Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

Directory of Open Access Journals (Sweden)

Jakobek Judy L

2007-07-01

duplicated copy may simply augment/supplement a specific pathway function (aflR/aflS and aflX/aflY or the duplicated copy may evolve a completely new function (aflT/aflQ and aflC/aflW. Gene modules that are contiguous in one species and noncontiguous in others point to possible rearrangements of cluster genes in the evolution of these species. Significantly higher mean Ka/Ks values in section Flavi compared to non-section Flavi species indicate increased positive selection acting in the evolution of genes in OMST and AF gene clusters.

Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

Science.gov (United States)

Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

2016-02-01

Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

The genomic distribution of intraspecific and interspecific sequence divergence of human segmental duplications relative to human/chimpanzee chromosomal rearrangements

Directory of Open Access Journals (Sweden)

Eichler Evan E

2008-08-01

Full Text Available Abstract Background It has been suggested that chromosomal rearrangements harbor the molecular footprint of the biological phenomena which they induce, in the form, for instance, of changes in the sequence divergence rates of linked genes. So far, all the studies of these potential associations have focused on the relationship between structural changes and the rates of evolution of single-copy DNA and have tried to exclude segmental duplications (SDs. This is paradoxical, since SDs are one of the primary forces driving the evolution of structure and function in our genomes and have been linked not only with novel genes acquiring new functions, but also with overall higher DNA sequence divergence and major chromosomal rearrangements. Results Here we take the opposite view and focus on SDs. We analyze several of the features of SDs, including the rates of intraspecific divergence between paralogous copies of human SDs and of interspecific divergence between human SDs and chimpanzee DNA. We study how divergence measures relate to chromosomal rearrangements, while considering other factors that affect evolutionary rates in single copy DNA. Conclusion We find that interspecific SD divergence behaves similarly to divergence of single-copy DNA. In contrast, old and recent paralogous copies of SDs do present different patterns of intraspecific divergence. Also, we show that some relatively recent SDs accumulate in regions that carry inversions in sister lineages.

Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

Science.gov (United States)

Li, Zhen; Van de Peer, Yves; De Smet, Riet

2016-01-01

Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

Mitochondrial genome of the Komodo dragon: efficient sequencing method with reptile-oriented primers and novel gene rearrangements.

Science.gov (United States)

Kumazawa, Yoshinori; Endo, Hideki

2004-04-30

The mitochondrial genome of the Komodo dragon (Varanus komodoensis) was nearly completely sequenced, except for two highly repetitive noncoding regions. An efficient sequencing method for squamate mitochondrial genomes was established by combining the long polymerase chain reaction (PCR) technology and a set of reptile-oriented primers designed for nested PCR amplifications. It was found that the mitochondrial genome had novel gene arrangements in which genes from NADH dehydrogenase subunit 6 to proline tRNA were extensively shuffled with duplicate control regions. These control regions had 99% sequence similarity over 700 bp. Although snake mitochondrial genomes are also known to possess duplicate control regions with nearly identical sequences, the location of the second control region suggested independent occurrence of the duplication on lineages leading to snakes and the Komodo dragon. Another feature of the mitochondrial genome of the Komodo dragon was the considerable number of tandem repeats, including sequences with a strong secondary structure, as a possible site for the slipped-strand mispairing in replication. These observations are consistent with hypotheses that tandem duplications via the slipped-strand mispairing may induce mitochondrial gene rearrangements and may serve to maintain similar copies of the control region.

The odds of duplicate gene persistence after polyploidization

Directory of Open Access Journals (Sweden)

Chain Frédéric JJ

2011-12-01

Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

Sterile DJH rearrangements reveal that distance between gene segments on the human Ig H chain locus influences their ability to rearrange

DEFF Research Database (Denmark)

Hansen, Tina Østergaard; Lange, Anders Blaabjerg; Barington, Torben

2015-01-01

Rearrangement of the Ig locus occurs in two steps. First, a JH gene is rearranged to a D gene followed by a VH gene rearranging to the DJH rearrangement. By next generation sequencing, we analyzed 9969 unique DJH rearrangements and 5919 unique VHDJH rearrangements obtained from peripheral blood B...... frequently than JH locus distal D genes, whereas VH locus proximal D genes were observed more frequently in nonproductive VHDJH rearrangements. We further demonstrate that the distance between VH, D, and JH gene segments influence their ability to rearrange within the human Ig locus....

Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Cheng Zou

2009-07-01

Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

Science.gov (United States)

Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

2010-10-15

Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

Directory of Open Access Journals (Sweden)

Zhixi Su

2014-01-01

Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome.

Science.gov (United States)

Sharp, Andrew J; Hansen, Sierra; Selzer, Rebecca R; Cheng, Ze; Regan, Regina; Hurst, Jane A; Stewart, Helen; Price, Sue M; Blair, Edward; Hennekam, Raoul C; Fitzpatrick, Carrie A; Segraves, Rick; Richmond, Todd A; Guiver, Cheryl; Albertson, Donna G; Pinkel, Daniel; Eis, Peggy S; Schwartz, Stuart; Knight, Samantha J L; Eichler, Evan E

2006-09-01

Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic disorders. We tested 290 individuals with mental retardation by BAC array comparative genomic hybridization and identified 16 pathogenic rearrangements, including de novo microdeletions of 17q21.31 found in four individuals. Using oligonucleotide arrays, we refined the breakpoints of this microdeletion, defining a 478-kb critical region containing six genes that were deleted in all four individuals. We mapped the breakpoints of this deletion and of four other pathogenic rearrangements in 1q21.1, 15q13, 15q24 and 17q12 to flanking segmental duplications, suggesting that these are also sites of recurrent rearrangement. In common with the 17q21.31 deletion, these breakpoint regions are sites of copy number polymorphism in controls, indicating that these may be inherently unstable genomic regions.

Functional requirements driving the gene duplication in 12 Drosophila species.

Science.gov (United States)

Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

2013-08-15

Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

Science.gov (United States)

Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

2012-06-15

Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

Directory of Open Access Journals (Sweden)

Jeffrey A. Fawcett

2011-02-01

Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

Science.gov (United States)

Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

2012-08-19

Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder.

Science.gov (United States)

Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M

2013-08-01

An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

Deciphering the Code of the Cancer Genome: Mechanisms of Chromosome Rearrangement

Science.gov (United States)

Willis, Nicholas A.; Rass, Emilie; Scully, Ralph

2015-01-01

Chromosome rearrangement plays a causal role in tumorigenesis by contributing to the inactivation of tumor suppressor genes, the dysregulated expression or amplification of oncogenes and the generation of novel gene fusions. Chromosome breaks are important intermediates in this process. How, when and where these breaks arise and the specific mechanisms engaged in their repair strongly influence the resulting patterns of chromosome rearrangement. Here, we review recent progress in understanding how certain distinctive features of the cancer genome, including clustered mutagenesis, tandem segmental duplications, complex breakpoints, chromothripsis, chromoplexy and chromoanasynthesis may arise. PMID:26726318

Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

Directory of Open Access Journals (Sweden)

Per Erixon

Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

Directory of Open Access Journals (Sweden)

Daniel J Kliebenstein

Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

Science.gov (United States)

Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

2017-08-01

Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Baumgarten Andrew

2004-06-01

Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.

Science.gov (United States)

Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David

2012-07-01

Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

Phylogenetic signal from rearrangements in 18 Anopheles species by joint scaffolding extant and ancestral genomes.

Science.gov (United States)

Anselmetti, Yoann; Duchemin, Wandrille; Tannier, Eric; Chauve, Cedric; Bérard, Sèverine

2018-05-09

Genomes rearrangements carry valuable information for phylogenetic inference or the elucidation of molecular mechanisms of adaptation. However, the detection of genome rearrangements is often hampered by current deficiencies in data and methods: Genomes obtained from short sequence reads have generally very fragmented assemblies, and comparing multiple gene orders generally leads to computationally intractable algorithmic questions. We present a computational method, ADSEQ, which, by combining ancestral gene order reconstruction, comparative scaffolding and de novo scaffolding methods, overcomes these two caveats. ADSEQ provides simultaneously improved assemblies and ancestral genomes, with statistical supports on all local features. Compared to previous comparative methods, it runs in polynomial time, it samples solutions in a probabilistic space, and it can handle a significantly larger gene complement from the considered extant genomes, with complex histories including gene duplications and losses. We use ADSEQ to provide improved assemblies and a genome history made of duplications, losses, gene translocations, rearrangements, of 18 complete Anopheles genomes, including several important malaria vectors. We also provide additional support for a differentiated mode of evolution of the sex chromosome and of the autosomes in these mosquito genomes. We demonstrate the method's ability to improve extant assemblies accurately through a procedure simulating realistic assembly fragmentation. We study a debated issue regarding the phylogeny of the Gambiae complex group of Anopheles genomes in the light of the evolution of chromosomal rearrangements, suggesting that the phylogenetic signal they carry can differ from the phylogenetic signal carried by gene sequences, more prone to introgression.

Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

Science.gov (United States)

Gout, Jean-Francois; Lynch, Michael

2015-08-01

Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

Science.gov (United States)

Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

2016-09-01

Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

Exon duplications in the ATP7A gene

DEFF Research Database (Denmark)

Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

2011-01-01

the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

Molecular mechanisms of extensive mitochondrial gene rearrangementin plethodontid salamanders

Energy Technology Data Exchange (ETDEWEB)

Mueller, Rachel Lockridge; Boore, Jeffrey L.

2005-06-01

Extensive gene rearrangement is reported in the mitochondrial genomes of lungless salamanders (Plethodontidae). In each genome with a novel gene order, there is evidence that the rearrangement was mediated by duplication of part of the mitochondrial genome, including the presence of both pseudogenes and additional, presumably functional, copies of duplicated genes. All rearrangement-mediating duplications include either the origin of light strand replication and the nearby tRNA genes or the regions flanking the origin of heavy strand replication. The latter regions comprise nad6, trnE, cob, trnT, an intergenic spacer between trnT and trnP and, in some genomes, trnP, the control region, trnF, rrnS, trnV, rrnL, trnL1, and nad1. In some cases, two copies of duplicated genes, presumptive regulatory regions, and/or sequences with no assignable function have been retained in the genome following the initial duplication; in other genomes, only one of the duplicated copies has been retained. Both tandem and non-tandem duplications are present in these genomes, suggesting different duplication mechanisms. In some of these mtDNAs, up to 25 percent of the total length is composed of tandem duplications of non-coding sequence that includes putative regulatory regions and/or pseudogenes of tRNAs and protein-coding genes along with otherwise unassignable sequences. These data indicate that imprecise initiation and termination of replication, slipped-strand mispairing, and intra-molecular recombination may all have played a role in generating repeats during the evolutionary history of plethodontid mitochondrial genomes.

Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

Science.gov (United States)

Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

2013-01-01

The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

Directory of Open Access Journals (Sweden)

Capra Valeria

2012-10-01

Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

Science.gov (United States)

Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

2016-10-13

PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

Comparative inference of duplicated genes produced by polyploidization in soybean genome.

Science.gov (United States)

Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

2013-01-01

Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

Recombination facilitates neofunctionalization of duplicate genes via originalization

Directory of Open Access Journals (Sweden)

Huang Ren

2010-06-01

Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

Divergence of gene body DNA methylation and evolution of plant duplicate genes.

Directory of Open Access Journals (Sweden)

Jun Wang

Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Mara Sangiovanni

2013-12-01

Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

Directory of Open Access Journals (Sweden)

Xi-Yin Wang

2011-01-01

Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

Directory of Open Access Journals (Sweden)

Khlestkina E.

2012-08-01

Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

International Nuclear Information System (INIS)

Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

1987-01-01

The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

Decoding Synteny Blocks and Large-Scale Duplications in Mammalian and Plant Genomes

Science.gov (United States)

Peng, Qian; Alekseyev, Max A.; Tesler, Glenn; Pevzner, Pavel A.

The existing synteny block reconstruction algorithms use anchors (e.g., orthologous genes) shared over all genomes to construct the synteny blocks for multiple genomes. This approach, while efficient for a few genomes, cannot be scaled to address the need to construct synteny blocks in many mammalian genomes that are currently being sequenced. The problem is that the number of anchors shared among all genomes quickly decreases with the increase in the number of genomes. Another problem is that many genomes (plant genomes in particular) had extensive duplications, which makes decoding of genomic architecture and rearrangement analysis in plants difficult. The existing synteny block generation algorithms in plants do not address the issue of generating non-overlapping synteny blocks suitable for analyzing rearrangements and evolution history of duplications. We present a new algorithm based on the A-Bruijn graph framework that overcomes these difficulties and provides a unified approach to synteny block reconstruction for multiple genomes, and for genomes with large duplications.

A survey of innovation through duplication in the reduced genomes of twelve parasites.

Directory of Open Access Journals (Sweden)

Jeremy D DeBarry

Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

Science.gov (United States)

Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

2016-01-01

Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

Directory of Open Access Journals (Sweden)

Shomron Noam

2007-11-01

Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

"Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes

Directory of Open Access Journals (Sweden)

Zhang Guofan

2009-02-01

Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.

Complete nucleotide sequence and gene rearrangement of the ...

Indian Academy of Sciences (India)

3Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People's Republic of China ... of these rearrangements involve tRNA genes, ND5 gene and ... ncbi.nlm.nih.gov/projects/Sequin/download/seq_win_download.

Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

Science.gov (United States)

Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

2011-01-01

vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

Science.gov (United States)

Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

2017-05-01

Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

Science.gov (United States)

Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

2010-02-01

The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

Science.gov (United States)

Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

2016-11-04

Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

Science.gov (United States)

Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

2015-12-01

Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

Science.gov (United States)

Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

2017-11-01

The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Transformation of follicular lymphoma to plasmablastic lymphoma with c-myc gene rearrangement.

Science.gov (United States)

Ouansafi, Ihsane; He, Bing; Fraser, Cory; Nie, Kui; Mathew, Susan; Bhanji, Rumina; Hoda, Rana; Arabadjief, Melissa; Knowles, Daniel; Cerutti, Andrea; Orazi, Attilio; Tam, Wayne

2010-12-01

Follicular lymphoma (FL) is an indolent lymphoma that transforms to high-grade lymphoma, mostly diffuse large B-cell lymphoma, in about a third of patients. We present the first report of a case of FL that transformed to plasmablastic lymphoma (PBL). Clonal transformation of the FL to PBL was evidenced by identical IGH/BCL2 gene rearrangements and VDJ gene usage in rearranged IGH genes. IGH/ BCL2 translocation was retained in the PBL, which also acquired c-myc gene rearrangement. Genealogic analysis based on somatic hypermutation of the rearranged IGH genes of both FL and PBL suggests that transformation of the FL to PBL occurred most likely by divergent evolution from a common progenitor cell rather than direct evolution from the FL clone. Our study of this unusual case expands the histologic spectrum of FL transformation and increases our understanding of the pathogenetic mechanisms of transformation of indolent lymphomas to aggressive lymphomas.

Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

DEFF Research Database (Denmark)

Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang

2008-01-01

Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

OpenAIRE

Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

2010-01-01

Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

Directory of Open Access Journals (Sweden)

Matthew A Carrigan

Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

Sorting cancer karyotypes using double-cut-and-joins, duplications and deletions.

Science.gov (United States)

Zeira, Ron; Shamir, Ron

2018-05-03

Problems of genome rearrangement are central in both evolution and cancer research. Most genome rearrangement models assume that the genome contains a single copy of each gene and the only changes in the genome are structural, i.e., reordering of segments. In contrast, tumor genomes also undergo numerical changes such as deletions and duplications, and thus the number of copies of genes varies. Dealing with unequal gene content is a very challenging task, addressed by few algorithms to date. More realistic models are needed to help trace genome evolution during tumorigenesis. Here we present a model for the evolution of genomes with multiple gene copies using the operation types double-cut-and-joins, duplications and deletions. The events supported by the model are reversals, translocations, tandem duplications, segmental deletions, and chromosomal amplifications and deletions, covering most types of structural and numerical changes observed in tumor samples. Our goal is to find a series of operations of minimum length that transform one karyotype into the other. We show that the problem is NP-hard and give an integer linear programming formulation that solves the problem exactly under some mild assumptions. We test our method on simulated genomes and on ovarian cancer genomes. Our study advances the state of the art in two ways: It allows a broader set of operations than extant models, thus being more realistic, and it is the first study attempting to reconstruct the full sequence of structural and numerical events during cancer evolution. Code and data are available in https://github.com/Shamir-Lab/Sorting-Cancer-Karyotypes. ronzeira@post.tau.ac.il, rshamir@tau.ac.il. Supplementary data are available at Bioinformatics online.

Intragenic rearrangements in X-linked intellectual deficiency: results of a-CGH in a series of 54 patients and identification of TRPC5 and KLHL15 as potential XLID genes.

Science.gov (United States)

Mignon-Ravix, Cécile; Cacciagli, Pierre; Choucair, Nancy; Popovici, Cornel; Missirian, Chantal; Milh, Mathieu; Mégarbané, André; Busa, Tiffany; Julia, Sophie; Girard, Nadine; Badens, Catherine; Sigaudy, Sabine; Philip, Nicole; Villard, Laurent

2014-08-01

High-resolution array comparative genomic hybridization (a-CGH) enables the detection of intragenic rearrangements, such as single exon deletion or duplication. This approach can lead to the identification of new disease genes. We report on the analysis of 54 male patients presenting with intellectual deficiency (ID) and a family history suggesting X-linked (XL) inheritance or maternal skewed X-chromosome inactivation (XCI), using a home-made X-chromosome-specific microarray covering the whole human X-chromosome at high resolution. The majority of patients had whole genome array-CGH prior to the selection and we did not include large rearrangements such as MECP2 and FMR1 duplications. We identified four rearrangements considered as causative or potentially pathogenic, corresponding to a detection rate of 8%. Two CNVs affected known XLID genes and were therefore considered as causative (IL1RAPL1 and OPHN1 intragenic deletions). Two new CNVs were considered as potentially pathogenic as they affected interesting candidates for ID. The first CNV is a deletion of the first exon of the TRPC5 gene, encoding a cation channel implicated in dendrite growth and patterning, in a child presenting with ID and an autism spectrum disorder (ASD). The second CNV is a partial deletion of KLHL15, in a patient with severe ID, epilepsy, and anomalies of cortical development. In both cases, in spite of strong arguments for clinical relevance, we were not able at this stage to confirm pathogenicity of the mutations, and the causality of the variants identified in XLID remains to be confirmed. © 2014 Wiley Periodicals, Inc.

Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

Science.gov (United States)

Kursel, Lisa E; Malik, Harmit S

2017-06-01

Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

A case with concurrent duplication, triplication, and uniparental isodisomy at 1q42.12-qter supporting microhomology-mediated break-induced replication model for replicative rearrangements.

Science.gov (United States)

Kohmoto, Tomohiro; Okamoto, Nana; Naruto, Takuya; Murata, Chie; Ouchi, Yuya; Fujita, Naoko; Inagaki, Hidehito; Satomura, Shigeko; Okamoto, Nobuhiko; Saito, Masako; Masuda, Kiyoshi; Kurahashi, Hiroki; Imoto, Issei

2017-01-01

Complex genomic rearrangements (CGRs) consisting of interstitial triplications in conjunction with uniparental isodisomy (isoUPD) have rarely been reported in patients with multiple congenital anomalies (MCA)/intellectual disability (ID). One-ended DNA break repair coupled with microhomology-mediated break-induced replication (MMBIR) has been recently proposed as a possible mechanism giving rise to interstitial copy number gains and distal isoUPD, although only a few cases providing supportive evidence in human congenital diseases with MCA have been documented. Here, we report on the chromosomal microarray (CMA)-based identification of the first known case with concurrent interstitial duplication at 1q42.12-q42.2 and triplication at 1q42.2-q43 followed by isoUPD for the remainder of chromosome 1q (at 1q43-qter). In distal 1q duplication/triplication overlapping with 1q42.12-q43, variable clinical features have been reported, and our 25-year-old patient with MCA/ID presented with some of these frequently described features. Further analyses including the precise mapping of breakpoint junctions within the CGR in a sequence level suggested that the CGR found in association with isoUPD in our case is a triplication with flanking duplications, characterized as a triplication with a particularly long duplication-inverted triplication-duplication (DUP-TRP/INV-DUP) structure. Because microhomology was observed in both junctions between the triplicated region and the flanking duplicated regions, our case provides supportive evidence for recently proposed replication-based mechanisms, such as MMBIR, underlying the formation of CGRs + isoUPD implicated in chromosomal disorders. To the best of our knowledge, this is the first case of CGRs + isoUPD observed in 1q and having DUP-TRP/INV-DUP structure with a long proximal duplication, which supports MMBIR-based model for genomic rearrangements. Molecular cytogenetic analyses using CMA containing single

Differential transcriptional modulation of duplicated fatty acid-binding protein genes by dietary fatty acids in zebrafish (Danio rerio: evidence for subfunctionalization or neofunctionalization of duplicated genes

Directory of Open Access Journals (Sweden)

Denovan-Wright Eileen M

2009-09-01

Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at zfin.org and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases

A de novo 11p12-p15.4 duplication in a patient with pharmacoresistant epilepsy, mental retardation, and dysmorphisms.

Science.gov (United States)

Coppola, Antonietta; Striano, Pasquale; Gimelli, Stefania; Ciampa, Clotilde; Santulli, Lia; Caranci, Ferdinando; Zuffardi, Orsetta; Gimelli, Giorgio; Striano, Salvatore; Zara, Federico

2010-03-01

We report a 22-year-old male patient with pharmacoresistant epilepsy, mental retardation and dysmorphisms. Standard cytogenetic analysis revealed a de novo interstitial duplication of the short arm of chromosome 11 (11p). High density array-CGH analysis showed that the rearrangement spans about 35Mb on chromosome 11p12-p15.4. Duplications of 11p are rare and usually involve the distal part of the chromosome arm (11p15), being not associated with epilepsy, whereas our patient showed a unique epileptic phenotype associated with mental retardation and dysmorphic features. The role of some rearranged genes in epilepsy pathogenesis in this patient is also discussed.

Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

International Nuclear Information System (INIS)

Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

2000-01-01

A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

Energy Technology Data Exchange (ETDEWEB)

Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

2000-09-18

A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

Contribution of Large Genomic Rearrangements in Italian Lynch Syndrome Patients: Characterization of a Novel Alu-Mediated Deletion

Directory of Open Access Journals (Sweden)

Francesca Duraturo

2013-01-01

Full Text Available Lynch syndrome is associated with germ-line mutations in the DNA mismatch repair (MMR genes, mainly MLH1 and MSH2. Most of the mutations reported in these genes to date are point mutations, small deletions, and insertions. Large genomic rearrangements in the MMR genes predisposing to Lynch syndrome also occur, but the frequency varies depending on the population studied on average from 5 to 20%. The aim of this study was to examine the contribution of large rearrangements in the MLH1 and MSH2 genes in a well-characterised series of 63 unrelated Southern Italian Lynch syndrome patients who were negative for pathogenic point mutations in the MLH1, MSH2, and MSH6 genes. We identified a large novel deletion in the MSH2 gene, including exon 6 in one of the patients analysed (1.6% frequency. This deletion was confirmed and localised by long-range PCR. The breakpoints of this rearrangement were characterised by sequencing. Further analysis of the breakpoints revealed that this rearrangement was a product of Alu-mediated recombination. Our findings identified a novel Alu-mediated rearrangement within MSH2 gene and showed that large deletions or duplications in MLH1 and MSH2 genes are low-frequency mutational events in Southern Italian patients with an inherited predisposition to colon cancer.

Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

Science.gov (United States)

Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

2011-12-20

The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

Meiotic UV-sensitive mutant that causes deletion of duplications in neurospora

International Nuclear Information System (INIS)

Newmeyer, D.; Galeazzi, D.R.

1978-01-01

The meiotic-3 (mei-3) mutant of Neurospora crassa has several effects: (1) when homozygous, it almost completely blocks meiosis and ascospore formation, (2) it is sensitive to uv, (3) its growth is inhibited by histidine, and (4) it increases the instability of nontandem duplications. This was shown for duplications produced by five different rearrangements and was demonstrated by two different criteria. The effects on meiosis and duplication instability are expressed strongly at 25 0 ; the effects on sensitivity to uv and to histidine are expressed strongly at 38.5 0 but only slightly at 25 0 . Nevertheless, all four effects were shown to be due to a single gene. Mei-3 is not allelic with previously reported uv-sensitive mutants. Two other results were obtained that are not necessarily due to mei-3: (1) a cross involving mei-3 produced a new unlinked meiotic mutant, mei-4, which is not sensitive to uv or histidine, and (2) a burst of several new mutants occurred in a different mei-3 stock, including a partial revertant to mei-3. Mei-3 has previously been shown to cause frequent complete loss of a terminal duplicate segment, beginning exactly at the original rearrangement breakpoint. Possible mechanisms are discussed by which a uv-sensitive mutant could cause such precise deletions

Evolution dynamics of a model for gene duplication under adaptive conflict

Science.gov (United States)

Ancliff, Mark; Park, Jeong-Man

2014-06-01

We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.

Relationship between mitochondrial gene rearrangements and stability of the origin of light strand replication

Directory of Open Access Journals (Sweden)

Miguel M. Fonseca

2008-01-01

Full Text Available Mitochondrial gene rearrangements are much more frequent in vertebrates than initially thought. It has been suggested that the origin of light strand replication could have an important role in the process of gene rearrangements, but this hypothesis has never been tested before. We used amphibians to test the correlation between light-strand replication origin thermodynamic stability and the occurrence of gene rearrangements. The two variables were correlated in a non-phylogenetic approach, but when tested in a phylogenetically based comparative method the correlation was not significant, although species with unstable light-strand replication origins were much more likely to have undergone gene rearrangements. This indicates that within amphibians there are stable and unstable phylogenetic groups regarding mitochondrial gene order. The species analyzed showed variability in the thermodynamic stability of the secondary structure, in the length of its stem and loop, and several species did not present the 5’-GCCGG-3’ motif reported to be necessary for efficient mitochondrial DNA replication. Future studies should focus on the role of the light-strand replication origin in mitochondrial DNA replication and gene rearrangements mechanisms.

Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

Directory of Open Access Journals (Sweden)

Huang Yong

2009-11-01

Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

Directory of Open Access Journals (Sweden)

Bowerman Bruce

2009-08-01

Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

Immunoglobulin gene expression and regulation of rearrangement in kappa transgenic mice

International Nuclear Information System (INIS)

Ritchie, K.A.

1986-01-01

Transgenic mice were produced by microinjection of the functionally rearranged immunoglobulin kappa gene from the myeloma MOPC-21 into the male pronucleus of fertilized mouse eggs, and implantation of the microinjected embryos into foster mothers. Mice that integrated the injected gene were detected by hybridizing tail DNA dots with radioactively labelled pBR322 plasmid DNA, which detects pBR322 sequences left as a tag on the microinjected DNA. Mice that integrated the injected gene (six males) were mated and the DNA, RNA and serum kappa chains of their offspring were analyzed. A rabbit anti-mouse kappa chain antiserum was also produced for use in detection of mouse kappa chains on protein blots. Hybridomas were produced from the spleen cells of these kappa transgenic mice to immortalize representative B cells and to investigate expression of the transgenic kappa gene, its effect on allelic exclusion, and its effect on the control of light chain gene rearrangement and expression. The results show that the microinjected DNA is integrated as concatamers in unique single or, rarely, two separate sites in the genome. The concatamers are composed of several copies (16 to 64) of injected DNA arranged in a head to tail fashion. The transgene is expressed into protein normally and in a tissue specific fashion. For the first time in these transgenic mice, all tissues contain a functionally rearranged and potentially expressible immunoglobulin gene. The transgene is expressed only in B cells and not in hepatocytes, for example. This indicates that rearrangement of immunoglobulin genes is necessary but not sufficient for the tissue specific expression of these genes by B cells

Combined mutation and rearrangement screening by quantitative PCR high-resolution melting: is it relevant for hereditary recurrent Fever genes?

Directory of Open Access Journals (Sweden)

Nathalie Pallares-Ruiz

2010-11-01

Full Text Available The recent identification of genes implicated in hereditary recurrent fevers has allowed their specific diagnosis. So far however, only punctual mutations have been identified and a significant number of patients remain with no genetic confirmation of their disease after routine molecular approaches such as sequencing. The possible involvement of sequence rearrangements in these patients has only been examined in familial Mediterranean fever and was found to be unlikely. To assess the existence of larger genetic alterations in 3 other concerned genes, MVK (Mevalonate kinase, NLRP3 (Nod like receptor family, pyrin domain containing 3 and TNFRSF1A (TNF receptor superfamily 1A, we adapted the qPCR-HRM method to study possible intragenic deletions and duplications. This single-tube approach, combining both qualitative (mutations and quantitative (rearrangement screening, has proven effective in Lynch syndrome diagnosis. Using this approach, we studied 113 unselected (prospective group and 88 selected (retrospective group patients and identified no intragenic rearrangements in the 3 genes. Only qualitative alterations were found with a sensitivity similar to that obtained using classical molecular techniques for screening punctual mutations. Our results support that deleterious copy number alterations in MVK, NLRP3 and TNFRSF1A are rare or absent from the mutational spectrum of hereditary recurrent fevers, and demonstrate that a routine combined method such as qPCR-HRM provides no further help in genetic diagnosis. However, quantitative approaches such as qPCR or SQF-PCR did prove to be quick and effective and could still be useful after non contributory punctual mutation screening in the presence of clinically evocative signs.

Duplication of 20p12.3 associated with familial Wolff-Parkinson-White syndrome.

Science.gov (United States)

Mills, Kimberly I; Anderson, Jacqueline; Levy, Philip T; Cole, F Sessions; Silva, Jennifer N A; Kulkarni, Shashikant; Shinawi, Marwan

2013-01-01

Wolff-Parkinson-White (WPW) syndrome is caused by preexcitation of the ventricular myocardium via an accessory pathway which increases the risk for paroxysmal supraventricular tachycardia. The condition is often sporadic and of unknown etiology in the majority of cases. Autosomal dominant inheritance and association with congenital heart defects or ventricular hypertrophy were described. Microdeletions of 20p12.3 have been associated with WPW syndrome with either cognitive dysfunction or Alagille syndrome. Here, we describe the association of 20p12.3 duplication with WPW syndrome in a patient who presented with non-immune hydrops. Her paternal uncle carries the duplication and has attention-deficit hyperactivity disorder and electrocardiographic findings consistent with WPW. The 769 kb duplication was detected by the Affymetrix Whole Genome-Human SNP Array 6.0 and encompasses two genes and the first two exons of a third gene. We discuss the potential role of the genes in the duplicated region in the pathogenesis of WPW and possible neurobehavioral abnormalities. Our data provide additional support for a significant role of 20p12.3 chromosomal rearrangements in the etiology of WPW syndrome. Copyright © 2012 Wiley Periodicals, Inc.

Multiple independent origins of mitochondrial control region duplications in the order Psittaciformes

Science.gov (United States)

Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.

2012-01-01

Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055

Polytomy refinement for the correction of dubious duplications in gene trees.

Science.gov (United States)

Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia

2014-09-01

Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at http://www-ens.iro.umontreal.ca/~lafonman/software.php. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

Directory of Open Access Journals (Sweden)

Michael H. Kohn

2008-01-01

Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

Evolutionary diversification of plant shikimate kinase gene duplicates.

Directory of Open Access Journals (Sweden)

Geoffrey Fucile

2008-12-01

Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

Mutations and Rearrangements in the Genome of Sulfolobus solfataricus P2

DEFF Research Database (Denmark)

Redder, P.; Garrett, R. A.

2006-01-01

The genome of Sulfolobus solfataricus P2 carries a larger number of transposable elements than any other sequenced genome from an archaeon or bacterium and, as a consequence, may be particularly susceptible to rearrangement and change. In order to gain more insight into the natures and frequencies...... of different types of mutation and possible rearrangements that can occur in the genome, the pyrEF locus was examined for mutations that were isolated after selection with 5-fluoroorotic acid. About two-thirds of the 130 mutations resulted from insertions of mobile elements, including insertion sequence (IS...... deletions, insertions, and a duplication, were observed, and about one-fifth of the mutations occurred elsewhere in the genome, possibly in an orotate transporter gene. One mutant exhibited a 5-kb genomic rearrangement at the pyrEF locus involving a two-step IS element-dependent reaction, and its boundaries...

Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.

Directory of Open Access Journals (Sweden)

Hiroyasu Kamei

2008-08-01

Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.

Clinical spectrum associated with recurrent genomic rearrangements in chromosome 17q12.

Science.gov (United States)

Nagamani, Sandesh Chakravarthy Sreenath; Erez, Ayelet; Shen, Joseph; Li, Chumei; Roeder, Elizabeth; Cox, Sarah; Karaviti, Lefkothea; Pearson, Margret; Kang, Sung-Hae L; Sahoo, Trilochan; Lalani, Seema R; Stankiewicz, Pawel; Sutton, V Reid; Cheung, Sau Wai

2010-03-01

Deletions in chromosome 17q12 encompassing the HNF1 beta gene cause cystic renal disease and maturity onset diabetes of the young, and have been recently described as the first recurrent genomic deletion leading to diabetes. Earlier reports of patients with this microdeletion syndrome have suggested an absence of cognitive impairment, differentiating it from most other contiguous gene deletion syndromes. The reciprocal duplication of 17q12 is rare and has been hypothesized to be associated with an increased risk of epilepsy and mental retardation. We conducted a detailed clinical and molecular characterization of four patients with a deletion and five patients with a reciprocal duplication of this region. Our patients with deletion of 17q12 presented with cognitive impairment, cystic renal disease, seizures, and structural abnormalities of the brain. Patients with reciprocal duplications manifest with cognitive impairment and behavioral abnormalities, but not with seizures. Our findings expand the phenotypic spectrum associated with rearrangements of 17q12 and show that cognitive impairment is a part of the phenotype of individuals with deletions of 17q12.

Analysis Of Segmental Duplications In The Pig Genome Based On Next-Generation Sequencing

DEFF Research Database (Denmark)

Fadista, João; Bendixen, Christian

Segmental duplications are >1kb segments of duplicated DNA present in a genome with high sequence identity (>90%). They are associated with genomic rearrangements and provide a significant source of gene and genome evolution within mammalian genomes. Although segmental duplications have been...... extensively studied in other organisms, its analysis in pig has been hampered by the lack of a complete pig genome assembly. By measuring the depth of coverage of Illumina whole-genome shotgun sequencing reads of the Tabasco animal aligned to the latest pig genome assembly (Sus scrofa 10 – based also...... and their associated copy number alterations, focusing on the global organization of these segments and their possible functional significance in porcine phenotypes. This work provides insights into mammalian genome evolution and generates a valuable resource for porcine genomics research...

The vertebrate ancestral repertoire of visual opsins, transducin alpha subunits and oxytocin/vasopressin receptors was established by duplication of their shared genomic region in the two rounds of early vertebrate genome duplications.

Science.gov (United States)

Lagman, David; Ocampo Daza, Daniel; Widmark, Jenny; Abalo, Xesús M; Sundström, Görel; Larhammar, Dan

2013-11-02

Vertebrate color vision is dependent on four major color opsin subtypes: RH2 (green opsin), SWS1 (ultraviolet opsin), SWS2 (blue opsin), and LWS (red opsin). Together with the dim-light receptor rhodopsin (RH1), these form the family of vertebrate visual opsins. Vertebrate genomes contain many multi-membered gene families that can largely be explained by the two rounds of whole genome duplication (WGD) in the vertebrate ancestor (2R) followed by a third round in the teleost ancestor (3R). Related chromosome regions resulting from WGD or block duplications are said to form a paralogon. We describe here a paralogon containing the genes for visual opsins, the G-protein alpha subunit families for transducin (GNAT) and adenylyl cyclase inhibition (GNAI), the oxytocin and vasopressin receptors (OT/VP-R), and the L-type voltage-gated calcium channels (CACNA1-L). Sequence-based phylogenies and analyses of conserved synteny show that the above-mentioned gene families, and many neighboring gene families, expanded in the early vertebrate WGDs. This allows us to deduce the following evolutionary scenario: The vertebrate ancestor had a chromosome containing the genes for two visual opsins, one GNAT, one GNAI, two OT/VP-Rs and one CACNA1-L gene. This chromosome was quadrupled in 2R. Subsequent gene losses resulted in a set of five visual opsin genes, three GNAT and GNAI genes, six OT/VP-R genes and four CACNA1-L genes. These regions were duplicated again in 3R resulting in additional teleost genes for some of the families. Major chromosomal rearrangements have taken place in the teleost genomes. By comparison with the corresponding chromosomal regions in the spotted gar, which diverged prior to 3R, we could time these rearrangements to post-3R. We present an extensive analysis of the paralogon housing the visual opsin, GNAT and GNAI, OT/VP-R, and CACNA1-L gene families. The combined data imply that the early vertebrate WGD events contributed to the evolution of vision and the

A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

Directory of Open Access Journals (Sweden)

Brahmbhatt Sonal

2008-11-01

Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

Aberrant immunoglobulin and c-myc gene rearrangements in patients with nonmalignant monoclonal cryoglobulinemia

International Nuclear Information System (INIS)

Perl, A.; Wang, N.; Williams, J.M.; Hunt, M.J.; Rosenfeld, S.I.; Condemi, J.J.; Packman, C.H.; Abraham, G.N.

1987-01-01

The status of the immunoglobulin (Ig) genes was investigated in patients with idiopathic nonmalignant monoclonal IgG cryoglobulinemia (NCG). In NCG, monoclonal antibodies are synthesized at an accelerated rate by nonmalignant B lymphocytes. In order to determine whether this high production rate is related to a clonal B cell expansion, the rearrangement of the Ig genes was investigated by Southern blot analysis of genomic, 32 P-labelled, DNA extracted from the peripheral blood lymphocytes of four NCG patients. In three of four (VI, BR, and CH) clonal expansion of B cells was detected using probes specific for the genes. BamHI digestion of DNA from VI and BR produced three rearranged fragments which cohybridized with two of the probes. This finding suggested the presence of additional nonsecretory B cell clones and/or disruption of the gene segments spanned by and detected with the probes. In addition, the possibility of aberrant gene rearrangements was supported by noting the alteration of the c-myc gene locus in genomic DNA from peripheral blood leukocytes of VI and CH. Northern blot analysis of RNA isolated from peripheral blood B cells of VI and CH demonstrated aberrant transcripts of the c-myc gene, showing an active role of the altered c-myc locus. Detection of c-myc rearrangement in NCG patients clearly shows that this event may not be a final step in malignant B cell transformation

Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

Directory of Open Access Journals (Sweden)

Bergthorsson Ulfar

2011-09-01

Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

Directory of Open Access Journals (Sweden)

Brenner Sydney

2008-06-01

Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

Energy Technology Data Exchange (ETDEWEB)

Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

1996-07-01

Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

Submicroscopic duplication of the Wolf-Hirschhorn critical region with a 4p terminal deletion.

Science.gov (United States)

Roselló, M; Monfort, S; Orellana, C; Ferrer-Bolufer, I; Quiroga, R; Oltra, S; Martínez, F

2009-01-01

Chromosomal rearrangements in the short arm of chromosome 4 can result in 2 different clinical entities: Wolf-Hirschhorn syndrome (WHS), characterized by severe growth delay, mental retardation, microcephaly, 'Greek helmet' facies, and closure defects, or partial 4p trisomy, associated with multiple congenital anomalies, mental retardation, and facial dysmorphisms. We present clinical and laboratory findings in a patient who showed a small duplication in 4p16.3 associated with a subtle terminal deletion in the same chromosomal region. GTG-banding analyses, multiplex ligation-dependent probe amplification analyses, and studies by array-based comparative genomic hybridization were performed. The results of the analyses revealed a de novo 1.3 Mb deletion of the terminal 4p and a 1.1 Mb duplication in our patient, encompassing the WHS critical region. Interestingly, this unusual duplication/deletion rearrangement results in an intermediate phenotype that shares characteristics of the WHS and the 4p trisomy syndrome. The use of novel technologies in the genetic diagnosis leads to the description of new clinical syndromes; there is a growing list of microduplication syndromes. Therefore, we propose that overexpression of candidate genes in WHS (WHSC1, WHSC2 and LETM1) due to a duplication causes a clinical entity different to both the WHS and 4p trisomy syndrome. (c) 2009 S. Karger AG, Basel.

The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

Directory of Open Access Journals (Sweden)

Cho Hyuk

2010-12-01

Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

Marfan syndrome with a complex chromosomal rearrangement including deletion of the FBN1 gene

Directory of Open Access Journals (Sweden)

Colovati Mileny ES

2012-01-01

Full Text Available Abstract Background The majority of Marfan syndrome (MFS cases is caused by mutations in the fibrillin-1 gene (FBN1, mapped to chromosome 15q21.1. Only few reports on deletions including the whole FBN1 gene, detected by molecular cytogenetic techniques, were found in literature. Results We report here on a female patient with clinical symptoms of the MFS spectrum plus craniostenosis, hypothyroidism and intellectual deficiency who presents a 1.9 Mb deletion, including the FBN1 gene and a complex rearrangement with eight breakpoints involving chromosomes 6, 12 and 15. Discussion This is the first report of MFS with a complex chromosome rearrangement involving a deletion of FBN1 and contiguous genes. In addition to the typical clinical findings of the Marfan syndrome due to FBN1 gene haploinsufficiency, the patient presents features which may be due to the other gene deletions and possibly to the complex chromosome rearrangement.

Extensive gene rearrangements in the mitochondrial genomes of two egg parasitoids, Trichogramma japonicum and Trichogramma ostriniae (Hymenoptera: Chalcidoidea: Trichogrammatidae).

Science.gov (United States)

Chen, Long; Chen, Peng-Yan; Xue, Xiao-Feng; Hua, Hai-Qing; Li, Yuan-Xi; Zhang, Fan; Wei, Shu-Jun

2018-05-04

Animal mitochondrial genomes usually exhibit conserved gene arrangement across major lineages, while those in the Hymenoptera are known to possess frequent rearrangements, as are those of several other orders of insects. Here, we sequenced two complete mitochondrial genomes of Trichogramma japonicum and Trichogramma ostriniae (Hymenoptera: Chalcidoidea: Trichogrammatidae). In total, 37 mitochondrial genes were identified in both species. The same gene arrangement pattern was found in the two species, with extensive gene rearrangement compared with the ancestral insect mitochondrial genome. Most tRNA genes and all protein-coding genes were encoded on the minority strand. In total, 15 tRNA genes and seven protein-coding genes were rearranged. The rearrangements of cox1 and nad2 as well as most tRNA genes were novel. Phylogenetic analysis based on nucleotide sequences of protein-coding genes and on gene arrangement patterns produced identical topologies that support the relationship of (Agaonidae + Pteromalidae) + Trichogrammatidae in Chalcidoidea. CREx analysis revealed eight rearrangement operations occurred from presumed ancestral gene order of Chalcidoidea to form the derived gene order of Trichogramma. Our study shows that gene rearrangement information in Chalcidoidea can potentially contribute to the phylogeny of Chalcidoidea when more mitochondrial genome sequences are available.

The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

Science.gov (United States)

Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

2010-01-01

Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

Signals of historical interlocus gene conversion in human segmental duplications.

Directory of Open Access Journals (Sweden)

Beth L Dumont

Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

Directory of Open Access Journals (Sweden)

Nayereh Nouri

2014-01-01

Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

Molecular screening of pituitary adenomas for gene mutations and rearrangements

Energy Technology Data Exchange (ETDEWEB)

Herman, V.; Drazin, N.Z.; Gonskey, R.; Melmed, S. (Cedars-Sinai Medical Center, Los Angeles, CA (United States))

1993-07-01

Although pituitary tumors arise as benign monoclonal neoplasms, genetic alterations have not readily been identified in these adenomas. The authors studied restriction fragment abnormalities involving the GH gene locus, and mutations in the p53 and H-, K-, and N-ras genes in 22 human GH cell adenomas. Twenty two nonsecretory adenomas were also examined for p53 and ras gene mutations. Seven prolactinoma DNA samples were tested for deletions in the multiple endocrine neoplasia-1 (MEN-1) locus, as well as for rearrangements in the hst gene, a member of the fibroblast growth factor family. In DNA from GH-cell adenomas, identical GH restriction patterns were detected in both pituitary and lymphocyte DNA in all patients and in one patient with a mixed GH-TSH cell adenoma. Using polymerase chain reaction (PCR)-single stranded conformation polymorphism analysis, no mutations were detected in exons 5, 6, 7 and 8 of the p53 gene in GH cell adenomas nor in 22 nonsecretory adenomas. Codons 12/13 and 61 of H-ras, K-ras, and N-ras genes were also intact on GH cell adenomas and in nonsecretory adenomas. Site-specific probes for chromosome 11q13 including, PYGM, D11S146, and INT2 were used in 7 sporadic PRL-secreting adenomas to detect deletions of the MEN-1 locus on chromosome 11. One patient was identified with a loss of 11p, and the remaining 6 patients did not demonstrate loss of heterozygosity in the pituitary 11q13 locus, compared to lymphocyte DNA. None of these patients demonstrated hst gene rearrangements which also maps to this locus. These results show that p53 and ras gene mutations are not common events in the pathogenesis of acromegaly and nonsecretory tumors. Although hst gene rearrangements and deletions of 11q13 are not associated with sporadic PRl-cell adenoma formation, a single patient was detected with a partial loss of chromosome 11, including the putative MEN-1 site. 31 refs., 5 figs., 2 tabs.

Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

Science.gov (United States)

Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

2014-01-01

Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

DGGE based whole-gene mutation scanning of the dystrophlin gene in Duchenne and Becker muscular dystrophy patients

NARCIS (Netherlands)

Hofstra, RMW; Mulder, IM; Vossen, R; de Koning-Gans, PAM; Kraak, M; Ginjaar, IB; van der Hout, AH; Bakker, E; Buys, CHCM; van Essen, AJ; den Dunnen, JT

2004-01-01

Duchenne and Becker muscular dystrophy (DMD and BMD) are caused by mutations in the dystrophin gene. Large rearrangements in the gene are found in about two,thirds of DMD patients, with similar to60% carrying deletions and 5-10% carrying duplications. Most of the remaining 30-35% of patients are

Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

Science.gov (United States)

Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

2011-12-01

Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

Gene duplication as a major force in evolution

Indian Academy of Sciences (India)

Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

Science.gov (United States)

Gu, Xun; Wang, Yufeng; Gu, Jianying

2002-06-01

The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

Detection and precise mapping of germline rearrangements in BRCA1, BRCA2, MSH2, and MLH1 using zoom-in array comparative genomic hybridization (aCGH)

DEFF Research Database (Denmark)

Staaf, Johan; Törngren, Therese; Rambech, Eva

2008-01-01

Disease-predisposing germline mutations in cancer susceptibility genes may consist of large genomic rearrangements that are challenging to detect and characterize using standard PCR-based mutation screening methods. Here, we describe a custom-made zoom-in microarray comparative genomic hybridizat......Disease-predisposing germline mutations in cancer susceptibility genes may consist of large genomic rearrangements that are challenging to detect and characterize using standard PCR-based mutation screening methods. Here, we describe a custom-made zoom-in microarray comparative genomic...... deletions or duplications occurring in BRCA1 (n=11), BRCA2 (n=2), MSH2 (n=7), or MLH1 (n=9). Additionally, we demonstrate its applicability for uncovering complex somatic rearrangements, exemplified by zoom-in analysis of the PTEN and CDKN2A loci in breast cancer cells. The sizes of rearrangements ranged...... from several 100 kb, including large flanking regions, to rearrangements, allowing convenient design...

On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

Science.gov (United States)

Kordi, Misagh; Bansal, Mukul S

2017-01-01

Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.

The effects of chromosome rearrangements on the expression of heterochromatic genes in chromosome 2L of Drosophila melanogaster

International Nuclear Information System (INIS)

Wakimoto, B.T.; Hearn, M.G.

1990-01-01

The light (lt) gene of Drosophila melanogaster is located at the base of the left arm of chromosome 2, within or very near centromeric heterochromatin (2Lh). Chromosome rearrangements that move the lt + gene from its normal proximal position and place the gene in distal euchromatin result in mosaic or variegated expression of the gene. The cytogenetic and genetic properties of 17 lt-variegated rearrangements induced by X radiation are described in this report. The authors show that five of the heterochromatic genes adjacent to lt are subject to inactivation by these rearrangements and that the euchromatic loci in proximal 2L are not detectably affected. The properties of the rearrangements suggest that proximity to heterochromatin is an important regulatory requirement for at least six 2Lh genes. They discuss how the properties of the position effects on heterochromatic genes relate to other proximity-dependent phenomena such as transvection

On Computing Breakpoint Distances for Genomes with Duplicate Genes.

Science.gov (United States)

Shao, Mingfu; Moret, Bernard M E

2017-06-01

A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

Science.gov (United States)

Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

2015-06-08

The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

Science.gov (United States)

Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

2008-02-12

The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

Directory of Open Access Journals (Sweden)

Nemanja Vukašinović

Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

Validation of rearrangement break points identified by paired-end sequencing in natural populations of Drosophila melanogaster.

Science.gov (United States)

Cridland, Julie M; Thornton, Kevin R

2010-01-13

Several recent studies have focused on the evolution of recently duplicated genes in Drosophila. Currently, however, little is known about the evolutionary forces acting upon duplications that are segregating in natural populations. We used a high-throughput, paired-end sequencing platform (Illumina) to identify structural variants in a population sample of African D. melanogaster. Polymerase chain reaction and sequencing confirmation of duplications detected by multiple, independent paired-ends showed that paired-end sequencing reliably uncovered the break points of structural rearrangements and allowed us to identify a number of tandem duplications segregating within a natural population. Our confirmation experiments show that rates of confirmation are very high, even at modest coverage. Our results also compare well with previous studies using microarrays (Emerson J, Cardoso-Moreira M, Borevitz JO, Long M. 2008. Natural selection shapes genome wide patterns of copy-number polymorphism in Drosophila melanogaster. Science. 320:1629-1631. and Dopman EB, Hartl DL. 2007. A portrait of copy-number polymorphism in Drosophila melanogaster. Proc Natl Acad Sci U S A. 104:19920-19925.), which both gives us confidence in the results of this study as well as confirms previous microarray results.We were also able to identify whole-gene duplications, such as a novel duplication of Or22a, an olfactory receptor, and identify copy-number differences in genes previously known to be under positive selection, like Cyp6g1, which confers resistance to dichlorodiphenyltrichloroethane. Several "hot spots" of duplications were detected in this study, which indicate that particular regions of the genome may be more prone to generating duplications. Finally, population frequency analysis of confirmed events also showed an excess of rare variants in our population, which indicates that duplications segregating in the population may be deleterious and ultimately destined to be lost from the

T-cell receptor gene rearrangement in Epstein-Barr virus infectious mononucleosis.

Science.gov (United States)

Marbello, L; Riva, M; Veronese, S; Nosari, A M; Ravano, E; Colosimo, A; Paris, L; Morra, E

2012-09-01

This report describes the case of a previously healthy young man who presented with fever, pharyngitis, cervical lymphadenopathy, lymphocytosis, and severe thrombocytopenia. Serological tests for Epstein-Barr virus were diagnostic of a primary Epstein-Barr virus infectious mononucleosis but severe thrombocytopenia aroused the suspicion of a lymphoproliferative disease. T-cell receptor gene analysis performed on peripheral and bone marrow blood revealed a T-cell receptor γ-chain rearrangement without the evidence of malignancy using standard histologic and immunophenotype studies. Signs and symptoms of the infectious disease, blood count, and T-cell receptor gene rearrangement resolved with observation without the evidence of emergence of a lymphoproliferative disease. In the contest of a suspected lymphoproliferative disease, molecular results should be integrated with all available data for an appropriate diagnosis.

Identification of Ohnolog Genes Originating from Whole Genome Duplication in Early Vertebrates, Based on Synteny Comparison across Multiple Genomes.

Science.gov (United States)

Singh, Param Priya; Arora, Jatin; Isambert, Hervé

2015-07-01

Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.

Three neuropeptide Y receptor genes in the spiny dogfish, Squalus acanthias, support en bloc duplications in early vertebrate evolution.

Science.gov (United States)

Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan

2003-08-01

It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.

STRIDE: Species Tree Root Inference from Gene Duplication Events.

Science.gov (United States)

Emms, David M; Kelly, Steven

2017-12-01

The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Duplication and relocation of the functional DPY19L2 gene within low copy repeats

Directory of Open Access Journals (Sweden)

Cheung Joseph

2006-03-01

Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

Science.gov (United States)

Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

2016-09-02

Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome

NARCIS (Netherlands)

Sharp, Andrew J.; Hansen, Sierra; Selzer, Rebecca R.; Cheng, Ze; Regan, Regina; Hurst, Jane A.; Stewart, Helen; Price, Sue M.; Blair, Edward; Hennekam, Raoul C.; Fitzpatrick, Carrie A.; Segraves, Rick; Richmond, Todd A.; Guiver, Cheryl; Albertson, Donna G.; Pinkel, Daniel; Eis, Peggy S.; Schwartz, Stuart; Knight, Samantha J. L.; Eichler, Evan E.

2006-01-01

Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic

Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

Science.gov (United States)

Kordi, Misagh; Bansal, Mukul S

2017-06-01

Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

Differential contributions to the transcriptome of duplicated genes in response to abiotic stresses in natural and synthetic polyploids.

Science.gov (United States)

Dong, Shaowei; Adams, Keith L

2011-06-01

Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

Chromosome Evolution in the Free-Living Flatworms: First Evidence of Intrachromosomal Rearrangements in Karyotype Evolution of Macrostomum lignano (Platyhelminthes, Macrostomida)

Science.gov (United States)

Zadesenets, Kira S.; Ershov, Nikita I.; Berezikov, Eugene; Rubtsov, Nikolay B.

2017-01-01

The free-living flatworm Macrostomum lignano is a hidden tetraploid. Its genome was formed by a recent whole genome duplication followed by chromosome fusions. Its karyotype (2n = 8) consists of a pair of large chromosomes (MLI1), which contain regions of all other chromosomes, and three pairs of small metacentric chromosomes. Comparison of MLI1 with metacentrics was performed by painting with microdissected DNA probes and fluorescent in situ hybridization of unique DNA fragments. Regions of MLI1 homologous to small metacentrics appeared to be contiguous. Besides the loss of DNA repeat clusters (pericentromeric and telomeric repeats and the 5S rDNA cluster) from MLI1, the difference between small metacentrics MLI2 and MLI4 and regions homologous to them in MLI1 were revealed. Abnormal karyotypes found in the inbred DV1/10 subline were analyzed, and structurally rearranged chromosomes were described with the painting technique, suggesting the mechanism of their origin. The revealed chromosomal rearrangements generate additional diversity, opening the way toward massive loss of duplicated genes from a duplicated genome. Our findings suggest that the karyotype of M. lignano is in the early stage of genome diploidization after whole genome duplication, and further studies on M. lignano and closely related species can address many questions about karyotype evolution in animals. PMID:29084138

Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

Directory of Open Access Journals (Sweden)

Nishida Mutsumi

2007-11-01

Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

Science.gov (United States)

Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

2010-01-01

Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

Divergence of the bZIP Gene Family in Strawberry, Peach, and Apple Suggests Multiple Modes of Gene Evolution after Duplication

Directory of Open Access Journals (Sweden)

Xiao-Long Wang

2015-01-01

Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.

Anaplastic lymphoma kinase (ALK) gene rearrangements in radiation-related human papillary thyroid carcinoma after the Chernobyl accident.

Science.gov (United States)

Arndt, Annette; Steinestel, Konrad; Rump, Alexis; Sroya, Manveer; Bogdanova, Tetiana; Kovgan, Leonila; Port, Matthias; Abend, Michael; Eder, Stefan

2018-04-06

Childhood radiation exposure has been associated with increased papillary thyroid carcinoma (PTC) risk. The role of anaplastic lymphoma kinase (ALK) gene rearrangements in radiation-related PTC remains unclear, but STRN-ALK fusions have recently been detected in PTCs from radiation exposed persons after Chernobyl using targeted next-generation sequencing and RNA-seq. We investigated ALK and RET gene rearrangements as well as known driver point mutations in PTC tumours from 77 radiation-exposed patients (mean age at surgery 22.4 years) and PTC tumours from 19 non-exposed individuals after the Chernobyl accident. ALK rearrangements were detected by fluorescence in situ hybridisation (FISH) and confirmed with immunohistochemistry (IHC); point mutations in the BRAF and RAS genes were detected by DNA pyrosequencing. Among the 77 tumours from exposed persons, we identified 7 ALK rearrangements and none in the unexposed group. When combining ALK and RET rearrangements, we found 24 in the exposed (31.2%) compared to two (10.5%) in the unexposed group. Odds ratios increased significantly in a dose-dependent manner up to 6.2 (95%CI: 1.1, 34.7; p = 0.039) at Iodine-131 thyroid doses >500 mGy. In total, 27 cases carried point mutations of BRAF or RAS genes, yet logistic regression analysis failed to identify significant dose association. To our knowledge we are the first to describe ALK rearrangements in post-Chernobyl PTC samples using routine methods such as FISH and IHC. Our findings further support the hypothesis that gene rearrangements, but not oncogenic driver mutations, are associated with ionizing radiation-related tumour risk. IHC may represent an effective method for ALK-screening in PTCs with known radiation aetiology, which is of clinical value since oncogenic ALK activation might represent a valuable target for small molecule inhibitors. © 2018 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and

Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

Science.gov (United States)

Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

2018-01-22

Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

Science.gov (United States)

Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

2014-01-01

Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

Directory of Open Access Journals (Sweden)

Jill C Preston

Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

Simulating evolution of protein complexes through gene duplication and co-option.

Science.gov (United States)

Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter

2016-06-21

We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genomic regulatory landscapes and chromosomal rearrangements

DEFF Research Database (Denmark)

Ladegaard, Elisabete L Engenheiro

2008-01-01

The main objectives of the PhD study are to identify and characterise chromosomal rearrangements within evolutionarily conserved regulatory landscapes around genes involved in the regulation of transcription and/or development (trans-dev genes). A frequent feature of trans-dev genes is that they ......The main objectives of the PhD study are to identify and characterise chromosomal rearrangements within evolutionarily conserved regulatory landscapes around genes involved in the regulation of transcription and/or development (trans-dev genes). A frequent feature of trans-dev genes...... the complex spatio-temporal expression of the associated trans-dev gene. Rare chromosomal breakpoints that disrupt the integrity of these regulatory landscapes may be used as a tool, not only to make genotype-phenotype associations, but also to link the associated phenotype with the position and tissue...... specificity of the individual CNEs. In this PhD study I have studied several chromosomal rearrangements with breakpoints in the vicinity of trans-dev genes. This included chromosomal rearrangements compatible with known phenotype-genotype associations (Rieger syndrome-PITX2, Mowat-Wilson syndrome-ZEB2...

Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

Science.gov (United States)

Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

2016-01-01

Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

Directory of Open Access Journals (Sweden)

Olga V Popova

Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

Directory of Open Access Journals (Sweden)

Kesterson Robert A

2003-04-01

Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

Genome rearrangements detected by SNP microarrays in individuals with intellectual disability referred with possible Williams syndrome.

Directory of Open Access Journals (Sweden)

Ariel M Pani

2010-08-01

Full Text Available Intellectual disability (ID affects 2-3% of the population and may occur with or without multiple congenital anomalies (MCA or other medical conditions. Established genetic syndromes and visible chromosome abnormalities account for a substantial percentage of ID diagnoses, although for approximately 50% the molecular etiology is unknown. Individuals with features suggestive of various syndromes but lacking their associated genetic anomalies pose a formidable clinical challenge. With the advent of microarray techniques, submicroscopic genome alterations not associated with known syndromes are emerging as a significant cause of ID and MCA.High-density SNP microarrays were used to determine genome wide copy number in 42 individuals: 7 with confirmed alterations in the WS region but atypical clinical phenotypes, 31 with ID and/or MCA, and 4 controls. One individual from the first group had the most telomeric gene in the WS critical region deleted along with 2 Mb of flanking sequence. A second person had the classic WS deletion and a rearrangement on chromosome 5p within the Cri du Chat syndrome (OMIM:123450 region. Six individuals from the ID/MCA group had large rearrangements (3 deletions, 3 duplications, one of whom had a large inversion associated with a deletion that was not detected by the SNP arrays.Combining SNP microarray analyses and qPCR allowed us to clone and sequence 21 deletion breakpoints in individuals with atypical deletions in the WS region and/or ID or MCA. Comparison of these breakpoints to databases of genomic variation revealed that 52% occurred in regions harboring structural variants in the general population. For two probands the genomic alterations were flanked by segmental duplications, which frequently mediate recurrent genome rearrangements; these may represent new genomic disorders. While SNP arrays and related technologies can identify potentially pathogenic deletions and duplications, obtaining sequence information

Gene duplications in prokaryotes can be associated with environmental adaptation.

Science.gov (United States)

Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

2010-10-20

Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

Directory of Open Access Journals (Sweden)

Görel Sundström

Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

Directory of Open Access Journals (Sweden)

Ge Song

2010-04-01

Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

Directory of Open Access Journals (Sweden)

Luís Filipe Costa Castro

Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

Recurrent Rearrangements of Human Amylase Genes Create Multiple Independent CNV Series.

Science.gov (United States)

Shwan, Nzar A A; Louzada, Sandra; Yang, Fengtang; Armour, John A L

2017-05-01

The human amylase gene cluster includes the human salivary (AMY1) and pancreatic amylase genes (AMY2A and AMY2B), and is a highly variable and dynamic region of the genome. Copy number variation (CNV) of AMY1 has been implicated in human dietary adaptation, and in population association with obesity, but neither of these findings has been independently replicated. Despite these functional implications, the structural genomic basis of CNV has only been defined in detail very recently. In this work, we use high-resolution analysis of copy number, and analysis of segregation in trios, to define new, independent allelic series of amylase CNVs in sub-Saharan Africans, including a series of higher-order expansions of a unit consisting of one copy each of AMY1, AMY2A, and AMY2B. We use fiber-FISH (fluorescence in situ hybridization) to define unexpected complexity in the accompanying rearrangements. These findings demonstrate recurrent involvement of the amylase gene region in genomic instability, involving at least five independent rearrangements of the pancreatic amylase genes (AMY2A and AMY2B). Structural features shared by fundamentally distinct lineages strongly suggest that the common ancestral state for the human amylase cluster contained more than one, and probably three, copies of AMY1. © 2017 WILEY PERIODICALS, INC.

Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

Directory of Open Access Journals (Sweden)

Yong Guo

Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

Science.gov (United States)

Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.

2017-01-01

The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane

Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

Directory of Open Access Journals (Sweden)

Tommy Harding

2017-05-01

Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like

Tissue-specific differential induction of duplicated fatty acid-binding protein genes by the peroxisome proliferator, clofibrate, in zebrafish (Danio rerio

Directory of Open Access Journals (Sweden)

Venkatachalam Ananda B

2012-07-01

Full Text Available Abstract Background Force, Lynch and Conery proposed the duplication-degeneration-complementation (DDC model in which partitioning of ancestral functions (subfunctionalization and acquisition of novel functions (neofunctionalization were the two primary mechanisms for the retention of duplicated genes. The DDC model was tested by analyzing the transcriptional induction of the duplicated fatty acid-binding protein (fabp genes by clofibrate in zebrafish. Clofibrate is a specific ligand of the peroxisome proliferator-activated receptor (PPAR; it activates PPAR which then binds to a peroxisome proliferator response element (PPRE to induce the transcriptional initiation of genes primarily involved in lipid homeostasis. Zebrafish was chosen as our model organism as it has many duplicated genes owing to a whole genome duplication (WGD event that occurred ~230-400 million years ago in the teleost fish lineage. We assayed the steady-state levels of fabp mRNA and heterogeneous nuclear RNA (hnRNA transcripts in liver, intestine, muscle, brain and heart for four sets of duplicated fabp genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, fabp10a/fabp10b and fabp11a/fabp11b in zebrafish fed different concentrations of clofibrate. Result Electron microscopy showed an increase in the number of peroxisomes and mitochondria in liver and heart, respectively, in zebrafish fed clofibrate. Clofibrate also increased the steady-state level of acox1 mRNA and hnRNA transcripts in different tissues, a gene with a functional PPRE. These results demonstrate that zebrafish is responsive to clofibrate, unlike some other fishes. The levels of fabp mRNA and hnRNA transcripts for the four sets of duplicated fabp genes was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. The level of hnRNA coded by a gene is an indirect estimate of the rate of transcriptional initiation of that gene. Clofibrate increased the steady-state level of fabp mRNAs and hn

Detection of clonal immunoglobulin heavy chain gene rearrangements by the polymerase chain reaction and capillary gel electrophoresis.

Science.gov (United States)

Fan, Hongxin; Robetorye, Ryan S

2013-01-01

Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.

Evolutionary history of glucose-6-phosphatase encoding genes in vertebrate lineages: towards a better understanding of the functions of multiple duplicates.

Science.gov (United States)

Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien

2017-05-02

Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.

Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene

Directory of Open Access Journals (Sweden)

Kane L Greer

2014-01-01

Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.

Analysis of TCRAD gene recombination: radio-induct rearrangement and signal joint structure

International Nuclear Information System (INIS)

Touvrey, C.

2005-09-01

We have shown that irradiation of pre-TCR-deficient CD3ε -/- mice restores thymocyte differentiation, by a p53-dependent and by a p53-independent pathway. Events normally associated during normal thymocyte development are dissociated in response to radiation exposure. Both of these pathways require LAT expression. Therefore, radiation exposure activates pre-TCR-like signals. TCRA gene rearrangement is induced following radiation exposure. The signal joints resulting from TCRA gene rearrangement have the same structure than those found in wild type mice. All signal joint analyzed in un-manipulated wild type mice do exhibit junctional diversity. This diversity results mainly from TdT activity. We present evidences that proteins involved in DNA repair and genomic stability participated in SJ formation. We propose that signal joint diversity is not an aberrant process but is a key feature of V(D)J recombination. All our work increases our understanding of molecular events associated with V(D)J recombination. (author)

Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

Science.gov (United States)

Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

2011-03-01

In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

Chromosomal rearrangements and gene flow over time in an inter-specific hybrid zone of the Sorex araneus group.

Science.gov (United States)

Yannic, G; Basset, P; Hausser, J

2009-06-01

Most hybrid zones have existed for hundreds or thousands of years but have generally been observed for only a short time period. Studies extending over periods long enough to track evolutionary changes in the zones or assess the ultimate outcome of hybridization are scarce. Here, we describe the evolution over time of the level of genetic isolation between two karyotypically different species of shrews (Sorex araneus and Sorex antinorii) at a hybrid zone located in the Swiss Alps. We first evaluated hybrid zone movement by contrasting patterns of gene flow and changes in cline parameters (centre and width) using 24 microsatellite loci, between two periods separated by 10 years apart. Additionally, we tested the role of chromosomal rearrangements on gene flow by analysing microsatellite loci located on both rearranged and common chromosomes to both species. We did not detect any movement of the hybrid zone during the period analysed, suggesting that the zone is a typical tension zone. However, the gene flow was significantly lower among the rearranged than the common chromosomes for the second period, whereas the difference was only marginally significant for the first period. This further supports the role of chromosomal rearrangements on gene flow between these taxa.

Gene duplications in prokaryotes can be associated with environmental adaptation

Directory of Open Access Journals (Sweden)

Lempicki Richard A

2010-10-01

Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

Science.gov (United States)

Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

2009-07-01

Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

Nested Inversion Polymorphisms Predispose Chromosome 22q11.2 to Meiotic Rearrangements.

Science.gov (United States)

Demaerel, Wolfram; Hestand, Matthew S; Vergaelen, Elfi; Swillen, Ann; López-Sánchez, Marcos; Pérez-Jurado, Luis A; McDonald-McGinn, Donna M; Zackai, Elaine; Emanuel, Beverly S; Morrow, Bernice E; Breckpot, Jeroen; Devriendt, Koenraad; Vermeesch, Joris R

2017-10-05

Inversion polymorphisms between low-copy repeats (LCRs) might predispose chromosomes to meiotic non-allelic homologous recombination (NAHR) events and thus lead to genomic disorders. However, for the 22q11.2 deletion syndrome (22q11.2DS), the most common genomic disorder, no such inversions have been uncovered as of yet. Using fiber-FISH, we demonstrate that parents transmitting the de novo 3 Mb LCR22A-D 22q11.2 deletion, the reciprocal duplication, and the smaller 1.5 Mb LCR22A-B 22q11.2 deletion carry inversions of LCR22B-D or LCR22C-D. Hence, the inversions predispose chromosome 22q11.2 to meiotic rearrangements and increase the individual risk for transmitting rearrangements. Interestingly, the inversions are nested or flanking rather than coinciding with the deletion or duplication sizes. This finding raises the possibility that inversions are a prerequisite not only for 22q11.2 rearrangements but also for all NAHR-mediated genomic disorders. Copyright © 2017. Published by Elsevier Inc.

Diagnostic value of immunoglobulin κ light chain gene rearrangement analysis in B-cell lymphomas.

Science.gov (United States)

Kokovic, Ira; Jezersek Novakovic, Barbara; Novakovic, Srdjan

2015-03-01

Analysis of the immunoglobulin κ light chain (IGK) gene is an alternative method for B-cell clonality assessment in the diagnosis of mature B-cell proliferations in which the detection of clonal immunoglobulin heavy chain (IGH) gene rearrangements fails. The aim of the present study was to evaluate the added value of standardized BIOMED-2 assay for the detection of clonal IGK gene rearrangements in the diagnostic setting of suspected B-cell lymphomas. With this purpose, 92 specimens from 80 patients with the final diagnosis of mature B-cell lymphoma (37 specimens), mature T-cell lymphoma (26 specimens) and reactive lymphoid proliferation (29 specimens) were analyzed for B-cell clonality. B-cell clonality analysis was performed using the BIOMED-2 IGH and IGK gene clonality assays. The determined sensitivity of the IGK assay was 67.6%, while the determined sensitivity of the IGH assay was 75.7%. The sensitivity of combined IGH+IGK assay was 81.1%. The determined specificity of the IGK assay was 96.2% in the group of T-cell lymphomas and 96.6% in the group of reactive lesions. The determined specificity of the IGH assay was 84.6% in the group of lymphomas and 86.2% in the group of reactive lesions. The comparison of GeneScan (GS) and heteroduplex pretreatment-polyacrylamide gel electrophoresis (HD-PAGE) methods for the analysis of IGK gene rearrangements showed a higher efficacy of GS analysis in a series of 27 B-cell lymphomas analyzed by both methods. In the present study, we demonstrated that by applying the combined IGH+IGK clonality assay the overall detection rate of B-cell clonality was increased by 5.4%. Thus, we confirmed the added value of the standardized BIOMED-2 IGK assay for assessment of B-cell clonality in suspected B-cell lymphomas with inconclusive clinical and cyto/histological diagnosis.

A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

Directory of Open Access Journals (Sweden)

Taro Tsujimura

2010-12-01

Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

Multiplex Ligation-dependent Probe Amplification Identification of Deletions and Duplications of the Duchenne Muscular Dystrophy Gene in Taiwanese Subjects

Directory of Open Access Journals (Sweden)

Hsiao-Lin Hwa

2007-05-01

Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.

Differential retention of metabolic genes following whole-genome duplication.

Science.gov (United States)

Gout, Jean-François; Duret, Laurent; Kahn, Daniel

2009-05-01

Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

Rearranged anaplastic lymphoma kinase (ALK) gene found for the first time in adult-onset papillary thyroid cancer cases among atomic bomb survivors

International Nuclear Information System (INIS)

Hamatani, K.; Mukai, M.; Takahashi, K.; Nakachi, K.; Kusunoki, Y.; Hayashi, Y.

2012-01-01

Full text of the publication follows: Thyroid cancer is one of the malignancies most strongly associated with ionizing radiation in humans. Epidemiology studies of atomic bomb (A-bomb) survivors have indicated that excess relative risk of papillary thyroid cancer per Gy was remarkably high in the survivors. We therefore aim to clarify mechanisms linking A-bomb radiation exposure and development of papillary thyroid cancer. Toward this end, we intend to clarify characteristics of gene alterations occurring in radiation-associated adult-onset papillary thyroid cancer from the Life Span Study cohort of A-bomb survivors. We have thus far found that with increased radiation dose, papillary thyroid cancer cases with chromosomal rearrangements (mainly RET/PTC rearrangements) significantly increased and papillary thyroid cancer cases with point mutations (mainly BRAF-V600E) significantly decreased. Papillary thyroid cancer cases with non-detected gene alterations that carried no mutations in RET, NTRK1, BRAF or RAS genes tended to increase with increased radiation dose. In addition, we found that relative frequency of these papillary thyroid cancer cases significantly decreased with time elapsed since exposure. Through analysis of papillary thyroid cancer cases with non-detected gene alterations, we recently discovered a new type of rearrangement for the first time in papillary thyroid cancer, i.e., rearranged anaplastic lymphoma kinase (ALK) gene, although identification of any partner gene(s) is needed. Specifically, rearrangement of ALK was found in 10 of 19 exposed papillary thyroid cancer cases with non-detected gene alterations but not in any of the six non-exposed papillary thyroid cancer cases. Furthermore, papillary thyroid cancer with ALK rearrangement was frequently found in the cases with high radiation dose or with short time elapsed since A-bomb exposure. These results suggest that chromosomal rearrangement, typically of RET and ALK, may play an important

Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

Directory of Open Access Journals (Sweden)

Praveen Baskaran

Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

Directory of Open Access Journals (Sweden)

Korchagina Natalia

2011-08-01

Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

Most ultraviolet irradiation induced mutations in the nematode Caenorhabditis elegans are chromosomal rearrangements

International Nuclear Information System (INIS)

Stewart, H.I.; Rosenbluth, R.E.; Baillie, D.L.

1991-01-01

In this study the utility of 254-nm ultraviolet light (UV) as a magnetic tool in C.elegans is determined. It is demonstrated that irradiation of adult hermaphrodites provides a simple method for the induction of heritable chromosomal rearrangements. A screening protocol was employed that identifies either recessive lethal mutations in the 40 map unit region balanced by the translocation eT1(III;V), or unc-36(III) duplications. Mutations were recovered in 3% of the chromosomes screened after a dose of 120 J/m 2 . This rate resembles that for 1500 R γ-ray-induced mutations selected in a similar manner. The mutations were classified either as lethals [mapping to Linkage Group (LG)III or LGV] or as putative unc-36 duplications. In contrast to the majority of UV-induced mutations analysed in micro-organisms, a large fraction of the C.elegans UV-induced mutations were found to be not simple intragenic lesions, but deficiencies for more than one adjacent gene or more complex events. Preliminary evidence for this conclusion came from the high frequency of mutations that had a dominant effect causing reduced numbers of adult progeny. Subsequently 6 out of 9 analysed LGV mutations were found to be deficiencies. Other specific rearrangements also identified were: one translocation, sT5(II;III), and two unc-36 duplications, sDp8 and sDp9. It was concluded that UV irradiation can easily be used as an additional tool for the analysis of C.elegans chromosomes, and that C.elegans should prove to be a useful organism in which to study the mechanisms whereby UV acts as a mutagen in cells of complex eukaryotes. (author). 46 refs.; 5 figs.; 4 tabs

Characterization of a complex rearrangement involving duplication and deletion of 9p in an infant with craniofacial dysmorphism and cardiac anomalies

Directory of Open Access Journals (Sweden)

Di Bartolo Daniel L

2012-07-01

Full Text Available Abstract Partial duplication and partial deletion of the short arm of chromosome 9 have each been reported in the literature as clinically recognizable syndromes. We present clinical, cytogenetic, and molecular findings on a five-week-old female infant with concomitant duplication and terminal deletion of the short arm of chromosome 9. To our knowledge ten such cases have previously been reported. Conventional cytogenetic analysis identified additional material on chromosome 9 at band p23. FISH analysis aided in determining the additional material consisted of an inverted duplication with a terminal deletion of the short arm. Microarray analysis confirmed this interpretation and further characterized the abnormality as a duplication of about 32.7 Mb, from 9p23 to 9p11.2, and a terminal deletion of about 11.5 Mb, from 9p24.3 to 9p23. The infant displayed characteristic features of Duplication 9p Syndrome (hypotonia, bulbous nose, single transverse palmar crease, cranial anomalies, as well as features associated with Deletion 9p Syndrome (flat nasal bridge, long philtrum, cardiac anomalies despite the deletion being distal to the reported critical region for this syndrome. This case suggests that there are genes or regulatory elements that lie outside of the reported critical region responsible for certain phenotypic features associated with Deletion 9p Syndrome. It also underscores the importance of utilizing array technology to precisely define abnormalities involving the short arm of 9p in order to further refine genotype/phenotype associations and to identify additional cases of duplication/deletion.

Host Mitochondrial Association Evolved in the Human Parasite Toxoplasma gondii via Neofunctionalization of a Gene Duplicate.

Science.gov (United States)

Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P

2016-05-01

In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.

Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

Directory of Open Access Journals (Sweden)

Gadagkar Sudhindra R

2010-04-01

Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

Molecular Subtyping of Primary Prostate Cancer Reveals Specific and Shared Target Genes of Different ETS Rearrangements

Directory of Open Access Journals (Sweden)

Paula Paulo

2012-07-01

Full Text Available This work aimed to evaluate whether ETS transcription factors frequently involved in rearrangements in prostate carcinomas (PCa, namely ERG and ETV1, regulate specific or shared target genes. We performed differential expression analysis on nine normal prostate tissues and 50 PCa enriched for different ETS rearrangements using exon-level expression microarrays, followed by in vitro validation using cell line models. We found specific deregulation of 57 genes in ERG-positive PCa and 15 genes in ETV1-positive PCa, whereas deregulation of 27 genes was shared in both tumor subtypes. We further showed that the expression of seven tumor-associated ERG target genes (PLA1A, CACNA1D, ATP8A2, HLA-DMB, PDE3B, TDRD1, and TMBIM1 and two tumor-associated ETV1 target genes (FKBP10 and GLYATL2 was significantly affected by specific ETS silencing in VCaP and LNCaP cell line models, respectively, whereas the expression of three candidate ERG and ETV1 shared targets (GRPR, KCNH8, and TMEM45B was significantly affected by silencing of either ETS. Interestingly, we demonstrate that the expression of TDRD1, the topmost overexpressed gene of our list of ERG-specific candidate targets, is inversely correlated with the methylation levels of a CpG island found at -66 bp of the transcription start site in PCa and that TDRD1 expression is regulated by direct binding of ERG to the CpG island in VCaP cells. We conclude that ETS transcription factors regulate specific and shared target genes and that TDRD1, FKBP10, and GRPR are promising therapeutic targets and can serve as diagnostic markers for molecular subtypes of PCa harboring specific fusion gene rearrangements.

Duplications and losses in gene families of rust pathogens highlight putative effectors.

Science.gov (United States)

Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

2014-01-01

Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

Science.gov (United States)

Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

2012-11-02

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

Science.gov (United States)

Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

2012-01-01

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

scid Thymocytes with TCRbeta gene rearrangements are targets for the oncogenic effect of SCL and LMO1 transgenes.

Science.gov (United States)

Chervinsky, D S; Lam, D H; Melman, M P; Gross, K W; Aplan, P D

2001-09-01

SCL and LMO1 were both discovered by virtue of their activation by chromosomaltranslocation in patients with T-cell acute lymphoblastic leukemia (T-ALL). Overexpression of SCL and LMO1 in the thymus of transgenic mice leads to T-ALL at a young age. scid (severe combined immunodeficient) mice are unable to efficiently recombine antigen receptor genes and consequently display a developmental block at the CD4-CD8- to CD4+CD8+ transition. To test the hypothesis that this developmental block would protect SCL/LMO1 transgenic mice from developing T-ALL, we crossed the SCL and LMO1 transgenes onto a scid background. The age of onset for T-ALL in the SCL/LMO1/scid mice was significantly delayed (P < 0.001) compared with SCL/LMO1/wild-type mice. Intriguingly, all of the SCL/LMO1/scid malignancies displayed clonal, in-frame TCRbeta gene rearrangements. Taken together, these findings suggest that the "leaky" scid thymocyte that undergoes a productive TCRbeta gene rearrangement is susceptible to the oncogenic action of SCL and LMO1 and additionally suggests that TCRbeta gene rearrangements may be required for the oncogenic action of SCL and LMO1.

Finding all sorting tandem duplication random loss operations

DEFF Research Database (Denmark)

Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

2011-01-01

A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

Chimeric Amino Acid Rearrangements as Immune Targets in Prostate Cancer

Science.gov (United States)

2016-05-01

COVERED 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Chimeric Amino Acid Rearrangements as Immune Targets in Prostate Cancer 5b. GRANT NUMBER W81XWH...that result from gene rearrangements given their high frequency relative to somatic point mutations. Gene rearrangements can yield novel chimeric

Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

Energy Technology Data Exchange (ETDEWEB)

Pejcha, Robert; Ludwig, Martha L. (Michigan)

2010-03-08

Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

International Nuclear Information System (INIS)

Pejcha, Robert; Ludwig, Martha L.

2005-01-01

Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

Directory of Open Access Journals (Sweden)

Robert Pejchal

2005-02-01

Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

The chimeric gene CHRFAM7A, a partial duplication of the CHRNA7 gene, is a dominant negative regulator of α7*nAChR function.

Science.gov (United States)

Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry

2011-10-15

The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.

Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

Directory of Open Access Journals (Sweden)

Jessica B Hostetler

2016-10-01

Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

Multiple chromosomal rearrangements structured the ancestral vertebrate Hox-bearing protochromosomes.

Directory of Open Access Journals (Sweden)

Vincent J Lynch

2009-01-01

Full Text Available While the proposal that large-scale genome expansions occurred early in vertebrate evolution is widely accepted, the exact mechanisms of the expansion--such as a single or multiple rounds of whole genome duplication, bloc chromosome duplications, large-scale individual gene duplications, or some combination of these--is unclear. Gene families with a single invertebrate member but four vertebrate members, such as the Hox clusters, provided early support for Ohno's hypothesis that two rounds of genome duplication (the 2R-model occurred in the stem lineage of extant vertebrates. However, despite extensive study, the duplication history of the Hox clusters has remained unclear, calling into question its usefulness in resolving the role of large-scale gene or genome duplications in early vertebrates. Here, we present a phylogenetic analysis of the vertebrate Hox clusters and several linked genes (the Hox "paralogon" and show that different phylogenies are obtained for Dlx and Col genes than for Hox and ErbB genes. We show that these results are robust to errors in phylogenetic inference and suggest that these competing phylogenies can be resolved if two chromosomal crossover events occurred in the ancestral vertebrate. These results resolve conflicting data on the order of Hox gene duplications and the role of genome duplication in vertebrate evolution and suggest that a period of genome reorganization occurred after genome duplications in early vertebrates.

Constitutional chromothripsis rearrangements involve clustered double-stranded DNA breaks and nonhomologous repair mechanisms.

Science.gov (United States)

Kloosterman, Wigard P; Tavakoli-Yaraki, Masoumeh; van Roosmalen, Markus J; van Binsbergen, Ellen; Renkens, Ivo; Duran, Karen; Ballarati, Lucia; Vergult, Sarah; Giardino, Daniela; Hansson, Kerstin; Ruivenkamp, Claudia A L; Jager, Myrthe; van Haeringen, Arie; Ippel, Elly F; Haaf, Thomas; Passarge, Eberhard; Hochstenbach, Ron; Menten, Björn; Larizza, Lidia; Guryev, Victor; Poot, Martin; Cuppen, Edwin

2012-06-28

Chromothripsis represents a novel phenomenon in the structural variation landscape of cancer genomes. Here, we analyze the genomes of ten patients with congenital disease who were preselected to carry complex chromosomal rearrangements with more than two breakpoints. The rearrangements displayed unanticipated complexity resembling chromothripsis. We find that eight of them contain hallmarks of multiple clustered double-stranded DNA breaks (DSBs) on one or more chromosomes. In addition, nucleotide resolution analysis of 98 breakpoint junctions indicates that break repair involves nonhomologous or microhomology-mediated end joining. We observed that these eight rearrangements are balanced or contain sporadic deletions ranging in size between a few hundred base pairs and several megabases. The two remaining complex rearrangements did not display signs of DSBs and contain duplications, indicative of rearrangement processes involving template switching. Our work provides detailed insight into the characteristics of chromothripsis and supports a role for clustered DSBs driving some constitutional chromothripsis rearrangements. Copyright © 2012 The Authors. Published by Elsevier Inc. All rights reserved.

Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

Science.gov (United States)

Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

2016-12-13

Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Chromosomal rearrangements in Tourette syndrome

DEFF Research Database (Denmark)

Bertelsen, Birgitte; Debes, Nanette Mol; Hjermind, Lena E

2013-01-01

, and identification of susceptibility genes through linkage and association studies has been complicated due to inherent difficulties such as no clear mode of inheritance, genetic heterogeneity, and apparently incomplete penetrance. Positional cloning through mapping of disease-related chromosome rearrangements has...... been an efficient tool for the cloning of disease genes in several Mendelian disorders and in a number of complex disorders. Through cytogenetic investigation of 205 TS patients, we identified three possibly disease-associated chromosome rearrangements rendering this approach relevant in chasing TS...

Duplications and losses in gene families of rust pathogens highlight putative effectors

Directory of Open Access Journals (Sweden)

Amanda L. Pendleton

2014-06-01

Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

Directory of Open Access Journals (Sweden)

Tong Jingou

2006-11-01

Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

Additions, losses, and rearrangements on the evolutionary route from a reconstructed ancestor to the modern Saccharomyces cerevisiae genome.

Directory of Open Access Journals (Sweden)

Jonathan L Gordon

2009-05-01

Full Text Available Comparative genomics can be used to infer the history of genomic rearrangements that occurred during the evolution of a species. We used the principle of parsimony, applied to aligned synteny blocks from 11 yeast species, to infer the gene content and gene order that existed in the genome of an extinct ancestral yeast about 100 Mya, immediately before it underwent whole-genome duplication (WGD. The reconstructed ancestral genome contains 4,703 ordered loci on eight chromosomes. The reconstruction is complete except for the subtelomeric regions. We then inferred the series of rearrangement steps that led from this ancestor to the current Saccharomyces cerevisiae genome; relative to the ancestral genome we observe 73 inversions, 66 reciprocal translocations, and five translocations involving telomeres. Some fragile chromosomal sites were reused as evolutionary breakpoints multiple times. We identified 124 genes that have been gained by S. cerevisiae in the time since the WGD, including one that is derived from a hAT family transposon, and 88 ancestral loci at which S. cerevisiae did not retain either of the gene copies that were formed by WGD. Sites of gene gain and evolutionary breakpoints both tend to be associated with tRNA genes and, to a lesser extent, with origins of replication. Many of the gained genes in S. cerevisiae have functions associated with ethanol production, growth in hypoxic environments, or the uptake of alternative nutrient sources.

Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max).

Science.gov (United States)

Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M

2015-03-15

Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.

Recurrent rearrangements of the PLAG1 and HMGA2 genes in lacrimal gland pleomorphic adenoma and carcinoma ex pleomorphic adenoma

DEFF Research Database (Denmark)

Andreasen, Simon; von Holstein, Sarah L; Homøe, Preben

2018-01-01

PURPOSE: Lacrimal gland tumours constitute a wide spectrum of neoplastic lesions that are histologically similar to tumours of the salivary gland. In the salivary gland, pleomorphic adenoma (PA) is frequently characterized by recurrent chromosomal rearrangements of the PLAG1 and HMGA2 genes......, a genetic feature retained in carcinoma ex pleomorphic adenoma (ca-ex-PA) that makes it possible to distinguish ca-ex-PA from de novo carcinomas. However, whether PLAG1 and HMGA2 gene rearrangements are found in lacrimal gland PA and ca-ex-PA is not known. METHODS: Twenty-one lacrimal gland PAs and four ca......-ex-PAs were retrospectively reviewed and subjected to break-apart fluorescence in situ hybridization (FISH) for rearrangements of the PLAG1 gene. Cases without PLAG1 abnormalities were subjected to HMGA2 break-apart FISH. Immunohistochemical staining for PLAG1 and HMGA2 protein was performed and correlated...

Prevalence of Gene Rearrangements in Mexican Children with Acute Lymphoblastic Leukemia: A Population Study—Report from the Mexican Interinstitutional Group for the Identification of the Causes of Childhood Leukemia

Science.gov (United States)

Bekker-Méndez, Vilma Carolina; Miranda-Peralta, Enrique; Núñez-Enríquez, Juan Carlos; Olarte-Carrillo, Irma; Guerra-Castillo, Francisco Xavier; Pompa-Mera, Ericka Nelly; Ocaña-Mondragón, Alicia; Bernáldez-Ríos, Roberto; Medina-Sanson, Aurora; Jiménez-Hernández, Elva; Amador-Sánchez, Raquel; Peñaloza-González, José Gabriel; de Diego Flores-Chapa, José; Fajardo-Gutiérrez, Arturo; Flores-Lujano, Janet; Rodríguez-Zepeda, María del Carmen; Dorantes-Acosta, Elisa María; Bolea-Murga, Victoria; Núñez-Villegas, Nancy; Velázquez-Aviña, Martha Margarita; Torres-Nava, José Refugio; Reyes-Zepeda, Nancy Carolina; González-Bonilla, Cesar; Mejía-Aranguré, Juan Manuel

2014-01-01

Mexico has one of the highest incidences of childhood leukemia worldwide and significantly higher mortality rates for this disease compared with other countries. One possible cause is the high prevalence of gene rearrangements associated with the etiology or with a poor prognosis of childhood acute lymphoblastic leukemia (ALL). The aims of this multicenter study were to determine the prevalence of the four most common gene rearrangements [ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, and MLL rearrangements] and to explore their relationship with mortality rates during the first year of treatment in ALL children from Mexico City. Patients were recruited from eight public hospitals during 2010–2012. A total of 282 bone marrow samples were obtained at each child's diagnosis for screening by conventional and multiplex reverse transcription polymerase chain reaction to determine the gene rearrangements. Gene rearrangements were detected in 50 (17.7%) patients. ETV6-RUNX1 was detected in 21 (7.4%) patients, TCF3-PBX1 in 20 (7.1%) patients, BCR-ABL1 in 5 (1.8%) patients, and MLL rearrangements in 4 (1.4%) patients. The earliest deaths occurred at months 1, 2, and 3 after diagnosis in patients with MLL, ETV6-RUNX1, and BCR-ABL1 gene rearrangements, respectively. Gene rearrangements could be related to the aggressiveness of leukemia observed in Mexican children. PMID:25692130

A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

Science.gov (United States)

Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

2010-12-01

Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

Science.gov (United States)

Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

2010-04-01

Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

Gene duplication and fragmentation in the zebra finch major histocompatibility complex

Directory of Open Access Journals (Sweden)

Burt David W

2010-04-01

Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

Science.gov (United States)

Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

2016-01-01

To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

DEFF Research Database (Denmark)

Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.

2007-01-01

and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...

Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

DEFF Research Database (Denmark)

Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne

2012-01-01

with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

International Nuclear Information System (INIS)

Essouissi, Imen

2006-01-01

Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

Science.gov (United States)

Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

2018-01-01

Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

Detection of ALK gene rearrangement in non-small cell lung cancer: a comparison of fluorescence in situ hybridization and chromogenic in situ hybridization with correlation of ALK protein expression.

Science.gov (United States)

Kim, Hyojin; Yoo, Seol-Bong; Choe, Ji-Young; Paik, Jin Ho; Xu, Xianhua; Nitta, Hiroaki; Zhang, Wenjun; Grogan, Thomas M; Lee, Choon-Taek; Jheon, Sanghoon; Chung, Jin-Haeng

2011-08-01

Accurate determination of ALK rearrangement is important in lung cancer patients, especially in determining their eligibility for crizotinib therapy. Fluorescence in situ hybridization (FISH) has been regarded as the gold standard method for detecting ALK rearrangement. However, FISH requires a fluorescence microscope, and the signals are labile and rapidly fade over time. This study evaluates the concordance between ALK gene rearrangement in non-small cell lung cancer assessed by ALK FISH and a newly developed ALK chromogenic in situ hybridization (CISH) and correlates the results with ALK protein expression assessed by immunohistochemistry. A total of 465 formalin-fixed, paraffin-embedded non-small cell lung cancer samples were analyzed by ALK FISH (PathVysion, Vysis, Abbott) and ALK CISH. For comparison, all specimens were stained by immunohistochemistry (clone 5A4, Novocastra) and interobserver reproducibility was assessed. We found that agreement between the pathologists on the CISH-determined ALK status was achieved in 449 patients (96.6%), and ALK rearrangement was identified in 18 patients (4.0%) in CISH method. Among these cases, 443 cases (95.3%) had results matching the corresponding FISH results: 17 rearranged, 425 wild types, and 1 discordant case. There was high concordance in the assessment of ALK gene rearrangement between FISH and CISH techniques (κ = 0.92) and between observers (κ = 0.97). In addition, there was high concordance in the ALK gene status and ALK protein expression between CISH and IHC tests (κ = 0.82). CISH is a highly reproducible and practical method to detect ALK gene rearrangement and correlated well with ALK protein expression. Here, we present a diagnostic algorithm (Chung's SNUBH ALK protocol) to detect lung cancer with ALK rearrangements using IHC, FISH and CISH. Because CISH allows a concurrent analysis of histological features of the tumors and gene rearrangement, it appears to be a useful method in determining ALK gene

Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

Science.gov (United States)

Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

2017-03-06

Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito.

Science.gov (United States)

Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène

2015-10-05

Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

Effects of chromosomal rearrangements on the zeste-white interaction in Drosophila melanogaster

International Nuclear Information System (INIS)

Smolik-Utlaut, S.M.; Gelbart, W.M.

1987-01-01

Three gene systems have been shown to exhibit proximity-dependent phenotypes in Drosophila melanogaster; bithorax (BX-C), decapentaplegic (DPP-C) and white (w). In structurally homozygous genotypes, specific allelic combinations at these loci exhibit one phenotype, while in certain rearrangement heterozygotes the same allelic combinations exhibit dramatically different phenotypes. The genetic properties of the proximity-dependent allelic complementation (termed transvection effects) at the BX-C and DPP-C, are quite similar. As determined by cytogenetic analysis of transvection-disrupting rearrangements, the critical regions for the BX-C and DDP-C transvection effects extend proximally from these loci for several hundred polytene chromosome bands. The interaction between the zeste and white loci appears to depend upon the proximity of the two w + alleles. By use of insertional duplications, displacement of w + homologues has been shown to interfere with the zeste-white interaction. In this report, the authors investigate the basis for the difference in the size of the BX-C and DPP-C critical regions from that of white using a 137 Cs-mutagenesis procedure. The authors test and eliminate the possibility that the difference is due to evidence strongly suggests that the zeste-white interaction is, at the phenotypic level, much less sensitive to displacement of the homologous genes than is transvection at either the BX-C or DPP-C. Given these results, they suggest that the zeste-white interaction and transvection are two different proximity-dependent phenomena

Detection of clonal T-cell receptor beta and gamma chain gene rearrangement by polymerase chain reaction and capillary gel electrophoresis.

Science.gov (United States)

Fan, Hongxin; Robetorye, Ryan S

2013-01-01

Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.

Two Rounds of Whole Genome Duplication in the AncestralVertebrate

Energy Technology Data Exchange (ETDEWEB)

Dehal, Paramvir; Boore, Jeffrey L.

2005-04-12

The hypothesis that the relatively large and complex vertebrate genome was created by two ancient, whole genome duplications has been hotly debated, but remains unresolved. We reconstructed the evolutionary relationships of all gene families from the complete gene sets of a tunicate, fish, mouse, and human, then determined when each gene duplicated relative to the evolutionary tree of the organisms. We confirmed the results of earlier studies that there remains little signal of these events in numbers of duplicated genes, gene tree topology, or the number of genes per multigene family. However, when we plotted the genomic map positions of only the subset of paralogous genes that were duplicated prior to the fish-tetrapod split, their global physical organization provides unmistakable evidence of two distinct genome duplication events early in vertebrate evolution indicated by clear patterns of 4-way paralogous regions covering a large part of the human genome. Our results highlight the potential for these large-scale genomic events to have driven the evolutionary success of the vertebrate lineage.

Detection of clonal B cells in microdissected reactive lymphoproliferations: possible diagnostic pitfalls in PCR analysis of immunoglobulin heavy chain gene rearrangement

DEFF Research Database (Denmark)

Zhou, X.G.; Sandvej, K.; Gregersen, Niels

1999-01-01

Aims-To evaluate the specificity of standard and fluorescence based (GENESCAN) polymerase chain reaction (PCR) immunoglobulin heavy chain (IgH) gene rearrangement analysis in complete and microdissected paraffin wax embedded sections from lymphoid proliferations. Methods-PCR IgH gene rearrangement...... because of preferential priming or detection of local B cell clones. Data from clonal analysis of small, microdissected or lymphocyte poor samples must be evaluated critically. It is recommended that analyses should be run in parallel on at least two tissue specimens. Only reproducible bands present...

Gene expression in a paleopolyploid: a transcriptome resource for the ciliate Paramecium tetraurelia

Directory of Open Access Journals (Sweden)

Kapusta Aurélie

2010-10-01

Full Text Available Abstract Background The genome of Paramecium tetraurelia, a unicellular model that belongs to the ciliate phylum, has been shaped by at least 3 successive whole genome duplications (WGD. These dramatic events, which have also been documented in plants, animals and fungi, are resolved over evolutionary time by the loss of one duplicate for the majority of genes. Thanks to a low rate of large scale genome rearrangement in Paramecium, an unprecedented large number of gene duplicates of different ages have been identified, making this organism an outstanding model to investigate the evolutionary consequences of polyploidization. The most recent WGD, with 51% of pre-duplication genes still in 2 copies, provides a snapshot of a phase of rapid gene loss that is not accessible in more ancient polyploids such as yeast. Results We designed a custom oligonucleotide microarray platform for P. tetraurelia genome-wide expression profiling and used the platform to measure gene expression during 1 the sexual cycle of autogamy, 2 growth of new cilia in response to deciliation and 3 biogenesis of secretory granules after massive exocytosis. Genes that are differentially expressed during these time course experiments have expression patterns consistent with a very low rate of subfunctionalization (partition of ancestral functions between duplicated genes in particular since the most recent polyploidization event. Conclusions A public transcriptome resource is now available for Paramecium tetraurelia. The resource has been integrated into the ParameciumDB model organism database, providing searchable access to the data. The microarray platform, freely available through NimbleGen Systems, provides a robust, cost-effective approach for genome-wide expression profiling in P. tetraurelia. The expression data support previous studies showing that at short evolutionary times after a whole genome duplication, gene dosage balance constraints and not functional change are

Flexibility and symmetry of prokaryotic genome rearrangement reveal lineage-associated core-gene-defined genome organizational frameworks.

Science.gov (United States)

Kang, Yu; Gu, Chaohao; Yuan, Lina; Wang, Yue; Zhu, Yanmin; Li, Xinna; Luo, Qibin; Xiao, Jingfa; Jiang, Daquan; Qian, Minping; Ahmed Khan, Aftab; Chen, Fei; Zhang, Zhang; Yu, Jun

2014-11-25

The prokaryotic pangenome partitions genes into core and dispensable genes. The order of core genes, albeit assumed to be stable under selection in general, is frequently interrupted by horizontal gene transfer and rearrangement, but how a core-gene-defined genome maintains its stability or flexibility remains to be investigated. Based on data from 30 species, including 425 genomes from six phyla, we grouped core genes into syntenic blocks in the context of a pangenome according to their stability across multiple isolates. A subset of the core genes, often species specific and lineage associated, formed a core-gene-defined genome organizational framework (cGOF). Such cGOFs are either single segmental (one-third of the species analyzed) or multisegmental (the rest). Multisegment cGOFs were further classified into symmetric or asymmetric according to segment orientations toward the origin-terminus axis. The cGOFs in Gram-positive species are exclusively symmetric and often reversible in orientation, as opposed to those of the Gram-negative bacteria, which are all asymmetric and irreversible. Meanwhile, all species showing strong strand-biased gene distribution contain symmetric cGOFs and often specific DnaE (α subunit of DNA polymerase III) isoforms. Furthermore, functional evaluations revealed that cGOF genes are hub associated with regard to cellular activities, and the stability of cGOF provides efficient indexes for scaffold orientation as demonstrated by assembling virtual and empirical genome drafts. cGOFs show species specificity, and the symmetry of multisegmental cGOFs is conserved among taxa and constrained by DNA polymerase-centric strand-biased gene distribution. The definition of species-specific cGOFs provides powerful guidance for genome assembly and other structure-based analysis. Prokaryotic genomes are frequently interrupted by horizontal gene transfer (HGT) and rearrangement. To know whether there is a set of genes not only conserved in position

A case report of two male siblings with autism and duplication of Xq13-q21, a region including three genes predisposing for autism.

Science.gov (United States)

Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher

2014-05-01

Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.

New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

Science.gov (United States)

Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

2015-07-01

The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

Recurrent reciprocal genomic rearrangements of 17q12 are associated with renal disease, diabetes, and epilepsy

DEFF Research Database (Denmark)

Mefford, Heather C; Clauin, Severine; Sharp, Andrew J

2007-01-01

predisposed to recurrent rearrangement, by array-based comparative genomic hybridization. We found that 6% of fetal material showed evidence of microdeletion or microduplication, including three independent events that likely resulted from unequal crossing-over between segmental duplications. One...

Mapping Breakpoints of Complex Chromosome Rearrangements Involving a Partial Trisomy 15q23.1-q26.2 Revealed by Next Generation Sequencing and Conventional Techniques.

Directory of Open Access Journals (Sweden)

Qiong Pan

Full Text Available Complex chromosome rearrangements (CCRs, which are rather rare in the whole population, may be associated with aberrant phenotypes. Next-generation sequencing (NGS and conventional techniques, could be used to reveal specific CCRs for better genetic counseling. We report the CCRs of a girl and her mother, which were identified using a combination of NGS and conventional techniques including G-banding, fluorescence in situ hybridization (FISH and PCR. The girl demonstrated CCRs involving chromosomes 3 and 8, while the CCRs of her mother involved chromosomes 3, 5, 8, 11 and 15. HumanCytoSNP-12 Chip analysis identified a 35.4 Mb duplication on chromosome 15q21.3-q26.2 in the proband and a 1.6 Mb microdeletion at chromosome 15q21.3 in her mother. The proband inherited the rearranged chromosomes 3 and 8 from her mother, and the duplicated region on chromosome 15 of the proband was inherited from the mother. Approximately one hundred genes were identified in the 15q21.3-q26.2 duplicated region of the proband. In particular, TPM1, SMAD6, SMAD3, and HCN4 may be associated with her heart defects, and HEXA, KIF7, and IDH2 are responsible for her developmental and mental retardation. In addition, we suggest that a microdeletion on the 15q21.3 region of the mother, which involved TCF2, TCF12, ADMA10 and AQP9, might be associated with mental retardation. We delineate the precise structures of the derivative chromosomes, chromosome duplication origin and possible molecular mechanisms for aberrant phenotypes by combining NGS data with conventional techniques.

Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

Energy Technology Data Exchange (ETDEWEB)

Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

2009-01-01

Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

Science.gov (United States)

Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

2016-02-01

Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Comparative investigations of T cell receptor gamma gene rearrangements in frozen and formalin-fixed paraffin wax-embedded tissues by capillary electrophoresis

DEFF Research Database (Denmark)

Christensen, M; Funder, A D; Bendix, K

2006-01-01

AIM: To compare clonal T cell receptor gamma (TCRgamma) gene rearrangements in frozen and formalin-fixed paraffin wax-embedded (FFPE) tissue, using capillary electrophoresis for use in diagnostics, as T cell lymphomas may be difficult to diagnose by conventional methods.METHODS: The DNA for PCR......% for patient specimens and the specificity 100%. The junctional region between the Vgamma and Jgamma segments was specific for each patient.CONCLUSIONS: Capillary electrophoresis of PCR products from frozen and FFPE tissue is suitable for detecting clonal TCRgamma gene rearrangements. It is important, however...

Mirror-image duplication of the primary axis and heart in Xenopus embryos by the overexpression of Msx-1 gene.

Science.gov (United States)

Chen, Y; Solursh, M

1995-10-01

The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.

Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene

Directory of Open Access Journals (Sweden)

J. Uberos

2012-01-01

Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.

Clinical significance of productive immunoglobulin heavy chain gene rearrangements in childhood acute lymphoblastic leukemia.

Science.gov (United States)

Katsibardi, Katerina; Braoudaki, Maria; Papathanasiou, Chrissa; Karamolegou, Kalliopi; Tzortzatou-Stathopoulou, Fotini

2011-09-01

We analyzed the CDR3 region of 80 children with B-cell acute lymphoblastic leukemia (B-ALL) using the ImMunoGeneTics Information System and JOINSOLVER. In total, 108 IGH@ rearrangements were analyzed. Most of them (75.3%) were non-productive. IGHV@ segments proximal to IGHD-IGHJ@ were preferentially rearranged (45.3%). Increased utilization of IGHV3 segments IGHV3-13 (11.3%) and IGHV3-15 (9.3%), IGHD3 (30.5%), and IGHJ4 (34%) was noted. In pro-B ALL more frequent were IGHV3-11 (33.3%) and IGHV6-1 (33.3%), IGHD2-21 (50%), IGHJ4 (50%), and IGHJ6 (50%) segments. Shorter CDR3 length was observed in IGHV@6, IGHD7, and IGHJ1 segments, whereas increased CDR3 length was related to IGHV3, IGHD2, and IGHJ4 segments. Increased risk of relapse was found in patients with productive sequences. Specifically, the relapse-free survival rate at 5 years in patients with productive sequences at diagnosis was 75% (standard error [SE] ±9%), whereas in patients with non-productive sequences it was 97% (SE ±1.92%) (p-value =0.0264). Monoclonality and oligoclonality were identified in 81.2% and 18.75% cases at diagnosis, respectively. Sequence analysis revealed IGHV@ to IGHDJ joining only in 6.6% cases with oligoclonality. The majority (75%) of relapsed patients had monoclonal IGH@ rearrangements. The preferential utilization of IGHV@ segments proximal to IGHDJ depended on their location on the IGHV@ locus. Molecular mechanisms occurring during IGH@ rearrangement might play an essential role in childhood ALL prognosis. In our study, the productivity of the rearranged sequences at diagnosis proved to be a significant prognostic factor.

Precise detection of rearrangement breakpoints in mammalian chromosomes

Directory of Open Access Journals (Sweden)

Gautier Christian

2008-06-01

Full Text Available Abstract Background Genomes undergo large structural changes that alter their organisation. The chromosomal regions affected by these rearrangements are called breakpoints, while those which have not been rearranged are called synteny blocks. We developed a method to precisely delimit rearrangement breakpoints on a genome by comparison with the genome of a related species. Contrary to current methods which search for synteny blocks and simply return what remains in the genome as breakpoints, we propose to go further and to investigate the breakpoints themselves in order to refine them. Results Given some reliable and non overlapping synteny blocks, the core of the method consists in refining the regions that are not contained in them. By aligning each breakpoint sequence against its specific orthologous sequences in the other species, we can look for weak similarities inside the breakpoint, thus extending the synteny blocks and narrowing the breakpoints. The identification of the narrowed breakpoints relies on a segmentation algorithm and is statistically assessed. Since this method requires as input synteny blocks with some properties which, though they appear natural, are not verified by current methods for detecting such blocks, we further give a formal definition and provide an algorithm to compute them. The whole method is applied to delimit breakpoints on the human genome when compared to the mouse and dog genomes. Among the 355 human-mouse and 240 human-dog breakpoints, 168 and 146 respectively span less than 50 Kb. We compared the resulting breakpoints with some publicly available ones and show that we achieve a better resolution. Furthermore, we suggest that breakpoints are rarely reduced to a point, and instead consist in often large regions that can be distinguished from the sequences around in terms of segmental duplications, similarity with related species, and transposable elements. Conclusion Our method leads to smaller

Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

Directory of Open Access Journals (Sweden)

Todd J Treangen

2011-01-01

Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template.

Science.gov (United States)

Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya

2014-01-01

Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

Science.gov (United States)

Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

2016-01-01

The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

Rearrangement of RAG-1 recombinase gene in radiation-sensitive ''wasted'' mice

International Nuclear Information System (INIS)

Woloschak, G.E.; Weaver, P.

1994-01-01

The recent cloning and characterization of recombinase genes (RAG- 1/RAG-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice (wst). Our results revealed expression of RAG-1 mRNA was detected in spinal cord or brain from wst/wst mice or their normal littermates (wst/sm-bullet mice). In thymus tissue, a small RAG-1 transcript was detected in wst/wst mice that was not evident in thymus from control mice. In wst/lg-bullet mice, a two-fold increase in RAG-1 mRNA was evident in thymus tissue. RAG-2 mRNA could only be detected in thymus tissue from wst/sm-bullet and not from wst;/wst or parental control BCF 1 mice. Southern blots revealed a rearrangement/deletion within the RAG-1 gene of affected wasted mice, not evident in known strain-specific parental or littermate controls. These results support the idea that the RAG-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage

Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch.

Directory of Open Access Journals (Sweden)

Raúl A Ortiz-Merino

2017-05-01

Full Text Available Many interspecies hybrids have been discovered in yeasts, but most of these hybrids are asexual and can replicate only mitotically. Whole-genome duplication has been proposed as a mechanism by which interspecies hybrids can regain fertility, restoring their ability to perform meiosis and sporulate. Here, we show that this process occurred naturally during the evolution of Zygosaccharomyces parabailii, an interspecies hybrid that was formed by mating between 2 parents that differed by 7% in genome sequence and by many interchromosomal rearrangements. Surprisingly, Z. parabailii has a full sexual cycle and is genetically haploid. It goes through mating-type switching and autodiploidization, followed by immediate sporulation. We identified the key evolutionary event that enabled Z. parabailii to regain fertility, which was breakage of 1 of the 2 homeologous copies of the mating-type (MAT locus in the hybrid, resulting in a chromosomal rearrangement and irreparable damage to 1 MAT locus. This rearrangement was caused by HO endonuclease, which normally functions in mating-type switching. With 1 copy of MAT inactivated, the interspecies hybrid now behaves as a haploid. Our results provide the first demonstration that MAT locus damage is a naturally occurring evolutionary mechanism for whole-genome duplication and restoration of fertility to interspecies hybrids. The events that occurred in Z. parabailii strongly resemble those postulated to have caused ancient whole-genome duplication in an ancestor of Saccharomyces cerevisiae.

CNV analysis in Tourette syndrome implicates large genomic rearrangements in COL8A1 and NRXN1.

Directory of Open Access Journals (Sweden)

Abhishek Nag

Full Text Available Tourette syndrome (TS is a neuropsychiatric disorder with a strong genetic component. However, the genetic architecture of TS remains uncertain. Copy number variation (CNV has been shown to contribute to the genetic make-up of several neurodevelopmental conditions, including schizophrenia and autism. Here we describe CNV calls using SNP chip genotype data from an initial sample of 210 TS cases and 285 controls ascertained in two Latin American populations. After extensive quality control, we found that cases (N = 179 have a significant excess (P = 0.006 of large CNV (>500 kb calls compared to controls (N = 234. Amongst 24 large CNVs seen only in the cases, we observed four duplications of the COL8A1 gene region. We also found two cases with ∼400 kb deletions involving NRXN1, a gene previously implicated in neurodevelopmental disorders, including TS. Follow-up using multiplex ligation-dependent probe amplification (and including 53 more TS cases validated the CNV calls and identified additional patients with rearrangements in COL8A1 and NRXN1, but none in controls. Examination of available parents indicates that two out of three NRXN1 deletions detected in the TS cases are de-novo mutations. Our results are consistent with the proposal that rare CNVs play a role in TS aetiology and suggest a possible role for rearrangements in the COL8A1 and NRXN1 gene regions.

CNV analysis in Tourette syndrome implicates large genomic rearrangements in COL8A1 and NRXN1.

Science.gov (United States)

Nag, Abhishek; Bochukova, Elena G; Kremeyer, Barbara; Campbell, Desmond D; Muller, Heike; Valencia-Duarte, Ana V; Cardona, Julio; Rivas, Isabel C; Mesa, Sandra C; Cuartas, Mauricio; Garcia, Jharley; Bedoya, Gabriel; Cornejo, William; Herrera, Luis D; Romero, Roxana; Fournier, Eduardo; Reus, Victor I; Lowe, Thomas L; Farooqi, I Sadaf; Mathews, Carol A; McGrath, Lauren M; Yu, Dongmei; Cook, Ed; Wang, Kai; Scharf, Jeremiah M; Pauls, David L; Freimer, Nelson B; Plagnol, Vincent; Ruiz-Linares, Andrés

2013-01-01

Tourette syndrome (TS) is a neuropsychiatric disorder with a strong genetic component. However, the genetic architecture of TS remains uncertain. Copy number variation (CNV) has been shown to contribute to the genetic make-up of several neurodevelopmental conditions, including schizophrenia and autism. Here we describe CNV calls using SNP chip genotype data from an initial sample of 210 TS cases and 285 controls ascertained in two Latin American populations. After extensive quality control, we found that cases (N = 179) have a significant excess (P = 0.006) of large CNV (>500 kb) calls compared to controls (N = 234). Amongst 24 large CNVs seen only in the cases, we observed four duplications of the COL8A1 gene region. We also found two cases with ∼400 kb deletions involving NRXN1, a gene previously implicated in neurodevelopmental disorders, including TS. Follow-up using multiplex ligation-dependent probe amplification (and including 53 more TS cases) validated the CNV calls and identified additional patients with rearrangements in COL8A1 and NRXN1, but none in controls. Examination of available parents indicates that two out of three NRXN1 deletions detected in the TS cases are de-novo mutations. Our results are consistent with the proposal that rare CNVs play a role in TS aetiology and suggest a possible role for rearrangements in the COL8A1 and NRXN1 gene regions.

Analysis of large deletions in BRCA1, BRCA2 and PALB2 genes in Finnish breast and ovarian cancer families

International Nuclear Information System (INIS)

Pylkäs, Katri; Erkko, Hannele; Nikkilä, Jenni; Sólyom, Szilvia; Winqvist, Robert

2008-01-01

BRCA1 and BRCA2 are the two most important genes associated with familial breast and ovarian cancer susceptibility. In addition, PALB2 has recently been identified as a breast cancer susceptibility gene in several populations. Here we have evaluated whether large genomic rearrangement in these genes could explain some of Finnish breast and/or ovarian cancer families. Altogether 61 index patients of Northern Finnish breast and/or ovarian cancer families were analyzed by Multiplex ligation-dependent probe amplification (MLPA) method in order to identify exon deletions and duplications in BRCA1, BRCA2 and PALB2. The families have been comprehensively screened for germline mutation in these genes by conventional methods of mutation analysis and were found negative. We identified one large deletion in BRCA1, deleting the most part of the gene (exon 1A-13) in one family with family history of ovarian cancer. No large genomic rearrangements were identified in either BRCA2 or PALB2. In Finland, women eligible for BRCA1 or BRCA2 mutation screening, when found negative, could benefit from screening for large genomic rearrangements at least in BRCA1. On the contrary, the genomic rearrangements in PALB2 seem not to contribute to the hereditary breast cancer susceptibility

Inverted duplication including Endothelin 3 closely related to dermal hyperpigmentation in Silkie chickens

Directory of Open Access Journals (Sweden)

Ming TIAN,Suyun FANG,Yanqiang WANG,Xiaorong GU,Chungang FENG,Rui HAO,Xiaoxiang HU,Ning LI

2014-06-01

Full Text Available The dermal hyperpigmentation phenotype in chickens is controlled by the dominant fibromelanosis allele. One of the ten unique characteristics of Silkie chickens is the fibromelanosis phenotype, which is pigmentation in the dermal layer of the skin and connective tissue. In this study, we found a mutation of fibromelanosis, a genomic rearrangement that included an inverted duplication of endothelin3 (EDN3, is responsible. We show that, as a stimulator of melanoblast proliferation, EDN3 expression was increased in silkie embryos and in both skin and muscle throughout adulthood. EDN3 expression led to an increase in expression of the downstream genes EDNRB2 and TYRP2, and was closely relate with the hyperpigmentation phenotype. We examined eight different Chinese chicken breeds showing hyperpigmentation and conclude that this structural genetic variant exists in all fibromelanosis chicken breeds.

Genome rearrangements and phylogeny reconstruction in Yersinia pestis.

Science.gov (United States)

Bochkareva, Olga O; Dranenko, Natalia O; Ocheredko, Elena S; Kanevsky, German M; Lozinsky, Yaroslav N; Khalaycheva, Vera A; Artamonova, Irena I; Gelfand, Mikhail S

2018-01-01

Genome rearrangements have played an important role in the evolution of Yersinia pestis from its progenitor Yersinia pseudotuberculosis . Traditional phylogenetic trees for Y. pestis based on sequence comparison have short internal branches and low bootstrap supports as only a small number of nucleotide substitutions have occurred. On the other hand, even a small number of genome rearrangements may resolve topological ambiguities in a phylogenetic tree. We reconstructed phylogenetic trees based on genome rearrangements using several popular approaches such as Maximum likelihood for Gene Order and the Bayesian model of genome rearrangements by inversions. We also reconciled phylogenetic trees for each of the three CRISPR loci to obtain an integrated scenario of the CRISPR cassette evolution. Analysis of contradictions between the obtained evolutionary trees yielded numerous parallel inversions and gain/loss events. Our data indicate that an integrated analysis of sequence-based and inversion-based trees enhances the resolution of phylogenetic reconstruction. In contrast, reconstructions of strain relationships based on solely CRISPR loci may not be reliable, as the history is obscured by large deletions, obliterating the order of spacer gains. Similarly, numerous parallel gene losses preclude reconstruction of phylogeny based on gene content.

Interleukin-1 beta gene deregulation associated with chromosomal rearrangement: A candidate initiating event for murine radiation-myeloid leukemogenesis

International Nuclear Information System (INIS)

Silver, A.; Boultwood, J.; Breckon, G.; Masson, W.; Adam, J.; Shaw, A.R.; Cox, R.

1989-01-01

The incidence of acute myeloid leukemia (AML) in CBA/H mice following exposure to single acute doses of ionizing radiation has previously been determined. A high proportion of these AMLs are characterized by rearrangement of murine chromosome 2 in the C2 and/or E5-F regions, and there is evidence that these events are a direct consequence of radiation damage to multipotential hemopoietic cells. Using a combination of in situ chromosome hybridization and mRNA analyses, we show that the cytokine gene interleukin-1 beta (IL-1 beta) is encoded in the chromosome 2 F region and is translocated in a chromosome 2---2 rearrangement in an x-ray-induced AML (N36). Also, IL-1 beta is specifically deregulated in N36 and in two other chromosome 2-rearranged AMLs but not in a fourth, which has two cytogenetically normal chromosome 2 copies. We suggest that radiation-induced specific chromosome 2 rearrangement associated with IL-1 beta deregulation may initiate murine leukemogenesis through the uncoupling of normal proliferative control mechanisms in multipotential hemopoietic cells

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Directory of Open Access Journals (Sweden)

Muhammad I. Ullah

2017-12-01

Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

Characterization of apparently balanced chromosomal rearrangements from the developmental genome anatomy project.

Science.gov (United States)

Higgins, Anne W; Alkuraya, Fowzan S; Bosco, Amy F; Brown, Kerry K; Bruns, Gail A P; Donovan, Diana J; Eisenman, Robert; Fan, Yanli; Farra, Chantal G; Ferguson, Heather L; Gusella, James F; Harris, David J; Herrick, Steven R; Kelly, Chantal; Kim, Hyung-Goo; Kishikawa, Shotaro; Korf, Bruce R; Kulkarni, Shashikant; Lally, Eric; Leach, Natalia T; Lemyre, Emma; Lewis, Janine; Ligon, Azra H; Lu, Weining; Maas, Richard L; MacDonald, Marcy E; Moore, Steven D P; Peters, Roxanna E; Quade, Bradley J; Quintero-Rivera, Fabiola; Saadi, Irfan; Shen, Yiping; Shendure, Jay; Williamson, Robin E; Morton, Cynthia C

2008-03-01

Apparently balanced chromosomal rearrangements in individuals with major congenital anomalies represent natural experiments of gene disruption and dysregulation. These individuals can be studied to identify novel genes critical in human development and to annotate further the function of known genes. Identification and characterization of these genes is the goal of the Developmental Genome Anatomy Project (DGAP). DGAP is a multidisciplinary effort that leverages the recent advances resulting from the Human Genome Project to increase our understanding of birth defects and the process of human development. Clinically significant phenotypes of individuals enrolled in DGAP are varied and, in most cases, involve multiple organ systems. Study of these individuals' chromosomal rearrangements has resulted in the mapping of 77 breakpoints from 40 chromosomal rearrangements by FISH with BACs and fosmids, array CGH, Southern-blot hybridization, MLPA, RT-PCR, and suppression PCR. Eighteen chromosomal breakpoints have been cloned and sequenced. Unsuspected genomic imbalances and cryptic rearrangements were detected, but less frequently than has been reported previously. Chromosomal rearrangements, both balanced and unbalanced, in individuals with multiple congenital anomalies continue to be a valuable resource for gene discovery and annotation.

A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

Directory of Open Access Journals (Sweden)

V.L. Quadros

2006-07-01

Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

Science.gov (United States)

Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

2010-07-27

The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans

International Nuclear Information System (INIS)

Majerfeld, I.H.; Roper, J.A.

1978-01-01

Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers

PCR-based clonality analysis of B-cell lymphomas in paraffin-embedded tissues: diagnostic value of immunoglobulin kappa and lambda light chain gene rearrangement investigation.

Science.gov (United States)

Amara, Khaled; Trimeche, Mounir; Ziadi, Sonia; Sriha, Badreddine; Mokni, Moncef; Korbi, Sadok

2006-01-01

Polymerase chain reaction (PCR)-based analysis, employed for detecting immunoglobulin heavy chain (IgH) gene rearrangements, has become a diagnostic tool widely used in the investigation of B-cell lymphomas, but the overall sensitivity of these methods does not exceed 80%, notably in germinal center (GC) and post-GC B-cell origin lymphomas. Many PCR strategies devised for detecting immunoglobulin light chain (IgL) gene rearrangements have been developed to enhance the clonality detection rates. However, the feasibility of these methods in routine clinical diagnosis using paraffin-embedded tissues has not yet been investigated sufficiently. We studied a large series of 108 cases of B-cell lymphomas, as well as 20 reactive lymphoid tissues using degenerate primers to amplify immunoglobulin kappa (Igkappa) and lambda (Iglambda) light chain genes. B-cell clonality was further investigated using semi-nested PCR for IgH gene rearrangements. B-cell clonality was detected in 74%, 56.5%, and 43.5% of cases using IgH, Igkappa, and Iglambda PCR, respectively. By combining these methods, the clonality detection rate increased to 93.5%. Only polyclonal patterns were noted in reactive lymphoid samples. We concluded that in addition to the established methods for IgH analysis, a PCR-based approach for IgL gene rearrangements analysis improves the clonality detection rate in over 90% of B-cell lymphoma cases using routine histological specimens with poor preservation of the genomic DNA.

An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

Science.gov (United States)

2012-01-01

Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

Science.gov (United States)

Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

2016-01-01

Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

A 45 X male patient with 7q distal deletion and rearrangement with SRY gene translocation: a case report.

Science.gov (United States)

Bilen, S; Okten, A; Karaguzel, G; Ikbal, M; Aslan, Y

2013-01-01

Here we present a male newborn with multiple congenital anomalies who also has an extremely rare form of testicular disorder of sex development (DSD). His karyotype was 45X, without any mosaicism. SRY gene was positive by polymerase chain reaction (PCR), and rearranged on distal part of the 7th chromosome by fluorescence in situ hybridization (FISH) analysis. SRY, normally located on the Y chromosome, is the most important gene that plays a role in the development of male sex. SRY gen may be translocated onto another chromosome, mostly X chromosome in the XX testicular DSD. On the other hand very few cases of 45 X testicular DSD were published to date. Other clinical manifestations of our patient were compatible with distal 7 q deletion syndrome. To the best of our knowledge this is the first case of 45 X testicular DSD with SRY gene rearranged on the 7th autosomal chromosome.

Germline rearrangements in families with strong family history of glioma and malignant melanoma, colon, and breast cancer

Science.gov (United States)

Andersson, Ulrika; Wibom, Carl; Cederquist, Kristina; Aradottir, Steina; Borg, Åke; Armstrong, Georgina N.; Shete, Sanjay; Lau, Ching C.; Bainbridge, Matthew N.; Claus, Elizabeth B.; Barnholtz-Sloan, Jill; Lai, Rose; Il'yasova, Dora; Houlston, Richard S.; Schildkraut, Joellen; Bernstein, Jonine L.; Olson, Sara H.; Jenkins, Robert B.; Lachance, Daniel H.; Wrensch, Margaret; Davis, Faith G.; Merrell, Ryan; Johansen, Christoffer; Sadetzki, Siegal; Bondy, Melissa L.; Melin, Beatrice S.; Adatto, Phyllis; Morice, Fabian; Payen, Sam; McQuinn, Lacey; McGaha, Rebecca; Guerra, Sandra; Paith, Leslie; Roth, Katherine; Zeng, Dong; Zhang, Hui; Yung, Alfred; Aldape, Kenneth; Gilbert, Mark; Weinberger, Jeffrey; Colman, Howard; Conrad, Charles; de Groot, John; Forman, Arthur; Groves, Morris; Levin, Victor; Loghin, Monica; Puduvalli, Vinay; Sawaya, Raymond; Heimberger, Amy; Lang, Frederick; Levine, Nicholas; Tolentino, Lori; Saunders, Kate; Thach, Thu-Trang; Iacono, Donna Dello; Sloan, Andrew; Gerson, Stanton; Selman, Warren; Bambakidis, Nicholas; Hart, David; Miller, Jonathan; Hoffer, Alan; Cohen, Mark; Rogers, Lisa; Nock, Charles J; Wolinsky, Yingli; Devine, Karen; Fulop, Jordonna; Barrett, Wendi; Shimmel, Kristen; Ostrom, Quinn; Barnett, Gene; Rosenfeld, Steven; Vogelbaum, Michael; Weil, Robert; Ahluwalia, Manmeet; Peereboom, David; Staugaitis, Susan; Schilero, Cathy; Brewer, Cathy; Smolenski, Kathy; McGraw, Mary; Naska, Theresa; Rosenfeld, Steven; Ram, Zvi; Blumenthal, Deborah T.; Bokstein, Felix; Umansky, Felix; Zaaroor, Menashe; Cohen, Avi; Tzuk-Shina, Tzeela; Voldby, Bo; Laursen, René; Andersen, Claus; Brennum, Jannick; Henriksen, Matilde Bille; Marzouk, Maya; Davis, Mary Elizabeth; Boland, Eamon; Smith, Marcel; Eze, Ogechukwu; Way, Mahalia; Lada, Pat; Miedzianowski, Nancy; Frechette, Michelle; Paleologos, Nina; Byström, Gudrun; Svedberg, Eva; Huggert, Sara; Kimdal, Mikael; Sandström, Monica; Brännström, Nikolina; Hayat, Amina; Tihan, Tarik; Zheng, Shichun; Berger, Mitchel; Butowski, Nicholas; Chang, Susan; Clarke, Jennifer; Prados, Michael; Rice, Terri; Sison, Jeannette; Kivett, Valerie; Duo, Xiaoqin; Hansen, Helen; Hsuang, George; Lamela, Rosito; Ramos, Christian; Patoka, Joe; Wagenman, Katherine; Zhou, Mi; Klein, Adam; McGee, Nora; Pfefferle, Jon; Wilson, Callie; Morris, Pagan; Hughes, Mary; Britt-Williams, Marlin; Foft, Jessica; Madsen, Julia; Polony, Csaba; McCarthy, Bridget; Zahora, Candice; Villano, John; Engelhard, Herbert; Borg, Ake; Chanock, Stephen K; Collins, Peter; Elston, Robert; Kleihues, Paul; Kruchko, Carol; Petersen, Gloria; Plon, Sharon; Thompson, Patricia; Johansen, C.; Sadetzki, S.; Melin, B.; Bondy, Melissa L.; Lau, Ching C.; Scheurer, Michael E.; Armstrong, Georgina N.; Liu, Yanhong; Shete, Sanjay; Yu, Robert K.; Aldape, Kenneth D.; Gilbert, Mark R.; Weinberg, Jeffrey; Houlston, Richard S.; Hosking, Fay J.; Robertson, Lindsay; Papaemmanuil, Elli; Claus, Elizabeth B.; Claus, Elizabeth B.; Barnholtz-Sloan, Jill; Sloan, Andrew E.; Barnett, Gene; Devine, Karen; Wolinsky, Yingli; Lai, Rose; McKean-Cowdin, Roberta; Il'yasova, Dora; Schildkraut, Joellen; Sadetzki, Siegal; Yechezkel, Galit Hirsh; Bruchim, Revital Bar-Sade; Aslanov, Lili; Sadetzki, Siegal; Johansen, Christoffer; Kosteljanetz, Michael; Broholm, Helle; Bernstein, Jonine L.; Olson, Sara H.; Schubert, Erica; DeAngelis, Lisa; Jenkins, Robert B.; Yang, Ping; Rynearson, Amanda; Andersson, Ulrika; Wibom, Carl; Henriksson, Roger; Melin, Beatrice S.; Cederquist, Kristina; Aradottir, Steina; Borg, Åke; Merrell, Ryan; Lada, Patricia; Wrensch, Margaret; Wiencke, John; Wiemels, Joe; McCoy, Lucie; McCarthy, Bridget J.; Davis, Faith G.

2014-01-01

Background Although familial susceptibility to glioma is known, the genetic basis for this susceptibility remains unidentified in the majority of glioma-specific families. An alternative approach to identifying such genes is to examine cancer pedigrees, which include glioma as one of several cancer phenotypes, to determine whether common chromosomal modifications might account for the familial aggregation of glioma and other cancers. Methods Germline rearrangements in 146 glioma families (from the Gliogene Consortium; http://www.gliogene.org/) were examined using multiplex ligation-dependent probe amplification. These families all had at least 2 verified glioma cases and a third reported or verified glioma case in the same family or 2 glioma cases in the family with at least one family member affected with melanoma, colon, or breast cancer.The genomic areas covering TP53, CDKN2A, MLH1, and MSH2 were selected because these genes have been previously reported to be associated with cancer pedigrees known to include glioma. Results We detected a single structural rearrangement, a deletion of exons 1-6 in MSH2, in the proband of one family with 3 cases with glioma and one relative with colon cancer. Conclusions Large deletions and duplications are rare events in familial glioma cases, even in families with a strong family history of cancers that may be involved in known cancer syndromes. PMID:24723567

A conserved segmental duplication within ELA.

Science.gov (United States)

Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C

2010-12-01

The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

Combining phylogenetic and syntenic analyses for understanding the evolution of TCP ECE genes in eudicots.

Directory of Open Access Journals (Sweden)

Hélène L Citerne

Full Text Available TCP ECE genes encode transcription factors which have received much attention for their repeated recruitment in the control of floral symmetry in core eudicots, and more recently in monocots. Major duplications of TCP ECE genes have been described in core eudicots, but the evolutionary history of this gene family is unknown in basal eudicots. Reconstructing the phylogeny of ECE genes in basal eudicots will help set a framework for understanding the functional evolution of these genes. TCP ECE genes were sequenced in all major lineages of basal eudicots and Gunnera which belongs to the sister clade to all other core eudicots. We show that in these lineages they have a complex evolutionary history with repeated duplications. We estimate the timing of the two major duplications already identified in the core eudicots within a timeframe before the divergence of Gunnera and after the divergence of Proteales. We also use a synteny-based approach to examine the extent to which the expansion of TCP ECE genes in diverse eudicot lineages may be due to genome-wide duplications. The three major core-eudicot specific clades share a number of collinear genes, and their common evolutionary history may have originated at the γ event. Genomic comparisons in Arabidopsis thaliana and Solanumlycopersicum highlight their separate polyploid origin, with syntenic fragments with and without TCP ECE genes showing differential gene loss and genomic rearrangements. Comparison between recently available genomes from two basal eudicots Aquilegiacoerulea and Nelumbonucifera suggests that the two TCP ECE paralogs in these species are also derived from large-scale duplications. TCP ECE loci from basal eudicots share many features with the three main core eudicot loci, and allow us to infer the makeup of the ancestral eudicot locus.

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

Directory of Open Access Journals (Sweden)

Xiaoli Jin

2017-06-01

Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.

Science.gov (United States)

Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe

2015-11-01

A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

Recurrent reciprocal genomic rearrangements of 17q12 are associated with renal disease, diabetes, and epilepsy.

Science.gov (United States)

Mefford, Heather C; Clauin, Severine; Sharp, Andrew J; Moller, Rikke S; Ullmann, Reinhard; Kapur, Raj; Pinkel, Dan; Cooper, Gregory M; Ventura, Mario; Ropers, H Hilger; Tommerup, Niels; Eichler, Evan E; Bellanne-Chantelot, Christine

2007-11-01

Most studies of genomic disorders have focused on patients with cognitive disability and/or peripheral nervous system defects. In an effort to broaden the phenotypic spectrum of this disease model, we assessed 155 autopsy samples from fetuses with well-defined developmental pathologies in regions predisposed to recurrent rearrangement, by array-based comparative genomic hybridization. We found that 6% of fetal material showed evidence of microdeletion or microduplication, including three independent events that likely resulted from unequal crossing-over between segmental duplications. One of the microdeletions, identified in a fetus with multicystic dysplastic kidneys, encompasses the TCF2 gene on 17q12, previously shown to be mutated in maturity-onset diabetes, as well as in a subset of pediatric renal abnormalities. Fine-scale mapping of the breakpoints in different patient cohorts revealed a recurrent 1.5-Mb de novo deletion in individuals with phenotypes that ranged from congenital renal abnormalities to maturity-onset diabetes of the young type 5. We also identified the reciprocal duplication, which appears to be enriched in samples from patients with epilepsy. We describe the first example of a recurrent genomic disorder associated with diabetes.

An ancient duplication of exon 5 in the Snap25 gene is required for complex neuronal development/function.

Directory of Open Access Journals (Sweden)

Jenny U Johansson

2008-11-01

Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.

Assessing duplication and loss of APETALA1/FRUITFULL homologs in Ranunculales

Science.gov (United States)

Pabón-Mora, Natalia; Hidalgo, Oriane; Gleissberg, Stefan; Litt, Amy

2013-01-01

Gene duplication and loss provide raw material for evolutionary change within organismal lineages as functional diversification of gene copies provide a mechanism for phenotypic variation. Here we focus on the APETALA1/FRUITFULL MADS-box gene lineage evolution. AP1/FUL genes are angiosperm-specific and have undergone several duplications. By far the most significant one is the core-eudicot duplication resulting in the euAP1 and euFUL clades. Functional characterization of several euAP1 and euFUL genes has shown that both function in proper floral meristem identity, and axillary meristem repression. Independently, euAP1 genes function in floral meristem and sepal identity, whereas euFUL genes control phase transition, cauline leaf growth, compound leaf morphogenesis and fruit development. Significant functional variation has been detected in the function of pre-duplication basal-eudicot FUL-like genes, but the underlying mechanisms for change have not been identified. FUL-like genes in the Papaveraceae encode all functions reported for euAP1 and euFUL genes, whereas FUL-like genes in Aquilegia (Ranunculaceae) function in inflorescence development and leaf complexity, but not in flower or fruit development. Here we isolated FUL-like genes across the Ranunculales and used phylogenetic approaches to analyze their evolutionary history. We identified an early duplication resulting in the RanFL1 and RanFL2 clades. RanFL1 genes were present in all the families sampled and are mostly under strong negative selection in the MADS, I and K domains. RanFL2 genes were only identified from Eupteleaceae, Papaveraceae s.l., Menispermaceae and Ranunculaceae and show relaxed purifying selection at the I and K domains. We discuss how asymmetric sequence diversification, new motifs, differences in codon substitutions and likely protein-protein interactions resulting from this Ranunculiid-specific duplication can help explain the functional differences among basal-eudicot FUL-like genes

Antibody-Based Detection of ERG Rearrangement-Positive Prostate Cancer

Directory of Open Access Journals (Sweden)

Kyung Park

2010-07-01

Full Text Available TMPRSS2-ERG gene fusions occur in 50% of prostate cancers and result in the overexpression of a chimeric fusion transcript that encodes a truncated ERG product. Previous attempts to detect truncated ERG products have been hindered by a lack of specific antibodies. Here, we characterize a rabbit anti-ERG monoclonal antibody (clone EPR 3864; Epitomics, Burlingame, CA using immunoblot analysis on prostate cancer cell lines, synthetic TMPRSS2-ERG constructs, chromatin immunoprecipitation, and immunofluorescence. We correlated ERG protein expression with the presence of ERG gene rearrangements in prostate cancertissues using a combined immunohistochemistry(IHC and fluorescence in situ hybridization (FISH analysis. We independently evaluated two patient cohorts and observed ERG expression confined to prostate cancer cells and high-grade prostatic intraepithelial reoplasia associated with ERG-positive cancer, as well as vessels and lymphocytes (where ERG has a known biologic role. Image analysis of 131 cases demonstrated nearly 100% sensitivity for detecting ERG rearrangement prostate cancer, with only 2 (1.5% of 131 cases demonstrating strong ERG protein expression without any known ERG gene fusion. The combired pathology evaluation of 207 patient tumors for ERG protein expression had 95.7% sensitivity and 96.5% specificity for determining ERG rearrangement prostate cancer. Ir conclusion, this study qualifies a specific anti-ERG antibody and demonstrates exquisite association between ERG gene rearrangement and truncated ERG protein product expression. Giver the ease of performing IHC versus FISH, ERG protein expression may be useful for molecularly subtypirg prostate cancer based or ERG rearrangement status and suggests clinical utility it prostate needle biopsy evaluation.

Detection and precise mapping of germline rearrangements in BRCA1, BRCA2, MSH2, and MLH1 using zoom-in array comparative genomic hybridization (aCGH)

DEFF Research Database (Denmark)

Staaf, Johan; Törngren, Therese; Rambech, Eva

2008-01-01

deletions or duplications occurring in BRCA1 (n=11), BRCA2 (n=2), MSH2 (n=7), or MLH1 (n=9). Additionally, we demonstrate its applicability for uncovering complex somatic rearrangements, exemplified by zoom-in analysis of the PTEN and CDKN2A loci in breast cancer cells. The sizes of rearrangements ranged...

Positive selection and ancient duplications in the evolution of class B floral homeotic genes of orchids and grasses

Directory of Open Access Journals (Sweden)

Koch Marcus A

2009-04-01

Full Text Available Abstract Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection

The Sequence and Analysis of Duplication Rich Human Chromosome 16

Science.gov (United States)

Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

2004-01-01

We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

The sequence and analysis of duplication rich human chromosome 16

Energy Technology Data Exchange (ETDEWEB)

Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

2004-08-01

We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

Determination of leukemia-associated gene rearrangements and ultrastructural changes in Chernobyl accident liquidators blood leukocytes long term after radiation exposure

International Nuclear Information System (INIS)

Butenko, Z.A.; Smirnova, I.A.; Yanok, E.A.; Kishinskaya, E.G.; Zak, K.P.; Afanas'eva, V.V.; Mikhajlovskaya, Eh.V.

1997-01-01

The results of ultrastructural and molecular-genetic investigations of blood cells from 120 liquidators 7-10 years after Chernobyl accident with the total exposure radiation doses ranging from 5.1 to 75.0 cGy are presented. Electron microscopic studies revealed marked changes in ultrastructure of neutrophils nuclei - hyper segmentation, whimsical prominences, loops, swelling and destruction of cytoplasmic granules. There was an increase in the number of 'aberrant' forms of lymphocytes with disturbed structure of chromatin, additional nuclei and changed membrane contour. Structural polymorphism of the leukemia associated bcr and ribosomal RNA (rRNA) genes were studied using Southern blot hybridization. Allelic polymorphism of bcr gene with characteristic for chronic myeloid leukemia allele distribution and rearrangements of eRNA genes were detected in 11.5% of accident liquidators. This data point out to structure-functional leucocyte changes and possibility of arising leukemia associated gene rearrangements in blood cells of some liquidators many years after the exposure to radiation and serve for determination of group at risk of oncohematological diseases

Multiple independent structural dynamic events in the evolution of snake mitochondrial genomes.

Science.gov (United States)

Qian, Lifu; Wang, Hui; Yan, Jie; Pan, Tao; Jiang, Shanqun; Rao, Dingqi; Zhang, Baowei

2018-05-10

Mitochondrial DNA sequences have long been used in phylogenetic studies. However, little attention has been paid to the changes in gene arrangement patterns in the snake's mitogenome. Here, we analyzed the complete mitogenome sequences and structures of 65 snake species from 14 families and examined their structural patterns, organization and evolution. Our purpose was to further investigate the evolutionary implications and possible rearrangement mechanisms of the mitogenome within snakes. In total, eleven types of mitochondrial gene arrangement patterns were detected (Type I, II, III, III-A, III-B, III-B1, III-C, III-D, III-E, III-F, III-G), with mitochondrial genome rearrangements being a major trend in snakes, especially in Alethinophidia. In snake mitogenomes, the rearrangements mainly involved three processes, gene loss, translocation and duplication. Within Scolecophidia, the O L was lost several times in Typhlopidae and Leptotyphlopidae, but persisted as a plesiomorphy in the Alethinophidia. Duplication of the control region and translocation of the tRNA Leu gene are two visible features in Alethinophidian mitochondrial genomes. Independently and stochastically, the duplication of pseudo-Pro (P*) emerged in seven different lineages of unequal size in three families, indicating that the presence of P* was a polytopic event in the mitogenome. The WANCY tRNA gene cluster and the control regions and their adjacent segments were hotspots for mitogenome rearrangement. Maintenance of duplicate control regions may be the source for snake mitogenome structural diversity.

Rapid genome reshaping by multiple-gene loss after whole-genome duplication in teleost fish suggested by mathematical modeling

Science.gov (United States)

Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi

2015-01-01

Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810

The Asian Rice Gall Midge (Orseolia oryzae Mitogenome Has Evolved Novel Gene Boundaries and Tandem Repeats That Distinguish Its Biotypes.

Directory of Open Access Journals (Sweden)

Isha Atray

Full Text Available The complete mitochondrial genome of the Asian rice gall midge, Orseolia oryzae (Diptera; Cecidomyiidae was sequenced, annotated and analysed in the present study. The circular genome is 15,286 bp with 13 protein-coding genes, 22 tRNAs and 2 ribosomal RNA genes, and a 578 bp non-coding control region. All protein coding genes used conventional start codons and terminated with a complete stop codon. The genome presented many unusual features: (1 rearrangement in the order of tRNAs as well as protein coding genes; (2 truncation and unusual secondary structures of tRNAs; (3 presence of two different repeat elements in separate non-coding regions; (4 presence of one pseudo-tRNA gene; (5 inversion of the rRNA genes; (6 higher percentage of non-coding regions when compared with other insect mitogenomes. Rearrangements of the tRNAs and protein coding genes are explained on the basis of tandem duplication and random loss model and why intramitochondrial recombination is a better model for explaining rearrangements in the O. oryzae mitochondrial genome is discussed. Furthermore, we evaluated the number of iterations of the tandem repeat elements found in the mitogenome. This led to the identification of genetic markers capable of differentiating rice gall midge biotypes and the two Orseolia species investigated.

Automation of ALK gene rearrangement testing with fluorescence in situ hybridization (FISH): a feasibility study.

Science.gov (United States)

Zwaenepoel, Karen; Merkle, Dennis; Cabillic, Florian; Berg, Erica; Belaud-Rotureau, Marc-Antoine; Grazioli, Vittorio; Herelle, Olga; Hummel, Michael; Le Calve, Michele; Lenze, Dido; Mende, Stefanie; Pauwels, Patrick; Quilichini, Benoit; Repetti, Elena

2015-02-01

In the past several years we have observed a significant increase in our understanding of molecular mechanisms that drive lung cancer. Specifically in the non-small cell lung cancer sub-types, ALK gene rearrangements represent a sub-group of tumors that are targetable by the tyrosine kinase inhibitor Crizotinib, resulting in significant reductions in tumor burden. Phase II and III clinical trials were performed using an ALK break-apart FISH probe kit, making FISH the gold standard for identifying ALK rearrangements in patients. FISH is often considered a labor and cost intensive molecular technique, and in this study we aimed to demonstrate feasibility for automation of ALK FISH testing, to improve laboratory workflow and ease of testing. This involved automation of the pre-treatment steps of the ALK assay using various protocols on the VP 2000 instrument, and facilitating automated scanning of the fluorescent FISH specimens for simplified enumeration on various backend scanning and analysis systems. The results indicated that ALK FISH can be automated. Significantly, both the Ikoniscope and BioView system of automated FISH scanning and analysis systems provided a robust analysis algorithm to define ALK rearrangements. In addition, the BioView system facilitated consultation of difficult cases via the internet. Copyright © 2015 Elsevier Inc. All rights reserved.

A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

NARCIS (Netherlands)

Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

2012-01-01

De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

Rearrangement of RAG-1 recombinase gene in radiation-sensitive ''wasted'' mice

International Nuclear Information System (INIS)

Woloschak, G.E.; Libertin, C.R.; Weaver, P.; Churchill, M.; Chang-Liu, C.M.

1993-01-01

Mice recessive for the autosomal gene ''wasted'' (wst) display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (RAG-1/RAG-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed expression of RAG-1 mRNA in spinal cord (but not brain) of control mice; no expression of RAG-1 mRNA was detected in spinal cord or brain from wst/wst mice or their normal littermates (wst/· mice). In thymus tissue, a small RAG-1 transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/· mice, a two-fold increase in RAG-1 MRNA was evident in thymus tissue. RAG-2 mRNA could only be detected in thymus tissue from wst/· and not from wst/wst or parental control BCF 1 mice. Southern blots revealed a rearrangement/deletion within the RAG-1 gene of affected wasted mice, not evident in known strain-specific parental or littermate controls. These results support the idea that the RAG-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage

Rearrangement of RAG-1 recombinase gene in radiation-sensitive ``wasted`` mice

Energy Technology Data Exchange (ETDEWEB)

Woloschak, G.E. [Argonne National Lab., IL (United States)]|[Loyola Univ., Maywood, IL (United States); Libertin, C.R.; Weaver, P. [Loyola Univ., Maywood, IL (United States); Churchill, M.; Chang-Liu, C.M. [Argonne National Lab., IL (United States)

1993-09-01

Mice recessive for the autosomal gene ``wasted`` (wst) display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (RAG-1/RAG-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed expression of RAG-1 mRNA in spinal cord (but not brain) of control mice; no expression of RAG-1 mRNA was detected in spinal cord or brain from wst/wst mice or their normal littermates (wst/{center_dot} mice). In thymus tissue, a small RAG-1 transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/{center_dot} mice, a two-fold increase in RAG-1 MRNA was evident in thymus tissue. RAG-2 mRNA could only be detected in thymus tissue from wst/{center_dot} and not from wst/wst or parental control BCF{sub 1} mice. Southern blots revealed a rearrangement/deletion within the RAG-1 gene of affected wasted mice, not evident in known strain-specific parental or littermate controls. These results support the idea that the RAG-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

Chromosomal Rainbows detect Oncogenic Rearrangements of Signaling Molecules in Thyroid Tumors

Energy Technology Data Exchange (ETDEWEB)

O' Brien, Benjamin; Jossart, Gregg H.; Ito, Yuko; Greulich-Bode, Karin M.; Weier, Jingly F.; Munne, Santiago; Clark, Orlo H.; Weier, Heinz-Ulrich G.

2010-08-19

Altered signal transduction can be considered a hallmark of many solid tumors. In thyroid cancers the receptor tyrosine kinase (rtk) genes NTRK1 (Online Mendelian Inheritance in Man = OMIM *191315, also known as 'TRKA'), RET ('Rearranged during Transfection protooncogene', OMIM *164761) and MET (OMIM *164860) have been reported as activated, rearranged or overexpressed. In many cases, a combination of cytogenetic and molecular techniques allows elucidation of cellular changes that initiate tumor development and progression. While the mechanisms leading to overexpression of the rtk MET gene remain largely unknown, a variety of chromosomal rearrangements of the RET or NTKR1 gene could be demonstrated in thyroid cancer. Abnormal expressions in these tumors seem to follow a similar pattern: the rearrangement translocates the 3'-end of the rtk gene including the entire catalytic domain to an expressed gene leading to a chimeric RNA and protein with kinase activity. Our research was prompted by an increasing number of reports describing translocations involving ret and previously unknown translocation partners. We developed a high resolution technique based on fluorescence in situ hybridization (FISH) to allow rapid screening for cytogenetic rearrangements which complements conventional chromosome banding analysis. Our technique applies simultaneous hybridization of numerous probes labeled with different reporter molecules which are distributed along the target chromosome allowing the detection of cytogenetic changes at near megabase-pair (Mbp) resolution. Here, we report our results using a probe set specific for human chromosome 10, which is altered in a significant portion of human thyroid cancers (TC's). While rendering accurate information about the cytogenetic location of rearranged elements, our multi-locus, multi-color analysis was developed primarily to overcome limitations of whole chromosome painting (WCP) and chromosome banding

A 15 Mb large paracentric chromosome 21 inversion identified in Czech population through a pair of flanking duplications.

Science.gov (United States)

Drabova, Jana; Trkova, Marie; Hancarova, Miroslava; Novotna, Drahuse; Hejtmankova, Michaela; Havlovicova, Marketa; Sedlacek, Zdenek

2014-01-01

Inversions are balanced structural chromosome rearrangements, which can influence gene expression and the risk of unbalanced chromosome constitution in offspring. Many examples of inversion polymorphisms exist in human, affecting both heterochromatic regions and euchromatin. We describe a novel, 15 Mb long paracentric inversion, inv(21)(q21.1q22.11), affecting more than a third of human 21q. Despite of its length, the inversion cannot be detected using karyotyping due to similar band patterns on the normal and inverted chromosomes, and is therefore likely to escape attention. Its identification was aided by the repeated observation of the same pair of 150 kb long duplications present in cis on chromosome 21 in three Czech families subjected to microarray analysis. The finding prompted us to hypothesise that this co-occurrence of two remote duplications could be associated with an inversion of the intervening segment, and this speculation turned out to be right. The inversion was confirmed in a series of FISH experiments which also showed that the second copy of each of the duplications was always located at the opposite end of the inversion. The presence of the same pair of duplications in additional individuals reported in public databases indicates that the inversion may also be present in other populations. Three out of the total of about 4000 chromosomes 21 examined in our sample carried the duplications and were inverted, corresponding to carrier frequency of about 1/660. Although the breakpoints affect protein-coding genes, the occurrence of the inversion in normal parents and siblings of our patients and the occurrence of the duplications in unaffected controls in databases indicate that this rare variant is rather non-pathogenic. The inverted segment carried an identical shared haplotype in the three families studied. The haplotypes, however, diverged very rapidly in the flanking regions, possibly pointing to an ancient founder event at the origin of the

A complex genomic rearrangement involving the endothelin 3 locus causes dermal hyperpigmentation in the chicken.

Directory of Open Access Journals (Sweden)

Ben Dorshorst

2011-12-01

Full Text Available Dermal hyperpigmentation or Fibromelanosis (FM is one of the few examples of skin pigmentation phenotypes in the chicken, where most other pigmentation variants influence feather color and patterning. The Silkie chicken is the most widespread and well-studied breed displaying this phenotype. The presence of the dominant FM allele results in extensive pigmentation of the dermal layer of skin and the majority of internal connective tissue. Here we identify the causal mutation of FM as an inverted duplication and junction of two genomic regions separated by more than 400 kb in wild-type individuals. One of these duplicated regions contains endothelin 3 (EDN3, a gene with a known role in promoting melanoblast proliferation. We show that EDN3 expression is increased in the developing Silkie embryo during the time in which melanoblasts are migrating, and elevated levels of expression are maintained in the adult skin tissue. We have examined four different chicken breeds from both Asia and Europe displaying dermal hyperpigmentation and conclude that the same structural variant underlies this phenotype in all chicken breeds. This complex genomic rearrangement causing a specific monogenic trait in the chicken illustrates how novel mutations with major phenotypic effects have been reused during breed formation in domestic animals.

Initiation of MLL-rearranged AML is dependent on C/EBPα

DEFF Research Database (Denmark)

Ohlsson, Ewa; Hasemann, Marie Sigurd; Willer, Anton

2014-01-01

have compared gene expression profiles from human MLL-rearranged AML to normal progenitors and identified the myeloid tumor suppressor C/EBPα as a putative collaborator in MLL-rearranged AML. Interestingly, we find that deletion of Cebpa rendered murine hematopoietic progenitors completely resistant...

Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

Directory of Open Access Journals (Sweden)

Erin S Kelleher

2007-08-01

Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

Quantitative and Qualitative Changes in V-J α Rearrangements During Mouse Thymocytes Differentiation

Science.gov (United States)

Pasqual, Nicolas; Gallagher, Maighréad; Aude-Garcia, Catherine; Loiodice, Mélanie; Thuderoz, Florence; Demongeot, Jacques; Ceredig, Rod; Marche, Patrice Noël; Jouvin-Marche, Evelyne

2002-01-01

Knowledge of the complete nucleotide sequence of the mouse TCRAD locus allows an accurate determination V-J rearrangement status. Using multiplex genomic PCR assays and real time PCR analysis, we report a comprehensive and systematic analysis of the V-J recombination of TCR α chain in normal mouse thymocytes during development. These respective qualitative and quantitative approaches give rise to four major points describing the control of gene rearrangements. (a) The V-J recombination pattern is not random during ontogeny and generates a limited TCR α repertoire; (b) V-J rearrangement control is intrinsic to the thymus; (c) each V gene rearranges to a set of contiguous J segments with a gaussian-like frequency; (d) there are more rearrangements involving V genes at the 3′ side than 5′ end of V region. Taken together, this reflects a preferential association of V and J gene segments according to their respective positions in the locus, indicating that accessibility of both V and J regions is coordinately regulated, but in different ways. These results provide a new insight into TCR α repertoire size and suggest a scenario for V usage during differentiation. PMID:12417627

Emergence of a Homo sapiens-specific gene family and chromosome 16p11.2 CNV susceptibility.

Science.gov (United States)

Nuttle, Xander; Giannuzzi, Giuliana; Duyzend, Michael H; Schraiber, Joshua G; Narvaiza, Iñigo; Sudmant, Peter H; Penn, Osnat; Chiatante, Giorgia; Malig, Maika; Huddleston, John; Benner, Chris; Camponeschi, Francesca; Ciofi-Baffoni, Simone; Stessman, Holly A F; Marchetto, Maria C N; Denman, Laura; Harshman, Lana; Baker, Carl; Raja, Archana; Penewit, Kelsi; Janke, Nicolette; Tang, W Joyce; Ventura, Mario; Banci, Lucia; Antonacci, Francesca; Akey, Joshua M; Amemiya, Chris T; Gage, Fred H; Reymond, Alexandre; Eichler, Evan E

2016-08-11

Genetic differences that specify unique aspects of human evolution have typically been identified by comparative analyses between the genomes of humans and closely related primates, including more recently the genomes of archaic hominins. Not all regions of the genome, however, are equally amenable to such study. Recurrent copy number variation (CNV) at chromosome 16p11.2 accounts for approximately 1% of cases of autism and is mediated by a complex set of segmental duplications, many of which arose recently during human evolution. Here we reconstruct the evolutionary history of the locus and identify bolA family member 2 (BOLA2) as a gene duplicated exclusively in Homo sapiens. We estimate that a 95-kilobase-pair segment containing BOLA2 duplicated across the critical region approximately 282 thousand years ago (ka), one of the latest among a series of genomic changes that dramatically restructured the locus during hominid evolution. All humans examined carried one or more copies of the duplication, which nearly fixed early in the human lineage--a pattern unlikely to have arisen so rapidly in the absence of selection (P sapiens-specific duplication. In summary, the duplicative transposition of BOLA2 at the root of the H. sapiens lineage about 282 ka simultaneously increased copy number of a gene associated with iron homeostasis and predisposed our species to recurrent rearrangements associated with disease.

Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

Directory of Open Access Journals (Sweden)

Yue-zhong Li

2017-04-01

Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

DEFF Research Database (Denmark)

Hougs, L; Barington, T; Madsen, HO

1993-01-01

reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...

Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

Czech Academy of Sciences Publication Activity Database

Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman

2014-01-01

Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

Science.gov (United States)

Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

2014-05-01

Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes.

Science.gov (United States)

Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R

2007-01-01

The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat

Heterogeneity of BCR-ABL rearrangement in patients with chronic myeloid leukemia in Pakistan.

Science.gov (United States)

Tabassum, Najia; Saboor, Mohammad; Ghani, Rubina; Moinuddin, Moinuddin

2014-07-01

Breakpoint cluster region-Abelson (BCR-ABL) rearrangement or Philadelphia (Ph) chromosome in Chronic Myeloid Leukemia (CML) is derived from a reciprocal chromosomal translocation between ABL gene on chromosome 9 and BCR gene on chromosome 22. This chimeric protein has various sizes and therefore different clinical behaviour. The purpose of this study was to determine the heterogeneity of BCR-ABL rearrangement in patients with Ph(+)CML in Pakistan. The study was conducted at Civil Hospital and Baqai Institute of Hematology (BIH) Karachi. Blood samples from 25 patients with CML were collected. Multiplex reverse transcription polymerase chain reaction (RT-PCR) was performed to identify various BCR-ABL transcripts. All 25 samples showed BCR-ABL rearrangements. Out of these, 24 (96%) patients expressed p210 BCR-ABL rearrangements i.e. 60% (n=15) had b3a2 and 32% (n=8) had b2a2 rearrangements. Co-expression of b3a2 /b2a2 rearrangement and p190 (e1a3) rearrangement was also identified in two patients. It is apparent that majority of the patients had p210 BCR-ABL rearrangements. Frequency of co-expression and rare fusion transcripts was very low.

Deciphering the Code of the Cancer Genome: Mechanisms of Chromosome Rearrangement

OpenAIRE

Willis, Nicholas A.; Rass, Emilie; Scully, Ralph

2015-01-01

Chromosome rearrangement plays a causal role in tumorigenesis by contributing to the inactivation of tumor suppressor genes, the dysregulated expression or amplification of oncogenes and the generation of novel gene fusions. Chromosome breaks are important intermediates in this process. How, when and where these breaks arise and the specific mechanisms engaged in their repair strongly influence the resulting patterns of chromosome rearrangement. Here, we review recent progress in understandin...

Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

Directory of Open Access Journals (Sweden)

Shuming Zou

Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

The IQD gene family in soybean: structure, phylogeny, evolution and expression.

Directory of Open Access Journals (Sweden)

Lin Feng

Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

Mre11-Sae2 and RPA Collaborate to Prevent Palindromic Gene Amplification.

Science.gov (United States)

Deng, Sarah K; Yin, Yi; Petes, Thomas D; Symington, Lorraine S

2015-11-05

Foldback priming at DNA double-stranded breaks is one mechanism proposed to initiate palindromic gene amplification, a common feature of cancer cells. Here, we show that small (5-9 bp) inverted repeats drive the formation of large palindromic duplications, the major class of chromosomal rearrangements recovered from yeast cells lacking Sae2 or the Mre11 nuclease. RPA dysfunction increased the frequency of palindromic duplications in Sae2 or Mre11 nuclease-deficient cells by ∼ 1,000-fold, consistent with intra-strand annealing to create a hairpin-capped chromosome that is subsequently replicated to form a dicentric isochromosome. The palindromic duplications were frequently associated with duplication of a second chromosome region bounded by a repeated sequence and a telomere, suggesting the dicentric chromosome breaks and repairs by recombination between dispersed repeats to acquire a telomere. We propose secondary structures within single-stranded DNA are potent instigators of genome instability, and RPA and Mre11-Sae2 play important roles in preventing their formation and propagation, respectively. Copyright © 2015 Elsevier Inc. All rights reserved.

RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

Science.gov (United States)

Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

2018-04-24

RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features resembling Coffin-Siris Syndrome.

Science.gov (United States)

Zhu, Jun; Qiu, Jun; Magrane, Gregg; Abedalthagafi, Malak; Zanko, Andrea; Golabi, Mahin; Chehab, Farid F

2012-01-01

We characterized the t(7;22)(q32;q11.2) chromosomal translocation in an obese female with coarse features, short stature, developmental delay and a hypoplastic fifth digit. While these clinical features suggest Coffin-Siris Syndrome (CSS), we excluded a CSS diagnosis by exome sequencing based on the absence of deleterious mutations in six chromatin-remodeling genes recently shown to cause CSS. Thus, molecular characterization of her translocation could delineate genes that underlie other syndromes resembling CSS. Comparative genomic hybridization microarrays revealed on chromosome 7 the duplication of a 434,682 bp region that included the tail end of an uncharacterized gene termed C7orf58 (also called CPED1) and spanned the entire WNT16 and FAM3C genes. Because the translocation breakpoint on chromosome 22 did not disrupt any apparent gene, her disorder was deemed to result from the rearrangement on chromosome 7. Mapping of yeast and bacterial artificial chromosome clones by fluorescent in situ hybridization on chromosome spreads from this patient showed that the duplicated region and all three genes within it were located on both derivative chromosomes 7 and 22. Furthermore, DNA sequencing of exons and splice junctional regions from C7orf58, WNT16 and FAM3C revealed the presence of potential splice site and promoter mutations, thereby augmenting the detrimental effect of the duplicated genes. Hence, dysregulation and/or disruptions of C7orf58, WNT16 and FAM3C underlie the phenotype of this patient, serve as candidate genes for other individuals with similar clinical features and could provide insights into the physiological role of the novel gene C7orf58.

Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22(q32.1;q11.2 chromosomal translocation and clinical features resembling Coffin-Siris Syndrome.

Directory of Open Access Journals (Sweden)

Jun Zhu

Full Text Available We characterized the t(7;22(q32;q11.2 chromosomal translocation in an obese female with coarse features, short stature, developmental delay and a hypoplastic fifth digit. While these clinical features suggest Coffin-Siris Syndrome (CSS, we excluded a CSS diagnosis by exome sequencing based on the absence of deleterious mutations in six chromatin-remodeling genes recently shown to cause CSS. Thus, molecular characterization of her translocation could delineate genes that underlie other syndromes resembling CSS. Comparative genomic hybridization microarrays revealed on chromosome 7 the duplication of a 434,682 bp region that included the tail end of an uncharacterized gene termed C7orf58 (also called CPED1 and spanned the entire WNT16 and FAM3C genes. Because the translocation breakpoint on chromosome 22 did not disrupt any apparent gene, her disorder was deemed to result from the rearrangement on chromosome 7. Mapping of yeast and bacterial artificial chromosome clones by fluorescent in situ hybridization on chromosome spreads from this patient showed that the duplicated region and all three genes within it were located on both derivative chromosomes 7 and 22. Furthermore, DNA sequencing of exons and splice junctional regions from C7orf58, WNT16 and FAM3C revealed the presence of potential splice site and promoter mutations, thereby augmenting the detrimental effect of the duplicated genes. Hence, dysregulation and/or disruptions of C7orf58, WNT16 and FAM3C underlie the phenotype of this patient, serve as candidate genes for other individuals with similar clinical features and could provide insights into the physiological role of the novel gene C7orf58.

Imperfect conformation of experimental and epidemiological data for frequency of RET/РТС gene rearrangements in papillary thyroid carcinoma for the Chernobyl accident

Directory of Open Access Journals (Sweden)

Ushenkova L.N.

2013-12-01

Full Text Available In an overview and analytical study of the epidemiological data on the frequency of RET/РТС gene rearrangements in sporadic and radiogenic (patients after radiotherapy, residents of contaminated after the Chernobyl disaster areas, victims after the atomic bombings, etc. carcinomas of the thyroid gland were examined. In general, the observed epidemiological laws were confirmed in radiobiology experiments by irradiation of different cultures of thyroid cells and ex vivo with the exception of Chernobyl cohorts. Induction of RET/РТС gene rearrangements by 131l exposure in children carcinomas of Chernobyl residents in mice did not observe too. It is concluded that the situation with the frequency of RET/РТС rearrangements in thyroid carcinoma in Chernobyl cohorts once again confirms the multifactorial nature of the induction and development of these tumors with a contribution of radiation and non-radiation factors (iodine deficiency and different stresses.

The duplication 17p13.3 phenotype

DEFF Research Database (Denmark)

Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

2013-01-01

. Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

10p Duplication characterized by fluorescence in situ hybridization

Energy Technology Data Exchange (ETDEWEB)

Wiktor, A.; Feldman, G.L.; Van Dyke, D.L.; Kratkoczki, P.; Ditmars, D.M. Jr. [Henry Ford Hospital, Detroit, MI (United States)

1994-09-01

We describe a patient with severe failure to thrive, mild-moderate developmental delay, cleft lip and palate, and other anomalies. Routine cytogenetic analysis documented a de novo chromosome rearrangement involving chromosome 4, but the origin of the derived material was unknown. Using chromosome specific painting probes, the karyotype was defined as 46,XY,der(4)t(4;10)(q35;p11.23). Characterization of the dup(10p) by fluorescence in situ hybridization (FISH) analysis provides another example of the usefulness of this technology in identifying small deletions, duplications, or supernumerary marker chromosomes. 19 refs., 4 figs.

Rearrangement of Rag-1 recombinase gene in DNA-repair deficient/immunodeficient ``wasted`` mice

Energy Technology Data Exchange (ETDEWEB)

Woloschak, G.E.; Weaver, P.; Churchill, M.; Chang-Liu, C-M. [Argonne National Lab., IL (United States); Libertin, C.R. [Loyola Univ., Maywood, IL (United States)

1992-11-01

Mice recessive for the autosomal gene ``wasted`` (wst) display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (Rag-l/Rag-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed that in thymus tissue, a small Rag-I transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/{sm_bullet} mice, a two-fold increase in Rag-1 mRNA was evident in thymus tissue. Rag-2 mRNA could only be detected in thymus tissue from wst/{sm_bullet} and not from wst/wst or parental control BCF, mice. Southern blots revealed a rearrangement or deletion within the Rag-1 gene of affected wasted mice that was not evident in known strain-specific parental or littermate controls. These results support the idea that the Rag-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

Are duplicated genes responsible for anthracnose resistance in common bean?

Science.gov (United States)

Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

2017-01-01

The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

Evaluation of ALK gene rearrangement in central nervous system metastases of non-small-cell lung cancer using two-step RT-PCR technique.

Science.gov (United States)

Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J

2017-12-01

RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.

De novo 12q22.q23.3 duplication associated with temporal lobe epilepsy.

Science.gov (United States)

Vari, Maria Stella; Traverso, Monica; Bellini, Tommaso; Madia, Francesca; Pinto, Francesca; Minetti, Carlo; Striano, Pasquale; Zara, Federico

2017-08-01

Temporal lobe epilepsy (TLE) is the most common form of focal epilepsy and may be associated with acquired central nervous system lesions or could be genetic. Various susceptibility genes and environmental factors are believed to be involved in the aetiology of TLE, which is considered to be a heterogeneous, polygenic, and complex disorder. Rare point mutations in LGI1, DEPDC5, and RELN as well as some copy number variations (CNVs) have been reported in families with TLE patients. We perform a genetic analysis by Array-CGH in a patient with dysmorphic features and temporal lobe epilepsy. We report a de novo duplication of the long arm of chromosome 12. We confirm that 12q22-q23.3 is a candidate locus for familial temporal lobe epilepsy with febrile seizures and highlight the role of chromosomal rearrangements in patients with epilepsy and intellectual disability. Copyright © 2017 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

Rearrangement of RAG-1 recombinase gene in DNA-repair deficient ``wasted`` mice

Energy Technology Data Exchange (ETDEWEB)

Woloschak, G.E.; Libertin, C.R.; Weaver, P. [Loyola Univ., Chicago, IL (United States); Churchill, M.; Chang-Liu, C.M. [Argonne National Lab., IL (United States)

1993-11-01

Mice recessive for the autosomal gene ``wasted`` wst display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (RAG-l/RAG-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed expression of RAG-1 mRNA in spinal cord (but not brain) of control mice; no expression of RAG-1 mRNA was detected in spinal cord or brain from wst/wst mice or their normal littermates (wst/{center_dot}mice). In thymus tissue, a small RAG-1 transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/{center_dot}mice, a two-fold increase in RAG-1 mRNA was evident in thymus tissue. RAG-2 mRNA could only be detected in thymus tissue from wst/{center_dot} and not from wst/wst or parental control BCF{sub 1} mice. Southern blots revealed a rearrangement/deletion within the RAG-1 gene of affected wasted mice, not evident in known strain-specific parental or littermate controls. These results support the idea that the RAG-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

Science.gov (United States)

Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

2017-09-11

The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

DNA rearrangement in human follicular lymphoma can involve the 5' or the 3' region of the bcl-2 gene

International Nuclear Information System (INIS)

Tsujimoto, Y.; Bashir, M.M.; Givol, I.; Cossman, J.; Jaffe, E.; Croce, C.M.

1987-01-01

In most human lymphomas, the chromosome translocation t(14;18) occurs within two breakpoint clustering regions on chromosome 18, the major one at the 3' untranslated region of the bcl-2 gene and the minor one at 3' of the gene. Analysis of a panel of follicular lymphoma DNAs using probes for the first exon of the bcl-2 gene indicates that DNA rearrangements may also occur 5' to the involved bcl-2 gene. In this case the IgH locus and the bcl-2 gene are found in an order suggesting that an inversion also occurred during the translocation process. The coding region of the bcl-2 gene, however, are left intact in all cases of follicular lymphoma studied to date

Array-CGH in patients with Kabuki-like phenotype: identification of two patients with complex rearrangements including 2q37 deletions and no other recurrent aberration.

Science.gov (United States)

Cuscó, Ivon; del Campo, Miguel; Vilardell, Mireia; González, Eva; Gener, Blanca; Galán, Enrique; Toledo, Laura; Pérez-Jurado, Luis A

2008-04-11

Kabuki syndrome (KS) is a multiple congenital anomaly syndrome characterized by specific facial features, mild to moderate mental retardation, postnatal growth delay, skeletal abnormalities, and unusual dermatoglyphic patterns with prominent fingertip pads. A 3.5 Mb duplication at 8p23.1-p22 was once reported as a specific alteration in KS but has not been confirmed in other patients. The molecular basis of KS remains unknown. We have studied 16 Spanish patients with a clinical diagnosis of KS or KS-like to search for genomic imbalances using genome-wide array technologies. All putative rearrangements were confirmed by FISH, microsatellite markers and/or MLPA assays, which also determined whether the imbalance was de novo or inherited. No duplication at 8p23.1-p22 was observed in our patients. We detected complex rearrangements involving 2q in two patients with Kabuki-like features: 1) a de novo inverted duplication of 11 Mb with a 4.5 Mb terminal deletion, and 2) a de novo 7.2 Mb-terminal deletion in a patient with an additional de novo 0.5 Mb interstitial deletion in 16p. Additional copy number variations (CNV), either inherited or reported in normal controls, were identified and interpreted as polymorphic variants. No specific CNV was significantly increased in the KS group. Our results further confirmed that genomic duplications of 8p23 region are not a common cause of KS and failed to detect other recurrent rearrangement causing this disorder. The detection of two patients with 2q37 deletions suggests that there is a phenotypic overlap between the two conditions, and screening this region in the Kabuki-like patients should be considered.

Detection of SYT and EWS gene rearrangements by dual-color break-apart CISH in liquid-based cytology samples of synovial sarcoma and Ewing sarcoma/primitive neuroectodermal tumor.

Science.gov (United States)

Kumagai, Arisa; Motoi, Toru; Tsuji, Kaori; Imamura, Tetsuo; Fukusato, Toshio

2010-08-01

To improve cytologic diagnostic accuracy for translocation-associated sarcomas, we explored dual-color break-apart (dc) chromogenic in situ hybridization (CISH) on liquid-based cytology (LBC) samples of 2 prototypic sarcomas: synovial sarcoma (SS) and Ewing sarcoma/primitive neuroectodermal tumor (ES/PNET). LBC samples of 10 cases of SS and 9 cases of ES/PNET were subjected to dc-CISH using probes for the specifically rearranged genes in each tumor entity: SYT in SS and EWS in ES/PNET. Rearranged SYT was successfully detected in all SSs but not in any ES/PNETs. In contrast, EWS rearrangement was identified in all ES/PNETs but not in any SSs. These results were validated by dc-fluorescence in situ hybridization and reverse transcription-polymerase chain reaction. dc-CISH on LBC samples is a reliable modality to detect gene rearrangements in sarcomas. This system has a clear advantage over other methods, enabling simultaneous visualization of the genetic abnormality and well-preserved, nonoverlapping cytomorphologic features with clear background under bright-field microscope.

Rearrangements of genes for the antigen receptor on T cells as markers of lineage and clonality in human lymphoid neoplasms.

Science.gov (United States)

Waldmann, T A; Davis, M M; Bongiovanni, K F; Korsmeyer, S J

1985-09-26

The T alpha and T beta chains of the heterodimeric T-lymphocyte antigen receptor are encoded by separated DNA segments that recombine during T-cell development. We have used rearrangements of the T beta gene as a widely applicable marker of clonality in the T-cell lineage. We show that the T beta genes are used in both the T8 and T4 subpopulations of normal T cells and that Sézary leukemia, adult T-cell leukemia, and the non-B-lineage acute lymphoblastic leukemias are clonal expansions of T cells. Furthermore, circulating T cells from a patient with the T8-cell-predominantly lymphocytosis associated with granulocytopenia are shown to be monoclonal. Finally, the sensitivity and specificity of this tumor-associated marker have been exploited to monitor the therapy of a patient with adult T-cell leukemia. These unique DNA rearrangements provide insights into the cellular origin, clonality, and natural history of T-cell neoplasia.

Conditional genomic rearrangement by designed meiotic recombination using VDE (PI-SceI) in yeast.

Science.gov (United States)

Fukuda, Tomoyuki; Ohya, Yoshikazu; Ohta, Kunihiro

2007-10-01

Meiotic recombination plays critical roles in the acquisition of genetic diversity and has been utilized for conventional breeding of livestock and crops. The frequency of meiotic recombination is normally low, and is extremely low in regions called "recombination cold domains". Here, we describe a new and highly efficient method to modulate yeast meiotic gene rearrangements using VDE (PI-SceI), an intein-encoded endonuclease that causes an efficient unidirectional meiotic gene conversion at its recognition sequence (VRS). We designed universal targeting vectors, by use of which the strain that inserts the VRS at a desired site is acquired. Meiotic induction of the strains provided unidirectional gene conversions and frequent genetic rearrangements of flanking genes with little impact on cell viability. This system thus opens the way for the designed modulation of meiotic gene rearrangements, regardless of recombinational activity of chromosomal domains. Finally, the VDE-VRS system enabled us to conduct meiosis-specific conditional knockout of genes where VDE-initiated gene conversion disrupts the target gene during meiosis, serving as a novel approach to examine the functions of genes during germination of resultant spores.

Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

Science.gov (United States)

Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

2015-02-15

WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

Consecutive analysis of mutation spectrum in the dystrophin gene of 507 Korean boys with Duchenne/Becker muscular dystrophy in a single center.

Science.gov (United States)

Cho, Anna; Seong, Moon-Woo; Lim, Byung Chan; Lee, Hwa Jeen; Byeon, Jung Hye; Kim, Seung Soo; Kim, Soo Yeon; Choi, Sun Ah; Wong, Ai-Lynn; Lee, Jeongho; Kim, Jon Soo; Ryu, Hye Won; Lee, Jin Sook; Kim, Hunmin; Hwang, Hee; Choi, Ji Eun; Kim, Ki Joong; Hwang, Young Seung; Hong, Ki Ho; Park, Seungman; Cho, Sung Im; Lee, Seung Jun; Park, Hyunwoong; Seo, Soo Hyun; Park, Sung Sup; Chae, Jong Hee

2017-05-01

Duchenne and Becker muscular dystrophies (DMD and BMD) are allelic X-linked recessive muscle diseases caused by mutations in the large and complex dystrophin gene. We analyzed the dystrophin gene in 507 Korean DMD/BMD patients by multiple ligation-dependent probe amplification and direct sequencing. Overall, 117 different deletions, 48 duplications, and 90 pathogenic sequence variations, including 30 novel variations, were identified. Deletions and duplications accounted for 65.4% and 13.3% of Korean dystrophinopathy, respectively, suggesting that the incidence of large rearrangements in dystrophin is similar among different ethnic groups. We also detected sequence variations in >100 probands. The small variations were dispersed across the whole gene, and 12.3% were nonsense mutations. Precise genetic characterization in patients with DMD/BMD is timely and important for implementing nationwide registration systems and future molecular therapeutic trials in Korea and globally. Muscle Nerve 55: 727-734, 2017. © 2016 Wiley Periodicals, Inc.

Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

Science.gov (United States)

Tornow, J; Santangelo, G M

1994-06-01

A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

Nearly complete mitogenome of hairy sawfly, Corynis lateralis (Brullé, 1832) (Hymenoptera: Cimbicidae): rearrangements in the IQM and ARNS1EF gene clusters.

Science.gov (United States)

Doğan, Özgül; Korkmaz, E Mahir

2017-10-01

The Cimbicidae is a small family of the primitive and relatively less diverse suborder Symphyta (Hymenoptera). Here, nearly complete mitochondrial genome (mitogenome) of hairy sawfly, Corynis lateralis (Hymenoptera: Cimbicidae) was sequenced using next generation sequencing and comparatively analysed with the mitogenome of Trichiosoma anthracinum. The sequenced length of C. lateralis mitogenome was 14,899 bp with an A+T content of 80.60%. All protein coding genes (PCGs) are initiated by ATN codons and all are terminated with TAR or T- stop codon. All tRNA genes preferred usual anticodons. Compared with the inferred insect ancestral mitogenome, two tRNA rearrangements were observed in the IQM and ARNS1EF gene clusters, representing a new event not previously reported in Symphyta. An illicit priming of replication and/or intra/inter-mitochondrial recombination and TDRL seem to be responsible mechanisms for the rearrangement events in these gene clusters. Phylogenetic analyses confirmed the position of Corynis within Cimbicidae and recovered a relationship of Tenthredinoidea + (Cephoidea + Orussoidea) in Symphyta.

Duplication of the dystroglycan gene in most branches of teleost fish

Directory of Open Access Journals (Sweden)

Giardina Bruno

2007-05-01

Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

MLL duplication in a pediatric patient with B-cell lymphoblastic lymphoma.

Science.gov (United States)

Mater, David Van; Goodman, Barbara K; Wang, Endi; Gaca, Ana M; Wechsler, Daniel S

2012-04-01

Lymphoblastic lymphoma is the second most common type of non-Hodgkin lymphoma seen in children. Approximately, 90% of lymphoblastic lymphomas arise from T cells, with the remaining 10% being B-cell-lineage derived. Although T-cell lymphoblastic lymphoma most frequently occurs in the anterior mediastinum (thymus), B-cell lymphoblastic lymphoma (B-LBL) predominates in extranodal sites such as skin and bone. Here, we describe a pediatric B-LBL patient who presented with extensive abdominal involvement and whose lymphoma cells displayed segmental duplication of the mixed lineage leukemia (MLL) gene. MLL duplication/amplification has been described primarily in acute myeloid leukemia and myelodysplastic syndrome with no published reports of discrete MLL duplication/amplification events in B-LBL. The MLL gene duplication noted in this case may represent a novel mechanism for tumorigenesis in B-LBL.

A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

Directory of Open Access Journals (Sweden)

Bertram Brenig

Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

NARCIS (Netherlands)

Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

Analysis of high-identity segmental duplications in the grapevine genome

Directory of Open Access Journals (Sweden)

Carelli Francesco N

2011-08-01

Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.

Digging deeper: new gene order rearrangements and distinct patterns of codons usage in mitochondrial genomes among shrimps from the Axiidea, Gebiidea and Caridea (Crustacea: Decapoda

Directory of Open Access Journals (Sweden)

Mun Hua Tan

2017-03-01

Full Text Available Background Whole mitochondrial DNA is being increasingly utilized for comparative genomic and phylogenetic studies at deep and shallow evolutionary levels for a range of taxonomic groups. Although mitogenome sequences are deposited at an increasing rate into public databases, their taxonomic representation is unequal across major taxonomic groups. In the case of decapod crustaceans, several infraorders, including Axiidea (ghost shrimps, sponge shrimps, and mud lobsters and Caridea (true shrimps are still under-represented, limiting comprehensive phylogenetic studies that utilize mitogenomic information. Methods Sequence reads from partial genome scans were generated using the Illumina MiSeq platform and mitogenome sequences were assembled from these low coverage reads. In addition to examining phylogenetic relationships within the three infraorders, Axiidea, Gebiidea, and Caridea, we also investigated the diversity and frequency of codon usage bias and mitogenome gene order rearrangements. Results We present new mitogenome sequences for five shrimp species from Australia that includes two ghost shrimps, Callianassa ceramica and Trypaea australiensis, along with three caridean shrimps, Macrobrachium bullatum, Alpheus lobidens, and Caridina cf. nilotica. Strong differences in codon usage were discovered among the three infraorders and significant gene order rearrangements were observed. While the gene order rearrangements are congruent with the inferred phylogenetic relationships and consistent with taxonomic classification, they are unevenly distributed within and among the three infraorders. Discussion Our findings suggest potential for mitogenome rearrangements to be useful phylogenetic markers for decapod crustaceans and at the same time raise important questions concerning the drivers of mitogenome evolution in different decapod crustacean lineages.

Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

Directory of Open Access Journals (Sweden)

Giao Ngoc Nguyen

2017-08-01

Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: a novel genotype with a 72 nucleotide G gene duplication.

Directory of Open Access Journals (Sweden)

Alireza Eshaghi

Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.

The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

Directory of Open Access Journals (Sweden)

Haendler Bernard

2008-12-01

Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

NARCIS (Netherlands)

Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

2013-01-01

Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

Environmental and chemotherapeutic agents induce breakage at genes involved in leukemia-causing gene rearrangements in human hematopoietic stem/progenitor cells

Energy Technology Data Exchange (ETDEWEB)

Thys, Ryan G., E-mail: rthys@wakehealth.edu [Department of Cancer Biology, Wake Forest School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157-1016 (United States); Lehman, Christine E., E-mail: clehman@wakehealth.edu [Department of Cancer Biology, Wake Forest School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157-1016 (United States); Pierce, Levi C.T., E-mail: Levipierce@gmail.com [Human Longevity, Inc., San Diego, California 92121 (United States); Wang, Yuh-Hwa, E-mail: yw4b@virginia.edu [Department of Biochemistry and Molecular Genetics, University of Virginia, 1340 Jefferson Park Avenue, Charlottesville, VA 22908-0733 (United States)

2015-09-15

Highlights: • Environmental/chemotherapeutic agents cause DNA breakage in MLL and CBFB in HSPCs. • Diethylnitrosamine-induced DNA breakage at MLL and CBFB shown for the first time. • Chemical-induced DNA breakage occurs at topoisomerase II cleavage sites. • Chemical-induced DNA breaks display a pattern similar to those in leukemia patients. • Long-term exposures suggested to generate DNA breakage at leukemia-related genes. - Abstract: Hematopoietic stem and progenitor cells (HSPCs) give rise to all of the cells that make up the hematopoietic system in the human body, making their stability and resilience especially important. Damage to these cells can severely impact cell development and has the potential to cause diseases, such as leukemia. Leukemia-causing chromosomal rearrangements have largely been studied in the context of radiation exposure and are formed by a multi-step process, including an initial DNA breakage and fusion of the free DNA ends. However, the mechanism for DNA breakage in patients without previous radiation exposure is unclear. Here, we investigate the role of non-cytotoxic levels of environmental factors, benzene, and diethylnitrosamine (DEN), and chemotherapeutic agents, etoposide, and doxorubicin, in generating DNA breakage at the patient breakpoint hotspots of the MLL and CBFB genes in human HSPCs. These conditions represent exposure to chemicals encountered daily or residual doses from chemotherapeutic drugs. Exposure of HSPCs to non-cytotoxic levels of environmental chemicals or chemotherapeutic agents causes DNA breakage at preferential sites in the human genome, including the leukemia-related genes MLL and CBFB. Though benzene, etoposide, and doxorubicin have previously been linked to leukemia formation, this is the first study to demonstrate a role for DEN in the generation of DNA breakage at leukemia-specific sites. These chemical-induced DNA breakpoints coincide with sites of predicted topoisomerase II cleavage. The

Environmental and chemotherapeutic agents induce breakage at genes involved in leukemia-causing gene rearrangements in human hematopoietic stem/progenitor cells

International Nuclear Information System (INIS)

Thys, Ryan G.; Lehman, Christine E.; Pierce, Levi C.T.; Wang, Yuh-Hwa

2015-01-01

Highlights: • Environmental/chemotherapeutic agents cause DNA breakage in MLL and CBFB in HSPCs. • Diethylnitrosamine-induced DNA breakage at MLL and CBFB shown for the first time. • Chemical-induced DNA breakage occurs at topoisomerase II cleavage sites. • Chemical-induced DNA breaks display a pattern similar to those in leukemia patients. • Long-term exposures suggested to generate DNA breakage at leukemia-related genes. - Abstract: Hematopoietic stem and progenitor cells (HSPCs) give rise to all of the cells that make up the hematopoietic system in the human body, making their stability and resilience especially important. Damage to these cells can severely impact cell development and has the potential to cause diseases, such as leukemia. Leukemia-causing chromosomal rearrangements have largely been studied in the context of radiation exposure and are formed by a multi-step process, including an initial DNA breakage and fusion of the free DNA ends. However, the mechanism for DNA breakage in patients without previous radiation exposure is unclear. Here, we investigate the role of non-cytotoxic levels of environmental factors, benzene, and diethylnitrosamine (DEN), and chemotherapeutic agents, etoposide, and doxorubicin, in generating DNA breakage at the patient breakpoint hotspots of the MLL and CBFB genes in human HSPCs. These conditions represent exposure to chemicals encountered daily or residual doses from chemotherapeutic drugs. Exposure of HSPCs to non-cytotoxic levels of environmental chemicals or chemotherapeutic agents causes DNA breakage at preferential sites in the human genome, including the leukemia-related genes MLL and CBFB. Though benzene, etoposide, and doxorubicin have previously been linked to leukemia formation, this is the first study to demonstrate a role for DEN in the generation of DNA breakage at leukemia-specific sites. These chemical-induced DNA breakpoints coincide with sites of predicted topoisomerase II cleavage. The

SHOX gene defects and selected dysmorphic signs in patients of idiopathic short stature and Léri-Weill dyschondrosteosis.

Science.gov (United States)

Hirschfeldova, K; Solc, R; Baxova, A; Zapletalova, J; Kebrdlova, V; Gaillyova, R; Prasilova, S; Soukalova, J; Mihalova, R; Lnenicka, P; Florianova, M; Stekrova, J

2012-01-10

The aim of the study was to analyze frequency of SHOX gene defects and selected dysmorphic signs in patients of both idiopathic short stature (ISS) and Léri-Weill dyschondrosteosis (LWD), all derived from the Czech population. Overall, 98 subjects were analyzed in the study. Inclusion criteria were the presence of short stature (-2.0 SD), in combination with at least one of the selected dysmorphic signs for the ISS+ group; and the presence of Madelung deformity, without positive karyotyping for the LWD+ group. Each proband was analyzed by use of P018 MLPA kit, which covers SHOX and its regulatory sequences. Additionally, mutational analysis was done of the coding portions of the SHOX. Both extent and breakpoint localizations in the deletions/duplications found were quite variable. Some PAR1 rearrangements were detected, without obvious phenotypic association. In the ISS+ group, MLPA analysis detected four PAR1 deletions associated with a SHOX gene defect, PAR1 duplication with an ambiguous effect, and two SHOX mutations (13.7%). In the LWD+ group, MLPA analysis detected nine deletions in PAR1 region, with a deleterious effect on SHOX, first reported case of isolated SHOX enhancer duplication, and SHOX mutation (68.8%). In both ISS+ and LWD+ groups were positivity associated with a disproportionately short stature; in the ISS+ group, in combination with muscular hypertrophy. It seems that small PAR1 rearrangements might be quite frequent in the population. Our study suggests disproportionateness, especially in combination with muscular hypertrophy, as relevant indicators of ISS to be the effect of SHOX defect. Copyright © 2011 Elsevier B.V. All rights reserved.

Recurrent DNA inversion rearrangements in the human genome

DEFF Research Database (Denmark)

Flores, Margarita; Morales, Lucía; Gonzaga-Jauregui, Claudia

2007-01-01

Several lines of evidence suggest that reiterated sequences in the human genome are targets for nonallelic homologous recombination (NAHR), which facilitates genomic rearrangements. We have used a PCR-based approach to identify breakpoint regions of rearranged structures in the human genome...... to human genomic variation is discussed........ In particular, we have identified intrachromosomal identical repeats that are located in reverse orientation, which may lead to chromosomal inversions. A bioinformatic workflow pathway to select appropriate regions for analysis was developed. Three such regions overlapping with known human genes, located...

Enteric and rectal duplications and duplication cysts in the adult.

Science.gov (United States)

Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin

2005-03-01

Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

Mapping 22q11.2 Gene Dosage Effects on Brain Morphometry.

Science.gov (United States)

Lin, Amy; Ching, Christopher R K; Vajdi, Ariana; Sun, Daqiang; Jonas, Rachel K; Jalbrzikowski, Maria; Kushan-Wells, Leila; Pacheco Hansen, Laura; Krikorian, Emma; Gutman, Boris; Dokoru, Deepika; Helleman, Gerhard; Thompson, Paul M; Bearden, Carrie E

2017-06-28

Reciprocal chromosomal rearrangements at the 22q11.2 locus are associated with elevated risk of neurodevelopmental disorders. The 22q11.2 deletion confers the highest known genetic risk for schizophrenia, but a duplication in the same region is strongly associated with autism and is less common in schizophrenia cases than in the general population. Here we conducted the first study of 22q11.2 gene dosage effects on brain structure in a sample of 143 human subjects: 66 with 22q11.2 deletions (22q-del; 32 males), 21 with 22q11.2 duplications (22q-dup; 14 males), and 56 age- and sex-matched controls (31 males). 22q11.2 gene dosage varied positively with intracranial volume, gray and white matter volume, and cortical surface area (deletion control > duplication). Widespread differences were observed for cortical surface area with more localized effects on cortical thickness. These diametric patterns extended into subcortical regions: 22q-dup carriers had a significantly larger right hippocampus, on average, but lower right caudate and corpus callosum volume, relative to 22q-del carriers. Novel subcortical shape analysis revealed greater radial distance (thickness) of the right amygdala and left thalamus, and localized increases and decreases in subregions of the caudate, putamen, and hippocampus in 22q-dup relative to 22q-del carriers. This study provides the first evidence that 22q11.2 is a genomic region associated with gene-dose-dependent brain phenotypes. Pervasive effects on cortical surface area imply that this copy number variant affects brain structure early in the course of development. SIGNIFICANCE STATEMENT Probing naturally occurring reciprocal copy number variation in the genome may help us understand mechanisms underlying deviations from typical brain and cognitive development. The 22q11.2 genomic region is particularly susceptible to chromosomal rearrangements and contains many genes crucial for neuronal development and migration. Not surprisingly

Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

International Nuclear Information System (INIS)

Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

2006-01-01

The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

A molecularly defined duplication set for the X chromosome of Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.; Schulze, Karen L.; Park, Soo; Carlson, Joseph W.; Hoskins, Roger A.; Bellen, Hugo J.; Kaufman, Thomas C.

2010-07-22

We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

4p16.1-p15.31 duplication and 4p terminal deletion in a 3-years old Chinese girl: Array-CGH, genotype-phenotype and neurological characterization.

Science.gov (United States)

Piccione, Maria; Salzano, Emanuela; Vecchio, Davide; Ferrara, Dante; Malacarne, Michela; Pierluigi, Mauro; Ferrara, Ines; Corsello, Giovanni

2015-07-01

Microscopically chromosome rearrangements of the short arm of chromosome 4 include the two known clinical entities: partial trisomy 4p and deletions of the Wolf-Hirschhorn critical regions 1 and 2 (WHSCR-1 and WHSCR-2, respectively), which cause cranio-facial anomalies, congenital malformations and developmental delay/intellectual disability. We report on clinical findings detected in a Chinese patient with a de novo 4p16.1-p15.32 duplication in association with a subtle 4p terminal deletion of 6 Mb in size. This unusual chromosome imbalance resulted in WHS classical phenotype, while clinical manifestations of 4p trisomy were practically absent. This observation suggests the hypothesis that haploinsufficiency of sensitive dosage genes with regulatory function placed in WHS critical region, is more pathogenic than concomitant 4p duplicated segment. Additionally clinical findings in our patient confirm a variable penetrance of major malformations and neurological features in Chinese children despite of WHS critical region's deletion. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

Directory of Open Access Journals (Sweden)

Tran Lan T

2012-08-01

Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

Programmed Rearrangement in Ciliates: Paramecium.

Science.gov (United States)

Betermier, Mireille; Duharcourt, Sandra

2014-12-01

Programmed genome rearrangements in the ciliate Paramecium provide a nice illustration of the impact of transposons on genome evolution and plasticity. During the sexual cycle, development of the somatic macronucleus involves elimination of ∼30% of the germline genome, including repeated DNA (e.g., transposons) and ∼45,000 single-copy internal eliminated sequences (IES). IES excision is a precise cut-and-close process, in which double-stranded DNA cleavage at IES ends depends on PiggyMac, a domesticated piggyBac transposase. Genome-wide analysis has revealed that at least a fraction of IESs originate from Tc/mariner transposons unrelated to piggyBac. Moreover, genomic sequences with no transposon origin, such as gene promoters, can be excised reproducibly as IESs, indicating that genome rearrangements contribute to the control of gene expression. How the system has evolved to allow elimination of DNA sequences with no recognizable conserved motif has been the subject of extensive research during the past two decades. Increasing evidence has accumulated for the participation of noncoding RNAs in epigenetic control of elimination for a subset of IESs, and in trans-generational inheritance of alternative rearrangement patterns. This chapter summarizes our current knowledge of the structure of the germline and somatic genomes for the model species Paramecium tetraurelia, and describes the DNA cleavage and repair factors that constitute the IES excision machinery. We present an overview of the role of specialized RNA interference machineries and their associated noncoding RNAs in the control of DNA elimination. Finally, we discuss how RNA-dependent modification and/or remodeling of chromatin may guide PiggyMac to its cognate cleavage sites.

Rearrangement of Rag-1 recombinase gene in DNA-repair deficient/immunodeficient wasted'' mice

Energy Technology Data Exchange (ETDEWEB)

Woloschak, G.E.; Weaver, P.; Churchill, M.; Chang-Liu, C-M. (Argonne National Lab., IL (United States)); Libertin, C.R. (Loyola Univ., Maywood, IL (United States))

1992-01-01

Mice recessive for the autosomal gene wasted'' (wst) display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (Rag-l/Rag-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed that in thymus tissue, a small Rag-I transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/[sm bullet] mice, a two-fold increase in Rag-1 mRNA was evident in thymus tissue. Rag-2 mRNA could only be detected in thymus tissue from wst/[sm bullet] and not from wst/wst or parental control BCF, mice. Southern blots revealed a rearrangement or deletion within the Rag-1 gene of affected wasted mice that was not evident in known strain-specific parental or littermate controls. These results support the idea that the Rag-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae).

Science.gov (United States)

Zevering, C E; Moritz, C; Heideman, A; Sturm, R A

1991-11-01

Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.

External cystic rectal duplication: an unusual presentation of rectal duplication cyst.

Science.gov (United States)

Karaman, I; Karaman, A; Arda, N; Cakmak, O

2007-11-01

Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

Clinical and cytogenetic features of a population-based consecutive series of 285 pediatric T-cell acute lymphoblastic leukemias: rare T-cell receptor gene rearrangements are associated with poor outcome

DEFF Research Database (Denmark)

Karrman, Kristina; Forestier, Erik; Heyman, Mats

2009-01-01

-cell receptor (TCR) gene rearrangements (20%) [TCR;11p13 (10%), TCR;10q24 (3%), TCR;other (8%)], del(9p) (17%), +8 (14%), del(6q) (12%), and 11q23 rearrangements (6%). The TCR;other group comprised the rare rearrangements t(X;14)(p11;q11), t(X;7)(q22;q34), t(1;14)(p32;q11), ins(14;5)(q11;q?q?), inv(7)(p15q34....... In a multivariate analysis, two factors affected negatively the EFS, namely a WBC count of > or =200 x 10(9)/l (P rearrangements (P = 0.001). In conclusion, in this large series of childhood T-ALLs from the Nordic countries, the cytogenetic findings were not associated...

DNA rearrangements from γ-irradiated normal human fibroblasts preferentially occur in transcribed regions of the genome

International Nuclear Information System (INIS)

Forrester, H.B.; Radford, I.R.

2003-01-01

Full text: DNA rearrangement events leading to chromosomal aberrations are central to ionizing radiation-induced cell death. Although DNA double-strand breaks are probably the lesion that initiates formation of chromosomal aberrations, little is understood about the molecular mechanisms that generate and modulate DNA rearrangement. Examination of the sequences that flank sites of DNA rearrangement may provide information regarding the processes and enzymes involved in rearrangement events. Accordingly, we developed a method using inverse PCR that allows the detection and sequencing of putative radiation-induced DNA rearrangements in defined regions of the human genome. The method can detect single copies of a rearrangement event that has occurred in a particular region of the genome and, therefore, DNA rearrangement detection does not require survival and continued multiplication of the affected cell. Ionizing radiation-induced DNA rearrangements were detected in several different regions of the genome of human fibroblast cells that were exposed to 30 Gy of γ-irradiation and then incubated for 24 hours at 37 deg C. There was a 3- to 5-fold increase in the number of products amplified from irradiated as compared with control cells in the target regions 5' to the C-MYC, CDKN1A, RB1, and FGFR2 genes. Sequences were examined from 121 DNA rearrangements. Approximately half of the PCR products were derived from possible inter-chromosomal rearrangements and the remainder were from intra-chromosomal events. A high proportion of the sequences that rearranged with target regions were located in genes, suggesting that rearrangements may occur preferentially in transcribed regions. Eighty-four percent of the sequences examined by reverse transcriptase PCR were from transcribed sequences in IMR-90 cells. The distribution of DNA rearrangements within the target regions is non-random and homology occurs between the sequences involved in rearrangements in some cases but is not

The detection of large deletions or duplications in genomic DNA.

Science.gov (United States)

Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

2002-11-01

While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae.

Science.gov (United States)

Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya

2014-08-01

We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.

Highly variable rates of genome rearrangements between hemiascomycetous yeast lineages.

Directory of Open Access Journals (Sweden)

2006-03-01

Full Text Available Hemiascomycete yeasts cover an evolutionary span comparable to that of the entire phylum of chordates. Since this group currently contains the largest number of complete genome sequences it presents unique opportunities to understand the evolution of genome organization in eukaryotes. We inferred rates of genome instability on all branches of a phylogenetic tree for 11 species and calculated species-specific rates of genome rearrangements. We characterized all inversion events that occurred within synteny blocks between six representatives of the different lineages. We show that the rates of macro- and microrearrangements of gene order are correlated within individual lineages but are highly variable across different lineages. The most unstable genomes correspond to the pathogenic yeasts Candida albicans and Candida glabrata. Chromosomal maps have been intensively shuffled by numerous interchromosomal rearrangements, even between species that have retained a very high physical fraction of their genomes within small synteny blocks. Despite this intensive reshuffling of gene positions, essential genes, which cluster in low recombination regions in the genome of Saccharomyces cerevisiae, tend to remain syntenic during evolution. This work reveals that the high plasticity of eukaryotic genomes results from rearrangement rates that vary between lineages but also at different evolutionary times of a given lineage.

Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

Directory of Open Access Journals (Sweden)

Sergey Yegorov

Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

Enteric Duplication.

Science.gov (United States)

Jeziorczak, Paul M; Warner, Brad W

2018-03-01

Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

A molecularly defined duplication set for the X chromosome of Drosophila melanogaster.

Science.gov (United States)

Venken, Koen J T; Popodi, Ellen; Holtzman, Stacy L; Schulze, Karen L; Park, Soo; Carlson, Joseph W; Hoskins, Roger A; Bellen, Hugo J; Kaufman, Thomas C

2010-12-01

We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using ΦC31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.

Science.gov (United States)

Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P

2017-07-31

The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.

High level of chromosomal instability in circulating tumor cells of ROS1-rearranged non-small-cell lung cancer.

Science.gov (United States)

Pailler, E; Auger, N; Lindsay, C R; Vielh, P; Islas-Morris-Hernandez, A; Borget, I; Ngo-Camus, M; Planchard, D; Soria, J-C; Besse, B; Farace, F

2015-07-01

Genetic aberrations affecting the c-ros oncogene 1 (ROS1) tyrosine kinase gene have been reported in a small subset of patients with non-small-cell lung cancer (NSCLC). We evaluated whether ROS1-chromosomal rearrangements could be detected in circulating tumor cells (CTCs) and examined tumor heterogeneity of CTCs and tumor biopsies in ROS1-rearranged NSCLC patients. Using isolation by size of epithelial tumor cells (ISET) filtration and filter-adapted-fluorescence in situ hybridization (FA-FISH), ROS1 rearrangement was examined in CTCs from four ROS1-rearranged patients treated with the ROS1-inhibitor, crizotinib, and four ROS1-negative patients. ROS1-gene alterations observed in CTCs at baseline from ROS1-rearranged patients were compared with those present in tumor biopsies and in CTCs during crizotinib treatment. Numerical chromosomal instability (CIN) of CTCs was assessed by DNA content quantification and chromosome enumeration. ROS1 rearrangement was detected in the CTCs of all four patients with ROS1 rearrangement previously confirmed by tumor biopsy. In ROS1-rearranged patients, median number of ROS1-rearranged CTCs at baseline was 34.5 per 3 ml blood (range, 24-55). In ROS1-negative patients, median background hybridization of ROS1-rearranged CTCs was 7.5 per 3 ml blood (range, 7-11). Tumor heterogeneity, assessed by ROS1 copy number, was significantly higher in baseline CTCs compared with paired tumor biopsies in the three patients experiencing PR or SD (P < 0.0001). Copy number in ROS1-rearranged CTCs increased significantly in two patients who progressed during crizotinib treatment (P < 0.02). CTCs from ROS1-rearranged patients had a high DNA content and gain of chromosomes, indicating high levels of aneuploidy and numerical CIN. We provide the first proof-of-concept that CTCs can be used for noninvasive and sensitive detection of ROS1 rearrangement in NSCLC patients. CTCs from ROS1-rearranged patients show considerable heterogeneity of ROS1-gene

The formation and recovery of two-break chromosome rearrangements from irradiated spermatozoa of Drosophila melanogaster

International Nuclear Information System (INIS)

Leigh, B.

1978-01-01

Chromosome and chromatid-type rearrangements can be induced by exposure of spermatozoa of Drosophila to ionising radiation. A model, proposed to explain the formation and recovery of compound autosomes, has been extended to account for the induction of centric fragments capped by a duplication of paternal chromosome material. Three basic assumptions have been used; (1) that the sperm nucleus contains a haploid set of unreplicated chromosomes, (2) that the broken chromosome ends can be joined together before or after replication, and (3) that one of the first two cleavage nuclei may be lost and an adult organism derived from the other. The present paper reports a theoretical application of this combination of aasumptions to the general case of the formation and recovery of two-break rearrangements. This has led to an elucidation of the relation between repeats, compounds, fragments, and deficiencies on the one hand and inversions and translocations on the other hand. Dicentric chromosomes and segmental aneuploidy can be simply explained. A selective screen is formed by the segregation of chromatid rearrangements and the aneuploidy tolerance levels of the early cleavage nuclei. Thus there is an alternative way of explaining observations which might indicate preferential breakage or joining

Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

International Nuclear Information System (INIS)

Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

2009-01-01

The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

Energy Technology Data Exchange (ETDEWEB)

Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

2009-10-01

The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

Delineating Rearrangements in Single Yeast Artificial Chromosomes by Quantitative DNA Fiber Mapping

Energy Technology Data Exchange (ETDEWEB)

Weier, Heinz-Ulrich G.; Greulich-Bode, Karin M.; Wu, Jenny; Duell, Thomas

2009-09-18

Cloning of large chunks of human genomic DNA in recombinant systems such as yeast or bacterial artificial chromosomes has greatly facilitated the construction of physical maps, the positional cloning of disease genes or the preparation of patient-specific DNA probes for diagnostic purposes. For this process to work efficiently, the DNA cloning process and subsequent clone propagation need to maintain stable inserts that are neither deleted nor otherwise rearranged. Some regions of the human genome; however, appear to have a higher propensity than others to rearrange in any host system. Thus, techniques to detect and accurately characterize such rearrangements need to be developed. We developed a technique termed 'Quantitative DNA Fiber Mapping (QDFM)' that allows accurate tagging of sequence elements of interest with near kilobase accuracy and optimized it for delineation of rearrangements in recombinant DNA clones. This paper demonstrates the power of this microscopic approach by investigating YAC rearrangements. In our examples, high-resolution physical maps for regions within the immunoglobulin lambda variant gene cluster were constructed for three different YAC clones carrying deletions of 95 kb and more. Rearrangements within YACs could be demonstrated unambiguously by pairwise mapping of cosmids along YAC DNA molecules. When coverage by YAC clones was not available, distances between cosmid clones were estimated by hybridization of cosmids onto DNA fibers prepared from human genomic DNA. In addition, the QDFM technology provides essential information about clone stability facilitating closure of the maps of the human genome as well as those of model organisms.

Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

NARCIS (Netherlands)

Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.

2014-01-01

Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

Sequencing and characterisation of rearrangements in three S. pastorianus strains reveals the presence of chimeric genes and gives evidence of breakpoint reuse.

Directory of Open Access Journals (Sweden)

Sarah K Hewitt

Full Text Available Gross chromosomal rearrangements have the potential to be evolutionarily advantageous to an adapting organism. The generation of a hybrid species increases opportunity for recombination by bringing together two homologous genomes. We sought to define the location of genomic rearrangements in three strains of Saccharomyces pastorianus, a natural lager-brewing yeast hybrid of Saccharomyces cerevisiae and Saccharomyces eubayanus, using whole genome shotgun sequencing. Each strain of S. pastorianus has lost species-specific portions of its genome and has undergone extensive recombination, producing chimeric chromosomes. We predicted 30 breakpoints that we confirmed at the single nucleotide level by designing species-specific primers that flank each breakpoint, and then sequencing the PCR product. These rearrangements are the result of recombination between areas of homology between the two subgenomes, rather than repetitive elements such as transposons or tRNAs. Interestingly, 28/30 S. cerevisiae-S. eubayanus recombination breakpoints are located within genic regions, generating chimeric genes. Furthermore we show evidence for the reuse of two breakpoints, located in HSP82 and KEM1, in strains of proposed independent origin.

ETV6-RUNX1 Rearrangement in Tunisian Pediatric B-Lineage Acute Lymphoblastic Leukemia

Directory of Open Access Journals (Sweden)

Abir Gmidène

2009-01-01

Full Text Available In this study, Forty-one out of fifty-seven Tunisian children with B-lineage acute lymphoblastic leukemia (B-ALL, and without cytogenetically detectable recurrent abnormalities at the time of the diagnosis, were evaluated by fluorescence in situ hybridization (FISH for the t(12;21. This translocation leads ETV6-RUNX1 (previously TEL-AML1 fusion gene. 16 patients (28% had ETV6-RUNX1 rearrangement. In addition to this rearrangement, two cases showed a loss of the normal ETV6 allele, and three others showed an extra signal of the RUNX1 gene. Seven patients without ETV6-RUNX1 rearrangement showed extra signals of the RUNX1 gene. One out of the 7 patients was also associated with a t(3;12 identified by FISH. This is the first Tunisian study in which we report the incidence of t(12;21 among childhood B-lineage ALL and in which we have found multiple copies of RUNX1. Finally, our findings confirm that additional or secondary genetic changes are commonly encountered in pediatric B-lineage ALL with ETV6-RUNX1 gene fusion which is envisaged to play a pivotal role in disease progression.

HOXA9 is required for survival in human MLL-rearranged acute leukemias

NARCIS (Netherlands)

J. Faber (Joerg); A.V. Krivtsov (Andrei); M.C. Stubbs (Matthew); R. Wright (Renee); T.N. Davis (Tina); M.M. van den Heuvel-Eibrink (Marry); C.M. Zwaan (Christian Michel); A.L. Kung (Andrew); S.A. Armstrong (Scott)

2009-01-01

textabstractLeukemias that harbor translocations involving the mixed lineage leukemia gene (MLL) possess unique biologic characteristics and often have an unfavorable prognosis. Gene expression analyses demonstrate a distinct profile for MLL-rearranged leukemias with consistent high-level expression

Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses.