirdly, two pump wavelengths can be separated as large as 17.3nm. Meanwhile, when one pump wavelength is fixed at 1549.1nm, the other can be tuned within a wide wavelength range about 7.6nm with the conversion efficiency higher than -34dB, which is much larger than that in the SHG+DFG situation. Finally, the temporal waveform of the converted idler pulse is observed with rather clear appearance achieved, and no obvious changes of the pulse shape and width are found compared with its corresponding original injected signal, showing that our proposed scheme exhibits a very good conversion performance.

General vibration monitoring: Utility Building, August 1992

International Nuclear Information System (INIS)

Jendrzejczyk, J.A.; Wambsganss, M.W.; Smith, R.K.

1993-01-01

This vibration data was generated from measurements made on 8/12/92. The contents are self explanatory. They are baseline measurements and no exceptionally large vibration amplitude or response was observed. These measurements represent baseline measurements, i.e., measurements with no driving forces active, made on the utility building, a service building for the Advanced Photon Source at Argonne National Laboratory

Experimental evaluation of vibrations in heat exchangers

International Nuclear Information System (INIS)

Martin Ghiselli, A.

1997-01-01

Flow induced vibrations may produce damage of heat exchangers, condensers and steam generators tubes. To evaluate this problem a set of tests were developed to know the real support state of the tubes, which have great influence on the vibration response. This paper include a description of the tests and the results obtained applying them on a heat exchanger equipment. (author) [es

Vibrations in pipelines of nuclear power plants

International Nuclear Information System (INIS)

Leal, M.R.L.V.; Bevilacqua, L.

1984-01-01

It is presented the main causes of vibrations in nuclear power plants pipelines to allow the identification of critical areas and correct the errors during the specification design. The methods of vibration analysis to give subsidies in the determination of the corrective providences when the problem appears during the commissioning or the generation energy, are also presented. (M.C.K.) [pt

Construction of a Vibration Monitoring System for HANARO's Rotating Machinery and Analysis of Pump Vibration Signals

International Nuclear Information System (INIS)

Ryu, Jeong Soo; Yoon, Doo Byung

2005-01-01

HANARO is an open-tank-in-pool type research reactor with a thermal power of 30MW. In order to remove the heat generated by the reactor core and the reflector vessel, primary cooling pumps and reflector cooling pumps circulate coolant. These pumps are installed at the RCI(Reactor Concrete Island) which is covered by heavy concrete hatches. For the prevention of an abnormal operation of these pumps in the RCI, it is necessary to construct a vibration monitoring system that provides an alarm signal to the reactor control room when the rotating speed or the vibration level exceeds the allowable limit. The first objective of this work is to construct a vibration monitoring system for HANARO's rotating machinery. The second objective is to verify the possibility of condition monitoring of the rotating machinery. To construct a vibration monitoring system, as a first step, the standards and references related to the vibration monitoring system were investigated. In addition, to determine the number and the location of sensors that can effectively characterize the overall vibration of a pump, the vibration of the primary cooling pumps and the reflector cooling pumps were measured. Based on these results, detailed construction plans for the vibration monitoring system for HANARO were established. Then, in accordance with the construction plans, the vibration monitoring system for HANARO's rotating machinery was manufactured and installed at HANARO. To achieve the second objective, FFT analysis and bearing fault detection of the measured vibration signals were performed. The analysis results demonstrate that the accelerometers mounted at the bearing locations of the pumps can effectively monitor the pump condition

14th International Conference on Acoustics and Vibration of Mechanical Structures

CERN Document Server

Marinca, Vasile

2018-01-01

This book is a collection of papers presented at Acoustics and Vibration of Mechanical Structures 2017 – AVMS 2017 – highlighting the current trends and state-of-the-art developments in the field. It covers a broad range of topics, such as noise and vibration control, noise and vibration generation and propagation, the effects of noise and vibration, condition monitoring and vibration testing, modeling, prediction and simulation of noise and vibration, environmental and occupational noise and vibration, noise and vibration attenuators, as well as biomechanics and bioacoustics. The book also presents analytical, numerical and experimental techniques for evaluating linear and non-linear noise and vibration problems (including strong nonlinearity). It is primarily intended for academics, researchers and professionals, as well as PhD students in various fields of the acoustics and vibration of mechanical structures.

Vibration Suppression of Electronic Box by a Dual Function Piezoelectric Energy Harvester-Tuned Vibration Absorber

Directory of Open Access Journals (Sweden)

Sajid Rafique

2014-04-01

Full Text Available Over the past few years, remarkable developments in piezoelectric materials have motivated many researchers to work in the field of vibration energy harvesting by using piezoelectric beam like smart structures. This paper aimed to present the most recent application of a dual function piezoelectric device which can suppress vibration and harvest vibration energy simultaneously and a brief illustration of conventional mechanical and electrical TVAs (Tuned Vibration Absorber. It is shown that the proposed dual function device combines the benefits of conventional mechanical and electrical TVAs and reduces their relative disadvantages. Conversion of mechanical energy into electrical energy introduces damping and, hence, the optimal damping required by this TVA is generated by the energy harvesting effects. This paper presents the methodology of implementing the theory of 'electromechanical' TVAs to suppress the response of any real world structure. The work also illustrates the prospect of extensive applications of such novel "electromechanical" TVAs in defence and industry. The results show that the optimum degree of vibration suppression of an electronic box is achieved by this dual function TVA through suitable tuning of the attached electrical circuitry

Vibration suppression of electronic box by a dual function piezoelectric energy harvester-tuned vibration absorber

International Nuclear Information System (INIS)

Rafique, S.; Shah, S.

2014-01-01

Over the past few years, remarkable developments in piezoelectric materials have motivated many researchers to work in the field of vibration energy harvesting by using piezoelectric beam like smart structures. This paper aimed to present the most recent application of a dual function piezoelectric device which can suppress vibration and harvest vibration energy simultaneously and a brief illustration of conventional mechanical and electrical TVAs (Tuned Vibration Absorber). It is shown that the proposed dual function device combines the benefits of conventional mechanical and electrical TVAs and reduces their relative disadvantages. Conversion of mechanical energy into electrical energy introduces damping and, hence, the optimal damping required by this TVA is generated by the energy harvesting effects. This paper presents the methodology of implementing the theory of electromechanical TVAs to suppress the response of any real world structure. The work also illustrates the prospect of extensive applications of such novel electromechanical TVAs in defence and industry. The results show that the optimum degree of vibration suppression of an electronic box is achieved by this dual function TVA through suitable tuning of the attached electrical circuitry. (author)

Effect of Ultrasonic Vibration on Proliferation and Differentiation of Cells

Directory of Open Access Journals (Sweden)

Haruka Hino

2016-12-01

Full Text Available The effect of mechanical stimulation of vibration on proliferation and differentiation of cells has been studied in vitro. To apply the vibration on the cells, a piezoelectric element was attached on the outside surface of the bottom of the culture plate of six wells. The piezoelectric element was vibrated by sinusoidally alternating voltage at 1.0 MHz generated by a function generator. Five kinds of cells were used in the experiment: C2C12 (mouse myoblast cell, L929 (fibroblast connective tissue of mouse, Hepa1-6 (mouse hepatoma cell, HUVEC (human umbilical vein endothelial cell, and Neuro-2a (mouse neural crest-derived cell line. After the incubation for 24 hours, cells were exposed to the ultrasonic vibration intermittently for three days: for thirty minutes per day. At the end of the experiment, the number of cells was counted by colorimetric method with a microplate photometer. In the case of Neuro-2a, the total length of the neurite was calculated at the microscopic image. The experimental study shows following results. Cells are exfoliated by the strong vibration. Proliferation and differentiation of cells are accelerated with mild vibration. The optimum intensity of vibration depends on the kind of cells.

Vibrational sum-frequency generation spectroscopy of lipid bilayers at repetition rates up to 100 kHz

Science.gov (United States)

Yesudas, Freeda; Mero, Mark; Kneipp, Janina; Heiner, Zsuzsanna

2018-03-01

Broadband vibrational sum-frequency generation (BB-VSFG) spectroscopy has become a well-established surface analytical tool capable of identifying the orientation and structure of molecular layers. A straightforward way to boost the sensitivity of the technique could be to increase the laser repetition rate beyond that of standard BB-VSFG spectrometers, which rely on Ti:sapphire lasers operating at repetition rates of 1-5 kHz. Nevertheless, possible thermally induced artifacts in the vibrational spectra due to higher laser average powers are unexplored. Here, we discuss laser power induced temperature accumulation effects that distort the BB-VSFG spectra of 1,2-diacyl-sn-glycero-3-phosphocholine at an interface between two transparent phases at repetition rates of 5, 10, 50, and 100 kHz at constant pulse energy. No heat-induced distortions were found in the spectra, suggesting that the increase in the laser repetition rate provides a feasible route to an improved signal-to-noise ratio or shorter data acquisition times in BB-VSFG spectroscopy for thin films on transparent substrates. The results have implications for future BB-VSFG spectrometers pushing the detection limit for molecular layers with low surface coverage.

Predictive analyses of flow-induced vibration and fretting wear in steam generator tubes

International Nuclear Information System (INIS)

Axisa, F.

1989-01-01

Maintaining the service life of PWR steam generators under highly reliable conditions requires a complex design to prevent various damaging processes, including those related to flow induced vibration. Predictive analyses have to rely on numerical tools to compute the vibratory response of multi-supported tubes in association with experimental data and semi-empirical relationships for quantifying flow-induced excitation mechanisms and tube damaging processes. In the presence of loose supports tube dynamics becomes highly nonlinear in nature. To deal with such problems CEA and FRAMATOME developed a computer program called GERBOISE. This paper provides a short description of an experimental program currently in progress at CEN Saclay to validate the numerical methods implemented in GERBOISE. According to the results obtained so far reasonable agreement is obtained between experiment and numerical simulation, especially as averaged quantities are concerned

An electromagnetic inerter-based vibration suppression device

International Nuclear Information System (INIS)

Gonzalez-Buelga, A; Clare, L R; Neild, S A; Jiang, J Z; Inman, D J

2015-01-01

This paper describes how an inerter-based device for structural vibration suppression can be realized using an electromagnetic transducer such as a linear motor. When the motor shaft moves, a difference of voltage is generated across the transducer coil. The voltage difference is proportional to the relative velocity between its two terminals. The electromagnetic transducer will exert a force proportional to current following the Lorentz principle if the circuit is closed around the transducer coil. If an electronic circuit consisting of a capacitor, an inductance and a resistance with the appropriate configuration is connected, the resulting force reflected back into the mechanical domain is equivalent to that achieved by a mechanical inerter-based device. The proposed configuration is easy to implement and very versatile, provided a high quality conversion system with negligible losses. With the use of electromagnetic devices, a new generation of vibration absorbers can be realized, for example in the electrical domain it would be relatively uncomplicated to synthesize multi-frequency or real time tunable vibration absorbers by adding electrical components in parallel. In addition by using resistance emulators in the electrical circuits, part of the absorbed vibration energy can be converted into usable power. Here an electromagnetic tuned inerter damper (E-TID) is tested experimentally using real time dynamic substructuring. A voltage compensation unit was developed in order to compensate for coil losses. This voltage compensation unit requires power, which is acquired through harvesting from the vibration energy using a resistance emulator. A power balance analysis was developed in order to ensure the device can be self sufficient. Promising experimental results, using this approach, have been obtained and are presented in this paper. The ultimate goal of this research is the development of autonomous electromagnetic vibration absorbers, able to harvest energy

A study on the evaluation of vibration effect and the development of vibration reduction method for Wolsung unit 1 main steam piping

Energy Technology Data Exchange (ETDEWEB)

Lee, Hyun; Kim, Yeon Whan [Korea Electric Power Corp. (KEPCO), Taejon (Korea, Republic of). Research Center; Kim, Tae Ryong; Park, Jin Ho [Korea Atomic Energy Research Inst., Daeduk (Korea, Republic of)

1996-08-01

The main steam piping of nuclear power plant which runs between steam generator and high pressure turbine has been experienced to have a severe effect on the safe operation of the plant due to the vibration induced by the steam flowing inside the piping. The imposed cyclic loads by the vibration could result in the degradation of the related structures such as connection parts between main instruments, valves, pipe supports and building. The objective of the study is to reduce the vibration level of Wolsung nuclear power plant unit 1 main steam pipeline by analyzing vibration characteristics of the piping, identifying sources of the vibration and developing a vibration reduction method .The location of the maximum vibration is piping between the main steam header and steam chest .The stress level was found to be within the allowable limit .The main vibration frequency was found to be 4{approx}6 Hz which is the same as the natural frequency from model test .A vibration reduction method using pipe supports of energy absorbing type(WEAR)is selected .The measured vibration level after WEAR installation was reduced about 36{approx}77% in displacement unit (author). 36 refs., 188 figs.

Researches Concerning to Minimize Vibrations when Processing Normal Lathe

Directory of Open Access Journals (Sweden)

Lenuța Cîndea

2015-09-01

Full Text Available In the cutting process, vibration is inevitable appearance, and in situations where the amplitude exceeds the limits of precision dimensional and shape of the surfaces generated vibrator phenomenon is detrimental.Field vibration is an issue of increasingly developed, so the futures will a better understanding of them and their use even in other sectors.The paper developed experimental measurement of vibrations at the lathe machining normal. The scheme described kinematical machine tool, cutting tool, cutting conditions, presenting experimental facility for measuring vibration occurring at turning. Experimental results have followed measurement of amplitude, which occurs during interior turning the knife without silencer incorporated. The tests were performed continuously for different speed, feed and depth of cut.

Time-varying output performances of piezoelectric vibration energy harvesting under nonstationary random vibrations

Science.gov (United States)

Yoon, Heonjun; Kim, Miso; Park, Choon-Su; Youn, Byeng D.

2018-01-01

Piezoelectric vibration energy harvesting (PVEH) has received much attention as a potential solution that could ultimately realize self-powered wireless sensor networks. Since most ambient vibrations in nature are inherently random and nonstationary, the output performances of PVEH devices also randomly change with time. However, little attention has been paid to investigating the randomly time-varying electroelastic behaviors of PVEH systems both analytically and experimentally. The objective of this study is thus to make a step forward towards a deep understanding of the time-varying performances of PVEH devices under nonstationary random vibrations. Two typical cases of nonstationary random vibration signals are considered: (1) randomly-varying amplitude (amplitude modulation; AM) and (2) randomly-varying amplitude with randomly-varying instantaneous frequency (amplitude and frequency modulation; AM-FM). In both cases, this study pursues well-balanced correlations of analytical predictions and experimental observations to deduce the relationships between the time-varying output performances of the PVEH device and two primary input parameters, such as a central frequency and an external electrical resistance. We introduce three correlation metrics to quantitatively compare analytical prediction and experimental observation, including the normalized root mean square error, the correlation coefficient, and the weighted integrated factor. Analytical predictions are in an excellent agreement with experimental observations both mechanically and electrically. This study provides insightful guidelines for designing PVEH devices to reliably generate electric power under nonstationary random vibrations.

Flow Instabilities and Main Steam Line Vibrations in a Pressurized Water Reactor

International Nuclear Information System (INIS)

Henriksson, Mats; Westin, Johan; Granhall, Tord; Andersson, Lars; Bjerke, Lars-Erik

2002-01-01

Severe vibrational problems occurred in the main steam system of a PWR nuclear power plant, about 18 months after a steam generator replacement had been carried out. The magnitude of the vibrations reached levels at which the operators had to reduce power in order to stay within the operating limits imposed by the nuclear inspectorate. To solve the problem the following analyses methods were employed: - Testing the influence on vibration level from different modes of plant operation; - Analyses of plant measurement data; - Calculations of: hydraulic behaviour of the system, structural dynamic behaviour of the system, flow at the steam generator outlet. Scale model testing of the steam generator outlet region. Hydraulic flow disturbances in the main steam system were measured using pressure and strain gauges, which made it possible to track individual pressure pulses propagating through the main steam system. Analyses showed that the pressure pulses causing the vibration originated from the vicinity of the steam generator outlet. By using computer codes for network fluid flow analyses the pressure pulses found in the measurement traces could be generated in calculations. Careful studies of the flow at the steam generator outlet region, using model testing in a 1:3 scale model as well as transient 3D CFD calculations, gave clear indications that flow separation occurred at the steam generator outlet nozzle and at the first bend. Finally, by substituting the outlet nozzle for a different design with a multi-port nozzle, the steam line vibration problem has been solved. (authors)

Energy scavenging from environmental vibration.

Energy Technology Data Exchange (ETDEWEB)

Galchev, Tzeno (University of Michigan); Apblett, Christopher Alan; Najafi, Khalil (University of Michigan)

2009-10-01

The goal of this project is to develop an efficient energy scavenger for converting ambient low-frequency vibrations into electrical power. In order to achieve this a novel inertial micro power generator architecture has been developed that utilizes the bi-stable motion of a mechanical mass to convert a broad range of low-frequency (< 30Hz), and large-deflection (>250 {micro}m) ambient vibrations into high-frequency electrical output energy. The generator incorporates a bi-stable mechanical structure to initiate high-frequency mechanical oscillations in an electromagnetic scavenger. This frequency up-conversion technique enhances the electromechanical coupling and increases the generated power. This architecture is called the Parametric Frequency Increased Generator (PFIG). Three generations of the device have been fabricated. It was first demonstrated using a larger bench-top prototype that had a functional volume of 3.7cm3. It generated a peak power of 558{micro}W and an average power of 39.5{micro}W at an input acceleration of 1g applied at 10 Hz. The performance of this device has still not been matched by any other reported work. It yielded the best power density and efficiency for any scavenger operating from low-frequency (<10Hz) vibrations. A second-generation device was then fabricated. It generated a peak power of 288{micro}W and an average power of 5.8{micro}W from an input acceleration of 9.8m/s{sup 2} at 10Hz. The device operates over a frequency range of 20Hz. The internal volume of the generator is 2.1cm{sup 3} (3.7cm{sup 3} including casing), half of a standard AA battery. Lastly, a piezoelectric version of the PFIG is currently being developed. This device clearly demonstrates one of the key features of the PFIG architecture, namely that it is suitable for MEMS integration, more so than resonant generators, by incorporating a brittle bulk piezoelectric ceramic. This is the first micro-scale piezoelectric generator capable of <10Hz operation. The

Enhanced vibration diagnostics using vibration signature analysis

International Nuclear Information System (INIS)

Ahmed, S.; Shehzad, K.; Zahoor, Y.; Mahmood, A.; Bibi, A.

2001-01-01

Symptoms will appear in equipment, as well as in human beings. when 'suffering from sickness. Symptoms of abnormality in equipment are vibration, noise, deformation, temperature, pressure, electric current, crack, wearing, leakage etc. these are called modes of failure. If the mode of failure is vibration then the vibration signature analysis can be effectively used in order to diagnose the machinery problems. Much valuable information is contained within these vibration 'Spectra' or 'Signatures' but is only of use if the analyst can unlock its 'Secrets'. This paper documents a vibration problem in the motor of a centrifugal pump (Type ETA). It focuses mainly on the roll of modern vibration monitoring system in problem analysis. The problem experienced was the motor unstability and noise due to high vibration. Using enhanced vibration signature data, the problem was analyzed. which suggested that the rotor eccentricity was the cause of excessive noise and vibration in the motor. In conclusion, advanced electronic monitoring and diagnostic systems provide powerful information for machine's condition assessment and problem analysis. Appropriate interpretation and use of this information is important for accurate and effective vibration analysis. (author)

Power-Generation Characteristics After Vibration and Thermal Stresses of Thermoelectric Unicouples with CoSb3/Ti/Mo(Cu) Interfaces

Science.gov (United States)

Bae, Kwang Ho; Choi, Soon-Mok; Kim, Kyung-Hun; Choi, Hyoung-Seuk; Seo, Won-Seon; Kim, Il-Ho; Lee, Soonil; Hwang, Hae Jin

2015-06-01

Reliability tests for thermoelectric unicouples were carried out to investigate the adhesion properties of CoSb3/Ti/Mo(Cu) interfaces. The n-type In0.25 Co3.95Ni0.05Sb12 and p-type In0.25Co3FeSb12 bulks were prepared for fabricating a thermoelectric unicouple (one p- n couple) by an induction melting and a spark plasma sintering process. Mo-Cu alloy was selected as an electrode for the unicouples due to its high melting temperature and proper work function value. Many thermoelectric unicouples with the CoSb3/Ti/Mo(Cu) interfaces were fabricated with the proper brazing materials by means of a repeated firing process. Reliability of the unicouples with the interfaces was evaluated by a vibration test and a thermal cycling test. After the thermal cycling and vibration tests, the power-generation characteristics of the unicouples were compared with the unicouples before the tests. Even after the vibration test, electrical power with a power density of 0.5 W/cm2 was generated. The Ti-interlayer is considered as a possible candidate for making a reliable unicouple with high adhesion strength. With the thermal cycling test, the resistance of the unicouple increased and the electrical power from the unicouple decreased. A failure mode by the thermal cycling test was ascribed to a complex effect of micro-cracks originated from the thermal stress and oxidation problem of the thermoelectric materials; that is, a thick oxide layer more than 300 μm was detected after a high-temperature durability test of n-type In0.25Co3.95Ni0.05Sb12 material at 773 K in air for 7 days.

SFG synthesis of general high-order all-pass and all-pole current transfer functions using CFTAs.

Science.gov (United States)

Tangsrirat, Worapong

2014-01-01

An approach of using the signal flow graph (SFG) technique to synthesize general high-order all-pass and all-pole current transfer functions with current follower transconductance amplifiers (CFTAs) and grounded capacitors has been presented. For general nth-order systems, the realized all-pass structure contains at most n + 1 CFTAs and n grounded capacitors, while the all-pole lowpass circuit requires only n CFTAs and n grounded capacitors. The resulting circuits obtained from the synthesis procedure are resistor-less structures and especially suitable for integration. They also exhibit low-input and high-output impedances and also convenient electronic controllability through the g m-value of the CFTA. Simulation results using real transistor model parameters ALA400 are also included to confirm the theory.

SFG Synthesis of General High-Order All-Pass and All-Pole Current Transfer Functions Using CFTAs

Directory of Open Access Journals (Sweden)

Worapong Tangsrirat

2014-01-01

Full Text Available An approach of using the signal flow graph (SFG technique to synthesize general high-order all-pass and all-pole current transfer functions with current follower transconductance amplifiers (CFTAs and grounded capacitors has been presented. For general nth-order systems, the realized all-pass structure contains at most n + 1 CFTAs and n grounded capacitors, while the all-pole lowpass circuit requires only n CFTAs and n grounded capacitors. The resulting circuits obtained from the synthesis procedure are resistor-less structures and especially suitable for integration. They also exhibit low-input and high-output impedances and also convenient electronic controllability through the gm-value of the CFTA. Simulation results using real transistor model parameters ALA400 are also included to confirm the theory.

Evaluation of the Perceptual Characteristics of a Force Induced by Asymmetric Vibrations.

Science.gov (United States)

Tanabe, Takeshi; Yano, Hiroaki; Iwata, Hiroo

2017-08-29

This paper describes the properties of proprioceptive sensations induced by asymmetric vibration using a vibration speaker-type non-grounded haptic interface. We confirm that the vibration speaker generates a perceived force that pulls or pushes a user's hand in a particular direction when an asymmetric amplitude signal that is generated by inverting a part of a sine wave is input. In this paper, to verify the system with respect to various factors of force perception caused by asymmetric vibration, we conducted six experiments and the following results were obtained. (1) The force vector can be controlled by reversing the asymmetric waves. (2) By investigating the physical characteristics of the vibration, asymmetric vibration was confirmed. (3) The presentation of vibration in the shear direction on the finger pad is effective. (4) The point of subjective equality of the perceived force can be controlled by up to 0.43 N by changing the amplitude voltage of the input signals. (5) The minimum stimulation time required for force perception is 66.7 ms. (6) When the vibration is continuously presented for 40 to 50 s, the perceived force decreases because of adaptation. Hence, we confirmed that we can control both the direction and magnitude of the reaction force by changing the input signal of the vibration speaker.

Energy harvesting from vibration using a piezoelectric membrane

Energy Technology Data Exchange (ETDEWEB)

Ericka, M.; Vasic, D.; Costa, F.; Tliba, S. [Ecole Normale Superieure de Cachan, Systemes et Applications des Technologies de l' Information et de l' Energie (SATIE, UMR 8029), 94 - Cachan (France); Poulin, G. [Ecole Nationale Superieure d' Ingenieurs Electriciens de Grenoble, Laboratoire d' Automatique de Grenoble, 38 (France)

2005-09-01

In this paper we investigate the capability of harvesting the electric energy from mechanical vibrations in a dynamic environment through a piezoelectric membrane transducer. This transducer consists of 2 layers lead zirconate titanate (PZT)/brass, the brass layer is embedded over the whole circumference by epoxy adhesive. A very small vibration gives a consequent deformation of the membrane which generates electric energy. Due to the impedance matrices connecting the efforts and flows of the membrane, we have established the dynamic electric equivalent circuit of the transducer. In a first study and in order to validate theoretical results, we performed experiments with a vibrating machine moving a macroscopic 25 mm diameter piezoelectric membrane. A power of 1.8 mW was generated at the resonance frequency (2.58 kHz) across a 56 k{omega} optimal resistor and for a 2 g acceleration. (authors)

Pickin’ up good vibrations

CERN Multimedia

Katarina Anthony

2015-01-01

In preparation for the civil engineering work on the HL-LHC, vibration measurements were carried out at the LHC’s Point 1 last month. These measurements will help evaluate how civil engineering work could impact the beam, and will provide crucial details about the site’s geological make-up before construction begins.   A seismic truck at Point 1 generated wave-like vibrations measured by EN/MME. From carrying out R&D to produce state-of-the-art magnets to developing innovative, robust materials capable of withstanding beam impact, the HL-LHC is a multi-faceted project involving many groups and teams across CERN’s departments. It was in this framework that the project management mandated CERN's Mechanical and Materials Engineering (EN/MME) group to measure the propagation of vibrations around Point 1. Their question: can civil engineering work for the HL-LHC – the bulk of which is scheduled for LS2 – begin while the LHC is running? Alth...

Influence of bearing pre-load coefficient on shaft vibration and pad temperature in a hydroturbine generator unit. A case study

Energy Technology Data Exchange (ETDEWEB)

Feng Fuzhou; Chu Fulei; Guo Dan; Lu Wenxiu [Tsinghua Univ., Beijing, BJ (China). Dept. of Precision Instruments

2001-07-01

From data collected by an online condition monitoring and fault diagnosis system, a higher pad temperature at the upper guide bearing in a pumped storage power generator unit installed in Guangdong province(GPSPS), China, was found. And also a relatively intensive shaft vibration occurred at the lower guide bearing. By calculating the Reynolds equation and viscosity-temperature equation of the lubricant, a curve between the pre-load coefficient and the increment of pad temperature is obtained, which shows that the larger, the pre-load coefficient, the bigger, the increment of pad temperature. For a practical unit in GPSPS, by employing Transfer matrix method and Wilson-{theta} method to analyze shaft vibration at different pre-load coefficients of the whole bearing or ''pad pair'' bearings, the results show that the larger the pre-load coefficient is, the smaller the vibration amplitude is, the shorter the time for vibration to become steady is. And an uneven pre-load coefficient of the ''pad pair'' bearings will cause shaft orbit from a circle to an ellipse whose long axes is at the direction of the ''pad pair'' with the lowest pre-load coefficient. Finally, reasons of higher pad temperature of the upper guide bearing and larger shaft vibration at the lower guide bearing are due to the inconsistent relation of bearing assembling clearance or pre-load coefficient of the upper and lower guide bearing, and also due to the too small, uneven pre-load coefficient of ''pad pair'' bearings. After a scheme for adjusting the bearing clearance is given, data measured show that the analysis and simulation methods are correct and the adjustment scheme to the assembling clearance of the upper and lower guide bearings is feasible and can be used to guide the field maintenance conveniently. (orig.)

PC based vibration monitoring system

International Nuclear Information System (INIS)

Jain, Sanjay K.; Roy, D.A.; Pithawa, C.K.; Patil, R.K.

2004-01-01

Health of large rotating machinery gets reflected in the vibration signature of the rotor and supporting structures and proper recording of these signals and their analysis can give a clear picture of the health of the machine. Using these data and their trending, it is possible to predict an impending trouble in the machine so that preventive action can be taken in time and catastrophic failure can be avoided. Continuous monitoring and analysis can give quick warning and enable operator to take preventive measures. Reactor Control Division, BARC is developing a PC based Vibration monitoring system for turbo generator machinery. The System can acquire 20 vibration signals at a rate of 5000 samples per second and also 15 process signals at a rate of 100 samples/ sec. The software for vibration monitoring system includes acquisition modules, analysis modules and Graphical User Interface module. The acquisition module involves initialization, setting of required parameters and acquiring the data from PC-based data acquisition cards. The acquired raw vibration data is then stored for analysis using various software packages. The display and analysis of acquired data is done in LabVIEW 7.0 where the data is displayed in time as well as frequency domain along with the RMS value of the signal. (author)

A THEORETICAL STUDY AND 3D MODELING OF NONLINEAR PASSIVE VIBRATION ISOLATOR

OpenAIRE

Sabyasachi Mukherjee

2017-01-01

The study of sound and vibration are closely related. Sound or "pressure waves" are generated by vibrating structures (e.g. vocal cords); these pressure waves can also induce the vibration of structures (e.g. ear drum). Hence, when trying to reduce noise it is often a problem in trying to reduce vibration. The high speed engines and machines when mounted on foundations and supports cause vibrations of excessive amplitude because of unbalance forces setup during their working. These are the di...

Vibration analysis for trending ageing in rotating machinery

International Nuclear Information System (INIS)

Sinha, S.K.; Rama Rao, A.

2006-01-01

The need for condition monitoring system for important equipment and machinery is a growing requirement in every industry and more so in the nuclear power plants because of stringent safety requirements. This is largely because of the inherent benefit of being able to promote predictive maintenance practice rather than uneconomical preventive maintenance practice in the plant. Forerunner among the condition monitoring parameter is vibration signatures measured on a rotating machine. It is known that every moving element in a rotating machine generates vibration signal that is uniquely its own. Detection of such signals and monitoring the changing conditions in a machine through vibration analysis is a technique involving the knowledge of engineering art and the mathematical theory. This blend of sound engineering judgement and vibration data interpretation skill is in fact the basis of vibration diagnostic techniques. (author)

Cases of coupled vibrations and prametric instability in rotating machines

OpenAIRE

Luneno, Jean-Claude

2012-01-01

The principal task in this research project was to analyse the causes and consequences of coupled vibrations and parametric instability in hydropower rotors; where both horizontal and vertical machines are involved. Vibration is a well-known undesirable behavior of dynamical systems characterised by persistent periodic, quasi-periodic or chaotic motions. Vibrations generate noise and cause fatigue, which initiates cracks in mechanical structures. Motions coupling can in some cases augment the...

MR Damper Controlled Vibration Absorber for Enhanced Mitigation of Harmonic Vibrations

Directory of Open Access Journals (Sweden)

Felix Weber

2016-12-01

Full Text Available This paper describes a semi-active vibration absorber (SVA concept based on a real-time controlled magnetorheological damper (MR-SVA for the enhanced mitigation of structural vibrations due to harmonic disturbing forces. The force of the MR damper is controlled in real-time to generate the frequency and damping controls according to the behaviour of the undamped vibration absorber for the actual frequency of vibration. As stiffness and damping emulations in semi-active actuators are coupled quantities the control is formulated to prioritize the frequency control by the controlled stiffness. The control algorithm is augmented by a stiffness correction method ensuring precise frequency control when the desired control force is constrained by the semi-active restriction and residual force of the MR damper. The force tracking task is solved by a model-based feed forward with feedback correction. The MR-SVA is numerically and experimentally validated for the primary structure with nominal eigenfrequency and when de-tuning of −10%, −5%, +5% and +10% is present. Both validations demonstrate that the MR-SVA improves the vibration reduction in the primary structure by up to 55% compared to the passive tuned mass damper (TMD. Furthermore, it is shown that the MR-SVA with only 80% of tuned mass leads to approximately the same enhanced performance while the associated increased relative motion amplitude of the tuned mass is more than compensated be the reduced dimensions of the mass. Therefore, the MR-SVA is an appropriate solution for the mitigation of tall buildings where the pendulum mass can be up to several thousands of metric tonnes and space for the pendulum damper is limited.

Nonlinear optical polarization analysis in chemistry and biology

CERN Document Server

Simpson, Garth J

2017-01-01

This rigorous yet accessible guide presents a molecular-based description of nonlinear optical polarization analysis of chemical and biological assemblies. It includes discussion of the most common nonlinear optical microscopy and interfacial measurements used for quantitative analysis, specifically second harmonic generation (SHG), two-photon excited fluorescence (2PEF), vibrational sum frequency generation (SFG), and coherent anti-Stokes Raman spectroscopy/stimulated Raman spectroscopy (CARS/SRS). A linear algebra mathematical framework is developed, allowing step-wise systematic connections to be made between the observable measurements and the molecular response. Effects considered include local field corrections, the molecular orientation distribution, rotations between the molecular frame, the local frame and the laboratory frame, and simplifications from molecular and macromolecular symmetry. Specific examples are provided throughout the book, working from the common and relatively simple case studies ...

Integrated predictive maintenance program vibration and lube oil analysis: Part I - history and the vibration program

International Nuclear Information System (INIS)

Maxwell, H.

1996-01-01

This paper is the first of two papers which describe the Predictive Maintenance Program for rotating machines at the Palo Verde Nuclear Generating Station. The organization has recently been restructured and significant benefits have been realized by the interaction, or open-quotes synergyclose quotes between the Vibration Program and the Lube Oil Analysis Program. This paper starts with the oldest part of the program - the Vibration Program and discusses the evolution of the program to its current state. The open-quotes Vibrationclose quotes view of the combined program is then presented

Friction interface mechanics and self-induced vibrations

OpenAIRE

Wernitz, Boris Alexander

2013-01-01

Vibrations in braking systems have been studied since the beginning of the last century and despite several insights, still many phenomena, particularly in the area of friction induced vibrations, are not fully understood. The objective of the actual study was the identification of the complex dynamics in the friction interface of a dry friction brake system. In this context, particular consideration was given to the generation of instabilities and brake squeal. In work presently being ...

Development of Design Criteria for Fluid Induced Structural Vibrations in Steam Generators and Heat Exchangers

International Nuclear Information System (INIS)

Uvan Catton; Dhir, Vijay K.; Deepanjan Mitra; Omar Alquaddoomi; Pierangelo Adinolfi

2004-01-01

Flow-induced vibration in heat exchangers has been a major cause of concern in the nuclear industry for several decades. Many incidents of failure of heat exchangers due to apparent flow-induced vibration have been reported through the USNRC incident reporting system. Almost all heat exchangers have to deal with this problem during their operation. The phenomenon has been studied since the 1970s and the database of experimental studies on flow-induced vibration is constantly updated with new findings and improved design criteria for heat exchangers

Particular aspects regarding the effects of whole body vibration exposure

Directory of Open Access Journals (Sweden)

Picu Mihaela

2018-01-01

Full Text Available This paper analyses the influence of whole-body vibrations on human performance; for this it was investigated how a group of men (20-29 years of age and a group of woman (21–31 years of age answered to specific requirements after being subjected to vertical vibrations under controlled laboratory conditions for 10-25 min. The vibrations were generated by a vibrant system with known amplitudes and frequencies. Accelerations were measured with NetdB - complex system for measuring and analysing human vibration and they were found in the range 0.4 - 3.1m/s2. The subjects’ performances were determined for each vibration level using specific tests. It can be concluded that exposure to vibrations higher than those recommended by ISO 2631 significantly disrupts how subjects responded to tests requirements.

Torsional Vibration of a Shafting System under Electrical Disturbances

Directory of Open Access Journals (Sweden)

Ling Xiang

2012-01-01

Full Text Available Torsional vibration responses of a nonlinear shafting system are studied by a modified Riccati torsional transfer matrix combining with the Newmark-β method. Firstly, the system is modeled as a chain consisting of an elastic spring with concentrated mass points, from which a multi-segment lumped mass model is established. Secondly, accumulated errors are eliminated from the eigenfrequencies and responses of the system's torsional vibration by this newly developed procedure. The incremental transfer matrix method, combining the modified Riccati torsional transfer matrix with Newmark-β method, is further applied to solve the dynamical equations for the torsional vibration of the nonlinear shafting system. Lastly, the shafting system of a turbine-generator is employed as an illustrating example, and simulation analysis has been performed on the transient responses of the shaft's torsional vibrations during typical power network disturbances, such as three-phase short circuit, two-phase short circuit and asynchronous juxtaposition. The results validate the present method and are instructive for the design of a turbo-generator shaft.

Multi-Exciter Vibroacoustic Simulation of Hypersonic Flight Vibration

International Nuclear Information System (INIS)

GREGORY, DANNY LYNN; CAP, JEROME S.; TOGAMI, THOMAS C.; NUSSER, MICHAEL A.; HOLLINGSHEAD, JAMES RONALD

1999-01-01

Many aerospace structures must survive severe high frequency, hypersonic, random vibration during their flights. The random vibrations are generated by the turbulent boundary layer developed along the exterior of the structures during flight. These environments have not been simulated very well in the past using a fixed-based, single exciter input with an upper frequency range of 2 kHz. This study investigates the possibility of using acoustic ardor independently controlled multiple exciters to more accurately simulate hypersonic flight vibration. The test configuration, equipment, and methodology are described. Comparisons with actual flight measurements and previous single exciter simulations are also presented

Vibrational spectroscopic study of fluticasone propionate

Science.gov (United States)

Ali, H. R. H.; Edwards, H. G. M.; Kendrick, J.; Scowen, I. J.

2009-03-01

Fluticasone propionate is a synthetic glucocorticoid with potent anti-inflammatory activity that has been used effectively in the treatment of chronic asthma. The present work reports a vibrational spectroscopic study of fluticasone propionate and gives proposed molecular assignments on the basis of ab initio calculations using BLYP density functional theory with a 6-31G* basis set and vibrational frequencies predicted within the quasi-harmonic approximation. Several spectral features and band intensities are explained. This study generated a library of information that can be employed to aid the process monitoring of fluticasone propionate.

A Solid-State Deuterium NMR and SFG Study of the Side Chain Dynamics of Peptides Adsorbed onto Surfaces

Science.gov (United States)

Breen, Nicholas F.; Weidner, Tobias; Li, Kun; Castner, David G.; Drobny, Gary P.

2011-01-01

The artificial amphiphilic peptide LKα14 adopts a helical structure at interfaces, with opposite orientation of its leucine (L, hydrophobic) and lysine (K, hydrophilic) side chains. When adsorbed onto surfaces, different residue side chains necessarily have different proximities to the surface, depending on both their position in the helix and the composition of the surface itself. Deuterating the individual leucine residues (isopropyl-d7) permits the use of solid-state deuterium NMR as a site-specific probe of side chain dynamics. In conjunction with SFG as a probe of the peptide binding face, we demonstrate that the mobility of specific leucine side chains at the interface is quantifiable in terms of their surface proximity. PMID:19764755

The effects of vibration-reducing gloves on finger vibration

Science.gov (United States)

Welcome, Daniel E.; Dong, Ren G.; Xu, Xueyan S.; Warren, Christopher; McDowell, Thomas W.

2015-01-01

Vibration-reducing (VR) gloves have been used to reduce the hand-transmitted vibration exposures from machines and powered hand tools but their effectiveness remains unclear, especially for finger protection. The objectives of this study are to determine whether VR gloves can attenuate the vibration transmitted to the fingers and to enhance the understanding of the mechanisms of how these gloves work. Seven adult male subjects participated in the experiment. The fixed factors evaluated include hand force (four levels), glove condition (gel-filled, air bladder, no gloves), and location of the finger vibration measurement. A 3-D laser vibrometer was used to measure the vibrations on the fingers with and without wearing a glove on a 3-D hand-arm vibration test system. This study finds that the effect of VR gloves on the finger vibration depends on not only the gloves but also their influence on the distribution of the finger contact stiffness and the grip effort. As a result, the gloves increase the vibration in the fingertip area but marginally reduce the vibration in the proximal area at some frequencies below 100 Hz. On average, the gloves reduce the vibration of the entire fingers by less than 3% at frequencies below 80 Hz but increase at frequencies from 80 to 400 Hz. At higher frequencies, the gel-filled glove is more effective at reducing the finger vibration than the air bladder-filled glove. The implications of these findings are discussed. Relevance to industry Prolonged, intensive exposure to hand-transmitted vibration can cause hand-arm vibration syndrome. Vibration-reducing gloves have been used as an alternative approach to reduce the vibration exposure. However, their effectiveness for reducing finger-transmitted vibrations remains unclear. This study enhanced the understanding of the glove effects on finger vibration and provided useful information on the effectiveness of typical VR gloves at reducing the vibration transmitted to the fingers. The new

Performance of Different Sensors for Monitoring of the Vibration Generated during Thermosonic Non-destructive Testing

Energy Technology Data Exchange (ETDEWEB)

Kang, Bu Byoung [Korea Railroad Research Institute, Uiwang (Korea, Republic of)

2011-04-15

Vibration monitoring is required for reliable thermosonic testing to decide whether sufficient vibration is achieved in each test for the detection of cracks. From a practical point of view, a cheaper and convenient monitoring method is better for the application to real tests. Therefore, the performance of different sensors for vibration monitoring was investigated and compared in this study to find a convenient and acceptable measurement method for thermosonics. Velocity measured by a laser vibrometer and strain provide an equivalent HI when measured at the same position. The microphone can provide a cheaper vibration monitoring device than the laser and the heating index calculated by a microphone signal shows similar characteristics to that calculated from velocity measured by the laser vibrometer. The microphone frequency response shows that it underestimates high frequency components but it is applicable to practical tests because it gives a conservative value of HI

Experimental Research on Vibrations of Double Harmonic Gear Transmission

Directory of Open Access Journals (Sweden)

Sava Ianici

2017-11-01

Full Text Available Gears transmission can be important sources of vibration in the mechanical system structures and can have a significant share in the overall vibration level. The current trend of significant increase in powers and speeds transmitted by modern mechanical systems, along with the size reduction, may cause a worsening of the behaviour of transmissions with gears in terms of vibration, especially when the optimization criteria were not respected in the design, execution and installation phase. This paper presents a study of vibrations that occur in a double harmonic gear transmission (DHGT, based on experimental research. The experimental researches revealed that in a double harmonic gear transmission the vibrations are initiated and develop in the multipara harmonics engagement of the teeth and in the kinematic couplings materialized between the wave generator and the flexible toothed wheel. These vibrations are later transmitted by means of the shafts and bearings to the transmission housing, respectively, through the walls of it, propagating in the air.

Structure-borne sound structural vibrations and sound radiation at audio frequencies

CERN Document Server

Cremer, L; Petersson, Björn AT

2005-01-01

Structure-Borne Sound"" is a thorough introduction to structural vibrations with emphasis on audio frequencies and the associated radiation of sound. The book presents in-depth discussions of fundamental principles and basic problems, in order to enable the reader to understand and solve his own problems. It includes chapters dealing with measurement and generation of vibrations and sound, various types of structural wave motion, structural damping and its effects, impedances and vibration responses of the important types of structures, as well as with attenuation of vibrations, and sound radi

New perspectives on mechanisms of sound generation in songbirds

DEFF Research Database (Denmark)

Goller, Franz; Larsen, Ole Næsbye

2002-01-01

-tone mechanism similar to human phonation with the labia forming a pneumatic valve. The classical avian model proposed that vibrations of the thin medial tympaniform membranes are the primary sound generating mechanism. As a direct test of these two hypotheses we ablated the medial tympaniform membranes in two......The physical mechanisms of sound generation in the vocal organ, the syrinx, of songbirds have been investigated mostly with indirect methods. Recent direct endoscopic observation identified vibrations of the labia as the principal sound source. This model suggests sound generation in a pulse...... atmosphere) as well as direct (labial vibration during tonal sound) measurements of syringeal vibrations support a vibration-based soundgenerating mechanism even for tonal sounds....

Review of Energy Harvesters Utilizing Bridge Vibrations

Directory of Open Access Journals (Sweden)

Farid Ullah Khan

2016-01-01

Full Text Available For health monitoring of bridges, wireless acceleration sensor nodes (WASNs are normally used. In bridge environment, several forms of energy are available for operating WASNs that include wind, solar, acoustic, and vibration energy. However, only bridge vibration has the tendency to be utilized for embedded WASNs application in bridge structures. This paper reports on the recent advancements in the area of vibration energy harvesters (VEHs utilizing bridge oscillations. The bridge vibration is narrowband (1 to 40 Hz with low acceleration levels (0.01 to 3.8 g. For utilization of bridge vibration, electromagnetic based vibration energy harvesters (EM-VEHs and piezoelectric based vibration energy harvesters (PE-VEHs have been developed. The power generation of the reported EM-VEHs is in the range from 0.7 to 1450000 μW. However, the power production by the developed PE-VEHs ranges from 0.6 to 7700 μW. The overall size of most of the bridge VEHs is quite comparable and is in mesoscale. The resonant frequencies of EM-VEHs are on the lower side (0.13 to 27 Hz in comparison to PE-VEHs (1 to 120 Hz. The power densities reported for these bridge VEHs range from 0.01 to 9539.5 μW/cm3 and are quite enough to operate most of the commercial WASNs.

Vibration Disturbance Damping System Design to Protect Payload of the Rocket

Directory of Open Access Journals (Sweden)

Sutisno Sutisno

2012-12-01

Full Text Available Rocket motor generates vibrations acting on whole rocket body including its contents. Part of the body which is sensitive to disturbance is the rocket payload. The payload consists of various electronic instruments including: transmitter, various sensors, accelerometer, gyro, the embedded controller system, and others. This paper presents research on rocket vibration influence to the payload and the method to avoid disturbance. Avoiding influence of vibration disturbance can be done using silicone gel material whose typical damping factors are relatively high. The rocket vibration was simulated using electromagnetic motor, and the vibrations were measured using an accelerometer sensor. The measurement results were displayed in the form of curve, indicating the vibration level on some parts of the tested material. Some measurement results can be applied to determine the good material to attenuate vibration disturbance on the instruments of the payload.

Development of varying magnetic field analysis technology caused by vibration of MRI apparatus

International Nuclear Information System (INIS)

Imamura, Yukinobu; Motoshiromizu, Hirofumi; Abe, Mitsushi; Watanabe, Hiroyuki; Takeuchi, Hiroyuki

2015-01-01

In Magnetic Resonance Imaging (MRI) apparatus, pulse current is energized to the gradient coils in a strong static magnetic field generated by the static magnetic poles. Since electromagnetic force (i.e. Lorentz force) is generated in the gradient coils, the MRI magnet system vibrates. On the other hand, vibration of the MRI magnet system is affected by electromagnetic force caused by static magnetic poles vibration. As the vibration of MRI magnet system causes magnetic field disturbance (so-called 'error magnetic field') and affect image quality, it is important to evaluate them in the design process. In this study, a varying magnetic field evaluation method for MRI magnet system was developed. Vibration and electromagnetic force is considered in the weak coupling formation using the Modal Magnetic Dumping (MMD) method. In the eddy current analysis by vibration, the displacement was considered in the magnetic field changes in the finite elements. Error magnetic field caused by equipment vibration was obtained by superposition of the static magnetic field fluctuation and the eddy current magnetic field. Then open type MRI magnet was evaluated by the proposed methodology. A a result, vibration of static magnet poles were suppressed by magnetic dumping at 50 Hz or less and eddy current magnetic field was dominant at 50 Hz or more. (author)

Wireless Inductive Power Device Suppresses Blade Vibrations

Science.gov (United States)

Morrison, Carlos R.; Provenza, Andrew J.; Choi, Benjamin B.; Bakhle, Milind A.; Min, James B.; Stefko, George L.; Duffy, Kirsten P.; Fougers, Alan J.

2011-01-01

Vibration in turbomachinery can cause blade failures and leads to the use of heavier, thicker blades that result in lower aerodynamic efficiency and increased noise. Metal and/or composite fatigue in the blades of jet engines has resulted in blade destruction and loss of lives. Techniques for suppressing low-frequency blade vibration, such as gtuned circuit resistive dissipation of vibratory energy, h or simply "passive damping," can require electronics incorporating coils of unwieldy dimensions and adding unwanted weight to the rotor. Other approaches, using vibration-dampening devices or damping material, could add undesirable weight to the blades or hub, making them less efficient. A wireless inductive power device (WIPD) was designed, fabricated, and developed for use in the NASA Glenn's "Dynamic Spin Rig" (DSR) facility. The DSR is used to simulate the functionality of turbomachinery. The relatively small and lightweight device [10 lb (approx.=4.5 kg)] replaces the existing venerable and bulky slip-ring. The goal is the eventual integration of this technology into actual turbomachinery such as jet engines or electric power generators, wherein the device will facilitate the suppression of potentially destructive vibrations in fan blades. This technology obviates slip rings, which require cooling and can prove unreliable or be problematic over time. The WIPD consists of two parts: a remote element, which is positioned on the rotor and provides up to 100 W of electrical power to thin, lightweight piezoelectric patches strategically placed on/in fan blades; and a stationary base unit that wirelessly communicates with the remote unit. The base unit supplies inductive power, and also acts as an input and output corridor for wireless measurement, and active control command to the remote unit. Efficient engine operation necessitates minimal disturbance to the gas flow across the turbine blades in any effort to moderate blade vibration. This innovation makes it

Mechanical vibration to electrical energy converter

Science.gov (United States)

Kellogg, Rick Allen [Tijeras, NM; Brotz, Jay Kristoffer [Albuquerque, NM

2009-03-03

Electromechanical devices that generate an electrical signal in response to an external source of mechanical vibrations can operate as a sensor of vibrations and as an energy harvester for converting mechanical vibration to electrical energy. The devices incorporate a magnet that is movable through a gap in a ferromagnetic circuit, wherein a coil is wound around a portion of the ferromagnetic circuit. A flexible coupling is used to attach the magnet to a frame for providing alignment of the magnet as it moves or oscillates through the gap in the ferromagnetic circuit. The motion of the magnet can be constrained to occur within a substantially linear range of magnetostatic force that develops due to the motion of the magnet. The devices can have ferromagnetic circuits with multiple arms, an array of magnets having alternating polarity and, encompass micro-electromechanical (MEM) devices.

Influence of Cable Vibrations on Connectors Used in Automotive Applications

Directory of Open Access Journals (Sweden)

AMEL Bouzera

2012-10-01

Full Text Available In order to determine the influence of cable vibrations on the contact resistance of connectors, the cable resonant frequency and the resulting movement of both parts of the connector have been studied. The increase of contact voltage, followed by rapidfluctuations generated by wear particles, has been analysed. A test bench designed to monitor wire vibrations was used while the transferred amplitude was measured by a high sensitivity displacement sensor. The contact interface was made of copper alloy and tin coated. The connector was connected to a resistive power supplytransmitting different currents and voltage values. Two investigations were performed on the contact voltage measured with a fast sampling oscilloscope which enabled histograms and a Fast FourierTransform analysis to be obtained. The appearance of contact fluctuations observed during the fretting generated by cable vibrations, and depending upon the wear effect, is attributed toelectromechanical phenomena. Some slow fluctuations are well correlated to the vibration period while the rapid ones are linked to an electrical conduction perturbation in the granular interface caused by the connector movement.

Optimization design of high power ultrasonic circular ring radiator in coupled vibration.

Science.gov (United States)

Xu, Long; Lin, Shuyu; Hu, Wenxu

2011-10-01

This paper presents a new high power ultrasonic (HPU) radiator, which consists of a transducer, an ultrasonic horn, and a metal circular ring. Both the transducer and horn in longitudinal vibrations are used to drive a metal circular ring in a radial-axial coupled vibration. This coupled vibration cannot only generate ultrasound in both the radial and axial directions, but also focus the ultrasound inside the circular ring. Except for the radial-axial coupled vibration mode, the third longitudinal harmonic vibration mode with relative large vibration amplitude is also detected, which can be used as another operation mode. Overall, the HPU with these two vibration modes should have good potential to be applied in liquid processing, such as sonochemistry, ultrasonic cleaning, and Chinese herbal medicine extraction. Copyright © 2011 Elsevier B.V. All rights reserved.

Sensitivity improvement techniques for micromechanical vibrating accelerometers

Directory of Open Access Journals (Sweden)

Vtorushin Sergey

2016-01-01

Full Text Available The paper presents the problems of detecting a desired signal generated by micromechanical vibrating accelerometer. Three detection methods, namely frequency, amplitude and phase are considered in this paper. These methods are used in micromechanical vibrating accelerometers that incorporate a force sensitive element which transforms measured acceleration into the output signal. Investigations are carried out using the ANSYS finite element program and MATLAB/Simulink support package. Investigation results include the comparative analysis of the output signal characteristics obtained by the different detection methods.

High-power non linear frequency converted laser diodes

DEFF Research Database (Denmark)

Jensen, Ole Bjarlin; Andersen, Peter E.; Hansen, Anders Kragh

2015-01-01

We present different methods of generating light in the blue-green spectral range by nonlinear frequency conversion of tapered diode lasers achieving state-of-the-art power levels. In the blue spectral range, we show results using single-pass second harmonic generation (SHG) as well as cavity enh...... enhanced sum frequency generation (SFG) with watt-level output powers. SHG and SFG are also demonstrated in the green spectral range as a viable method to generate up to 4 W output power with high efficiency using different configurations....

DOE/ANL/HTRI heat exchanger tube vibration data bank

International Nuclear Information System (INIS)

Halle, H.; Chenoweth, J.M.; Wambsganss, M.W.

1980-02-01

Development of a new heat exchanger tube vibration data bank at Argonne National Laboratory is described. Comprehensive case histories on heat exchangers that have experienced tube-vibration problems and units that have been trouble-free are accumulated and this information is rendered available for evaluation, improvement, and development of vibration-prediction methods and design guidelines. Discussions include difficulties in generating a data bank, data form development, and solicitation efforts. Also included are 15 case histories upon which the data bank will be built. As new case histories are received, they will be assembled and published as addenda to this report

Environmental vibration reduction utilizing an array of mass scatterers

DEFF Research Database (Denmark)

Peplow, Andrew; Andersen, Lars Vabbersgaard; Bucinskas, Paulius

2017-01-01

.g. concrete or stone blocks, specially designed brick walls, etc.). The natural frequencies of vibration for such blocks depend on the local ground stiffness and on the mass of the blocks which can be chosen to provide resonance at specified frequencies. This work concerns the effectiveness of such “blocking......Ground vibration generated by rail and road traffic is a major source of environmental noise and vibration pollution in the low-frequency range. A promising and cost effective mitigation method can be the use of heavy masses placed as a periodic array on the ground surface near the road or track (e...

Bevel Gearbox Fault Diagnosis using Vibration Measurements

Directory of Open Access Journals (Sweden)

Hartono Dennis

2016-01-01

Full Text Available The use of vibration measurementanalysis has been proven to be effective for gearbox fault diagnosis. However, the complexity of vibration signals observed from a gearbox makes it difficult to accurately detectfaults in the gearbox. This work is based on a comparative studyof several time-frequency signal processing methods that can be used to extract information from transient vibration signals containing useful diagnostic information. Experiments were performed on a bevel gearbox test rig using vibration measurements obtained from accelerometers. Initially, thediscrete wavelet transform was implementedfor vibration signal analysis to extract the frequency content of signal from the relevant frequency region. Several time-frequency signal processing methods werethen incorporated to extract the fault features of vibration signals and their diagnostic performances were compared. It was shown thatthe Short Time Fourier Transform (STFT could not offer a good time resolution to detect the periodicity of the faulty gear tooth due the difficulty in choosing an appropriate window length to capture the impulse signal. The Continuous Wavelet Transform (CWT, on the other hand, was suitable to detection of vibration transients generated by localized fault from a gearbox due to its multi-scale property. However, both methods still require a thorough visual inspection. In contrast, it was shown from the experiments that the diagnostic method using the Cepstrumanalysis could provide a direct indication of the faulty tooth without the need of a thorough visual inspection as required by CWT and STFT.

A modern concept for status oriented vibration monitoring of big turbogenerators

International Nuclear Information System (INIS)

Herz, F.; Theodor, P.

1997-01-01

The investigation of mechanical vibrations is an excellent method of showing the current condition of a machine. This paper deals with the vibrations monitoring of large turbo-generators. First the general aspects of monitoring, as well as diagnostic strategies and impact on the operation of the installation is discussed. An example of a condition-oriented vibration monitoring is the description of the 'Vibroview' system recently developed and installed in the Leibstadt nuclear power plant. (author) 16 figs., tabs., refs

Intracellular recording from a spider vibration receptor.

Science.gov (United States)

Gingl, Ewald; Burger, Anna-M; Barth, Friedrich G

2006-05-01

The present study introduces a new preparation of a spider vibration receptor that allows intracellular recording of responses to natural mechanical or electrical stimulation of the associated mechanoreceptor cells. The spider vibration receptor is a lyriform slit sense organ made up of 21 cuticular slits located on the distal end of the metatarsus of each walking leg. The organ is stimulated when the tarsus receives substrate vibrations, which it transmits to the organ's cuticular structures, reducing the displacement to about one tenth due to geometrical reasons. Current clamp recording was used to record action potentials generated by electrical or mechanical stimuli. Square pulse stimulation identified two groups of sensory cells, the first being single-spike cells which generated only one or two action potentials and the second being multi-spike cells which produced bursts of action potentials. When the more natural mechanical sinusoidal stimulation was applied, differences in adaptation rate between the two cell types remained. In agreement with prior extracellular recordings, both cell types showed a decrease in the threshold tarsus deflection with increasing stimulus frequency. Off-responses to mechanical stimuli have also been seen in the metatarsal organ for the first time.

SFG spectroscopy from 10 -8 to 1000 mbar: less-ordered CO structures and coadsorption on Pd (1 1 1)

Science.gov (United States)

Morkel, Matthias; Unterhalt, Holger; Salmeron, Miquel; Rupprechter, Günther; Freund, Hans-Joachim

2003-06-01

Vibrational sum frequency generation spectroscopy was employed to study "less-ordered" phases resulting from low-temperature CO exposure on Pd(1 1 1). Such imperfect structures may also occur under catalytic reaction conditions up to 1000 mbar and originate from the superposition of ordered structures when the CO mobility and flux were insufficient. The effect of coadsorbed hydrogen and water was also examined.

[Occupational standing vibration rate and vibrational diseases].

Science.gov (United States)

Karnaukh, N G; Vyshchipan, V F; Haumenko, B S

2003-12-01

Occupational standing vibration rate is proposed in evaluating a degree of impairment of an organism activity. It will allow more widely to introduce specification of quality and quantity in assessment of the development of vibrational disease. According out-patient and inpatient obtained data we have established criterial values of functional changes in accordance with accumulated occupational standing vibration rate. The nomogram was worked out for defining a risk of the development of vibrational disease in mine workers. This nomogram more objectively can help in diagnostics of the disease.

Time-resolved study of formate on Ni( 1 1 1 ) by picosecond SFG spectroscopy

Science.gov (United States)

Kusafuka, K.; Noguchi, H.; Onda, K.; Kubota, J.; Domen, K.; Hirose, C.; Wada, A.

2002-04-01

Time-resolved vibrational measurements were carried out on formate (HCOO) adsorbed on Ni(1 1 1) surface by combining the sum-frequency generation method and picosecond laser system (time resolution of 6 ps). Rapid intensity decrease (within the time resolution) followed by intensity recovery (time constant of several tens of ps) of CH stretching signal was observed when picosecond 800 nm pulse was irradiated on the sample surface. From the results of temperature and pump fluence dependences of temporal behaviour of signal intensity, we concluded that the observed intensity change was induced by non-thermal process. Mechanism of the temporal intensity change was discussed.

Vibration-based Energy Harvesting Systems Characterization Using Automated Electronic Equipment

Directory of Open Access Journals (Sweden)

Ioannis KOSMADAKIS

2015-04-01

Full Text Available A measurement bench has been developed to fully automate the procedure for the characterization of a vibration-based energy scavenging system. The measurement system is capable of monitoring all important characteristics of a vibration harvesting system (input and output voltage, current, and other parameters, frequency and acceleration values, etc.. It is composed of a PC, typical digital measuring instruments (oscilloscope, waveform generator, etc., certain sensors and actuators, along with a microcontroller based automation module. The automation of the procedure and the manipulation of the acquired data are performed by LabVIEW software. Typical measurements of a system consisting of a vibrating source, a vibration transducer and an active rectifier are presented.

Femtosecond nonlinear spectroscopy at surfaces: Second-harmonic probing of hole burning at the Si(111)7x7 surface and Fourier-transform sum-frequency vibrational spectroscopy

International Nuclear Information System (INIS)

McGuire, John Andrew

2004-01-01

The high temporal resolution and broad bandwidth of a femtosecond laser system are exploited in a pair of nonlinear optical studies of surfaces. The dephasing dynamics of resonances associated with the adatom dangling bonds of the Si(111)7 x 7 surface are explored by transient second-harmonic hole burning, a process that can be described as a fourth-order nonlinear optical process. Spectral holes produced by a 100 fs pump pulse at about 800 nm are probed by the second harmonic signal of a 100 fs pulse tunable around 800 nm. The measured spectral holes yield homogeneous dephasing times of a few tens of femtoseconds. Fits with a Lorentzian spectral hole centered at zero probe detuning show a linear dependence of the hole width on pump fluence, which suggests that charge carrier-carrier scattering dominates the dephasing dynamics at the measured excitation densities. Extrapolation of the deduced homogeneous dephasing times to zero excitation density yields an intrinsic dephasing time of ∼ 70 fs. The presence of a secondary spectral hole indicates that scattering of the surface electrons with surface optical phonons at 570 cm -1 occurs within the first 200 fs after excitation. The broad bandwidth of femtosecond IR pulses is used to perform IR-visible sum frequency vibrational spectroscopy. By implementing a Fourier-transform technique, we demonstrate the ability to obtain sub-laser-bandwidth spectral resolution. FT-SFG yields a greater signal when implemented with a stretched visible pulse than with a femtosecond visible pulse. However, when compared with multichannel spectroscopy using a femtosecond IR pulse but a narrowband visible pulse, Fourier-transform SFG is found to have an inferior signal-to-noise ratio. A mathematical analysis of the signal-to-noise ratio illustrates the constraints on the Fourier-transform approach

Femtosecond nonlinear spectroscopy at surfaces: Second-harmonic probing of hole burning at the Si(111)7x7 surface and fourier-transform sum-frequency vibrational spectroscopy

Energy Technology Data Exchange (ETDEWEB)

McGuire, John Andrew [Univ. of California, Berkeley, CA (United States)

2004-11-24

The high temporal resolution and broad bandwidth of a femtosecond laser system are exploited in a pair of nonlinear optical studies of surfaces. The dephasing dynamics of resonances associated with the adatom dangling bonds of the Si(111)7 x 7 surface are explored by transient second-harmonic hole burning, a process that can be described as a fourth-order nonlinear optical process. Spectral holes produced by a 100 fs pump pulse at about 800 nm are probed by the second harmonic signal of a 100 fs pulse tunable around 800 nm. The measured spectral holes yield homogeneous dephasing times of a few tens of femtoseconds. Fits with a Lorentzian spectral hole centered at zero probe detuning show a linear dependence of the hole width on pump fluence, which suggests that charge carrier-carrier scattering dominates the dephasing dynamics at the measured excitation densities. Extrapolation of the deduced homogeneous dephasing times to zero excitation density yields an intrinsic dephasing time of {approx} 70 fs. The presence of a secondary spectral hole indicates that scattering of the surface electrons with surface optical phonons at 570 cm^-1 occurs within the first 200 fs after excitation. The broad bandwidth of femtosecond IR pulses is used to perform IR-visible sum frequency vibrational spectroscopy. By implementing a Fourier-transform technique, we demonstrate the ability to obtain sub-laser-bandwidth spectral resolution. FT-SFG yields a greater signal when implemented with a stretched visible pulse than with a femtosecond visible pulse. However, when compared with multichannel spectroscopy using a femtosecond IR pulse but a narrowband visible pulse, Fourier-transform SFG is found to have an inferior signal-to-noise ratio. A mathematical analysis of the signal-to-noise ratio illustrates the constraints on the Fourier-transform approach.

Recovering Intrinsic Fragmental Vibrations Using the Generalized Subsystem Vibrational Analysis.

Science.gov (United States)

Tao, Yunwen; Tian, Chuan; Verma, Niraj; Zou, Wenli; Wang, Chao; Cremer, Dieter; Kraka, Elfi

2018-05-08

Normal vibrational modes are generally delocalized over the molecular system, which makes it difficult to assign certain vibrations to specific fragments or functional groups. We introduce a new approach, the Generalized Subsystem Vibrational Analysis (GSVA), to extract the intrinsic fragmental vibrations of any fragment/subsystem from the whole system via the evaluation of the corresponding effective Hessian matrix. The retention of the curvature information with regard to the potential energy surface for the effective Hessian matrix endows our approach with a concrete physical basis and enables the normal vibrational modes of different molecular systems to be legitimately comparable. Furthermore, the intrinsic fragmental vibrations act as a new link between the Konkoli-Cremer local vibrational modes and the normal vibrational modes.

Analysis of flow induced vibration in heat exchangers

International Nuclear Information System (INIS)

Beek, A.W. van

1977-01-01

A description will be given of three different types of heat exchangers developed by the Dutch Nuclear Industry Group ''Neratoom'' in cooperation with TNO for the sodium-cooled fast breeder reactor SNR-300 at Kalkar. Moreover, the research related with flow induced vibrations carried out by TNO (Organization for Applied Scientific Research) will be presented. The flow induced forces on the tubes of the straight-tube steam generators were measured at the inlet and outlet section where partial crossflow occurs. With the measured flow induced forces the response of a tube was calculated as a function of the tube-to-supportbush clearances taking into account the non-linear damping effects from the sodium. The theoretical results showed that for this particular design no tube impact damage is to be expected which was confirmed later by a full scale experiment. Special attention will be devoted to the steam generator with helical-coil tube-bundles, where the sodium flows in a counter cross-flow over the tube-bundle. Extensive measurements of the power spectra of the flow induced forces were carried out since no information could be found in the literature. The vibration analysis will be presented and vibration modes of the entire bundle will be compared with experimentally obtained results. Finally a description of the vibration tests to be carried out on the intermediate heat exchanger (IHX) will be presented. (author)

Analysis of flow induced vibration in heat exchangers

Energy Technology Data Exchange (ETDEWEB)

Beek, A.W. van [Institute for Mechanical Constructions TNO, Delft (Netherlands)

1977-12-01

A description will be given of three different types of heat exchangers developed by the Dutch Nuclear Industry Group ''Neratoom'' in cooperation with TNO for the sodium-cooled fast breeder reactor SNR-300 at Kalkar. Moreover, the research related with flow induced vibrations carried out by TNO (Organization for Applied Scientific Research) will be presented. The flow induced forces on the tubes of the straight-tube steam generators were measured at the inlet and outlet section where partial crossflow occurs. With the measured flow induced forces the response of a tube was calculated as a function of the tube-to-supportbush clearances taking into account the non-linear damping effects from the sodium. The theoretical results showed that for this particular design no tube impact damage is to be expected which was confirmed later by a full scale experiment. Special attention will be devoted to the steam generator with helical-coil tube-bundles, where the sodium flows in a counter cross-flow over the tube-bundle. Extensive measurements of the power spectra of the flow induced forces were carried out since no information could be found in the literature. The vibration analysis will be presented and vibration modes of the entire bundle will be compared with experimentally obtained results. Finally a description of the vibration tests to be carried out on the intermediate heat exchanger (IHX) will be presented. (author)

Vibrations as a contributor to the cracking of PGV-1000 steam generator cold collector

International Nuclear Information System (INIS)

Verezemskij, V.G.

1997-01-01

The results of multiple investigations of cold collector ruptures at NPPs with WWER-1000 reactor as a complex and multi-parameter process are generalized. It is shown that the temperature of cold collector operation (280-290 deg C) at which environment corrosion effects are maximum has an important role for revealing the factors causing the damage. When the reactor plant operates under stationary and transient conditions the primary coolant circuit equipment, main circulation pipelines and main steam lines become involved into vibrations with different intensities as a result of pressure pulsations at reverse and multiple frequencies of the main circulation pumps connected with formation of standing pressure waves in the primary circuit and steam lines. The analysis made gives an opportunity to conclude that dynamic loads (vibrations) play the leading part in reaching the limits of cold collector metal cyclic strength and its cracking. It means that the measures for cold collector service life increasing should be directed on vibration amplitude lowering and cyclic stress decreasing

Gerotor and bearing system for whirling mass orbital vibrator

Energy Technology Data Exchange (ETDEWEB)

Brett, James Ford; Westermark, Robert Victor; Turner, Jr., Joey Earl; Lovin, Samuel Scott; Cole, Jack Howard; Myers, Will

2007-02-27

A gerotor and bearing apparatus for a whirling mass orbital vibrator which generates vibration in a borehole. The apparatus includes a gerotor with an inner gear rotated by a shaft having one less lobe than an outer gear. A whirling mass is attached to the shaft. At least one bearing is attached to the shaft so that the bearing engages at least one sleeve. A mechanism is provided to rotate the inner gear, the mass and the bearing in a selected rotational direction in order to cause the mass, the inner gear, and the bearing to backwards whirl in an opposite rotational direction. The backwards whirling mass creates seismic vibrations.

Natural vibration experimental analysis of Novovoronezhskaya NPP main building

International Nuclear Information System (INIS)

Zoubkov, D.; Isaikin, A.; Shablinsky, G.; Lopanchuk, A.; Nefedov, S.

2005-01-01

1. Natural vibration frequencies are main characteristics of buildings and structures which allow to give integral estimation of their in-service state. Even relatively small changes of these frequencies as compared to the initially registered values point to serious defects of building structures. In this paper we analyzed natural vibration frequencies and natural modes of the main building (MB) of Novovoronezhskaya NPP operating nuclear unit with WWER-440 type reactor. The MB consists of a reactor compartment (RC), a machine room (MR) and an electric device (ED) unit positioned in between. 2. Natural vibration frequencies and natural modes of the MB were determined experimentally by analyzing its microvibrations caused by operation of basic equipment (turbines, pumps, etc.). Microvibrations of the main building were measured at 12 points. At each point measurements were carried out along two or three mutually perpendicular vibration directions. Spectral analysis of vibration records has been conducted. Identification of natural vibration frequencies was carried out on the basis of the spectral peaks and plotted vibration modes (taking into account operating frequencies of the basic equipment of the power generating unit). On the basis of the measurement results three transverse modes and corresponding natural vibration frequencies of the MB, one longitudinal mode and corresponding natural vibration frequency of the MB and two natural frequencies of vertical vibrations of RC and MR floor trusses (1st and 2nd symmetric forms) were determined. Dynamic characteristics of the main building of NV NPP resulting from full scale researches are supposed to be used as one of building structure stability criteria. (authors)

Effect of shelf aging on vibration transmissibility of anti-vibration gloves

Science.gov (United States)

SHIBATA, Nobuyuki

2017-01-01

Anti-vibration gloves have been used in real workplaces to reduce vibration transmitted through hand-held power tools to the hand. Generally materials used for vibration attenuation in gloves are resilient materials composed of certain synthetic and/or composite polymers. The mechanical characteristics of the resilient materials used in anti-vibration gloves are prone to be influenced by environmental conditions such as temperature, humidity, and photo-irradiation, which cause material degradation and aging. This study focused on the influence of shelf aging on the vibration attenuation performance of air-packaged anti-vibration gloves following 2 yr of shelf aging. Effects of shelf aging on the vibration attenuation performance of anti-vibration gloves were examined according to the Japan industrial standard JIS T8114 test protocol. The findings indicate that shelf aging induces the reduction of vibration attenuation performance in air-packaged anti-vibration gloves. PMID:28978817

Unusual motions of a vibrating string

Science.gov (United States)

Hanson, Roger J.

2003-10-01

The actual motions of a sinusoidally driven vibrating string can be very complex due to nonlinear effects resulting from varying tension and longitudinal motion not included in simple linear theory. Commonly observed effects are: generation of motion perpendicular to the driving force, sudden jumps in amplitude, hysteresis, and generation of higher harmonics. In addition, these effects are profoundly influenced by wire asymmetries which in a brass harpsichord wire can cause a small splitting of each natural frequency of free vibration into two closely spaced frequencies (relative separation ~0.2% to 2%), each associated with transverse motion along two orthogonal characteristic wire axes. Some unusual resulting patterns of complex motions of a point on the wire are exhibited on videotape. Examples include: sudden changes of harmonic content, generation of subharmonics, and motion which appears nearly chaotic but which has a pattern period of over 10 s. Another unusual phenomenon due to entirely different causes can occur when a violin string is bowed with a higher than normal force resulting in sounds ranging from about a musical third to a twelfth lower than the sound produced when the string is plucked.

Imaging arterial cells, atherosclerosis, and restenosis by multimodal nonlinear optical microscopy

Science.gov (United States)

Wang, Han-Wei; Simianu, Vlad; Locker, Matthew J.; Sturek, Michael; Cheng, Ji-Xin

2008-02-01

By integrating sum-frequency generation (SFG), and two-photon excitation fluorescence (TPEF) on a coherent anti-Stokes Raman scattering (CARS) microscope platform, multimodal nonlinear optical (NLO) imaging of arteries and atherosclerotic lesions was demonstrated. CARS signals arising from CH II-rich membranes allowed visualization of endothelial cells and smooth muscle cells in a carotid artery. Additionally, CARS microscopy allowed vibrational imaging of elastin and collagen fibrils which are rich in CH II bonds in their cross-linking residues. The extracellular matrix organization was further confirmed by TPEF signals arising from elastin's autofluorescence and SFG signals arising from collagen fibrils' non-centrosymmetric structure. The system is capable of identifying different atherosclerotic lesion stages with sub-cellular resolution. The stages of atherosclerosis, such as macrophage infiltration, lipid-laden foam cell accumulation, extracellular lipid distribution, fibrous tissue deposition, plaque establishment, and formation of other complicated lesions could be viewed by our multimodal CARS microscope. Collagen percentages in the region adjacent to coronary artery stents were resolved. High correlation between NLO and histology imaging evidenced the validity of the NLO imaging. The capability of imaging significant components of an arterial wall and distinctive stages of atherosclerosis in a label-free manner suggests the potential application of multimodal nonlinear optical microscopy to monitor the onset and progression of arterial diseases.

Passively synchronized dual-wavelength Q-switched lasers

DEFF Research Database (Denmark)

Janousek, Jiri; Tidemand-Lichtenberg, Peter; Mortensen, Jesper Liltorp

We present a simple and efficient way of generating synchronized Q-switched pulses at wavelengths hundreds of nanometers apart. This principle can result in new pulsed all-solid-state light sources at new wavelengths based on SFG.......We present a simple and efficient way of generating synchronized Q-switched pulses at wavelengths hundreds of nanometers apart. This principle can result in new pulsed all-solid-state light sources at new wavelengths based on SFG....

Pulsed, all solid-state light source in the visible spectral region based on non-linear cavity dumping

DEFF Research Database (Denmark)

Tidemand-Lichtenberg, Peter; Andersen, Martin; Johansson, Sandra

We propose a novel generic approach for generation of pulsed light in the visible spectrum, based on SFG between the high circulating intra-cavity power of a high finesse CW laser and a single-passed pulsed laser.......We propose a novel generic approach for generation of pulsed light in the visible spectrum, based on SFG between the high circulating intra-cavity power of a high finesse CW laser and a single-passed pulsed laser....

All-solid-state quasi-CW yellow laser with intracavity self-Raman conversion and sum frequency generation

International Nuclear Information System (INIS)

Kananovich, A; Grabtchikov, A; Orlovich, V; Demidovich, A; Danailov, M

2010-01-01

Quasi continuous-wave (qCW) yellow emission (pulse duration 5 ms, repetition rate 20 Hz) at 559 nm is demonstrated through intracavity sum frequency generation (SFG) of Stokes and fundamental fields in Nd:YVO 4 diode pumped self-Raman laser for the first time. Average in pulse output power at 559 nm was 0.47 W for 22 W of pump power, which corresponds to 2.1% of diode-to-yellow efficiency. The pulsed mode of operation was due to diode pump modulation and was used to reduce thermal stress of the crystal

Coupling vibration research on Vehicle-bridge system

Science.gov (United States)

Zhou, Jiguo; Wang, Guihua

2018-01-01

The vehicle-bridge coupling system forms when vehicle running on a bridge. It will generate a relatively large influence on the driving comfort and driving safe when the vibration of the vehicle is bigger. A three-dimensional vehicle-bridge system with biaxial seven degrees of freedom has been establish in this paper based on finite numerical simulation. Adopting the finite element transient numerical simulation to realize the numerical simulation of vehicle-bridge system coupling vibration. Then, analyze the dynamic response of vehicle and bridge while different numbers of vehicles running on the bridge. Got the variation rule of vertical vibration of car body and bridge, and that of the contact force between the wheel and bridge deck. The research results have a reference value for the analysis about the vehicle running on a large-span cabled bridge.

Flow induced vibrations in gas tube assembly of centrifuge

International Nuclear Information System (INIS)

Alam, M.; Atta, M.A.; Mirza, J.A.; Khan, A.Q.

1986-01-01

A centrifuge essentially consists of a rotor rotating at very high speed. Gas tube assembly, located at the center of the rotor, is used to introduce feed gas into the rotor and remove product and waste streams from it. The gas tube assembly is thus a static component, the product and waste scoops of which are lying in the high pressure region of a fluid rotating at very high speed. This can cause flow induced vibrations in the gas tube assembly. Such vibrations affect not only the mechanical stability of the gas tube assembly but may also reduce the separative power of the centrifuge. In a cascade, if some of the centrifuges have gas tube vibration, then cascade performance will be affected. A theoretical analysis of the effect of waste tube vibrations on product and waste flow rates and pressures in the centrifuge is presented. A simple stage consisting of two centrifuges, in which one has tube vibration, is considered for this purpose. The results are compared with experiment. It is shown that waste tube vibration generates oscillations in waste and product flow rates that are observable outside the centrifuge. (author)

Time-resolved SFG study of formate on a Ni( 1 1 1 ) surface under irradiation of picosecond laser pulses

Science.gov (United States)

Noguchi, H.; Okada, T.; Onda, K.; Kano, S. S.; Wada, A.; Domen, K.

2003-03-01

Time-resolved sum-frequency generation spectroscopy was carried out on a deuterated formate (DCOO) adsorbed on Ni(1 1 1) surface to investigate the surface reaction dynamics under instantaneous surface temperature jump induced by the irradiation by picosecond laser pulses. The irradiation of pump pulse (800 nm) caused the rapid intensity decrease of both CD and OCO stretching modes of bridged formate on Ni(1 1 1). Different temporal behaviors of intensity recovery between these two vibrational modes were observed, i.e., CD stretching mode recovered faster than OCO. This is the first result to show that the dynamics of adsorbates on metals strongly depends on the observed vibrational mode. From the results of temperature and pump fluence dependence, we concluded that the observed intensity change was not due to the decomposition or desorption, but was induced by a non-thermal process.

No Telescoping Effect with Dual Tendon Vibration.

Directory of Open Access Journals (Sweden)

Valeria Bellan

Full Text Available The tendon vibration illusion has been extensively used to manipulate the perceived position of one's own body part. However, findings from previous research do not seem conclusive sregarding the perceptual effect of the concurrent stimulation of both agonist and antagonist tendons over one joint. On the basis of recent data, it has been suggested that this paired stimulation generates an inconsistent signal about the limb position, which leads to a perceived shrinkage of the limb. However, this interesting effect has never been replicated. The aim of the present study was to clarify the effect of a simultaneous and equal vibration of the biceps and triceps tendons on the perceived location of the hand. Experiment 1 replicated and extended the previous findings. We compared a dual tendon stimulation condition with single tendon stimulation conditions and with a control condition (no vibration on both 'upward-downward' and 'towards-away from the elbow' planes. Our results show a mislocalisation towards the elbow of the position of the vibrated arm during dual vibration, in line with previous results; however, this did not clarify whether the effect was due to arm representation contraction (i.e., a 'telescoping' effect. Therefore, in Experiment 2 we investigated explicitly and implicitly the perceived arm length during the same conditions. Our results clearly suggest that in all the vibration conditions there was a mislocalisation of the entire arm (including the elbow, but no evidence of a contraction of the perceived arm length.

Vibration Energy Harvesting Potential for Turbomachinery Applications

Directory of Open Access Journals (Sweden)

Adrian STOICESCU

2018-03-01

Full Text Available The vibration energy harvesting process represents one of the research directions for increasing power efficiency of electric systems, increasing instrumentation nodes autonomy in hard to reach locations and decreasing total system mass by eliminating cables and higher-power adapters. Research based on the possibility of converting vibration energy into useful electric energy is used to evaluate the potential of its use on turbomachinery applications. Aspects such as the structure and characteristics of piezoelectric generators, harvesting networks, their setup and optimization, are considered. Finally, performance test results are shown using piezoelectric systems on a turbine engine.

In Situ Electrochemical SFG/DFG Study of CN⁻ and Nitrile Adsorption at Au from 1-Butyl-1-methyl-pyrrolidinium Bis(trifluoromethylsulfonyl Amide Ionic Liquid ([BMP][TFSA] Containing 4-{2-[1-(2-Cyanoethyl-1,2,3,4-tetrahydroquinolin-6-yl]diazenyl} Benzonitrile (CTDB and K[Au(CN₂

Directory of Open Access Journals (Sweden)

Benedetto Bozzini

2012-06-01

Full Text Available In this paper we report an in situ electrochemical Sum-/Difference Frequency Generation (SFG/DFG spectroscopy investigation of the adsorption of nitrile and CN⁻ from the ionic liquid 1-butyl-1-methyl-pyrrolidinium bis(trifluoromethylsulfonyl amide ([BMP][TFSA] containing 4-{2-[1-(2-cyanoethyl-1,2,3,4-tetrahydroquinolin-6-yl]- diazenyl}benzonitrile (CTDB at Au electrodes in the absence and in the presence of the Au-electrodeposition process from K[Au(CN₂]. The adsorption of nitrile and its coadsorption with CN⁻ resulting either from the cathodic decomposition of the dye or from ligand release from the Au(I cyanocomplex yield potential-dependent single or double SFG bands in the range 2,125–2,140 cm⁻¹, exhibiting Stark tuning values of ca. 3 and 1 cm⁻¹ V⁻¹ in the absence and presence of electrodeposition, respectively. The low Stark tuning found during electrodeposition correlates with the cathodic inhibiting effect of CTDB, giving rise to its levelling properties. The essential insensitivity of the other DFG parameters to the electrodeposition process is due to the growth of smooth Au.

Vibration mixer

Energy Technology Data Exchange (ETDEWEB)

Alekhin, S.A.; Chernov, V.S.; Denisenko, V.V.; Gorodnyanskiy, I.F.; Prokopov, L.I.; Tikhonov, Yu.P.

1983-01-01

The vibration mixer is proposed which contains a housing, vibration drive with rod installed in the upper part of the mixing mechanism made in the form of a hollow shaft with blades. In order to improve intensity of mixing and dispersion of the mud, the shaft with the blades is arranged on the rod of the vibrator and is equipped with a cam coupling whose drive disc is attached to the vibration rod. The rod is made helical, while the drive disc of the cam coupling is attached to the helical surface of the rod. In addition, the vibration mixer is equipped with perforated discs installed on the ends of the rods.

Optical fiber grating vibration sensor for vibration monitoring of hydraulic pump

Science.gov (United States)

Zhang, Zhengyi; Liu, Chuntong; Li, Hongcai; He, Zhenxin; Zhao, Xiaofeng

2017-06-01

In view of the existing electrical vibration monitoring traditional hydraulic pump vibration sensor, the high false alarm rate is susceptible to electromagnetic interference and is not easy to achieve long-term reliable monitoring, based on the design of a beam of the uniform strength structure of the fiber Bragg grating (FBG) vibration sensor. In this paper, based on the analysis of the vibration theory of the equal strength beam, the principle of FBG vibration tuning based on the equal intensity beam is derived. According to the practical application of the project, the structural dimensions of the equal strength beam are determined, and the optimization design of the vibrator is carried out. The finite element analysis of the sensor is carried out by ANSYS, and the first order resonant frequency is 94.739 Hz. The vibration test of the sensor is carried out by using the vibration frequency of 35 Hz and the vibration source of 50 Hz. The time domain and frequency domain analysis results of test data show that the sensor has good dynamic response characteristics, which can realize the accurate monitoring of the vibration frequency and meet the special requirements of vibration monitoring of hydraulic pump under specific environment.

Experimental investigations and finite element simulation of cutting heat in vibrational and conventional drilling of cortical bone.

Science.gov (United States)

Wang, Yu; Cao, Meng; Zhao, Xiangrui; Zhu, Gang; McClean, Colin; Zhao, Yuanyuan; Fan, Yubo

2014-11-01

Heat generated during bone drilling could cause irreversible thermal damage, which can lead to bone necrosis or even osteomyelitis. In this study, vibrational drilling was applied to fresh bovine bones to investigate the cutting heat in comparison with conventional drilling through experimental investigation and finite element analysis (FEA). The influence of vibrational frequency and amplitude on cutting heat generation and conduction were studied. The experimental results showed that, compared with the conventional drilling, vibrational drilling could significantly reduce the cutting temperature in drilling of cortical bone (P<0.05): the cutting temperature tended to decrease with increasing vibrational frequency and amplitude. The FEA results also showed that the vibrational amplitude holds a significant effect on the cutting heat conduction. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

Vibration aging of diesel-engine mounted electrical equipment

International Nuclear Information System (INIS)

Lee, B.J.; Morton, W.C.

1994-01-01

The Emergency Diesel Generator (EDG) in a Nuclear Power Plant is considered to be a component which is essential to safe plant operation. Failures of auxiliary equipment directly mounted on the EDG creates costly repairs, and compromises the engine's availability and reliability. Although IEEE-323 requires addressing of safety-related components due to mechanically induced vibration, very few guidelines exist in the nuclear industry to show how this may be accounted for. Most engine vendors rely on the empirical experience data as the basis of their evaluation for vibration. Upgrade of engine controls, addition of monitoring devices and other engine modifications require design and installation of new equipment to be mounted directly on the engine. This necessitates the evaluation for engine-induced vibration which is considered to be one of the most severe design parameters. This paper discusses the engine vibration characteristics, and the acquisition of extensive field vibration data on the diesel engine under operating conditions. The data is then used to develop life cycle vibration qualification test profiles that can be applied with confidence in a laboratory environment to qualify engine-mounted equipment. The intent is to validate a product's ability to survive under worst case, extended service on-engine conditions. This paper describes the procedures and approaches used to achieve those goals, and provides developed profile examples and test results

Elbow joint position sense after neuromuscular training with handheld vibration.

Science.gov (United States)

Tripp, Brady L; Faust, Donald; Jacobs, Patrick

2009-01-01

Clinicians use neuromuscular control exercises to enhance joint position sense (JPS); however, because standardizing such exercises is difficult, validations of their use are limited. To evaluate the acute effects of a neuromuscular training exercise with a handheld vibrating dumbbell on elbow JPS acuity. Crossover study. University athletic training research laboratory. Thirty-one healthy, college-aged volunteers (16 men, 15 women, age = 23 + or - 3 years, height = 173 + or - 8 cm, mass = 76 + or - 14 kg). We measured and trained elbow JPS using an electromagnetic tracking device that provided auditory and visual biofeedback. For JPS testing, participants held a dumbbell and actively identified the target elbow flexion angle (90 degrees ) using the software-generated biofeedback, followed by 3 repositioning trials without feedback. Each neuromuscular training protocol included 3 exercises during which participants held a 2.55-kg dumbbell vibrating at 15, 5, or 0 Hz and used software-generated biofeedback to locate and maintain the target elbow flexion angle for 15 seconds. We calculated absolute (accuracy) and variable (variability) errors using the differences between target and reproduced angles. Training protocols using 15-Hz vibration enhanced accuracy and decreased variability of elbow JPS (P or = .200). Our results suggest these neuromuscular control exercises, which included low-magnitude, low-frequency handheld vibration, may enhance elbow JPS. Future researchers should examine vibration of various durations and frequencies, should include injured participants and functional multijoint and multiplanar measures, and should examine long-term effects of training protocols on JPS and injury.

Flow-induced vibration analysis of Three Mile Island Unit-2 once-through steam generator tubes. Volume 1. Final report

International Nuclear Information System (INIS)

Johnson, J.R.; Brown, J.C.; Harris, C.E.; McGuinn, E.J.; Simonis, J.C.; Thoren, D.E.

1981-06-01

Tube responses to flow-induced vibration were measured in the top two spans and the tenth span in the B once-through steam generator at Three Mile Island, Unit 2. This program evaluated the effects of flow-induced biration of OTSG tubes during steady-state and transient operation. Twenty-three tubes were instrumented with accelerometers and strain gages in tubes located along the open lane, in the bundle, and at the tenth span. Tube displacements, frequencies, dynamic strains, and mode shapes were determined during steady-state and transient operation. Pressure sensors were installed in the OTSG to measure pressure fluctuations and plant parameters, which were recorded for correlation with tube response. Data analysis results indicate that the steady-state tube response increases with increasing reactor power, with the maximum response (12 mils peak to peak at midspan) at the outer perimeter of the generator in the 16th span

Tool-specific performance of vibration-reducing gloves for attenuating fingers-transmitted vibration

Science.gov (United States)

Welcome, Daniel E.; Dong, Ren G.; Xu, Xueyan S.; Warren, Christopher; McDowell, Thomas W.

2016-01-01

BACKGROUND Fingers-transmitted vibration can cause vibration-induced white finger. The effectiveness of vibration-reducing (VR) gloves for reducing hand transmitted vibration to the fingers has not been sufficiently examined. OBJECTIVE The objective of this study is to examine tool-specific performance of VR gloves for reducing finger-transmitted vibrations in three orthogonal directions (3D) from powered hand tools. METHODS A transfer function method was used to estimate the tool-specific effectiveness of four typical VR gloves. The transfer functions of the VR glove fingers in three directions were either measured in this study or during a previous study using a 3D laser vibrometer. More than seventy vibration spectra of various tools or machines were used in the estimations. RESULTS When assessed based on frequency-weighted acceleration, the gloves provided little vibration reduction. In some cases, the gloves amplified the vibration by more than 10%, especially the neoprene glove. However, the neoprene glove did the best when the assessment was based on unweighted acceleration. The neoprene glove was able to reduce the vibration by 10% or more of the unweighted vibration for 27 out of the 79 tools. If the dominant vibration of a tool handle or workpiece was in the shear direction relative to the fingers, as observed in the operation of needle scalers, hammer chisels, and bucking bars, the gloves did not reduce the vibration but increased it. CONCLUSIONS This study confirmed that the effectiveness for reducing vibration varied with the gloves and the vibration reduction of each glove depended on tool, vibration direction to the fingers, and finger location. VR gloves, including certified anti-vibration gloves do not provide much vibration reduction when judged based on frequency-weighted acceleration. However, some of the VR gloves can provide more than 10% reduction of the unweighted vibration for some tools or workpieces. Tools and gloves can be matched for

a Study of Radial Vibrations of a Rolling Tyre for TYRE-ROAD Noise Characterisation

Science.gov (United States)

Périsse, J.

2002-11-01

Because tyre-road noise represents the main noise source for light vehicles with driving speed above 60 km/h, comprehension of generation mechanism of tyre-road noise has become a subject of major importance. In this paper, tyre-road interaction and radial tyre vibrations are investigated for tyre-road noise characterisation. Experimental measurements are performed on a rolling smooth tyre with test laboratory facilities. Both tread band and sidewall responses of the tyre are measured and compared to each other. High concentration of vibrations is observed in the vicinity of the contact area. Stationary radial deformation and non-stationary vibrations due to road rugosity are studied. Frequency analyses have been performed on the acceleration time signals showing the influence of the rotating speed on the vibrations level and frequency content. Finally, by integrating acceleration signal of the tyre tread over one revolution, stationary radial displacement can be calculated and the true contact length can be estimated. This study provides us with new measurement data for comparison with mathematical modelling. It also gives a physical insight on generation mechanism of tyre radial vibrations.

Investigation of active vibration drilling using acoustic emission and cutting size analysis

Directory of Open Access Journals (Sweden)

Yingjian Xiao

2018-04-01

Full Text Available This paper describes an investigation of active bit vibration on the penetration mechanisms and bit-rock interaction for drilling with a diamond impregnated coring bit. A series of drill-off tests (DOTs were conducted where the drilling rate-of-penetration (ROP was measured at a series of step-wise increasing static bit thrusts or weight-on-bits (WOBs. Two active DOTs were conducted by applying 60 Hz axial vibration at the bit-rock interface using an electromagnetic vibrating table mounted underneath the drilling samples, and a passive DOT was conducted where the bit was allowed to vibrate naturally with lower amplitude due to the compliance of the drilling sample mountings. During drilling, an acoustic emission (AE system was used to record the AE signals generated by the diamond cutter penetration and the cuttings were collected for grain size analysis. The instrumented drilling system recorded the dynamic motions of the bit-rock interface using a laser displacement sensor, a load cell, and an LVDT (linear variable differential transformer recorded the dynamic WOB and the ROP, respectively. Calibration with the drilling system showed that rotary speed was approximately the same at any given WOB, facilitating comparison of the results at the same WOB. Analysis of the experimental results shows that the ROP of the bit at any given WOB increased with higher amplitude of axial bit-rock vibration, and the drill cuttings increased in size with a higher ROP. Spectral analysis of the AEs indicated that the higher ROP and larger cutting size were correlated with a higher AE energy and a lower AE frequency. This indicated that larger fractures were being created to generate larger cutting size. Overall, these results indicate that a greater magnitude of axial bit-rock vibration produces larger fractures and generates larger cuttings which, at the same rotary speed, results in a higher ROP. Keywords: Active bit vibration, Diamond coring drilling, Drill

Vibrational Characteristics of ring-type ultrasonic motor stator using ESPI

International Nuclear Information System (INIS)

Jung, Hyun Kyu; Paik, Sung Hoon; Kim, Seung Ho; Park, Ki Jun; Wang, Young Sung

2001-01-01

A stator of ring-type ultrasonic motor composed of the piezoelectric ceramic and the elastic metal was made to generate the travelling wave. Vibrational behavior of the stator was simulated by a finite element analysis using ATILA program and was measured by the electronic speckle pattern interferometry (ESPI) method. The resonance frequencies and vibration modes were analysed depending upon the comparison between the finite element analysis and ESPI measurement. The optimal vibration mode and frequency was estimated to be 7th resonant mode which was corresponded to the measured frequency of 39 KHz. It could be concluded that this fabricated stator can be applied for ring-type ultrasonic motor.

Flow-Induced Vibration of Circular Cylindrical Structures

Energy Technology Data Exchange (ETDEWEB)

Chen, Shoei-Sheng [Argonne National Lab. (ANL), Argonne, IL (United States). Components Technology Division

1985-06-01

Flow-induced vibration is a term to denote those phenomena associated with the response of structures placed in or conveying fluid flow. More specifically, the terra covers those cases in which an interaction develops between fluid-dynamic forces and the inertia, damping or elastic forces in the structures. The study of these phenomena draws on three disciplines: (1) structural mechanics, (2) mechanical vibration, and (3) fluid dynamics. The vibration of circular cylinders subject to flow has been known to man since ancient times; the vibration of a wire at its natural frequency in response to vortex shedding was known in ancient Greece as aeolian tones. But systematic studies of the problem were not made until a century ago when Strouhal established the relationship between vortex shedding frequency and flow velocity for a given cylinder diameter. The early research in this area has beer summarized by Zdravkovich (1985) and Goldstein (1965). Flow-induced structural vibration has been experienced in numerous fields, including the aerospace industry, power generation/transmission (turbine blades, heat exchanger tubes, nuclear reactor components), civil engineering (bridges, building, smoke stacks), and undersea technology. The problems have usually been encountered or created accidentally through improper design. In most cases, a structural or mechanical component, designed to meet specific objectives, develops problems when the undesired effects of flow field have not been accounted for in the design. When a flow-induced vibration problem is noted in the design stage, the engineer has different options to eliminate the detrimental vibration. Unfortunately, in many situations, the problems occur after the components are already in operation; the "fix" usually is very costly. Flow-induced vibration comprises complex and diverse phenomena; subcritical vibration of nuclear fuel assemblies, galloping of transmission lines, flutter of pipes conveying fluid, and whirling

Contact area affects frequency-dependent responses to vibration in the peripheral vascular and sensorineural systems.

Science.gov (United States)

Krajnak, Kristine; Miller, G R; Waugh, Stacey

2018-01-01

Repetitive exposure to hand-transmitted vibration is associated with development of peripheral vascular and sensorineural dysfunctions. These disorders and symptoms associated with it are referred to as hand-arm vibration syndrome (HAVS). Although the symptoms of the disorder have been well characterized, the etiology and contribution of various exposure factors to development of the dysfunctions are not well understood. Previous studies performed using a rat-tail model of vibration demonstrated that vascular and peripheral nervous system adverse effects of vibration are frequency-dependent, with vibration frequencies at or near the resonant frequency producing the most severe injury. However, in these investigations, the amplitude of the exposed tissue was greater than amplitude typically noted in human fingers. To determine how contact with vibrating source and amplitude of the biodynamic response of the tissue affects the risk of injury occurring, this study compared the influence of frequency using different levels of restraint to assess how maintaining contact of the tail with vibrating source affects the transmission of vibration. Data demonstrated that for the most part, increasing the contact of the tail with the platform by restraining it with additional straps resulted in an enhancement in transmission of vibration signal and elevation in factors associated with vascular and peripheral nerve injury. In addition, there were also frequency-dependent effects, with exposure at 250 Hz generating greater effects than vibration at 62.5 Hz. These observations are consistent with studies in humans demonstrating that greater contact and exposure to frequencies near the resonant frequency pose the highest risk for generating peripheral vascular and sensorineural dysfunction.

Characterization of Friction Joints Subjected to High Levels of Random Vibration

Science.gov (United States)

deSantos, Omar; MacNeal, Paul

2012-01-01

This paper describes the test program in detail including test sample description, test procedures, and vibration test results of multiple test samples. The material pairs used in the experiment were Aluminum-Aluminum, Aluminum- Dicronite coated Aluminum, and Aluminum-Plasmadize coated Aluminum. Levels of vibration for each set of twelve samples of each material pairing were gradually increased until all samples experienced substantial displacement. Data was collected on 1) acceleration in all three axes, 2) relative static displacement between vibration runs utilizing photogrammetry techniques, and 3) surface galling and contaminant generation. This data was used to estimate the values of static friction during random vibratory motion when "stick-slip" occurs and compare these to static friction coefficients measured before and after vibration testing.

Aerodynamic performance of a vibrating piezoelectric fan under varied operational conditions

International Nuclear Information System (INIS)

Stafford, J; Jeffers, N

2014-01-01

This paper experimentally examines the bulk aerodynamic performance of a vibrating fan operating in the first mode of vibration. The influence of operating condition on the local velocity field has also been investigated to understand the flow distribution at the exit region and determine the stalling condition for vibrating fans. Fan motion has been generated and controlled using a piezoelectric ceramic attached to a stainless steel cantilever. The frequency and amplitude at resonance were 109.4 Hz and 12.5 mm, respectively. A test facility has been developed to measure the pressure-flow characteristics of the vibrating fan and simultaneously conduct local velocity field measurements using particle image velocimetry. The results demonstrate the impact of system characteristics on the local velocity field. High momentum regions generated due to the oscillating motion exist with a component direction that is tangent to the blade at maximum displacement. These high velocity zones are significantly affected by increasing impedance while flow reversal is a dominant feature at maximum pressure rise. The findings outlined provide useful information for design of thermal management solutions that may incorporate this air cooling approach.

Theory of vibration protection

CERN Document Server

Karnovsky, Igor A

2016-01-01

This text is an advancement of the theory of vibration protection of mechanical systems with lumped and distributed parameters. The book offers various concepts and methods of solving vibration protection problems, discusses the advantages and disadvantages of different methods, and the fields of their effective applications. Fundamental approaches of vibration protection, which are considered in this book, are the passive, parametric and optimal active vibration protection. The passive vibration protection is based on vibration isolation, vibration damping and dynamic absorbers. Parametric vibration protection theory is based on the Shchipanov-Luzin invariance principle. Optimal active vibration protection theory is based on the Pontryagin principle and the Krein moment method. The book also contains special topics such as suppression of vibrations at the source of their occurrence and the harmful influence of vibrations on humans. Numerous examples, which illustrate the theoretical ideas of each chapter, ar...

Translational, rotational and vibrational temperatures of a gliding arc discharge at atmospheric pressure air

DEFF Research Database (Denmark)

Zhu, Jiajian; Gao, Jinlong; Ehn, Andreas

2014-01-01

and vibrational temperatures of a gliding arc generated at atmospheric pressure air are investigated. Translational temperatures (about 1100 K) were measured by laser-induced Rayleigh scattering, and two-dimensional temperature imaging was performed. Rotational and vibrational temperatures (about 3600 K and 6700...

Evaluation of blast-induced vibration effects on structures 1

Energy Technology Data Exchange (ETDEWEB)

Lee, Jong Rim; Jeon, Gyu Shick; Lee, Dae Soo; Joo, Kwang Ho; Lee, Woong Keon [Korea Electrotechnology Research Inst., Changwon (Korea, Republic of); Ryu, Chang Ha; Chung, So Keul; Lee, Kyung Won; Shin, Hee Soon; Chun, Sun Woo; Park, Yeon Jun; Synn, Joong Ho; Choi, Byung Hee [Korea Inst. of Geology Mining and Materials, Taejon (Korea, Republic of)

1995-12-31

Due to the difficulties of obtaining construction site for new plants, following ones are inevitably being built in the site adjacent to existing power plants. Therefore considerable thought has been recently given to the dynamic loading generated by blasting works near the plants to maintain the safety of structures and facilities in power plants. Our own standard for safety level of blast vibration is not prepared yet, and foreign standards have been generally employed without theoretical and experimental verification. Safety-related structures of power plants and facilities have to be protected against the effects of possible hazards due to blast vibration. Earthquakes have been considered a major dynamic design loading as a requirement of plant design, but the effects of blast-induced vibration are not. In order to ensure the safety, rational safe criterion should be established and blast design should be satisfy it, which requires the development of a model for prediction of vibration level through more systematic measurement and analysis. The main objectives of the study are : to provide background data for establishing the rational safe vibration limits, to develop models for prediction of blast vibration level, to establish safe blast design criterion, and to accumulate techniques for field measurements, data acquisition and analysis (author). 80 refs., 347 figs.

Vibration of machine

International Nuclear Information System (INIS)

Kwak, Mun Gyu; Na, Sung Su; Baek, Gwang Hyeon; Song, Chul Gi; Han, Sang Bo

2001-09-01

This book deals with vibration of machine which gives descriptions of free vibration using SDOF system, forced vibration using SDOF system, vibration of multi-degree of freedom system like introduction and normal form, distribution system such as introduction, free vibration of bar and practice problem, approximate solution like lumped approximations and Raleigh's quotient, engineering by intuition and experience, real problem and experimental method such as technology of signal, fourier transform analysis, frequency analysis and sensor and actuator.

Vibrations of Railroad Due to The Passage of The Underground Train

Science.gov (United States)

Konowrocki, Robert; Bajer, Czesław

2010-03-01

In the paper we present results of vibration measurements in the train and on the base of the railroad in tunnels of Warsaw Underground. Measurements were performed at straight and curved sections of the track. The paper is focused on the influence of the lateral slip in rail/wheel contact zone on the generation of vibrations and a noise. Vibrations were analyzed in terms of accelerations, velocities or displacements as a function of time and frequency. Results ware compared with the experiment of rolling of the wheel with lateral sleep. In both cases we observed double periodic oscillations.

Nonlinear generation of non-acoustic modes by low-frequency sound in a vibrationally relaxing gas

International Nuclear Information System (INIS)

Perelomova, A.

2010-01-01

Two dynamic equations referring to a weakly nonlinear and weakly dispersive flow of a gas in which molecular vibrational relaxation takes place, are derived. The first one governs an excess temperature associated with the thermal mode, and the second one describes variations in vibrational energy. Both quantities refer to non-wave types of gas motion. These variations are caused by the nonlinear transfer of acoustic energy into thermal mode and internal vibrational degrees of freedom of a relaxing gas. The final dynamic equations are instantaneous; they include a quadratic nonlinear acoustic source, reflecting the nonlinear character of interaction of low-frequency acoustic and non-acoustic motions of the fluid. All types of sound, periodic or aperiodic, may serve as an acoustic source of both phenomena. The low-frequency sound is considered in this study. Some conclusions about temporal behavior of non-acoustic modes caused by periodic and aperiodic sound are made. Under certain conditions, acoustic cooling takes place instead of heating. (author)

Component vibration of VVER-reactors - diagnostics and modelling

International Nuclear Information System (INIS)

Altstadt, E.; Scheffler, M.; Weiss, F.-P.

1995-01-01

Flow induced vibrations of reactor pressure vessel (RPV) internals (control element and core barrel motions) at VVER-440 reactors have led to the development of dedicated methods for on-line monitoring. These methods need a certain developed stage of the faults to be detected. To achieve a real sensitive early detection of mechanical faults of RPV internals, a theoretical vibration model was developed based on finite elements. The model comprises the whole primary circuit including the steam generators (SG). By means of that model all eigenfrequencies up to 30 Hz and the corresponding mode shapes were calculated for the normal vibration behaviour. Moreover the shift of eigenfrequencies and of amplitudes due to the degradation or to the failure of internal clamping and spring elements could be investigated, showing that a recognition of such degradations even inside the RPV is possible by pure excore vibration measurements. A true diagnostic, that is the identification of the failed component, might become possible because different faults influence different and well separated eigenfrequencies. (author)

Laser-Doppler vibrating tube densimeter for measurements at high temperatures and pressures

International Nuclear Information System (INIS)

Aida, Tsutomu; Yamazaki, Ai; Akutsu, Makoto; Ono, Takumi; Kanno, Akihiro; Hoshina, Taka-aki; Ota, Masaki; Watanabe, Masaru; Sato, Yoshiyuki; Smith, Richard L. Jr.; Inomata, Hiroshi

2007-01-01

A laser-Doppler vibrometer was used to measure the vibration of a vibrating tube densimeter for measuring P-V-T data at high temperatures and pressures. The apparatus developed allowed the control of the residence time of the sample so that decomposition at high temperatures could be minimized. A function generator and piezoelectric crystal was used to excite the U-shaped tube in one of its normal modes of vibration. Densities of methanol-water mixtures are reported for at 673 K and 40 MPa with an uncertainty of 0.009 g/cm 3

SFG study of methanol dissociative adsorption at Pt(1 0 0), Pt(1 1 0) and Pt(1 1 1) electrodes surfaces

Science.gov (United States)

Vidal, F.; Busson, B.; Six, C.; Pluchery, O.; Tadjeddine, A.

2002-04-01

The Pt( hkl)/methanol in acidic solution interface which constitutes a model of the anodic part of a fuel cell is studied by infrared-visible sum frequency generation vibrational spectroscopy. Methanol dissociative adsorption leads to CO poisoning of the Pt electrode surfaces. The structure of the CO/Pt( hkl) interface depends strongly on the orientation of the surface electrode.

Blasting vibrations control: The shortcomings of traditional methods

Energy Technology Data Exchange (ETDEWEB)

Vuillaume, P.M.; Kiszlo, M. [Institut National de l`Environnement Industriel et des Risques, Verneuil en Halatte (France); Bernard, T. [Compagnie Nouvelle de Scientifiques, Nice (France)

1996-12-31

In the context of its studies for the French ministry of the environment and for the French national coal board, INERIS (the French institute for the industrial environment and hazards, formerly CERCHAR) has made a complete critical survey of the methods generally used to reduce the levels of blasting vibrations. It is generally acknowledged that the main parameter to control vibrations is the so-called instantaneous charge, or charge per delay. This should be reduced as much as possible in order to diminish vibration levels. On account of this, the use of a new generation of blasting devices, such as non-electric detonators or electronic sequential timers has been developed since the seventies. INERIS has collected data from about 900 blasts in 2 quarries and 3 open pit mines. These data include input parameters such as borehole diameter, burden, spacing, charge per hole, charge per delay, total fired charge, etc ... They also include output measurements, such as vibration peak particle velocities, and main frequencies. These data have been analyzed with the help of multi variable statistical tools. Blasting tests were undertaken to evaluate new methods of vibrations control, such as the superposition of vibration signals. These methods appear to be accurate in many critical cases, but certainly would be highly improved with a better accuracy of firing delays. The development of electronic detonators seems to be the way of the future for a better blasting control.

An evaluation method of critical velocity for self-excited vibration of cross-shaped tube bundle in cross flow

International Nuclear Information System (INIS)

Inada, Fumio; Nishihara, Takashi; Yasuo, Akira; Morita, Ryo

2002-01-01

The applicability of the cross-shaped tube bundle as a lower plenum component of pressure vessel is examined to develop a next generation LWR in Japanese electric utilities. The flow-induced vibration characteristics are not understood well. Methods to evaluate turbulence induced vibration and vortex induced vibration were proposed by CRIEPI. In this study, vibration response is obtained experimentally to propose a method to evaluate self-excited vibration of cross-shaped tube bundle. The self-excited vibration was found to be generated when nondimensional flow velocity was above a critical value. The nondimensional critical velocity of normal configuration is 15% smaller than that of staggered configuration, which means that the nondimensional critical velocity of normal configuration can give conservative evaluation. The result of Reynolds number Re=6.2 x 10 4 agrees well with that of Re=6.8 x 10 5 , in which region, the effect of Reynolds number on the critical velocity is small. (author)

Reducing vibration transfer from power plants by active methods

Science.gov (United States)

Kiryukhin, A. V.; Milman, O. O.; Ptakhin, A. V.

2017-12-01

The possibility of applying the methods of active damping of vibration and pressure pulsations for reducing their transfer from power plants into the environment, the seating, and the industrial premises are considered. The results of experimental works implemented by the authors on the active broadband damping of vibration and dynamic forces after shock-absorption up to 15 dB in the frequency band up to 150 Hz, of water pressure pulsations in the pipeline up to 20 dB in the frequency band up to 600 Hz, and of spatial low-frequency air noise indoors of a diesel generator at discrete frequency up to 20 dB are presented. It is shown that a reduction of vibration transfer through a vibration-isolating junction (expansion joints) of pipelines with liquid is the most complicated and has hardly been developed so far. This problem is essential for vibration isolation of power equipment from the seating and the environment through pipelines with water and steam in the power and transport engineering, shipbuilding, and in oil and gas pipelines in pumping stations. For improving efficiency, reducing the energy consumption, and decreasing the overall dimensions of equipment, it is advisable to combine the work of an active system with passive damping means, the use of which is not always sufficient. The executive component of the systems of active damping should be placed behind the vibration isolators (expansion joints). It is shown that the existence of working medium and connection of vibration with pressure pulsations in existing designs of pipeline expansion joints lead to growth of vibration stiffness of the expansion joint with the environment by two and more orders as compared with the static stiffness and makes difficulties for using the active methods. For active damping of vibration transfer through expansion joints of pipelines with a liquid, it is necessary to develop expansion joint structures with minimal connection of vibrations and pulsations and minimal

Anti-vibration gloves?

Science.gov (United States)

Hewitt, Sue; Dong, Ren G; Welcome, Daniel E; McDowell, Thomas W

2015-03-01

For exposure to hand-transmitted vibration (HTV), personal protective equipment is sold in the form of anti-vibration (AV) gloves, but it remains unclear how much these gloves actually reduce vibration exposure or prevent the development of hand-arm vibration syndrome in the workplace. This commentary describes some of the issues that surround the classification of AV gloves, the assessment of their effectiveness and their applicability in the workplace. The available information shows that AV gloves are unreliable as devices for controlling HTV exposures. Other means of vibration control, such as using alternative production techniques, low-vibration machinery, routine preventative maintenance regimes, and controlling exposure durations are far more likely to deliver effective vibration reductions and should be implemented. Furthermore, AV gloves may introduce some adverse effects such as increasing grip force and reducing manual dexterity. Therefore, one should balance the benefits of AV gloves and their potential adverse effects if their use is considered. © Crown copyright 2014.

Correlating the vibrational spectra of structurally related molecules: A spectroscopic measure of similarity.

Science.gov (United States)

Tao, Yunwen; Zou, Wenli; Cremer, Dieter; Kraka, Elfi

2018-03-05

Using catastrophe theory and the concept of a mutation path, an algorithm is developed that leads to the direct correlation of the normal vibrational modes of two structurally related molecules. The mutation path is defined by weighted incremental changes in mass and geometry of the molecules in question, which are successively applied to mutate a molecule into a structurally related molecule and thus continuously converting their normal vibrational spectra from one into the other. Correlation diagrams are generated that accurately relate the normal vibrational modes to each other by utilizing mode-mode overlap criteria and resolving allowed and avoided crossings of vibrational eigenstates. The limitations of normal mode correlation, however, foster the correlation of local vibrational modes, which offer a novel vibrational measure of similarity. It will be shown how this will open new avenues for chemical studies. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

The comparison between the acquisition vibration data obtained by different types of transducers for hydraulic turbine head cover

Science.gov (United States)

Li, Youping; Lu, Jinsong; Cheng, Jian; Yin, Yongzhen; Wang, Jianlan

2017-04-01

Based on the summaries of the rules about the vibration measurement for hydro-generator sets with respect to relevant standards, the key issues of the vibration measurement, such as measurement modes, the transducer selection are illustrated. In addition, the problems existing in vibration measurement are pointed out. The actual acquisition data of head cover vertical vibration respectively obtained by seismic transducer and eddy current transducer in site hydraulic turbine performance tests during the rising of the reservoir upstream level in a certain hydraulic power plant are compared. The difference of the data obtained by the two types of transducers and the potential reasons are presented. The application conditions of seismic transducer and eddy current transducer for hydro-generator set vibration measurement are given based on the analysis. Research subjects that should be focused on about the topic discussed in this paper are suggested.

Vibration-reducing gloves: transmissibility at the palm of the hand in three orthogonal directions.

Science.gov (United States)

McDowell, Thomas W; Dong, Ren G; Welcome, Daniel E; Xu, Xueyan S; Warren, Christopher

2013-01-01

Vibration-reducing (VR) gloves are commonly used as a means to help control exposures to hand-transmitted vibrations generated by powered hand tools. The objective of this study was to characterise the vibration transmissibility spectra and frequency-weighted vibration transmissibility of VR gloves at the palm of the hand in three orthogonal directions. Seven adult males participated in the evaluation of seven glove models using a three-dimensional hand-arm vibration test system. Three levels of hand coupling force were applied in the experiment. This study found that, in general, VR gloves are most effective at reducing vibrations transmitted to the palm along the forearm direction. Gloves that are found to be superior at reducing vibrations in the forearm direction may not be more effective in the other directions when compared with other VR gloves. This casts doubts on the validity of the standardised glove screening test. Practitioner Summary: This study used human subjects to measure three-dimensional vibration transmissibility of vibration-reducing gloves at the palm and identified their vibration attenuation characteristics. This study found the gloves to be most effective at reducing vibrations along the forearm direction. These gloves did not effectively attenuate vibration along the handle axial direction.

Application of flow-induced vibration predictive techniques to operating steam generators

International Nuclear Information System (INIS)

Sauve, R.G.; Tabatabai, M.; Morandin, G.; Kozluk, M.J.

1998-01-01

Analytical techniques for flow-induced vibration (FIV), such as those incorporated in available design tools, are routinely applied to process equipment at the initial design stage. Unfortunately, this does not always apply to the situation when problems, related to FIV, develop in crucial operating equipment, since design uses conservative methods, whereas in-service applications require more realistic assessments. Usually these problems appear in the form of severe through wall fret flaws or fatigue cracks that compromise the integrity of the tubes and possibly the complete unit. It is here where a somewhat different approach must be taken in the evaluation of tube response to FIV. Tube damage from fretting wear or fatigue crack growth must be estimated from actual in situ operating conditions. In this paper, an overview of the predictive methods used in the development and/or qualification of remedial measures for problems that occur in operating process equipment along with applications are described. The steps in the evaluation procedure, from the prediction of flow regimes, the development of the nonlinear computer models and associated fluid forcing functions through to the estimates of tube damage in operating heat exchangers and steam generators are presented. A probabilistic (i.e. Monte Carlo simulation) FIV approach that readily accommodates uncertainties associated with damage predictions is summarized. The efficacy of this approach comes from the fact that probabilistic methods facilitate the incorporation of field data, and that a large number of tubes and possible variations in geometry, process and support conditions, usually present in such equipment, can be addressed effectively. (author)

Ultra-low-vibration pulse-tube cryocooler system - cooling capacity and vibration

Science.gov (United States)

Ikushima, Yuki; Li, Rui; Tomaru, Takayuki; Sato, Nobuaki; Suzuki, Toshikazu; Haruyama, Tomiyoshi; Shintomi, Takakazu; Yamamoto, Akira

2008-09-01

This report describes the development of low-vibration cooling systems with pulse-tube (PT) cryocoolers. Generally, PT cryocoolers have the advantage of lower vibrations in comparison to those of GM cryocoolers. However, cooling systems for the cryogenic laser interferometer observatory (CLIO), which is a gravitational wave detector, require an operational vibration that is sufficiently lower than that of a commercial PT cryocooler. The required specification for the vibration amplitude in cold stages is less than ±1 μm. Therefore, during the development of low-vibration cooling systems for the CLIO, we introduced advanced countermeasures for commercial PT cryocoolers. The cooling performance and the vibration amplitude were evaluated. The results revealed that 4 K and 80 K PT cooling systems with a vibration amplitude of less than ±1 μm and cooling performance of 4.5 K and 70 K at heat loads of 0.5 W and 50 W, respectively, were developed successfully.

Approaches to single photon detection

International Nuclear Information System (INIS)

Thew, R.T.; Curtz, N.; Eraerds, P.; Walenta, N.; Gautier, J.-D.; Koller, E.; Zhang, J.; Gisin, N.; Zbinden, H.

2009-01-01

We present recent results on our development of single photon detectors, including: gated and free-running InGaAs/InP avalanche photodiodes (APDs); hybrid detection systems based on sum-frequency generation (SFG) and Si APDs-SFG-Si APDs; and SSPDs (superconducting single photon detectors), for telecom wavelengths; as well as SiPM (Silicon photomultiplier) detectors operating in the visible regime.