WorldWideScience

Sample records for gene perturbation screens

  1. Noise Reduction in High-Throughput Gene Perturbation Screens

    Science.gov (United States)

    Motivation: Accurate interpretation of perturbation screens is essential for a successful functional investigation. However, the screened phenotypes are often distorted by noise, and their analysis requires specialized statistical analysis tools. The number and scope of statistical methods available...

  2. Large-scale image-based profiling of single-cell phenotypes in arrayed CRISPR-Cas9 gene perturbation screens.

    Science.gov (United States)

    de Groot, Reinoud; Lüthi, Joel; Lindsay, Helen; Holtackers, René; Pelkmans, Lucas

    2018-01-23

    High-content imaging using automated microscopy and computer vision allows multivariate profiling of single-cell phenotypes. Here, we present methods for the application of the CISPR-Cas9 system in large-scale, image-based, gene perturbation experiments. We show that CRISPR-Cas9-mediated gene perturbation can be achieved in human tissue culture cells in a timeframe that is compatible with image-based phenotyping. We developed a pipeline to construct a large-scale arrayed library of 2,281 sequence-verified CRISPR-Cas9 targeting plasmids and profiled this library for genes affecting cellular morphology and the subcellular localization of components of the nuclear pore complex (NPC). We conceived a machine-learning method that harnesses genetic heterogeneity to score gene perturbations and identify phenotypically perturbed cells for in-depth characterization of gene perturbation effects. This approach enables genome-scale image-based multivariate gene perturbation profiling using CRISPR-Cas9. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  3. Screening of Coulomb interaction and many-body perturbation theory in atoms

    International Nuclear Information System (INIS)

    Dzyuba, V.A.; Flambaum, V.V.; Sil'vestrov, P.G.; Sushkov, O.P.

    1988-01-01

    Taking into account the electron Coulomb interaction screening considerably improves the convergence of perturbation theory in residual interaction. The developed technique allows to take into account screening diagrams in all orders of perturbation theory. Calculation of the correlation corrections to the thallium energy levels is carried out as an example

  4. Empirical study of supervised gene screening

    Directory of Open Access Journals (Sweden)

    Ma Shuangge

    2006-12-01

    Full Text Available Abstract Background Microarray studies provide a way of linking variations of phenotypes with their genetic causations. Constructing predictive models using high dimensional microarray measurements usually consists of three steps: (1 unsupervised gene screening; (2 supervised gene screening; and (3 statistical model building. Supervised gene screening based on marginal gene ranking is commonly used to reduce the number of genes in the model building. Various simple statistics, such as t-statistic or signal to noise ratio, have been used to rank genes in the supervised screening. Despite of its extensive usage, statistical study of supervised gene screening remains scarce. Our study is partly motivated by the differences in gene discovery results caused by using different supervised gene screening methods. Results We investigate concordance and reproducibility of supervised gene screening based on eight commonly used marginal statistics. Concordance is assessed by the relative fractions of overlaps between top ranked genes screened using different marginal statistics. We propose a Bootstrap Reproducibility Index, which measures reproducibility of individual genes under the supervised screening. Empirical studies are based on four public microarray data. We consider the cases where the top 20%, 40% and 60% genes are screened. Conclusion From a gene discovery point of view, the effect of supervised gene screening based on different marginal statistics cannot be ignored. Empirical studies show that (1 genes passed different supervised screenings may be considerably different; (2 concordance may vary, depending on the underlying data structure and percentage of selected genes; (3 evaluated with the Bootstrap Reproducibility Index, genes passed supervised screenings are only moderately reproducible; and (4 concordance cannot be improved by supervised screening based on reproducibility.

  5. Singular Perturbation Analysis and Gene Regulatory Networks with Delay

    Science.gov (United States)

    Shlykova, Irina; Ponosov, Arcady

    2009-09-01

    There are different ways of how to model gene regulatory networks. Differential equations allow for a detailed description of the network's dynamics and provide an explicit model of the gene concentration changes over time. Production and relative degradation rate functions used in such models depend on the vector of steeply sloped threshold functions which characterize the activity of genes. The most popular example of the threshold functions comes from the Boolean network approach, where the threshold functions are given by step functions. The system of differential equations becomes then piecewise linear. The dynamics of this system can be described very easily between the thresholds, but not in the switching domains. For instance this approach fails to analyze stationary points of the system and to define continuous solutions in the switching domains. These problems were studied in [2], [3], but the proposed model did not take into account a time delay in cellular systems. However, analysis of real gene expression data shows a considerable number of time-delayed interactions suggesting that time delay is essential in gene regulation. Therefore, delays may have a great effect on the dynamics of the system presenting one of the critical factors that should be considered in reconstruction of gene regulatory networks. The goal of this work is to apply the singular perturbation analysis to certain systems with delay and to obtain an analog of Tikhonov's theorem, which provides sufficient conditions for constracting the limit system in the delay case.

  6. Learning gene networks under SNP perturbations using eQTL datasets.

    Directory of Open Access Journals (Sweden)

    Lingxue Zhang

    2014-02-01

    Full Text Available The standard approach for identifying gene networks is based on experimental perturbations of gene regulatory systems such as gene knock-out experiments, followed by a genome-wide profiling of differential gene expressions. However, this approach is significantly limited in that it is not possible to perturb more than one or two genes simultaneously to discover complex gene interactions or to distinguish between direct and indirect downstream regulations of the differentially-expressed genes. As an alternative, genetical genomics study has been proposed to treat naturally-occurring genetic variants as potential perturbants of gene regulatory system and to recover gene networks via analysis of population gene-expression and genotype data. Despite many advantages of genetical genomics data analysis, the computational challenge that the effects of multifactorial genetic perturbations should be decoded simultaneously from data has prevented a widespread application of genetical genomics analysis. In this article, we propose a statistical framework for learning gene networks that overcomes the limitations of experimental perturbation methods and addresses the challenges of genetical genomics analysis. We introduce a new statistical model, called a sparse conditional Gaussian graphical model, and describe an efficient learning algorithm that simultaneously decodes the perturbations of gene regulatory system by a large number of SNPs to identify a gene network along with expression quantitative trait loci (eQTLs that perturb this network. While our statistical model captures direct genetic perturbations of gene network, by performing inference on the probabilistic graphical model, we obtain detailed characterizations of how the direct SNP perturbation effects propagate through the gene network to perturb other genes indirectly. We demonstrate our statistical method using HapMap-simulated and yeast eQTL datasets. In particular, the yeast gene network

  7. Screening in weakly ionized dusty plasmas; effect of dust density perturbations

    International Nuclear Information System (INIS)

    Tolias, P.; Ratynskaia, S.

    2013-01-01

    The screening of the charge of a non-emitting dust grain immersed in a weakly ionized dusty plasma is studied on the basis of a self-consistent hydrodynamic description. The dust number density is considered large enough so that the test grain is not isolated from other grains and dust collective effects are important. Not only dust charge perturbations but also dust density perturbations are taken into account, the latter are shown to have a strong effect on both the short and long range part of the potential. The realization of collective attraction via the newly obtained potential is discussed, a mechanism that could be central to the understanding of phase-transitions and self-organization processes in dusty plasmas.

  8. Analytic perturbation theory for screened Coulomb potential: full continuum wave function

    International Nuclear Information System (INIS)

    Bechler, A.; Ennan, Mc J.; Pratt, R.H.

    1979-01-01

    An analytic perturbation theory developed previously is used to find a continuum screened-Coulomb wave function characterized by definite asymptotic momentum. This wave function satisfies an inhomogeneous partial differential equation which is solved in parabolic coordinates; the solution depends on both parabolic variables. We calculate partial wave projections of this solution and show that we can choose to add a solution of the homogeneous equation such that the partial wave projections become equal to the normalized continuum radial function found previously. However, finding the unique solution with given asymptotic linear momentum will require either using boundary conditions to determine the unique needed solution of the homogeneous equation or equivalently specifying the screened-Coulomb phase-shifts. (author)

  9. Paternal irradiation perturbs the expression of circadian genes in offspring

    International Nuclear Information System (INIS)

    Gomes, Andre M.G.F.; Barber, Ruth C.; Dubrova, Yuri E.

    2015-01-01

    Highlights: • We have analysed gene expression in the offspring of irradiated male mice. • CBA/Ca and BALB/c male mice were used in our study. • The pattern of gene expression was established in four tissues. • Expression of genes in involved in rhythmic process/circadian rhythm is compromised. • Our data may explain the phenomenon of transgenerational genomic instability. - Abstract: The circadian system represents a complex network which influences the timing of many biological processes. Recent studies have established that circadian alterations play an important role in the susceptibility to many human diseases, including cancer. Here we report that paternal irradiation in mice significantly affects the expression of genes involved in rhythmic processes in their first-generation offspring. Using microarrays, the patterns of gene expression were established for brain, kidney, liver and spleen samples from the non-exposed offspring of irradiated CBA/Ca and BALB/c male mice. The most over-represented categories among the genes differentially expressed in the offspring of control and irradiated males were those involved in rhythmic process, circadian rhythm and DNA-dependent regulation of transcription. The results of our study therefore provide a plausible explanation for the transgenerational effects of paternal irradiation, including increased transgenerational carcinogenesis described in other studies

  10. Paternal irradiation perturbs the expression of circadian genes in offspring

    Energy Technology Data Exchange (ETDEWEB)

    Gomes, Andre M.G.F.; Barber, Ruth C.; Dubrova, Yuri E., E-mail: yed2@le.ac.uk

    2015-05-15

    Highlights: • We have analysed gene expression in the offspring of irradiated male mice. • CBA/Ca and BALB/c male mice were used in our study. • The pattern of gene expression was established in four tissues. • Expression of genes in involved in rhythmic process/circadian rhythm is compromised. • Our data may explain the phenomenon of transgenerational genomic instability. - Abstract: The circadian system represents a complex network which influences the timing of many biological processes. Recent studies have established that circadian alterations play an important role in the susceptibility to many human diseases, including cancer. Here we report that paternal irradiation in mice significantly affects the expression of genes involved in rhythmic processes in their first-generation offspring. Using microarrays, the patterns of gene expression were established for brain, kidney, liver and spleen samples from the non-exposed offspring of irradiated CBA/Ca and BALB/c male mice. The most over-represented categories among the genes differentially expressed in the offspring of control and irradiated males were those involved in rhythmic process, circadian rhythm and DNA-dependent regulation of transcription. The results of our study therefore provide a plausible explanation for the transgenerational effects of paternal irradiation, including increased transgenerational carcinogenesis described in other studies.

  11. CRISPR Perturbation of Gene Expression Alters Bacterial Fitness under Stress and Reveals Underlying Epistatic Constraints.

    Science.gov (United States)

    Otoupal, Peter B; Erickson, Keesha E; Escalas-Bordoy, Antoni; Chatterjee, Anushree

    2017-01-20

    The evolution of antibiotic resistance has engendered an impending global health crisis that necessitates a greater understanding of how resistance emerges. The impact of nongenetic factors and how they influence the evolution of resistance is a largely unexplored area of research. Here we present a novel application of CRISPR-Cas9 technology for investigating how gene expression governs the adaptive pathways available to bacteria during the evolution of resistance. We examine the impact of gene expression changes on bacterial adaptation by constructing a library of deactivated CRISPR-Cas9 synthetic devices to tune the expression of a set of stress-response genes in Escherichia coli. We show that artificially inducing perturbations in gene expression imparts significant synthetic control over fitness and growth during stress exposure. We present evidence that these impacts are reversible; strains with synthetically perturbed gene expression regained wild-type growth phenotypes upon stress removal, while maintaining divergent growth characteristics under stress. Furthermore, we demonstrate a prevailing trend toward negative epistatic interactions when multiple gene perturbations are combined simultaneously, thereby posing an intrinsic constraint on gene expression underlying adaptive trajectories. Together, these results emphasize how CRISPR-Cas9 can be employed to engineer gene expression changes that shape bacterial adaptation, and present a novel approach to synthetically control the evolution of antimicrobial resistance.

  12. Inference of gene regulatory networks with sparse structural equation models exploiting genetic perturbations.

    Directory of Open Access Journals (Sweden)

    Xiaodong Cai

    Full Text Available Integrating genetic perturbations with gene expression data not only improves accuracy of regulatory network topology inference, but also enables learning of causal regulatory relations between genes. Although a number of methods have been developed to integrate both types of data, the desiderata of efficient and powerful algorithms still remains. In this paper, sparse structural equation models (SEMs are employed to integrate both gene expression data and cis-expression quantitative trait loci (cis-eQTL, for modeling gene regulatory networks in accordance with biological evidence about genes regulating or being regulated by a small number of genes. A systematic inference method named sparsity-aware maximum likelihood (SML is developed for SEM estimation. Using simulated directed acyclic or cyclic networks, the SML performance is compared with that of two state-of-the-art algorithms: the adaptive Lasso (AL based scheme, and the QTL-directed dependency graph (QDG method. Computer simulations demonstrate that the novel SML algorithm offers significantly better performance than the AL-based and QDG algorithms across all sample sizes from 100 to 1,000, in terms of detection power and false discovery rate, in all the cases tested that include acyclic or cyclic networks of 10, 30 and 300 genes. The SML method is further applied to infer a network of 39 human genes that are related to the immune function and are chosen to have a reliable eQTL per gene. The resulting network consists of 9 genes and 13 edges. Most of the edges represent interactions reasonably expected from experimental evidence, while the remaining may just indicate the emergence of new interactions. The sparse SEM and efficient SML algorithm provide an effective means of exploiting both gene expression and perturbation data to infer gene regulatory networks. An open-source computer program implementing the SML algorithm is freely available upon request.

  13. Gene expression network reconstruction by convex feature selection when incorporating genetic perturbations.

    Directory of Open Access Journals (Sweden)

    Benjamin A Logsdon

    Full Text Available Cellular gene expression measurements contain regulatory information that can be used to discover novel network relationships. Here, we present a new algorithm for network reconstruction powered by the adaptive lasso, a theoretically and empirically well-behaved method for selecting the regulatory features of a network. Any algorithms designed for network discovery that make use of directed probabilistic graphs require perturbations, produced by either experiments or naturally occurring genetic variation, to successfully infer unique regulatory relationships from gene expression data. Our approach makes use of appropriately selected cis-expression Quantitative Trait Loci (cis-eQTL, which provide a sufficient set of independent perturbations for maximum network resolution. We compare the performance of our network reconstruction algorithm to four other approaches: the PC-algorithm, QTLnet, the QDG algorithm, and the NEO algorithm, all of which have been used to reconstruct directed networks among phenotypes leveraging QTL. We show that the adaptive lasso can outperform these algorithms for networks of ten genes and ten cis-eQTL, and is competitive with the QDG algorithm for networks with thirty genes and thirty cis-eQTL, with rich topologies and hundreds of samples. Using this novel approach, we identify unique sets of directed relationships in Saccharomyces cerevisiae when analyzing genome-wide gene expression data for an intercross between a wild strain and a lab strain. We recover novel putative network relationships between a tyrosine biosynthesis gene (TYR1, and genes involved in endocytosis (RCY1, the spindle checkpoint (BUB2, sulfonate catabolism (JLP1, and cell-cell communication (PRM7. Our algorithm provides a synthesis of feature selection methods and graphical model theory that has the potential to reveal new directed regulatory relationships from the analysis of population level genetic and gene expression data.

  14. Mining the 30UTR of Autism-implicated Genes for SNPs Perturbing MicroRNA Regulation

    Institute of Scientific and Technical Information of China (English)

    Varadharajan Vaishnavi; Mayakannan Manikandan; Arasambattu Kannan Munirajan

    2014-01-01

    Autism spectrum disorder (ASD) refers to a group of childhood neurodevelopmental dis-orders with polygenic etiology. The expression of many genes implicated in ASD is tightly regulated by various factors including microRNAs (miRNAs), a class of noncoding RNAs 22 nucleotides in length that function to suppress translation by pairing with‘miRNA recognition elements’ (MREs) present in the 30untranslated region (30UTR) of target mRNAs. This emphasizes the role played by miRNAs in regulating neurogenesis, brain development and differentiation and hence any perturba-tions in this regulatory mechanism might affect these processes as well. Recently, single nucleotide polymorphisms (SNPs) present within 30UTRs of mRNAs have been shown to modulate existing MREs or even create new MREs. Therefore, we hypothesized that SNPs perturbing miRNA-medi-ated gene regulation might lead to aberrant expression of autism-implicated genes, thus resulting in disease predisposition or pathogenesis in at least a subpopulation of ASD individuals. We developed a systematic computational pipeline that integrates data from well-established databases. By following a stringent selection criterion, we identified 9 MRE-modulating SNPs and another 12 MRE-creating SNPs in the 30UTR of autism-implicated genes. These high-confidence candidate SNPs may play roles in ASD and hence would be valuable for further functional validation.

  15. Posterior association networks and functional modules inferred from rich phenotypes of gene perturbations.

    Directory of Open Access Journals (Sweden)

    Xin Wang

    Full Text Available Combinatorial gene perturbations provide rich information for a systematic exploration of genetic interactions. Despite successful applications to bacteria and yeast, the scalability of this approach remains a major challenge for higher organisms such as humans. Here, we report a novel experimental and computational framework to efficiently address this challenge by limiting the 'search space' for important genetic interactions. We propose to integrate rich phenotypes of multiple single gene perturbations to robustly predict functional modules, which can subsequently be subjected to further experimental investigations such as combinatorial gene silencing. We present posterior association networks (PANs to predict functional interactions between genes estimated using a Bayesian mixture modelling approach. The major advantage of this approach over conventional hypothesis tests is that prior knowledge can be incorporated to enhance predictive power. We demonstrate in a simulation study and on biological data, that integrating complementary information greatly improves prediction accuracy. To search for significant modules, we perform hierarchical clustering with multiscale bootstrap resampling. We demonstrate the power of the proposed methodologies in applications to Ewing's sarcoma and human adult stem cells using publicly available and custom generated data, respectively. In the former application, we identify a gene module including many confirmed and highly promising therapeutic targets. Genes in the module are also significantly overrepresented in signalling pathways that are known to be critical for proliferation of Ewing's sarcoma cells. In the latter application, we predict a functional network of chromatin factors controlling epidermal stem cell fate. Further examinations using ChIP-seq, ChIP-qPCR and RT-qPCR reveal that the basis of their genetic interactions may arise from transcriptional cross regulation. A Bioconductor package

  16. Reference Gene Screening for Analyzing Gene Expression Across Goat Tissue

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2013-12-01

    Full Text Available Real-time quantitative PCR (qRT-PCR is one of the important methods for investigating the changes in mRNA expression levels in cells and tissues. Selection of the proper reference genes is very important when calibrating the results of real-time quantitative PCR. Studies on the selection of reference genes in goat tissues are limited, despite the economic importance of their meat and dairy products. We used real-time quantitative PCR to detect the expression levels of eight reference gene candidates (18S, TBP, HMBS, YWHAZ, ACTB, HPRT1, GAPDH and EEF1A2 in ten tissues types sourced from Boer goats. The optimal reference gene combination was selected according to the results determined by geNorm, NormFinder and Bestkeeper software packages. The analyses showed that tissue is an important variability factor in genes expression stability. When all tissues were considered, 18S, TBP and HMBS is the optimal reference combination for calibrating quantitative PCR analysis of gene expression from goat tissues. Dividing data set by tissues, ACTB was the most stable in stomach, small intestine and ovary, 18S in heart and spleen, HMBS in uterus and lung, TBP in liver, HPRT1 in kidney and GAPDH in muscle. Overall, this study provided valuable information about the goat reference genes that can be used in order to perform a proper normalisation when relative quantification by qRT-PCR studies is undertaken.

  17. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    OpenAIRE

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

  18. Perturbations of gut microbiome genes in infants with atopic dermatitis according to feeding type.

    Science.gov (United States)

    Lee, Min-Jung; Kang, Mi-Jin; Lee, So-Yeon; Lee, Eun; Kim, Kangjin; Won, Sungho; Suh, Dong In; Kim, Kyung Won; Sheen, Youn Ho; Ahn, Kangmo; Kim, Bong-Soo; Hong, Soo-Jong

    2018-04-01

    Perturbations of the infant gut microbiota can shape development of the immune system and link to the risk of allergic diseases. We sought to understand the role of the gut microbiome in patients with atopic dermatitis (AD). The metagenome of the infant gut microbiome was analyzed according to feeding types. Composition of the gut microbiota was analyzed in fecal samples from 129 infants (6 months old) by using pyrosequencing, including 66 healthy infants and 63 infants with AD. The functional profile of the gut microbiome was analyzed by means of whole-metagenome sequencing (20 control subjects and 20 patients with AD). In addition, the total number of bacteria in the feces was determined by using real-time PCR. The gut microbiome of 6-month-old infants was different based on feeding types, and 2 microbiota groups (Bifidobacterium species-dominated and Escherichia/Veillonella species-dominated groups) were found in breast-fed and mixed-fed infants. Bacterial cell amounts in the feces were lower in infants with AD than in control infants. Although no specific taxa directly correlated with AD in 16S rRNA gene results, whole-metagenome analysis revealed differences in functional genes related to immune development. The reduction in genes for oxidative phosphorylation, phosphatidylinositol 3-kinase-Akt signaling, estrogen signaling, nucleotide-binding domain-like receptor signaling, and antigen processing and presentation induced by reduced colonization of mucin-degrading bacteria (Akkermansia muciniphila, Ruminococcus gnavus, and Lachnospiraceae bacterium 2_1_58FAA) was significantly associated with stunted immune development in the AD group compared with the control group (P gut microbiome can be associated with AD because of different bacterial genes that can modulate host immune cell function. Copyright © 2018 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  19. Screening of hypoxia-inducible genes in sporadic ALS.

    LENUS (Irish Health Repository)

    Cronin, Simon

    2008-10-01

    Genetic variations in two hypoxia-inducible angiogenic genes, VEGF and ANG, have been linked with sporadic amyotrophic lateral sclerosis (SALS). Common variations in these genes may reduce the levels or functioning of their products. VEGF and ANG belong to a larger group of angiogenic genes that are up-regulated under hypoxic conditions. We hypothesized that common genetic variation across other members of this group may also predispose to sporadic ALS. To screen other hypoxia-inducible angiogenic genes for association with SALS, we selected 112 tagging single nucleotide polymorphisms (tgSNPs) that captured the common genetic variation across 16 VEGF-like and eight ANG-like hypoxia-inducible genes. Screening for association was performed in 270 Irish individuals with typical SALS and 272 ethnically matched unrelated controls. SNPs showing association in the Irish phase were genotyped in a replication sample of 281 Swedish sporadic ALS patients and 286 Swedish controls. Seven markers showed association in the Irish. The one modest replication signal observed in the Swedish replication sample, at rs3801158 in the gene inhibin beta A, was for the opposite allele vs. the Irish cohort. We failed to detect association of common variation across 24 candidate hypoxia-inducible angiogenic genes with SALS.

  20. Screening for interaction effects in gene expression data.

    Directory of Open Access Journals (Sweden)

    Peter J Castaldi

    Full Text Available Expression quantitative trait (eQTL studies are a powerful tool for identifying genetic variants that affect levels of messenger RNA. Since gene expression is controlled by a complex network of gene-regulating factors, one way to identify these factors is to search for interaction effects between genetic variants and mRNA levels of transcription factors (TFs and their respective target genes. However, identification of interaction effects in gene expression data pose a variety of methodological challenges, and it has become clear that such analyses should be conducted and interpreted with caution. Investigating the validity and interpretability of several interaction tests when screening for eQTL SNPs whose effect on the target gene expression is modified by the expression level of a transcription factor, we characterized two important methodological issues. First, we stress the scale-dependency of interaction effects and highlight that commonly applied transformation of gene expression data can induce or remove interactions, making interpretation of results more challenging. We then demonstrate that, in the setting of moderate to strong interaction effects on the order of what may be reasonably expected for eQTL studies, standard interaction screening can be biased due to heteroscedasticity induced by true interactions. Using simulation and real data analysis, we outline a set of reasonable minimum conditions and sample size requirements for reliable detection of variant-by-environment and variant-by-TF interactions using the heteroscedasticity consistent covariance-based approach.

  1. Thalidomide induced early gene expression perturbations indicative of human embryopathy in mouse embryonic stem cells

    International Nuclear Information System (INIS)

    Gao, Xiugong; Sprando, Robert L.; Yourick, Jeffrey J.

    2015-01-01

    Developmental toxicity testing has traditionally relied on animal models which are costly, time consuming, and require the sacrifice of large numbers of animals. In addition, there are significant disparities between human beings and animals in their responses to chemicals. Thalidomide is a species-specific developmental toxicant that causes severe limb malformations in humans but not in mice. Here, we used microarrays to study transcriptomic changes induced by thalidomide in an in vitro model based on differentiation of mouse embryonic stem cells (mESCs). C57BL/6 mESCs were allowed to differentiate spontaneously and RNA was collected at 24, 48, and 72 h after exposure to 0.25 mM thalidomide. Global gene expression analysis using microarrays revealed hundreds of differentially expressed genes upon thalidomide exposure that were enriched in gene ontology (GO) terms and canonical pathways associated with embryonic development and differentiation. In addition, many genes were found to be involved in small GTPases-mediated signal transduction, heart development, and inflammatory responses, which coincide with clinical evidences and may represent critical embryotoxicities of thalidomide. These results demonstrate that transcriptomics in combination with mouse embryonic stem cell differentiation is a promising alternative model for developmental toxicity assessment. - Highlights: • Studied genomic changes in mouse embryonic stem cells upon thalidomide exposure • Identified gene expression changes that may represent thalidomide embryotoxicity • The toxicogenomic changes coincide well with known thalidomide clinical outcomes. • The mouse embryonic stem cell model is suitable for developmental toxicity testing. • The model has the potential for high-throughput screening of a multitude of compounds

  2. Thalidomide induced early gene expression perturbations indicative of human embryopathy in mouse embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Xiugong, E-mail: xiugong.gao@fda.hhs.gov; Sprando, Robert L.; Yourick, Jeffrey J.

    2015-08-15

    Developmental toxicity testing has traditionally relied on animal models which are costly, time consuming, and require the sacrifice of large numbers of animals. In addition, there are significant disparities between human beings and animals in their responses to chemicals. Thalidomide is a species-specific developmental toxicant that causes severe limb malformations in humans but not in mice. Here, we used microarrays to study transcriptomic changes induced by thalidomide in an in vitro model based on differentiation of mouse embryonic stem cells (mESCs). C57BL/6 mESCs were allowed to differentiate spontaneously and RNA was collected at 24, 48, and 72 h after exposure to 0.25 mM thalidomide. Global gene expression analysis using microarrays revealed hundreds of differentially expressed genes upon thalidomide exposure that were enriched in gene ontology (GO) terms and canonical pathways associated with embryonic development and differentiation. In addition, many genes were found to be involved in small GTPases-mediated signal transduction, heart development, and inflammatory responses, which coincide with clinical evidences and may represent critical embryotoxicities of thalidomide. These results demonstrate that transcriptomics in combination with mouse embryonic stem cell differentiation is a promising alternative model for developmental toxicity assessment. - Highlights: • Studied genomic changes in mouse embryonic stem cells upon thalidomide exposure • Identified gene expression changes that may represent thalidomide embryotoxicity • The toxicogenomic changes coincide well with known thalidomide clinical outcomes. • The mouse embryonic stem cell model is suitable for developmental toxicity testing. • The model has the potential for high-throughput screening of a multitude of compounds.

  3. FUN-L: gene prioritization for RNAi screens.

    Science.gov (United States)

    Lees, Jonathan G; Hériché, Jean-Karim; Morilla, Ian; Fernández, José M; Adler, Priit; Krallinger, Martin; Vilo, Jaak; Valencia, Alfonso; Ellenberg, Jan; Ranea, Juan A; Orengo, Christine

    2015-06-15

    Most biological processes remain only partially characterized with many components still to be identified. Given that a whole genome can usually not be tested in a functional assay, identifying the genes most likely to be of interest is of critical importance to avoid wasting resources. Given a set of known functionally related genes and using a state-of-the-art approach to data integration and mining, our Functional Lists (FUN-L) method provides a ranked list of candidate genes for testing. Validation of predictions from FUN-L with independent RNAi screens confirms that FUN-L-produced lists are enriched in genes with the expected phenotypes. In this article, we describe a website front end to FUN-L. The website is freely available to use at http://funl.org © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Changes in photosynthetic rates and gene expression of leaves during a source-sink perturbation in sugarcane.

    Science.gov (United States)

    McCormick, A J; Cramer, M D; Watt, D A

    2008-01-01

    In crops other than sugarcane there is good evidence that the size and activity of carbon sinks influence source activity via sugar-related regulation of the enzymes of photosynthesis, an effect that is partly mediated through coarse regulation of gene expression. In the current study, leaf shading treatments were used to perturb the source-sink balance in 12-month-old Saccharum spp. hybrid 'N19' (N19) by restricting source activity to a single mature leaf. Changes in leaf photosynthetic gas exchange variables and leaf and culm sugar concentrations were subsequently measured over a 14 d period. In addition, the changes in leaf gene response to the source-sink perturbation were measured by reverse northern hybridization analysis of an array of 128 expressed sequence tags (ESTs) related to photosynthetic and carbohydrate metabolism. Sucrose concentrations in immature culm tissue declined significantly over the duration of the shading treatment, while a 57 and 88% increase in the assimilation rate (A) and electron transport rate (ETR), respectively, was observed in the source leaf. Several genes (27) in the leaf displayed a >2-fold change in expression level, including the upregulation of several genes associated with C(4) photosynthesis, mitochondrial metabolism and sugar transport. Changes in gene expression levels of several genes, including Rubisco (EC 4.1.1.39) and hexokinase (HXK; EC 2.7.1.1), correlated with changes in photosynthesis and tissue sugar concentrations that occurred subsequent to the source-sink perturbation. These results are consistent with the notion that sink demand may limit source activity through a kinase-mediated sugar signalling mechanism that correlates to a decrease in source hexose concentrations, which, in turn, correlate with increased expression of genes involved in photosynthesis and metabolite transport. The signal feedback system reporting sink sufficiency and regulating source activity may be a potentially valuable target for

  5. Comparative Plasmodium gene overexpression reveals distinct perturbation of sporozoite transmission by profilin.

    Science.gov (United States)

    Sato, Yuko; Hliscs, Marion; Dunst, Josefine; Goosmann, Christian; Brinkmann, Volker; Montagna, Georgina N; Matuschewski, Kai

    2016-07-15

    Plasmodium relies on actin-based motility to migrate from the site of infection and invade target cells. Using a substrate-dependent gliding locomotion, sporozoites are able to move at fast speed (1-3 μm/s). This motility relies on a minimal set of actin regulatory proteins and occurs in the absence of detectable filamentous actin (F-actin). Here we report an overexpression strategy to investigate whether perturbations of F-actin steady-state levels affect gliding locomotion and host invasion. We selected two vital Plasmodium berghei G-actin-binding proteins, C-CAP and profilin, in combination with three stage-specific promoters and mapped the phenotypes afforded by overexpression in all three extracellular motile stages. We show that in merozoites and ookinetes, additional expression does not impair life cycle progression. In marked contrast, overexpression of C-CAP and profilin in sporozoites impairs circular gliding motility and salivary gland invasion. The propensity for productive motility correlates with actin accumulation at the parasite tip, as revealed by combinations of an actin-stabilizing drug and transgenic parasites. Strong expression of profilin, but not C-CAP, resulted in complete life cycle arrest. Comparative overexpression is an alternative experimental genetic strategy to study essential genes and reveals effects of regulatory imbalances that are not uncovered from deletion-mutant phenotyping. © 2016 Sato et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  6. Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Fernanda Veronese Oliveira

    2014-01-01

    Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.

  7. Screening Reliable Reference Genes for RT-qPCR Analysis of Gene Expression in Moringa oleifera.

    Science.gov (United States)

    Deng, Li-Ting; Wu, Yu-Ling; Li, Jun-Cheng; OuYang, Kun-Xi; Ding, Mei-Mei; Zhang, Jun-Jie; Li, Shu-Qi; Lin, Meng-Fei; Chen, Han-Bin; Hu, Xin-Sheng; Chen, Xiao-Yang

    2016-01-01

    Moringa oleifera is a promising plant species for oil and forage, but its genetic improvement is limited. Our current breeding program in this species focuses on exploiting the functional genes associated with important agronomical traits. Here, we screened reliable reference genes for accurately quantifying the expression of target genes using the technique of real-time quantitative polymerase chain reaction (RT-qPCR) in M. oleifera. Eighteen candidate reference genes were selected from a transcriptome database, and their expression stabilities were examined in 90 samples collected from the pods in different developmental stages, various tissues, and the roots and leaves under different conditions (low or high temperature, sodium chloride (NaCl)- or polyethyleneglycol (PEG)- simulated water stress). Analyses with geNorm, NormFinder and BestKeeper algorithms revealed that the reliable reference genes differed across sample designs and that ribosomal protein L1 (RPL1) and acyl carrier protein 2 (ACP2) were the most suitable reference genes in all tested samples. The experiment results demonstrated the significance of using the properly validated reference genes and suggested the use of more than one reference gene to achieve reliable expression profiles. In addition, we applied three isotypes of the superoxide dismutase (SOD) gene that are associated with plant adaptation to abiotic stress to confirm the efficacy of the validated reference genes under NaCl and PEG water stresses. Our results provide a valuable reference for future studies on identifying important functional genes from their transcriptional expressions via RT-qPCR technique in M. oleifera.

  8. Screening strategies for a highly polymorphic gene: DHPLC analysis of the Fanconi anemia group A gene.

    Science.gov (United States)

    Rischewski, J; Schneppenheim, R

    2001-01-30

    Patients with Fanconi anemia (Fanc) are at risk of developing leukemia. Mutations of the group A gene (FancA) are most common. A multitude of polymorphisms and mutations within the 43 exons of the gene are described. To examine the role of heterozygosity as a risk factor for malignancies, a partially automatized screening method to identify aberrations was needed. We report on our experience with DHPLC (WAVE (Transgenomic)). PCR amplification of all 43 exons from one individual was performed on one microtiter plate on a gradient thermocycler. DHPLC analysis conditions were established via melting curves, prediction software, and test runs with aberrant samples. PCR products were analyzed twice: native, and after adding a WT-PCR product. Retention patterns were compared with previously identified polymorphic PCR products or mutants. We have defined the mutation screening conditions for all 43 exons of FancA using DHPLC. So far, 40 different sequence variations have been detected in more than 100 individuals. The native analysis identifies heterozygous individuals, and the second run detects homozygous aberrations. Retention patterns are specific for the underlying sequence aberration, thus reducing sequencing demand and costs. DHPLC is a valuable tool for reproducible recognition of known sequence aberrations and screening for unknown mutations in the highly polymorphic FancA gene.

  9. Screening for the Most Suitable Reference Genes for Gene Expression Studies in Equine Milk Somatic Cells.

    Directory of Open Access Journals (Sweden)

    Jakub Cieslak

    Full Text Available Apart from the well-known role of somatic cell count as a parameter reflecting the inflammatory status of the mammary gland, the composition of cells isolated from milk is considered as a valuable material for gene expression studies in mammals. Due to its unique composition, in recent years an increasing interest in mare's milk consumption has been observed. Thus, investigating the genetic background of horse's milk variability presents and interesting study model. Relying on 39 milk samples collected from mares representing three breeds (Polish Primitive Horse, Polish Cold-blooded Horse, Polish Warmblood Horse we aimed to investigate the utility of equine milk somatic cells as a source of mRNA and to screen the best reference genes for RT-qPCR using geNorm and NormFinder algorithms. The results showed that despite relatively low somatic cell counts in mare's milk, the amount and the quality of the extracted RNA are sufficient for gene expression studies. The analysis of the utility of 7 potential reference genes for RT-qPCR experiments for the normalization of equine milk somatic cells revealed some differences between the outcomes of the applied algorithms, although in both cases the KRT8 and TOP2B genes were pointed as the most stable. Analysis by geNorm showed that the combination of 4 reference genes (ACTB, GAPDH, TOP2B and KRT8 is required for apropriate RT-qPCR experiments normalization, whereas NormFinder algorithm pointed the combination of KRT8 and RPS9 genes as the most suitable. The trial study of the relative transcript abundance of the beta-casein gene with the use of various types and numbers of internal control genes confirmed once again that the selection of proper reference gene combinations is crucial for the final results of each real-time PCR experiment.

  10. Screening for common copy-number variants in cancer genes.

    Science.gov (United States)

    Tyson, Jess; Majerus, Tamsin M O; Walker, Susan; Armour, John A L

    2010-12-01

    For most cases of colorectal cancer that arise without a family history of the disease, it is proposed that an appreciable heritable component of predisposition is the result of contributions from many loci. Although progress has been made in identifying single nucleotide variants associated with colorectal cancer risk, the involvement of low-penetrance copy number variants is relatively unexplored. We have used multiplex amplifiable probe hybridization (MAPH) in a fourfold multiplex (QuadMAPH), positioned at an average resolution of one probe per 2 kb, to screen a total of 1.56 Mb of genomic DNA for copy number variants around the genes APC, AXIN1, BRCA1, BRCA2, CTNNB1, HRAS, MLH1, MSH2, and TP53. Two deletion events were detected, one upstream of MLH1 in a control individual and the other in APC in a colorectal cancer patient, but these do not seem to correspond to copy number polymorphisms with measurably high population frequencies. In summary, by means of our QuadMAPH assay, copy number measurement data were of sufficient resolution and accuracy to detect any copy number variants with high probability. However, this study has demonstrated a very low incidence of deletion and duplication variants within intronic and flanking regions of these nine genes, in both control individuals and colorectal cancer patients. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs

    DEFF Research Database (Denmark)

    Khan, Aly A; Betel, Doron; Miller, Martin L

    2009-01-01

    Transfection of small RNAs (such as small interfering RNAs (siRNAs) and microRNAs (miRNAs)) into cells typically lowers expression of many genes. Unexpectedly, increased expression of genes also occurs. We investigated whether this upregulation results from a saturation effect--that is, competiti...

  12. Overexpression of transcription factor Sp1 leads to gene expression perturbations and cell cycle inhibition.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Deniaud

    Full Text Available BACKGROUND: The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. METHODOLOGY AND PRINCIPAL FINDINGS: We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. CONCLUSION: This study shows that the binding to DNA

  13. A Screening Method for the ALK Fusion Gene in NSCLC

    International Nuclear Information System (INIS)

    Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

    2012-01-01

    Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

  14. The leukemia-specific fusion gene ETV6/RUNX1 perturbs distinct key biological functions primarily by gene repression.

    Directory of Open Access Journals (Sweden)

    Gerhard Fuka

    Full Text Available BACKGROUND: ETV6/RUNX1 (E/R (also known as TEL/AML1 is the most frequent gene fusion in childhood acute lymphoblastic leukemia (ALL and also most likely the crucial factor for disease initiation; its role in leukemia propagation and maintenance, however, remains largely elusive. To address this issue we performed a shRNA-mediated knock-down (KD of the E/R fusion gene and investigated the ensuing consequences on genome-wide gene expression patterns and deducible regulatory functions in two E/R-positive leukemic cell lines. FINDINGS: Microarray analyses identified 777 genes whose expression was substantially altered. Although approximately equal proportions were either up- (KD-UP or down-regulated (KD-DOWN, the effects on biological processes and pathways differed considerably. The E/R KD-UP set was significantly enriched for genes included in the "cell activation", "immune response", "apoptosis", "signal transduction" and "development and differentiation" categories, whereas in the E/R KD-DOWN set only the "PI3K/AKT/mTOR signaling" and "hematopoietic stem cells" categories became evident. Comparable expression signatures obtained from primary E/R-positive ALL samples underline the relevance of these pathways and molecular functions. We also validated six differentially expressed genes representing the categories "stem cell properties", "B-cell differentiation", "immune response", "cell adhesion" and "DNA damage" with RT-qPCR. CONCLUSION: Our analyses provide the first preliminary evidence that the continuous expression of the E/R fusion gene interferes with key regulatory functions that shape the biology of this leukemia subtype. E/R may thus indeed constitute the essential driving force for the propagation and maintenance of the leukemic process irrespective of potential consequences of associated secondary changes. Finally, these findings may also provide a valuable source of potentially attractive therapeutic targets.

  15. Development of transgenic Brassica juncea lines for reduced seed sinapine content by perturbing phenylpropanoid pathway genes.

    Directory of Open Access Journals (Sweden)

    Sachin Kajla

    Full Text Available Sinapine is a major anti-nutritive compound that accumulates in the seeds of Brassica species. When ingested, sinapine imparts gritty flavuor in meat and milk of animals and fishy odor to eggs of brown egg layers, thereby compromising the potential use of the valuable protein rich seed meal. Sinapine content in Brassica juncea germplasm ranges from 6.7 to 15.1 mg/g of dry seed weight (DSW which is significantly higher than the prescribed permissible level of 3.0 mg/g of DSW. Due to limited natural genetic variability, conventional plant breeding approach for reducing the sinapine content has largely been unsuccessful. Hence, transgenic approach for gene silencing was adopted by targeting two genes-SGT and SCT, encoding enzymes UDP- glucose: sinapate glucosyltransferase and sinapoylglucose: choline sinapoyltransferase, respectively, involved in the final two steps of sinapine biosynthetic pathway. These two genes were isolated from B. juncea and eight silencing constructs were developed using three different RNA silencing approaches viz. antisense RNA, RNAi and artificial microRNA. Transgenics in B. juncea were developed following Agrobacterium-mediated transformation. From a total of 1232 independent T0 transgenic events obtained using eight silencing constructs, 25 homozygous lines showing single gene inheritance were identified in the T2 generation. Reduction of seed sinapine content in these lines ranged from 15.8% to 67.2%; the line with maximum reduction had sinapine content of 3.79 mg/g of DSW. The study also revealed that RNAi method was more efficient than the other two methods used in this study.

  16. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  17. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  18. Preliminary screening of the radiosensitivity-associated genes on colorectal cancer

    International Nuclear Information System (INIS)

    Xing Chungen; Yang Xiaodong; Zhou Liying; Wu Yongyou; Jiang Yinfen; Dai Hong; Lv Xiaodong; Gong Wei

    2007-01-01

    The screening of radiosensitive genes of human colorectal cancer was made by gene chip. Two human colorectal cancer cell lines LOVO and SW480 were cultivated and the total RNA was extracted from at least lxl0 7 cells. Then the gene expression profiling was performed by HG-U133 Plus 2.0 Array and the difference of gene expression has been analyzed. The results shows that there are 16882 genes expressed in LOVO cell and 17114 genes expressed in SW480 cell through gene expression profiling. It has been found that the genes with 2-fold expressed differentially include 908 genes up-regulated and 1312 genes down-regulated. The same genes, such as Fas and NFkB which is up-regulated, Caspas6, and RAD21 which is down-regulated, have been proved to be related to radiosensitivity. The genes with high expression level including CEACAM5, THBS1, SERPINE2, ARL7, HPGD in LOVO cell may also be related to the radiosensitivity. And the genes with high expression level including SCD, NQ01, LYZ, KRT20, ATP1B1 in SW480 cell may be related to the radioresistance of human colorectal cancer. It could be concluded that the radiosensitivity of colorectal cancer can be reflected from gene and protein expression level. And gene expression profiling is a fast and sensitive tool to predict the radiosensitivity and screen radiosensitive genes of colorectal cancer. (authors)

  19. A comparative study of mutation screening of sarcomeric genes ...

    African Journals Online (AJOL)

    , TNNT2) using single gene approach versus targeted gene panel next generation sequencing in a cohort of HCM patients in Egypt. Heba Sh. Kassem, Roddy Walsh, Paul J. Barton, Besra S. Abdelghany, Remon S. Azer, Rachel Buchan, ...

  20. High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

    Science.gov (United States)

    Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

    2018-01-01

    Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

  1. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  2. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S.; Geel van - Schutten, G.H.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus. Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in α-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  3. Reversible perturbations of gene regulation after genome editing in Drosophila cells.

    Directory of Open Access Journals (Sweden)

    Stefan Kunzelmann

    Full Text Available The prokaryotic phage defense CRISPR/cas-system has developed into a versatile toolbox for genome engineering and genetic studies in many organisms. While many efforts were spent on analyzing the consequences of off-target effects, only few studies addressed side-effects that occur due to the targeted manipulation of the genome. Here, we show that the CRISPR/cas9-mediated integration of an epitope tag in combination with a selection cassette can trigger an siRNA-mediated, epigenetic genome surveillance pathway in Drosophila melanogaster cells. After homology-directed insertion of the sequence coding for the epitope tag and the selection marker, a moderate level of siRNAs covering the inserted sequence and extending into the targeted locus was detected. This response affected protein levels less than two-fold and it persisted even after single cell cloning. However, removal of the selection cassette abolished the siRNA generation, demonstrating that this response is reversible. Consistently, marker-free genome engineering did not trigger the same surveillance mechanism. These two observations indicate that the selection cassette we employed induces an aberrant transcriptional arrangement and ultimately sets off the siRNA production. There have been prior concerns about undesirable effects induced by selection markers, but fortunately we were able to show that at least one of the epigenetic changes reverts as the marker gene is excised. Although the effects observed were rather weak (less than twofold de-repression upon ago2 or dcr-2 knock-down, we recommend that when selection markers are used during genome editing, a strategy for their subsequent removal should always be included.

  4. A Novel Functional Screen for New Breast Cancer Genes

    National Research Council Canada - National Science Library

    King, Mary-Claire; Welcsh, Piri L

    2005-01-01

    Genetic instability is a hallmark of tumor development. Mechanisms for maintenance of genomic stability are heterogeneous and identification of the genes responsible a critical goal of cancer biologists...

  5. Infrared microspectroscopy: a multiple-screening platform for investigating single-cell biochemical perturbations upon prion infection.

    Science.gov (United States)

    Didonna, Alessandro; Vaccari, Lisa; Bek, Alpan; Legname, Giuseppe

    2011-03-16

    Prion diseases are a group of fatal neurodegenerative disorders characterized by the accumulation of prions in the central nervous system. The pathogenic prion (PrP(Sc)) possesses the capability to convert the host-encoded cellular isoform of the prion protein, PrP(C), into nascent PrP(Sc). The present work aims at providing novel insight into cellular response upon prion infection evidenced by synchrotron radiation infrared microspectroscopy (SR-IRMS). This non-invasive, label-free analytical technique was employed to investigate the biochemical perturbations undergone by prion infected mouse hypothalamic GT1-1 cells at the cellular and subcellular level. A decrement in total cellular protein content upon prion infection was identified by infrared (IR) whole-cell spectra and validated by bicinchoninic acid assay and single-cell volume analysis by atomic force microscopy (AFM). Hierarchical cluster analysis (HCA) of IR data discriminated between infected and uninfected cells and allowed to deduce an increment of lysosomal bodies within the cytoplasm of infected GT1-1 cells, a hypothesis further confirmed by SR-IRMS at subcellular spatial resolution and fluorescent microscopy. The purpose of this work, therefore, consists of proposing IRMS as a powerful multiscreening platform, drawing on the synergy with conventional biological assays and microscopy techniques in order to increase the accuracy of investigations performed at the single-cell level.

  6. Infrared Microspectroscopy: A Multiple-Screening Platform for Investigating Single-Cell Biochemical Perturbations upon Prion Infection

    Science.gov (United States)

    2011-01-01

    Prion diseases are a group of fatal neurodegenerative disorders characterized by the accumulation of prions in the central nervous system. The pathogenic prion (PrPSc) possesses the capability to convert the host-encoded cellular isoform of the prion protein, PrPC, into nascent PrPSc. The present work aims at providing novel insight into cellular response upon prion infection evidenced by synchrotron radiation infrared microspectroscopy (SR-IRMS). This non-invasive, label-free analytical technique was employed to investigate the biochemical perturbations undergone by prion infected mouse hypothalamic GT1-1 cells at the cellular and subcellular level. A decrement in total cellular protein content upon prion infection was identified by infrared (IR) whole-cell spectra and validated by bicinchoninic acid assay and single-cell volume analysis by atomic force microscopy (AFM). Hierarchical cluster analysis (HCA) of IR data discriminated between infected and uninfected cells and allowed to deduce an increment of lysosomal bodies within the cytoplasm of infected GT1-1 cells, a hypothesis further confirmed by SR-IRMS at subcellular spatial resolution and fluorescent microscopy. The purpose of this work, therefore, consists of proposing IRMS as a powerful multiscreening platform, drawing on the synergy with conventional biological assays and microscopy techniques in order to increase the accuracy of investigations performed at the single-cell level. PMID:22778865

  7. Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues.

    Science.gov (United States)

    Pei, Wuhong; Xu, Lisha; Huang, Sunny C; Pettie, Kade; Idol, Jennifer; Rissone, Alberto; Jimenez, Erin; Sinclair, Jason W; Slevin, Claire; Varshney, Gaurav K; Jones, MaryPat; Carrington, Blake; Bishop, Kevin; Huang, Haigen; Sood, Raman; Lin, Shuo; Burgess, Shawn M

    2018-01-01

    Regenerative medicine holds great promise for both degenerative diseases and traumatic tissue injury which represent significant challenges to the health care system. Hearing loss, which affects hundreds of millions of people worldwide, is caused primarily by a permanent loss of the mechanosensory receptors of the inner ear known as hair cells. This failure to regenerate hair cells after loss is limited to mammals, while all other non-mammalian vertebrates tested were able to completely regenerate these mechanosensory receptors after injury. To understand the mechanism of hair cell regeneration and its association with regeneration of other tissues, we performed a guided mutagenesis screen using zebrafish lateral line hair cells as a screening platform to identify genes that are essential for hair cell regeneration, and further investigated how genes essential for hair cell regeneration were involved in the regeneration of other tissues. We created genetic mutations either by retroviral insertion or CRISPR/Cas9 approaches, and developed a high-throughput screening pipeline for analyzing hair cell development and regeneration. We screened 254 gene mutations and identified 7 genes specifically affecting hair cell regeneration. These hair cell regeneration genes fell into distinct and somewhat surprising functional categories. By examining the regeneration of caudal fin and liver, we found these hair cell regeneration genes often also affected other types of tissue regeneration. Therefore, our results demonstrate guided screening is an effective approach to discover regeneration candidates, and hair cell regeneration is associated with other tissue regeneration.

  8. Method for Screening Compounds That Influence Virulence Gene Expression in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Nielsen, A.; Nielsen, Kristian Fog; Frees, D.

    2010-01-01

    We present a simple assay to examine effects of compounds on virulence gene expression in the human pathogen Staphylococcus aureus. The assay employs transcriptional reporter strains carrying lacZ fused to central virulence genes. Compounds affecting virulence gene expression and activity...... of the agr locus are scored based on color change in the presence of a chromogenic beta-galactosidase substrate. The assay can be used to screen for novel antivirulence compounds from many different sources, such as fungi, as demonstrated here....

  9. Dual gene activation and knockout screen reveals directional dependencies in genetic networks. | Office of Cancer Genomics

    Science.gov (United States)

    Understanding the direction of information flow is essential for characterizing how genetic networks affect phenotypes. However, methods to find genetic interactions largely fail to reveal directional dependencies. We combine two orthogonal Cas9 proteins from Streptococcus pyogenes and Staphylococcus aureus to carry out a dual screen in which one gene is activated while a second gene is deleted in the same cell. We analyze the quantitative effects of activation and knockout to calculate genetic interaction and directionality scores for each gene pair.

  10. SPINE: SParse eIgengene NEtwork linking gene expression clusters in Dehalococcoides mccartyi to perturbations in experimental conditions.

    Directory of Open Access Journals (Sweden)

    Cresten B Mansfeldt

    Full Text Available We present a statistical model designed to identify the effect of experimental perturbations on the aggregate behavior of the transcriptome expressed by the bacterium Dehalococcoides mccartyi strain 195. Strains of Dehalococcoides are used in sub-surface bioremediation applications because they organohalorespire tetrachloroethene and trichloroethene (common chlorinated solvents that contaminate the environment to non-toxic ethene. However, the biochemical mechanism of this process remains incompletely described. Additionally, the response of Dehalococcoides to stress-inducing conditions that may be encountered at field-sites is not well understood. The constructed statistical model captured the aggregate behavior of gene expression phenotypes by modeling the distinct eigengenes of 100 transcript clusters, determining stable relationships among these clusters of gene transcripts with a sparse network-inference algorithm, and directly modeling the effect of changes in experimental conditions by constructing networks conditioned on the experimental state. Based on the model predictions, we discovered new response mechanisms for DMC, notably when the bacterium is exposed to solvent toxicity. The network identified a cluster containing thirteen gene transcripts directly connected to the solvent toxicity condition. Transcripts in this cluster include an iron-dependent regulator (DET0096-97 and a methylglyoxal synthase (DET0137. To validate these predictions, additional experiments were performed. Continuously fed cultures were exposed to saturating levels of tetrachloethene, thereby causing solvent toxicity, and transcripts that were predicted to be linked to solvent toxicity were monitored by quantitative reverse-transcription polymerase chain reaction. Twelve hours after being shocked with saturating levels of tetrachloroethene, the control transcripts (encoding for a key hydrogenase and the 16S rRNA did not significantly change. By contrast

  11. Comparative Screening of Digestion Tract Toxic Genes in Proteus mirabilis.

    Science.gov (United States)

    Shi, Xiaolu; Lin, Yiman; Qiu, Yaqun; Li, Yinghui; Jiang, Min; Chen, Qiongcheng; Jiang, Yixiang; Yuan, Jianhui; Cao, Hong; Hu, Qinghua; Huang, Shenghe

    2016-01-01

    Proteus mirabilis is a common urinary tract pathogen, and may induce various inflammation symptoms. Its notorious ability to resist multiple antibiotics and to form urinary tract stones makes its treatment a long and painful process, which is further challenged by the frequent horizontal gene transferring events in P. mirabilis genomes. Three strains of P. mirabilis C02011/C04010/C04013 were isolated from a local outbreak of a food poisoning event in Shenzhen, China. Our hypothesis is that new genes may have been acquired horizontally to exert the digestion tract infection and toxicity. The functional characterization of these three genomes shows that each of them independently acquired dozens of virulent genes horizontally from the other microbial genomes. The representative strain C02011 induces the symptoms of both vomit and diarrhea, and has recently acquired a complete type IV secretion system and digestion tract toxic genes from the other bacteria.

  12. SCREENING OF COMMON FLAX FAD GENES BY PCR

    Directory of Open Access Journals (Sweden)

    Veronika Štefúnová

    2013-02-01

    Full Text Available Currently, flax (Linum usitatissimum L. is an important crop from commercial and economical aspects. In the spotlight is the linseed oil as a source of α-linolenic acid. The aim of presented study was to analyse fatty acid desaturase (FAD genes in flax. Several genotypes of flax (Hohenheim, La Plata 1938, Redwing USA and Escalina were used. The primers described by Vrinten et al. (2005 were used for PCR amplification reactions. Two FAD3 genes, LuFAD3A and LuFAD3B, were identified in a genome of flax. Subsequently the nucleotide sequences between origins and genotypes of flax FAD genes were compared. Primarily were used the nucleotide sequences of FAD2 and FAD3C genes available in NCBI database. Differences were found using BLAST program in nucleotide sequences of FAD genes and the specific primers were designed to amplify a specific target sequences in a genome of flax. These primers were used in PCR amplification reactions to identification of FAD2 and FAD3C genes. The PCR products were separated by electrophoresis on agarose gel.

  13. High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kassir, Yona

    2017-01-01

    Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

  14. Molecular screening of pituitary adenomas for gene mutations and rearrangements

    Energy Technology Data Exchange (ETDEWEB)

    Herman, V.; Drazin, N.Z.; Gonskey, R.; Melmed, S. (Cedars-Sinai Medical Center, Los Angeles, CA (United States))

    1993-07-01

    Although pituitary tumors arise as benign monoclonal neoplasms, genetic alterations have not readily been identified in these adenomas. The authors studied restriction fragment abnormalities involving the GH gene locus, and mutations in the p53 and H-, K-, and N-ras genes in 22 human GH cell adenomas. Twenty two nonsecretory adenomas were also examined for p53 and ras gene mutations. Seven prolactinoma DNA samples were tested for deletions in the multiple endocrine neoplasia-1 (MEN-1) locus, as well as for rearrangements in the hst gene, a member of the fibroblast growth factor family. In DNA from GH-cell adenomas, identical GH restriction patterns were detected in both pituitary and lymphocyte DNA in all patients and in one patient with a mixed GH-TSH cell adenoma. Using polymerase chain reaction (PCR)-single stranded conformation polymorphism analysis, no mutations were detected in exons 5, 6, 7 and 8 of the p53 gene in GH cell adenomas nor in 22 nonsecretory adenomas. Codons 12/13 and 61 of H-ras, K-ras, and N-ras genes were also intact on GH cell adenomas and in nonsecretory adenomas. Site-specific probes for chromosome 11q13 including, PYGM, D11S146, and INT2 were used in 7 sporadic PRL-secreting adenomas to detect deletions of the MEN-1 locus on chromosome 11. One patient was identified with a loss of 11p, and the remaining 6 patients did not demonstrate loss of heterozygosity in the pituitary 11q13 locus, compared to lymphocyte DNA. None of these patients demonstrated hst gene rearrangements which also maps to this locus. These results show that p53 and ras gene mutations are not common events in the pathogenesis of acromegaly and nonsecretory tumors. Although hst gene rearrangements and deletions of 11q13 are not associated with sporadic PRl-cell adenoma formation, a single patient was detected with a partial loss of chromosome 11, including the putative MEN-1 site. 31 refs., 5 figs., 2 tabs.

  15. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  16. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  17. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  18. Ortholog-based screening and identification of genes related to intracellular survival.

    Science.gov (United States)

    Yang, Xiaowen; Wang, Jiawei; Bing, Guoxia; Bie, Pengfei; De, Yanyan; Lyu, Yanli; Wu, Qingmin

    2018-04-20

    Bioinformatics and comparative genomics analysis methods were used to predict unknown pathogen genes based on homology with identified or functionally clustered genes. In this study, the genes of common pathogens were analyzed to screen and identify genes associated with intracellular survival through sequence similarity, phylogenetic tree analysis and the λ-Red recombination system test method. The total 38,952 protein-coding genes of common pathogens were divided into 19,775 clusters. As demonstrated through a COG analysis, information storage and processing genes might play an important role intracellular survival. Only 19 clusters were present in facultative intracellular pathogens, and not all were present in extracellular pathogens. Construction of a phylogenetic tree selected 18 of these 19 clusters. Comparisons with the DEG database and previous research revealed that seven other clusters are considered essential gene clusters and that seven other clusters are associated with intracellular survival. Moreover, this study confirmed that clusters screened by orthologs with similar function could be replaced with an approved uvrY gene and its orthologs, and the results revealed that the usg gene is associated with intracellular survival. The study improves the current understanding of intracellular pathogens characteristics and allows further exploration of the intracellular survival-related gene modules in these pathogens. Copyright © 2018. Published by Elsevier B.V.

  19. Utilization of gene mapping and candidate gene mutation screening for diagnosing clinically equivocal conditions: a Norrie disease case study.

    Science.gov (United States)

    Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem

    2014-06-01

    Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.

  20. RNA Interference Screen to Identify Pathways That Enhance or Reduce Nonviral Gene Transfer During Lipofection

    OpenAIRE

    Barker, Gregory A; Diamond, Scott L

    2008-01-01

    Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In con...

  1. Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea.

    Science.gov (United States)

    Nakahara, Yoshiki; Sawabe, Shogo; Kainuma, Kenta; Katsuhara, Maki; Shibasaka, Mineo; Suzuki, Masanori; Yamamoto, Kosuke; Oguri, Suguru; Sakamoto, Hikaru

    2015-01-01

    Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1) a novel protein highly homologous to thaumatin-like proteins, (2) a novel coiled-coil protein of unknown function, and (3) a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

  2. Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea

    Directory of Open Access Journals (Sweden)

    Yoshiki eNakahara

    2015-10-01

    Full Text Available Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1 a novel protein highly homologous to thaumatin-like proteins, (2 a novel coiled-coil protein of unknown function, and (3 a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

  3. Screens

    OpenAIRE

    2016-01-01

    This Sixth volume in the series The Key Debates. Mutations and Appropriations in European Film Studies investigates the question of screens in the context both of the dematerialization due to digitalization and the multiplication of media screens. Scholars offer various infomations and theories of topics such as the archeology of screen, film and media theories, contemporary art, pragmatics of new ways of screening (from home video to street screening).

  4. The Candidate Cancer Gene Database: a database of cancer driver genes from forward genetic screens in mice.

    Science.gov (United States)

    Abbott, Kenneth L; Nyre, Erik T; Abrahante, Juan; Ho, Yen-Yi; Isaksson Vogel, Rachel; Starr, Timothy K

    2015-01-01

    Identification of cancer driver gene mutations is crucial for advancing cancer therapeutics. Due to the overwhelming number of passenger mutations in the human tumor genome, it is difficult to pinpoint causative driver genes. Using transposon mutagenesis in mice many laboratories have conducted forward genetic screens and identified thousands of candidate driver genes that are highly relevant to human cancer. Unfortunately, this information is difficult to access and utilize because it is scattered across multiple publications using different mouse genome builds and strength metrics. To improve access to these findings and facilitate meta-analyses, we developed the Candidate Cancer Gene Database (CCGD, http://ccgd-starrlab.oit.umn.edu/). The CCGD is a manually curated database containing a unified description of all identified candidate driver genes and the genomic location of transposon common insertion sites (CISs) from all currently published transposon-based screens. To demonstrate relevance to human cancer, we performed a modified gene set enrichment analysis using KEGG pathways and show that human cancer pathways are highly enriched in the database. We also used hierarchical clustering to identify pathways enriched in blood cancers compared to solid cancers. The CCGD is a novel resource available to scientists interested in the identification of genetic drivers of cancer. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response. | Office of Cancer Genomics

    Science.gov (United States)

    Functional genomics efforts face tradeoffs between number of perturbations examined and complexity of phenotypes measured. We bridge this gap with Perturb-seq, which combines droplet-based single-cell RNA-seq with a strategy for barcoding CRISPR-mediated perturbations, allowing many perturbations to be profiled in pooled format. We applied Perturb-seq to dissect the mammalian unfolded protein response (UPR) using single and combinatorial CRISPR perturbations. Two genome-scale CRISPR interference (CRISPRi) screens identified genes whose repression perturbs ER homeostasis.

  6. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  7. Database for High Throughput Screening Hits (dHITS): a simple tool to retrieve gene specific phenotypes from systematic screens done in yeast.

    Science.gov (United States)

    Chuartzman, Silvia G; Schuldiner, Maya

    2018-03-25

    In the last decade several collections of Saccharomyces cerevisiae yeast strains have been created. In these collections every gene is modified in a similar manner such as by a deletion or the addition of a protein tag. Such libraries have enabled a diversity of systematic screens, giving rise to large amounts of information regarding gene functions. However, often papers describing such screens focus on a single gene or a small set of genes and all other loci affecting the phenotype of choice ('hits') are only mentioned in tables that are provided as supplementary material and are often hard to retrieve or search. To help unify and make such data accessible, we have created a Database of High Throughput Screening Hits (dHITS). The dHITS database enables information to be obtained about screens in which genes of interest were found as well as the other genes that came up in that screen - all in a readily accessible and downloadable format. The ability to query large lists of genes at the same time provides a platform to easily analyse hits obtained from transcriptional analyses or other screens. We hope that this platform will serve as a tool to facilitate investigation of protein functions to the yeast community. © 2018 The Authors Yeast Published by John Wiley & Sons Ltd.

  8. RNA interference screen to identify pathways that enhance or reduce nonviral gene transfer during lipofection.

    Science.gov (United States)

    Barker, Gregory A; Diamond, Scott L

    2008-09-01

    Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In confirmation tests with single siRNAs, 18 of the 130 hits showed enhanced lipofection with two or more individual siRNAs in the absence of cytotoxicity. Of these confirmed gene targets, we identified five leading candidates, two of which are isoforms of the regulatory subunit of protein phosphatase 2A (PP2A). The best candidate siRNA targeted the PPP2R2C gene and produced a 65% increase in luminescence from lipofection, with a quantitative PCR-validated knockdown of approximately 76%. Flow cytometric analysis confirmed that the silencing of the PPP2R2C gene resulted in an improvement of 10% in transfection efficiency, thereby demonstrating an increase in the number of transfected cells. These results show that an RNA interference (RNAi) high-throughput screen (HTS) can be applied to nonviral gene transfer. We have also demonstrated that siRNAs can be co-delivered with lipofected DNA to increase the transfection efficiency in vitro.

  9. Perturbation theory

    International Nuclear Information System (INIS)

    Bartlett, R.; Kirtman, B.; Davidson, E.R.

    1978-01-01

    After noting some advantages of using perturbation theory some of the various types are related on a chart and described, including many-body nonlinear summations, quartic force-field fit for geometry, fourth-order correlation approximations, and a survey of some recent work. Alternative initial approximations in perturbation theory are also discussed. 25 references

  10. RPE65 gene: multiplex PCR and mutation screening in patients from ...

    Indian Academy of Sciences (India)

    Unknown

    The RPE65 protein is believed to play an important role in the metabolism of vitamin A in the ... PCR and mutation screening in patients from India with retinal degenerative diseases. ..... Bennett J. 2001 Gene therapy restores vision in a canine.

  11. A genetic screen identifies interferon-α effector genes required to suppress hepatitis C virus replication.

    Science.gov (United States)

    Fusco, Dahlene N; Brisac, Cynthia; John, Sinu P; Huang, Yi-Wen; Chin, Christopher R; Xie, Tiao; Zhao, Hong; Jilg, Nikolaus; Zhang, Leiliang; Chevaliez, Stephane; Wambua, Daniel; Lin, Wenyu; Peng, Lee; Chung, Raymond T; Brass, Abraham L

    2013-06-01

    Hepatitis C virus (HCV) infection is a leading cause of end-stage liver disease. Interferon-α (IFNα) is an important component of anti-HCV therapy; it up-regulates transcription of IFN-stimulated genes, many of which have been investigated for their antiviral effects. However, all of the genes required for the antiviral function of IFNα (IFN effector genes [IEGs]) are not known. IEGs include not only IFN-stimulated genes, but other nontranscriptionally induced genes that are required for the antiviral effect of IFNα. In contrast to candidate approaches based on analyses of messenger RNA (mRNA) expression, identification of IEGs requires a broad functional approach. We performed an unbiased genome-wide small interfering RNA screen to identify IEGs that inhibit HCV. Huh7.5.1 hepatoma cells were transfected with small interfering RNAs incubated with IFNα and then infected with JFH1 HCV. Cells were stained using HCV core antibody, imaged, and analyzed to determine the percent infection. Candidate IEGs detected in the screen were validated and analyzed further. The screen identified 120 previously unreported IEGs. From these, we more fully evaluated the following: asparagine-linked glycosylation 10 homolog (yeast, α-1,2-glucosyltransferase); butyrylcholinesterase; dipeptidyl-peptidase 4 (CD26, adenosine deaminase complexing protein 2); glucokinase (hexokinase 4) regulator; guanylate cyclase 1, soluble, β 3; MYST histone acetyltransferase 1; protein phosphatase 3 (formerly 2B), catalytic subunit, β isoform; peroxisomal proliferator-activated receptor-γ-DBD-interacting protein 1; and solute carrier family 27 (fatty acid transporter), member 2; and demonstrated that they enabled IFNα-mediated suppression of HCV at multiple steps of its life cycle. Expression of these genes had more potent effects against flaviviridae because a subset was required for IFNα to suppress dengue virus but not influenza A virus. In addition, many of the host genes detected in this

  12. Overexpression screens identify conserved dosage chromosome instability genes in yeast and human cancer

    Science.gov (United States)

    Duffy, Supipi; Fam, Hok Khim; Wang, Yi Kan; Styles, Erin B.; Kim, Jung-Hyun; Ang, J. Sidney; Singh, Tejomayee; Larionov, Vladimir; Shah, Sohrab P.; Andrews, Brenda; Boerkoel, Cornelius F.; Hieter, Philip

    2016-01-01

    Somatic copy number amplification and gene overexpression are common features of many cancers. To determine the role of gene overexpression on chromosome instability (CIN), we performed genome-wide screens in the budding yeast for yeast genes that cause CIN when overexpressed, a phenotype we refer to as dosage CIN (dCIN), and identified 245 dCIN genes. This catalog of genes reveals human orthologs known to be recurrently overexpressed and/or amplified in tumors. We show that two genes, TDP1, a tyrosyl-DNA-phosphdiesterase, and TAF12, an RNA polymerase II TATA-box binding factor, cause CIN when overexpressed in human cells. Rhabdomyosarcoma lines with elevated human Tdp1 levels also exhibit CIN that can be partially rescued by siRNA-mediated knockdown of TDP1. Overexpression of dCIN genes represents a genetic vulnerability that could be leveraged for selective killing of cancer cells through targeting of an unlinked synthetic dosage lethal (SDL) partner. Using SDL screens in yeast, we identified a set of genes that when deleted specifically kill cells with high levels of Tdp1. One gene was the histone deacetylase RPD3, for which there are known inhibitors. Both HT1080 cells overexpressing hTDP1 and rhabdomyosarcoma cells with elevated levels of hTdp1 were more sensitive to histone deacetylase inhibitors valproic acid (VPA) and trichostatin A (TSA), recapitulating the SDL interaction in human cells and suggesting VPA and TSA as potential therapeutic agents for tumors with elevated levels of hTdp1. The catalog of dCIN genes presented here provides a candidate list to identify genes that cause CIN when overexpressed in cancer, which can then be leveraged through SDL to selectively target tumors. PMID:27551064

  13. Construction of the BAC Library of Small Abalone (Haliotis diversicolor) for Gene Screening and Genome Characterization.

    Science.gov (United States)

    Jiang, Likun; You, Weiwei; Zhang, Xiaojun; Xu, Jian; Jiang, Yanliang; Wang, Kai; Zhao, Zixia; Chen, Baohua; Zhao, Yunfeng; Mahboob, Shahid; Al-Ghanim, Khalid A; Ke, Caihuan; Xu, Peng

    2016-02-01

    The small abalone (Haliotis diversicolor) is one of the most important aquaculture species in East Asia. To facilitate gene cloning and characterization, genome analysis, and genetic breeding of it, we constructed a large-insert bacterial artificial chromosome (BAC) library, which is an important genetic tool for advanced genetics and genomics research. The small abalone BAC library includes 92,610 clones with an average insert size of 120 Kb, equivalent to approximately 7.6× of the small abalone genome. We set up three-dimensional pools and super pools of 18,432 BAC clones for target gene screening using PCR method. To assess the approach, we screened 12 target genes in these 18,432 BAC clones and identified 16 positive BAC clones. Eight positive BAC clones were then sequenced and assembled with the next generation sequencing platform. The assembled contigs representing these 8 BAC clones spanned 928 Kb of the small abalone genome, providing the first batch of genome sequences for genome evaluation and characterization. The average GC content of small abalone genome was estimated as 40.33%. A total of 21 protein-coding genes, including 7 target genes, were annotated into the 8 BACs, which proved the feasibility of PCR screening approach with three-dimensional pools in small abalone BAC library. One hundred fifty microsatellite loci were also identified from the sequences for marker development in the future. The BAC library and clone pools provided valuable resources and tools for genetic breeding and conservation of H. diversicolor.

  14. A Morpholino-based screen to identify novel genes involved in craniofacial morphogenesis

    Science.gov (United States)

    Melvin, Vida Senkus; Feng, Weiguo; Hernandez-Lagunas, Laura; Artinger, Kristin Bruk; Williams, Trevor

    2014-01-01

    BACKGROUND The regulatory mechanisms underpinning facial development are conserved between diverse species. Therefore, results from model systems provide insight into the genetic causes of human craniofacial defects. Previously, we generated a comprehensive dataset examining gene expression during development and fusion of the mouse facial prominences. Here, we used this resource to identify genes that have dynamic expression patterns in the facial prominences, but for which only limited information exists concerning developmental function. RESULTS This set of ~80 genes was used for a high throughput functional analysis in the zebrafish system using Morpholino gene knockdown technology. This screen revealed three classes of cranial cartilage phenotypes depending upon whether knockdown of the gene affected the neurocranium, viscerocranium, or both. The targeted genes that produced consistent phenotypes encoded proteins linked to transcription (meis1, meis2a, tshz2, vgll4l), signaling (pkdcc, vlk, macc1, wu:fb16h09), and extracellular matrix function (smoc2). The majority of these phenotypes were not altered by reduction of p53 levels, demonstrating that both p53 dependent and independent mechanisms were involved in the craniofacial abnormalities. CONCLUSIONS This Morpholino-based screen highlights new genes involved in development of the zebrafish craniofacial skeleton with wider relevance to formation of the face in other species, particularly mouse and human. PMID:23559552

  15. PCR Screening of Antibiotic Resistance Genes in Faecal Samples from Australian and Chinese Children.

    Science.gov (United States)

    Ravensdale, Joshua T; Xian, Darren Ten Wei; Wei, Chooi Ming; Lv, Quanjun; Wen, Xiajian; Guo, Jing; Coorey, Ranil; LeSouëf, Peter; Lu, Fengmin; Zhang, Brad; Dykes, Gary A

    2018-03-31

    Recent public awareness campaigns on the risk of antibiotic resistance in pathogenic microbes has placed pressure on governments to enforce stricter antimicrobial stewardship policies on the hospital and agricultural industry. This study aimed to screen faecal samples from Australian and Chinese children for the presence of antibiotic resistance genes to identify demographics at risk of carriage of these genes and examine antimicrobial stewardship policies from the two countries which may influence carriage. Faecal samples from 46 Australian and 53 Chinese children were screened for the presence of six clinically relevant antibiotic resistance genes using PCR. Clinical and demographic data was also collected from each patient. Over 90% of faecal samples from Chinese children tested positive for β-lactam, macrolide, tetracycline, and aminoglycoside resistance genes, which was substantially higher than Australian samples. Besides country of origin, no clear trend could be seen to predict carriage of resistance genes. The exception to this was Chinese born children who immigrated to Australia having higher rates of carriage for bla TEM and tetM genes than children born and still living in Australia. These data indicated that Chinese children were more likely to carry certain antibiotic resistance genes than Australian children. The Chinese government has recently implemented strict policies to control the overuse of antibiotics in hospitals. However, many of these policies do not extend to the agricultural industry which could explain the differences seen in this study. Copyright © 2018. Published by Elsevier Ltd.

  16. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

    Science.gov (United States)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

    2018-02-12

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

  17. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  18. A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death.

    Science.gov (United States)

    Ma, Hongming; Dang, Ying; Wu, Yonggan; Jia, Gengxiang; Anaya, Edgar; Zhang, Junli; Abraham, Sojan; Choi, Jang-Gi; Shi, Guojun; Qi, Ling; Manjunath, N; Wu, Haoquan

    2015-07-28

    West Nile virus (WNV) causes an acute neurological infection attended by massive neuronal cell death. However, the mechanism(s) behind the virus-induced cell death is poorly understood. Using a library containing 77,406 sgRNAs targeting 20,121 genes, we performed a genome-wide screen followed by a second screen with a sub-library. Among the genes identified, seven genes, EMC2, EMC3, SEL1L, DERL2, UBE2G2, UBE2J1, and HRD1, stood out as having the strongest phenotype, whose knockout conferred strong protection against WNV-induced cell death with two different WNV strains and in three cell lines. Interestingly, knockout of these genes did not block WNV replication. Thus, these appear to be essential genes that link WNV replication to downstream cell death pathway(s). In addition, the fact that all of these genes belong to the ER-associated protein degradation (ERAD) pathway suggests that this might be the primary driver of WNV-induced cell death. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Genome-wide RNAi screening identifies genes inhibiting the migration of glioblastoma cells.

    Directory of Open Access Journals (Sweden)

    Jian Yang

    Full Text Available Glioblastoma Multiforme (GBM cells are highly invasive, infiltrating into the surrounding normal brain tissue, making it impossible to completely eradicate GBM tumors by surgery or radiation. Increasing evidence also shows that these migratory cells are highly resistant to cytotoxic reagents, but decreasing their migratory capability can re-sensitize them to chemotherapy. These evidences suggest that the migratory cell population may serve as a better therapeutic target for more effective treatment of GBM. In order to understand the regulatory mechanism underlying the motile phenotype, we carried out a genome-wide RNAi screen for genes inhibiting the migration of GBM cells. The screening identified a total of twenty-five primary hits; seven of them were confirmed by secondary screening. Further study showed that three of the genes, FLNA, KHSRP and HCFC1, also functioned in vivo, and knocking them down caused multifocal tumor in a mouse model. Interestingly, two genes, KHSRP and HCFC1, were also found to be correlated with the clinical outcome of GBM patients. These two genes have not been previously associated with cell migration.

  20. Screening key genes for abdominal aortic aneurysm based on gene expression omnibus dataset.

    Science.gov (United States)

    Wan, Li; Huang, Jingyong; Ni, Haizhen; Yu, Guanfeng

    2018-02-13

    Abdominal aortic aneurysm (AAA) is a common cardiovascular system disease with high mortality. The aim of this study was to identify potential genes for diagnosis and therapy in AAA. We searched and downloaded mRNA expression data from the Gene Expression Omnibus (GEO) database to identify differentially expressed genes (DEGs) from AAA and normal individuals. Then, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analysis, transcriptional factors (TFs) network and protein-protein interaction (PPI) network were used to explore the function of genes. Additionally, immunohistochemical (IHC) staining was used to validate the expression of identified genes. Finally, the diagnostic value of identified genes was accessed by receiver operating characteristic (ROC) analysis in GEO database. A total of 1199 DEGs (188 up-regulated and 1011 down-regulated) were identified between AAA and normal individual. KEGG pathway analysis displayed that vascular smooth muscle contraction and pathways in cancer were significantly enriched signal pathway. The top 10 up-regulated and top 10 down-regulated DEGs were used to construct TFs and PPI networks. Some genes with high degrees such as NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16 and FOXO1 were identified to be related to AAA. The consequences of IHC staining showed that CCR7 and PDGFA were up-regulated in tissue samples of AAA. ROC analysis showed that NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16, FOXO1 and PDGFA had the potential diagnostic value for AAA. The identified genes including NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16, FOXO1 and PDGFA might be involved in the pathology of AAA.

  1. Screen for genes involved in radiation survival of Escherichia coli and construction of a reference database

    Energy Technology Data Exchange (ETDEWEB)

    Sargentini, Neil J., E-mail: nsargentini@atsu.edu; Gularte, Nicholas P.; Hudman, Deborah A.

    2016-11-15

    Highlights: • 3907 Keio knockout mutants of E. coli screened for UV and X-radiation sensitivity. • 76 mutants showed significantly increased radiation sensitivity. • A database of 9 screening studies listed 352 genes only once; 103 genes, 2–7 times. • 33 genes from this study are uncommon and potentially novel. • Common and uncommon genes differ in gene function profile. - Abstract: A set of 3907 single-gene knockout (Keio collection) strains of Escherichia coli K-12 was examined for strains with increased susceptibility to killing by X- or UV-radiation. After screening with a high-throughput resazurin-based assay and determining radiation survival with triplicate clonogenic assays, we identified 76 strains (and associated deleted genes) showing statistically-significant increased radiation sensitivity compared to a control strain. To determine gene novelty, we constructed a reference database comprised of genes found in nine similar studies including ours. This database contains 455 genes comprised of 103 common genes (found 2–7 times), and 352 uncommon genes (found once). Our 76 genes includes 43 common genes and 33 uncommon (potentially novel) genes, i.e., appY, atoS, betB, bglJ, clpP, cpxA, cysB, cysE, ddlA, dgkA, dppF, dusB, elfG, eutK, fadD, glnA, groL, guaB, intF, prpR, queA, rplY, seqA, sufC,yadG, yagJ, yahD, yahO, ybaK, ybfA, yfaL, yhjV, and yiaL. Of our 33 uncommon gene mutants, 4 (12%) were sensitive only to UV-radiation, 10 (30%) only to X-radiation, and 19 (58%) to both radiations. Our uncommon mutants vs. our common mutants showed more radiation specificity, i.e., 12% vs. 9% (sensitive only to UV-); 30% vs. 16% (X-) and 58% vs. 74% (both radiations). Considering just our radiation-sensitive mutants, the median UV-radiation survival (75 J m{sup −2}) for 23 uncommon mutants was 6.84E-3 compared to 1.85E-3 for 36 common mutants (P = 0.025). Similarly, the average X-radiation survival for 29 uncommon mutants was 1.08E-2, compared to 6.19E

  2. A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

    2005-01-05

    A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

  3. Protocols for screening antimicrobial peptides that influence virulence gene expression in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bojer, Martin Saxtorph; Baldry, Mara; Ingmer, Hanne

    2017-01-01

    Compounds that inhibit virulence gene expression in bacterial pathogens have received increasing interest as possible alternatives to the traditional antibiotic treatment of infections. For the human pathogen Staphylococcus aureus, we have developed two simple assays based on reporter gene fusions...... to central virulence genes that are easily applicable for screening various sources of natural and synthetic peptides for anti-virulence effects. The plate assay is qualitative but simultaneously assesses the effect of gradient concentrations of the investigated compound, whereas the liquid assay...... is quantitative and can be employed to address whether a compound is acting on the central quorum sensing regulatory system, agr, that controls a large number of virulence genes in S. aureus....

  4. RNAi screen of DAF-16/FOXO target genes in C. elegans links pathogenesis and dauer formation.

    Directory of Open Access Journals (Sweden)

    Victor L Jensen

    2010-12-01

    Full Text Available The DAF-16/FOXO transcription factor is the major downstream output of the insulin/IGF1R signaling pathway controlling C. elegans dauer larva development and aging. To identify novel downstream genes affecting dauer formation, we used RNAi to screen candidate genes previously identified to be regulated by DAF-16. We used a sensitized genetic background [eri-1(mg366; sdf-9(m708], which enhances both RNAi efficiency and constitutive dauer formation (Daf-c. Among 513 RNAi clones screened, 21 displayed a synthetic Daf-c (SynDaf phenotype with sdf-9. One of these genes, srh-100, was previously identified to be SynDaf, but twenty have not previously been associated with dauer formation. Two of the latter genes, lys-1 and cpr-1, are known to participate in innate immunity and six more are predicted to do so, suggesting that the immune response may contribute to the dauer decision. Indeed, we show that two of these genes, lys-1 and clc-1, are required for normal resistance to Staphylococcus aureus. clc-1 is predicted to function in epithelial cohesion. Dauer formation exhibited by daf-8(m85, sdf-9(m708, and the wild-type N2 (at 27°C were all enhanced by exposure to pathogenic bacteria, while not enhanced in a daf-22(m130 background. We conclude that knockdown of the genes required for proper pathogen resistance increases pathogenic infection, leading to increased dauer formation in our screen. We propose that dauer larva formation is a behavioral response to pathogens mediated by increased dauer pheromone production.

  5. A modifier screen for Bazooka/PAR-3 interacting genes in the Drosophila embryo epithelium.

    Directory of Open Access Journals (Sweden)

    Wei Shao

    2010-04-01

    Full Text Available The development and homeostasis of multicellular organisms depends on sheets of epithelial cells. Bazooka (Baz; PAR-3 localizes to the apical circumference of epithelial cells and is a key hub in the protein interaction network regulating epithelial structure. We sought to identify additional proteins that function with Baz to regulate epithelial structure in the Drosophila embryo.The baz zygotic mutant cuticle phenotype could be dominantly enhanced by loss of known interaction partners. To identify additional enhancers, we screened molecularly defined chromosome 2 and 3 deficiencies. 37 deficiencies acted as strong dominant enhancers. Using deficiency mapping, bioinformatics, and available single gene mutations, we identified 17 interacting genes encoding known and predicted polarity, cytoskeletal, transmembrane, trafficking and signaling proteins. For each gene, their loss of function enhanced adherens junction defects in zygotic baz mutants during early embryogenesis. To further evaluate involvement in epithelial polarity, we generated GFP fusion proteins for 15 of the genes which had not been found to localize to the apical domain previously. We found that GFP fusion proteins for Drosophila ASAP, Arf79F, CG11210, Septin 5 and Sds22 could be recruited to the apical circumference of epithelial cells. Nine of the other proteins showed various intracellular distributions, and one was not detected.Our enhancer screen identified 17 genes that function with Baz to regulate epithelial structure in the Drosophila embryo. Our secondary localization screen indicated that some of the proteins may affect epithelial cell polarity by acting at the apical cell cortex while others may act through intracellular processes. For 13 of the 17 genes, this is the first report of a link to baz or the regulation of epithelial structure.

  6. A genome scale RNAi screen identifies GLI1 as a novel gene regulating vorinostat sensitivity.

    Science.gov (United States)

    Falkenberg, K J; Newbold, A; Gould, C M; Luu, J; Trapani, J A; Matthews, G M; Simpson, K J; Johnstone, R W

    2016-07-01

    Vorinostat is an FDA-approved histone deacetylase inhibitor (HDACi) that has proven clinical success in some patients; however, it remains unclear why certain patients remain unresponsive to this agent and other HDACis. Constitutive STAT (signal transducer and activator of transcription) activation, overexpression of prosurvival Bcl-2 proteins and loss of HR23B have been identified as potential biomarkers of HDACi resistance; however, none have yet been used to aid the clinical utility of HDACi. Herein, we aimed to further elucidate vorinostat-resistance mechanisms through a functional genomics screen to identify novel genes that when knocked down by RNA interference (RNAi) sensitized cells to vorinostat-induced apoptosis. A synthetic lethal functional screen using a whole-genome protein-coding RNAi library was used to identify genes that when knocked down cooperated with vorinostat to induce tumor cell apoptosis in otherwise resistant cells. Through iterative screening, we identified 10 vorinostat-resistance candidate genes that sensitized specifically to vorinostat. One of these vorinostat-resistance genes was GLI1, an oncogene not previously known to regulate the activity of HDACi. Treatment of vorinostat-resistant cells with the GLI1 small-molecule inhibitor, GANT61, phenocopied the effect of GLI1 knockdown. The mechanism by which GLI1 loss of function sensitized tumor cells to vorinostat-induced apoptosis is at least in part through interactions with vorinostat to alter gene expression in a manner that favored apoptosis. Upon GLI1 knockdown and vorinostat treatment, BCL2L1 expression was repressed and overexpression of BCL2L1 inhibited GLI1-knockdown-mediated vorinostat sensitization. Taken together, we present the identification and characterization of GLI1 as a new HDACi resistance gene, providing a strong rationale for development of GLI1 inhibitors for clinical use in combination with HDACi therapy.

  7. Dried blood spots of pooled samples for RHD gene screening in blood donors of mixed ancestry.

    Science.gov (United States)

    Silva-Malta, M C F; Araujo, N C Fidélis; Vieira, O V Neves; Schmidt, L Cayres; Gonçalves, P de Cassia; Martins, M Lobato

    2015-10-01

    In this study, we present a strategy for RHD gene screening based on real-time polymerase chain reaction (PCR) using dried blood spots of pooled samples. Molecular analysis of blood donors may be used to detect RHD variants among the presumed D-negative individuals. RHD genotyping using pooled samples is a strategy to test a large number of samples at a more reasonable cost. RHD gene detection based on real-time PCR using dried blood spots of pooled samples was standardised and used to evaluate 1550 Brazilian blood donors phenotyped as RhD-negative. Positive results were re-evaluated by retesting single samples using real-time PCR and conventional multiplex PCR to amplify five RHD-specific exons. PCR-sequence-specific primers was used to amplify RHDψ allele. We devised a strategy for RHD gene screening using dried blood spots of five pooled samples. Among 1550 serologically D-negative blood donors, 58 (3.74%) had the RHD gene. The non-functional RHDψ allele was detected in 47 samples (3.02%). The present method is a promising strategy to detect the RHD gene among presumed RhD-negative blood donors, particularly for populations with African ancestry. © 2015 British Blood Transfusion Society.

  8. Mutation screening and association analysis of six candidate genes for autism on chromosome 7q

    DEFF Research Database (Denmark)

    Bonora, E.; Lamb, J.A.; Barnby, G.

    2005-01-01

    in the genes CUTL1, LAMB1 and PTPRZ1. Analysis of genetic variants provided evidence for association with autism for one of the new missense changes identified in LAMB1; this effect was stronger in a subgroup of affected male sibling pair families, implying a possible specific sex-related effect......Genetic studies have provided evidence for an autism susceptibility locus (AUTS1) on chromosome 7q. Screening for mutations in six genes mapping to 7q, CUTL1, SRPK2, SYPL, LAMB1, NRCAM and PTPRZ1 in 48 unrelated individuals with autism led to the identification of several new coding variants...

  9. Screening of potential biomarkers in uterine leiomyomas disease via gene expression profiling analysis.

    Science.gov (United States)

    Liu, Xuhui; Liu, Yanfei; Zhao, Jingrong; Liu, Yan

    2018-05-01

    The present study aimed to screen potential biomarkers for uterine leiomyomas disease, particularly target genes associated with the mediator of RNA polymerase II transcription subunit 12 (MED12) mutation. The microarray data of GSE30673, including 10 MED12 wild-type myometrium, 8 MED12 mutation leiomyoma and 2 MED12 wild-type leiomyoma samples, were downloaded from the Gene Expression Omnibus database. Compared with myometrium samples, differently-expressed genes (DEGs) in the MED12 mutation and wild-type leiomyoma samples were identified using the Limma package. The two sets of DEGs obtained were intersected to screen common DEGs. The DEGs in the MED12 mutation and wild-type leiomyoma samples, and common DEGs were defined as group A, B and C. Gene Ontology (GO) and pathway enrichment analyses were performed using the Database for Annotation, Visualization and Integrated Discovery online tool. Based on the Kyoto Encyclopedia of Genes and Genomes database, pathway relation networks were constructed. DEGs in GO terms and pathways were intersected to screen important DEGs. Subsequently, a gene co‑expression network was constructed and visualized using Cytoscape software. Reverse transcription‑quantitative polymerase chain reaction was used to detect the expression levels of important DEGs. A total of 1,258 DEGs in group A were screened, and enriched for extracellular matrix (ECM) organization and ECM‑receptor interaction. In addition, a total of 1,571 DEGs in group B were enriched for cell adhesion. Furthermore, 391 DEGs were involved in extracellular matrix organization. Pathway relation networks of group A, B and C were constructed with nodes of 48, 39, and 28, respectively. Finally, 135 important DEGs were obtained, including Acyl‑CoA synthetase medium‑chain family member 3, protein S (α) (PROS1) and F11 receptor. A gene co‑expression network with 68 nodes was constructed. The expression of caspase 1 (CASP1) and aldehyde dehydrogenase 1 family member

  10. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  11. Radioresistance related genes screened by protein-protein interaction network analysis in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Zhu Xiaodong; Guo Ya; Qu Song; Li Ling; Huang Shiting; Li Danrong; Zhang Wei

    2012-01-01

    Objective: To discover radioresistance associated molecular biomarkers and its mechanism in nasopharyngeal carcinoma by protein-protein interaction network analysis. Methods: Whole genome expression microarray was applied to screen out differentially expressed genes in two cell lines CNE-2R and CNE-2 with different radiosensitivity. Four differentially expressed genes were randomly selected for further verification by the semi-quantitative RT-PCR analysis with self-designed primers. The common differentially expressed genes from two experiments were analyzed with the SNOW online database in order to find out the central node related to the biomarkers of nasopharyngeal carcinoma radioresistance. The expression of STAT1 in CNE-2R and CNE-2 cells was measured by Western blot. Results: Compared with CNE-2 cells, 374 genes in CNE-2R cells were differentially expressed while 197 genes showed significant differences. Four randomly selected differentially expressed genes were verified by RT-PCR and had same change trend in consistent with the results of chip assay. Analysis with the SNOW database demonstrated that those 197 genes could form a complicated interaction network where STAT1 and JUN might be two key nodes. Indeed, the STAT1-α expression in CNE-2R was higher than that in CNE-2 (t=4.96, P<0.05). Conclusions: The key nodes of STAT1 and JUN may be the molecular biomarkers leading to radioresistance in nasopharyngeal carcinoma, and STAT1-α might have close relationship with radioresistance. (authors)

  12. A Genome-Wide Screen for Dendritically Localized RNAs Identifies Genes Required for Dendrite Morphogenesis

    Directory of Open Access Journals (Sweden)

    Mala Misra

    2016-08-01

    Full Text Available Localizing messenger RNAs at specific subcellular sites is a conserved mechanism for targeting the synthesis of cytoplasmic proteins to distinct subcellular domains, thereby generating the asymmetric protein distributions necessary for cellular and developmental polarity. However, the full range of transcripts that are asymmetrically distributed in specialized cell types, and the significance of their localization, especially in the nervous system, are not known. We used the EP-MS2 method, which combines EP transposon insertion with the MS2/MCP in vivo fluorescent labeling system, to screen for novel localized transcripts in polarized cells, focusing on the highly branched Drosophila class IV dendritic arborization neurons. Of a total of 541 lines screened, we identified 55 EP-MS2 insertions producing transcripts that were enriched in neuronal processes, particularly in dendrites. The 47 genes identified by these insertions encode molecularly diverse proteins, and are enriched for genes that function in neuronal development and physiology. RNAi-mediated knockdown confirmed roles for many of the candidate genes in dendrite morphogenesis. We propose that the transport of mRNAs encoded by these genes into the dendrites allows their expression to be regulated on a local scale during the dynamic developmental processes of dendrite outgrowth, branching, and/or remodeling.

  13. Traffic Perturbation

    CERN Multimedia

    C. Colloca TS/FM

    2004-01-01

    TS/FM group informs you that, for the progress of the works at the Prévessin site entrance, some perturbation of the traffic may occur during the week between the 14th and 18th of June for a short duration. Access will be assured at any time. For more information, please contact 160239. C. Colloca TS/FM

  14. NMD Microarray Analysis for Rapid Genome-Wide Screen of Mutated Genes in Cancer

    Directory of Open Access Journals (Sweden)

    Maija Wolf

    2005-01-01

    Full Text Available Gene mutations play a critical role in cancer development and progression, and their identification offers possibilities for accurate diagnostics and therapeutic targeting. Finding genes undergoing mutations is challenging and slow, even in the post-genomic era. A new approach was recently developed by Noensie and Dietz to prioritize and focus the search, making use of nonsense-mediated mRNA decay (NMD inhibition and microarray analysis (NMD microarrays in the identification of transcripts containing nonsense mutations. We combined NMD microarrays with array-based CGH (comparative genomic hybridization in order to identify inactivation of tumor suppressor genes in cancer. Such a “mutatomics” screening of prostate cancer cell lines led to the identification of inactivating mutations in the EPHB2 gene. Up to 8% of metastatic uncultured prostate cancers also showed mutations of this gene whose loss of function may confer loss of tissue architecture. NMD microarray analysis could turn out to be a powerful research method to identify novel mutated genes in cancer cell lines, providing targets that could then be further investigated for their clinical relevance and therapeutic potential.

  15. Combined Gene Expression and RNAi Screening to Identify Alkylation Damage Survival Pathways from Fly to Human.

    Science.gov (United States)

    Zanotto-Filho, Alfeu; Dashnamoorthy, Ravi; Loranc, Eva; de Souza, Luis H T; Moreira, José C F; Suresh, Uthra; Chen, Yidong; Bishop, Alexander J R

    2016-01-01

    Alkylating agents are a key component of cancer chemotherapy. Several cellular mechanisms are known to be important for its survival, particularly DNA repair and xenobiotic detoxification, yet genomic screens indicate that additional cellular components may be involved. Elucidating these components has value in either identifying key processes that can be modulated to improve chemotherapeutic efficacy or may be altered in some cancers to confer chemoresistance. We therefore set out to reevaluate our prior Drosophila RNAi screening data by comparison to gene expression arrays in order to determine if we could identify any novel processes in alkylation damage survival. We noted a consistent conservation of alkylation survival pathways across platforms and species when the analysis was conducted on a pathway/process level rather than at an individual gene level. Better results were obtained when combining gene lists from two datasets (RNAi screen plus microarray) prior to analysis. In addition to previously identified DNA damage responses (p53 signaling and Nucleotide Excision Repair), DNA-mRNA-protein metabolism (transcription/translation) and proteasome machinery, we also noted a highly conserved cross-species requirement for NRF2, glutathione (GSH)-mediated drug detoxification and Endoplasmic Reticulum stress (ER stress)/Unfolded Protein Responses (UPR) in cells exposed to alkylation. The requirement for GSH, NRF2 and UPR in alkylation survival was validated by metabolomics, protein studies and functional cell assays. From this we conclude that RNAi/gene expression fusion is a valid strategy to rapidly identify key processes that may be extendable to other contexts beyond damage survival.

  16. Combined Gene Expression and RNAi Screening to Identify Alkylation Damage Survival Pathways from Fly to Human.

    Directory of Open Access Journals (Sweden)

    Alfeu Zanotto-Filho

    Full Text Available Alkylating agents are a key component of cancer chemotherapy. Several cellular mechanisms are known to be important for its survival, particularly DNA repair and xenobiotic detoxification, yet genomic screens indicate that additional cellular components may be involved. Elucidating these components has value in either identifying key processes that can be modulated to improve chemotherapeutic efficacy or may be altered in some cancers to confer chemoresistance. We therefore set out to reevaluate our prior Drosophila RNAi screening data by comparison to gene expression arrays in order to determine if we could identify any novel processes in alkylation damage survival. We noted a consistent conservation of alkylation survival pathways across platforms and species when the analysis was conducted on a pathway/process level rather than at an individual gene level. Better results were obtained when combining gene lists from two datasets (RNAi screen plus microarray prior to analysis. In addition to previously identified DNA damage responses (p53 signaling and Nucleotide Excision Repair, DNA-mRNA-protein metabolism (transcription/translation and proteasome machinery, we also noted a highly conserved cross-species requirement for NRF2, glutathione (GSH-mediated drug detoxification and Endoplasmic Reticulum stress (ER stress/Unfolded Protein Responses (UPR in cells exposed to alkylation. The requirement for GSH, NRF2 and UPR in alkylation survival was validated by metabolomics, protein studies and functional cell assays. From this we conclude that RNAi/gene expression fusion is a valid strategy to rapidly identify key processes that may be extendable to other contexts beyond damage survival.

  17. Diagnostic yield, interpretation, and clinical utility of mutation screening of sarcomere encoding genes in Danish hypertrophic cardiomyopathy patients and relatives

    DEFF Research Database (Denmark)

    Andersen, Paal Skytt; Havndrup, Ole; Hougs, Lotte

    2008-01-01

    persons. Index patients were screened for mutations in all coding regions of 10 sarcomere genes (MYH7, MYL3, MYBPC3, TNNI3, TNNT2, TPM1, ACTC, CSRP3, TCAP, and TNNC1) and five exons of TTN. Relatives were screened for presence of minor or major diagnostic criteria for HCM and tracking of DNA variants...

  18. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

    Science.gov (United States)

    Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

    2012-06-01

    Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Adiponectin gene therapy ameliorates high-fat, high-sucrose diet-induced metabolic perturbations in mice.

    Science.gov (United States)

    Kandasamy, A D; Sung, M M; Boisvenue, J J; Barr, A J; Dyck, J R B

    2012-09-10

    Adiponectin is an adipokine secreted primarily from adipose tissue that can influence circulating plasma glucose and lipid levels through multiple mechanisms involving a variety of organs. In humans, reduced plasma adiponectin levels induced by obesity are associated with insulin resistance and type 2 diabetes, suggesting that low adiponectin levels may contribute the pathogenesis of obesity-related insulin resistance. The objective of the present study was to investigate whether gene therapy designed to elevate circulating adiponectin levels is a viable strategy for ameliorating insulin resistance in mice fed a high-fat, high-sucrose (HFHS) diet. Electroporation-mediated gene transfer of mouse adiponectin plasmid DNA into gastrocnemius muscle resulted in elevated serum levels of globular and high-molecular weight adiponectin compared with control mice treated with empty plasmid. In comparison to HFHS-fed mice receiving empty plasmid, mice receiving adiponectin gene therapy displayed significantly decreased weight gain following 13 weeks of HFHS diet associated with reduced fat accumulation, and exhibited increased oxygen consumption and locomotor activity as measured by indirect calorimetry, suggesting increased energy expenditure in these mice. Consistent with improved whole-body metabolism, mice receiving adiponectin gene therapy also had lower blood glucose and insulin levels, improved glucose tolerance and reduced hepatic gluconeogenesis compared with control mice. Furthermore, immunoblot analysis of livers from mice receiving adiponectin gene therapy showed an increase in insulin-stimulated phosphorylation of insulin signaling proteins. Based on these data, we conclude that adiponectin gene therapy ameliorates the metabolic abnormalities caused by feeding mice a HFHS diet and may be a potential therapeutic strategy to improve obesity-mediated impairments in insulin sensitivity.

  20. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

    International Nuclear Information System (INIS)

    Wang Xiaojuan; Song, Yu; Ma Yanhua; Zhuo Renying; Jin Liang

    2011-01-01

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: → Evaluate Cd tolerance in wide sources of alfalfa accessions. → Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. → Cloned differentially expressed metallothionein (MT) genes. → Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. → MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

  1. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  2. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

    Energy Technology Data Exchange (ETDEWEB)

    Wang Xiaojuan, E-mail: xiaojuanwang@lzu.edu.cn [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Song, Yu [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Environment Management College of China, Qinhuangdao 066004 (China); Ma Yanhua [Hebei Normal University of Science and Technology, Qinhuangdao 066004 (China); Zhuo Renying [Key Lab of Tree Genomics, Research Institute of Subtropical of Forest, Chinese Academy of Forest, Fuyang 311400 (China); Jin Liang [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China)

    2011-12-15

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: > Evaluate Cd tolerance in wide sources of alfalfa accessions. > Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. > Cloned differentially expressed metallothionein (MT) genes. > Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. > MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

  3. Global Screening of Antiviral Genes that Suppress Baculovirus Transgene Expression in Mammalian Cells.

    Science.gov (United States)

    Wang, Chia-Hung; Naik, Nenavath Gopal; Liao, Lin-Li; Wei, Sung-Chan; Chao, Yu-Chan

    2017-09-15

    Although baculovirus has been used as a safe and convenient gene delivery vector in mammalian cells, baculovirus-mediated transgene expression is less effective in various mammalian cell lines. Identification of the negative regulators in host cells is necessary to improve baculovirus-based expression systems. Here, we performed high-throughput shRNA library screening, targeting 176 antiviral innate immune genes, and identified 43 host restriction factor genes in a human A549 lung carcinoma cell line. Among them, suppression of receptor interaction protein kinase 1 (RIP1, also known as RIPK1) significantly increased baculoviral transgene expression without resulting in significant cell death. Silencing of RIP1 did not affect viral entry or cell viability, but it did inhibit nuclear translocation of the IRF3 and NF-κB transcription factors. Also, activation of downstream signaling mediators (such as TBK1 and IRF7) was affected, and subsequent interferon and cytokine gene expression levels were abolished. Further, Necrostatin-1 (Nec-1)-an inhibitor of RIP1 kinase activity-dramatically increased baculoviral transgene expression in RIP1-silenced cells. Using baculovirus as a model system, this study presents an initial investigation of large numbers of human cell antiviral innate immune response factors against a "nonadaptive virus." In addition, our study has made baculovirus a more efficient gene transfer vector for some of the most frequently used mammalian cell systems.

  4. SCREENING OF ANTIMICROBIAL ACTIVITY AND GENES CODING POLYKETIDE SYNTHETASE AND NONRIBOSOMAL PEPTIDE SYNTHETASE OF ACTINOMYCETE ISOLATES

    Directory of Open Access Journals (Sweden)

    Silvia Kovácsová

    2013-12-01

    Full Text Available The aim of this study was to observe antimicrobial activity using agar plate diffusion method and screening genes coding polyketide synthetase (PKS-I and nonribosomal peptide synthetase (NRPS from actinomycetes. A total of 105 actinomycete strains were isolated from arable soil. Antimicrobial activity was demonstrated at 54 strains against at least 1 of total 12 indicator organisms. Antifungal properties were recorded more often than antibacterial properties. The presence of PKS-I and NRPS genes were founded at 61 of total 105 strains. The number of strains with mentioned biosynthetic enzyme gene fragments matching the anticipated length were 19 (18% and 50 (47% respectively. Overall, five actinomycete strains carried all the biosynthetical genes, yet no antimicrobial activity was found against any of tested pathogens. On the other hand, twenty-one strains showed antimicrobial activity even though we were not able to amplify any of the PKS or NRPS genes from them. Combination of the two methods showed broad-spectrum antimicrobial activity of actinomycetes isolated from arable soil, which indicate that actinomycetes are valuable reservoirs of novel bioactive compounds.

  5. Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I.

    Science.gov (United States)

    Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J

    2012-01-01

    PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  6. Identification of immune protective genes of Eimeria maxima through cDNA expression library screening.

    Science.gov (United States)

    Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai

    2017-02-16

    Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our

  7. Mutation screening of the TP53 gene by temporal temperature gradient gel electrophoresis.

    Science.gov (United States)

    Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise

    2005-01-01

    A protocol for detection of mutations in the TP53 gene using temporal temperature gradient gel electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques denaturing gradient gel electrophoresis (DGGE) and constant denaturant gel electrophoresis (CDGE) and eliminates some of the problems. The result is a rapid and sensitive screening technique that is robust and easily set up in smaller laboratory environments.

  8. Mutation screening of the TP53 gene by temporal temperature gel electrophoresis (TTGE).

    Science.gov (United States)

    Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise

    2014-01-01

    A protocol for detection of mutations in the TP53 gene using temporal temperature gradient electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques, denaturing gradient gel electrophoresis and constant denaturant gel electrophoresis, and eliminates some of the problems. The result is a rapid and sensitive screening technique which is robust and easily set up in smaller laboratory environments.

  9. Screening for mutations in the uroporphyrinogen decarboxylase gene using denaturing gradient gel electrophoresis

    DEFF Research Database (Denmark)

    Christiansen, L; Ged, C; Hombrados, I

    1999-01-01

    to exon skipping, and a 2-bp deletion (415-416delTA) resulting in a frameshift and the introduction of a premature stop codon. Heterologous expression and enzymatic studies of the mutant proteins demonstrate that the three mutations leading to shortening or truncation of the UROD protein have no residual......, confirming the heterogeneity of the underlying genetic defects of these diseases. We have established a denaturing gradient gel electrophoresis (DGGE) assay for mutation detection in the UROD gene, enabling the simultaneous screening for known and unknown mutations. The established assay has proved able...

  10. Perturbation of B Cell Gene Expression Persists in HIV-Infected Children Despite Effective Antiretroviral Therapy and Predicts H1N1 Response.

    Science.gov (United States)

    Cotugno, Nicola; De Armas, Lesley; Pallikkuth, Suresh; Rinaldi, Stefano; Issac, Biju; Cagigi, Alberto; Rossi, Paolo; Palma, Paolo; Pahwa, Savita

    2017-01-01

    Despite effective antiretroviral therapy (ART), HIV-infected individuals with apparently similar clinical and immunological characteristics can vary in responsiveness to vaccinations. However, molecular mechanisms responsible for such impairment, as well as biomarkers able to predict vaccine responsiveness in HIV-infected children, remain unknown. Following the hypothesis that a B cell qualitative impairment persists in HIV-infected children (HIV) despite effective ART and phenotypic B cell immune reconstitution, the aim of the current study was to investigate B cell gene expression of HIV compared to age-matched healthy controls (HCs) and to determine whether distinct gene expression patterns could predict the ability to respond to influenza vaccine. To do so, we analyzed prevaccination transcriptional levels of a 96-gene panel in equal numbers of sort-purified B cell subsets (SPBS) isolated from peripheral blood mononuclear cells using multiplexed RT-PCR. Immune responses to H1N1 antigen were determined by hemaglutination inhibition and memory B cell ELISpot assays following trivalent-inactivated influenza vaccination (TIV) for all study participants. Although there were no differences in terms of cell frequencies of SPBS between HIV and HC, the groups were distinguishable based upon gene expression analyses. Indeed, a 28-gene signature, characterized by higher expression of genes involved in the inflammatory response and immune activation was observed in activated memory B cells (CD27 + CD21 - ) from HIV when compared to HC despite long-term viral control (>24 months). Further analysis, taking into account H1N1 responses after TIV in HIV participants, revealed that a 25-gene signature in resting memory (RM) B cells (CD27 + CD21 + ) was able to distinguish vaccine responders from non-responders (NR). In fact, prevaccination RM B cells of responders showed a higher expression of gene sets involved in B cell adaptive immune responses ( APRIL, BTK, BLIMP1 ) and

  11. A negative screen for mutations in calstabin 1 and 2 genes in patients with dilated cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Biagi Diogo G

    2012-01-01

    Full Text Available Abstract Background Calstabins 1 and 2 bind to Ryanodine receptors regulating muscle excitation-contraction coupling. Mutations in Ryanodine receptors affecting their interaction with calstabins lead to different cardiac pathologies. Animal studies suggest the involvement of calstabins with dilated cardiomyopathy. Results We tested the hypothesis that calstabins mutations may cause dilated cardiomyopathy in humans screening 186 patients with idiopathic dilated cardiomyopathy for genetic alterations in calstabins 1 and 2 genes (FKBP12 and FKBP12.6. No missense variant was found. Five no-coding variations were found but not related to the disease. Conclusions These data corroborate other studies suggesting that mutations in FKBP12 and FKBP12.6 genes are not commonly related to cardiac diseases.

  12. Screening for susceptibility genes in hereditary non-polyposis colorectal cancer.

    Science.gov (United States)

    Yu, Li; Yin, Bo; Qu, Kaiying; Li, Jingjing; Jin, Qiao; Liu, Ling; Liu, Chunlan; Zhu, Yuxing; Wang, Qi; Peng, Xiaowei; Zhou, Jianda; Cao, Peiguo; Cao, Ke

    2018-06-01

    In the present study, hereditary non-polyposis colorectal cancer (HNPCC) susceptibility genes were screened for using whole exome sequencing in 3 HNPCC patients from 1 family and using single nucleotide polymorphism (SNP) genotyping assays in 96 other colorectal cancer and control samples. Peripheral blood was obtained from 3 HNPCC patients from 1 family; the proband and the proband's brother and cousin. High-throughput sequencing was performed using whole exome capture technology. Sequences were aligned against the HAPMAP, dbSNP130 and 1,000 Genome Project databases. Reported common variations and synonymous mutations were filtered out. Non-synonymous single nucleotide variants in the 3 HNPCC patients were integrated and the candidate genes were identified. Finally, SNP genotyping was performed for the genes in 96 peripheral blood samples. In total, 60.4 Gb of data was retrieved from the 3 HNPCC patients using whole exome capture technology. Subsequently, according to certain screening criteria, 15 candidate genes were identified. Among the 96 samples that had been SNP genotyped, 92 were successfully genotyped for 15 gene loci, while genotyping for HTRA1 failed in 4 sporadic colorectal cancer patient samples. In 12 control subjects and 81 sporadic colorectal cancer patients, genotypes at 13 loci were wild-type, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 . The CEP290 genotype was mutant in 1 sporadic colorectal cancer patient and was wild-type in all other subjects. A total of 5 of the 12 control subjects and 30 of the 81 sporadic colorectal cancer patients had a mutant HTRA1 genotype. In all 3 HNPCC patients, the same mutant genotypes were identified at all 15 gene loci. Overall, 13 potential susceptibility genes for HNPCC were identified, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 .

  13. DNA methylation perturbations in genes involved in polyunsaturated Fatty Acid biosynthesis associated with depression and suicide risk.

    Science.gov (United States)

    Haghighi, Fatemeh; Galfalvy, Hanga; Chen, Sean; Huang, Yung-Yu; Cooper, Thomas B; Burke, Ainsley K; Oquendo, Maria A; Mann, J John; Sublette, M Elizabeth

    2015-01-01

    Polyunsaturated fatty acid (PUFA) status has been associated with neuropsychiatric disorders, including depression and risk of suicide. Long-chain PUFAs (LC-PUFAs) are obtained in the diet or produced by sequential desaturation and elongation of shorter-chain precursor fatty acids linoleic acid (LA, 18:2n-6) and α-linolenic acid (ALA, 18:3n-3). We compared DNA methylation patterns in genes involved in LC-PUFA biosynthesis in major depressive disorder (MDD) with (n = 22) and without (n = 39) history of suicide attempt, and age- and sex-matched healthy volunteers (n = 59). Plasma levels of selected PUFAs along the LC-PUFA biosynthesis pathway were determined by transesterification and gas chromatography. CpG methylation levels for the main human LC-PUFA biosynthetic genes, fatty acid desaturases 1 (Fads1) and 2 (Fads2), and elongation of very long-chain fatty acids protein 5 (Elovl5), were assayed by bisulfite pyrosequencing. Associations between PUFA levels and diagnosis or suicide attempt status did not survive correction for multiple testing. However, MDD diagnosis and suicide attempts were significantly associated with DNA methylation in Elovl5 gene regulatory regions. Also the relative roles of PUFA levels and DNA methylation with respect to diagnostic and suicide attempt status were determined by least absolute shrinkage and selection operator logistic regression analyses. We found that PUFA associations with suicide attempt status were explained by effects of Elovl5 DNA methylation within the regulatory regions. The observed link between plasma PUFA levels, DNA methylation, and suicide risk may have implications for modulation of disease-associated epigenetic marks by nutritional intervention.

  14. DNA methylation perturbations in genes involved in polyunsaturated fatty acid biosynthesis associated with depression and suicide risk

    Directory of Open Access Journals (Sweden)

    Fatemeh eHaghighi

    2015-04-01

    Full Text Available Polyunsaturated fatty acid (PUFA status has been associated with neuropsychiatric disorders, including depression and risk of suicide. Long-chain PUFAs (LC-PUFAs are obtained in the diet or produced by sequential desaturation and elongation of shorter-chain precursor fatty acids linoleic acid (LA, 18:2n-6 and α-linolenic acid (ALA, 18:3n-3. We compared DNA methylation patterns in genes involved in LC-PUFA biosynthesis in major depressive disorder (MDD with (n=22 and without (n=39 history of suicide attempt, and age- and sex-matched healthy volunteers (n=59. Plasma levels of selected PUFAs along the LC-PUFA biosynthesis pathway were determined by transesterification and gas chromatography. CpG methylation levels for the main human LC-PUFA biosynthetic genes, fatty acid desaturases 1 (Fads1 and 2 (Fads2, and elongation of very long chain fatty acids protein 5 (Elovl5, were assayed by bisulfite pyrosequencing. Associations between PUFA levels and diagnosis or suicide attempt status did not survive correction for multiple testing. However, MDD diagnosis and suicide attempts were significantly associated with DNA methylation in Elovl5 gene regulatory regions. Also the relative roles of PUFA levels and DNA methylation with respect to diagnostic and suicide attempt status were determined by least absolute shrinkage and selection operator (LASSO logistic regression analyses. We found that PUFA associations with suicide attempt status were explained by effects of Elovl5 DNA methylation within the regulatory regions. The observed link between plasma PUFA levels, DNA methylation, and suicide risk may have implications for modulation of disease-associated epigenetic marks by nutritional intervention.

  15. Novel gene function revealed by mouse mutagenesis screens for models of age-related disease.

    Science.gov (United States)

    Potter, Paul K; Bowl, Michael R; Jeyarajan, Prashanthini; Wisby, Laura; Blease, Andrew; Goldsworthy, Michelle E; Simon, Michelle M; Greenaway, Simon; Michel, Vincent; Barnard, Alun; Aguilar, Carlos; Agnew, Thomas; Banks, Gareth; Blake, Andrew; Chessum, Lauren; Dorning, Joanne; Falcone, Sara; Goosey, Laurence; Harris, Shelley; Haynes, Andy; Heise, Ines; Hillier, Rosie; Hough, Tertius; Hoslin, Angela; Hutchison, Marie; King, Ruairidh; Kumar, Saumya; Lad, Heena V; Law, Gemma; MacLaren, Robert E; Morse, Susan; Nicol, Thomas; Parker, Andrew; Pickford, Karen; Sethi, Siddharth; Starbuck, Becky; Stelma, Femke; Cheeseman, Michael; Cross, Sally H; Foster, Russell G; Jackson, Ian J; Peirson, Stuart N; Thakker, Rajesh V; Vincent, Tonia; Scudamore, Cheryl; Wells, Sara; El-Amraoui, Aziz; Petit, Christine; Acevedo-Arozena, Abraham; Nolan, Patrick M; Cox, Roger; Mallon, Anne-Marie; Brown, Steve D M

    2016-08-18

    Determining the genetic bases of age-related disease remains a major challenge requiring a spectrum of approaches from human and clinical genetics to the utilization of model organism studies. Here we report a large-scale genetic screen in mice employing a phenotype-driven discovery platform to identify mutations resulting in age-related disease, both late-onset and progressive. We have utilized N-ethyl-N-nitrosourea mutagenesis to generate pedigrees of mutagenized mice that were subject to recurrent screens for mutant phenotypes as the mice aged. In total, we identify 105 distinct mutant lines from 157 pedigrees analysed, out of which 27 are late-onset phenotypes across a range of physiological systems. Using whole-genome sequencing we uncover the underlying genes for 44 of these mutant phenotypes, including 12 late-onset phenotypes. These genes reveal a number of novel pathways involved with age-related disease. We illustrate our findings by the recovery and characterization of a novel mouse model of age-related hearing loss.

  16. Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.

    Science.gov (United States)

    Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid

    2009-04-01

    Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.

  17. Screening of SHOX gene sequence variants in Saudi Arabian children with idiopathic short stature.

    Science.gov (United States)

    Alharthi, Abdulla A; El-Hallous, Ehab I; Talaat, Iman M; Alghamdi, Hamed A; Almalki, Matar I; Gaber, Ahmed

    2017-10-01

    Short stature affects approximately 2%-3% of children, representing one of the most frequent disorders for which clinical attention is sought during childhood. Despite assumed genetic heterogeneity, mutations or deletions in the short stature homeobox-containing gene ( SHOX ) are frequently detected in subjects with short stature. Idiopathic short stature (ISS) refers to patients with short stature for various unknown reasons. The goal of this study was to screen all the exons of SHOX to identify related mutations. We screened all the exons of SHOX for mutations analysis in 105 ISS children patients (57 girls and 48 boys) living in Taif governorate, KSA using a direct DNA sequencing method. Height, arm span, and sitting height were recorded, and subischial leg length was calculated. A total of 30 of 105 ISS patients (28%) contained six polymorphic variants in exons 1, 2, 4, and 6. One mutation was found in the DNA domain binding region of exon 4. Three of these polymorphic variants were novel, while the others were reported previously. There were no significant differences in anthropometric measures in ISS patients with and without identifiable polymorphic variants in SHOX . In Saudi Arabia ISS patients, rather than SHOX , it is possible that new genes are involved in longitudinal growth. Additional molecular analysis is required to diagnose and understand the etiology of this disease.

  18. Path from schizophrenia genomics to biology: gene regulation and perturbation in neurons derived from induced pluripotent stem cells and genome editing.

    Science.gov (United States)

    Duan, Jubao

    2015-02-01

    Schizophrenia (SZ) is a devastating mental disorder afflicting 1% of the population. Recent genome-wide association studies (GWASs) of SZ have identified >100 risk loci. However, the causal variants/genes and the causal mechanisms remain largely unknown, which hinders the translation of GWAS findings into disease biology and drug targets. Most risk variants are noncoding, thus likely regulate gene expression. A major mechanism of transcriptional regulation is chromatin remodeling, and open chromatin is a versatile predictor of regulatory sequences. MicroRNA-mediated post-transcriptional regulation plays an important role in SZ pathogenesis. Neurons differentiated from patient-specific induced pluripotent stem cells (iPSCs) provide an experimental model to characterize the genetic perturbation of regulatory variants that are often specific to cell type and/or developmental stage. The emerging genome-editing technology enables the creation of isogenic iPSCs and neurons to efficiently characterize the effects of SZ-associated regulatory variants on SZ-relevant molecular and cellular phenotypes involving dopaminergic, glutamatergic, and GABAergic neurotransmissions. SZ GWAS findings equipped with the emerging functional genomics approaches provide an unprecedented opportunity for understanding new disease biology and identifying novel drug targets.

  19. Preconception Screening for Gene Polymorphisms Associated with Thrombophilia and Hyperhomocysteinemia Risk in Healthy Young Women

    Directory of Open Access Journals (Sweden)

    Elena Yu. Glotova

    2013-09-01

    Full Text Available The frequency characteristics of the gene polymorphisms (FVL G1691A, FII G20210A, MTHFR C677T, MTHFR A1298C, MTRR A66G associated with thrombophilia, hyperhomocysteinemia risk and different perinatal or pregnancy complications were studied. This examination was conducted among 130 planned-pregnancy healthy young women aged between 19 and 29 years. A gene mutation analysis was performed using a real-time polymerase chain reaction (real-time PCR. Factor V Leiden (FVL G1691A and prothrombin gene (FII G20210A mutations were not identified in the women surveyed. The frequency of the occurrence of the heterozygous FVL 1691G/A genotype associated with the risk of thrombosis during pregnancy was very low in these women (0.8%. The frequency of the MTHFR (methylenetetrahydrofolate reductase 1298C/С mutant genotype was 11.5%, MTHFR 677T/Т – 5.4%, and MTRR (methionine synthase reductase 66G/G – 31.5%. A combination of the MTHFR 677TT/1298CC and MTHFR 677TТ/MTRR 66GG mutant genotypes, which significantly increased the risk of pregnancy loss and neural tube defects, were found to occur in 0.8% of the cases.We concluded that selective thrombophilia screening (FVL G1691A and FII G20210A based on prior personal and/or family history of venous thromboembolism was more cost-effective than a universal preconception screening in all planning pregnancy women. However, in order to decrease the risk of congenital anomalies and pregnancy complications associated with folate dependent homocysteine metabolism, preconception care should include folate supplementation

  20. Genetic basis of prune belly syndrome: screening for HNF1β gene.

    Science.gov (United States)

    Granberg, Candace F; Harrison, Steven M; Dajusta, Daniel; Zhang, Shaohua; Hajarnis, Sachin; Igarashi, Peter; Baker, Linda A

    2012-01-01

    Although the cause of prune belly syndrome is unknown, familial evidence suggests a genetic component. Recently 2 nonfamilial cases of prune belly syndrome with chromosome 17q12 deletions encompassing the HNF1β gene have made this a candidate gene for prune belly syndrome. To date, there has been no large-scale screening of patients with prune belly syndrome for HNF1β mutations. We assessed the role of HNF1β in prune belly syndrome by screening for genomic mutations with functional characterization of any detected mutations. We studied patients with prune belly syndrome who were prospectively enrolled in our Pediatric Genitourinary DNA Repository since 2001. DNA from patient samples was amplified by polymerase chain reaction, sequenced for coding and splice regions of the HNF1β gene, and compared to control databases. We performed functional assay testing of the ability of mutant HNF1β to activate a luciferase construct with an HNF1β DNA binding site. From 32 prune belly syndrome probands (30 males, 2 females) HNF1β sequencing detected a missense mutation (V61G) in 1 child with prune belly syndrome. Absent in control databases, V61G was previously reported in 2 patients without prune belly syndrome who had congenital genitourinary anomalies. Functional testing showed similar luciferase activity compared to wild-type HNF1β, suggesting the V61G substitution does not disturb HNF1β function. One genomic HNF1β mutation was detected in 3% of patients with prune belly syndrome but found to be functionally normal. Thus, functionally significant HNF1β mutations are uncommon in prune belly syndrome, despite case reports of HNF1β deletions. Further genetic study is necessary, as identification of the genetic basis of prune belly syndrome may ultimately lead to prevention and improved treatments for this rare but severe syndrome. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  1. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  2. GNAI3: Another Candidate Gene to Screen in Persons with Ocular Albinism

    Science.gov (United States)

    Young, Alejandra; Sader, Avery; Farber, Debora B.

    2016-01-01

    Ocular albinism type 1 (OA), caused by mutations in the OA1 gene, encodes a G-protein coupled receptor, OA1, localized in melanosomal membranes of the retinal pigment epithelium (RPE). This disorder is characterized by both RPE macro-melanosomes and abnormal decussation of ganglion cell axons at the brain’s optic chiasm. We demonstrated previously that Oa1 specifically activates Gαi3, which also signals in the Oa1 transduction pathway that regulates melanosomal biogenesis. In this study, we screened the human Gαi3 gene, GNAI3, in DNA samples from 26 patients who had all clinical characteristics of OA but in whom a specific mutation in the OA1 gene had not been found, and in 6 normal control individuals. Using the Agilent HaloPlex Target Enrichment System and next-generation sequencing (NGS) on the Illumina MiSeq platform, we identified 518 variants after rigorous filtering. Many of these variants were corroborated by Sanger sequencing. Overall, 98.8% coverage of the GNAI3 gene was obtained by the HaloPlex amplicons. Of all variants, 6 non-synonymous and 3 synonymous were in exons, 41 in a non-coding exon embedded in the 3’ untranslated region (UTR), 6 in the 5’ UTR, and 462 in introns. These variants included novel SNVs, insertions, deletions, and a frameshift mutation. All were found in at least one patient but none in control samples. Using computational methods, we modeled the GNAI3 protein and its non-synonymous exonic mutations and determined that several of these may be the cause of disease in the patients studied. Thus, we have identified GNAI3 as a second gene possibly responsible for X-linked ocular albinism. PMID:27607449

  3. GNAI3: Another Candidate Gene to Screen in Persons with Ocular Albinism.

    Directory of Open Access Journals (Sweden)

    Alejandra Young

    Full Text Available Ocular albinism type 1 (OA, caused by mutations in the OA1 gene, encodes a G-protein coupled receptor, OA1, localized in melanosomal membranes of the retinal pigment epithelium (RPE. This disorder is characterized by both RPE macro-melanosomes and abnormal decussation of ganglion cell axons at the brain's optic chiasm. We demonstrated previously that Oa1 specifically activates Gαi3, which also signals in the Oa1 transduction pathway that regulates melanosomal biogenesis. In this study, we screened the human Gαi3 gene, GNAI3, in DNA samples from 26 patients who had all clinical characteristics of OA but in whom a specific mutation in the OA1 gene had not been found, and in 6 normal control individuals. Using the Agilent HaloPlex Target Enrichment System and next-generation sequencing (NGS on the Illumina MiSeq platform, we identified 518 variants after rigorous filtering. Many of these variants were corroborated by Sanger sequencing. Overall, 98.8% coverage of the GNAI3 gene was obtained by the HaloPlex amplicons. Of all variants, 6 non-synonymous and 3 synonymous were in exons, 41 in a non-coding exon embedded in the 3' untranslated region (UTR, 6 in the 5' UTR, and 462 in introns. These variants included novel SNVs, insertions, deletions, and a frameshift mutation. All were found in at least one patient but none in control samples. Using computational methods, we modeled the GNAI3 protein and its non-synonymous exonic mutations and determined that several of these may be the cause of disease in the patients studied. Thus, we have identified GNAI3 as a second gene possibly responsible for X-linked ocular albinism.

  4. Screening of Dystrophin Gene Deletions in Egyptian Patients with DMD/BMD Muscular Dystrophies

    Directory of Open Access Journals (Sweden)

    Laila K. Effat

    2000-01-01

    Full Text Available Duchenne muscular dystrophy (DMD and Becker muscular dystrophy (BMD are allelic disorders caused by mutations within the dystrophin gene. Our study has identified 100 Egyptian families collected from the Human Genetics Clinic, National Research Center, Cairo. All cases were subjected to complete clinical evaluation pedigree analysis, electromyography studies, estimation of serum creatine phosphokinase enzyme (CPK levels and DNA analysis. Multiplex PCR using 18 pairs of specific primers were used for screening of deletion mutations within the dystrophin gene. A frequency of 55% among the families. Sixty per cent of detected deletions involved multiple exons spanning the major or the minor hot spot of the dystrophin gene. The remainder 40% which mainly involved exon 45. Comparing these findings with frequencies of other countries it was found that our figures fall within the reported range of 40%– for deletions. The distribution of deletions in our study and other different studies was variable and specific ethnic differences do not apparently account for specific deletions. In addition this study concluded that employment of the 18 exon analysis is a cost effective and a highly accurate (97% to launch a nationwide program.

  5. Screening for Glucosyltransferase gene (gtf from exopolysaccahride producing lactic acid bacteria

    Directory of Open Access Journals (Sweden)

    Donna M. Ariestanti

    2008-04-01

    Full Text Available Glucosyltransferase (GTF is an enzyme involved in exopolysaccharide (EPS polymer synthesis in microbes. One example of EPS that has been used in pharmaceutical and medical application is dextran. Dextran has been used in conjugated-drug delivery system as matrix. As a group of microbes producing EPS, lactic acid bacteria (LAB have been well reported carrying sucrase genes glucosyltransferase (gtf, as well as fructosyltransferases (ftf. In an attempt to search for novel gtf genes as the aim of this study, LAB collection isolated from local sources yielded from previous study were screened performing PCR using degenerate primers DegFor and DegRev. An approximately 660 base pairs (bp amplicons were obtained by using genomic DNAs of those LAB isolates as templates with conserved region of gtf genes catalytic domain as target. Two out of 20 LAB strains were yielded no amplicon as observed on agarose gel, while one strain exhibited non-specific amplicon DNA bands with sizes other than 660 bp. The two negative ones were isolated from soil obtained from dairy product waste field and from waste of soy sauce from previous study, while the latter was isolated from waste of soy sauce.

  6. Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis.

    Science.gov (United States)

    Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R

    2017-08-07

    The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.

  7. Careful with That Axe, Gene, Genome Perturbation after a PEG-Mediated Protoplast Transformation in Fusarium verticillioides.

    Science.gov (United States)

    Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall'Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter

    2017-05-31

    Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1 , in F. verticillioides . A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1 -deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1 -mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome.

  8. Careful with That Axe, Gene, Genome Perturbation after a PEG-Mediated Protoplast Transformation in Fusarium verticillioides

    Directory of Open Access Journals (Sweden)

    Valeria Scala

    2017-05-01

    Full Text Available Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1, in F. verticillioides. A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1-deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1-mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome.

  9. Model for screening of resonant magnetic perturbations by plasma in a realistic tokamak geometry and its impact on divertor strike points

    Czech Academy of Sciences Publication Activity Database

    Cahyna, Pavel; Nardon, E.

    2011-01-01

    Roč. 415, č. 1 (2011), S927-S931 ISSN 0022-3115. [International Conference on Plasma-Surface Interactions in Controlled Fusion Device/19th./. San Diego, 24.05.2010-28.05.2010] R&D Projects: GA MŠk 7G09042; GA MŠk LA08048 Institutional research plan: CEZ:AV0Z20430508 Keywords : tokamaks * ELM control * resonant magnetic perturbations * divertor Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 2.052, year: 2011 http://dx.doi.org/10.1016/j.jnucmat.2011.01.117

  10. A small interfering RNA screen of genes involved in DNA repair identifies tumor-specific radiosensitization by POLQ knockdown

    DEFF Research Database (Denmark)

    Higgins, Geoff S; Prevo, Remko; Lee, Yin-Fai

    2010-01-01

    The effectiveness of radiotherapy treatment could be significantly improved if tumor cells could be rendered more sensitive to ionizing radiation (IR) without altering the sensitivity of normal tissues. However, many of the key therapeutically exploitable mechanisms that determine intrinsic tumor...... radiosensitivity are largely unknown. We have conducted a small interfering RNA (siRNA) screen of 200 genes involved in DNA damage repair aimed at identifying genes whose knockdown increased tumor radiosensitivity. Parallel siRNA screens were conducted in irradiated and unirradiated tumor cells (SQ20B......) and irradiated normal tissue cells (MRC5). Using gammaH2AX foci at 24 hours after IR, we identified several genes, such as BRCA2, Lig IV, and XRCC5, whose knockdown is known to cause increased cell radiosensitivity, thereby validating the primary screening end point. In addition, we identified POLQ (DNA...

  11. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    Science.gov (United States)

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

    2014-10-18

    the different subtype have the similar clinical manifestations, signs, enzyme detection and electromyography changes. Muscle biopsy plays an important role in the selection of genes to be detected. Hot spot mutation in C-terminal of the RYR1 gene can only be identified in patients with central core disease, so we suggest this hot spot gene mutation screening apply to the suspicious patient with central core disease only.

  12. Screening non-classical 21-hydroxylase gene deficiency from patients diagnosed as polycystic ovary syndrome by gene assay

    Directory of Open Access Journals (Sweden)

    Jie HU

    2016-04-01

    Full Text Available Objective  To screen non-classical 21-hydroxylase deficiency (NC-21OHD from patients diagnosed as polycystic ovary syndrome (PCOS by gene assay. Methods  Ninety-eight patients with PCOS were enrolled according to 2003 Rotterdam criteria from Department of Endocrinology, Tangdu Hospital of Fourth Military Medical University, and they were divided into three groups according to the modified Ferriman-Gallway (mF-G score as follows: group A with score 0-2; group B with score 3-5, and group C with score ≥6. Meanwhile, 30 healthy subjects from the Medical Center of the Hospital were recruited as control group. Peripheral blood of all subjects were collected for extracting DNA, the CYP21A2 gene were amplified by 5 pairs of specific primers, and then the PCR products were sequenced by Shanghai Sangon Co. The subjects would accept test for serum cortisol and adrenocorticotropic hormone (ACTH at 8:00am if their CYP21A2 was proved to be abnormal. Results  Thirty subjects of control group had no any defects in CYP21A2, but 5 of 98 patients with PCOS were proved to be deficient in CYP21A2, and the genotypes were V281L/920-921insT (P1, V281L/I230M (P2, V281L/Normal (P3, P4, P5, respectively, and all of them were heterozygous mutations. The incidences of NC-21OHD in group C and B were 28.6% and 3.3%, respectively. Genotype P1 had been identified to belong to NC-21OHD, which was consistent with its clinical phenotype. All genotypes P3, P4 and P5 belonged to carriers. But for P2, since I230M hadn't been reported in literature, the patient with V281L/I230M couldn't be classified now. Serum biochemical results showed that only in P1 the cortisol was close to the normal lower level, and ACTH was close to the normal upper limit of the reported level in the literature, and the remainders were all normal. Conclusions  Although PCOS and NC-21OHD are very similar in clinical manifestations, they are different completely in the pathogenesis and treatment. So it

  13. BRCA1 and BRCA2 Gene Mutations Screening In Sporadic Breast Cancer Patients In Kazakhstan.

    Directory of Open Access Journals (Sweden)

    Ainur R. Akilzhanova

    2013-05-01

    Full Text Available Background: A large number of distinct mutations in the BRCA1 and BRCA2 genes have been reported worldwide, but little is known regarding the role of these inherited susceptibility genes in breast cancer risk among Kazakhstan women. Aim: To evaluate the role of BRCA1/2 mutations in Kazakhstan women presenting with sporadic breast cancer. Methods: We investigated the distribution and nature of polymorphisms in BRCA1 and BRCA2 entire coding regions in 156 Kazakhstan sporadic breast cancer cases and 112 age-matched controls using automatic direct sequencing. Results: We identified 22 distinct variants, including 16 missense mutations and 6 polymorphisms in BRCA1/2 genes. In BRCA1, 9 missense mutations and 3 synonymous polymorphisms were observed. In BRCA2, 7 missense mutations and 3 polymorphisms were detected. There was a higher prevalence of observed mutations in Caucasian breast cancer cases compared to Asian cases (p<0.05; higher frequencies of sequence variants were observed in Asian controls. No recurrent or founder mutations were observed in BRCA1/2 genes. There were no statistically significant differences in age at diagnosis, tumor histology, size of tumor, and lymph node involvement between women with breast cancer with or without the BRCA sequence alterations. Conclusions: Considering the majority of breast cancer cases are sporadic, the present study will be helpful in the evaluation of the need for the genetic screening of BRCA1/2 mutations and reliable genetic counseling for Kazakhstan sporadic breast cancer patients. Evaluation of common polymorphisms and mutations and breast cancer risk in families with genetic predisposition to breast cancer is ongoing in another current investigation. 

  14. Identifying genes that extend life span using a high-throughput screening system.

    Science.gov (United States)

    Chen, Cuiying; Contreras, Roland

    2007-01-01

    We developed a high-throughput functional genomic screening system that allows identification of genes prolonging lifespan in the baker's yeast Saccharomyces cerevisiae. The method is based on isolating yeast mother cells with a higher than average number of cell divisions as indicated by the number of bud scars on their surface. Fluorescently labeled wheat germ agglutinin (WGA) was used for specific staining of chitin, a major component of bud scars. The critical new steps in our bud-scar-sorting system are the use of small microbeads, which allows successive rounds of purification and regrowth of the mother cells (M-cell), and utilization of flow cytometry to sort and isolate cells with a longer lifespan based on the number of bud scars specifically labeled with WGA.

  15. Functional Screening of Antibiotic Resistance Genes from a Representative Metagenomic Library of Food Fermenting Microbiota

    Directory of Open Access Journals (Sweden)

    Chiara Devirgiliis

    2014-01-01

    Full Text Available Lactic acid bacteria (LAB represent the predominant microbiota in fermented foods. Foodborne LAB have received increasing attention as potential reservoir of antibiotic resistance (AR determinants, which may be horizontally transferred to opportunistic pathogens. We have previously reported isolation of AR LAB from the raw ingredients of a fermented cheese, while AR genes could be detected in the final, marketed product only by PCR amplification, thus pointing at the need for more sensitive microbial isolation techniques. We turned therefore to construction of a metagenomic library containing microbial DNA extracted directly from the food matrix. To maximize yield and purity and to ensure that genomic complexity of the library was representative of the original bacterial population, we defined a suitable protocol for total DNA extraction from cheese which can also be applied to other lipid-rich foods. Functional library screening on different antibiotics allowed recovery of ampicillin and kanamycin resistant clones originating from Streptococcus salivarius subsp. thermophilus and Lactobacillus helveticus genomes. We report molecular characterization of the cloned inserts, which were fully sequenced and shown to confer AR phenotype to recipient bacteria. We also show that metagenomics can be applied to food microbiota to identify underrepresented species carrying specific genes of interest.

  16. Microsatellite-Aided Screening for Fertility Restoration Genes (Rf Facilitates Hybrid Improvement

    Directory of Open Access Journals (Sweden)

    Raafat El-Namaky

    2016-05-01

    Full Text Available DNA markers enabled to determine the chromosomal locations of the two Rf genes (Rf3 and Rf4 in the wild-abortive cytoplasmic male sterility (WA-CMS system. Four simple sequence repeats (SSRs RM171, RM258, RM315 and RM443 were used to detect the allelic status with respect to the fertility restoration genes (Rf3 and Rf4 in 300 rice cultivars or breeding lines. The results revealed that out of 300 lines, 90 lines screened had Rf3, 65 lines had Rf4, and 45 lines had Rf3 and Rf4 alleles. Furthermore, 45 lines selected using SSR markers were mated with a CMS line (IR58025A to analyze their restoring ability. Offspring of all the test lines except HHZ8-SAL9DT1-Y1, HHZ5-SAL9-Y3-1 and IDSA77 exhibited higher pollen and spikelet fertility (> 80%, thus confirming they bear the Rf alleles. The hybrid offspring of ARH12-6-1-1-B-3-1, IR32307-10-3-2-1 and Sahel 329 had the highest pollen fertility (97.39%, 98.30% and 97.10%, respectively and spikelet fertility (95.10%, 97.07% and 96.10%, respectively.

  17. Screening of Genes Specifically Expressed in Males of Fenneropenaeus chinensis and Their Potential as Sex Markers

    Directory of Open Access Journals (Sweden)

    Shihao Li

    2013-01-01

    Full Text Available The androgenic gland (AG, playing an important role in sex differentiation of male crustacean, is a target candidate to understand the mechanism of male development and to mine male-specific sex markers. An SSH library (designated as male reproduction-related tissues—SSH library, MRT-SSH library for short was constructed using cDNA from tissues located at the basal part of the 5th pereiopods, including AG and part of spermatophore sac, as tester, and the cDNA from the basal part of the 4th pereiopods of these male shrimp as driver. 402 ESTs from the SSH library were sequenced and assembled into 48 contigs and 104 singlets. Twelve contigs and 14 singlets were identified as known genes. The proteins encoded by the identified genes were categorized, according to their proposed functions, into neuropeptide hormone and hormone transporter, RNA posttranscriptional regulation, translation, cell growth and death, metabolism, genetic information processing, signal transduction/transport, or immunity-related proteins. Eleven highly expressed contigs in the SSH library were selected for validation of the MRT-SSH library and screening sex markers of shrimp. One contig, specifically expressed in male shrimp, had a potential to be developed as a transcriptomic sex marker in shrimp.

  18. In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.

    Directory of Open Access Journals (Sweden)

    Juan Du

    Full Text Available Hedgehog (Hh signaling is highly conserved in all metazoan animals and plays critical roles in many developmental processes. Dysregulation of the Hh signaling cascade has been implicated in many diseases, including cancer. Although key components of the Hh pathway have been identified, significant gaps remain in our understanding of the regulation of individual Hh signaling molecules. Here, we report the identification of novel regulators of the Hh pathway, obtained from an in vivo RNA interference (RNAi screen in Drosophila. By selectively targeting critical genes functioning in post-translational modification systems utilizing ubiquitin (Ub and Ub-like proteins, we identify two novel genes (dUba3 and dUbc12 that negatively regulate Hh signaling activity. We provide in vivo and in vitro evidence illustrating that dUba3 and dUbc12 are essential components of the neddylation pathway; they function in an enzyme cascade to conjugate the ubiquitin-like NEDD8 modifier to Cullin proteins. Neddylation activates the Cullin-containing ubiquitin ligase complex, which in turn promotes the degradation of Cubitus interruptus (Ci, the downstream transcription factor of the Hh pathway. Our study reveals a conserved molecular mechanism of the neddylation pathway in Drosophila and sheds light on the complex post-translational regulations in Hh signaling.

  19. A powerful nonparametric method for detecting differentially co-expressed genes: distance correlation screening and edge-count test.

    Science.gov (United States)

    Zhang, Qingyang

    2018-05-16

    Differential co-expression analysis, as a complement of differential expression analysis, offers significant insights into the changes in molecular mechanism of different phenotypes. A prevailing approach to detecting differentially co-expressed genes is to compare Pearson's correlation coefficients in two phenotypes. However, due to the limitations of Pearson's correlation measure, this approach lacks the power to detect nonlinear changes in gene co-expression which is common in gene regulatory networks. In this work, a new nonparametric procedure is proposed to search differentially co-expressed gene pairs in different phenotypes from large-scale data. Our computational pipeline consisted of two main steps, a screening step and a testing step. The screening step is to reduce the search space by filtering out all the independent gene pairs using distance correlation measure. In the testing step, we compare the gene co-expression patterns in different phenotypes by a recently developed edge-count test. Both steps are distribution-free and targeting nonlinear relations. We illustrate the promise of the new approach by analyzing the Cancer Genome Atlas data and the METABRIC data for breast cancer subtypes. Compared with some existing methods, the new method is more powerful in detecting nonlinear type of differential co-expressions. The distance correlation screening can greatly improve computational efficiency, facilitating its application to large data sets.

  20. Overlapping gene expression profiles of model compounds provide opportunities for immunotoxicity screening

    International Nuclear Information System (INIS)

    Baken, Kirsten A.; Pennings, Jeroen L.A.; Jonker, Martijs J.; Schaap, Mirjam M.; Vries, Annemieke de; Steeg, Harry van; Breit, Timo M.; Loveren, Henk van

    2008-01-01

    In order to investigate immunotoxic effects of a set of model compounds in mice, a toxicogenomics approach was combined with information on macroscopical and histopathological effects on spleens and on modulation of immune function. Bis(tri-n-butyltin)oxide (TBTO), cyclosporin A (CsA), and benzo[a]pyrene (B[a]P) were administered to C57BL/6 mice at immunosuppressive dose levels. Acetaminophen (APAP) was included in the study since indications of immunomodulating properties of this compound have appeared in the literature. TBTO exposure caused the most pronounced effect on gene expression and also resulted in the most severe reduction of body weight gain and induction of splenic irregularities. All compounds caused inhibition of cell division in the spleen as shown by microarray analysis as well as by suppression of lymphocyte proliferation after application of a contact sensitizer as demonstrated in an immune function assay that was adapted from the local lymph node assay. The immunotoxicogenomics approach applied in this study thus pointed to immunosuppression through cell cycle arrest as a common mechanism of action of immunotoxicants, including APAP. Genes related to cell division such as Ccna2, Brca1, Birc5, Incenp, and Cdkn1a (p21) were identified as candidate genes to indicate anti-proliferative effects of xenobiotics in immune cells for future screening assays. The results of our experiments also show the value of group wise pathway analysis for detection of more subtle transcriptional effects and the potency of evaluation of effects in the spleen to demonstrate immunotoxicity

  1. Supersingular quantum perturbations

    International Nuclear Information System (INIS)

    Detwiler, L.C.; Klauder, J.R.

    1975-01-01

    A perturbation potential is called supersingular whenever generally every matrix element of the perturbation in the unperturbed eigenstates is infinite. It follows that supersingular perturbations do not have conventional perturbation expansions, say for energy eigenvalues. By invoking variational arguments, we determine the asymptotic behavior of the energy eigenvalues for asymptotically small values of the coupling constant of the supersingular perturbation

  2. A modified screening system for loss-of-function and dominant negative alleles of essential MCMV genes.

    Directory of Open Access Journals (Sweden)

    Madlen Pogoda

    Full Text Available Inactivation of gene products by dominant negative mutants is a valuable tool to assign functions to yet uncharacterized proteins, to map protein-protein interactions or to dissect physiological pathways. Detailed functional and structural knowledge about the target protein would allow the construction of inhibitory mutants by targeted mutagenesis. Yet, such data are limited for the majority of viral proteins, so that the target gene needs to be subjected to random mutagenesis to identify suitable mutants. However, for cytomegaloviruses this requires a two-step screening approach, which is time-consuming and labor-intensive. Here, we report the establishment of a high-throughput suitable screening system for the identification of inhibitory alleles of essential genes of the murine cytomegalovirus (MCMV. In this screen, the site-specific recombination of a specifically modified MCMV genome was transferred from the bacterial background to permissive host cells, thereby combining the genetic engineering and the rescue test in one step. Using a reference set of characterized pM53 mutants it was shown that the novel system is applicable to identify non-complementing as well as inhibitory mutants in a high-throughput suitable setup. The new cis-complementation assay was also applied to a basic genetic characterization of pM99, which was identified as essential for MCMV growth. We believe that the here described novel genetic screening approach can be adapted for the genetic characterization of essential genes of any large DNA viruses.

  3. Comprehensive Maturity Onset Diabetes of the Young (MODY) Gene Screening in Pregnant Women with Diabetes in India.

    Science.gov (United States)

    Doddabelavangala Mruthyunjaya, Mahesh; Chapla, Aaron; Hesarghatta Shyamasunder, Asha; Varghese, Deny; Varshney, Manika; Paul, Johan; Inbakumari, Mercy; Christina, Flory; Varghese, Ron Thomas; Kuruvilla, Kurien Anil; V Paul, Thomas; Jose, Ruby; Regi, Annie; Lionel, Jessie; Jeyaseelan, L; Mathew, Jiji; Thomas, Nihal

    2017-01-01

    Pregnant women with diabetes may have underlying beta cell dysfunction due to mutations/rare variants in genes associated with Maturity Onset Diabetes of the Young (MODY). MODY gene screening would reveal those women genetically predisposed and previously unrecognized with a monogenic form of diabetes for further clinical management, family screening and genetic counselling. However, there are minimal data available on MODY gene variants in pregnant women with diabetes from India. In this study, utilizing the Next generation sequencing (NGS) based protocol fifty subjects were screened for variants in a panel of thirteen MODY genes. Of these subjects 18% (9/50) were positive for definite or likely pathogenic or uncertain MODY variants. The majority of these variants was identified in subjects with autosomal dominant family history, of whom five were in women with pre-GDM and four with overt-GDM. The identified variants included one patient with HNF1A Ser3Cys, two PDX1 Glu224Lys, His94Gln, two NEUROD1 Glu59Gln, Phe318Ser, one INS Gly44Arg, one GCK, one ABCC8 Arg620Cys and one BLK Val418Met variants. In addition, three of the seven offspring screened were positive for the identified variant. These identified variants were further confirmed by Sanger sequencing. In conclusion, these findings in pregnant women with diabetes, imply that a proportion of GDM patients with autosomal dominant family history may have MODY. Further NGS based comprehensive studies with larger samples are required to confirm these finding.

  4. Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

    DEFF Research Database (Denmark)

    Alvaro, D.; Sunjevaric, I.; Reid, R. J.

    2006-01-01

    We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background......, to minimize the contribution of unpredicted recessive genetic factors present in the individual library strains. We utilize a set of strains where each contains a conditional centromere construct on one of the 16 yeast chromosomes that allows the destabilization and selectable loss of that chromosome. After...... complementation of any spurious recessive mutations in the library strain, facilitating attribution of the observed phenotype to the documented gene deletion and dramatically reducing false positive results commonly obtained in library screens. The systematic hybrid LOH method can be applied to virtually any...

  5. A genome-wide immunodetection screen in S. cerevisiae uncovers novel genes involved in lysosomal vacuole function and morphology.

    Directory of Open Access Journals (Sweden)

    Florante Ricarte

    Full Text Available Vacuoles of yeast Saccharomyces cerevisiae are functionally analogous to mammalian lysosomes. Both are cellular organelles responsible for macromolecular degradation, ion/pH homeostasis, and stress survival. We hypothesized that undefined gene functions remain at post-endosomal stage of vacuolar events and performed a genome-wide screen directed at such functions at the late endosome and vacuole interface - ENV genes. The immunodetection screen was designed to identify mutants that internally accumulate precursor form of the vacuolar hydrolase carboxypeptidase Y (CPY. Here, we report the uncovering and initial characterizations of twelve ENV genes. The small size of the collection and the lack of genes previously identified with vacuolar events are suggestive of the intended exclusive functional interface of the screen. Most notably, the collection includes four novel genes ENV7, ENV9, ENV10, and ENV11, and three genes previously linked to mitochondrial processes - MAM3, PCP1, PPE1. In all env mutants, vesicular trafficking stages were undisturbed in live cells as assessed by invertase and active α-factor secretion, as well as by localization of the endocytic fluorescent marker FM4-64 to the vacuole. Several mutants exhibit defects in stress survival functions associated with vacuoles. Confocal fluorescence microscopy revealed the collection to be significantly enriched in vacuolar morphologies suggestive of fusion and fission defects. These include the unique phenotype of lumenal vesicles within vacuoles in the novel env9Δ mutant and severely fragmented vacuoles upon deletion of GET4, a gene recently implicated in tail anchored membrane protein insertion. Thus, our results establish new gene functions in vacuolar function and morphology, and suggest a link between vacuolar and mitochondrial events.

  6. Screening Key Genes Associated with the Development and Progression of Non-small Cell Lung Cancer Based on Gene-enrichment Analysis and Meta-analysis

    Directory of Open Access Journals (Sweden)

    Wenwu HE

    2012-07-01

    Full Text Available Background and objective Non-small cell lung cancer (NSCLC is one of the most common malignant tumors; however, its causes are still not completely understood. This study was designed to screen the key genes and pathways related to NSCLC occurrence and development and to establish the scientific foundation for the genetic mechanisms and targeted therapy of NSCLC. Methods Both gene set-enrichment analysis (GSEA and meta-analysis (meta were used to screen the critical pathways and genes that might be corretacted with the development and progression of lung cancer at the transcription level. Results Using the GSEA and meta methods, focal adhesion and regulation of actin cytoskeleton were determined to be the more prominent overlapping significant pathways. In the focal adhesion pathway, 31 genes were statistically significant (P<0.05, whereas in the regulation of actin cytoskeleton pathway, 32 genes were statistically significant (P<0.05. Conclusion The focal adhesion and the regulation of actin cytoskeleton pathways might play important roles in the occurrence and development of NSCLC. Further studies are needed to determine the biological function for the positiue genes.

  7. Identification of genes important for cutaneous function revealed by a large scale reverse genetic screen in the mouse.

    Directory of Open Access Journals (Sweden)

    Tia DiTommaso

    2014-10-01

    Full Text Available The skin is a highly regenerative organ which plays critical roles in protecting the body and sensing its environment. Consequently, morbidity and mortality associated with skin defects represent a significant health issue. To identify genes important in skin development and homeostasis, we have applied a high throughput, multi-parameter phenotype screen to the conditional targeted mutant mice generated by the Wellcome Trust Sanger Institute's Mouse Genetics Project (Sanger-MGP. A total of 562 different mouse lines were subjected to a variety of tests assessing cutaneous expression, macroscopic clinical disease, histological change, hair follicle cycling, and aberrant marker expression. Cutaneous lesions were associated with mutations in 23 different genes. Many of these were not previously associated with skin disease in the organ (Mysm1, Vangl1, Trpc4ap, Nom1, Sparc, Farp2, and Prkab1, while others were ascribed new cutaneous functions on the basis of the screening approach (Krt76, Lrig1, Myo5a, Nsun2, and Nf1. The integration of these skin specific screening protocols into the Sanger-MGP primary phenotyping pipelines marks the largest reported reverse genetic screen undertaken in any organ and defines approaches to maximise the productivity of future projects of this nature, while flagging genes for further characterisation.

  8. High Throughput Synthesis and Screening for Agents Inhibiting Androgen Receptor Mediated Gene Transcription

    National Research Council Canada - National Science Library

    Boger, Dale L

    2005-01-01

    .... This entails the high throughput synthesis of DNA binding agents related to distamycin, their screening for binding to androgen response elements using a new high throughput DNA binding screen...

  9. High Throughout Synthesis and Screening for Agents Inhibiting Androgen Receptor Mediated Gene Transcription

    National Research Council Canada - National Science Library

    Boger, Dale

    2003-01-01

    .... This entails the high throughput synthesis of DNA binding agents related to distamycin, their screening for binding to androgen response elements using a new high throughput DNA binding screen...

  10. High Throughput Synthesis and Screening for Agents Inhibiting Androgen Receptor Mediated Gene Transcription

    National Research Council Canada - National Science Library

    Boger, Dale

    2004-01-01

    .... This entails the high throughput synthesis of DNA binding agents related to distamycin, their screening for binding to androgen response elements using a new high throughput DNA binding screen...

  11. Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

    Science.gov (United States)

    Firnhaber, Christopher; Hammarlund, Marc

    2013-11-01

    Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

  12. Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua.

    Science.gov (United States)

    Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei

    2013-01-01

    The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (Ppest control.

  13. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    Science.gov (United States)

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  14. A Simplified Method for Gene Knockout and Direct Screening of Recombinant Clones for Application in Paenibacillus polymyxa.

    Directory of Open Access Journals (Sweden)

    Seong-Bin Kim

    Full Text Available Paenibacillus polymyxa is a bacterium widely used in agriculture, industry, and environmental remediation because it has multiple functions including nitrogen fixation and produces various biologically active compounds. Among these compounds are the antibiotics polymyxins, and the bacterium is currently being reassessed for medical application. However, a lack of genetic tools for manipulation of P. polymyxa has limited our understanding of the biosynthesis of these compounds.To facilitate an understanding of the genetic determinants of the bacterium, we have developed a system for marker exchange mutagenesis directly on competent cells of P. polymyxa under conditions where homologous recombination is enhanced by denaturation of the suicide plasmid DNA. To test this system, we targeted P. polymyxa α-and β-amylase genes for disruption. Chloramphenicol or erythromycin resistance genes were inserted into the suicide plasmid pGEM7Z-f+ (Promega. To mediate homologous recombination and replacement of the targeted genes with the antibiotic resistance genes nucleotide sequences of the α-and β-amylase genes were cloned into the plasmid flanking the antibiotic resistance genes.We have created a simple system for targeted gene deletion in P. polymyxa E681. We propose that P. polymyxa isogenic mutants could be developed using this system of marker exchange mutagenesis. α-and β-amylase genes provide a useful tool for direct recombinant screening in P. polymyxa.

  15. RBC Antibody Screen

    Science.gov (United States)

    ... C Cystic Fibrosis (CF) Gene Mutations Testing Cytomegalovirus (CMV) Tests D-dimer Dengue Fever Testing Des-gamma- ... Index of Screening Recommendations Not Listed? Not Listed? Newborn Screening Screening Tests for Infants Screening Tests for ...

  16. High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis.

    Science.gov (United States)

    Meeske, Alexander J; Rodrigues, Christopher D A; Brady, Jacqueline; Lim, Hoong Chuin; Bernhardt, Thomas G; Rudner, David Z

    2016-01-01

    The differentiation of the bacterium Bacillus subtilis into a dormant spore is among the most well-characterized developmental pathways in biology. Classical genetic screens performed over the past half century identified scores of factors involved in every step of this morphological process. More recently, transcriptional profiling uncovered additional sporulation-induced genes required for successful spore development. Here, we used transposon-sequencing (Tn-seq) to assess whether there were any sporulation genes left to be discovered. Our screen identified 133 out of the 148 genes with known sporulation defects. Surprisingly, we discovered 24 additional genes that had not been previously implicated in spore formation. To investigate their functions, we used fluorescence microscopy to survey early, middle, and late stages of differentiation of null mutants from the B. subtilis ordered knockout collection. This analysis identified mutants that are delayed in the initiation of sporulation, defective in membrane remodeling, and impaired in spore maturation. Several mutants had novel sporulation phenotypes. We performed in-depth characterization of two new factors that participate in cell-cell signaling pathways during sporulation. One (SpoIIT) functions in the activation of σE in the mother cell; the other (SpoIIIL) is required for σG activity in the forespore. Our analysis also revealed that as many as 36 sporulation-induced genes with no previously reported mutant phenotypes are required for timely spore maturation. Finally, we discovered a large set of transposon insertions that trigger premature initiation of sporulation. Our results highlight the power of Tn-seq for the discovery of new genes and novel pathways in sporulation and, combined with the recently completed null mutant collection, open the door for similar screens in other, less well-characterized processes.

  17. High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis

    Science.gov (United States)

    Brady, Jacqueline; Lim, Hoong Chuin; Bernhardt, Thomas G.; Rudner, David Z.

    2016-01-01

    The differentiation of the bacterium Bacillus subtilis into a dormant spore is among the most well-characterized developmental pathways in biology. Classical genetic screens performed over the past half century identified scores of factors involved in every step of this morphological process. More recently, transcriptional profiling uncovered additional sporulation-induced genes required for successful spore development. Here, we used transposon-sequencing (Tn-seq) to assess whether there were any sporulation genes left to be discovered. Our screen identified 133 out of the 148 genes with known sporulation defects. Surprisingly, we discovered 24 additional genes that had not been previously implicated in spore formation. To investigate their functions, we used fluorescence microscopy to survey early, middle, and late stages of differentiation of null mutants from the B. subtilis ordered knockout collection. This analysis identified mutants that are delayed in the initiation of sporulation, defective in membrane remodeling, and impaired in spore maturation. Several mutants had novel sporulation phenotypes. We performed in-depth characterization of two new factors that participate in cell–cell signaling pathways during sporulation. One (SpoIIT) functions in the activation of σE in the mother cell; the other (SpoIIIL) is required for σG activity in the forespore. Our analysis also revealed that as many as 36 sporulation-induced genes with no previously reported mutant phenotypes are required for timely spore maturation. Finally, we discovered a large set of transposon insertions that trigger premature initiation of sporulation. Our results highlight the power of Tn-seq for the discovery of new genes and novel pathways in sporulation and, combined with the recently completed null mutant collection, open the door for similar screens in other, less well-characterized processes. PMID:26735940

  18. Simulation and estimation of gene number in a biological pathway using almost complete saturation mutagenesis screening of haploid mouse cells.

    Science.gov (United States)

    Tokunaga, Masahiro; Kokubu, Chikara; Maeda, Yusuke; Sese, Jun; Horie, Kyoji; Sugimoto, Nakaba; Kinoshita, Taroh; Yusa, Kosuke; Takeda, Junji

    2014-11-24

    Genome-wide saturation mutagenesis and subsequent phenotype-driven screening has been central to a comprehensive understanding of complex biological processes in classical model organisms such as flies, nematodes, and plants. The degree of "saturation" (i.e., the fraction of possible target genes identified) has been shown to be a critical parameter in determining all relevant genes involved in a biological function, without prior knowledge of their products. In mammalian model systems, however, the relatively large scale and labor intensity of experiments have hampered the achievement of actual saturation mutagenesis, especially for recessive traits that require biallelic mutations to manifest detectable phenotypes. By exploiting the recently established haploid mouse embryonic stem cells (ESCs), we present an implementation of almost complete saturation mutagenesis in a mammalian system. The haploid ESCs were mutagenized with the chemical mutagen N-ethyl-N-nitrosourea (ENU) and processed for the screening of mutants defective in various steps of the glycosylphosphatidylinositol-anchor biosynthetic pathway. The resulting 114 independent mutant clones were characterized by a functional complementation assay, and were shown to be defective in any of 20 genes among all 22 known genes essential for this well-characterized pathway. Ten mutants were further validated by whole-exome sequencing. The predominant generation of single-nucleotide substitutions by ENU resulted in a gene mutation rate proportional to the length of the coding sequence, which facilitated the experimental design of saturation mutagenesis screening with the aid of computational simulation. Our study enables mammalian saturation mutagenesis to become a realistic proposition. Computational simulation, combined with a pilot mutagenesis experiment, could serve as a tool for the estimation of the number of genes essential for biological processes such as drug target pathways when a positive selection of

  19. Screening for mutations in the androgen receptor gene (AR) causing infertility in Syrian men using real-time PCR

    International Nuclear Information System (INIS)

    Madania, A.; Ghouri, I.; Abou-Alshamat, Gh.; Issa, M.; Al-Halabi, M.

    2012-01-01

    14 known point mutations in the androgen receptor gene (AR) causing male infertility were screened by real time PCR and by DNA sequencing, in order to identify point mutations in the AR gene causing infertility in azoospermic men. We screened 110 Syrian patients suffering from non-obstructive azoospermia with no chromosomal aberrations or AZF micro deletions. We discovered a new AR mutation, del 57Leu, described for the first time as a possible cause of male infertility. Furthermore, we found two patients with the Ala474Val mutation and one patient bearing the Pro390Ser mutation. Our results indicate that these mutations are significant markers for idiopathic male infertility in the Syrian society and in Mediterranean populations in general. (author)

  20. The Identification of Genes Important in Pseudomonas syringae pv. phaseolicola Plant Colonisation Using In Vitro Screening of Transposon Libraries.

    Directory of Open Access Journals (Sweden)

    Bharani Manoharan

    Full Text Available The bacterial plant pathogen Pseudomonas syringae pv. phaseolicola (Pph colonises the surface of common bean plants before moving into the interior of plant tissue, via wounds and stomata. In the intercellular spaces the pathogen proliferates in the apoplastic fluid and forms microcolonies (biofilms around plant cells. If the pathogen can suppress the plant's natural resistance response, it will cause halo blight disease. The process of resistance suppression is fairly well understood, but the mechanisms used by the pathogen in colonisation are less clear. We hypothesised that we could apply in vitro genetic screens to look for changes in motility, colony formation, and adhesion, which are proxies for infection, microcolony formation and cell adhesion. We made transposon (Tn mutant libraries of Pph strains 1448A and 1302A and found 106/1920 mutants exhibited alterations in colony morphology, motility and biofilm formation. Identification of the insertion point of the Tn identified within the genome highlighted, as expected, a number of altered motility mutants bearing mutations in genes encoding various parts of the flagellum. Genes involved in nutrient biosynthesis, membrane associated proteins, and a number of conserved hypothetical protein (CHP genes were also identified. A mutation of one CHP gene caused a positive increase in in planta bacterial growth. This rapid and inexpensive screening method allows the discovery of genes important for in vitro traits that can be correlated to roles in the plant interaction.

  1. Comprehensive Maturity Onset Diabetes of the Young (MODY Gene Screening in Pregnant Women with Diabetes in India.

    Directory of Open Access Journals (Sweden)

    Mahesh Doddabelavangala Mruthyunjaya

    Full Text Available Pregnant women with diabetes may have underlying beta cell dysfunction due to mutations/rare variants in genes associated with Maturity Onset Diabetes of the Young (MODY. MODY gene screening would reveal those women genetically predisposed and previously unrecognized with a monogenic form of diabetes for further clinical management, family screening and genetic counselling. However, there are minimal data available on MODY gene variants in pregnant women with diabetes from India. In this study, utilizing the Next generation sequencing (NGS based protocol fifty subjects were screened for variants in a panel of thirteen MODY genes. Of these subjects 18% (9/50 were positive for definite or likely pathogenic or uncertain MODY variants. The majority of these variants was identified in subjects with autosomal dominant family history, of whom five were in women with pre-GDM and four with overt-GDM. The identified variants included one patient with HNF1A Ser3Cys, two PDX1 Glu224Lys, His94Gln, two NEUROD1 Glu59Gln, Phe318Ser, one INS Gly44Arg, one GCK, one ABCC8 Arg620Cys and one BLK Val418Met variants. In addition, three of the seven offspring screened were positive for the identified variant. These identified variants were further confirmed by Sanger sequencing. In conclusion, these findings in pregnant women with diabetes, imply that a proportion of GDM patients with autosomal dominant family history may have MODY. Further NGS based comprehensive studies with larger samples are required to confirm these finding.

  2. Comprehensive Maturity Onset Diabetes of the Young (MODY) Gene Screening in Pregnant Women with Diabetes in India

    Science.gov (United States)

    Hesarghatta Shyamasunder, Asha; Varghese, Deny; Varshney, Manika; Paul, Johan; Inbakumari, Mercy; Christina, Flory; Varghese, Ron Thomas; Kuruvilla, Kurien Anil; V. Paul, Thomas; Jose, Ruby; Regi, Annie; Lionel, Jessie; Jeyaseelan, L.; Mathew, Jiji; Thomas, Nihal

    2017-01-01

    Pregnant women with diabetes may have underlying beta cell dysfunction due to mutations/rare variants in genes associated with Maturity Onset Diabetes of the Young (MODY). MODY gene screening would reveal those women genetically predisposed and previously unrecognized with a monogenic form of diabetes for further clinical management, family screening and genetic counselling. However, there are minimal data available on MODY gene variants in pregnant women with diabetes from India. In this study, utilizing the Next generation sequencing (NGS) based protocol fifty subjects were screened for variants in a panel of thirteen MODY genes. Of these subjects 18% (9/50) were positive for definite or likely pathogenic or uncertain MODY variants. The majority of these variants was identified in subjects with autosomal dominant family history, of whom five were in women with pre-GDM and four with overt-GDM. The identified variants included one patient with HNF1A Ser3Cys, two PDX1 Glu224Lys, His94Gln, two NEUROD1 Glu59Gln, Phe318Ser, one INS Gly44Arg, one GCK, one ABCC8 Arg620Cys and one BLK Val418Met variants. In addition, three of the seven offspring screened were positive for the identified variant. These identified variants were further confirmed by Sanger sequencing. In conclusion, these findings in pregnant women with diabetes, imply that a proportion of GDM patients with autosomal dominant family history may have MODY. Further NGS based comprehensive studies with larger samples are required to confirm these finding PMID:28095440

  3. Screening the Drug Sensitivity Genes Related to GEM and CDDP in the Lung Cancer Cell-lines

    Directory of Open Access Journals (Sweden)

    Chunyu YANG

    2009-10-01

    Full Text Available Background and objective Screening of small-cell lung cancer (SCLC and non-small cell lung cancer (NSCLC cell lines with gemcitabine hydrochloride (GEM and cisplatin (CDDP related to drug sensitivity gene might clarify the action mechanism of anti-cancer drugs and provide a new clue for overcoming drug resistance and the development of new anti-cancer drugs, and also provide theoretical basis for the clinical treatment of individual. Methods The drug sensitivity of CDDP and GEM in 4 SCLC cell lines and 6 NSCLC cell lines was determined using MTT colorimetric assay, while the cDNA macroarray was applied to detect the gene expression state related to drug sensitivity of 10 lung cancer cell line in 1 291, and the correlation between the two was analysized. Results There were 6 genes showing significant positive correlation (r≥0.632, P < 0.05 with GEM sensitivity; 45 genes positively related to CDDP; another 41 genes related to both GEM and CDDP (r≥± 0.4. Lung cancer with GEM and CDDP sensitivity of two types of drugs significantly related genes were Metallothinein (Signal transduction molecules, Cathepsin B (Organization protease B and TIMP1 (Growth factor; the GEM, CDDP sensitivity associated genes of lung cancer cell lines mainly distributed in Metallothinein, Cathepsin B, growth factor TIMP1 categories. Conclusion There existed drug-related sensitive genes of GEM, CDDP in SCLC and NSCLC cell lines; of these genes, Metallothinein, Cathepsin B and TIMP1 genes presented a significant positive correlation with GEM drug sensitivity, a significant negative correlation with CDDP drug sensitivity.

  4. A high-throughput fluorescence-based assay system for appetite-regulating gene and drug screening.

    Directory of Open Access Journals (Sweden)

    Yasuhito Shimada

    Full Text Available The increasing number of people suffering from metabolic syndrome and obesity is becoming a serious problem not only in developed countries, but also in developing countries. However, there are few agents currently approved for the treatment of obesity. Those that are available are mainly appetite suppressants and gastrointestinal fat blockers. We have developed a simple and rapid method for the measurement of the feeding volume of Danio rerio (zebrafish. This assay can be used to screen appetite suppressants and enhancers. In this study, zebrafish were fed viable paramecia that were fluorescently-labeled, and feeding volume was measured using a 96-well microplate reader. Gene expression analysis of brain-derived neurotrophic factor (bdnf, knockdown of appetite-regulating genes (neuropeptide Y, preproinsulin, melanocortin 4 receptor, agouti related protein, and cannabinoid receptor 1, and the administration of clinical appetite suppressants (fluoxetine, sibutramine, mazindol, phentermine, and rimonabant revealed the similarity among mechanisms regulating appetite in zebrafish and mammals. In combination with behavioral analysis, we were able to evaluate adverse effects on locomotor activities from gene knockdown and chemical treatments. In conclusion, we have developed an assay that uses zebrafish, which can be applied to high-throughput screening and target gene discovery for appetite suppressants and enhancers.

  5. Genome-wide screening for genes whose deletions confer sensitivity to mutagenic purine base analogs in yeast

    Directory of Open Access Journals (Sweden)

    Kozmin Stanislav G

    2005-06-01

    Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.

  6. Large-scale functional RNAi screen in C. elegans identifies genes that regulate the dysfunction of mutant polyglutamine neurons.

    Science.gov (United States)

    Lejeune, François-Xavier; Mesrob, Lilia; Parmentier, Frédéric; Bicep, Cedric; Vazquez-Manrique, Rafael P; Parker, J Alex; Vert, Jean-Philippe; Tourette, Cendrine; Neri, Christian

    2012-03-13

    A central goal in Huntington's disease (HD) research is to identify and prioritize candidate targets for neuroprotective intervention, which requires genome-scale information on the modifiers of early-stage neuron injury in HD. Here, we performed a large-scale RNA interference screen in C. elegans strains that express N-terminal huntingtin (htt) in touch receptor neurons. These neurons control the response to light touch. Their function is strongly impaired by expanded polyglutamines (128Q) as shown by the nearly complete loss of touch response in adult animals, providing an in vivo model in which to manipulate the early phases of expanded-polyQ neurotoxicity. In total, 6034 genes were examined, revealing 662 gene inactivations that either reduce or aggravate defective touch response in 128Q animals. Several genes were previously implicated in HD or neurodegenerative disease, suggesting that this screen has effectively identified candidate targets for HD. Network-based analysis emphasized a subset of high-confidence modifier genes in pathways of interest in HD including metabolic, neurodevelopmental and pro-survival pathways. Finally, 49 modifiers of 128Q-neuron dysfunction that are dysregulated in the striatum of either R/2 or CHL2 HD mice, or both, were identified. Collectively, these results highlight the relevance to HD pathogenesis, providing novel information on the potential therapeutic targets for neuroprotection in HD. © 2012 Lejeune et al; licensee BioMed Central Ltd.

  7. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Melon (Cucumis melo. L is not only an economically important cucurbitaceous crop but also an attractive model for studying many biological characteristics. Screening appropriate reference genes is essential to reverse transcription quantitative real-time PCR (RT-qPCR, which is key to many studies involving gene expression analysis. In this study, 14 candidate reference genes were selected, and the variations in their expression in roots and leaves of plants subjected to biotic stress, abiotic stress, and plant growth regulator treatment were assessed by RT-qPCR. The stability of the expression of the selected genes was determined and ranked using geNorm and NormFinder. geNorm identified the two most stable genes for each set of conditions: CmADP and CmUBIep across all samples, CmUBIep and CmRPL in roots, CmRAN and CmACT in leaves, CmADP and CmRPL under abiotic stress conditions, CmTUA and CmACT under biotic stress conditions, and CmRAN and CmACT under plant growth regulator treatments. NormFinder determined CmRPL to be the best reference gene in roots and under biotic stress conditions and CmADP under the other experimental conditions. CmUBC2 and CmPP2A were not found to be suitable under many experimental conditions. The catalase family genes CmCAT1, CmCAT2, and CmCAT3 were identified in melon genome and used as target genes to validate the reliability of identified reference genes. The catalase family genes showed the most upregulation 3 days after inoculation with Fusarium wilt in roots, after which they were downregulated. Their levels of expression were significantly overestimated when the unsuitable reference gene was used for normalization. These results not only provide guidelines for the selection of reference genes for gene expression analyses in melons but may also provide valuable information for studying the functions of catalase family genes in stress responses.

  8. A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.

    Science.gov (United States)

    Parsons, Linda M; Grzeschik, Nicola A; Amaratunga, Kasun; Burke, Peter; Quinn, Leonie M; Richardson, Helena E

    2017-08-07

    In both Drosophila melanogaster and mammalian systems, epithelial structure and underlying cell polarity are essential for proper tissue morphogenesis and organ growth. Cell polarity interfaces with multiple cellular processes that are regulated by the phosphorylation status of large protein networks. To gain insight into the molecular mechanisms that coordinate cell polarity with tissue growth, we screened a boutique collection of RNAi stocks targeting the kinome for their capacity to modify Drosophila "cell polarity" eye and wing phenotypes. Initially, we identified kinase or phosphatase genes whose depletion modified adult eye phenotypes associated with the manipulation of cell polarity complexes (via overexpression of Crb or aPKC). We next conducted a secondary screen to test whether these cell polarity modifiers altered tissue overgrowth associated with depletion of Lgl in the wing. These screens identified Hippo, Jun kinase (JNK), and Notch signaling pathways, previously linked to cell polarity regulation of tissue growth. Furthermore, novel pathways not previously connected to cell polarity regulation of tissue growth were identified, including Wingless (Wg/Wnt), Ras, and lipid/Phospho-inositol-3-kinase (PI3K) signaling pathways. Additionally, we demonstrated that the "nutrient sensing" kinases Salt Inducible Kinase 2 and 3 ( SIK2 and 3 ) are potent modifiers of cell polarity phenotypes and regulators of tissue growth. Overall, our screen has revealed novel cell polarity-interacting kinases and phosphatases that affect tissue growth, providing a platform for investigating molecular mechanisms coordinating cell polarity and tissue growth during development. Copyright © 2017 Parsons et al.

  9. A comparative genomics screen identifies a Sinorhizobium meliloti 1021 sodM-like gene strongly expressed within host plant nodules

    Directory of Open Access Journals (Sweden)

    Queiroux Clothilde

    2012-05-01

    Full Text Available Abstract Background We have used the genomic data in the Integrated Microbial Genomes system of the Department of Energy’s Joint Genome Institute to make predictions about rhizobial open reading frames that play a role in nodulation of host plants. The genomic data was screened by searching for ORFs conserved in α-proteobacterial rhizobia, but not conserved in closely-related non-nitrogen-fixing α-proteobacteria. Results Using this approach, we identified many genes known to be involved in nodulation or nitrogen fixation, as well as several new candidate genes. We knocked out selected new genes and assayed for the presence of nodulation phenotypes and/or nodule-specific expression. One of these genes, SMc00911, is strongly expressed by bacterial cells within host plant nodules, but is expressed minimally by free-living bacterial cells. A strain carrying an insertion mutation in SMc00911 is not defective in the symbiosis with host plants, but in contrast to expectations, this mutant strain is able to out-compete the S. meliloti 1021 wild type strain for nodule occupancy in co-inoculation experiments. The SMc00911 ORF is predicted to encode a “SodM-like” (superoxide dismutase-like protein containing a rhodanese sulfurtransferase domain at the N-terminus and a chromate-resistance superfamily domain at the C-terminus. Several other ORFs (SMb20360, SMc01562, SMc01266, SMc03964, and the SMc01424-22 operon identified in the screen are expressed at a moderate level by bacteria within nodules, but not by free-living bacteria. Conclusions Based on the analysis of ORFs identified in this study, we conclude that this comparative genomics approach can identify rhizobial genes involved in the nitrogen-fixing symbiosis with host plants, although none of the newly identified genes were found to be essential for this process.

  10. Screening of molecular cell targets for carcinogenic heterocyclic aromatic amines by using CALUX® reporter gene assays.

    Science.gov (United States)

    Steinberg, Pablo; Behnisch, Peter A; Besselink, Harrie; Brouwer, Abraham A

    2017-06-01

    Heterocyclic aromatic amines (HCAs) are compounds formed when meat or fish are cooked at high temperatures for a long time or over an open fire. To determine which pathways of toxicity are activated by HCAs, nine out of the ten HCAs known to be carcinogenic in rodents (2-amino-9H-pyrido[2,3-b]indole (AαC), 2-aminodipyrido[1,2-a:3',2-d]imidazole (Glu-P-2), 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), 2-amino-3-methyl-9H-pyrido[2,3-b]indole (MeAαC), 2-amino-3,4-dimethylimidazo[4,5-f]quinoline (MeIQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indole (Trp-P-1), and 3-amino-1-methyl-5H-pyrido[4,3-b]indole (Trp-P-2)) were tested in the estrogen receptor α (ERα), androgen receptor (AR), glucocorticoid receptor (GR), peroxisome proliferator-activated receptor γ2 (PPARγ2), polycyclic aromatic hydrocarbons (PAH), Nrf2, and p53 CALUX® reporter gene assays. Trp-P-1 was the only HCA that led to a positive response in the ERα, PPARγ2, and Nrf2 CALUX® assays. In the PAH CALUX® assay, Trp-P-2, MeAαC, and AαC induced luciferase activity to a greater extent than MeIQ and PhIP. In the p53 CALUX® assay without a coupled metabolic activation, only Trp-P-1 and Trp-P-2 enhanced luciferase expression; when a metabolic activation step was coupled to the p53 CALUX® assay, Trp-P-1, Glu-P-2, MeIQ, MeIQx, and PhIP induced a positive response. No HCA was positive in the AR and GR CALUX® assays. Taken together, the results obtained show that the battery of CALUX® assays performed in the present study can successfully be used to screen for molecular cell targets of carcinogenic compounds such as HCAs.

  11. New genes tied to endocrine, metabolic, and dietary regulation of lifespan from a Caenorhabditis elegans genomic RNAi screen.

    Directory of Open Access Journals (Sweden)

    Malene Hansen

    2005-07-01

    Full Text Available Most of our knowledge about the regulation of aging comes from mutants originally isolated for other phenotypes. To ask whether our current view of aging has been affected by selection bias, and to deepen our understanding of known longevity pathways, we screened a genomic Caenorhabditis elegans RNAi library for clones that extend lifespan. We identified 23 new longevity genes affecting signal transduction, the stress response, gene expression, and metabolism and assigned these genes to specific longevity pathways. Our most important findings are (i that dietary restriction extends C. elegans' lifespan by down-regulating expression of key genes, including a gene required for methylation of many macromolecules, (ii that integrin signaling is likely to play a general, evolutionarily conserved role in lifespan regulation, and (iii that specific lipophilic hormones may influence lifespan in a DAF-16/FOXO-dependent fashion. Surprisingly, of the new genes that have conserved sequence domains, only one could not be associated with a known longevity pathway. Thus, our current view of the genetics of aging has probably not been distorted substantially by selection bias.

  12. New Genes Tied to Endocrine, Metabolic, and Dietary Regulation of Lifespan from a Caenorhabditis elegans Genomic RNAi Screen.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Most of our knowledge about the regulation of aging comes from mutants originally isolated for other phenotypes. To ask whether our current view of aging has been affected by selection bias, and to deepen our understanding of known longevity pathways, we screened a genomic Caenorhabditis elegans RNAi library for clones that extend lifespan. We identified 23 new longevity genes affecting signal transduction, the stress response, gene expression, and metabolism and assigned these genes to specific longevity pathways. Our most important findings are (i that dietary restriction extends C. elegans' lifespan by down-regulating expression of key genes, including a gene required for methylation of many macromolecules, (ii that integrin signaling is likely to play a general, evolutionarily conserved role in lifespan regulation, and (iii that specific lipophilic hormones may influence lifespan in a DAF-16/FOXO-dependent fashion. Surprisingly, of the new genes that have conserved sequence domains, only one could not be associated with a known longevity pathway. Thus, our current view of the genetics of aging has probably not been distorted substantially by selection bias.

  13. Digital Gene Expression Analysis to Screen Disease Resistance-Relevant Genes from Leaves of Herbaceous Peony (Paeonia lactiflora Pall. Infected by Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Saijie Gong

    Full Text Available Herbaceous peony (Paeonia lactiflora Pall. is a well-known traditional flower in China and is widely used for landscaping and garden greening due to its high ornamental value. However, disease spots usually appear after the flowering of the plant and may result in the withering of the plant in severe cases. This study examined the disease incidence in an herbaceous peony field in the Yangzhou region, Jiangsu Province. Based on morphological characteristics and molecular data, the disease in this area was identified as a gray mold caused by Botrytis cinerea. Based on previously obtained transcriptome data, eight libraries generated from two herbaceous peony cultivars 'Zifengyu' and 'Dafugui' with different susceptibilities to the disease were then analyzed using digital gene expression profiling (DGE. Thousands of differentially expressed genes (DEGs were screened by comparing the eight samples, and these genes were annotated using the Gene ontology (GO and Kyoto encyclopedia of genes and genomes (KEGG database. The pathways related to plant-pathogen interaction, secondary metabolism synthesis and antioxidant system were concentrated, and 51, 76, and 13 disease resistance-relevant candidate genes were identified, respectively. The expression patterns of these candidate genes differed between the two cultivars: their expression of the disease-resistant cultivar 'Zifengyu' sharply increased during the early stages of infection, while it was relatively subdued in the disease-sensitive cultivar 'Dafugui'. A selection of ten candidate genes was evaluated by quantitative real-time PCR (qRT-PCR to validate the DGE data. These results revealed the transcriptional changes that took place during the interaction of herbaceous peony with B. cinerea, providing insight into the molecular mechanisms of host resistance to gray mold.

  14. Developments in perturbation theory

    International Nuclear Information System (INIS)

    Greenspan, E.

    1976-01-01

    Included are sections dealing with perturbation expressions for reactivity, methods for the calculation of perturbed fluxes, integral transport theory formulations for reactivity, generalized perturbation theory, sensitivity and optimization studies, multigroup calculations of bilinear functionals, and solution of inhomogeneous Boltzmann equations with singular operators

  15. Genome-Wide RNAi Ionomics Screen Reveals New Genes and Regulation of Human Trace Element Metabolism

    OpenAIRE

    Malinouski, Mikalai; Hasan, Nesrin M.; Zhang, Yan; Seravalli, Javier; Lin, Jie; Avanesov, Andrei; Lutsenko, Svetlana; Gladyshev, Vadim N.

    2017-01-01

    Trace elements are essential for human metabolism and dysregulation of their homeostasis is associated with numerous disorders. Here we characterize mechanisms that regulate trace elements in human cells by designing and performing a genome-wide high-throughput siRNA/ionomics screen, and examining top hits in cellular and biochemical assays. The screen reveals high stability of the ionomes, especially the zinc ionome, and yields known regulators and novel candidates. We further uncover fundam...

  16. Application of microarray and functional-based screening methods for the detection of antimicrobial resistance genes in the microbiomes of healthy humans.

    Directory of Open Access Journals (Sweden)

    Roderick M Card

    Full Text Available The aim of this study was to screen for the presence of antimicrobial resistance genes within the saliva and faecal microbiomes of healthy adult human volunteers from five European countries. Two non-culture based approaches were employed to obviate potential bias associated with difficult to culture members of the microbiota. In a gene target-based approach, a microarray was employed to screen for the presence of over 70 clinically important resistance genes in the saliva and faecal microbiomes. A total of 14 different resistance genes were detected encoding resistances to six antibiotic classes (aminoglycosides, β-lactams, macrolides, sulphonamides, tetracyclines and trimethoprim. The most commonly detected genes were erm(B, blaTEM, and sul2. In a functional-based approach, DNA prepared from pooled saliva samples was cloned into Escherichia coli and screened for expression of resistance to ampicillin or sulphonamide, two of the most common resistances found by array. The functional ampicillin resistance screen recovered genes encoding components of a predicted AcrRAB efflux pump. In the functional sulphonamide resistance screen, folP genes were recovered encoding mutant dihydropteroate synthase, the target of sulphonamide action. The genes recovered from the functional screens were from the chromosomes of commensal species that are opportunistically pathogenic and capable of exchanging DNA with related pathogenic species. Genes identified by microarray were not recovered in the activity-based screen, indicating that these two methods can be complementary in facilitating the identification of a range of resistance mechanisms present within the human microbiome. It also provides further evidence of the diverse reservoir of resistance mechanisms present in bacterial populations in the human gut and saliva. In future the methods described in this study can be used to monitor changes in the resistome in response to antibiotic therapy.

  17. Genome-wide screening and transcriptional profile analysis of desaturase genes in the European corn borer moth

    Institute of Scientific and Technical Information of China (English)

    Bingye Xue; Alejandro P. Rooney; Wendell L. Roelofs

    2012-01-01

    Acyl-coenzyme A (Acyl-CoA) desaturases play a key role in the biosynthesis of female moth sex pheromones.Desaturase genes are encoded by a large multigene family,and they have been divided into five subgroups on the basis of biochemical functionality and phylogenetic affinity.In this study both copy numbers and transcriptional levels of desaturase genes in the European corn borer (ECB),Ostrinia nubilalis,were investigated.The results from genome-wide screening of ECB bacterial artificial chromosome (BAC)library indicated there are many copies of some desaturase genes in the genome.An open reading frame (ORF) has been isolated for the novel desaturase gene ECB ezi-△11β from ECB gland complementary DNA and its functionality has been analyzed by two yeast expression systems.No functional activities have been detected for it.The expression levels of the four desaturase genes both in the pheromone gland and fat body of ECB and Asian corn borer (ACB),O.furnacalis,were determined by real-time polymerase chain reaction.In the ECB gland,△ 11 is the most abundant,although the amount of △14 is also considerable.In the ACB gland,△14 is the most abundant and is 100 times more abundant than all the other three combined.The results from the analysis of evolution of desaturase gene transcription in the ECB,ACB and other moths indicate that the pattern of △ 11 gene transcription is significantly different from the transcriptional patterns of other desaturase genes and this difference is tied to the underlying nucleotide composition bias of the genome.

  18. Genes Required for Growth at High Hydrostatic Pressure in Escherichia coli K-12 Identified by Genome-Wide Screening

    Science.gov (United States)

    Black, S. Lucas; Dawson, Angela; Ward, F. Bruce; Allen, Rosalind J.

    2013-01-01

    Despite the fact that much of the global microbial biosphere is believed to exist in high pressure environments, the effects of hydrostatic pressure on microbial physiology remain poorly understood. We use a genome-wide screening approach, combined with a novel high-throughput high-pressure cell culture method, to investigate the effects of hydrostatic pressure on microbial physiology in vivo. The Keio collection of single-gene deletion mutants in Escherichia coli K-12 was screened for growth at a range of pressures from 0.1 MPa to 60 MPa. This led to the identification of 6 genes, rodZ, holC, priA, dnaT, dedD and tatC, whose products were required for growth at 30 MPa and a further 3 genes, tolB, rffT and iscS, whose products were required for growth at 40 MPa. Our results support the view that the effects of pressure on cell physiology are pleiotropic, with DNA replication, cell division, the cytoskeleton and cell envelope physiology all being potential failure points for cell physiology during growth at elevated pressure. PMID:24040140

  19. Incidence, Antimicrobial Susceptibility, and Toxin Genes Possession Screening of Staphylococcus aureus in Retail Chicken Livers and Gizzards

    Directory of Open Access Journals (Sweden)

    Lubna S. Abdalrahman

    2015-04-01

    Full Text Available Few recent outbreaks in Europe and the US involving Campylobacter and Salmonella were linked to the consumption of chicken livers. Studies investigating Staphylococcus aureus in chicken livers and gizzards are very limited. The objectives of this study were to determine the prevalence, antimicrobial resistance, and virulence of S. aureus and MRSA (Methicillin-Resistant Staphylococcus aureus in retail chicken livers and gizzards in Tulsa, Oklahoma. In this study, 156 chicken livers and 39 chicken gizzards samples of two brands were collected. While one of the brands showed very low prevalence of 1% (1/100 for S. aureus in chicken livers and gizzards, the second brand showed prevalence of 37% (31/95. No MRSA was detected since none harbored the mecA or mecC gene. Eighty seven S. aureus isolates from livers and 28 from gizzards were screened for antimicrobial resistance to 16 antimicrobials and the possession of 18 toxin genes. Resistance to most of the antimicrobials screened including cefoxitin and oxacillin was higher in the chicken gizzards isolates. While the prevalence of enterotoxin genes seg and sei was higher in the gizzards isolates, the prevalence of hemolysin genes hla, hlb, and hld was higher in the livers ones. The lucocidin genes lukE-lukD was equally prevalent in chicken livers and gizzards isolates. Using spa typing, a subset of the recovered isolates showed that they are not known to be livestock associated and, hence, may be of a human origin. In conclusion, this study stresses the importance of thorough cooking of chicken livers and gizzards since it might contain multidrug resistant enterotoxigenic S. aureus. To our knowledge this is the first study to specifically investigate the prevalence of S. aureus in chicken livers and gizzards in the US.

  20. Species identification in meat products: A new screening method based on high resolution melting analysis of cyt b gene.

    Science.gov (United States)

    Lopez-Oceja, A; Nuñez, C; Baeta, M; Gamarra, D; de Pancorbo, M M

    2017-12-15

    Meat adulteration by substitution with lower value products and/or mislabeling involves economic, health, quality and socio-religious issues. Therefore, identification and traceability of meat species has become an important subject to detect possible fraudulent practices. In the present study the development of a high resolution melt (HRM) screening method for the identification of eight common meat species is reported. Samples from Bos taurus, Ovis aries, Sus scrofa domestica, Equus caballus, Oryctolagus cuniculus, Gallus gallus domesticus, Meleagris gallopavo and Coturnix coturnix were analyzed through the amplification of a 148 bp fragment from the cyt b gene with a universal primer pair in HRM analyses. Melting profiles from each species, as well as from several DNA mixtures of these species and blind samples, allowed a successful species differentiation. The results demonstrated that the HRM method here proposed is a fast, reliable, and low-cost screening technique. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Small-molecule screen identifies modulators of EWS/FLI1 target gene expression and cell survival in Ewing's sarcoma.

    Science.gov (United States)

    Boro, Aleksandar; Prêtre, Kathya; Rechfeld, Florian; Thalhammer, Verena; Oesch, Susanne; Wachtel, Marco; Schäfer, Beat W; Niggli, Felix K

    2012-11-01

    Ewing's sarcoma family of tumors (EFT) is characterized by the presence of chromosomal translocations leading to the expression of oncogenic transcription factors such as, in the majority of cases, EWS/FLI1. Because of its key role in Ewing's sarcoma development and maintenance, EWS/FLI1 represents an attractive therapeutic target. Here, we characterize PHLDA1 as a novel direct target gene whose expression is repressed by EWS/FLI1. Using this gene and additional specific well-characterized target genes such as NROB1, NKX2.2 and CAV1, all activated by EWS/FLI1, as a read-out system, we screened a small-molecule compound library enriched for FDA-approved drugs that modulated the expression of EWS/FLI1 target genes. Among a hit-list of nine well-known drugs such as camptothecin, fenretinide, etoposide and doxorubicin, we also identified the kinase inhibitor midostaurin (PKC412). Subsequent experiments demonstrated that midostaurin is able to induce apoptosis in a panel of six Ewing's sarcoma cell lines in vitro and can significantly suppress xenograft tumor growth in vivo. These results suggest that midostaurin might be a novel drug that is active against Ewing's cells, which might act by modulating the expression of EWS/FLI1 target genes. Copyright © 2012 UICC.

  2. Gene Technology: Also a Gender Issue. Views of Dutch Informed Women on Genetic Screening and Gene Therapy.

    Science.gov (United States)

    van Berkel, Dymphie; Klinge, Ineke

    1997-01-01

    The views of Dutch women on the implications of the analysis of the human genome were studied by questionnaire and interview. Although a serious lack of knowledge about the topic was found, interviews produced a broad range of problematic issues. Attention to gender implications of gene technology is needed. (Author/EMK)

  3. Screening key candidate genes and pathways involved in insulinoma by microarray analysis.

    Science.gov (United States)

    Zhou, Wuhua; Gong, Li; Li, Xuefeng; Wan, Yunyan; Wang, Xiangfei; Li, Huili; Jiang, Bin

    2018-06-01

    Insulinoma is a rare type tumor and its genetic features remain largely unknown. This study aimed to search for potential key genes and relevant enriched pathways of insulinoma.The gene expression data from GSE73338 were downloaded from Gene Expression Omnibus database. Differentially expressed genes (DEGs) were identified between insulinoma tissues and normal pancreas tissues, followed by pathway enrichment analysis, protein-protein interaction (PPI) network construction, and module analysis. The expressions of candidate key genes were validated by quantitative real-time polymerase chain reaction (RT-PCR) in insulinoma tissues.A total of 1632 DEGs were obtained, including 1117 upregulated genes and 514 downregulated genes. Pathway enrichment results showed that upregulated DEGs were significantly implicated in insulin secretion, and downregulated DEGs were mainly enriched in pancreatic secretion. PPI network analysis revealed 7 hub genes with degrees more than 10, including GCG (glucagon), GCGR (glucagon receptor), PLCB1 (phospholipase C, beta 1), CASR (calcium sensing receptor), F2R (coagulation factor II thrombin receptor), GRM1 (glutamate metabotropic receptor 1), and GRM5 (glutamate metabotropic receptor 5). DEGs involved in the significant modules were enriched in calcium signaling pathway, protein ubiquitination, and platelet degranulation. Quantitative RT-PCR data confirmed that the expression trends of these hub genes were similar to the results of bioinformatic analysis.The present study demonstrated that candidate DEGs and enriched pathways were the potential critical molecule events involved in the development of insulinoma, and these findings were useful for better understanding of insulinoma genesis.

  4. Combined mutation and rearrangement screening by quantitative PCR high-resolution melting: is it relevant for hereditary recurrent Fever genes?

    Directory of Open Access Journals (Sweden)

    Nathalie Pallares-Ruiz

    2010-11-01

    Full Text Available The recent identification of genes implicated in hereditary recurrent fevers has allowed their specific diagnosis. So far however, only punctual mutations have been identified and a significant number of patients remain with no genetic confirmation of their disease after routine molecular approaches such as sequencing. The possible involvement of sequence rearrangements in these patients has only been examined in familial Mediterranean fever and was found to be unlikely. To assess the existence of larger genetic alterations in 3 other concerned genes, MVK (Mevalonate kinase, NLRP3 (Nod like receptor family, pyrin domain containing 3 and TNFRSF1A (TNF receptor superfamily 1A, we adapted the qPCR-HRM method to study possible intragenic deletions and duplications. This single-tube approach, combining both qualitative (mutations and quantitative (rearrangement screening, has proven effective in Lynch syndrome diagnosis. Using this approach, we studied 113 unselected (prospective group and 88 selected (retrospective group patients and identified no intragenic rearrangements in the 3 genes. Only qualitative alterations were found with a sensitivity similar to that obtained using classical molecular techniques for screening punctual mutations. Our results support that deleterious copy number alterations in MVK, NLRP3 and TNFRSF1A are rare or absent from the mutational spectrum of hereditary recurrent fevers, and demonstrate that a routine combined method such as qPCR-HRM provides no further help in genetic diagnosis. However, quantitative approaches such as qPCR or SQF-PCR did prove to be quick and effective and could still be useful after non contributory punctual mutation screening in the presence of clinically evocative signs.

  5. An overexpression screen in Drosophila for genes that restrict growth or cell-cycle progression in the developing eye.

    OpenAIRE

    Tseng, Ai-Sun Kelly; Hariharan, Iswar K

    2002-01-01

    We screened for genes that, when overexpressed in the proliferating cells of the eye imaginal disc, result in a reduction in the size of the adult eye. After crossing the collection of 2296 EP lines to the ey-GAL4 driver, we identified 46 lines, corresponding to insertions in 32 different loci, that elicited a small eye phenotype. These lines were classified further by testing for an effect in postmitotic cells using the sev-GAL4 driver, by testing for an effect in the wing using en-GAL4, and...

  6. Mutation screening of the Ectodysplasin-A receptor gene EDAR in hypohidrotic ectodermal dysplasia

    NARCIS (Netherlands)

    van der Hout, Annemarie H.; Oudesluijs, Gretel G.; Venema, Andrea; Verheij, Joke B. G. M.; Mol, Bart G. J.; Rump, Patrick; Brunner, Han G.; Vos, Yvonne J.; van Essen, Anthonie J.

    Hypohidrotic ectodermal dysplasia (HED) can be caused by mutations in the X-linked ectodysplasin A (ED1) gene or the autosomal ectodysplasin A-receptor (EDAR) and EDAR-associated death domain (EDARADD) genes. X-linked and autosomal forms are sometimes clinically indistinguishable. For genetic

  7. Searching for resistance genes to Bursaphelenchus xylophilus using high throughput screening

    Directory of Open Access Journals (Sweden)

    Santos Carla S

    2012-11-01

    Full Text Available Abstract Background Pine wilt disease (PWD, caused by the pinewood nematode (PWN; Bursaphelenchus xylophilus, damages and kills pine trees and is causing serious economic damage worldwide. Although the ecological mechanism of infestation is well described, the plant’s molecular response to the pathogen is not well known. This is due mainly to the lack of genomic information and the complexity of the disease. High throughput sequencing is now an efficient approach for detecting the expression of genes in non-model organisms, thus providing valuable information in spite of the lack of the genome sequence. In an attempt to unravel genes potentially involved in the pine defense against the pathogen, we hereby report the high throughput comparative sequence analysis of infested and non-infested stems of Pinus pinaster (very susceptible to PWN and Pinus pinea (less susceptible to PWN. Results Four cDNA libraries from infested and non-infested stems of P. pinaster and P. pinea were sequenced in a full 454 GS FLX run, producing a total of 2,083,698 reads. The putative amino acid sequences encoded by the assembled transcripts were annotated according to Gene Ontology, to assign Pinus contigs into Biological Processes, Cellular Components and Molecular Functions categories. Most of the annotated transcripts corresponded to Picea genes-25.4-39.7%, whereas a smaller percentage, matched Pinus genes, 1.8-12.8%, probably a consequence of more public genomic information available for Picea than for Pinus. The comparative transcriptome analysis showed that when P. pinaster was infested with PWN, the genes malate dehydrogenase, ABA, water deficit stress related genes and PAR1 were highly expressed, while in PWN-infested P. pinea, the highly expressed genes were ricin B-related lectin, and genes belonging to the SNARE and high mobility group families. Quantitative PCR experiments confirmed the differential gene expression between the two pine species

  8. Searching for resistance genes to Bursaphelenchus xylophilus using high throughput screening

    Science.gov (United States)

    2012-01-01

    Background Pine wilt disease (PWD), caused by the pinewood nematode (PWN; Bursaphelenchus xylophilus), damages and kills pine trees and is causing serious economic damage worldwide. Although the ecological mechanism of infestation is well described, the plant’s molecular response to the pathogen is not well known. This is due mainly to the lack of genomic information and the complexity of the disease. High throughput sequencing is now an efficient approach for detecting the expression of genes in non-model organisms, thus providing valuable information in spite of the lack of the genome sequence. In an attempt to unravel genes potentially involved in the pine defense against the pathogen, we hereby report the high throughput comparative sequence analysis of infested and non-infested stems of Pinus pinaster (very susceptible to PWN) and Pinus pinea (less susceptible to PWN). Results Four cDNA libraries from infested and non-infested stems of P. pinaster and P. pinea were sequenced in a full 454 GS FLX run, producing a total of 2,083,698 reads. The putative amino acid sequences encoded by the assembled transcripts were annotated according to Gene Ontology, to assign Pinus contigs into Biological Processes, Cellular Components and Molecular Functions categories. Most of the annotated transcripts corresponded to Picea genes-25.4-39.7%, whereas a smaller percentage, matched Pinus genes, 1.8-12.8%, probably a consequence of more public genomic information available for Picea than for Pinus. The comparative transcriptome analysis showed that when P. pinaster was infested with PWN, the genes malate dehydrogenase, ABA, water deficit stress related genes and PAR1 were highly expressed, while in PWN-infested P. pinea, the highly expressed genes were ricin B-related lectin, and genes belonging to the SNARE and high mobility group families. Quantitative PCR experiments confirmed the differential gene expression between the two pine species. Conclusions Defense-related genes

  9. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages

    DEFF Research Database (Denmark)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man

    2018-01-01

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed...... with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes...... have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays...

  10. High-throughput screening for gene libraries expressing carbohydrate hydrolase activity

    NARCIS (Netherlands)

    Leemhuis, Hans; Euverink, Gert-Jan W.; Dijkhuizen, Lubbert

    2003-01-01

    A simple and fast method is described allowing screening of large number of Escherichia coli clones (4000 per day) for the presence of functional or improved carbohydrate hydrolase enzymes. The procedure is relatively cheap and has the advantage that carbohydrate degrading activity can be directly

  11. Genome-wide screening of Saccharomyces cerevisiae genes regulated by vanillin.

    Science.gov (United States)

    Park, Eun-Hee; Kim, Myoung-Dong

    2015-01-01

    During pretreatment of lignocellulosic biomass, a variety of fermentation inhibitors, including acetic acid and vanillin, are released. Using DNA microarray analysis, this study explored genes of the budding yeast Saccharomyces cerevisiae that respond to vanillin-induced stress. The expression of 273 genes was upregulated and that of 205 genes was downregulated under vanillin stress. Significantly induced genes included MCH2, SNG1, GPH1, and TMA10, whereas NOP2, UTP18, FUR1, and SPR1 were down regulated. Sequence analysis of the 5'-flanking region of upregulated genes suggested that vanillin might regulate gene expression in a stress response element (STRE)-dependent manner, in addition to a pathway that involved the transcription factor Yap1p. Retardation in the cell growth of mutant strains indicated that MCH2, SNG1, and GPH1 are intimately involved in vanillin stress response. Deletion of the genes whose expression levels were decreased under vanillin stress did not result in a notable change in S. cerevisiae growth under vanillin stress. This study will provide the basis for a better understanding of the stress response of the yeast S. cerevisiae to fermentation inhibitors.

  12. Screening for mutations in two exons of FANCG gene in Pakistani population.

    Science.gov (United States)

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  13. Screening of Three Novel Candidate Genes in Arrhythmogenic Right Ventricular Cardiomyopathy

    DEFF Research Database (Denmark)

    Christensen, Alex Hørby; Benn, Marianne; Tybjærg-Hansen, Anne

    2011-01-01

    Arrhythmogenic right ventricular cardiomyopathy (ARVC) has been associated with mutations in genes encoding cellular adhesion proteins. However, only about 40% of patients have mutations in known genes. We hypothesized that mutations in the genes encoding ß-catenin (CTNNB1), a-T-catenin (CTNNA3......Scanner melting curve analysis. Our comprehensive mutation scanning did not identify any disease-causing mutations. Thirty-five sequence variants were found, including one rare nonsynonymous variant of unknown significance (CTNNA3 A689V). Fourteen of the variants were novel. In conclusion, in our cohort...

  14. One-Pot Parallel Synthesis of Lipid Library via Thiolactone Ring Opening and Screening for Gene Delivery.

    Science.gov (United States)

    Molla, Mijanur R; Böser, Alexander; Rana, Akshita; Schwarz, Karina; Levkin, Pavel A

    2018-04-18

    Efficient delivery of nucleic acids into cells is of great interest in the field of cell biology and gene therapy. Despite a lot of research, transfection efficiency and structural diversity of gene-delivery vectors are still limited. A better understanding of the structure-function relationship of gene delivery vectors is also essential for the design of novel and intelligent delivery vectors, efficient in "difficult-to-transfect" cells and in vivo clinical applications. Most of the existing strategies for the synthesis of gene-delivery vectors require multiple steps and lengthy procedures. Here, we demonstrate a facile, three-component one-pot synthesis of a combinatorial library of 288 structurally diverse lipid-like molecules termed "lipidoids" via a thiolactone ring opening reaction. This strategy introduces the possibility to synthesize lipidoids with hydrophobic tails containing both unsaturated bonds and reducible disulfide groups. The whole synthesis and purification are convenient, extremely fast, and can be accomplished within a few hours. Screening of the produced lipidoids using HEK293T cells without addition of helper lipids resulted in identification of highly stable liposomes demonstrating ∼95% transfection efficiency with low toxicity.

  15. A Knockout Screen of ApiAP2 Genes Reveals Networks of Interacting Transcriptional Regulators Controlling the Plasmodium Life Cycle.

    Science.gov (United States)

    Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver

    2017-01-11

    A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  16. Exploration for the Salinity Tolerance-Related Genes from Xero-Halophyte Atriplex canescens Exploiting Yeast Functional Screening System

    Directory of Open Access Journals (Sweden)

    Gang Yu

    2017-11-01

    Full Text Available Plant productivity is limited by salinity stress, both in natural and agricultural systems. Identification of salt stress-related genes from halophyte can provide insights into mechanisms of salt stress tolerance in plants. Atriplex canescens is a xero-halophyte that exhibits optimum growth in the presence of 400 mM NaCl. A cDNA library derived from highly salt-treated A. canescens plants was constructed based on a yeast expression system. A total of 53 transgenic yeast clones expressing enhanced salt tolerance were selected from 105 transformants. Their plasmids were sequenced and the gene characteristics were annotated using a BLASTX search. Retransformation of yeast cells with the selected plasmids conferred salt tolerance to the resulting transformants. The expression patterns of 28 of these stress-related genes were further investigated in A. canescens leaves by quantitative reverse transcription-PCR. In this study, we provided a rapid and robust assay system for large-scale screening of genes for varied abiotic stress tolerance with high efficiency in A. canescens.

  17. A genome-wide screen for genetic variants that modify the recruitment of REST to its target genes.

    Directory of Open Access Journals (Sweden)

    Rory Johnson

    Full Text Available Increasing numbers of human diseases are being linked to genetic variants, but our understanding of the mechanistic links leading from DNA sequence to disease phenotype is limited. The majority of disease-causing nucleotide variants fall within the non-protein-coding portion of the genome, making it likely that they act by altering gene regulatory sequences. We hypothesised that SNPs within the binding sites of the transcriptional repressor REST alter the degree of repression of target genes. Given that changes in the effective concentration of REST contribute to several pathologies-various cancers, Huntington's disease, cardiac hypertrophy, vascular smooth muscle proliferation-these SNPs should alter disease-susceptibility in carriers. We devised a strategy to identify SNPs that affect the recruitment of REST to target genes through the alteration of its DNA recognition element, the RE1. A multi-step screen combining genetic, genomic, and experimental filters yielded 56 polymorphic RE1 sequences with robust and statistically significant differences of affinity between alleles. These SNPs have a considerable effect on the the functional recruitment of REST to DNA in a range of in vitro, reporter gene, and in vivo analyses. Furthermore, we observe allele-specific biases in deeply sequenced chromatin immunoprecipitation data, consistent with predicted differenes in RE1 affinity. Amongst the targets of polymorphic RE1 elements are important disease genes including NPPA, PTPRT, and CDH4. Thus, considerable genetic variation exists in the DNA motifs that connect gene regulatory networks. Recently available ChIP-seq data allow the annotation of human genetic polymorphisms with regulatory information to generate prior hypotheses about their disease-causing mechanism.

  18. A Genome-Wide Screen for Genetic Variants That Modify the Recruitment of REST to Its Target Genes

    Science.gov (United States)

    Johnson, Rory; Richter, Nadine; Bogu, Gireesh K.; Bhinge, Akshay; Teng, Siaw Wei; Choo, Siew Hua; Andrieux, Lise O.; de Benedictis, Cinzia; Jauch, Ralf; Stanton, Lawrence W.

    2012-01-01

    Increasing numbers of human diseases are being linked to genetic variants, but our understanding of the mechanistic links leading from DNA sequence to disease phenotype is limited. The majority of disease-causing nucleotide variants fall within the non-protein-coding portion of the genome, making it likely that they act by altering gene regulatory sequences. We hypothesised that SNPs within the binding sites of the transcriptional repressor REST alter the degree of repression of target genes. Given that changes in the effective concentration of REST contribute to several pathologies—various cancers, Huntington's disease, cardiac hypertrophy, vascular smooth muscle proliferation—these SNPs should alter disease-susceptibility in carriers. We devised a strategy to identify SNPs that affect the recruitment of REST to target genes through the alteration of its DNA recognition element, the RE1. A multi-step screen combining genetic, genomic, and experimental filters yielded 56 polymorphic RE1 sequences with robust and statistically significant differences of affinity between alleles. These SNPs have a considerable effect on the the functional recruitment of REST to DNA in a range of in vitro, reporter gene, and in vivo analyses. Furthermore, we observe allele-specific biases in deeply sequenced chromatin immunoprecipitation data, consistent with predicted differenes in RE1 affinity. Amongst the targets of polymorphic RE1 elements are important disease genes including NPPA, PTPRT, and CDH4. Thus, considerable genetic variation exists in the DNA motifs that connect gene regulatory networks. Recently available ChIP–seq data allow the annotation of human genetic polymorphisms with regulatory information to generate prior hypotheses about their disease-causing mechanism. PMID:22496669

  19. High-Throughput Behavioral Screens: the First Step towards Finding Genes Involved in Vertebrate Brain Function Using Zebrafish

    Directory of Open Access Journals (Sweden)

    Robert Gerlai

    2010-04-01

    Full Text Available The zebrafish has been in the forefront of developmental biology for three decades and has become a favorite of geneticists. Due to the accumulated genetic knowledge and tools developed for the zebrafish it is gaining popularity in other disciplines, including neuroscience. The zebrafish offers a compromise between system complexity (it is a vertebrate similar in many ways to our own species and practical simplicity (it is small, easy to keep, and prolific. Such features make zebrafish an excellent choice for high throughput mutation and drug screening. For the identification of mutation or drug induced alteration of brain function arguably the best methods are behavioral test paradigms. This review does not present experimental examples for the identification of particular genes or drugs. Instead it describes how behavioral screening methods may enable one to find functional alterations in the vertebrate brain. Furthermore, the review is not comprehensive. The behavioral test examples presented are biased according to the personal interests of the author. They will cover research areas including learning and memory, fear and anxiety, and social behavior. Nevertheless, the general principles will apply to other functional domains and should represent a snapshot of the rapidly evolving behavioral screening field with zebrafish.

  20. Analysis of mammalian gene function through broad based phenotypic screens across a consortium of mouse clinics

    Science.gov (United States)

    Adams, David J; Adams, Niels C; Adler, Thure; Aguilar-Pimentel, Antonio; Ali-Hadji, Dalila; Amann, Gregory; André, Philippe; Atkins, Sarah; Auburtin, Aurelie; Ayadi, Abdel; Becker, Julien; Becker, Lore; Bedu, Elodie; Bekeredjian, Raffi; Birling, Marie-Christine; Blake, Andrew; Bottomley, Joanna; Bowl, Mike; Brault, Véronique; Busch, Dirk H; Bussell, James N; Calzada-Wack, Julia; Cater, Heather; Champy, Marie-France; Charles, Philippe; Chevalier, Claire; Chiani, Francesco; Codner, Gemma F; Combe, Roy; Cox, Roger; Dalloneau, Emilie; Dierich, André; Di Fenza, Armida; Doe, Brendan; Duchon, Arnaud; Eickelberg, Oliver; Esapa, Chris T; El Fertak, Lahcen; Feigel, Tanja; Emelyanova, Irina; Estabel, Jeanne; Favor, Jack; Flenniken, Ann; Gambadoro, Alessia; Garrett, Lilian; Gates, Hilary; Gerdin, Anna-Karin; Gkoutos, George; Greenaway, Simon; Glasl, Lisa; Goetz, Patrice; Da Cruz, Isabelle Goncalves; Götz, Alexander; Graw, Jochen; Guimond, Alain; Hans, Wolfgang; Hicks, Geoff; Hölter, Sabine M; Höfler, Heinz; Hancock, John M; Hoehndorf, Robert; Hough, Tertius; Houghton, Richard; Hurt, Anja; Ivandic, Boris; Jacobs, Hughes; Jacquot, Sylvie; Jones, Nora; Karp, Natasha A; Katus, Hugo A; Kitchen, Sharon; Klein-Rodewald, Tanja; Klingenspor, Martin; Klopstock, Thomas; Lalanne, Valerie; Leblanc, Sophie; Lengger, Christoph; le Marchand, Elise; Ludwig, Tonia; Lux, Aline; McKerlie, Colin; Maier, Holger; Mandel, Jean-Louis; Marschall, Susan; Mark, Manuel; Melvin, David G; Meziane, Hamid; Micklich, Kateryna; Mittelhauser, Christophe; Monassier, Laurent; Moulaert, David; Muller, Stéphanie; Naton, Beatrix; Neff, Frauke; Nolan, Patrick M; Nutter, Lauryl MJ; Ollert, Markus; Pavlovic, Guillaume; Pellegata, Natalia S; Peter, Emilie; Petit-Demoulière, Benoit; Pickard, Amanda; Podrini, Christine; Potter, Paul; Pouilly, Laurent; Puk, Oliver; Richardson, David; Rousseau, Stephane; Quintanilla-Fend, Leticia; Quwailid, Mohamed M; Racz, Ildiko; Rathkolb, Birgit; Riet, Fabrice; Rossant, Janet; Roux, Michel; Rozman, Jan; Ryder, Ed; Salisbury, Jennifer; Santos, Luis; Schäble, Karl-Heinz; Schiller, Evelyn; Schrewe, Anja; Schulz, Holger; Steinkamp, Ralf; Simon, Michelle; Stewart, Michelle; Stöger, Claudia; Stöger, Tobias; Sun, Minxuan; Sunter, David; Teboul, Lydia; Tilly, Isabelle; Tocchini-Valentini, Glauco P; Tost, Monica; Treise, Irina; Vasseur, Laurent; Velot, Emilie; Vogt-Weisenhorn, Daniela; Wagner, Christelle; Walling, Alison; Weber, Bruno; Wendling, Olivia; Westerberg, Henrik; Willershäuser, Monja; Wolf, Eckhard; Wolter, Anne; Wood, Joe; Wurst, Wolfgang; Yildirim, Ali Önder; Zeh, Ramona; Zimmer, Andreas; Zimprich, Annemarie

    2015-01-01

    The function of the majority of genes in the mouse and human genomes remains unknown. The mouse ES cell knockout resource provides a basis for characterisation of relationships between gene and phenotype. The EUMODIC consortium developed and validated robust methodologies for broad-based phenotyping of knockouts through a pipeline comprising 20 disease-orientated platforms. We developed novel statistical methods for pipeline design and data analysis aimed at detecting reproducible phenotypes with high power. We acquired phenotype data from 449 mutant alleles, representing 320 unique genes, of which half had no prior functional annotation. We captured data from over 27,000 mice finding that 83% of the mutant lines are phenodeviant, with 65% demonstrating pleiotropy. Surprisingly, we found significant differences in phenotype annotation according to zygosity. Novel phenotypes were uncovered for many genes with unknown function providing a powerful basis for hypothesis generation and further investigation in diverse systems. PMID:26214591

  1. Functional screen for genes responsible for tamoxifen resistance in human breast cancer cells

    NARCIS (Netherlands)

    Meijer, Danielle; van Agthoven, Ton; Bosma, Peter T.; Nooter, Kees; Dorssers, Lambert C. J.

    2006-01-01

    Antiestrogens, such as tamoxifen, are widely used for endocrine treatment of estrogen receptor-positive breast cancer. However, as breast cancer progresses, development of tamoxifen resistance is inevitable. The mechanisms underlying this resistance are not well understood. To identify genes

  2. Systematic screen for mutants resistant to TORC1 inhibition in fission yeast reveals genes involved in cellular ageing and growth

    Directory of Open Access Journals (Sweden)

    Charalampos Rallis

    2014-01-01

    Target of rapamycin complex 1 (TORC1, which controls growth in response to nutrients, promotes ageing in multiple organisms. The fission yeast Schizosaccharomyces pombe emerges as a valuable genetic model system to study TORC1 function and cellular ageing. Here we exploited the combinatorial action of rapamycin and caffeine, which inhibit fission yeast growth in a TORC1-dependent manner. We screened a deletion library, comprising ∼84% of all non-essential fission yeast genes, for drug-resistant mutants. This screen identified 33 genes encoding functions such as transcription, kinases, mitochondrial respiration, biosynthesis, intra-cellular trafficking, and stress response. Among the corresponding mutants, 5 showed shortened and 21 showed increased maximal chronological lifespans; 15 of the latter mutants showed no further lifespan increase with rapamycin and might thus represent key targets downstream of TORC1. We pursued the long-lived sck2 mutant with additional functional analyses, revealing that the Sck2p kinase functions within the TORC1 network and is required for normal cell growth, global protein translation, and ribosomal S6 protein phosphorylation in a nutrient-dependent manner. Notably, slow cell growth was associated with all long-lived mutants while oxidative-stress resistance was not.

  3. A zebrafish screen for craniofacial mutants identifies wdr68 as a highly conserved gene required for endothelin-1 expression

    Directory of Open Access Journals (Sweden)

    Amsterdam Adam

    2006-06-01

    Full Text Available Abstract Background Craniofacial birth defects result from defects in cranial neural crest (NC patterning and morphogenesis. The vertebrate craniofacial skeleton is derived from cranial NC cells and the patterning of these cells occurs within the pharyngeal arches. Substantial efforts have led to the identification of several genes required for craniofacial skeletal development such as the endothelin-1 (edn1 signaling pathway that is required for lower jaw formation. However, many essential genes required for craniofacial development remain to be identified. Results Through screening a collection of insertional zebrafish mutants containing approximately 25% of the genes essential for embryonic development, we present the identification of 15 essential genes that are required for craniofacial development. We identified 3 genes required for hyomandibular development. We also identified zebrafish models for Campomelic Dysplasia and Ehlers-Danlos syndrome. To further demonstrate the utility of this method, we include a characterization of the wdr68 gene. We show that wdr68 acts upstream of the edn1 pathway and is also required for formation of the upper jaw equivalent, the palatoquadrate. We also present evidence that the level of wdr68 activity required for edn1 pathway function differs between the 1st and 2nd arches. Wdr68 interacts with two minibrain-related kinases, Dyrk1a and Dyrk1b, required for embryonic growth and myotube differentiation, respectively. We show that a GFP-Wdr68 fusion protein localizes to the nucleus with Dyrk1a in contrast to an engineered loss of function mutation Wdr68-T284F that no longer accumulated in the cell nucleus and failed to rescue wdr68 mutant animals. Wdr68 homologs appear to exist in all eukaryotic genomes. Notably, we found that the Drosophila wdr68 homolog CG14614 could substitute for the vertebrate wdr68 gene even though insects lack the NC cell lineage. Conclusion This work represents a systematic

  4. Comprehensive genome-wide analysis of Glutathione S-transferase gene family in potato (Solanum tuberosum L.) and their expression profiling in various anatomical tissues and perturbation conditions.

    Science.gov (United States)

    Islam, Md Shiful; Choudhury, Mouraj; Majlish, Al-Nahian Khan; Islam, Tahmina; Ghosh, Ajit

    2018-01-10

    Glutathione S-transferases (GSTs) are ubiquitous enzymes which play versatile functions including cellular detoxification and stress tolerance. In this study, a comprehensive genome-wide identification of GST gene family was carried out in potato (Solanum tuberosum L.). The result demonstrated the presence of at least 90 GST genes in potato which is greater than any other reported species. According to the phylogenetic analyses of Arabidopsis, rice and potato GST members, GSTs could be subdivided into ten different classes and each class is found to be highly conserved. The largest class of potato GST family is tau with 66 members, followed by phi and lambda. The chromosomal localization analysis revealed the highly uneven distribution of StGST genes across the potato genome. Transcript profiling of 55 StGST genes showed the tissue-specific expression for most of the members. Moreover, expression of StGST genes were mainly repressed in response to abiotic stresses, while largely induced in response to biotic and hormonal elicitations. Further analysis of StGST gene's promoter identified the presence of various stress responsive cis-regulatory elements. Moreover, one of the highly stress responsive StGST members, StGSTU46, showed strong affinity towards flurazole with lowest binding energy of -7.6kcal/mol that could be used as antidote to protect crop against herbicides. These findings will facilitate the further functional and evolutionary characterization of GST genes in potato. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Microarray-based screening of differentially expressed genes in glucocorticoid-induced avascular necrosis

    Science.gov (United States)

    Huang, Gangyong; Wei, Yibing; Zhao, Guanglei; Xia, Jun; Wang, Siqun; Wu, Jianguo; Chen, Feiyan; Chen, Jie; Shi, Jingshen

    2017-01-01

    The underlying mechanisms of glucocorticoid (GC)-induced avascular necrosis of the femoral head (ANFH) have yet to be fully understood, in particular the mechanisms associated with the change of gene expression pattern. The present study aimed to identify key genes with a differential expression pattern in GC-induced ANFH. E-MEXP-2751 microarray data were downloaded from the ArrayExpress database. Differentially expressed genes (DEGs) were identified in 5 femoral head samples of steroid-induced ANFH rats compared with 5 placebo-treated rat samples. Gene Ontology (GO) and pathway enrichment analyses were performed upon these DEGs. A total 93 DEGs (46 upregulated and 47 downregulated genes) were identified in GC-induced ANFH samples. These DEGs were enriched in different GO terms and pathways, including chondrocyte differentiation and detection of chemical stimuli. The enrichment map revealed that skeletal system development was interconnected with several other GO terms by gene overlap. The literature mined network analysis revealed that 5 upregulated genes were associated with femoral necrosis, including parathyroid hormone receptor 1 (PTHR1), vitamin D (1,25-Dihydroxyvitamin D3) receptor (VDR), collagen, type II, α1, proprotein convertase subtilisin/kexin type 6 and zinc finger protein 354C (ZFP354C). In addition, ZFP354C and VDR were identified to transcription factors. Furthermore, PTHR1 was revealed to interact with VDR, and α-2-macroglobulin (A2M) interacted with fibronectin 1 (FN1) in the PPI network. PTHR1 may be involved in GC-induced ANFH via interacting with VDR. A2M may also be involved in the development of GC-induced ANFH through interacting with FN1. An improved understanding of the molecular mechanisms underlying GC-induced ANFH may provide novel targets for diagnostics and therapeutic treatment. PMID:28393228

  6. Microarray‑based screening of differentially expressed genes in glucocorticoid‑induced avascular necrosis.

    Science.gov (United States)

    Huang, Gangyong; Wei, Yibing; Zhao, Guanglei; Xia, Jun; Wang, Siqun; Wu, Jianguo; Chen, Feiyan; Chen, Jie; Shi, Jingshen

    2017-06-01

    The underlying mechanisms of glucocorticoid (GC)‑induced avascular necrosis of the femoral head (ANFH) have yet to be fully understood, in particular the mechanisms associated with the change of gene expression pattern. The present study aimed to identify key genes with a differential expression pattern in GC‑induced ANFH. E‑MEXP‑2751 microarray data were downloaded from the ArrayExpress database. Differentially expressed genes (DEGs) were identified in 5 femoral head samples of steroid‑induced ANFH rats compared with 5 placebo‑treated rat samples. Gene Ontology (GO) and pathway enrichment analyses were performed upon these DEGs. A total 93 DEGs (46 upregulated and 47 downregulated genes) were identified in GC‑induced ANFH samples. These DEGs were enriched in different GO terms and pathways, including chondrocyte differentiation and detection of chemical stimuli. The enrichment map revealed that skeletal system development was interconnected with several other GO terms by gene overlap. The literature mined network analysis revealed that 5 upregulated genes were associated with femoral necrosis, including parathyroid hormone receptor 1 (PTHR1), vitamin D (1,25‑Dihydroxyvitamin D3) receptor (VDR), collagen, type II, α1, proprotein convertase subtilisin/kexin type 6 and zinc finger protein 354C (ZFP354C). In addition, ZFP354C and VDR were identified to transcription factors. Furthermore, PTHR1 was revealed to interact with VDR, and α‑2‑macroglobulin (A2M) interacted with fibronectin 1 (FN1) in the PPI network. PTHR1 may be involved in GC‑induced ANFH via interacting with VDR. A2M may also be involved in the development of GC‑induced ANFH through interacting with FN1. An improved understanding of the molecular mechanisms underlying GC‑induced ANFH may provide novel targets for diagnostics and therapeutic treatment.

  7. Screening for polymorphisms in the PXR gene in a Dutch population.

    Science.gov (United States)

    Bosch, Tessa M; Deenen, Maarten; Pruntel, Roelof; Smits, Paul H M; Schellens, Jan H M; Beijnen, Jos H; Meijerman, Irma

    2006-05-01

    Cytochrome P450 3A4 (CYP3A4) is involved in the metabolism of over 50% of all drugs currently in use. However, CYP3A4 expression shows a large inter-individual variation that cannot only be explained by genetic polymorphisms identified in this gene. The pregnane X receptor (PXR) has been identified as a transcriptional regulator of CYP3A4. Single nucleotide polymorphisms (SNPs) in the PXR gene could influence PXR activity and thereby CYP3A4 expression. This study was therefore aimed at determining the frequencies of known SNPs and detecting yet unknown SNPs in the PXR gene in a Dutch population. Genomic DNA was isolated from blood samples obtained from 100 healthy volunteers and subjected to PCR amplification, followed by DNA sequencing. The population, of which the ethnicity was 93% Caucasian, consisted of 79 female individuals and 21 males. A total of 24 SNPs were found in the PXR gene, eight of which are previously unknown. The allelic frequencies found in this population varied from 0.5 to 73%. Most of the previously detected SNPs were located in introns. One new SNP, T8555G in exon 8, causes an amino acid change of C379G and is located in the Ligand Binding Domain of PXR. Several SNPs were detected in the PXR gene, one of which is located in the ligand binding domain (LBD). These SNPs may influence PXR-mediated CYP3A4 induction.

  8. Endocrine disruption screening by protein and gene expression of vitellogenin in freshly isolated and cryopreserved rainbow trout hepatocytes.

    Science.gov (United States)

    Markell, Lauren K; Mingoia, Robert T; Peterson, Heather M; Yao, Jianhong; Waters, Stephanie M; Finn, James P; Nabb, Diane L; Han, Xing

    2014-08-18

    Xenobiotics may activate the estrogen receptor, resulting in alteration of normal endocrine functions in animals and humans. Consequently, this necessitates development of assay end points capable of identifying estrogenic xenobiotics. In the present study, we screened the potential estrogenicity of chemicals via their ability to induce vitellogenin (VTG) expression in cultured primary hepatocytes from male trout. A routine method for VTG detection measures the secretion of the protein by enzyme-linked immunosorbent assay (ELISA) in freshly isolated trout hepatocytes. However, this lengthy (6 days) culturing procedure requires that hepatocyte isolation is performed each time the assay is run. We optimized this methodology by investigating the utility of cryopreserved hepatocytes, shortening the incubation time, performing a quantitative real-time PCR (qPCR) method for VTG quantification, and verifying the model system with reference chemicals 17β-estradiol, estrone, diethylstilbestrol, hexestrol, genistein, and a negative control, corticosterone. To test the performance of both freshly isolated and cryopreserved hepatocytes, mRNA was collected from hepatocytes following 24 h treatment for VTG gene expression analysis, whereas cell culture media was collected for a VTG ELISA 96 h post-treatment. EC50 values were obtained for each reference chemical except for corticosterone, which exhibited no induction of VTG gene or protein level. Our results show linear concordance between ELISA and qPCR detection methods. Although there was approximately 50% reduction in VTG inducibility following cryopreservation, linear concordance of EC50 values was found between freshly isolated and cryopreserved hepatocytes, indicating that cryopreservation does not alter the functional assessment of estrogen receptor activation and therefore VTG expression. These studies demonstrate that qPCR is a sensitive and specific method for detecting VTG gene expression that can be used together

  9. Environmental Application of Reporter-Genes Based Biosensors for Chemical Contamination Screening

    Directory of Open Access Journals (Sweden)

    Matejczyk Marzena

    2014-12-01

    Full Text Available The paper presents results of research concerning possibilities of applications of reporter-genes based microorganisms, including the selective presentation of defects and advantages of different new scientific achievements of methodical solutions in genetic system constructions of biosensing elements for environmental research. The most robust and popular genetic fusion and new trends in reporter genes technology – such as LacZ (β-galactosidase, xylE (catechol 2,3-dioxygenase, gfp (green fluorescent proteins and its mutated forms, lux (prokaryotic luciferase, luc (eukaryotic luciferase, phoA (alkaline phosphatase, gusA and gurA (β-glucuronidase, antibiotics and heavy metals resistance are described. Reporter-genes based biosensors with use of genetically modified bacteria and yeast successfully work for genotoxicity, bioavailability and oxidative stress assessment for detection and monitoring of toxic compounds in drinking water and different environmental samples, surface water, soil, sediments.

  10. Genome-wide screen for salmonella genes required for long-term systemic infection of the mouse.

    Directory of Open Access Journals (Sweden)

    2006-02-01

    Full Text Available A microarray-based negative selection screen was performed to identify Salmonella enterica serovar Typhimurium (serovar Typhimurium genes that contribute to long-term systemic infection in 129X1/SvJ (Nramp1(r mice. A high-complexity transposon-mutagenized library was used to infect mice intraperitoneally, and the selective disappearance of mutants was monitored after 7, 14, 21, and 28 d postinfection. One hundred and eighteen genes were identified to contribute to serovar Typhimurium infection of the spleens of mice by 28 d postinfection. The negatively selected mutants represent many known aspects of Salmonella physiology and pathogenesis, although the majority of the identified genes are of putative or unknown function. Approximately 30% of the negatively selected genes correspond to horizontally acquired regions such as those within Salmonella pathogenicity islands (SPI 1-5, prophages (Gifsy-1 and -2 and remnant, and the pSLT virulence plasmid. In addition, mutations in genes responsible for outer membrane structure and remodeling, such as LPS- and PhoP-regulated and fimbrial genes, were also selected against. Competitive index experiments demonstrated that the secreted SPI2 effectors SseK2 and SseJ as well as the SPI4 locus are attenuated relative to wild-type bacteria during systemic infection. Interestingly, several SPI1-encoded type III secretion system effectors/translocases are required by serovar Typhimurium to establish and, unexpectedly, to persist systemically, challenging the present description of Salmonella pathogenesis. Moreover, we observed a progressive selection against serovar Typhimurium mutants based upon the duration of the infection, suggesting that different classes of genes may be required at distinct stages of infection. Overall, these data indicate that Salmonella long-term systemic infection in the mouse requires a diverse repertoire of virulence factors. This diversity of genes presumably reflects the fact that

  11. Status of perturbative QCD

    International Nuclear Information System (INIS)

    Collins, J.C.

    1985-01-01

    Progress in quantum chromodynamics in the past year is reviewed in these specific areas: proof of factorization for hadron-hadron collisions, fast calculation of higher order graphs, perturbative Monte Carlo calculations for hadron-hadron scattering, applicability of perturbative methods to heavy quark production, and understanding of the small-x problem. 22 refs

  12. HNF1 alpha gene coding regions mutations screening, in a Caucasian population clinically characterized as MODY from Argentina.

    Science.gov (United States)

    Lopez, Ariel Pablo; Foscaldi, Sabrina Andrea; Perez, Maria Silvia; Rodriguez, Martín; Traversa, Mercedes; Puchulu, Félix Miguel; Bergada, Ignacio; Frechtel, Gustavo Daniel

    2011-02-01

    There are at least six subtypes of Maturity Onset Diabetes of the Young (MODY) with distinctive genetic causes. MODY 3 is caused by mutations in HNF1A gene, an insulin transcription factor, so mutations in this gene are associated with impaired insulin secretion. MODY 3 prevalence differs according to the population analyzed, but it is one of the most frequent subtypes. Therefore, our aims in this work were to find mutations present in the HNF1A gene and provide information on their prevalence. Mutations screening was done in a group of 80 unrelated patients (average age 17.1 years) selected by clinical characterization of MODY, by SSCP electrophoresis followed by sequenciation. We found eight mutations, of which six were novel and four sequence variants, which were all novel. Therefore the prevalence of MODY 3 in this group was 10%. Compared clinical data between the non-MODY 3 patients and the MODY 3 diagnosed patients did not show any significant difference. Eight patients were diagnosed as MODY 3 and new data about the prevalence of that subtype is provided. Our results contribute to reveal novel mutations, providing new data about the prevalence of that subtype. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  13. Mutational screening of the USH2A gene in Spanish USH patients reveals 23 novel pathogenic mutations

    Directory of Open Access Journals (Sweden)

    Diaz-Llopis Manuel

    2011-10-01

    Full Text Available Abstract Background Usher Syndrome type II (USH2 is an autosomal recessive disorder, characterized by moderate to severe hearing impairment and retinitis pigmentosa (RP. Among the three genes implicated, mutations in the USH2A gene account for 74-90% of the USH2 cases. Methods To identify the genetic cause of the disease and determine the frequency of USH2A mutations in a cohort of 88 unrelated USH Spanish patients, we carried out a mutation screening of the 72 coding exons of this gene by direct sequencing. Moreover, we performed functional minigene studies for those changes that were predicted to affect splicing. Results As a result, a total of 144 DNA sequence variants were identified. Based upon previous studies, allele frequencies, segregation analysis, bioinformatics' predictions and in vitro experiments, 37 variants (23 of them novel were classified as pathogenic mutations. Conclusions This report provide a wide spectrum of USH2A mutations and clinical features, including atypical Usher syndrome phenotypes resembling Usher syndrome type I. Considering only the patients clearly diagnosed with Usher syndrome type II, and results obtained in this and previous studies, we can state that mutations in USH2A are responsible for 76.1% of USH2 disease in patients of Spanish origin.

  14. Table 2. List of screened and selected genes from public data base ...

    Indian Academy of Sciences (India)

    User

    Table 3. List of primers used in qRT-PCR and promoter cloning. Primers used in qRT-PCR (5'-3'). Gene name primer sequence. Forward (5'-3'). Reverse (5'-3'). PW250 (AT1G19250) GCATAACCTCTCTCAGATGGCTTCT. TCGGGTTGTGATGAACTAAGTTCTT. PW590 (AT1G74590) ATGGGACGTGGATAAGCACATACT.

  15. Cloning and SNP screening of TLR4 gene and the association ...

    African Journals Online (AJOL)

    huis

    Human models, in particular, suggest TLR4 to be a candidate gene .... Rapid amplification of cDNA ends (RACE) was performed with a BD SMART™ RACE cDNA .... content (PIC) were calculated with software of POPGENE (Ver. 1.31).

  16. Early results of sarcomeric gene screening from the Egyptian National BA-HCM Program.

    Science.gov (United States)

    Kassem, Heba Sh; Azer, Remon S; Saber-Ayad, Maha; Ayad, Maha S; Moharem-Elgamal, Sarah; Magdy, Gehan; Elguindy, Ahmed; Cecchi, Franco; Olivotto, Iacopo; Yacoub, Magdi H

    2013-02-01

    The present study comprised sarcomeric genotyping of the three most commonly involved sarcomeric genes: MYBPC3, MYH7, and TNNT2 in 192 unrelated Egyptian hypertrophic cardiomyopathy (HCM) index patients. Mutations were detected in 40 % of cases. Presence of positive family history was significantly (p=0.002) associated with a higher genetic positive yield (49/78, 62.8 %). The majority of the detected mutations in the three sarcomeric genes were novel (40/62, 65 %) and mostly private (47/62, 77 %). Single nucleotide substitution was the most frequently detected mutation type (51/62, 82 %). Over three quarters of these substitutions (21/27, 78 %) involved CpG dinucleotide sites and resulted from C>T or G>A transition in the three analyzed genes, highlighting the significance of CpG high mutability within the sarcomeric genes examined. This study could aid in global comparative studies in different ethnic populations and constitutes an important step in the evolution of the integrated clinical, translational, and basic science HCM program.

  17. New in vitro reporter gene bioassays for screening of hormonal active compounds in the environment

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Kateřina; Cajthaml, Tomáš

    2010-01-01

    Roč. 88, č. 4 (2010), s. 839-847 ISSN 0175-7598 R&D Projects: GA ČR GAP503/10/0408 Institutional research plan: CEZ:AV0Z50200510 Keywords : endocrine disruptors * in vitro bioassays * reporter gene assays Subject RIV: EE - Microbiology, Virology Impact factor: 3.280, year: 2010

  18. Perturbative and constructive renormalization

    International Nuclear Information System (INIS)

    Veiga, P.A. Faria da

    2000-01-01

    These notes are a survey of the material treated in a series of lectures delivered at the X Summer School Jorge Andre Swieca. They are concerned with renormalization in Quantum Field Theories. At the level of perturbation series, we review classical results as Feynman graphs, ultraviolet and infrared divergences of Feynman integrals. Weinberg's theorem and Hepp's theorem, the renormalization group and the Callan-Symanzik equation, the large order behavior and the divergence of most perturbation series. Out of the perturbative regime, as an example of a constructive method, we review Borel summability and point out how it is possible to circumvent the perturbation diseases. These lectures are a preparation for the joint course given by professor V. Rivasseau at the same school, where more sophisticated non-perturbative analytical methods based on rigorous renormalization group techniques are presented, aiming at furthering our understanding about the subject and bringing field theoretical models to a satisfactory mathematical level. (author)

  19. Gene expression and epigenetic discovery screen reveal methylation of SFRP2 in prostate cancer.

    LENUS (Irish Health Repository)

    Perry, Antoinette S

    2013-04-15

    Aberrant activation of Wnts is common in human cancers, including prostate. Hypermethylation associated transcriptional silencing of Wnt antagonist genes SFRPs (Secreted Frizzled-Related Proteins) is a frequent oncogenic event. The significance of this is not known in prostate cancer. The objectives of our study were to (i) profile Wnt signaling related gene expression and (ii) investigate methylation of Wnt antagonist genes in prostate cancer. Using TaqMan Low Density Arrays, we identified 15 Wnt signaling related genes with significantly altered expression in prostate cancer; the majority of which were upregulated in tumors. Notably, histologically benign tissue from men with prostate cancer appeared more similar to tumor (r = 0.76) than to benign prostatic hyperplasia (BPH; r = 0.57, p < 0.001). Overall, the expression profile was highly similar between tumors of high (≥ 7) and low (≤ 6) Gleason scores. Pharmacological demethylation of PC-3 cells with 5-Aza-CdR reactivated 39 genes (≥ 2-fold); 40% of which inhibit Wnt signaling. Methylation frequencies in prostate cancer were 10% (2\\/20) (SFRP1), 64.86% (48\\/74) (SFRP2), 0% (0\\/20) (SFRP4) and 60% (12\\/20) (SFRP5). SFRP2 methylation was detected at significantly lower frequencies in high-grade prostatic intraepithelial neoplasia (HGPIN; 30%, (6\\/20), p = 0.0096), tumor adjacent benign areas (8.82%, (7\\/69), p < 0.0001) and BPH (11.43% (4\\/35), p < 0.0001). The quantitative level of SFRP2 methylation (normalized index of methylation) was also significantly higher in tumors (116) than in the other samples (HGPIN = 7.45, HB = 0.47, and BPH = 0.12). We show that SFRP2 hypermethylation is a common event in prostate cancer. SFRP2 methylation in combination with other epigenetic markers may be a useful biomarker of prostate cancer.

  20. A genetic screen for modifiers of Drosophila caspase Dcp-1 reveals caspase involvement in autophagy and novel caspase-related genes

    Directory of Open Access Journals (Sweden)

    Ahnn Joohong

    2010-01-01

    Full Text Available Abstract Background Caspases are cysteine proteases with essential functions in the apoptotic pathway; their proteolytic activity toward various substrates is associated with the morphological changes of cells. Recent reports have described non-apoptotic functions of caspases, including autophagy. In this report, we searched for novel modifiers of the phenotype of Dcp-1 gain-of-function (GF animals by screening promoter element- inserted Drosophila melanogaster lines (EP lines. Results We screened ~15,000 EP lines and identified 72 Dcp-1-interacting genes that were classified into 10 groups based on their functions and pathways: 4 apoptosis signaling genes, 10 autophagy genes, 5 insulin/IGF and TOR signaling pathway genes, 6 MAP kinase and JNK signaling pathway genes, 4 ecdysone signaling genes, 6 ubiquitination genes, 11 various developmental signaling genes, 12 transcription factors, 3 translation factors, and 11 other unclassified genes including 5 functionally undefined genes. Among them, insulin/IGF and TOR signaling pathway, MAP kinase and JNK signaling pathway, and ecdysone signaling are known to be involved in autophagy. Together with the identification of autophagy genes, the results of our screen suggest that autophagy counteracts Dcp-1-induced apoptosis. Consistent with this idea, we show that expression of eGFP-Atg5 rescued the eye phenotype caused by Dcp-1 GF. Paradoxically, we found that over-expression of full-length Dcp-1 induced autophagy, as Atg8b-GFP, an indicator of autophagy, was increased in the eye imaginal discs and in the S2 cell line. Taken together, these data suggest that autophagy suppresses Dcp-1-mediated apoptotic cell death, whereas Dcp-1 positively regulates autophagy, possibly through feedback regulation. Conclusions We identified a number of Dcp-1 modifiers that genetically interact with Dcp-1-induced cell death. Our results showing that Dcp-1 and autophagy-related genes influence each other will aid future

  1. An EST screen from the annelid Pomatoceros lamarckii reveals patterns of gene loss and gain in animals

    Directory of Open Access Journals (Sweden)

    Chen Wei-Chung

    2009-09-01

    Full Text Available Abstract Background Since the drastic reorganisation of the phylogeny of the animal kingdom into three major clades of bilaterians; Ecdysozoa, Lophotrochozoa and Deuterostomia, it became glaringly obvious that the selection of model systems with extensive molecular resources was heavily biased towards only two of these three clades, namely the Ecdysozoa and Deuterostomia. Increasing efforts have been put towards redressing this imbalance in recent years, and one of the principal phyla in the vanguard of this endeavour is the Annelida. Results In the context of this effort we here report our characterisation of an Expressed Sequence Tag (EST screen in the serpulid annelid, Pomatoceros lamarckii. We have sequenced over 5,000 ESTs which consolidate into over 2,000 sequences (clusters and singletons. These sequences are used to build phylogenetic trees to estimate relative branch lengths amongst different taxa and, by comparison to genomic data from other animals, patterns of gene retention and loss are deduced. Conclusion The molecular phylogenetic trees including the P. lamarckii sequences extend early observations that polychaetes tend to have relatively short branches in such trees, and hence are useful taxa with which to reconstruct gene family evolution. Also, with the availability of lophotrochozoan data such as that of P. lamarckii, it is now possible to make much more accurate reconstructions of the gene complement of the ancestor of the bilaterians than was previously possible from comparisons of ecdysozoan and deuterostome genomes to non-bilaterian outgroups. It is clear that the traditional molecular model systems for protostomes (e.g. Drosophila melanogaster and Caenorhabditis elegans, which are restricted to the Ecdysozoa, have undergone extensive gene loss during evolution. These ecdysozoan systems, in terms of gene content, are thus more derived from the bilaterian ancestral condition than lophotrochozoan systems like the polychaetes

  2. Genome-Wide RNAi Ionomics Screen Reveals New Genes and Regulation of Human Trace Element Metabolism

    Science.gov (United States)

    Malinouski, Mikalai; Hasan, Nesrin M.; Zhang, Yan; Seravalli, Javier; Lin, Jie; Avanesov, Andrei; Lutsenko, Svetlana; Gladyshev, Vadim N.

    2017-01-01

    Trace elements are essential for human metabolism and dysregulation of their homeostasis is associated with numerous disorders. Here we characterize mechanisms that regulate trace elements in human cells by designing and performing a genome-wide high-throughput siRNA/ionomics screen, and examining top hits in cellular and biochemical assays. The screen reveals high stability of the ionomes, especially the zinc ionome, and yields known regulators and novel candidates. We further uncover fundamental differences in the regulation of different trace elements. Specifically, selenium levels are controlled through the selenocysteine machinery and expression of abundant selenoproteins; copper balance is affected by lipid metabolism and requires machinery involved in protein trafficking and posttranslational modifications; and the iron levels are influenced by iron import and expression of the iron/heme-containing enzymes. Our approach can be applied to a variety of disease models and/or nutritional conditions, and the generated dataset opens new directions for studies of human trace element metabolism. PMID:24522796

  3. High-Throughput Screening Using iPSC-Derived Neuronal Progenitors to Identify Compounds Counteracting Epigenetic Gene Silencing in Fragile X Syndrome.

    Science.gov (United States)

    Kaufmann, Markus; Schuffenhauer, Ansgar; Fruh, Isabelle; Klein, Jessica; Thiemeyer, Anke; Rigo, Pierre; Gomez-Mancilla, Baltazar; Heidinger-Millot, Valerie; Bouwmeester, Tewis; Schopfer, Ulrich; Mueller, Matthias; Fodor, Barna D; Cobos-Correa, Amanda

    2015-10-01

    Fragile X syndrome (FXS) is the most common form of inherited mental retardation, and it is caused in most of cases by epigenetic silencing of the Fmr1 gene. Today, no specific therapy exists for FXS, and current treatments are only directed to improve behavioral symptoms. Neuronal progenitors derived from FXS patient induced pluripotent stem cells (iPSCs) represent a unique model to study the disease and develop assays for large-scale drug discovery screens since they conserve the Fmr1 gene silenced within the disease context. We have established a high-content imaging assay to run a large-scale phenotypic screen aimed to identify compounds that reactivate the silenced Fmr1 gene. A set of 50,000 compounds was tested, including modulators of several epigenetic targets. We describe an integrated drug discovery model comprising iPSC generation, culture scale-up, and quality control and screening with a very sensitive high-content imaging assay assisted by single-cell image analysis and multiparametric data analysis based on machine learning algorithms. The screening identified several compounds that induced a weak expression of fragile X mental retardation protein (FMRP) and thus sets the basis for further large-scale screens to find candidate drugs or targets tackling the underlying mechanism of FXS with potential for therapeutic intervention. © 2015 Society for Laboratory Automation and Screening.

  4. Polymorphism screening and mapping of nine meat performance-related genes in the pig

    Czech Academy of Sciences Publication Activity Database

    Horák, Pavel; Stratil, Antonín; Svatoňová, Martina; Maštálková, Lucie; Patáková, Jitka; Van Poucke, M.; Bartenschlager, H.; Peelman, L. J.; Geldermann, H.

    2010-01-01

    Roč. 41, č. 3 (2010), s. 334-335 ISSN 0268-9146 R&D Projects: GA AV ČR KJB500450801; GA ČR GA523/09/0844; GA ČR(CZ) GA523/06/1302 Institutional research plan: CEZ:AV0Z50450515 Keywords : genomics * meat performance-related genes * pig Subject RIV: GI - Animal Husbandry ; Breeding Impact factor: 2.203, year: 2010

  5. Genetic screening of the FLCN gene identify six novel variants and a Danish founder mutation

    DEFF Research Database (Denmark)

    Rossing, Maria; Albrechtsen, Anders; Skytte, Anne-Bine

    2016-01-01

    Pathogenic germline mutations in the folliculin (FLCN) tumor suppressor gene predispose to Birt-Hogg-Dubé (BHD) syndrome, a rare disease characterized by the development of cutaneous hamartomas (fibrofolliculomas), multiple lung cysts, spontaneous pneumothoraces and renal cell cancer. In this stu...... understanding of BHD syndrome and management of BHD patients.Journal of Human Genetics advance online publication, 13 October 2016; doi:10.1038/jhg.2016.118....

  6. Screening of point mutations by multiple SSCP analysis in the dystrophin gene

    Energy Technology Data Exchange (ETDEWEB)

    Lasa, A.; Baiget, M.; Gallano, P. [Hospital Sant Pau, Barcelona (Spain)

    1994-09-01

    Duchenne muscular dystrophy (DMD) is a lethal, X-linked neuromuscular disorder. The population frequency of DMD is one in approximately 3500 boys, of which one third is thought to be a new mutant. The DMD gene is the largest known to date, spanning over 2,3 Mb in band Xp21.2; 79 exons are transcribed into a 14 Kb mRNA coding for a protein of 427 kD which has been named dystrophin. It has been shown that about 65% of affected boys have a gene deletion with a wide variation in localization and size. The remaining affected individuals who have no detectable deletions or duplications would probably carry more subtle mutations that are difficult to detect. These mutations occur in several different exons and seem to be unique to single patients. Their identification represents a formidable goal because of the large size and complexity of the dystrophin gene. SSCP is a very efficient method for the detection of point mutations if the parameters that affect the separation of the strands are optimized for a particular DNA fragment. The multiple SSCP allows the simultaneous study of several exons, and implies the use of different conditions because no single set of conditions will be optimal for all fragments. Seventy-eight DMD patients with no deletion or duplication in the dystrophin gene were selected for the multiple SSCP analysis. Genomic DNA from these patients was amplified using the primers described for the diagnosis procedure (muscle promoter and exons 3, 8, 12, 16, 17, 19, 32, 45, 48 and 51). We have observed different mobility shifts in bands corresponding to exons 8, 12, 43 and 51. In exons 17 and 45, altered electrophoretic patterns were found in different samples identifying polymorphisms already described.

  7. Polymorphism screening and mapping of nine meat performance-related genes in the pig

    Czech Academy of Sciences Publication Activity Database

    Horák, Pavel; Stratil, Antonín; Svatoňová, Martina; Maštálková, Lucie; Patáková, Jitka; Van Poucke, M.; Bartenschlager, H.; Peelman, L. J.; Geldermann, H.

    2010-01-01

    Roč. 41, č. 3 (2010), s. 334-335 ISSN 0268-9146 R&D Projects: GA AV ČR KJB500450801; GA ČR GA523/09/0844; GA ČR(CZ) GA523/06/1302 Institutional research plan: CEZ:AV0Z50450515 Keywords : genomics * meat performance -related genes * pig Subject RIV: GI - Animal Husbandry ; Breeding Impact factor: 2.203, year: 2010

  8. Identification of Multiple Cryptococcal Fungicidal Drug Targets by Combined Gene Dosing and Drug Affinity Responsive Target Stability Screening

    Directory of Open Access Journals (Sweden)

    Yoon-Dong Park

    2016-08-01

    Full Text Available Cryptococcus neoformans is a pathogenic fungus that is responsible for up to half a million cases of meningitis globally, especially in immunocompromised individuals. Common fungistatic drugs, such as fluconazole, are less toxic for patients but have low efficacy for initial therapy of the disease. Effective therapy against the disease is provided by the fungicidal drug amphotericin B; however, due to its high toxicity and the difficulty in administering its intravenous formulation, it is imperative to find new therapies targeting the fungus. The antiparasitic drug bithionol has been recently identified as having potent fungicidal activity. In this study, we used a combined gene dosing and drug affinity responsive target stability (GD-DARTS screen as well as protein modeling to identify a common drug binding site of bithionol within multiple NAD-dependent dehydrogenase drug targets. This combination genetic and proteomic method thus provides a powerful method for identifying novel fungicidal drug targets for further development.

  9. Cytogenetic and molecular screening of the DAZ gene family in a population of infertile males

    Directory of Open Access Journals (Sweden)

    Nubia Amparo Ruiz Suárez

    2003-01-01

    Full Text Available The purpose of this study was to evalúate the frequency of Y chromosome structural, numerical, chromosomal and genetic abnormalities, as well as DAZ gene microdeletions in the Y chromosome in a population of infertile males. Genetic abnormalities have been established to date in up to 24% of males having severe abnormalities in their sperm (Dohle et al. 2002; deletion of the DAZ gene family (deleted in azoospermia is the most common cause. It has been found in 6% of the oligozoospermias and in 12% of the azoospermias (Van Landuyt et al. 2000. A popula­tion of 20 azoospermic and 10 oligozoospermic males was studied. Five males having normal sperm parameters were used as controls. Each sample was karyotyped (QFQ banding and underwent sY254, sY255 and sY257 mo­lecular amplification. Genetic study revealed alterations in 16.6% of the cases: 6.6% at chromosome level and 10% at molecule level. No chromosomal or molecular gene alterations were detected in control males. The frequencies found lead to a broader population-based study being recommended. They confirmed the need for performing judicious genetic counselling in infertile couples with male factor infertility to avoid or minimise the risks of trans-mitting these abnormalities to offspring and provide better prognosis for assisted reproductive techniques in such patients. Key words: azoospermia; oligozoospermia; microdeletions; ICSI

  10. Gain-of-function screen for genes that affect Drosophila muscle pattern formation.

    Directory of Open Access Journals (Sweden)

    Nicole Staudt

    2005-10-01

    Full Text Available This article reports the production of an EP-element insertion library with more than 3,700 unique target sites within the Drosophila melanogaster genome and its use to systematically identify genes that affect embryonic muscle pattern formation. We designed a UAS/GAL4 system to drive GAL4-responsive expression of the EP-targeted genes in developing apodeme cells to which migrating myotubes finally attach and in an intrasegmental pattern of cells that serve myotubes as a migration substrate on their way towards the apodemes. The results suggest that misexpression of more than 1.5% of the Drosophila genes can interfere with proper myotube guidance and/or muscle attachment. In addition to factors already known to participate in these processes, we identified a number of enzymes that participate in the synthesis or modification of protein carbohydrate side chains and in Ubiquitin modifications and/or the Ubiquitin-dependent degradation of proteins, suggesting that these processes are relevant for muscle pattern formation.

  11. Children’s Hospital of Pittsburgh and Diabetes Institute of the Walter Reed Health Care System Genetic Screening in Diabetes: Candidate Gene Analysis for Diabetic Retinopathy

    Science.gov (United States)

    2010-05-01

    Screening in Diabetes : Candidate Gene Analysis for Diabetic Retinopathy PRINCIPAL INVESTIGATOR: Robert A. Vigersky, COL MC CONTRACTING ORGANIZATION... Diabetes Institute of the Walter Reed Health Care System Genetic Screening in Diabetes : Candidate Gene Analysis for Diabetic Retinopathy 5c. PROGRAM... diabetic  neuropathy, and  diabetic   retinopathy .  This was an observational study in which the investigators obtained DNA samples from the blood of

  12. Detention of HPV L1 Capsid Protein and hTERC Gene in Screening of Cervical Cancer

    Directory of Open Access Journals (Sweden)

    Huang Bin

    2013-06-01

    Full Text Available   Objective(s: To investigate the expression of human papilloma virus (HPV L1 capsid protein, and human telomerase RNA component (hTERC in cervical cancer and the role of detection of both genes in screening of cervical cancer.   Materials and Methods: A total of 309 patients were recruited and cervical exfoliated cells were collected. Immunocytochemistry was employed to detect HPV L1 capsid protein, and fluorescent in situ hybridization (FISH was performed to detect the hTERC. Results: The expression of HPV L1 capsid protein reduced with the increase of the histological grade of cervical cells and was negatively related to the grade of cervical lesions. However, the expression of hTERC increased with the increase of the histological grade and positively associated with the grade of cervical lesions. The proportion of patients with L1(-/hTERC(+ was higher in patients with histological grade of CIN2 or higher than that in those with histological grade of CIN1. The L1(+/hTERC(- and L1(-/hTERC(- were negatively related to the grade of cervical lesions. L1(-/hTERC(+ was positively associated with the grade of cervical lesions. The L1/hTERC ratio increased. The negative predictive value of both HPV L1 and hTERC was higher than that of HPV L1 or hTERC, but there was no marked difference in the screening efficacy of cervical cancer among HPV L1, hTERC and HPV L1+hTERC. Conclusion: HPV L1 capsid protein and hTERC gene may serve as markers for the early diagnosis and prediction of cervical lesions. The increase in L1/hTERC ratio reflects the progression of cervical lesions to a certain extent.

  13. An siRNA-based functional genomics screen for the identification of regulators of ciliogenesis and ciliopathy genes

    Science.gov (United States)

    Racher, Hilary; Phelps, Ian G.; Toedt, Grischa; Kennedy, Julie; Wunderlich, Kirsten A.; Sorusch, Nasrin; Abdelhamed, Zakia A.; Natarajan, Subaashini; Herridge, Warren; van Reeuwijk, Jeroen; Horn, Nicola; Boldt, Karsten; Parry, David A.; Letteboer, Stef J.F.; Roosing, Susanne; Adams, Matthew; Bell, Sandra M.; Bond, Jacquelyn; Higgins, Julie; Morrison, Ewan E.; Tomlinson, Darren C.; Slaats, Gisela G.; van Dam, Teunis J. P.; Huang, Lijia; Kessler, Kristin; Giessl, Andreas; Logan, Clare V.; Boyle, Evan A.; Shendure, Jay; Anazi, Shamsa; Aldahmesh, Mohammed; Al Hazzaa, Selwa; Hegele, Robert A.; Ober, Carole; Frosk, Patrick; Mhanni, Aizeddin A.; Chodirker, Bernard N.; Chudley, Albert E.; Lamont, Ryan; Bernier, Francois P.; Beaulieu, Chandree L.; Gordon, Paul; Pon, Richard T.; Donahue, Clem; Barkovich, A. James; Wolf, Louis; Toomes, Carmel; Thiel, Christian T.; Boycott, Kym M.; McKibbin, Martin; Inglehearn, Chris F.; Stewart, Fiona; Omran, Heymut; Huynen, Martijn A.; Sergouniotis, Panagiotis I.; Alkuraya, Fowzan S.; Parboosingh, Jillian S.; Innes, A Micheil; Willoughby, Colin E.; Giles, Rachel H.; Webster, Andrew R.; Ueffing, Marius; Blacque, Oliver; Gleeson, Joseph G.; Wolfrum, Uwe; Beales, Philip L.; Gibson, Toby

    2015-01-01

    Defects in primary cilium biogenesis underlie the ciliopathies, a growing group of genetic disorders. We describe a whole genome siRNA-based reverse genetics screen for defects in biogenesis and/or maintenance of the primary cilium, obtaining a global resource. We identify 112 candidate ciliogenesis and ciliopathy genes, including 44 components of the ubiquitin-proteasome system, 12 G-protein-coupled receptors, and three pre-mRNA processing factors (PRPF6, PRPF8 and PRPF31) mutated in autosomal dominant retinitis pigmentosa. The PRPFs localise to the connecting cilium, and PRPF8- and PRPF31-mutated cells have ciliary defects. Combining the screen with exome sequencing data identified recessive mutations in PIBF1/CEP90 and C21orf2/LRRC76 as causes of the ciliopathies Joubert and Jeune syndromes. Biochemical approaches place C21orf2 within key ciliopathy-associated protein modules, offering an explanation for the skeletal and retinal involvement observed in individuals with C21orf2-variants. Our global, unbiased approaches provide insights into ciliogenesis complexity and identify roles for unanticipated pathways in human genetic disease. PMID:26167768

  14. Tris(1,3-dichloro-2-propyl) phosphate perturbs the expression of genes involved in immune response and lipid and steroid metabolism in chicken embryos

    International Nuclear Information System (INIS)

    Farhat, Amani; Buick, Julie K.; Williams, Andrew; Yauk, Carole L.; O'Brien, Jason M.; Crump, Doug; Williams, Kim L.; Chiu, Suzanne; Kennedy, Sean W.

    2014-01-01

    We previously demonstrated that in ovo exposure to the flame retardant tris(1,3-dichloro-2-propyl) phosphate (TDCPP) decreased plasma thyroxine levels, reduced growth parameters, and decreased gallbladder size in chicken embryos. In the current study DNA microarrays were used to evaluate global mRNA expression in liver tissue of male chicken embryos that exhibited the above mentioned effects. Injected doses were dimethyl sulfoxide vehicle control, 7.6 or 45 μg TDCPP/g egg. TDCPP caused significant changes in the expression of five genes at the low dose and 47 genes at the high dose (False Discovery Rate p ≤ 0.1, fold change ≥ 1.5). The gene expression analysis suggested a compromised immune function, a state of cholestatic liver/biliary fibrosis, and disrupted lipid and steroid metabolism. Circulating bile acid levels were elevated, which is an indication of liver dysfunction, and plasma cholesterol levels were reduced; however, hepatic bile acid and cholesterol levels were unaltered. Interactome analyses identified apolipoprotein E, hepatocyte nuclear factor 4 alpha, and peroxisome proliferator-activated receptor alpha as key regulatory molecules involved in the effects of TDCPP. Our results demonstrate a targeted effect of TDCPP toxicity on lipid metabolism, including cholesterol, that helps explain the aforementioned phenotypic effects, as chicken embryos are highly dependent on yolk lipids for growth and maintenance throughout development. Finally, our results are in concordance with the literature that describes TDCPP as a cancer-causing agent, since the majority of dysregulated genes were involved in cancer pathways. - Highlights: • TDCPP dysregulates genes involved in immune function and lipid metabolism. • A targeted effect of TDCPP toxicity on cholesterol metabolism is apparent. • A state of cholestatic liver fibrosis is suggested by the expression profile. • Elevated plasma bile acids suggest that TDCPP causes liver dysfunction

  15. Tris(1,3-dichloro-2-propyl) phosphate perturbs the expression of genes involved in immune response and lipid and steroid metabolism in chicken embryos

    Energy Technology Data Exchange (ETDEWEB)

    Farhat, Amani [Department of Biology, University of Ottawa, Ottawa, ON K1N 6N5 (Canada); National Wildlife Research Centre, Environment Canada, Ottawa, ON K1A 0H3 (Canada); Buick, Julie K.; Williams, Andrew; Yauk, Carole L.; O' Brien, Jason M. [Environmental Health Science and Research Bureau, Health Canada, Ottawa, ON K1A 0K9 (Canada); Crump, Doug; Williams, Kim L.; Chiu, Suzanne [National Wildlife Research Centre, Environment Canada, Ottawa, ON K1A 0H3 (Canada); Kennedy, Sean W., E-mail: sean.kennedy@ec.gc.ca [Department of Biology, University of Ottawa, Ottawa, ON K1N 6N5 (Canada); National Wildlife Research Centre, Environment Canada, Ottawa, ON K1A 0H3 (Canada)

    2014-03-01

    We previously demonstrated that in ovo exposure to the flame retardant tris(1,3-dichloro-2-propyl) phosphate (TDCPP) decreased plasma thyroxine levels, reduced growth parameters, and decreased gallbladder size in chicken embryos. In the current study DNA microarrays were used to evaluate global mRNA expression in liver tissue of male chicken embryos that exhibited the above mentioned effects. Injected doses were dimethyl sulfoxide vehicle control, 7.6 or 45 μg TDCPP/g egg. TDCPP caused significant changes in the expression of five genes at the low dose and 47 genes at the high dose (False Discovery Rate p ≤ 0.1, fold change ≥ 1.5). The gene expression analysis suggested a compromised immune function, a state of cholestatic liver/biliary fibrosis, and disrupted lipid and steroid metabolism. Circulating bile acid levels were elevated, which is an indication of liver dysfunction, and plasma cholesterol levels were reduced; however, hepatic bile acid and cholesterol levels were unaltered. Interactome analyses identified apolipoprotein E, hepatocyte nuclear factor 4 alpha, and peroxisome proliferator-activated receptor alpha as key regulatory molecules involved in the effects of TDCPP. Our results demonstrate a targeted effect of TDCPP toxicity on lipid metabolism, including cholesterol, that helps explain the aforementioned phenotypic effects, as chicken embryos are highly dependent on yolk lipids for growth and maintenance throughout development. Finally, our results are in concordance with the literature that describes TDCPP as a cancer-causing agent, since the majority of dysregulated genes were involved in cancer pathways. - Highlights: • TDCPP dysregulates genes involved in immune function and lipid metabolism. • A targeted effect of TDCPP toxicity on cholesterol metabolism is apparent. • A state of cholestatic liver fibrosis is suggested by the expression profile. • Elevated plasma bile acids suggest that TDCPP causes liver dysfunction.

  16. Aryl hydrocarbon receptor (AhR-mediated perturbations in gene expression during early stages of CD4+ T-cell differentiation

    Directory of Open Access Journals (Sweden)

    Diana eRohlman

    2012-08-01

    Full Text Available Activation of the aryl hydrocarbon receptor (AhR by its prototypic ligand, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD, mediates potent suppression of T-cell dependent immune responses. The suppressive effects of TCDD occur early during CD4+ T-cell differentiation in the absence of effects on proliferation and have recently been associated with the induction of AhR-dependent regulatory T-cells (Treg. Since AhR functions as a ligand-activated transcription factor, changes in gene expression induced by TCDD during the early stages of CD4+ T-cell differentiation are likely to reflect fundamental mechanisms of AhR action. A custom panel of genes associated with T-cell differentiation was used to query changes in gene expression induced by exposure to 1 nM TCDD. CD4+ T-cells from AhR+/+ and AhR-/- mice were cultured with cytokines known to polarize the differentiation of T-cells to various effector lineages. Treatment with TCDD induced expression of Cyp1a1, Cyp1b1 and Ahrr in CD4+ T-cells from AhR+/+ mice under all culture conditions, validating the presence and activation of AhR in these cells. The highest levels of AhR activation occurred under Th17 conditions at 24 hours and Tr1 conditions at 48 hours. Unexpectedly, expression levels of most genes associated with early T-cell differentiation were unaltered by AhR activation, including lineage-specific genes that drive CD4+ T-cell polarization. The major exception was AhR-dependent up-regulation of Il22 that was seen under all culture conditions. Independent of TCDD, AhR down-regulated the expression of Il17a and Rorc based on increased expression of these genes in AhR-deficient cells across culture conditions. These findings are consistent with a role for AhR in down-regulation of inflammatory immune responses and implicate IL-22 as a potential contributor to the immunosuppressive effects of TCDD.

  17. Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

    Science.gov (United States)

    Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

    2016-01-01

    Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

  18. Facile high-throughput forward chemical genetic screening by in situ monitoring of glucuronidase-based reporter gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Vivek eHalder

    2015-01-01

    Full Text Available The use of biologically active small molecules to perturb biological functions holds enormous potential for investigating complex signaling networks. However, in contrast to animal systems, the search for and application of chemical tools for basic discovery in the plant sciences, generally referred to as ‘chemical genetics’, has only recently gained momentum. In addition to cultured cells, the well-characterized, small-sized model plant Arabidopsis thaliana is suitable for cultivation in microplates, which allows employing diverse cell- or phenotype-based chemical screens. In such screens, a chemical’s bioactivity is typically assessed either through scoring its impact on morphological traits or quantifying molecular attributes such as enzyme or reporter activities. Here, we describe a facile forward chemical screening methodology for intact Arabidopsis seedlings harboring the β-glucuronidase (GUS reporter by directly quantifying GUS activity in situ with 4-methylumbelliferyl-β-D-glucuronide (4-MUG as substrate. The quantitative nature of this screening assay has an obvious advantage over the also convenient histochemical GUS staining method, as it allows application of statistical procedures and unbiased hit selection based on threshold values as well as distinction between compounds with strong or weak bioactivity. At the same time, the in situ bioassay is very convenient requiring less effort and time for sample handling in comparison to the conventional quantitative in vitro GUS assay using 4-MUG, as validated with several Arabidopsis lines harboring different GUS reporter constructs. To demonstrate that the developed assays is particularly suitable for large-scale screening projects, we performed a pilot screen for chemical activators or inhibitors of salicylic acid-mediated defense signaling using the Arabidopsis PR1p::GUS line. Importantly, the screening methodology provided here can be adopted for any inducible GUS reporter line.

  19. Mutation screening of USH3 gene (clarin-1) in Spanish patients with Usher syndrome: low prevalence and phenotypic variability.

    Science.gov (United States)

    Aller, E; Jaijo, T; Oltra, S; Alió, J; Galán, F; Nájera, C; Beneyto, M; Millán, J M

    2004-12-01

    Usher syndrome type III is an autosomal recessive disorder clinically characterized by the association of retinitis pigmentosa (RP), variable presence of vestibular dysfunction and progressive hearing loss, being the progression of the hearing impairment the critical parameter classically used to distinguish this form from Usher syndrome type I and Usher syndrome type II. Usher syndrome type III clinical subtype is the rarest form of Usher syndrome in Spain, accounting only for 6% of all Usher syndrome Spanish cases. The gene responsible for Usher syndrome type III is named clarin-1 and it is thought to be involved in hair cell and photoreceptor cell synapses. Here, we report a screening for mutations in clarin-1 gene among our series of Usher syndrome Spanish patients. Clarin-1 has been found to be responsible for the disease in only two families: the first one is a previously reported family homozygous for Y63X mutation and the second one, described here, is homozygous for C40G. This accounts for 1.7% of Usher syndrome Spanish families. It is noticeable that, whereas C40G family is clinically compatible with Usher syndrome type III due to the progression of the hearing loss, Y63X family could be diagnosed as Usher syndrome type I because the hearing impairment is profound and stable. Thus, we consider that the progression of hearing loss is not the definitive key parameter to distinguish Usher syndrome type III from Usher syndrome type I and Usher syndrome type II.

  20. Screening and Expression of a Silicon Transporter Gene (Lsi1) in Wild-Type Indica Rice Cultivars

    Science.gov (United States)

    Abiri, Rambod; Kalhori, Nahid; Atabaki, Narges

    2017-01-01

    Silicon (Si) is one of the most prevalent elements in the soil. It is beneficial for plant growth and development, and it contributes to plant defense against different stresses. The Lsi1 gene encodes a Si transporter that was identified in a mutant Japonica rice variety. This gene was not identified in fourteen Malaysian rice varieties during screening. Then, a mutant version of Lsi1 was substituted for the native version in the three most common Malaysian rice varieties, MR219, MR220, and MR276, to evaluate the function of the transgene. Real-time PCR was used to explore the differential expression of Lsi1 in the three transgenic rice varieties. Silicon concentrations in the roots and leaves of transgenic plants were significantly higher than in wild-type plants. Transgenic varieties showed significant increases in the activities of the enzymes SOD, POD, APX, and CAT; photosynthesis; and chlorophyll content; however, the highest chlorophyll A and B levels were observed in transgenic MR276. Transgenic varieties have shown a stronger root and leaf structure, as well as hairier roots, compared to the wild-type plants. This suggests that Lsi1 plays a key role in rice, increasing the absorption and accumulation of Si, then alters antioxidant activities, and improves morphological properties. PMID:28191468

  1. Screening and Expression of a Silicon Transporter Gene (Lsi1 in Wild-Type Indica Rice Cultivars

    Directory of Open Access Journals (Sweden)

    Mahbod Sahebi

    2017-01-01

    Full Text Available Silicon (Si is one of the most prevalent elements in the soil. It is beneficial for plant growth and development, and it contributes to plant defense against different stresses. The Lsi1 gene encodes a Si transporter that was identified in a mutant Japonica rice variety. This gene was not identified in fourteen Malaysian rice varieties during screening. Then, a mutant version of Lsi1 was substituted for the native version in the three most common Malaysian rice varieties, MR219, MR220, and MR276, to evaluate the function of the transgene. Real-time PCR was used to explore the differential expression of Lsi1 in the three transgenic rice varieties. Silicon concentrations in the roots and leaves of transgenic plants were significantly higher than in wild-type plants. Transgenic varieties showed significant increases in the activities of the enzymes SOD, POD, APX, and CAT; photosynthesis; and chlorophyll content; however, the highest chlorophyll A and B levels were observed in transgenic MR276. Transgenic varieties have shown a stronger root and leaf structure, as well as hairier roots, compared to the wild-type plants. This suggests that Lsi1 plays a key role in rice, increasing the absorption and accumulation of Si, then alters antioxidant activities, and improves morphological properties.

  2. Screening and Expression of a Silicon Transporter Gene (Lsi1) in Wild-Type Indica Rice Cultivars.

    Science.gov (United States)

    Sahebi, Mahbod; Hanafi, Mohamed M; Rafii, M Y; Azizi, Parisa; Abiri, Rambod; Kalhori, Nahid; Atabaki, Narges

    2017-01-01

    Silicon (Si) is one of the most prevalent elements in the soil. It is beneficial for plant growth and development, and it contributes to plant defense against different stresses. The Lsi1 gene encodes a Si transporter that was identified in a mutant Japonica rice variety. This gene was not identified in fourteen Malaysian rice varieties during screening. Then, a mutant version of Lsi1 was substituted for the native version in the three most common Malaysian rice varieties, MR219, MR220, and MR276, to evaluate the function of the transgene. Real-time PCR was used to explore the differential expression of Lsi1 in the three transgenic rice varieties. Silicon concentrations in the roots and leaves of transgenic plants were significantly higher than in wild-type plants. Transgenic varieties showed significant increases in the activities of the enzymes SOD, POD, APX, and CAT; photosynthesis; and chlorophyll content; however, the highest chlorophyll A and B levels were observed in transgenic MR276. Transgenic varieties have shown a stronger root and leaf structure, as well as hairier roots, compared to the wild-type plants. This suggests that Lsi1 plays a key role in rice, increasing the absorption and accumulation of Si, then alters antioxidant activities, and improves morphological properties.

  3. Perturbative QCD and jets

    International Nuclear Information System (INIS)

    Mueller, A.H.

    1986-03-01

    A brief review of some of the recent progress in perturbative QCD is given (heavy quark production, small-x physics, minijets and related topics, classical simulations in high energy reactions, coherence and the string effect)

  4. Generalized chiral perturbation theory

    International Nuclear Information System (INIS)

    Knecht, M.; Stern, J.

    1994-01-01

    The Generalized Chiral Perturbation Theory enlarges the framework of the standard χPT (Chiral Perturbation Theory), relaxing certain assumptions which do not necessarily follow from QCD or from experiment, and which are crucial for the usual formulation of the low energy expansion. In this way, experimental tests of the foundations of the standard χPT become possible. Emphasis is put on physical aspects rather than on formal developments of GχPT. (author). 31 refs

  5. ScreenFect A: an efficient and low toxic liposome for gene delivery to mesenchymal stem cells.

    Science.gov (United States)

    Li, Li-Ming; Ruan, Gui-Xin; HuangFu, Ming-Yi; Chen, Zhi-Lan; Liu, Hui-Na; Li, Lin-Xian; Hu, Yu-Lan; Han, Min; Davidson, Gary; Levkin, Pavel A; Gao, Jian-Qing

    2015-07-05

    Mesenchymal stem cells (MSCs) hold great promise in variety of therapeutic applications including tissue engineering and cancer therapy. Genetic modification of MSCs can be used to enhance the therapeutic effect of MSCs by facilitating a specific function or by transforming MSCs into more effective gene therapy tools. However, the successful generation of genetically modified MSCs is often limited by the poor transfection efficiency or high toxicity of available transfection reagents. In our previous study, we used thiol-yne click chemistry to develop new liposomal vectors, including ScreenFect(®) A (SF) (Li et al., 2012). In this study, we investigated the transfection performance of SF on MSCs. A comparative evaluation of transfection efficiency, cell viability and cellular DNA uptake was performed using the Lipofectamine™ 2000 (L2K) as a control, and the results show that SF is superior to L2K for MSC transfection. The presence of serum did not significantly influence the transfection efficiency of either SF or L2K but greatly reduced the viability of MSC transfected by L2K. The higher efficiency of SF-mediated transfection compared to L2K was also correlated with better proliferation of cells. These results were supported by monitoring the intracellular fate of DNA, which confirmed stable transportation of DNA from lysosomes and efficient nuclear localization. TGF-β1 gene delivery by SF promoted MSC osteogenic differentiation in an osteogenic induction condition. As the first study of SF lipofection on stem cells, this study highlights a promising role of SF in gene delivery to MSCs as well as other stem cells to facilitate tissue engineering and other therapeutic effects based on genetically modified stem cells. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Comprehensive screening of the USH2A gene in Usher syndrome type II and non-syndromic recessive retinitis pigmentosa.

    Science.gov (United States)

    Seyedahmadi, Babak Jian; Rivolta, Carlo; Keene, Julia A; Berson, Eliot L; Dryja, Thaddeus P

    2004-08-01

    A screen of the entire coding region of the USH2A gene in 129 unrelated patients with Usher syndrome type II (USH2) and in 146 unrelated patients with non-syndromic autosomal recessive retinitis pigmentosa (ARRP) uncovered 54 different sequence variations, including 18 likely pathogenic mutations (13 frameshift, three nonsense, and two missense), 12 changes of uncertain pathogenicity (11 missense changes and one in-frame deletion), and 24 non-pathogenic rare variants or polymorphisms. Of the 18 likely pathogenic mutations, nine were novel. Among the USH2 patients, 50 (39%) had one or two likely pathogenic mutations. The most common mutant allele in USH2 patients was E767fs, which was found in 29 patients, including one homozygote. Among the ARRP patients, we found 17 (12%) with one or two likely pathogenic mutations. The most common mutant allele in ARRP patients was C759F and it was found in 10 patients. The C759F allele was also found in two USH2 patients; in neither of them was a change in the other allele found. The second most common mutant allele in both patient groups was L1447fs (found in 6/50 USH2 patients and 6/17 ARRP patients). Of the 50+17=67 patients with identified USH2A mutations, only one mutation in one allele was found in 41+12=53 (79%); the reason for the high proportion of patients with only one identified mutation is obscure. Our results indicate that USH2A mutations are found in about 7% of all cases of RP in North America, a frequency similar to the RPGR gene (8%) and the rhodopsin gene (10%).

  7. Mutation analysis of the human CYP3A4 gene 5' regulatory region: population screening using non-radioactive SSCP.

    Science.gov (United States)

    Hamzeiy, Hossein; Vahdati-Mashhadian, Nasser; Edwards, Helen J; Goldfarb, Peter S

    2002-03-20

    Human CYP3A4 is the major cytochrome P450 isoenzyme in adult human liver and is known to metabolise many xenobiotic and endogenous compounds. There is substantial inter-individual variation in the hepatic levels of CYP3A4. Although, polymorphic mutations have been reported in the 5' regulatory region of the CYP3A4 gene, those that have been investigated so far do not appear to have any effect on gene expression. To determine whether other mutations exist in this region of the gene, we have performed a new population screen on a panel of 101 human DNA samples. A 1140 bp section of the 5' proximal regulatory region of the CYP3A4 gene, containing numerous regulatory motifs, was amplified from genomic DNA as three overlapping segments. The 300 bp distal enhancer region at -7.9kb containing additional regulatory motifs was also amplified. Mutation analysis of the resulting PCR products was carried out using non-radioactive single strand conformation polymorphism (SSCP) and confirmatory sequencing of both DNA strands in those samples showing extra SSCP bands. In addition to detection of the previously reported CYP3A4*1B allele in nine subjects, three novel alleles were found: CYP3A4*1E (having a T-->A transversion at -369 in one subject), CYP3A4*1F (having a C-->G tranversion at -747 in 17 subjects) and CYP3A4*15B containing a nine-nucleotide insertion between -845 and -844 linked to an A-->G transition at -392 and a G-->A transition in exon 6 (position 485 in the cDNA) in one subject. All the novel alleles were heterozygous. No mutations were found in the upstream distal enhancer region. Our results clearly indicate that this rapid and simple SSCP approach can reveal mutant alleles in drug metabolising enzyme genes. Detection and determination of the frequency of novel alleles in CYP3A4 will assist investigation of the relationship between genotype, xenobiotic metabolism and toxicity in the CYP3A family of isoenzymes.

  8. Genetic screens to identify pathogenic gene variants in the common cancer predisposition Lynch syndrome

    DEFF Research Database (Denmark)

    Drost, Mark; Lützen, Anne; van Hees, Sandrine

    2013-01-01

    In many individuals suspected of the common cancer predisposition Lynch syndrome, variants of unclear significance (VUS), rather than an obviously pathogenic mutations, are identified in one of the DNA mismatch repair (MMR) genes. The uncertainty of whether such VUS inactivate MMR, and therefore...... function. When a residue identified as mutated in an individual suspected of Lynch syndrome is listed as critical in such a reverse diagnosis catalog, there is a high probability that the corresponding human VUS is pathogenic. To investigate the applicability of this approach, we have generated....... Nearly half of these critical residues match with VUS previously identified in individuals suspected of Lynch syndrome. This aids in the assignment of pathogenicity to these human VUS and validates the approach described here as a diagnostic tool. In a wider perspective, this work provides a model...

  9. Screening and Evaluation of Deleterious SNPs in APOE Gene of Alzheimer’s Disease

    Directory of Open Access Journals (Sweden)

    Tariq Ahmad Masoodi

    2012-01-01

    Full Text Available Introduction. Apolipoprotein E (APOE is an important risk factor for Alzheimer’s disease (AD and is present in 30–50% of patients who develop late-onset AD. Several single-nucleotide polymorphisms (SNPs are present in APOE gene which act as the biomarkers for exploring the genetic basis of this disease. The objective of this study is to identify deleterious nsSNPs associated with APOE gene. Methods. The SNPs were retrieved from dbSNP. Using I-Mutant, protein stability change was calculated. The potentially functional nonsynonymous (ns SNPs and their effect on protein was predicted by PolyPhen and SIFT, respectively. FASTSNP was used for functional analysis and estimation of risk score. The functional impact on the APOE protein was evaluated by using Swiss PDB viewer and NOMAD-Ref server. Results. Six nsSNPs were found to be least stable by I-Mutant 2.0 with DDG value of >−1.0. Four nsSNPs showed a highly deleterious tolerance index score of 0.00. Nine nsSNPs were found to be probably damaging with position-specific independent counts (PSICs score of ≥2.0. Seven nsSNPs were found to be highly polymorphic with a risk score of 3-4. The total energies and root-mean-square deviation (RMSD values were higher for three mutant-type structures compared to the native modeled structure. Conclusion. We concluded that three nsSNPs, namely, rs11542041, rs11542040, and rs11542034, to be potentially functional polymorphic.

  10. Screening of the target genes trans-activated by HLA-HA8 in hepatocytes

    Directory of Open Access Journals (Sweden)

    Qi WANG

    2011-06-01

    Full Text Available Objective To clone and identify the target genes trans-activated by human minor histocompatibility antigen HLA-HA8 in hepatocytes with suppression subtractive hybridization(SSH and bioinfomatics technique.Methods mRNA was isolated from HepG2 cells transfected by pcDNA3.1(--HLA-HA8 and pcDNA3.1(- empty vector,and then used to synthesize the double-stranded cDNA(marked as Tester and Driver,respectively by reverse transcription.After being digested with restriction enzyme Rsa I,the tester cDNA was divided into two parts and ligated to the specific adaptor 1 and adaptor 2,respectively,and then hybridized with driver cDNA twice and underwent PCR twice.The production was subcloned into pEGM-Teasy plasmid vectors to set up the subtractive library.The library was then amplified by transfection into E.coli strain DH5α.The cDNA was sequenced and analyzed in GenBank with Blast search after PCR amplification.Results The subtractive library of genes trans-activated by HLA-HA8 was constructed successfully.The amplified library contained 101 positive clones.Colony PCR showed that all these clones contained 200-1000bp inserts.Twenty eight clones were selected randomly to analyze the sequences.The result of homologous analysis showed that altogether 16 coding sequences were gotten,of which 4 sequences were with unknown function.Conclusions The obtained sequences trans-activated by HLA-HA8 may code different proteins and play important roles in cell growth and metabolism,energy synthesis and metabolism,material transport and signal transduction.This finding will bring some new clues for the studies not only on the biological functions of HLA-HA8,but also on the HBV infection mechanism.

  11. Development of a High-Throughput Gene Expression Screen for Modulators of RAS-MAPK Signaling in a Mutant RAS Cellular Context.

    Science.gov (United States)

    Severyn, Bryan; Nguyen, Thi; Altman, Michael D; Li, Lixia; Nagashima, Kumiko; Naumov, George N; Sathyanarayanan, Sriram; Cook, Erica; Morris, Erick; Ferrer, Marc; Arthur, Bill; Benita, Yair; Watters, Jim; Loboda, Andrey; Hermes, Jeff; Gilliland, D Gary; Cleary, Michelle A; Carroll, Pamela M; Strack, Peter; Tudor, Matt; Andersen, Jannik N

    2016-10-01

    The RAS-MAPK pathway controls many cellular programs, including cell proliferation, differentiation, and apoptosis. In colorectal cancers, recurrent mutations in this pathway often lead to increased cell signaling that may contribute to the development of neoplasms, thereby making this pathway attractive for therapeutic intervention. To this end, we developed a 26-member gene signature of RAS-MAPK pathway activity utilizing the Affymetrix QuantiGene Plex 2.0 reagent system and performed both primary and confirmatory gene expression-based high-throughput screens (GE-HTSs) using KRAS mutant colon cancer cells (SW837) and leveraging a highly annotated chemical library. The screen achieved a hit rate of 1.4% and was able to enrich for hit compounds that target RAS-MAPK pathway members such as MEK and EGFR. Sensitivity and selectivity performance measurements were 0.84 and 1.00, respectively, indicating high true-positive and true-negative rates. Active compounds from the primary screen were confirmed in a dose-response GE-HTS assay, a GE-HTS assay using 14 additional cancer cell lines, and an in vitro colony formation assay. Altogether, our data suggest that this GE-HTS assay will be useful for larger unbiased chemical screens to identify novel compounds and mechanisms that may modulate the RAS-MAPK pathway. © 2016 Society for Laboratory Automation and Screening.

  12. Dysgenesis and histological changes of genitals and perturbations of gene expression in male rats after in utero exposure to antiandrogen mixtures

    DEFF Research Database (Denmark)

    Metzdorff, Stine Broeng; Dalgaard, Majken; Christiansen, Sofie

    2007-01-01

    of the individual chemicals. Chemicals were administered orally to pregnant Wistar rats from gestational day 7 to postnatal day 16. Changes in reproductive organ weights and of androgen-regulated gene expression in prostates from male rat pups were chosen as end points for extensive dose-response studies. With all...... own did not produce significant reductions in the weights of seminal vesicles and PBP C3 expression induced a marked mixture effect. Thus, antiandrogens cause additive effects on end points of various molecular complexities such as alterations at the morphological and the molecular level. Exposure...

  13. Fungal Screening on Olive Oil for Extracellular Triacylglycerol Lipases: Selection of a Trichoderma harzianum Strain and Genome Wide Search for the Genes

    Science.gov (United States)

    Canseco-Pérez, Miguel Angel; Castillo-Avila, Genny Margarita; Islas-Flores, Ignacio; Apolinar-Hernández, Max M.; Rivera-Muñoz, Gerardo; Gamboa-Angulo, Marcela; Couoh-Uicab, Yeny

    2018-01-01

    A lipolytic screening with fungal strains isolated from lignocellulosic waste collected in banana plantation dumps was carried out. A Trichoderma harzianum strain (B13-1) showed good extracellular lipolytic activity (205 UmL−1). Subsequently, functional screening of the lipolytic activity on Rhodamine B enriched with olive oil as the only carbon source was performed. The successful growth of the strain allows us to suggest that a true lipase is responsible for the lipolytic activity in the B13-1 strain. In order to identify the gene(s) encoding the protein responsible for the lipolytic activity, in silico identification and characterization of triacylglycerol lipases from T. harzianum is reported for the first time. A survey in the genome of this fungus retrieved 50 lipases; however, bioinformatic analyses and putative functional descriptions in different databases allowed us to choose seven lipases as candidates. Suitability of the bioinformatic screening to select the candidates was confirmed by reverse transcription polymerase chain reaction (RT-PCR). The gene codifying 526309 was expressed when the fungus grew in a medium with olive oil as carbon source. This protein shares homology with commercial lipases, making it a candidate for further applications. The success in identifying a lipase gene inducible with olive oil and the suitability of the functional screening and bioinformatic survey carried out herein, support the premise that the strategy can be used in other microorganisms with sequenced genomes to search for true lipases, or other enzymes belonging to large protein families. PMID:29370083

  14. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

    2005-01-01

    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

  15. [Mutation screening of MITF gene in patients with Waardenburg syndrome type 2].

    Science.gov (United States)

    Chen, Jing; Yang, Shu-Zhi; Liu, Jun; Han, Bing; Wang, Guo-Jian; Zhang, Xin; Kang, Dong-Yang; Dai, Pu; Young, Wie-Yen; Yuan, Hui-Jun

    2008-04-01

    Warrgenburg syndrome type 2 (WS2) is the most common autosomal dominantly-inherited syndrome with hearing loss. MITF (microphthalmia associated transcription factor)is a basic-helix-loop-helix-luecine zipper (bHLHZip) factor which regulates expression of tyrosinase, and is involved in melanocyte differentiation. Mutations in MITF associated with WS2 have been identified in some but not all affected families. Here, we report a three-generation Chinese family with a point mutation in the MITF gene causing WS2. The proband exhibits congenital severe sensorineural hearing loss, heterochromia iridis and facial freckles. One of family members manifests sensorineural deafness, and the other patients show premature greying or/and freckles. This mutation, heterozygous deletion c.639delA, creates a stop codon in exon 7 and is predicted to result in a truncated protein lacking normal interaction with its target DNA motif. This mutation is a novel mutation and the third case identified in exon 7 of MITF in WS2. Though there is only one base pair distance between this novel mutation and the other two documented cases and similar amino acids change, significant difference is seen in clinical phenotype, which suggests genetic background may play an important role.

  16. Mobile-phone radiation-induced perturbation of gene-expression profiling, redox equilibrium and sporadic-apoptosis control in the ovary of Drosophila melanogaster.

    Science.gov (United States)

    Manta, Areti K; Papadopoulou, Deppie; Polyzos, Alexander P; Fragopoulou, Adamantia F; Skouroliakou, Aikaterini S; Thanos, Dimitris; Stravopodis, Dimitrios J; Margaritis, Lukas H

    2017-04-03

    The daily use by people of wireless communication devices has increased exponentially in the last decade, begetting concerns regarding its potential health hazards. Drosophila melanogaster four days-old adult female flies were exposed for 30 min to radiation emitted by a commercial mobile phone at a SAR of 0.15 W/kg and a SAE of 270 J/kg. ROS levels and apoptotic follicles were assayed in parallel with a genome-wide microarrays analysis. ROS cellular contents were found to increase by 1.6-fold (x), immediately after the end of exposure, in follicles of pre-choriogenic stages (germarium - stage 10), while sporadically generated apoptotic follicles (germarium 2b and stages 7-9) presented with an averaged 2x upregulation in their sub-population mass, 4 h after fly's irradiation with mobile device. Microarray analysis revealed 168 genes being differentially expressed, 2 h post-exposure, in response to radiofrequency (RF) electromagnetic field-radiation exposure (≥1.25x, P mobile-phone radiation for 30 min has an immediate impact on ROS production in animal's ovary, which seems to cause a global, systemic and non-targeted transcriptional reprogramming of gene expression, 2 h post-exposure, being finally followed by induction of apoptosis 4 h after the end of exposure. Conclusively, this unique type of pulsed radiation, mainly being derived from daily used mobile phones, seems capable of mobilizing critical cytopathic mechanisms, and altering fundamental genetic programs and networks in D. melanogaster.

  17. Host-Induced Silencing of Two Pharyngeal Gland Genes Conferred Transcriptional Alteration of Cell Wall-Modifying Enzymes of Meloidogyne incognita vis-à-vis Perturbed Nematode Infectivity in Eggplant.

    Science.gov (United States)

    Shivakumara, Tagginahalli N; Chaudhary, Sonam; Kamaraju, Divya; Dutta, Tushar K; Papolu, Pradeep K; Banakar, Prakash; Sreevathsa, Rohini; Singh, Bhupinder; Manjaiah, K M; Rao, Uma

    2017-01-01

    The complex parasitic strategy of Meloidogyne incognita appears to involve simultaneous expression of its pharyngeal gland-specific effector genes in order to colonize the host plants. Research reports related to effector crosstalk in phytonematodes for successful parasitism of the host tissue is yet underexplored. In view of this, we have used in planta effector screening approach to understand the possible interaction of pioneer genes ( msp-18 and msp-20 , putatively involved in late and early stage of M. incognita parasitism, respectively) with other unrelated effectors such as cell-wall modifying enzymes (CWMEs) in M. incognita . Host-induced gene silencing (HIGS) strategy was used to generate the transgenic eggplants expressing msp-18 and msp-20 , independently. Putative transformants were characterized via qRT-PCR and Southern hybridization assay. SiRNAs specific to msp-18 and msp - 20 were also detected in the transformants via Northern hybridization assay. Transgenic expression of the RNAi constructs of msp-18 and msp-20 genes resulted in 43.64-69.68% and 41.74-67.30% reduction in M. incognita multiplication encompassing 6 and 10 events, respectively. Additionally, transcriptional oscillation of CWMEs documented in the penetrating and developing nematodes suggested the possible interaction among CWMEs and pioneer genes. The rapid assimilation of plant-derived carbon by invading nematodes was also demonstrated using 14 C isotope probing approach. Our data suggests that HIGS of msp-18 and msp-20 , improves nematode resistance in eggplant by affecting the steady-state transcription level of CWME genes in invading nematodes, and safeguard the plant against nematode invasion at very early stage because nematodes may become the recipient of bioactive RNA species during the process of penetration into the plant root.

  18. Microarray-based apoptosis gene screening technique in trichostatin A-induced drug-resisted lung cancer A549/CDDP cells

    Directory of Open Access Journals (Sweden)

    Ya-jun WANG

    2016-09-01

    Full Text Available Objective  To detect the expression profile changes of apoptosis-related genes in trichostatin A (TSA-induced drug-resisted lung cancer cells A549/CDDP by microarray, in order to screen the target genes in TSA treating cisplatin-resisted lung cancer. Methods  A549/CDDP cells were treated by TSA for 24 hours. Total RNA was extracted and reversely transcribed into cDNA. Gene expression levels were detected by the NimbleGen whole genome microarray. Differences of expression profiles between TSA-treated and control group were measured by NimbleScan 2.5 software and GO analysis. Apoptosis and proliferation related genes were screened from the expression changed genes. Results  Compared with the control group, 85 apoptosis-related genes were up-regulated and 43 growth or proliferation related genes were down-regulated in the TSA-treated group. GO analysis showed that the functions of these genes are mainly regulating apoptosis, cell resistance to chem ical stimuli protein, as well as regulating cell growth, proliferation and the biological process of maintaining the cell biological quality. TSA-activated not only the mitochondrial apoptotic pathways, but also the death receptor related apoptosis pathway, and down-regulated the drug resistance related genes BAG3 and ABCC2. Conclusion  TSA may cause the expression changes of apoptotic and proliferation genes in A549/CDDP cells, these genes may play a role in TSA treating cisplatin-resisted lung cancer. DOI: 10.11855/j.issn.0577-7402.2016.08.07

  19. Perturbative anyon gas

    International Nuclear Information System (INIS)

    Dasnieres de Veigy, A.; Ouvry, S.; Paris-6 Univ., 75

    1992-06-01

    The problem of the statistical mechanics of an anyon gas is addressed. A perturbative analysis in the anyonic coupling constant α is reviewed, and the thermodynamical potential is computed at first and second order. An adequate second quantized formalism (field theory at finite temperature) is proposed. At first order in perturbation theory, the results are strikingly simple: only the second virial coefficient close to bosonic statistics is corrected. At second order, however, the complexity of the anyon model appears. One can compute exactly the perturbative correction to each cluster coefficient. However, and contrary to first order, a closed expression for the equation of state seems out of reach. As an illustration, the perturbative expressions of a 3 , a 4 , a 5 and a 6 are given at second order. Finally, using the same formalism, the equation of state of an anyon gas in a constant magnetic field is analyzed at first order in perturbation theory. (K.A.) 16 refs.; 3 figs.; 7 tabs

  20. A comparative study of mutation screening of sarcomeric genes (MYBPC3, MYH7, TNNT2 using single gene approach versus targeted gene panel next generation sequencing in a cohort of HCM patients in Egypt

    Directory of Open Access Journals (Sweden)

    Heba Sh. Kassem

    2017-10-01

    Full Text Available Background: NGS enables simultaneous sequencing of large numbers of associated genes in genetic heterogeneous disorders, in a more rapid and cost-effective manner than traditional technologies. However there have been limited direct comparisons between NGS and more established technologies to assess the sensitivity and false negative rates of this new approach. The scope of the present manuscript is to compare variants detected in MYBPC3, MYH7 and TNNT2 genes using the stepwise dHPLC/Sanger versus targeted NGS. Methods: In this study, we have analysed a group of 150 samples of patients from the Bibliotheca Alexandrina-Aswan Heart Centre National HCM program. The genetic testing was simultaneously undertaken by high throughput denaturing high-performance liquid chromatography (dHPLC followed by Sanger based sequencing and targeted next generation deep sequencing using panel of inherited cardiac genes (ICC. The panel included over 100 genes including the 3 sarcomeric genes. Analysis of the sequencing data of the 3 genes was undertaken in a double blinded strategy. Results: NGS analysis detected all pathogenic and likely pathogenic variants identified by dHPLC (50 in total, some samples had double hits. There was a 0% false negative rate for NGS based analysis. Nineteen variants were missed by dHPLC and detected by NGS, thus increasing the diagnostic yield in this co- analysed cohort from 22.0% (33/150 to 31.3% (47/150.Of interest to note that the mutation spectrum in this Egyptian HCM population revealed a high rate of homozygosity in MYBPC3 and MYH7 genes in comparison to other population studies (6/150, 4%. None of the homozygous samples were detected by dHPLC analysis. Conclusion: NGS provides a useful and rapid tool to allow panoramic screening of several genes simultaneously with a high sensitivity rate amongst genes of known etiologic role allowing high throughput analysis of HCM patients and relevant control series in a less characterised

  1. Chiral perturbation theory

    International Nuclear Information System (INIS)

    Ecker, G.

    1996-06-01

    After a general introduction to the structure of effective field theories, the main ingredients of chiral perturbation theory are reviewed. Applications include the light quark mass ratios and pion-pion scattering to two-loop accuracy. In the pion-nucleon system, the linear σ model is contrasted with chiral perturbation theory. The heavy-nucleon expansion is used to construct the effective pion-nucleon Lagrangian to third order in the low-energy expansion, with applications to nucleon Compton scattering. (author)

  2. Tackling heterogeneity: a leaf disc-based assay for the high-throughput screening of transient gene expression in tobacco.

    Directory of Open Access Journals (Sweden)

    Natalia Piotrzkowski

    Full Text Available Transient Agrobacterium-mediated gene expression assays for Nicotiana tabacum (N. tabacum are frequently used because they facilitate the comparison of multiple expression constructs regarding their capacity for maximum recombinant protein production. However, for three model proteins, we found that recombinant protein accumulation (rpa was significantly influenced by leaf age and leaf position effects. The ratio between the highest and lowest amount of protein accumulation (max/min ratio was found to be as high as 11. Therefore, construct-based impacts on the rpa level that are less than 11-fold will be masked by background noise. To address this problem, we developed a leaf disc-based screening assay and infiltration device that allows the rpa level in a whole tobacco plant to be reliably and reproducibly determined. The prototype of the leaf disc infiltration device allows 14 Agrobacterium-mediated infiltration events to be conducted in parallel. As shown for three model proteins, the average max/min rpa ratio was reduced to 1.4 using this method, which allows for a sensitive comparison of different genetic elements affecting recombinant protein expression.

  3. Social Health Insurance-Based Simultaneous Screening for 154 Mutations in 19 Deafness Genes Efficiently Identified Causative Mutations in Japanese Hearing Loss Patients.

    Directory of Open Access Journals (Sweden)

    Kentaro Mori

    Full Text Available Sensorineural hearing loss is one of the most common neurosensory disorders in humans. The incidence of SNHL is estimated to be 1 in 500-1000 newborns. In more than half of these patients, the hearing loss is associated with genetic causes. In Japan, genetic testing for the patients with SNHL using the Invader assay to screen for 46 mutations in 13 deafness genes was approved by the Ministry of Health, Labour and Welfare for inclusion in social health insurance coverage in 2012. Furthermore, from August 2015, this genetic testing has been expanded to screen for 154 mutations in 19 deafness genes using targeted genomic enrichment with massively parallel DNA sequencing combined with the Invader assay and TaqMan genotyping. For this study we analyzed 717 unrelated Japanese hearing loss patients. The total allele frequency of 154 mutations in 19 deafness genes was 32.64% (468/1434 and the total numbers of cases associated with at least one mutation was 44.07% (316/717. Among these, we were able to diagnose 212 (30% patients, indicating that the present screening could efficiently identify causative mutations in hearing loss patients. It is noteworthy that 27 patients (3.8% had coexistent multiple mutations in different genes. Five of these 27 patients (0.7%, 5/717 overall were diagnosed with genetic hearing loss affected by concomitant with responsible mutations in more than two different genes. For patients identified with multiple mutations in different genes, it is necessary to consider that several genes might have an impact on their phenotypes.

  4. Preheating curvaton perturbations

    International Nuclear Information System (INIS)

    Bastero-Gil, M.; Di Clemente, V.; King, S.F.

    2005-01-01

    We discuss the potentially important role played by preheating in certain variants of the curvaton mechanism in which isocurvature perturbations of a D-flat (and F-flat) direction become converted to curvature perturbations during reheating. We discover that parametric resonance of the isocurvature components amplifies the superhorizon fluctuations by a significant amount. As an example of these effects we develop a particle physics motivated model which involves hybrid inflation with the waterfall field N being responsible for generating the μ term, the right-handed neutrino mass scale, and the Peccei-Quinn symmetry breaking scale. The role of the curvaton field can be played either by usual Higgs field, or the lightest right-handed sneutrino. Our new results show that it is possible to achieve the correct curvature perturbations for initial values of the curvaton fields of order the weak scale. In this model we show that the prediction for the spectral index of the final curvature perturbation only depends on the mass of the curvaton during inflation, where consistency with current observational data requires the ratio of this mass to the Hubble constant to be 0.3

  5. String perturbation theory diverges

    International Nuclear Information System (INIS)

    Gross, D.J.; Periwal, V.

    1988-01-01

    We prove that perturbation theory for the bosonic string diverges for arbitrary values of the coupling constant and is not Borel summable. This divergence is independent of the existence of the infinities that occur in the theory due to the presence of tachyons and dilaton tadpoles. We discuss the physical implications of such a divergence

  6. Divergent Perturbation Series

    International Nuclear Information System (INIS)

    Suslov, I.M.

    2005-01-01

    Various perturbation series are factorially divergent. The behavior of their high-order terms can be determined by Lipatov's method, which involves the use of instanton configurations of appropriate functional integrals. When the Lipatov asymptotic form is known and several lowest order terms of the perturbation series are found by direct calculation of diagrams, one can gain insight into the behavior of the remaining terms of the series, which can be resummed to solve various strong-coupling problems in a certain approximation. This approach is demonstrated by determining the Gell-Mann-Low functions in φ 4 theory, QED, and QCD with arbitrary coupling constants. An overview of the mathematical theory of divergent series is presented, and interpretation of perturbation series is discussed. Explicit derivations of the Lipatov asymptotic form are presented for some basic problems in theoretical physics. A solution is proposed to the problem of renormalon contributions, which hampered progress in this field in the late 1970s. Practical perturbation-series summation schemes are described both for a coupling constant of order unity and in the strong-coupling limit. An interpretation of the Borel integral is given for 'non-Borel-summable' series. Higher order corrections to the Lipatov asymptotic form are discussed

  7. Instantaneous stochastic perturbation theory

    International Nuclear Information System (INIS)

    Lüscher, Martin

    2015-01-01

    A form of stochastic perturbation theory is described, where the representative stochastic fields are generated instantaneously rather than through a Markov process. The correctness of the procedure is established to all orders of the expansion and for a wide class of field theories that includes all common formulations of lattice QCD.

  8. Cosmological perturbations in antigravity

    Science.gov (United States)

    Oltean, Marius; Brandenberger, Robert

    2014-10-01

    We compute the evolution of cosmological perturbations in a recently proposed Weyl-symmetric theory of two scalar fields with oppositely signed conformal couplings to Einstein gravity. It is motivated from the minimal conformal extension of the standard model, such that one of these scalar fields is the Higgs while the other is a new particle, the dilaton, introduced to make the Higgs mass conformally symmetric. At the background level, the theory admits novel geodesically complete cyclic cosmological solutions characterized by a brief period of repulsive gravity, or "antigravity," during each successive transition from a big crunch to a big bang. For simplicity, we consider scalar perturbations in the absence of anisotropies, with potential set to zero and without any radiation. We show that despite the necessarily wrong-signed kinetic term of the dilaton in the full action, these perturbations are neither ghostlike nor tachyonic in the limit of strongly repulsive gravity. On this basis, we argue—pending a future analysis of vector and tensor perturbations—that, with respect to perturbative stability, the cosmological solutions of this theory are viable.

  9. Perturbed Markov chains

    OpenAIRE

    Solan, Eilon; Vieille, Nicolas

    2015-01-01

    We study irreducible time-homogenous Markov chains with finite state space in discrete time. We obtain results on the sensitivity of the stationary distribution and other statistical quantities with respect to perturbations of the transition matrix. We define a new closeness relation between transition matrices, and use graph-theoretic techniques, in contrast with the matrix analysis techniques previously used.

  10. Scalar cosmological perturbations

    International Nuclear Information System (INIS)

    Uggla, Claes; Wainwright, John

    2012-01-01

    Scalar perturbations of Friedmann-Lemaitre cosmologies can be analyzed in a variety of ways using Einstein's field equations, the Ricci and Bianchi identities, or the conservation equations for the stress-energy tensor, and possibly introducing a timelike reference congruence. The common ground is the use of gauge invariants derived from the metric tensor, the stress-energy tensor, or from vectors associated with a reference congruence, as basic variables. Although there is a complication in that there is no unique choice of gauge invariants, we will show that this can be used to advantage. With this in mind our first goal is to present an efficient way of constructing dimensionless gauge invariants associated with the tensors that are involved, and of determining their inter-relationships. Our second goal is to give a unified treatment of the various ways of writing the governing equations in dimensionless form using gauge-invariant variables, showing how simplicity can be achieved by a suitable choice of variables and normalization factors. Our third goal is to elucidate the connection between the metric-based approach and the so-called 1 + 3 gauge-invariant approach to cosmological perturbations. We restrict our considerations to linear perturbations, but our intent is to set the stage for the extension to second-order perturbations. (paper)

  11. Generalized perturbation series

    International Nuclear Information System (INIS)

    Baird, L.C.; Stinchcomb, G.

    1973-01-01

    An approximate solution of the Green's function equation may be used to generate an exact solution of the Schroedinger equation. This is accomplished through an iterative procedure. The procedure is equivalent to a perturbation expansion if the approximate Green's function is exact with respect to some reference potential

  12. Perturbed S3 neutrinos

    DEFF Research Database (Denmark)

    jora, Renata; Schechter, Joseph; Naeem Shahid, M.

    2009-01-01

    We study the effects of the perturbation which violates the permutation symmetry of three Majorana neutrinos but preserves the well known (23) interchange symmetry. This is done in the presenceof an arbitrary Majorana phase which serves to insure the degeneracy of the three neutrinos at the unper...... at the unperturbed level....

  13. A simple screening method for detection of Klinefelter syndrome and other X-chromosome aneuploidies based on copy number of the androgen receptor gene

    DEFF Research Database (Denmark)

    Ottesen, A M; Garn, I D; Aksglaede, L

    2007-01-01

    Due to the high prevalence and variable phenotype of patients with Klinefelter syndrome, there is a need for a robust and rapid screening method allowing early diagnosis. Here, we report on the development and detailed clinical validation of a quantitative real-time PCR (qPCR)-based method...... of the copy number assessment of the androgen receptor (AR) gene, located to Xq11.2-q12. We analysed samples from 50 individuals, including a healthy male and female controls and patients with Klinefelter syndrome (47,XXY; 48,XXXY) (n = 28), mosaicisms (46,XX/47,XXY/48XXYY; 45,X/46,XY) (n = 3), other sex......-gene expression. The XIST-expression based assay was correct in only 29/36 samples (81%). Our findings demonstrated that the AR-qPCR technique is a simple and reliable screening method for diagnosis of patients with Klinefelter syndrome or other chromosomal disorders involving an aberrant number of X-chromosomes....

  14. Genome-wide screen in Saccharomyces cerevisiae identifies vacuolar protein sorting, autophagy, biosynthetic, and tRNA methylation genes involved in life span regulation.

    Directory of Open Access Journals (Sweden)

    Paola Fabrizio

    2010-07-01

    Full Text Available The study of the chronological life span of Saccharomyces cerevisiae, which measures the survival of populations of non-dividing yeast, has resulted in the identification of homologous genes and pathways that promote aging in organisms ranging from yeast to mammals. Using a competitive genome-wide approach, we performed a screen of a complete set of approximately 4,800 viable deletion mutants to identify genes that either increase or decrease chronological life span. Half of the putative short-/long-lived mutants retested from the primary screen were confirmed, demonstrating the utility of our approach. Deletion of genes involved in vacuolar protein sorting, autophagy, and mitochondrial function shortened life span, confirming that respiration and degradation processes are essential for long-term survival. Among the genes whose deletion significantly extended life span are ACB1, CKA2, and TRM9, implicated in fatty acid transport and biosynthesis, cell signaling, and tRNA methylation, respectively. Deletion of these genes conferred heat-shock resistance, supporting the link between life span extension and cellular protection observed in several model organisms. The high degree of conservation of these novel yeast longevity determinants in other species raises the possibility that their role in senescence might be conserved.

  15. Genome-wide screen in Saccharomyces cerevisiae identifies vacuolar protein sorting, autophagy, biosynthetic, and tRNA methylation genes involved in life span regulation.

    Science.gov (United States)

    Fabrizio, Paola; Hoon, Shawn; Shamalnasab, Mehrnaz; Galbani, Abdulaye; Wei, Min; Giaever, Guri; Nislow, Corey; Longo, Valter D

    2010-07-15

    The study of the chronological life span of Saccharomyces cerevisiae, which measures the survival of populations of non-dividing yeast, has resulted in the identification of homologous genes and pathways that promote aging in organisms ranging from yeast to mammals. Using a competitive genome-wide approach, we performed a screen of a complete set of approximately 4,800 viable deletion mutants to identify genes that either increase or decrease chronological life span. Half of the putative short-/long-lived mutants retested from the primary screen were confirmed, demonstrating the utility of our approach. Deletion of genes involved in vacuolar protein sorting, autophagy, and mitochondrial function shortened life span, confirming that respiration and degradation processes are essential for long-term survival. Among the genes whose deletion significantly extended life span are ACB1, CKA2, and TRM9, implicated in fatty acid transport and biosynthesis, cell signaling, and tRNA methylation, respectively. Deletion of these genes conferred heat-shock resistance, supporting the link between life span extension and cellular protection observed in several model organisms. The high degree of conservation of these novel yeast longevity determinants in other species raises the possibility that their role in senescence might be conserved.

  16. Genome-wide RNAi screen reveals the E3 SUMO-protein ligase gene SIZ1 as a novel determinant of furfural tolerance in Saccharomyces cerevisiae

    OpenAIRE

    Xiao, Han; Zhao, Huimin

    2014-01-01

    Background Furfural is a major growth inhibitor in lignocellulosic hydrolysates and improving furfural tolerance of microorganisms is critical for rapid and efficient fermentation of lignocellulosic biomass. In this study, we used the RNAi-Assisted Genome Evolution (RAGE) method to select for furfural resistant mutants of Saccharomyces cerevisiae, and identified a new determinant of furfural tolerance. Results By using a genome-wide RNAi (RNA-interference) screen in S. cerevisiae for genes in...

  17. High-Throughput Screening for Spermatogenesis Candidate Genes in the AZFc Region of the Y Chromosome by Multiplex Real Time PCR Followed by High Resolution Melting Analysis

    OpenAIRE

    Alechine, Evguenia; Corach, Daniel

    2014-01-01

    Microdeletions in the AZF region of the Y chromosome are among the most frequent genetic causes of male infertility, although the specific role of the genes located in this region is not fully understood. AZFa and AZFb deletions impair spermatogenesis since no spermatozoa are found in the testis. Deletions of the AZFc region, despite being the most frequent in azoospermic patients, do not correlate with spermatogenic failure. Therefore, the aim of this work was to develop a screening method t...

  18. High-throughput screening for spermatogenesis candidate genes in the AZFc region of the Y chromosome by multiplex real time PCR followed by high resolution melting analysis

    OpenAIRE

    Alechine, Evguenia; Corach, Daniel

    2017-01-01

    Microdeletions in the AZF region of the Y chromosome are among the most frequent genetic causes of male infertility, although the specific role of the genes located in this region is not fully understood. AZFa and AZFb deletions impair spermatogenesis since no spermatozoa are found in the testis. Deletions of the AZFc region, despite being the most frequent in azoospermic patients, do not correlate with spermatogenic failure. Therefore, the aim of this work was to develop a screening method t...

  19. A temperature-tolerant multiplex elements and genes screening system for genetically modified organisms based on dual priming oligonucleotide primers and capillary electrophoresis.

    Science.gov (United States)

    Fu, Wei; Wei, Shuang; Wang, Chenguang; Du, Zhixin; Zhu, Pengyu; Wu, Xiyang; Wu, Gang; Zhu, Shuifang

    2017-08-15

    High throughput screening systems are the preferred solution to meet the urgent requirement of increasing number of genetically modified organisms (GMOs). In this study, we have successfully developed a multiplex GMO element screening system with dual priming oligonucleotide (DPO) primers. This system can detect the cauliflower mosaic virus 35S (CaMV 35S), terminator of nopaline synthase gene (NOS), figwort mosaic virus 35S (FMV 35S) promoter, neomycin phosphotransferaseII (NPTII), Bt Cry 1Ab, phosphinothricin acetyltransferase genes (bar) and Streptomyces viridochromogenes (pat) simultaneously, which covers more than 90% of all authorized GMO species worldwide. This system exhibits a high tolerance to annealing temperatures, high specificity and a limit of detection equal to conventional PCR. A total of 214 samples from markets, national entry-exit agencies, the Institute for Reference Materials and Measurement (IRMM) and the American Oil Chemists' Society (AOCS) were also tested for applicability. This screening system is therefore suitable for GMO screening. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Studying the perturbative Reggeon

    International Nuclear Information System (INIS)

    Griffiths, S.; Ross, D.A.

    2000-01-01

    We consider the flavour non-singlet Reggeon within the context of perturbative QCD. This consists of ladders built out of ''reggeized'' quarks. We propose a method for the numerical solution of the integro-differential equation for the amplitude describing the exchange of such a Reggeon. The solution is known to have a sharp rise at low values of Bjorken-x when applied to non-singlet quantities in deep-inelastic scattering. We show that when the running of the coupling is taken into account this sharp rise is further enhanced, although the Q 2 dependence is suppressed by the introduction of the running coupling. We also investigate the effects of simulating non-perturbative physics by introducing a constituent mass for the soft quarks and an effective mass for the soft gluons exchanged in the t-channel. (orig.)

  1. Renormalized Lie perturbation theory

    International Nuclear Information System (INIS)

    Rosengaus, E.; Dewar, R.L.

    1981-07-01

    A Lie operator method for constructing action-angle transformations continuously connected to the identity is developed for area preserving mappings. By a simple change of variable from action to angular frequency a perturbation expansion is obtained in which the small denominators have been renormalized. The method is shown to lead to the same series as the Lagrangian perturbation method of Greene and Percival, which converges on KAM surfaces. The method is not superconvergent, but yields simple recursion relations which allow automatic algebraic manipulation techniques to be used to develop the series to high order. It is argued that the operator method can be justified by analytically continuing from the complex angular frequency plane onto the real line. The resulting picture is one where preserved primary KAM surfaces are continuously connected to one another

  2. Nonperturbative perturbation theory

    International Nuclear Information System (INIS)

    Bender, C.M.

    1989-01-01

    In this talk we describe a recently proposed graphical perturbative calculational scheme for quantum field theory. The basic idea is to expand in the power of the interaction term. For example, to solve a λφ 4 theory in d-dimensional space-time, we introduce a small parameter δ and consider a λ(φ 2 ) 1+δ field theory. We show how to expand such a theory as a series in powers of δ. The resulting perturbation series appears to have a finite radius of convergence and numerical results for low-dimensional models are good. We have computed the two-point and four-point Green's functions to second order in powers of δ and the 2n-point Green's functions (n>2) to order δ. We explain how to renormalize the theory and show that, to first order in powers of δ, when δ>0 and d≥4 the theory is free. This conclusion remains valid to second order in powers of δ, and we believe that it remains valid to all orders in powers of δ. The new perturbative scheme is consistent with global supersymmetry invariance. We examine a two-dimensional supersymmetric quantum field theory in which we do not know of any other means for doing analytical calculations. We illustrate the power of this new technique by computing the ground-state energy density E to second order in this new perturbation theory. We show that there is a beautiful and delicate cancellation between infinite classes of graphs which leads to the result that E=0. (orig.)

  3. Perturbed asymptotically linear problems

    OpenAIRE

    Bartolo, R.; Candela, A. M.; Salvatore, A.

    2012-01-01

    The aim of this paper is investigating the existence of solutions of some semilinear elliptic problems on open bounded domains when the nonlinearity is subcritical and asymptotically linear at infinity and there is a perturbation term which is just continuous. Also in the case when the problem has not a variational structure, suitable procedures and estimates allow us to prove that the number of distinct crtitical levels of the functional associated to the unperturbed problem is "stable" unde...

  4. Twisting perturbed parafermions

    Directory of Open Access Journals (Sweden)

    A.V. Belitsky

    2017-07-01

    Full Text Available The near-collinear expansion of scattering amplitudes in maximally supersymmetric Yang–Mills theory at strong coupling is governed by the dynamics of stings propagating on the five sphere. The pentagon transitions in the operator product expansion which systematize the series get reformulated in terms of matrix elements of branch-point twist operators in the two-dimensional O(6 nonlinear sigma model. The facts that the latter is an asymptotically free field theory and that there exists no local realization of twist fields prevents one from explicit calculation of their scaling dimensions and operator product expansion coefficients. This complication is bypassed making use of the equivalence of the sigma model to the infinite-level limit of WZNW models perturbed by current–current interactions, such that one can use conformal symmetry and conformal perturbation theory for systematic calculations. Presently, to set up the formalism, we consider the O(3 sigma model which is reformulated as perturbed parafermions.

  5. Quantitative high-throughput gene expression profiling of human striatal development to screen stem cell–derived medium spiny neurons

    Directory of Open Access Journals (Sweden)

    Marco Straccia

    Full Text Available A systematic characterization of the spatio-temporal gene expression during human neurodevelopment is essential to understand brain function in both physiological and pathological conditions. In recent years, stem cell technology has provided an in vitro tool to recapitulate human development, permitting also the generation of human models for many diseases. The correct differentiation of human pluripotent stem cell (hPSC into specific cell types should be evaluated by comparison with specific cells/tissue profiles from the equivalent adult in vivo organ. Here, we define by a quantitative high-throughput gene expression analysis the subset of specific genes of the whole ganglionic eminence (WGE and adult human striatum. Our results demonstrate that not only the number of specific genes is crucial but also their relative expression levels between brain areas. We next used these gene profiles to characterize the differentiation of hPSCs. Our findings demonstrate a temporal progression of gene expression during striatal differentiation of hPSCs from a WGE toward an adult striatum identity. Present results establish a gene expression profile to qualitatively and quantitatively evaluate the telencephalic hPSC-derived progenitors eventually used for transplantation and mature striatal neurons for disease modeling and drug-screening.

  6. The Screening of Genes Sensitive to Long-Term, Low-Level Microwave Exposure and Bioinformatic Analysis of Potential Correlations to Learning and Memory

    Institute of Scientific and Technical Information of China (English)

    ZHAO Ya Li; LI Ying Xian; MA Hong Bo; LI Dong; LI Hai Liang; JIANG Rui; KAN Guang Han; YANG Zhen Zhong; HUANG Zeng Xin

    2015-01-01

    Objective To gain a better understanding of gene expression changes in the brain following microwave exposure in mice. This study hopes to reveal mechanisms contributing to microwave-induced learning and memory dysfunction. Methods Mice were exposed to whole body 2100 MHz microwaves with specific absorption rates (SARs) of 0.45 W/kg, 1.8 W/kg, and 3.6 W/kg for 1 hour daily for 8 weeks. Differentially expressing genes in the brains were screened using high-density oligonucleotide arrays, with genes showing more significant differences further confirmed by RT-PCR. Results The gene chip results demonstrated that 41 genes (0.45 W/kg group), 29 genes (1.8 W/kg group), and 219 genes (3.6 W/kg group) were differentially expressed. GO analysis revealed that these differentially expressed genes were primarily involved in metabolic processes, cellular metabolic processes, regulation of biological processes, macromolecular metabolic processes, biosynthetic processes, cellular protein metabolic processes, transport, developmental processes, cellular component organization, etc. KEGG pathway analysis showed that these genes are mainly involved in pathways related to ribosome, Alzheimer's disease, Parkinson's disease, long-term potentiation, Huntington's disease, and Neurotrophin signaling. Construction of a protein interaction network identified several important regulatory genes including synbindin (sbdn), Crystallin (CryaB), PPP1CA, Ywhaq, Psap, Psmb1, Pcbp2, etc., which play important roles in the processes of learning and memory. Conclusion Long-term, low-level microwave exposure may inhibit learning and memory by affecting protein and energy metabolic processes and signaling pathways relating to neurological functions or diseases.

  7. The Screening of Genes Sensitive to Long-Term, Low-Level Microwave Exposure and Bioinformatic Analysis of Potential Correlations to Learning and Memory.

    Science.gov (United States)

    Zhao, Ya Li; Li, Ying Xian; Ma, Hong Bo; Li, Dong; Li, Hai Liang; Jiang, Rui; Kan, Guang Han; Yang, Zhen Zhong; Huang, Zeng Xin

    2015-08-01

    To gain a better understanding of gene expression changes in the brain following microwave exposure in mice. This study hopes to reveal mechanisms contributing to microwave-induced learning and memory dysfunction. Mice were exposed to whole body 2100 MHz microwaves with specific absorption rates (SARs) of 0.45 W/kg, 1.8 W/kg, and 3.6 W/kg for 1 hour daily for 8 weeks. Differentially expressing genes in the brains were screened using high-density oligonucleotide arrays, with genes showing more significant differences further confirmed by RT-PCR. The gene chip results demonstrated that 41 genes (0.45 W/kg group), 29 genes (1.8 W/kg group), and 219 genes (3.6 W/kg group) were differentially expressed. GO analysis revealed that these differentially expressed genes were primarily involved in metabolic processes, cellular metabolic processes, regulation of biological processes, macromolecular metabolic processes, biosynthetic processes, cellular protein metabolic processes, transport, developmental processes, cellular component organization, etc. KEGG pathway analysis showed that these genes are mainly involved in pathways related to ribosome, Alzheimer's disease, Parkinson's disease, long-term potentiation, Huntington's disease, and Neurotrophin signaling. Construction of a protein interaction network identified several important regulatory genes including synbindin (sbdn), Crystallin (CryaB), PPP1CA, Ywhaq, Psap, Psmb1, Pcbp2, etc., which play important roles in the processes of learning and memorye. Long-term, low-level microwave exposure may inhibit learning and memory by affecting protein and energy metabolic processes and signaling pathways relating to neurological functions or diseases. Copyright © 2015 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  8. Screening of radiation-induced genes in human lymphoblastoid cells irradiated with 20 cGy of γ-ray by gene chip

    International Nuclear Information System (INIS)

    Wang Huiping; Long Xianhui; Xu Qinzhi; Bai Bei; Sui Jianli; Zhou Pingkun

    2006-01-01

    cDNA gene chip was used to detect the transcriptional profile of human lymphoblasts cells irradiated with 20 cGy of 60 Co γ-ray. The microarray contains 14112 cDNA probing corresponding to 14112 human genes. The results showed that the transcription level of 83 genes changed; among which 21 genes were up-regulated. Most of them were associated with signal transduction, cell cycle regulation, cellular immunity, cytoskeleton and movement, etc. It indicated that low-dose irradiation can modulate the expression of a series of functional genes, which is the primary molecular basis of cellular responses to radiation. (authors)

  9. Screening of the USH1G gene among Spanish patients with Usher syndrome. Lack of mutations and evidence of a minor role in the pathogenesis of the syndrome.

    Science.gov (United States)

    Aller, Elena; Jaijo, Teresa; Beneyto, Magdalena; Nájera, Carmen; Morera, Constantino; Pérez-Garrigues, Herminio; Ayuso, Carmen; Millán, Jose

    2007-09-01

    The Usher syndrome (USH) is an autosomal recessive hereditary disorder characterized by the association of sensorineural hearing loss, retinitis pigmentosa (RP) and, in some cases, vestibular dysfunction. The USH1G gene, encoding SANS, has been found to cause both Usher syndrome type I and atypical Usher syndrome. 109 Spanish unrelated patients suffering from Usher syndrome type I, type II, type III and unclassified Usher syndrome were screened for mutations in this gene, but only eight different changes without a clear pathogenic effect have been detected. Based on these results as well as previous studies in other populations where mutational analysis of this gene has been carried out, one can conclude that USH1G has a minor involvement in Usher syndrome pathogenesis.

  10. Rapid screening of spontaneous and radiation-induced structural changes at the vestigial gene of Drosophila melanogaster by polymerase chain reaction

    International Nuclear Information System (INIS)

    Aleksandrov, I.D.; Lapidus, I.L.; Aleksandrova, M.V.; Karpovskij, A.L.; Korablinova, S.V.; Levkovich, N.V.

    1998-01-01

    A total of 27 independent isolated spontaneous and gamma-ray-induced heritable mutations at the vestigial gene of Drosophila melanogaster were analysed by a rapid deletion screening method with polymerase chain reaction (PCR) amplification. According to the results obtained 36.4% (4 of 11) of spontaneous mutants and 62.5% (10 of 16) of gamma-ray-induced ones have revealed deficiency of one or more fragments studied. The rest of spontaneous and radiation mutants showed no alterations in the PCR patterns, indicating possible small scale changes (point mutations) inside the gene region studied or, probably, the gross lesions situated elsewhere. The distribution of the mutation damages in the gene region studied are discussed

  11. Mutation screening of the CDKL5 gene in cryptogenic infantile intractable epilepsy and review of clinical sensitivity.

    Science.gov (United States)

    Intusoma, Utcharee; Hayeeduereh, Fadell; Plong-On, Oradawan; Sripo, Thanya; Vasiknanonte, Punnee; Janjindamai, Supachai; Lusawat, Apasri; Thammongkol, Sasipa; Visudtibhan, Anannit; Limprasert, Pornprot

    2011-09-01

    To perform CDKL5 mutation screening in Thai children with cryptogenic infantile intractable epilepsy and to determine the clinical sensitivity of CDKL5 screening when different inclusion criteria were applied. Children with cryptogenic infantile intractable epilepsy were screened for CDKL5 mutation using multiplex ligation-dependent probe amplification and DNA sequencing. The clinical sensitivity was reviewed by combining the results of studies using similar inclusion screening criteria. Thirty children (19 girls and 11 boys) with a median seizure onset of 7 months were screened. Almost a half had infantile spasms and one fifth had stereotypic hand movements. A novel c.2854C>T (p.R952X) was identified in an ambulatory girl who had severe mental retardation, multiple types of seizures without Rett-like features. Her mother had a mild intellectual disability, yet her grandmother and half sister were normal despite having the same genetic alteration (random X-inactivation patterns). The pathogenicity of p.R952X identified here was uncertain since healthy relatives and 6 female controls also harbor this alteration. The clinical sensitivity of CDKL5 mutation screening among females with Rett-like features and negative MECP2 screening was 7.8% while the clinical sensitivity among females having cryptogenic intractable seizures with an onset before the ages of 12, 6 and 3 months were 4.7, 11.6 and 14.3%, respectively. Copyright © 2011 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  12. Non-Perturbative Renormalization

    CERN Document Server

    Mastropietro, Vieri

    2008-01-01

    The notion of renormalization is at the core of several spectacular achievements of contemporary physics, and in the last years powerful techniques have been developed allowing to put renormalization on a firm mathematical basis. This book provides a self-consistent and accessible introduction to the sophisticated tools used in the modern theory of non-perturbative renormalization, allowing an unified and rigorous treatment of Quantum Field Theory, Statistical Physics and Condensed Matter models. In particular the first part of this book is devoted to Constructive Quantum Field Theory, providi

  13. Perturbative quantum chromodynamics

    CERN Document Server

    1989-01-01

    This book will be of great interest to advanced students and researchers in the area of high energy theoretical physics. Being the most complete and updated review volume on Perturbative QCD, it serves as an extremely useful textbook or reference book. Some of the reviews in this volume are the best that have been written on the subject anywhere. Contents: Factorization of Hard Processes in QCD (J C Collins, D E Soper & G Sterman); Exclusive Processes in Quantum Chromodynamics (S J Brodsky & G P Lepage); Coherence and Physics of QCD Jets (Yu L Dokshitzer, V A Khoze & S I Troyan); Pomeron in Qu

  14. Perturbative quantum chromodynamics

    International Nuclear Information System (INIS)

    Radyushkin, A.V.

    1987-01-01

    The latest achievements in perturbative quantum chromodynamics (QCD) relating to the progress in factorization of small and large distances are presented. The following problems are concerned: Development of the theory of Sudakov effects on the basis of mean contour formalism. Development of nonlocal condensate formalism. Calculation of hadron wave functions and hadron distribution functions using QCD method of sum rules. Development of the theory of Regge behaviour in QCD, behaviour of structure functions at small x. Study of polarization effects in hadron processes with high momentum transfer

  15. Deep sequencing of ESTs from nacreous and prismatic layer producing tissues and a screen for novel shell formation-related genes in the pearl oyster.

    Directory of Open Access Journals (Sweden)

    Shigeharu Kinoshita

    Full Text Available BACKGROUND: Despite its economic importance, we have a limited understanding of the molecular mechanisms underlying shell formation in pearl oysters, wherein the calcium carbonate crystals, nacre and prism, are formed in a highly controlled manner. We constructed comprehensive expressed gene profiles in the shell-forming tissues of the pearl oyster Pinctada fucata and identified novel shell formation-related genes candidates. PRINCIPAL FINDINGS: We employed the GS FLX 454 system and constructed transcriptome data sets from pallial mantle and pearl sac, which form the nacreous layer, and from the mantle edge, which forms the prismatic layer in P. fucata. We sequenced 260477 reads and obtained 29682 unique sequences. We also screened novel nacreous and prismatic gene candidates by a combined analysis of sequence and expression data sets, and identified various genes encoding lectin, protease, protease inhibitors, lysine-rich matrix protein, and secreting calcium-binding proteins. We also examined the expression of known nacreous and prismatic genes in our EST library and identified novel isoforms with tissue-specific expressions. CONCLUSIONS: We constructed EST data sets from the nacre- and prism-producing tissues in P. fucata and found 29682 unique sequences containing novel gene candidates for nacreous and prismatic layer formation. This is the first report of deep sequencing of ESTs in the shell-forming tissues of P. fucata and our data provide a powerful tool for a comprehensive understanding of the molecular mechanisms of molluscan biomineralization.

  16. Inactivating Mutation screening of Exon 6 and Exon 10E of FSHR gene in women with Polycystic Ovarian Syndrome in Vellore population

    Science.gov (United States)

    Sekar, Nishu; Sapre, Madhura; Kale, Vaikhari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

    2017-11-01

    Polycystic Ovarian syndrome (PCOS) is a major cause of infertility in females of reproducing age and is typified by oligo-anovulation, hyperandrogenism, hirsutism and polycystic ovaries. FSHR gene located on chromosome 2 p21 is responsible for the normal follicular development and any deletion or mutation in the gene affects the interaction of FSH with its receptor. Thus, it becomes the candidate gene for PCOS study. Inactivating mutation in FSHR gene limits the receptor’s function by creating a complete block, changing the receptor-ligand complex or the basic hormone signal transduction.To screen the inactivating mutations in Exon 6 and Exon 10E of FSHR gene in women diagnosed with PCOS.PCR-RFLP analysis indicated that there were no inactivating mutations found in Exon 6 and Exon 10E. Variations in hormone levels were seen amongst the PCOS patients. There were no inactivating mutations found in FSHR gene of the women diagnosed with PCOS according to the Rotterdam criteria in Vellore population.

  17. Perturbed effects at radiation physics

    International Nuclear Information System (INIS)

    Külahcı, Fatih; Şen, Zekâi

    2013-01-01

    Perturbation methodology is applied in order to assess the linear attenuation coefficient, mass attenuation coefficient and cross-section behavior with random components in the basic variables such as the radiation amounts frequently used in the radiation physics and chemistry. Additionally, layer attenuation coefficient (LAC) and perturbed LAC (PLAC) are proposed for different contact materials. Perturbation methodology provides opportunity to obtain results with random deviations from the average behavior of each variable that enters the whole mathematical expression. The basic photon intensity variation expression as the inverse exponential power law (as Beer–Lambert's law) is adopted for perturbation method exposition. Perturbed results are presented not only in terms of the mean but additionally the standard deviation and the correlation coefficients. Such perturbation expressions provide one to assess small random variability in basic variables. - Highlights: • Perturbation methodology is applied to Radiation Physics. • Layer attenuation coefficient (LAC) and perturbed LAC are proposed for contact materials. • Perturbed linear attenuation coefficient is proposed. • Perturbed mass attenuation coefficient (PMAC) is proposed. • Perturbed cross-section is proposed

  18. The performance of the SEPT9 gene methylation assay and a comparison with other CRC screening tests: A meta-analysis.

    Science.gov (United States)

    Song, Lele; Jia, Jia; Peng, Xiumei; Xiao, Wenhua; Li, Yuemin

    2017-06-08

    The SEPT9 gene methylation assay is the first FDA-approved blood assay for colorectal cancer (CRC) screening. Fecal immunochemical test (FIT), FIT-DNA test and CEA assay are also in vitro diagnostic (IVD) tests used in CRC screening. This meta-analysis aims to review the SEPT9 assay performance and compare it with other IVD CRC screening tests. By searching the Ovid MEDLINE, EMBASE, CBMdisc and CJFD database, 25 out of 180 studies were identified to report the SEPT9 assay performance. 2613 CRC cases and 6030 controls were included, and sensitivity and specificity were used to evaluate its performance at various algorithms. 1/3 algorithm exhibited the best sensitivity while 2/3 and 1/1 algorithm exhibited the best balance between sensitivity and specificity. The performance of the blood SEPT9 assay is superior to that of the serum protein markers and the FIT test in symptomatic population, while appeared to be less potent than FIT and FIT-DNA tests in asymptomatic population. In conclusion, 1/3 algorithm is recommended for CRC screening, and 2/3 or 1/1 algorithms are suitable for early detection for diagnostic purpose. The SEPT9 assay exhibited better performance in symptomatic population than in asymptomatic population.

  19. High-Throughput Screening of Chemical Compound Libraries for Modulators of Salicylic Acid Signaling by In Situ Monitoring of Glucuronidase-Based Reporter Gene Expression.

    Science.gov (United States)

    Halder, Vivek; Kombrink, Erich

    2018-01-01

    Salicylic acid (SA) is a vital phytohormone that is intimately involved in coordination of the complex plant defense response to pathogen attack. Many aspects of SA signaling have been unraveled by classical genetic and biochemical methods using the model plant Arabidopsis thaliana, but many details remain unknown, owing to the inherent limitations of these methods. In recent years, chemical genetics has emerged as an alternative scientific strategy to complement classical genetics by virtue of identifying bioactive chemicals or probes that act selectively on their protein targets causing either activation or inhibition. Such selective tools have the potential to create conditional and reversible chemical mutant phenotypes that may be combined with genetic mutants. Here, we describe a facile chemical screening methodology for intact Arabidopsis seedlings harboring the β-glucuronidase (GUS) reporter by directly quantifying GUS activity in situ with 4-methylumbelliferyl-β-D-glucuronide (4-MUG) as substrate. The quantitative nature of this screening assay has an obvious advantage over the also convenient histochemical GUS staining method, as it allows application of statistical procedures and unbiased hit selection based on threshold values as well as distinction between compounds with strong or weak bioactivity. We show pilot screens for chemical activators or inhibitors of salicylic acid-mediated defense signaling using the Arabidopsis line expressing the SA-inducible PR1p::GUS reporter gene. Importantly, the screening methodology provided here can be adopted for any inducible GUS reporter line.

  20. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  1. Non-perturbative versus perturbative renormalization of lattice operators

    International Nuclear Information System (INIS)

    Goeckeler, M.; Technische Hochschule Aachen; Horsley, R.; Ilgenfritz, E.M.; Oelrich, H.; Forschungszentrum Juelich GmbH; Schierholz, G.; Forschungszentrum Juelich GmbH; Perlt, H.; Schiller, A.; Rakow, P.

    1995-09-01

    Our objective is to compute the moments of the deep-inelastic structure functions of the nucleon on the lattice. A major source of uncertainty is the renormalization of the lattice operators that enter the calculation. In this talk we compare the renormalization constants of the most relevant twist-two bilinear quark operators which we have computed non-perturbatively and perturbatively to one loop order. Furthermore, we discuss the use of tadpole improved perturbation theory. (orig.)

  2. Screening to Identify Commonly Used Chinese Herbs That Affect ERBB2 and ESR1 Gene Expression Using the Human Breast Cancer MCF-7 Cell Line

    Directory of Open Access Journals (Sweden)

    Jen-Hwey Chiu

    2014-01-01

    Full Text Available Aim. Our aim the was to screen the commonly used Chinese herbs in order to detect changes in ERBB2 and ESR1 gene expression using MCF-7 cells. Methods. Using the MCF-7 human breast cancer cell line, cell cytotoxicity and proliferation were evaluated by MTT and trypan blue exclusion assays, respectively. A luciferase reporter assay was established by transient transfecting MCF-7 cells with plasmids containing either the ERBB2 or the ESR1 promoter region linked to the luciferase gene. Chinese herbal extracts were used to treat the cells at 24 h after transfection, followed by measurement of their luciferase activity. The screening results were verified by Western blotting to measure HER2 and ERα protein expression. Results. At concentrations that induced little cytotoxicity, thirteen single herbal extracts and five compound recipes were found to increase either ERBB2 or ESR1 luciferase activity. By Western blotting, Si-Wu-Tang, Kuan-Shin-Yin, and Suan-Tsao-Ren-Tang were found to increase either HER2 or ERα protein expression. In addition, Ligusticum chuanxiong was shown to have a great effect on ERBB2 gene expression and synergistically with estrogen to stimulate MCF-7 cell growth. Conclusion. Our results provide important information that should affect clinical treatment strategies among breast cancer patients who are receiving hormonal or targeted therapies.

  3. Chemical Genomic Screening of a Saccharomyces cerevisiae Genomewide Mutant Collection Reveals Genes Required for Defense against Four Antimicrobial Peptides Derived from Proteins Found in Human Saliva

    Science.gov (United States)

    Bhatt, Sanjay; Schoenly, Nathan E.; Lee, Anna Y.; Nislow, Corey; Bobek, Libuse A.

    2013-01-01

    To compare the effects of four antimicrobial peptides (MUC7 12-mer, histatin 12-mer, cathelicidin KR20, and a peptide containing lactoferricin amino acids 1 to 11) on the yeast Saccharomyces cerevisiae, we employed a genomewide fitness screen of combined collections of mutants with homozygous deletions of nonessential genes and heterozygous deletions of essential genes. When an arbitrary fitness score cutoffs of 1 (indicating a fitness defect, or hypersensitivity) and −1 (indicating a fitness gain, or resistance) was used, 425 of the 5,902 mutants tested exhibited altered fitness when treated with at least one peptide. Functional analysis of the 425 strains revealed enrichment among the identified deletions in gene groups associated with the Gene Ontology (GO) terms “ribosomal subunit,” “ribosome biogenesis,” “protein glycosylation,” “vacuolar transport,” “Golgi vesicle transport,” “negative regulation of transcription,” and others. Fitness profiles of all four tested peptides were highly similar, particularly among mutant strains exhibiting the greatest fitness defects. The latter group included deletions in several genes involved in induction of the RIM101 signaling pathway, including several components of the ESCRT sorting machinery. The RIM101 signaling regulates response of yeasts to alkaline and neutral pH and high salts, and our data indicate that this pathway also plays a prominent role in regulating protective measures against all four tested peptides. In summary, the results of the chemical genomic screens of S. cerevisiae mutant collection suggest that the four antimicrobial peptides, despite their differences in structure and physical properties, share many interactions with S. cerevisiae cells and consequently a high degree of similarity between their modes of action. PMID:23208710

  4. A genetic screen for modifiers of UFO meristem activity identifies three novel FUSED FLORAL ORGANS genes required for early flower development in Arabidopsis.

    Science.gov (United States)

    Levin, J Z; Fletcher, J C; Chen, X; Meyerowitz, E M

    1998-06-01

    In a screen to identify novel genes required for early Arabidopsis flower development, we isolated four independent mutations that enhance the Ufo phenotype toward the production of filamentous structures in place of flowers. The mutants fall into three complementation groups, which we have termed FUSED FLORAL ORGANS (FFO) loci. ffo mutants have specific defects in floral organ separation and/or positioning; thus, the FFO genes identify components of a boundary formation mechanism(s) acting between developing floral organ primordia. FFO1 and FFO3 have specific functions in cauline leaf/stem separation and in first- and third-whorl floral organ separation, with FFO3 likely acting to establish and FFO1 to maintain floral organ boundaries. FFO2 acts at early floral stages to regulate floral organ number and positioning and to control organ separation within and between whorls. Plants doubly mutant for two ffo alleles display additive phenotypes, indicating that the FFO genes may act in separate pathways. Plants doubly mutant for an ffo gene and for ufo, lfy, or clv3 reveal that the FFO genes play roles related to those of UFO and LFY in floral meristem initiation and that FFO2 and FFO3 may act to control cell proliferation late in inflorescence development.

  5. In silico analysis and DHPLC screening strategy identifies novel apoptotic gene targets of aberrant promoter hypermethylation in prostate cancer.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2011-01-01

    Aberrant DNA methylation has been implicated as a key survival mechanism in cancer, whereby promoter hypermethylation silences genes essential for many cellular processes including apoptosis. Limited data is available on the methylation profile of apoptotic genes in prostate cancer (CaP). The aim of this study was to profile methylation of apoptotic-related genes in CaP using denaturing high performance liquid chromatography (DHPLC).

  6. Perturbation studies on KAHTER

    Energy Technology Data Exchange (ETDEWEB)

    Rueckert, M.; Jonas, H.; Neef, R. D.

    1974-10-15

    The paper describes experimental and analytical results by both transport theory and diffusion theory calculations of perturbation tests in the KAHTER pebble bed critical experiment. The fission-weighted adjoint flux is measured from in-core detector responses by introducing a Cf-source into the core. Adjoint-weighted reactivities are calculated and compared to reactivity measurements for the introduction of a fuel and graphite pebble onto the top of the critical pile, the central rod worth, and the effect of replacing B4C with varying amounts of HfC in the central rod. In addition, analytical studies were made of the sensitivity of criticality to the fuel to graphite pebble ratio as measured in tests and of the effect of the upper void cavity as simulated in tests by placing cadmium layer across the top of the pebble pile to force a zero flux boundary condition.

  7. Introduction to perturbation methods

    CERN Document Server

    Holmes, M

    1995-01-01

    This book is an introductory graduate text dealing with many of the perturbation methods currently used by applied mathematicians, scientists, and engineers. The author has based his book on a graduate course he has taught several times over the last ten years to students in applied mathematics, engineering sciences, and physics. The only prerequisite for the course is a background in differential equations. Each chapter begins with an introductory development involving ordinary differential equations. The book covers traditional topics, such as boundary layers and multiple scales. However, it also contains material arising from current research interest. This includes homogenization, slender body theory, symbolic computing, and discrete equations. One of the more important features of this book is contained in the exercises. Many are derived from problems of up- to-date research and are from a wide range of application areas.

  8. Perturbation theory with instantons

    International Nuclear Information System (INIS)

    Carruthers, P.; Pinsky, S.S.; Zachariasen, F.

    1977-05-01

    ''Perturbation theory'' rules are developed for calculating the effect of instantons in a pure Yang-Mills theory with no fermions, in the ''dilute gas'' approximation in which the N-instanton solution is assumed to be the sum of N widely separated one-instanton solutions. These rules are then used to compute the gluon propagator and proper vertex function including all orders of the instanton interaction but only to lowest order in the gluon coupling. It is to be expected that such an approximation is valid only for momenta q larger than the physical mass μ. The result is that in this regime instantons cause variations in the propagator and vertex of the form (μ 2 /q 2 )/sup -8π 2 b/ where b is the coefficient in the expansion of the β function: β = bg 3 +...

  9. A FRET-based high throughput screening assay to identify inhibitors of anthrax protective antigen binding to capillary morphogenesis gene 2 protein.

    Directory of Open Access Journals (Sweden)

    Michael S Rogers

    Full Text Available Anti-angiogenic therapies are effective for the treatment of cancer, a variety of ocular diseases, and have potential benefits in cardiovascular disease, arthritis, and psoriasis. We have previously shown that anthrax protective antigen (PA, a non-pathogenic component of anthrax toxin, is an inhibitor of angiogenesis, apparently as a result of interaction with the cell surface receptors capillary morphogenesis gene 2 (CMG2 protein and tumor endothelial marker 8 (TEM8. Hence, molecules that bind the anthrax toxin receptors may be effective to slow or halt pathological vascular growth. Here we describe development and testing of an effective homogeneous steady-state fluorescence resonance energy transfer (FRET high throughput screening assay designed to identify molecules that inhibit binding of PA to CMG2. Molecules identified in the screen can serve as potential lead compounds for the development of anti-angiogenic and anti-anthrax therapies. The assay to screen for inhibitors of this protein-protein interaction is sensitive and robust, with observed Z' values as high as 0.92. Preliminary screens conducted with a library of known bioactive compounds identified tannic acid and cisplatin as inhibitors of the PA-CMG2 interaction. We have confirmed that tannic acid both binds CMG2 and has anti-endothelial properties. In contrast, cisplatin appears to inhibit PA-CMG2 interaction by binding both PA and CMG2, and observed cisplatin anti-angiogenic effects are not mediated by interaction with CMG2. This work represents the first reported high throughput screening assay targeting CMG2 to identify possible inhibitors of both angiogenesis and anthrax intoxication.

  10. Analysis of mammalian gene function through broad-based phenotypic screens across a consortium of mouse clinics

    DEFF Research Database (Denmark)

    de Angelis, Martin Hrabě; Nicholson, George; Selloum, Mohammed

    2015-01-01

    The function of the majority of genes in the mouse and human genomes remains unknown. The mouse embryonic stem cell knockout resource provides a basis for the characterization of relationships between genes and phenotypes. The EUMODIC consortium developed and validated robust methodologies...

  11. Singular perturbation of simple eigenvalues

    International Nuclear Information System (INIS)

    Greenlee, W.M.

    1976-01-01

    Two operator theoretic theorems which generalize those of asymptotic regular perturbation theory and which apply to singular perturbation problems are proved. Application of these theorems to concrete problems is involved, but the perturbation expansions for eigenvalues and eigenvectors are developed in terms of solutions of linear operator equations. The method of correctors, as well as traditional boundary layer techniques, can be used to apply these theorems. The current formulation should be applicable to highly singular ''hard core'' potential perturbations of the radial equation of quantum mechanics. The theorems are applied to a comparatively simple model problem whose analysis is basic to that of the quantum mechanical problem

  12. Screening for Genes Coding for Putative Antitumor Compounds, Antimicrobial and Enzymatic Activities from Haloalkalitolerant and Haloalkaliphilic Bacteria Strains of Algerian Sahara Soils

    Directory of Open Access Journals (Sweden)

    Okba Selama

    2014-01-01

    Full Text Available Extreme environments may often contain unusual bacterial groups whose physiology is distinct from those of normal environments. To satisfy the need for new bioactive pharmaceuticals compounds and enzymes, we report here the isolation of novel bacteria from an extreme environment. Thirteen selected haloalkalitolerant and haloalkaliphilic bacteria were isolated from Algerian Sahara Desert soils. These isolates were screened for the presence of genes coding for putative antitumor compounds using PCR based methods. Enzymatic, antibacterial, and antifungal activities were determined by using cultural dependant methods. Several of these isolates are typical of desert and alkaline saline soils, but, in addition, we report for the first time the presence of a potential new member of the genus Nocardia with particular activity against the yeast Saccharomyces cerevisiae. In addition to their haloalkali character, the presence of genes coding for putative antitumor compounds, combined with the antimicrobial activity against a broad range of indicator strains and their enzymatic potential, makes them suitable for biotechnology applications.

  13. Genome-wide screening of the genes required for tolerance to vanillin, which is a potential inhibitor of bioethanol fermentation, in Saccharomyces cerevisiae.

    Science.gov (United States)

    Endo, Ayako; Nakamura, Toshihide; Ando, Akira; Tokuyasu, Ken; Shima, Jun

    2008-04-15

    Lignocellulosic materials are abundant and among the most important potential sources for bioethanol production. Although the pretreatment of lignocellulose is necessary for efficient saccharification and fermentation, numerous by-products, including furan derivatives, weak acids, and phenolic compounds, are generated in the pretreatment step. Many of these components inhibit the growth and fermentation of yeast. In particular, vanillin is one of the most effective inhibitors in lignocellulose hydrolysates because it inhibits fermentation at very low concentrations. To identify the genes required for tolerance to vanillin, we screened a set of diploid yeast deletion mutants, which are powerful tools for clarifying the function of particular genes. Seventy-six deletion mutants were identified as vanillin-sensitive mutants. The numerous deleted genes in the vanillin-sensitive mutants were classified under the functional categories for 'chromatin remodeling' and 'vesicle transport', suggesting that these functions are important for vanillin tolerance. The cross-sensitivity of the vanillin-sensitive mutants to furan derivatives, weak acids, and phenolic compounds was also examined. Genes for ergosterol biosynthesis were required for tolerance to all inhibitory compounds tested, suggesting that ergosterol is a key component of tolerance to various inhibitors. Our analysis predicts that vanillin tolerance in Saccharomyces cerevisiae is affected by various complicated processes that take place on both the molecular and the cellular level. In addition, the ergosterol biosynthetic process is important for achieving a tolerance to various inhibitors. Our findings provide a biotechnological basis for the molecular engineering as well as for screening of more robust yeast strains that may potentially be useful in bioethanol fermentation.

  14. Genome-wide screening of the genes required for tolerance to vanillin, which is a potential inhibitor of bioethanol fermentation, in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Tokuyasu Ken

    2008-04-01

    Full Text Available Abstract Background Lignocellulosic materials are abundant and among the most important potential sources for bioethanol production. Although the pretreatment of lignocellulose is necessary for efficient saccharification and fermentation, numerous by-products, including furan derivatives, weak acids, and phenolic compounds, are generated in the pretreatment step. Many of these components inhibit the growth and fermentation of yeast. In particular, vanillin is one of the most effective inhibitors in lignocellulose hydrolysates because it inhibits fermentation at very low concentrations. To identify the genes required for tolerance to vanillin, we screened a set of diploid yeast deletion mutants, which are powerful tools for clarifying the function of particular genes. Results Seventy-six deletion mutants were identified as vanillin-sensitive mutants. The numerous deleted genes in the vanillin-sensitive mutants were classified under the functional categories for 'chromatin remodeling' and 'vesicle transport', suggesting that these functions are important for vanillin tolerance. The cross-sensitivity of the vanillin-sensitive mutants to furan derivatives, weak acids, and phenolic compounds was also examined. Genes for ergosterol biosynthesis were required for tolerance to all inhibitory compounds tested, suggesting that ergosterol is a key component of tolerance to various inhibitors. Conclusion Our analysis predicts that vanillin tolerance in Saccharomyces cerevisiae is affected by various complicated processes that take place on both the molecular and the cellular level. In addition, the ergosterol biosynthetic process is important for achieving a tolerance to various inhibitors. Our findings provide a biotechnological basis for the molecular engineering as well as for screening of more robust yeast strains that may potentially be useful in bioethanol fermentation.

  15. Screening of the DNA mismatch repair genes MLH1, MSH2 and MSH6 in a Greek cohort of Lynch syndrome suspected families

    International Nuclear Information System (INIS)

    Thodi, Georgia; Fountzilas, George; Yannoukakos, Drakoulis; Fostira, Florentia; Sandaltzopoulos, Raphael; Nasioulas, George; Grivas, Anastasios; Boukovinas, Ioannis; Mylonaki, Maria; Panopoulos, Christos; Magic, Mirjana Brankovic

    2010-01-01

    Germline mutations in the DNA mismatch repair genes predispose to Lynch syndrome, thus conferring a high relative risk of colorectal and endometrial cancer. The MLH1, MSH2 and MSH6 mutational spectrum reported so far involves minor alterations scattered throughout their coding regions as well as large genomic rearrangements. Therefore, a combination of complete sequencing and a specialized technique for the detection of genomic rearrangements should be conducted during a proper DNA-testing procedure. Our main goal was to successfully identify Lynch syndrome families and determine the spectrum of MLH1, MSH2 and MSH6 mutations in Greek Lynch families in order to develop an efficient screening protocol for the Greek colorectal cancer patients' cohort. Forty-two samples from twenty-four families, out of which twenty two of Greek, one of Cypriot and one of Serbian origin, were screened for the presence of germline mutations in the major mismatch repair genes through direct sequencing and MLPA. Families were selected upon Amsterdam criteria or revised Bethesda guidelines. Ten deleterious alterations were detected in twelve out of the twenty-four families subjected to genetic testing, thus our detection rate is 50%. Four of the pathogenic point mutations, namely two nonsense, one missense and one splice site change, are novel, whereas the detected genomic deletion encompassing exon 6 of the MLH1 gene has been described repeatedly in the LOVD database. The average age of onset for the development of both colorectal and endometrial cancer among mutation positive families is 43.2 years. The mutational spectrum of the MMR genes investigated as it has been shaped by our analysis is quite heterogeneous without any strong indication for the presence of a founder effect

  16. Impact of gene patents and licensing practices on access to genetic testing and carrier screening for Tay-Sachs and Canavan disease.

    Science.gov (United States)

    Colaianni, Alessandra; Chandrasekharan, Subhashini; Cook-Deegan, Robert

    2010-04-01

    Genetic testing for Tay-Sachs and Canavan disease is particularly important for Ashkenazi Jews, because both conditions are more frequent in that population. This comparative case study was possible because of different patenting and licensing practices. The role of DNA testing differs between Tay-Sachs and Canavan diseases. The first-line screening test for Tay-Sachs remains an enzyme activity test rather than genotyping. Genotyping is used for preimplantation diagnosis and confirmatory testing. In contrast, DNA-based testing is the basis for Canavan screening and diagnosis. The HEXA gene for Tay-Sachs was cloned at the National Institutes of Health, and the gene was patented but has not been licensed. The ASPA gene for Canavan disease was cloned and patented by Miami Children's Hospital. Miami Children's Hospital did not inform family members and patient groups that had contributed to the gene discovery that it was applying for a patent, and pursued restrictive licensing practices when a patent issued in 1997. This led to intense controversy, litigation, and a sealed, nonpublic 2003 settlement that apparently allowed for nonexclusive licensing. A survey of laboratories revealed a possible price premium for ASPA testing, with per-unit costs higher than for other genetic tests in the Secretary's Advisory Committee on Genetics, Health, and Society case studies. The main conclusion from comparing genetic testing for Tay-Sachs and Canavan diseases, however, is that patenting and licensing conducted without communication with patients and advocates cause mistrust and can lead to controversy and litigation, a negative model to contrast with the positive model of patenting and licensing for genetic testing of cystic fibrosis.

  17. University of Texas Southwestern Medical Center (UTSW): Functional Signature Ontology Tool: Triplicate Measurements of Reporter Gene Expression in Response to Individual Genetic and Chemical Perturbations in HCT116 Cells | Office of Cancer Genomics

    Science.gov (United States)

    The goal of this project is to use an eight-gene expression profile to define functional signatures for small molecules and natural products with heretofore undefined mechanism of action. Two genes in the eight gene set are used as internal controls and do not vary across gene expression array data collected from the public domain. The remaining six genes are found to vary independently across a large collection of publically available gene expression array datasets.  Read the abstract

  18. University of Texas Southwestern Medical Center: Functional Signature Ontology Tool: Triplicate Measurements of Reporter Gene Expression in Response to Individual Genetic and Chemical Perturbations in HCT116 Cells | Office of Cancer Genomics

    Science.gov (United States)

    The goal of this project is to use an eight-gene expression profile to define functional signatures for small molecules and natural products with heretofore undefined mechanism of action. Two genes in the eight gene set are used as internal controls and do not vary across gene expression array data collected from the public domain. The remaining six genes are found to vary independently across a large collection of publically available gene expression array datasets.  Read the abstract

  19. A Genomewide Screen for Tolerance to Cationic Drugs Reveals Genes Important for Potassium Homeostasis in Saccharomyces cerevisiae

    Czech Academy of Sciences Publication Activity Database

    Barreto, L.; Canadell, D.; Petrezsélyová, Silvia; Navarrete, C.; Marešová, Lydie; Peréz-Valle, J.; Herrera, R.; Olier, I.; Giraldo, J.; Sychrová, Hana; Yenush, L.; Ramos, J.; Ariňo, J.

    2011-01-01

    Roč. 10, č. 9 (2011), s. 1241-1250 ISSN 1535-9778 R&D Projects: GA MŠk(CZ) LC531; GA AV ČR(CZ) IAA500110801 Institutional research plan: CEZ:AV0Z50110509 Keywords : Potassium homeostasis * Saccharomyces cerevisiae * genomewide screen Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.604, year: 2011

  20. A screen of a large Czech cohort of oligodontia patients implicates a novel mutation in the PAX9 gene

    Czech Academy of Sciences Publication Activity Database

    Šerý, Omar; Bonczek, Ondřej; Hloušková, A.; Černochová, P.; Vaněk, J.; Míšek, Ivan; Krejčí, J.; Izakovičová Hollá, L.

    2015-01-01

    Roč. 123, č. 2 (2015), s. 65-71 ISSN 0909-8836 R&D Projects: GA ČR GB14-37368G; GA MZd(CZ) NT11420 Institutional support: RVO:67985904 Keywords : monozygotic twins * mutation screening * oligodontia Subject RIV: FF - HEENT, Dentistry Impact factor: 1.607, year: 2015

  1. Genomics-based screening of differentially expressed genes in the brains of mice exposed to silver nanoparticles via inhalation

    International Nuclear Information System (INIS)

    Lee, Hye-Young; Choi, You-Jin; Jung, Eun-Jung; Yin, Hu-Quan; Kwon, Jung-Taek; Kim, Ji-Eun; Im, Hwang-Tae; Cho, Myung-Haing; Kim, Ju-Han; Kim, Hyun-Young; Lee, Byung-Hoon

    2010-01-01

    Silver nanoparticles (AgNP) are among the fastest growing product categories in the nanotechnology industry. Despite the importance of AgNP in consumer products and clinical applications, relatively little is known regarding AgNP toxicity and its associated risks. We investigated the effects of AgNP on gene expression in the mouse brain using Affymetrix Mouse Genome Arrays. C57BL/6 mice were exposed to AgNP (geometric mean diameter, 22.18 ± 1.72 nm; 1.91 x 10 7 particles/cm 3 ) for 6 h/day, 5 days/week using the nose-only exposure system for 2 weeks. Total RNA isolated from the cerebrum and cerebellum was subjected to hybridization. From over 39,000 probe sets, 468 genes in the cerebrum and 952 genes in the cerebellum were identified as AgNP-responsive (one-way analysis of variance; p < 0.05). The largest groups of gene products affected by AgNP exposure included 73 genes in the cerebrum and 144 genes in the cerebellum. AgNP exposure modulated the expression of several genes associated with motor neuron disorders, neurodegenerative disease, and immune cell function, indicating potential neurotoxicity and immunotoxicity associated with AgNP exposure. Real-time PCR data for five genes analyzed from whole blood showed good correlation with the observed changes in the brain. Following rigorous validation and substantiation, these genes may assist in the development of surrogate markers for AgNP exposure and/or toxicity.

  2. Genomics-based screening of differentially expressed genes in the brains of mice exposed to silver nanoparticles via inhalation

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hye-Young; Choi, You-Jin; Jung, Eun-Jung; Yin, Hu-Quan [Seoul National University, College of Pharmacy and Research Institute of Pharmaceutical Sciences (Korea, Republic of); Kwon, Jung-Taek; Kim, Ji-Eun; Im, Hwang-Tae; Cho, Myung-Haing [Seoul National University, College of Veterinary Medicine (Korea, Republic of); Kim, Ju-Han [Seoul National University, College of Medicine (Korea, Republic of); Kim, Hyun-Young [Occupational Safety and Health Research Institute, Chemical Safety and Health Research Center (Korea, Republic of); Lee, Byung-Hoon, E-mail: lee@snu.ac.k [Seoul National University, College of Pharmacy and Research Institute of Pharmaceutical Sciences (Korea, Republic of)

    2010-06-15

    Silver nanoparticles (AgNP) are among the fastest growing product categories in the nanotechnology industry. Despite the importance of AgNP in consumer products and clinical applications, relatively little is known regarding AgNP toxicity and its associated risks. We investigated the effects of AgNP on gene expression in the mouse brain using Affymetrix Mouse Genome Arrays. C57BL/6 mice were exposed to AgNP (geometric mean diameter, 22.18 {+-} 1.72 nm; 1.91 x 10{sup 7} particles/cm{sup 3}) for 6 h/day, 5 days/week using the nose-only exposure system for 2 weeks. Total RNA isolated from the cerebrum and cerebellum was subjected to hybridization. From over 39,000 probe sets, 468 genes in the cerebrum and 952 genes in the cerebellum were identified as AgNP-responsive (one-way analysis of variance; p < 0.05). The largest groups of gene products affected by AgNP exposure included 73 genes in the cerebrum and 144 genes in the cerebellum. AgNP exposure modulated the expression of several genes associated with motor neuron disorders, neurodegenerative disease, and immune cell function, indicating potential neurotoxicity and immunotoxicity associated with AgNP exposure. Real-time PCR data for five genes analyzed from whole blood showed good correlation with the observed changes in the brain. Following rigorous validation and substantiation, these genes may assist in the development of surrogate markers for AgNP exposure and/or toxicity.

  3. Isolating genes involved with genotoxic drug response in the nematode Caenorhabditis elegans using genome-wide RNAi screening

    DEFF Research Database (Denmark)

    Schøler, Lone Vedel; Møller, Tine Hørning; Nørgaard, Steffen

    2012-01-01

    The soil nematode Caenorhabditis elegans has become a popular genetic model organism used to study a broad range of complex biological processes, including development, aging, apoptosis, and DNA damage responses. Many genetic tools and tricks have been developed in C. elegans including knock down...... of gene expression via RNA interference (RNAi). In C. elegans RNAi can effectively be administrated via feeding the nematodes bacteria expressing double-stranded RNA targeting the gene of interest. Several commercial C. elegans RNAi libraries are available and hence gene inactivation using RNAi can...

  4. Screening a novel Na+/H+ antiporter gene from a metagenomic library of halophiles colonizing in the Dagong Ancient Brine Well in China.

    Science.gov (United States)

    Xiang, Wenliang; Zhang, Jie; Li, Lin; Liang, Huazhong; Luo, Hai; Zhao, Jian; Yang, Zhirong; Sun, Qun

    2010-05-01

    Metagenomic DNA libraries constructed from the Dagong Ancient Brine Well were screened for genes with Na(+)/H(+) antiporter activity on the antiporter-deficient Escherichia coli KNabc strain. One clone with a stable Na(+)-resistant phenotype was obtained and its Na(+)/H(+) antiporter gene was sequenced and designated as m-nha. The deduced amino acid sequence of M-Nha protein consists of 523 residues with a calculated molecular weight of 58 147 Da and a pI of 5.50, which is homologous with NhaH from Halobacillus dabanensis D-8(T) (92%) and Halobacillus aidingensis AD-6(T) (86%), and with Nhe2 from Bacillus sp. NRRL B-14911 (64%). It had a hydropathy profile with 10 putative transmembrane domains and a long carboxyl terminal hydrophilic tail of 140 amino acid residues, similar to Nhap from Synechocystis sp. and Aphanothece halophytica, as well as NhaG from Bacillus subtilis. The m-nha gene in the antiporter-negative mutant E. coli KNabc conferred resistance to Na(+) and the ability to grow under alkaline conditions. The difference in amino acid sequence and the putative secondary structure suggested that the m-nha isolated from the Dagong Ancient Brine Well in this study was a novel Na(+)/H(+) antiporter gene.

  5. High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

    Science.gov (United States)

    Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

    2018-01-02

    Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and

  6. Chiral perturbation theory

    International Nuclear Information System (INIS)

    Harada, Masayasu

    2009-01-01

    Chiral perturbation theory has been used for great number of phenomenological analyses in low energy QCD as well as the lattice QCD analyses since the creation of the theory by Weinberg in 1979 followed by its consolidation by Gasser and Leutwyler in 1984 and 85. The theory is now the highly established one as the approach based on the effective field theory to search for Green function including quantum correlations in the frame of the systematic expansion technique using Lagrangian which includes all of the terms allowed by the symmetry. This review has been intended to describe how systematically physical quantities are calculated in the framework of the chiral symmetry. Consequently many of the various phenomenological analyses are not taken up here for which other reports are to be referred. Further views are foreseen to be developed based on the theory in addition to numbers of results reported up to the present. Finally π-π scattering is taken up to discuss to what energy scale the theory is available. (S. Funahashi)

  7. Perturbed angular correlation

    International Nuclear Information System (INIS)

    Fabris, J.D.

    1977-01-01

    The electric quadrupolar interaction in some hafnium complexes, measured at the metal nucleus level is studied. For that purpose, the technique of γ-γ perturbed angular correlation is used: the frequencies of quadrupolar interaction are compared with some hafnium α-hydroxicarboxilates, namely glycolate, lactate, mandelate and benzylate; the influence of the temperature on the quadrupolar coupling on the hafnium tetramandelate is studied; finally, the effects associated with the capture of thermal neutrons by hafnium tetramandelate are examined locally at the nuclear level. The first group of results shows significant differences in a series of complexes derived from glycolic acid. On the other hand, the substitution of the protons in hafnium tetramandelate structure by some alkaline cations permits to verify a correlation between the variations in the quadrupolar coupling and the electronegativities of the substituent elements. Measurements at high temperatures show that this complex is thermally stable at 100 and 150 0 C. It is possible to see the appearance of two distinct sites for the probe nucleus, after heating the sample at 100 0 C for prolonged time. This fact is attributed to a probable interconversion among the postulated structural isomers for the octacoordinated compounds. Finally, measurements of angular correlation on the irradiated complex show that there is an effective destruction of the target molecule by neutron capture [pt

  8. Perturbative quantum chromodynamics

    International Nuclear Information System (INIS)

    Brodsky, S.J.

    1979-12-01

    The application of QCD to hadron dynamics at short distances, where asymptotic freedom allows a systematic perturbative approach, is addressed. The main theme of the approach is to incorporate systematically the effects of the hadronic wave function in large momentum transfer exclusive and inclusive reactions. Although it is conventional to treat the hadron as a classical source of on-shell quarks, there are important dynamical effects due to hadronic constituent structure which lead to a broader testing ground for QCD. QCD predictions are discussed for exclusive processes and form factors at large momentum transfer in which the short-distance behavior and the finite compositeness of the hadronic wave functions play crucial roles. Many of the standard tests of QCD are reviewed including the predictions for R = sigma/sub e + e - →had//sigma/sub e + e - →μ + μ - /, the structure functions of hadrons and photons, jet phenomena, and the QCD corrections to deep inelastic processes. The exclusive-inclusive connection in QCD, the effects of power-law scale-breaking contributions, and the important role of the available energy in controlling logarithmic scale violations are also discussed. 150 references, 44 figures

  9. Analysis of mammalian gene function through broad-based phenotypic screens across a consortium of mouse clinics.

    Science.gov (United States)

    de Angelis, Martin Hrabě; Nicholson, George; Selloum, Mohammed; White, Jacqui; Morgan, Hugh; Ramirez-Solis, Ramiro; Sorg, Tania; Wells, Sara; Fuchs, Helmut; Fray, Martin; Adams, David J; Adams, Niels C; Adler, Thure; Aguilar-Pimentel, Antonio; Ali-Hadji, Dalila; Amann, Gregory; André, Philippe; Atkins, Sarah; Auburtin, Aurelie; Ayadi, Abdel; Becker, Julien; Becker, Lore; Bedu, Elodie; Bekeredjian, Raffi; Birling, Marie-Christine; Blake, Andrew; Bottomley, Joanna; Bowl, Mike; Brault, Véronique; Busch, Dirk H; Bussell, James N; Calzada-Wack, Julia; Cater, Heather; Champy, Marie-France; Charles, Philippe; Chevalier, Claire; Chiani, Francesco; Codner, Gemma F; Combe, Roy; Cox, Roger; Dalloneau, Emilie; Dierich, André; Di Fenza, Armida; Doe, Brendan; Duchon, Arnaud; Eickelberg, Oliver; Esapa, Chris T; El Fertak, Lahcen; Feigel, Tanja; Emelyanova, Irina; Estabel, Jeanne; Favor, Jack; Flenniken, Ann; Gambadoro, Alessia; Garrett, Lilian; Gates, Hilary; Gerdin, Anna-Karin; Gkoutos, George; Greenaway, Simon; Glasl, Lisa; Goetz, Patrice; Da Cruz, Isabelle Goncalves; Götz, Alexander; Graw, Jochen; Guimond, Alain; Hans, Wolfgang; Hicks, Geoff; Hölter, Sabine M; Höfler, Heinz; Hancock, John M; Hoehndorf, Robert; Hough, Tertius; Houghton, Richard; Hurt, Anja; Ivandic, Boris; Jacobs, Hughes; Jacquot, Sylvie; Jones, Nora; Karp, Natasha A; Katus, Hugo A; Kitchen, Sharon; Klein-Rodewald, Tanja; Klingenspor, Martin; Klopstock, Thomas; Lalanne, Valerie; Leblanc, Sophie; Lengger, Christoph; le Marchand, Elise; Ludwig, Tonia; Lux, Aline; McKerlie, Colin; Maier, Holger; Mandel, Jean-Louis; Marschall, Susan; Mark, Manuel; Melvin, David G; Meziane, Hamid; Micklich, Kateryna; Mittelhauser, Christophe; Monassier, Laurent; Moulaert, David; Muller, Stéphanie; Naton, Beatrix; Neff, Frauke; Nolan, Patrick M; Nutter, Lauryl Mj; Ollert, Markus; Pavlovic, Guillaume; Pellegata, Natalia S; Peter, Emilie; Petit-Demoulière, Benoit; Pickard, Amanda; Podrini, Christine; Potter, Paul; Pouilly, Laurent; Puk, Oliver; Richardson, David; Rousseau, Stephane; Quintanilla-Fend, Leticia; Quwailid, Mohamed M; Racz, Ildiko; Rathkolb, Birgit; Riet, Fabrice; Rossant, Janet; Roux, Michel; Rozman, Jan; Ryder, Ed; Salisbury, Jennifer; Santos, Luis; Schäble, Karl-Heinz; Schiller, Evelyn; Schrewe, Anja; Schulz, Holger; Steinkamp, Ralf; Simon, Michelle; Stewart, Michelle; Stöger, Claudia; Stöger, Tobias; Sun, Minxuan; Sunter, David; Teboul, Lydia; Tilly, Isabelle; Tocchini-Valentini, Glauco P; Tost, Monica; Treise, Irina; Vasseur, Laurent; Velot, Emilie; Vogt-Weisenhorn, Daniela; Wagner, Christelle; Walling, Alison; Weber, Bruno; Wendling, Olivia; Westerberg, Henrik; Willershäuser, Monja; Wolf, Eckhard; Wolter, Anne; Wood, Joe; Wurst, Wolfgang; Yildirim, Ali Önder; Zeh, Ramona; Zimmer, Andreas; Zimprich, Annemarie; Holmes, Chris; Steel, Karen P; Herault, Yann; Gailus-Durner, Valérie; Mallon, Ann-Marie; Brown, Steve Dm

    2015-09-01

    The function of the majority of genes in the mouse and human genomes remains unknown. The mouse embryonic stem cell knockout resource provides a basis for the characterization of relationships between genes and phenotypes. The EUMODIC consortium developed and validated robust methodologies for the broad-based phenotyping of knockouts through a pipeline comprising 20 disease-oriented platforms. We developed new statistical methods for pipeline design and data analysis aimed at detecting reproducible phenotypes with high power. We acquired phenotype data from 449 mutant alleles, representing 320 unique genes, of which half had no previous functional annotation. We captured data from over 27,000 mice, finding that 83% of the mutant lines are phenodeviant, with 65% demonstrating pleiotropy. Surprisingly, we found significant differences in phenotype annotation according to zygosity. New phenotypes were uncovered for many genes with previously unknown function, providing a powerful basis for hypothesis generation and further investigation in diverse systems.

  10. To Screen Inactivation Mutation of Exon 1 of FSHR Gene in Polycystic Ovarian Syndrome: A South Indian Cohort Study

    Science.gov (United States)

    Sekar, Nishu; Yeole, Samiksha; Pradeep, Rashmi; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

    2017-11-01

    Polycystic ovary syndrome is an endocrine disorder. Irregular menstrual cycle, acne, facial hair and elevated androgen levels are the most common signs for PCOS. PCOS has an estimated prevalence of 4-12% among reproductive age women, thus making it a forerunner in female infertility. FSHR plays an important role in FSH signaling pathway making it an important gene for PCOS. In this study, we aim to focus on any association between the FSHR gene and PCOS. Our study was to evaluate any polymorphism of exon 1 of FSHR gene associated with PCOS.PCR-RFLP technique was performed on the PCOS samples. Hormonal changes were found in the patients. Exon 1 inactivation mutation of FSHR gene was not observed in the patient sample. A study of this association needs to be done using large sample size.

  11. Screening for large genomic rearrangements in the FANCA gene reveals extensive deletion in a Finnish breast cancer family.

    Science.gov (United States)

    Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri

    2011-03-28

    A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  12. An in vitro method for screening for the presence of thepat-2 gene in tomatoes (Lycopersicon esculentum Mill.).

    Science.gov (United States)

    Young, T E; Juvik, J A; Sullivan, J G; Skirvin, R M

    1990-01-01

    Under field conditions,pat-2, the gene which conditions parthenocarpy in tomatoes, is recessive. A simple method has been devised for distinguishing the heterozygote from the two homozygotes using tissue culture. Ovaries of plants segregating for thepat-2 gene were excised and cultured on a medium containing 100 ppm gibberellic acid. After three weeks in culture, three distinct ovary sizes could be seen. It was shown, using F 3 progeny tests, that the largest ovaries corresponded to those plants homozygous for thepat-2 gene, the smallest ovaries corresponded to those plants homozygous for the wild type allele, and the intermediate sized ovaries were the heterozygotes. The ability to identify the heterozygote would greatly simplify a backcross breeding program aimed at incorporating thepat-2 gene into commercial cultivars by eliminating the need for an F 3 progeny test to determine the genotype of a plant.

  13. Screening of lactic acid bacteria from Indonesia reveals glucansucrase and fructansucrase genes in two different Weissella confusa strains from soya

    NARCIS (Netherlands)

    Malik, Amarila; Radji, Maksum; Kralj, Slavko; Dijkhuizen, Lubbert

    2009-01-01

    Homopolysaccharide (glucan and fructan) synthesis from sucrose by sucrase enzymes in lactic acid bacteria (LAB) has been well studied in the genera Leuconostoc, Streptococcus and Lactobacillus. This study aimed to identify and characterize genes encoding glucansucrase/glucosyltransferase (GTF) and

  14. Screening of Oryza sativa L. for HptGene and Evaluation of Hpt Positive Samples Using Houba Retransposon-Based IRAP Markers

    Directory of Open Access Journals (Sweden)

    Gözde YÜZBAŞIOĞLU

    2017-02-01

    Full Text Available Increasing world population needs to enhance agricultural production because of food starvation. Genetically modified organism(GMOis a way to solve this problem. During gene transfers, DNA is inserted into a plant’s genome in a random way. Thisproducesspontaneous genetic changeswith movement of transposable elements, and even increasesvariations. Houbawas described as one of the active retrotransposonsin rice. The aim of this study was to screen rice samples collected from Turkey, and analyse Houba retrotransposon movements with IRAP technique intransgenic ones and their controls. For this purpose, 71 different rice seeds obtained from different regions of Turkey were used for GMO analysis.All samples were screened by real time PCR to test cauliflower mosaic virus (CaMV 35S promoter (P-35S regions, T-NOS (nopaline synthase terminator regions, figwort mosaic virus (FMV regions, bar, patand Cry1ab/ac,and hpt(hygromycin resistance genes. Hptgene was identified in 6samples as a result of real time PCR analysis. These 6transgenic samples with their controls were used for IRAP-PCRanalysisand 0-56% polymorphism ratios were observed in analysed samples. This study is one of the first detailed experimental data of transgenic Oryza sativaL. samples in terms of retrotransposon-based variation.

  15. Lattice regularized chiral perturbation theory

    International Nuclear Information System (INIS)

    Borasoy, Bugra; Lewis, Randy; Ouimet, Pierre-Philippe A.

    2004-01-01

    Chiral perturbation theory can be defined and regularized on a spacetime lattice. A few motivations are discussed here, and an explicit lattice Lagrangian is reviewed. A particular aspect of the connection between lattice chiral perturbation theory and lattice QCD is explored through a study of the Wess-Zumino-Witten term

  16. Perturbative QCD (1/3)

    CERN Multimedia

    CERN. Geneva

    2013-01-01

    Perturbative QCD is the general theoretical framework for describing hard scattering processes yielding multiparticle production at hadron colliders. In these lectures, we shall introduce fundamental features of perturbative QCD and describe its application to several high energy collider processes, including jet production in electron-positron annihilation, deep inelastic scattering, Higgs boson and gauge boson production at the LHC.

  17. Propagation of Ion Acoustic Perturbations

    DEFF Research Database (Denmark)

    Pécseli, Hans

    1975-01-01

    Equations describing the propagation of ion acoustic perturbations are considered, using the assumption that the electrons are Boltzman distributed and isothermal at all times. Quasi-neutrality is also considered.......Equations describing the propagation of ion acoustic perturbations are considered, using the assumption that the electrons are Boltzman distributed and isothermal at all times. Quasi-neutrality is also considered....

  18. On summation of perturbation expansions

    International Nuclear Information System (INIS)

    Horzela, A.

    1985-04-01

    The problem of the restoration of physical quantities defined by divergent perturbation expansions is analysed. The Pad'e and Borel summability is proved for alternating perturbation expansions with factorially growing coefficients. The proof is based on the methods of the classical moments theory. 17 refs. (author)

  19. Continual integral in perturbation theory

    International Nuclear Information System (INIS)

    Slavnov, A.A.

    1975-01-01

    It is shown that all results obtained by means of continual integration within the framework of perturbation theory are completely equivalent to those obtained by the usual diagram technique and are therfore just as rigorous. A rigorous justification is given for the rules for operating with continual integrals in perturbation theory. (author)

  20. Screening of B chromosomes for presence of two genes in yellow-necked mice, Apodemus flavicollis (Mammalia, Rodentia

    Directory of Open Access Journals (Sweden)

    Rajičić Marija

    2015-01-01

    Full Text Available B chromosomes (Bs are a very heterogeneous group of extra chromosomes. In various species Bs occur with different nucleotide sequences ranging from repetitive to protein coding. In yellow-necked field mice, Apodemus flavicollis Bs are small euchromatic chromosomes and untill now, only few molecular analyses have been conducted. In this study we examined A. flavicollis individuals with different number of Bs for presence of two genes, C-KIT and 18S rRNA. The C-KIT proto-oncogene was found on Bs in three Canidae species and one Cervidae species. This gene is a coding receptor critical for proliferation and cell differentiation of hematopoietic, melanoblast and primordial germ cells, and is highly conserved within mammals. While using semiquantitative PCR, we did not notice any difference in the C-KIT band intensity among animals with different number of Bs (0-3. The presence of only one copy of C- KIT gene was confirmed using real time-PCR on genomic DNA of A. flavicollis specimens with different number of Bs. rRNA genes in eukaryotes’ genome are organized like units of tandem repeated sequences. The units form distinct clusters on one to several chromosome pairs. rRNA genes were found on Bs in different species including two species of genus Apodemus. One particular sample with 2 Bs showed the number of 18S rRNA gene about three times that of the calibrator 0 B sample. This result can indicate the presence of 18S rRNA gene on Bs, but its confirmation requires the implementation of other methods. Still, we can neither confirm nor deny the existence of pseudogen of tested target genes, or lose of exon 1 of C-KIT protooncogen in Bs of A. flavicollis. Our findings are further discussed. [Projekat Ministarstva nauke Republike Srbije, br. 173003

  1. A SAGE-based screen for genes expressed in sub-populations of neurons in the mouse dorsal root ganglion

    Directory of Open Access Journals (Sweden)

    Garces Alain

    2007-11-01

    Full Text Available Abstract Background The different sensory modalities temperature, pain, touch and muscle proprioception are carried by somatosensory neurons of the dorsal root ganglia. Study of this system is hampered by the lack of molecular markers for many of these neuronal sub-types. In order to detect genes expressed in sub-populations of somatosensory neurons, gene profiling was carried out on wild-type and TrkA mutant neonatal dorsal root ganglia (DRG using SAGE (serial analysis of gene expression methodology. Thermo-nociceptors constitute up to 80 % of the neurons in the DRG. In TrkA mutant DRGs, the nociceptor sub-class of sensory neurons is lost due to absence of nerve growth factor survival signaling through its receptor TrkA. Thus, comparison of wild-type and TrkA mutants allows the identification of transcripts preferentially expressed in the nociceptor or mechano-proprioceptor subclasses, respectively. Results Our comparison revealed 240 genes differentially expressed between the two tissues (P Conclusion We have identified and characterized the detailed expression patterns of three genes in the developing DRG, placing them in the context of the known major neuronal sub-types defined by molecular markers. Further analysis of differentially expressed genes in this tissue promises to extend our knowledge of the molecular diversity of different cell types and forms the basis for understanding their particular functional specificities.

  2. Screening differentially expressed genes in an amphipod (Hyalella azteca) exposed to fungicide vinclozolin by suppression subtractive hybridization.

    Science.gov (United States)

    Wu, Yun H; Wu, Tsung M; Hong, Chwan Y; Wang, Yei S; Yen, Jui H

    2014-01-01

    Vinclozolin, a dicarboximide fungicide, is an endocrine disrupting chemical that competes with an androgenic endocrine disruptor compound. Most research has focused on the epigenetic effect of vinclozolin in humans. In terms of ecotoxicology, understanding the effect of vinclozolin on non-target organisms is important. The expression profile of a comprehensive set of genes in the amphipod Hyalella azteca exposed to vinclozolin was examined. The expressed sequence tags in low-dose vinclozolin-treated and -untreated amphipods were isolated and identified by suppression subtractive hybridization. DNA dot blotting was used to confirm the results and establish a subtracted cDNA library for comparing all differentially expressed sequences with and without vinclozolin treatment. In total, 494 differentially expressed genes, including hemocyanin, heatshock protein, cytochrome, cytochrome oxidase and NADH dehydrogenase were detected. Hemocyanin was the most abundant gene. DNA dot blotting revealed 55 genes with significant differential expression. These genes included larval serum protein 1 alpha, E3 ubiquitin-protein ligase, mitochondrial cytochrome c oxidase, mitochondrial protein, proteasome inhibitor, hemocyanin, zinc-finger-containing protein, mitochondrial NADH-ubiquinone oxidoreductase and epididymal sperm-binding protein. Vinclozolin appears to upregulate stress-related genes and hemocyanin, related to immunity. Moreover, vinclozolin downregulated NADH dehydrogenase, related to respiration. Thus, even a non-lethal concentration of vinclozolin still has an effect at the genetic level in H. azteca and presents a potential risk, especially as it would affect non-target organism hormone metabolism.

  3. On dark energy isocurvature perturbation

    International Nuclear Information System (INIS)

    Liu, Jie; Zhang, Xinmin; Li, Mingzhe

    2011-01-01

    Determining the equation of state of dark energy with astronomical observations is crucially important to understand the nature of dark energy. In performing a likelihood analysis of the data, especially of the cosmic microwave background and large scale structure data the dark energy perturbations have to be taken into account both for theoretical consistency and for numerical accuracy. Usually, one assumes in the global fitting analysis that the dark energy perturbations are adiabatic. In this paper, we study the dark energy isocurvature perturbation analytically and discuss its implications for the cosmic microwave background radiation and large scale structure. Furthermore, with the current astronomical observational data and by employing Markov Chain Monte Carlo method, we perform a global analysis of cosmological parameters assuming general initial conditions for the dark energy perturbations. The results show that the dark energy isocurvature perturbations are very weakly constrained and that purely adiabatic initial conditions are consistent with the data

  4. SCREENING FOR GENETIC CHANGES AND CODON 129 POLYMORPHISM IN PRNP GENE IN HEALTHY SLOVENIAN POPULATION AND SPORADIC CASES OF CREUTZFELDT-JAKOB DISEASE

    Directory of Open Access Journals (Sweden)

    Sava Smerkolj

    2004-11-01

    Full Text Available Background. Prion protein has an important role in development of prion diseases, fatal neurodegenerative disorders. As the codon 129 genotype of the prion protein gene (PRNP is a known susceptibility factor for the diseases, we wanted to determine its distribution in healthy Slovenian population and also in cases of sporadic Creutzfeldt-Jakob disease (sCJD. Furthermore, we wanted to screen the whole gene in order to establish the presence of genetic changes.Methods. We screened 350 DNA samples of healthy blood donors and 12 DNA samples of patients deceased of sCJD. After the amplification and conformation analysis had been done, the gene was sequenced using an automatic sequencer.Results. Methionine homozygotes comprised 46.8% of healthy population, valine homozygotes 12.1% and heterozygotes 41.1%; out of 12 sCJD patients 10 were methionine homozygotes (83.3%, 1 was valine homozygote (8.3% and 1 was heterozygote (8.3%.Found SNPs were combination of codon 76 change (228C > T and codon 84 change (252T > C in a single sample of healthy population, combination of codon 68 change (204T > C and codon 76 change (228C > T in two samples of healthy population and codon 117 change (351A > G in a healthy population sample and in a valine homozygote patient.Conclusions. In comparison to the pooled Caucasian population is genotype M/M frequency slightly increased on account of decreased genotype M/V frequency in healthy Slovenian population, suggesting a little higher risk for acquiring a new variant of CJD (vCJD, because up to date all confirmed vCJD cases except one heterozygote were methionine homozygotes. Codon 129 genotype distribution in sCJD can be described as disease-specific. The absence of pathogenic mutations in sCJD patients confirms the non-familial, sporadic disease form.

  5. Mutation Screening of the Krüppel-like Factor 1 Gene in Individuals With Increased Fetal Hemoglobin Referred for Hemoglobinopathy Investigation in South of Iran.

    Science.gov (United States)

    Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza

    2018-04-01

    Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (PC) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.

  6. Disformal transformation of cosmological perturbations

    Directory of Open Access Journals (Sweden)

    Masato Minamitsuji

    2014-10-01

    Full Text Available We investigate the gauge-invariant cosmological perturbations in the gravity and matter frames in the general scalar–tensor theory where two frames are related by the disformal transformation. The gravity and matter frames are the extensions of the Einstein and Jordan frames in the scalar–tensor theory where two frames are related by the conformal transformation, respectively. First, it is shown that the curvature perturbation in the comoving gauge to the scalar field is disformally invariant as well as conformally invariant, which gives the predictions from the cosmological model where the scalar field is responsible both for inflation and cosmological perturbations. Second, in case that the disformally coupled matter sector also contributes to curvature perturbations, we derive the evolution equations of the curvature perturbation in the uniform matter energy density gauge from the energy (nonconservation in the matter sector, which are independent of the choice of the gravity sector. While in the matter frame the curvature perturbation in the uniform matter energy density gauge is conserved on superhorizon scales for the vanishing nonadiabatic pressure, in the gravity frame it is not conserved even if the nonadiabatic pressure vanishes. The formula relating two frames gives the amplitude of the curvature perturbation in the matter frame, once it is evaluated in the gravity frame.

  7. Disformal transformation of cosmological perturbations

    International Nuclear Information System (INIS)

    Minamitsuji, Masato

    2014-01-01

    We investigate the gauge-invariant cosmological perturbations in the gravity and matter frames in the general scalar–tensor theory where two frames are related by the disformal transformation. The gravity and matter frames are the extensions of the Einstein and Jordan frames in the scalar–tensor theory where two frames are related by the conformal transformation, respectively. First, it is shown that the curvature perturbation in the comoving gauge to the scalar field is disformally invariant as well as conformally invariant, which gives the predictions from the cosmological model where the scalar field is responsible both for inflation and cosmological perturbations. Second, in case that the disformally coupled matter sector also contributes to curvature perturbations, we derive the evolution equations of the curvature perturbation in the uniform matter energy density gauge from the energy (non)conservation in the matter sector, which are independent of the choice of the gravity sector. While in the matter frame the curvature perturbation in the uniform matter energy density gauge is conserved on superhorizon scales for the vanishing nonadiabatic pressure, in the gravity frame it is not conserved even if the nonadiabatic pressure vanishes. The formula relating two frames gives the amplitude of the curvature perturbation in the matter frame, once it is evaluated in the gravity frame

  8. Polymorphism screening and haplotype analysis of the tryptophan hydroxylase gene (TPH1 and association with bipolar affective disorder in Taiwan

    Directory of Open Access Journals (Sweden)

    Lin Yi-Mei J

    2005-03-01

    Full Text Available Abstract Background Disturbances in serotonin neurotransmission are implicated in the etiology of many psychiatric disorders, including bipolar affective disorder (BPD. The tryptophan hydroxylase gene (TPH, which codes for the enzyme catalyzing the rate-limiting step in serotonin biosynthetic pathway, is one of the leading candidate genes for psychiatric and behavioral disorders. In a preliminary study, we found that TPH1 intron7 A218C polymorphism was associated with BPD. This study was designed to investigate sequence variants of the TPH1 gene in Taiwanese and to test whether the TPH1 gene is a susceptibility factor for the BPD. Methods Using a systematic approach, we have searched the exons and promoter region of the TPH1 gene for sequence variants in Taiwanese Han and have identified five variants, A-1067G, G-347T, T3804A, C27224T, and A27237G. These five variants plus another five taken from the literature and a public database were examined for an association in 108 BPD patients and 103 controls; no association was detected for any of the 10 variants. Results Haplotype constructions using these 10 SNPs showed that the 3 most common haplotypes in both patients and controls were identical. One of the fourth common haplotype in the patient group (i.e. GGGAGACCCA was unique and showed a trend of significance with the disease (P = 0.028. However, the significance was abolished after Bonferroni correction thus suggesting the association is weak. In addition, three haplotype-tagged SNPs (htSNPs were selected to represent all haplotypes with frequencies larger than 2% in the Taiwanese Han population. The defined TPH1 htSNPs significantly reduce the marker number for haplotype analysis thus provides useful information for future association studies in our population. Conclusion Results of this study did not support the role of TPH1 gene in BPD etiology. As the current studies found the TPH1 gene under investigation belongs to the peripheral

  9. Depression Screening

    Science.gov (United States)

    ... Depression Screening Substance Abuse Screening Alcohol Use Screening Depression Screening (PHQ-9) - Instructions The following questions are ... this tool, there is also text-only version . Depression Screening - Manual Instructions The following questions are a ...

  10. Proof of the concept to use a malignant B cell line drug screen strategy for identification and weight of melphalan resistance genes in multiple myeloma.

    Directory of Open Access Journals (Sweden)

    Martin Bøgsted

    Full Text Available In a conceptual study of drug resistance we have used a preclinical model of malignant B-cell lines by combining drug induced growth inhibition and gene expression profiling. In the current report a melphalan resistance profile of 19 genes were weighted by microarray data from the MRC Myeloma IX trial and time to progression following high dose melphalan, to generate an individual melphalan resistance index. The resistance index was subsequently validated in the HOVON65/GMMG-HD4 trial data set to prove the concept. Biologically, the assigned resistance indices were differentially distributed among translocations and cyclin D expression classes. Clinically, the 25% most melphalan resistant, the intermediate 50% and the 25% most sensitive patients had a median progression free survival of 18, 32 and 28 months, respectively (log-rank P-value  = 0.05. Furthermore, the median overall survival was 45 months for the resistant group and not reached for the intermediate and sensitive groups (log-rank P-value  = 0.003 following 38 months median observation. In a multivariate analysis, correcting for age, sex and ISS-staging, we found a high resistance index to be an independent variable associated with inferior progression free survival and overall survival. This study provides clinical proof of concept to use in vitro drug screen for identification of melphalan resistance gene signatures for future functional analysis.

  11. Molecular screening of the ghrelin gene in Italian obese children: the Leu72Met variant is associated with an earlier onset of obesity.

    Science.gov (United States)

    Miraglia del Giudice, E; Santoro, N; Cirillo, G; Raimondo, P; Grandone, A; D'Aniello, A; Di Nardo, M; Perrone, L

    2004-03-01

    To test whether ghrelin variants could play a role in modulating some aspects of the obese phenotype during childhood. We screened the ghrelin gene in 300 Italian obese children and adolescents (mean age 10.5+/-3.2 y; range 4-19 y) and 200 controls by using the single-strand conformation polymorphism and the restriction fragment length polymoprhism analysis. No mutations were detected with the exception of two previously described polymorphisms, Arg51Gln and Leu72Met. For both variations, allelic frequencies were similar between patients and controls. Interestingly, we showed that the Leu72Met polymorphism was associated with differences in the age at obesity onset. Patients with the Met72 allele became obese earlier than homozygous patients for the wild Leu72 allele. The logrank test comparing the plots of the complement of Kaplan-Meier estimates between the two groups of patients was statistically significant (Pghrelin variations cause the obesity due to single-gene mutations. The Leu72Met polymorphism of the ghrelin gene seems to play a role in anticipating the onset of obesity among children suggesting, therefore, that ghrelin may be involved in the pathophysiology of human adiposity.

  12. Cosmological perturbations beyond linear order

    CERN Multimedia

    CERN. Geneva

    2013-01-01

    Cosmological perturbation theory is the standard tool to understand the formation of the large scale structure in the Universe. However, its degree of applicability is limited by the growth of the amplitude of the matter perturbations with time. This problem can be tackled with by using N-body simulations or analytical techniques that go beyond the linear calculation. In my talk, I'll summarise some recent efforts in the latter that ameliorate the bad convergence of the standard perturbative expansion. The new techniques allow better analytical control on observables (as the matter power spectrum) over scales very relevant to understand the expansion history and formation of structure in the Universe.

  13. Instabilities in mimetic matter perturbations

    Energy Technology Data Exchange (ETDEWEB)

    Firouzjahi, Hassan; Gorji, Mohammad Ali [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), P.O. Box 19395-5531, Tehran (Iran, Islamic Republic of); Mansoori, Seyed Ali Hosseini, E-mail: firouz@ipm.ir, E-mail: gorji@ipm.ir, E-mail: shosseini@shahroodut.ac.ir, E-mail: shossein@ipm.ir [Physics Department, Shahrood University of Technology, P.O. Box 3619995161 Shahrood (Iran, Islamic Republic of)

    2017-07-01

    We study cosmological perturbations in mimetic matter scenario with a general higher derivative function. We calculate the quadratic action and show that both the kinetic term and the gradient term have the wrong sings. We perform the analysis in both comoving and Newtonian gauges and confirm that the Hamiltonians and the associated instabilities are consistent with each other in both gauges. The existence of instabilities is independent of the specific form of higher derivative function which generates gradients for mimetic field perturbations. It is verified that the ghost instability in mimetic perturbations is not associated with the higher derivative instabilities such as the Ostrogradsky ghost.

  14. Perturbation theory of effective Hamiltonians

    International Nuclear Information System (INIS)

    Brandow, B.H.

    1975-01-01

    This paper constitutes a review of the many papers which have used perturbation theory to derive ''effective'' or ''model'' Hamiltonians. It begins with a brief review of nondegenerate and non-many-body perturbation theory, and then considers the degenerate but non-many-body problem in some detail. It turns out that the degenerate perturbation problem is not uniquely defined, but there are some practical criteria for choosing among the various possibilities. Finally, the literature dealing with the linked-cluster aspects of open-shell many-body systems is reviewed. (U.S.)

  15. The theory of singular perturbations

    CERN Document Server

    De Jager, E M

    1996-01-01

    The subject of this textbook is the mathematical theory of singular perturbations, which despite its respectable history is still in a state of vigorous development. Singular perturbations of cumulative and of boundary layer type are presented. Attention has been given to composite expansions of solutions of initial and boundary value problems for ordinary and partial differential equations, linear as well as quasilinear; also turning points are discussed. The main emphasis lies on several methods of approximation for solutions of singularly perturbed differential equations and on the mathemat

  16. The power of perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Serone, Marco [SISSA International School for Advanced Studies and INFN Trieste, Via Bonomea 265, 34136, Trieste (Italy); Abdus Salam International Centre for Theoretical Physics, Strada Costiera 11, 34151, Trieste (Italy); Spada, Gabriele [SISSA International School for Advanced Studies and INFN Trieste, Via Bonomea 265, 34136, Trieste (Italy); Villadoro, Giovanni [Abdus Salam International Centre for Theoretical Physics, Strada Costiera 11, 34151, Trieste (Italy)

    2017-05-10

    We study quantum mechanical systems with a discrete spectrum. We show that the asymptotic series associated to certain paths of steepest-descent (Lefschetz thimbles) are Borel resummable to the full result. Using a geometrical approach based on the Picard-Lefschetz theory we characterize the conditions under which perturbative expansions lead to exact results. Even when such conditions are not met, we explain how to define a different perturbative expansion that reproduces the full answer without the need of transseries, i.e. non-perturbative effects, such as real (or complex) instantons. Applications to several quantum mechanical systems are presented.

  17. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  18. Developing an Alternanthera mosaic virus vector for efficient clonging of Whitefly cDNA RNAi to screen gene function

    Science.gov (United States)

    Alternanthera mosaic virus (AltMV; genus Potexvirus) is distinguished from the type member of the genus, Potato virus X by features of viral movement and variation within triple gene block protein 1 (TGB1). AltMV TGB1 variants TGB1L88 and TGB1P88 confer strong and weak silencing suppression, respect...

  19. Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

    Science.gov (United States)

    Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

    2014-05-01

    Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

  20. Screening for Resistance to Brown Rust of Sugarcane: Use of Bru1 resistance gene prospects and challenges

    Science.gov (United States)

    Brown rust of sugarcane caused by, Puccinia melanocephala, is a serious problem in the US sugarcane industry. A major resistance gene, Bru1 was identified and methodology for detecting it was developed by French scientists at CIRAD. The majority of the research resulting in the discovery of Bru1 res...

  1. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp

    International Nuclear Information System (INIS)

    Liu Wangjing; Chang Yunshiang; Wang Chunghsiung; Kou, Guang-Hsiung; Lo Chufang

    2005-01-01

    Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter

  2. Screening of cyanophytes from mosquito breeding places [mostly rice fields] with emphasis on unicellular species - potential recipients of Bti genes

    Czech Academy of Sciences Publication Activity Database

    Cepák, Vladislav; Rettich, F.

    2001-01-01

    Roč. 138, č. 102 (2001), s. 179-190 ISSN 0342-1120 R&D Projects: GA AV ČR KSK6005114 Institutional research plan: CEZ:AV0Z6005908 Keywords : Bti genes * cyanobacteria * cyanophytes * isolates * taxonomy Subject RIV: EF - Botanics Impact factor: 1.280, year: 1999

  3. Gene mutation, quantitative mutagenesis, and mutagen screening in mammalian cells: study with the CHO/HGPRT system

    International Nuclear Information System (INIS)

    Hsie, A.W.

    1980-01-01

    We have employed CHO cells to develop and define a set of stringent conditions for studying mutation induction to TG resistance. Several lines of evidence support the CHO/HGPRT system as a specific-locus mutational assay. The system permits quantification of mutation at the HGPRT locus induced by various physical and chemical mutagens. The quantitative nature of the system provides a basis for the study of structure-function relationships of various classes of chemical mutagens. The intra- and interlaboratory reproducibility of this system suggests its potential for screening environmental agents for mutagenic activity

  4. [Detection of Staphylococcus aureus resistant to methicillin (MRSA) by molecular biology (Cepheid GeneXpert IL, GeneOhm BD, Roche LightCycler, Hyplex Evigene I2A) versus screening by culture: Economic and practical strategy for the laboratory].

    Science.gov (United States)

    Laudat, P; Demondion, E; Jouannet, C; Charron, J; Chillou, C; Salaun, V; Mankikian, B

    2012-06-01

    Patients admitted in cardiac surgery and cardiac ICU at the Clinic Saint-Gatien (Tours) are screened for MRSA at the entrance by nasal swab and culture on blood agar and selective chromogenic medium made by addition of cefoxitin: BBL CHROMagar MRSA-II BD (result obtained at Day +1). We wanted to assess the molecular biology techniques available to obtain a result at day 0 for the majority of patients and to define an economic and practical strategy for the laboratory. We studied four molecular biology techniques: Cepheid GeneXpert (Cepheid) GeneOhm (BD), LightCycler (Roche) and Hyplex (I2A). Upon reception, nasal swabs were treated by culture, considered as reference, and one of the techniques of molecular biology, according to the manufacturer's notice. We conducted four studies between April 2008 and February 2009 to obtain a significant sample for each of them. By screening we mean a method that allows us to exclude MRSA carriage for patients waiting for surgery, and not to change patient management: for example, lack of isolation measures specific to entrance, no modification of antibiotic prophylaxis during surgery and no isolation measures in the immediate postoperative period. The criteria we considered for this evaluation were: (1) technician time: time to perform one or a series of sample(s) n=10 or more (about 2h for all techniques except GeneXpert 75min), level of skilled competences (no specific training for GeneXpert); (2) results: turnaround time (all molecular biology techniques), ease of reading and results interpretations (no specialized training required for GeneXpert), failure or not (12% of failure of internal controls for GeneOhm); (3) economic: cost for one or a series of sample(s) (n=10 or more), if we considered X as the reference culture cost (10 X Hyplex and LightCycler, 20 X and 40 X for GeneXpert GeneOhm); (4) NPV: 100% for GeneXpert and LightCycler. At same sensitivity, no technique, including culture, can solve alone our problem, which

  5. Oestrogenic activity of a textile industrial wastewater treatment plant effluent evaluated by the E-screen test and MELN gene-reporter luciferase assay

    Energy Technology Data Exchange (ETDEWEB)

    Schiliro, Tiziana, E-mail: tiziana.schiliro@unito.it [Department of Public Health and Microbiology, University of Torino, Via Santena 5bis, 10126 Torino (Italy); Porfido, Arianna [Department of Public Health and Microbiology, University of Torino, Via Santena 5bis, 10126 Torino (Italy); Spina, Federica; Varese, Giovanna Cristina [Department of Life Sciences and Systems Biology, University of Torino, Viale Mattioli 25, 10125 Torino (Italy); Gilli, Giorgio [Department of Public Health and Microbiology, University of Torino, Via Santena 5bis, 10126 Torino (Italy)

    2012-08-15

    This study quantified the biological oestrogenic activity in the effluent of a textile industrial wastewater treatment plant (IWWTP) in northwestern Italy. Samples of the IWWTP effluent were collected monthly, both before and after tertiary treatment (ozonation). After solid phase extraction, all samples were subjected to two in vitro tests of total estrogenic activity, the human breast cancer cell line (MCF-7 BUS) proliferation assay, or E-screen test, and the luciferase-transfected human breast cancer cell line (MELN) gene-reporter assay, to measure the 17{beta}-oestradiol equivalent quantity (EEQ). In the E-screen test, the mean EEQ values were 2.35 {+-} 1.68 ng/L pre-ozonation and 0.72 {+-} 0.58 ng/L post-ozonation; in the MELN gene-reporter luciferase assay, the mean EEQ values were 4.18 {+-} 3.54 ng/L pre-ozonation and 2.53 {+-} 2.48 ng/L post-ozonation. These results suggest that the post-ozonation IWWTP effluent had a lower oestrogenic activity (simple paired t-tests, p < 0.05). The average reduction of estrogenic activity of IWWTP effluent after ozonation was 67 {+-} 26% and 52 {+-} 27% as measured by E-screen test and MELN gene-reporter luciferase assay, respectively. There was a positive and significant correlation between the two tests (Rho S = 0.650, p = 0.022). This study indicates that the environmental risk is low because oestrogenic substances are deposited into the river via IWWTP at concentrations lower than those at which chronic exposure has been reported to affect the endocrine system of living organisms. -- Highlights: Black-Right-Pointing-Pointer The two in vitro tests are suited for oestrogenic activity assessment in textile WWTP. Black-Right-Pointing-Pointer There is a significant correlation between the results of the two in vitro tests. Black-Right-Pointing-Pointer The oestrogenic activity of the effluent is reduced by ozonation. Black-Right-Pointing-Pointer The input of estrogenic substances into the river via textile WWTP is low.

  6. Tunnelling instability via perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Graffi, S. (Bologna Univ. (Italy). Dip. di Matematica); Grecchi, V. (Moderna Univ. (Italy). Dip. di Matematica); Jona-Lasinio, G. (Paris-11 Univ., 91 - Orsay (France). Lab. de Physique Theorique et Hautes Energies)

    1984-10-21

    The semiclassical limit of low lying states in a multiwell potential is studied by rigorous perturbative techniques. In particular tunnelling instability and localisation of wave functions is obtained in a simple way under small deformations of symmetric potentials.

  7. Perturbation theory of quantum resonances

    Czech Academy of Sciences Publication Activity Database

    Durand, P.; Paidarová, Ivana

    2016-01-01

    Roč. 135, č. 7 (2016), s. 159 ISSN 1432-2234 Institutional support: RVO:61388955 Keywords : Partitioning technique * Analytic continuation * Perturbative expansion Subject RIV: CF - Physical ; Theoretical Chemistry

  8. Perturbation Theory of Embedded Eigenvalues

    DEFF Research Database (Denmark)

    Engelmann, Matthias

    project gives a general and systematic approach to analytic perturbation theory of embedded eigenvalues. The spectral deformation technique originally developed in the theory of dilation analytic potentials in the context of Schrödinger operators is systematized by the use of Mourre theory. The group...... of dilations is thereby replaced by the unitary group generated y the conjugate operator. This then allows to treat the perturbation problem with the usual Kato theory.......We study problems connected to perturbation theory of embedded eigenvalues in two different setups. The first part deals with second order perturbation theory of mass shells in massive translation invariant Nelson type models. To this end an expansion of the eigenvalues w.r.t. fiber parameter up...

  9. Perturbative tests of quantum chromodynamics

    International Nuclear Information System (INIS)

    Michael, C.

    1978-01-01

    A review is given of perturbation theory results for quantum chromodynamics and of tests in deep inelastic lepton scattering, electron-positron annihilation, hadronic production of massive dileptons and hadronic large-momentum-transfer processes. (author)

  10. Large-order perturbation theory

    International Nuclear Information System (INIS)

    Wu, T.T.

    1982-01-01

    The original motivation for studying the asymptotic behavior of the coefficients of perturbation series came from quantum field theory. An overview is given of some of the attempts to understand quantum field theory beyond finite-order perturbation series. At least is the case of the Thirring model and probably in general, the full content of a relativistic quantum field theory cannot be recovered from its perturbation series. This difficulty, however, does not occur in quantum mechanics, and the anharmonic oscillator is used to illustrate the methods used in large-order perturbation theory. Two completely different methods are discussed, the first one using the WKB approximation, and a second one involving the statistical analysis of Feynman diagrams. The first one is well developed and gives detailed information about the desired asymptotic behavior, while the second one is still in its infancy and gives instead information about the distribution of vertices of the Feynman diagrams

  11. Review of chiral perturbation theory

    Indian Academy of Sciences (India)

    Abstract. A review of chiral perturbation theory and recent developments on the comparison of its predictions with experiment is presented. Some interesting topics with scope for further elaboration are touched upon.

  12. Perturbation theory in light-cone gauge

    International Nuclear Information System (INIS)

    Vianello, Eliana

    2000-01-01

    Perturbation calculations are presented for the light-cone gauge Schwinger model. Eigenstates can be calculated perturbatively but the perturbation theory is nonstandard. We hope to extend the work to QCD 2 to resolve some outstanding issues in those theories

  13. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others

    1995-10-09

    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

  14. Diversity of reductive dehalogenase genes from environmental samples and enrichment cultures identified with degenerate primer PCR screens.

    Directory of Open Access Journals (Sweden)

    Laura Audrey Hug

    2013-11-01

    Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.

  15. Assessment of single nucleotide polymorphisms in screening 52 DNA repair and cell cycle control genes in Fanconi anemia patients

    Directory of Open Access Journals (Sweden)

    Petrović Sandra

    2015-01-01

    Full Text Available Fanconi anemia (FA is a rare genetically heterogeneous disorder associated with bone marrow failure, birth defects and cancer susceptibility. Apart from the disease- causing mutations in FANC genes, the identification of specific DNA variations, such as single nucleotide polymorphisms (SNPs, in other candidate genes may lead to a better clinical description of this condition enabling individualized treatment with improvement of the prognosis. In this study, we have assessed 95 SNPs located in 52 key genes involved in base excision repair (BER, nucleotide excision repair (NER, mismatch repair (MMR, double strand break (DSB repair and cell cycle control using a DNA repair chip (Asper Biotech, Estonia which includes most of the common variants for the candidate genes. The SNP genotyping was performed in five FA-D2 patients and in one FA-A patient. The polymorphisms studied were synonymous (n=10, nonsynonymous (missense (n=52 and in non-coding regions of the genome (introns and 5 ‘and 3’ untranslated regions (UTR (n=33. Polymorphisms found at the homozygous state are selected for further analysis. Our results have shown a significant inter-individual variability among patients in the type and the frequency of SNPs and also elucidate the need for further studies of polymorphisms located in ATM, APEX APE 1, XRCC1, ERCC2, MSH3, PARP4, NBS1, BARD1, CDKN1B, TP53 and TP53BP1 which may be of great importance for better clinical description of FA. In addition, the present report recommends the use of SNPs as predictive and prognostic genetic markers to individualize therapy of FA patients. [Projekat Ministarstva nauke Republike Srbije, br. 173046

  16. Development of a cell-based reporter assay for screening of inhibitors of hypoxia-inducible factor 2-induced gene expression.

    Science.gov (United States)

    Woldemichael, Girma M; Vasselli, James R; Gardella, Roberta S; McKee, Tawnya C; Linehan, W Marston; McMahon, James B

    2006-09-01

    Reporter cell lines have been developed for the identification of inhibitors of gene expression enhanced by hypoxia-inducible factor 2, which has been implicated as a transcription factor involved in the tumorigenesis of clear cell renal carcinoma. Stably transformed reporter clones of the human renal clear cell carcinoma cell line 786-O were generated by transfection or retroviral infection. Luciferase reporter expression in the vectors used was driven by either the natural human vascular endothelial growth factor (VEGF) promoter-enhancer or by the VEGF and the human endothelial nitric oxide synthase enhancers modulating minimal human cytomegalovirus promoter. Utility of the generated reporter cell lines was validated by introducing the von Hippel-Lindau protein complex and testing for reporter inducibility by hypoxia. The dynamic range in reporter activity under hypoxic stress was found to be at least 30- to 40-fold, with a signal-to-noise ratio of 60:1. Properties of the cell lines such as tolerance to up to 3% DMSO, signal stability with multiple in vitro passages, and utility in both 96- and 384-well plate formats indicated their suitability for use in a high-throughput screen. In addition, the potential use of these reporter lines in the evaluation of high-throughput screening hits in vivo in various mice models has been demonstrated.

  17. Screening of dementia genes by whole-exome sequencing in early-onset Alzheimer disease: input and lessons.

    Science.gov (United States)

    Nicolas, Gaël; Wallon, David; Charbonnier, Camille; Quenez, Olivier; Rousseau, Stéphane; Richard, Anne-Claire; Rovelet-Lecrux, Anne; Coutant, Sophie; Le Guennec, Kilan; Bacq, Delphine; Garnier, Jean-Guillaume; Olaso, Robert; Boland, Anne; Meyer, Vincent; Deleuze, Jean-François; Munter, Hans Markus; Bourque, Guillaume; Auld, Daniel; Montpetit, Alexandre; Lathrop, Mark; Guyant-Maréchal, Lucie; Martinaud, Olivier; Pariente, Jérémie; Rollin-Sillaire, Adeline; Pasquier, Florence; Le Ber, Isabelle; Sarazin, Marie; Croisile, Bernard; Boutoleau-Bretonnière, Claire; Thomas-Antérion, Catherine; Paquet, Claire; Sauvée, Mathilde; Moreaud, Olivier; Gabelle, Audrey; Sellal, François; Ceccaldi, Mathieu; Chamard, Ludivine; Blanc, Frédéric; Frebourg, Thierry; Campion, Dominique; Hannequin, Didier

    2016-05-01

    Causative variants in APP, PSEN1 or PSEN2 account for a majority of cases of autosomal dominant early-onset Alzheimer disease (ADEOAD, onset before 65 years). Variant detection rates in other EOAD patients, that is, with family history of late-onset AD (LOAD) (and no incidence of EOAD) and sporadic cases might be much lower. We analyzed the genomes from 264 patients using whole-exome sequencing (WES) with high depth of coverage: 90 EOAD patients with family history of LOAD and no incidence of EOAD in the family and 174 patients with sporadic AD starting between 51 and 65 years. We found three PSEN1 and one PSEN2 causative, probably or possibly causative variants in four patients (1.5%). Given the absence of PSEN1, PSEN2 and APP causative variants, we investigated whether these 260 patients might be burdened with protein-modifying variants in 20 genes that were previously shown to cause other types of dementia when mutated. For this analysis, we included an additional set of 160 patients who were previously shown to be free of causative variants in PSEN1, PSEN2 and APP: 107 ADEOAD patients and 53 sporadic EOAD patients with an age of onset before 51 years. In these 420 patients, we detected no variant that might modify the function of the 20 dementia-causing genes. We conclude that EOAD patients with family history of LOAD and no incidence of EOAD in the family or patients with sporadic AD starting between 51 and 65 years have a low variant-detection rate in AD genes.

  18. Nonlinearly perturbed semi-Markov processes

    CERN Document Server

    Silvestrov, Dmitrii

    2017-01-01

    The book presents new methods of asymptotic analysis for nonlinearly perturbed semi-Markov processes with a finite phase space. These methods are based on special time-space screening procedures for sequential phase space reduction of semi-Markov processes combined with the systematical use of operational calculus for Laurent asymptotic expansions. Effective recurrent algorithms are composed for getting asymptotic expansions, without and with explicit upper bounds for remainders, for power moments of hitting times, stationary and conditional quasi-stationary distributions for nonlinearly perturbed semi-Markov processes. These results are illustrated by asymptotic expansions for birth-death-type semi-Markov processes, which play an important role in various applications. The book will be a useful contribution to the continuing intensive studies in the area. It is an essential reference for theoretical and applied researchers in the field of stochastic processes and their applications that will cont...

  19. The detection of the methylated Wif-1 gene is more accurate than a fecal occult blood test for colorectal cancer screening

    KAUST Repository

    Amiot, Aurelien; Mansour, Hicham; Baumgaertner, Isabelle; Delchier, Jean-Charles; Tournigand, Christophe; Furet, Jean-Pierre; Carrau, Jean-Pierre; Canoui-Poitrine, Florence; Sobhani, Iradj

    2014-01-01

    Background: The clinical benefit of guaiac fecal occult blood tests (FOBT) is now well established for colorectal cancer screening. Growing evidence has demonstrated that epigenetic modifications and fecal microbiota changes, also known as dysbiosis, are associated with CRC pathogenesis and might be used as surrogate markers of CRC. Patients and Methods: We performed a cross-sectional study that included all consecutive subjects that were referred (from 2003 to 2007) for screening colonoscopies. Prior to colonoscopy, effluents (fresh stools, sera-S and urine-U) were harvested and FOBTs performed. Methylation levels were measured in stools, S and U for 3 genes (Wif1, ALX-4, and Vimentin) selected from a panel of 63 genes; Kras mutations and seven dominant and subdominant bacterial populations in stools were quantified. Calibration was assessed with the Hosmer-Lemeshow chi-square, and discrimination was determined by calculating the C-statistic (Area Under Curve) and Net Reclassification Improvement index. Results: There were 247 individuals (mean age 60.8±12.4 years, 52% of males) in the study group, and 90 (36%) of these individuals were patients with advanced polyps or invasive adenocarcinomas. A multivariate model adjusted for age and FOBT led to a C-statistic of 0.83 [0.77-0.88]. After supplementary sequential (one-by-one) adjustment, Wif-1 methylation (S or U) and fecal microbiota dysbiosis led to increases of the C-statistic to 0.90 [0.84-0.94] (p = 0.02) and 0.81 [0.74-0.86] (p = 0.49), respectively. When adjusted jointly for FOBT and Wif-1 methylation or fecal microbiota dysbiosis, the increase of the C-statistic was even more significant (0.91 and 0.85, p<0.001 and p = 0.10, respectively). Conclusion: The detection of methylated Wif-1 in either S or U has a higher performance accuracy compared to guaiac FOBT for advanced colorectal neoplasia screening. Conversely, fecal microbiota dysbiosis detection was not more accurate. Blood and urine testing could be

  20. The detection of the methylated Wif-1 gene is more accurate than a fecal occult blood test for colorectal cancer screening

    KAUST Repository

    Amiot, Aurelien

    2014-07-15

    Background: The clinical benefit of guaiac fecal occult blood tests (FOBT) is now well established for colorectal cancer screening. Growing evidence has demonstrated that epigenetic modifications and fecal microbiota changes, also known as dysbiosis, are associated with CRC pathogenesis and might be used as surrogate markers of CRC. Patients and Methods: We performed a cross-sectional study that included all consecutive subjects that were referred (from 2003 to 2007) for screening colonoscopies. Prior to colonoscopy, effluents (fresh stools, sera-S and urine-U) were harvested and FOBTs performed. Methylation levels were measured in stools, S and U for 3 genes (Wif1, ALX-4, and Vimentin) selected from a panel of 63 genes; Kras mutations and seven dominant and subdominant bacterial populations in stools were quantified. Calibration was assessed with the Hosmer-Lemeshow chi-square, and discrimination was determined by calculating the C-statistic (Area Under Curve) and Net Reclassification Improvement index. Results: There were 247 individuals (mean age 60.8±12.4 years, 52% of males) in the study group, and 90 (36%) of these individuals were patients with advanced polyps or invasive adenocarcinomas. A multivariate model adjusted for age and FOBT led to a C-statistic of 0.83 [0.77-0.88]. After supplementary sequential (one-by-one) adjustment, Wif-1 methylation (S or U) and fecal microbiota dysbiosis led to increases of the C-statistic to 0.90 [0.84-0.94] (p = 0.02) and 0.81 [0.74-0.86] (p = 0.49), respectively. When adjusted jointly for FOBT and Wif-1 methylation or fecal microbiota dysbiosis, the increase of the C-statistic was even more significant (0.91 and 0.85, p<0.001 and p = 0.10, respectively). Conclusion: The detection of methylated Wif-1 in either S or U has a higher performance accuracy compared to guaiac FOBT for advanced colorectal neoplasia screening. Conversely, fecal microbiota dysbiosis detection was not more accurate. Blood and urine testing could be

  1. The detection of the methylated Wif-1 gene is more accurate than a fecal occult blood test for colorectal cancer screening.

    Directory of Open Access Journals (Sweden)

    Aurelien Amiot

    Full Text Available The clinical benefit of guaiac fecal occult blood tests (FOBT is now well established for colorectal cancer screening. Growing evidence has demonstrated that epigenetic modifications and fecal microbiota changes, also known as dysbiosis, are associated with CRC pathogenesis and might be used as surrogate markers of CRC.We performed a cross-sectional study that included all consecutive subjects that were referred (from 2003 to 2007 for screening colonoscopies. Prior to colonoscopy, effluents (fresh stools, sera-S and urine-U were harvested and FOBTs performed. Methylation levels were measured in stools, S and U for 3 genes (Wif1, ALX-4, and Vimentin selected from a panel of 63 genes; Kras mutations and seven dominant and subdominant bacterial populations in stools were quantified. Calibration was assessed with the Hosmer-Lemeshow chi-square, and discrimination was determined by calculating the C-statistic (Area Under Curve and Net Reclassification Improvement index.There were 247 individuals (mean age 60.8±12.4 years, 52% of males in the study group, and 90 (36% of these individuals were patients with advanced polyps or invasive adenocarcinomas. A multivariate model adjusted for age and FOBT led to a C-statistic of 0.83 [0.77-0.88]. After supplementary sequential (one-by-one adjustment, Wif-1 methylation (S or U and fecal microbiota dysbiosis led to increases of the C-statistic to 0.90 [0.84-0.94] (p = 0.02 and 0.81 [0.74-0.86] (p = 0.49, respectively. When adjusted jointly for FOBT and Wif-1 methylation or fecal microbiota dysbiosis, the increase of the C-statistic was even more significant (0.91 and 0.85, p<0.001 and p = 0.10, respectively.The detection of methylated Wif-1 in either S or U has a higher performance accuracy compared to guaiac FOBT for advanced colorectal neoplasia screening. Conversely, fecal microbiota dysbiosis detection was not more accurate. Blood and urine testing could be used in those individuals reluctant to

  2. Midbrain Gene Screening Identifies a New Mesoaccumbal Glutamatergic Pathway and a Marker for Dopamine Cells Neuroprotected in Parkinson's Disease.

    Science.gov (United States)

    Viereckel, Thomas; Dumas, Sylvie; Smith-Anttila, Casey J A; Vlcek, Bianca; Bimpisidis, Zisis; Lagerström, Malin C; Konradsson-Geuken, Åsa; Wallén-Mackenzie, Åsa

    2016-10-20

    The ventral tegmental area (VTA) and substantia nigra pars compacta (SNc) of the midbrain are associated with Parkinson's disease (PD), schizophrenia, mood disorders and addiction. Based on the recently unraveled heterogeneity within the VTA and SNc, where glutamate, GABA and co-releasing neurons have been found to co-exist with the classical dopamine neurons, there is a compelling need for identification of gene expression patterns that represent this heterogeneity and that are of value for development of human therapies. Here, several unique gene expression patterns were identified in the mouse midbrain of which NeuroD6 and Grp were expressed within different dopaminergic subpopulations of the VTA, and TrpV1 within a small heterogeneous population. Optogenetics-coupled in vivo amperometry revealed a previously unknown glutamatergic mesoaccumbal pathway characterized by TrpV1-Cre-expression. Human GRP was strongly detected in non-melanized dopaminergic neurons within the SNc of both control and PD brains, suggesting GRP as a marker for neuroprotected neurons in PD. This study thus unravels markers for distinct subpopulations of neurons within the mouse and human midbrain, defines unique anatomical subregions within the VTA and exposes an entirely new glutamatergic pathway. Finally, both TRPV1 and GRP are implied in midbrain physiology of importance to neurological and neuropsychiatric disorders.

  3. Screening of the GPX3 gene identifies the "T" allele of the SNP -861A/T as a risk for ischemic stroke in young Asian Indians.

    Science.gov (United States)

    Akhter, Mohammad S; Biswas, Arijit; Rashid, Hina; Devi, Luxmi; Behari, Madhuri; Saxena, Renu

    2014-09-01

    Deficiency of plasma glutathione peroxidase (GPx-3) has been associated with platelet-dependent thrombosis. Single-nucleotide polymorphisms (SNPs) in the promoter region of GPX3 gene have been found associated with the risk for ischemic stroke in Caucasian populations. The aim of our present study was to evaluate the impact of genetic variations in the GPX3 gene and plasma GPx-3 antigen levels on ischemic stroke in young Asian Indians. One hundred patients with ischemic stroke and 200 age- and sex-matched controls were studied. Genetic analysis for the study population was done by a combination of variant screening using single-stranded conformation polymorphism and final genotyping by polymerase chain reaction-restriction fragment length polymorphism and allele-specific polymerase chain reactions. Plasma GPx-3 antigen levels were evaluated using commercial kits. Data were analyzed using genetic analysis software and statistical tools. Significantly higher GPx-3 levels were observed in controls compared with patients (controls 26.37 ± 3.66 μg/mL and patients 22.83 ± 4.57 μg/mL, P stroke phenotype (P stroke (P ischemic stroke phenotype. The -861A/T and -568T/C SNPs may show a statistically significant association with both plasma GPx-3 antigen levels and the stroke phenotype in a larger sample size. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  4. Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response.

    Science.gov (United States)

    Watson, Emma; MacNeil, Lesley T; Arda, H Efsun; Zhu, Lihua Julie; Walhout, Albertha J M

    2013-03-28

    Expression profiles are tailored according to dietary input. However, the networks that control dietary responses remain largely uncharacterized. Here, we combine forward and reverse genetic screens to delineate a network of 184 genes that affect the C. elegans dietary response to Comamonas DA1877 bacteria. We find that perturbation of a mitochondrial network composed of enzymes involved in amino acid metabolism and the TCA cycle affects the dietary response. In humans, mutations in the corresponding genes cause inborn diseases of amino acid metabolism, most of which are treated by dietary intervention. We identify several transcription factors (TFs) that mediate the changes in gene expression upon metabolic network perturbations. Altogether, our findings unveil a transcriptional response system that is poised to sense dietary cues and metabolic imbalances, illustrating extensive communication between metabolic networks in the mitochondria and gene regulatory networks in the nucleus. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Base case and perturbation scenarios

    Energy Technology Data Exchange (ETDEWEB)

    Edmunds, T

    1998-10-01

    This report describes fourteen energy factors that could affect electricity markets in the future (demand, process, source mix, etc.). These fourteen factors are believed to have the most influence on the State's energy environment. A base case, or most probable, characterization is given for each of these fourteen factors over a twenty year time horizon. The base case characterization is derived from quantitative and qualitative information provided by State of California government agencies, where possible. Federal government databases are nsed where needed to supplement the California data. It is envisioned that a initial selection of issue areas will be based upon an evaluation of them under base case conditions. For most of the fourteen factors, the report identities possible perturbations from base case values or assumptions that may be used to construct additional scenarios. Only those perturbations that are plausible and would have a significant effect on energy markets are included in the table. The fourteen factors and potential perturbations of the factors are listed in Table 1.1. These perturbations can be combined to generate internally consist.ent. combinations of perturbations relative to the base case. For example, a low natural gas price perturbation should be combined with a high natural gas demand perturbation. The factor perturbations are based upon alternative quantitative forecasts provided by other institutions (the Department of Energy - Energy Information Administration in some cases), changes in assumptions that drive the quantitative forecasts, or changes in assumptions about the structure of the California energy markets. The perturbations are intended to be used for a qualitative reexamination of issue areas after an initial evaluation under the base case. The perturbation information would be used as a "tiebreaker;" to make decisions regarding those issue areas that were marginally accepted or rejected under the base case. Hf a

  6. A targeted glycan-related gene screen reveals heparan sulfate proteoglycan sulfation regulates WNT and BMP trans-synaptic signaling.

    Directory of Open Access Journals (Sweden)

    Neil Dani

    Full Text Available A Drosophila transgenic RNAi screen targeting the glycan genome, including all N/O/GAG-glycan biosynthesis/modification enzymes and glycan-binding lectins, was conducted to discover novel glycan functions in synaptogenesis. As proof-of-product, we characterized functionally paired heparan sulfate (HS 6-O-sulfotransferase (hs6st and sulfatase (sulf1, which bidirectionally control HS proteoglycan (HSPG sulfation. RNAi knockdown of hs6st and sulf1 causes opposite effects on functional synapse development, with decreased (hs6st and increased (sulf1 neurotransmission strength confirmed in null mutants. HSPG co-receptors for WNT and BMP intercellular signaling, Dally-like Protein and Syndecan, are differentially misregulated in the synaptomatrix of these mutants. Consistently, hs6st and sulf1 nulls differentially elevate both WNT (Wingless; Wg and BMP (Glass Bottom Boat; Gbb ligand abundance in the synaptomatrix. Anterograde Wg signaling via Wg receptor dFrizzled2 C-terminus nuclear import and retrograde Gbb signaling via synaptic MAD phosphorylation and nuclear import are differentially activated in hs6st and sulf1 mutants. Consequently, transcriptional control of presynaptic glutamate release machinery and postsynaptic glutamate receptors is bidirectionally altered in hs6st and sulf1 mutants, explaining the bidirectional change in synaptic functional strength. Genetic correction of the altered WNT/BMP signaling restores normal synaptic development in both mutant conditions, proving that altered trans-synaptic signaling causes functional differentiation defects.

  7. Perturbation theory in large order

    International Nuclear Information System (INIS)

    Bender, C.M.

    1978-01-01

    For many quantum mechanical models, the behavior of perturbation theory in large order is strikingly simple. For example, in the quantum anharmonic oscillator, which is defined by -y'' + (x 2 /4 + ex 4 /4 - E) y = 0, y ( +- infinity) = 0, the perturbation coefficients, A/sub n/, in the expansion for the ground-state energy, E(ground state) approx. EPSILON/sub n = 0//sup infinity/ A/sub n/epsilon/sup n/, simplify dramatically as n → infinity: A/sub n/ approx. (6/π 3 )/sup 1/2/(-3)/sup n/GAMMA(n + 1/2). Methods of applied mathematics are used to investigate the nature of perturbation theory in quantum mechanics and show that its large-order behavior is determined by the semiclassical content of the theory. In quantum field theory the perturbation coefficients are computed by summing Feynman graphs. A statistical procedure in a simple lambda phi 4 model for summing the set of all graphs as the number of vertices → infinity is presented. Finally, the connection between the large-order behavior of perturbation theory in quantum electrodynamics and the value of α, the charge on the electron, is discussed. 7 figures

  8. Genome-Wide Screen for Saccharomyces cerevisiae Genes Contributing to Opportunistic Pathogenicity in an Invertebrate Model Host

    Directory of Open Access Journals (Sweden)

    Sujal S. Phadke

    2018-01-01

    Full Text Available Environmental opportunistic pathogens can exploit vulnerable hosts through expression of traits selected for in their natural environments. Pathogenicity is itself a complicated trait underpinned by multiple complex traits, such as thermotolerance, morphology, and stress response. The baker’s yeast, Saccharomyces cerevisiae, is a species with broad environmental tolerance that has been increasingly reported as an opportunistic pathogen of humans. Here we leveraged the genetic resources available in yeast and a model insect species, the greater waxmoth Galleria mellonella, to provide a genome-wide analysis of pathogenicity factors. Using serial passaging experiments of genetically marked wild-type strains, a hybrid strain was identified as the most fit genotype across all replicates. To dissect the genetic basis for pathogenicity in the hybrid isolate, bulk segregant analysis was performed which revealed eight quantitative trait loci significantly differing between the two bulks with alleles from both parents contributing to pathogenicity. A second passaging experiment with a library of deletion mutants for most yeast genes identified a large number of mutations whose relative fitness differed in vivo vs. in vitro, including mutations in genes controlling cell wall integrity, mitochondrial function, and tyrosine metabolism. Yeast is presumably subjected to a massive assault by the innate insect immune system that leads to melanization of the host and to a large bottleneck in yeast population size. Our data support that resistance to the innate immune response of the insect is key to survival in the host and identifies shared genetic mechanisms between S. cerevisiae and other opportunistic fungal pathogens.

  9. Screening for coding variants in FTO and SH2B1 genes in Chinese patients with obesity.

    Directory of Open Access Journals (Sweden)

    Zhaojing Zheng

    Full Text Available To investigate potential functional variants in FTO and SH2B1 genes among Chinese children with obesity.Sanger sequencing of PCR products of all FTO and SH2B1 exons and their flanking regions were performed in 338 Chinese Han children with obesity and 221 age- and sex-matched lean controls.A total of seven and five rare non-synonymous variants were identified in FTO and SH2B1, respectively. The overall frequencies of FTO and SH2B1 rare non-synonymous variants were similar in obese and lean children (2.37% and 0.90% vs. 1.81% and 1.36%, P>0.05. However, four out of the seven variants in FTO were novel and all were unique to obese children (p>0.05. None of the novel variants was consistently being predicted to be deleterious. Four out of five variants in SH2B1 were novel and one was unique to obese children (p>0.05. One variant (L293R that was consistently being predicted as deleterious in SH2B1 gene was unique to lean control. While rare missense mutations were more frequently detected in girls from obesity as well as lean control than boys, the difference was not statistically significant. In addition, it's shown that the prevalence of rare missense mutations of FTO as well as SH2B1 was similar across different ethnic groups.The rare missense mutations of FTO and SH2B1 did not confer risks of obesity in Chinese Han children in our cohort.

  10. Identification of unsuspected Wolfram syndrome cases through clinical assessment and WFS1 gene screening in type 1 diabetes mellitus patients.

    Science.gov (United States)

    Blanco-Aguirre, Maria E; la Parra, David Rivera-De; Tapia-Garcia, Hugo; Gonzalez-Rodriguez, Johanna; Welschen, Daniela; Welskin, Daniela; Arroyo-Yllanes, Maria Estela; Escudero, Irineo; Nuñez-Hernandez, Jorge A; Medina-Bravo, Patricia; Zenteno, Juan C

    2015-07-15

    Wolfram syndrome (WS) is a severe autosomal recessive pleiotropic disease primarily characterized by the association of juvenile-onset diabetes mellitus and optic atrophy. Earlier reports have shown that a proportion of WS cases may remain unrecognized due to misdiagnosis as type 1 diabetes mellitus (T1DM). The objectives of this work were to estimate the prevalence of patients fulfilling clinical criteria for WS in a cohort of subjects diagnosed as T1DM and to identify causal WFS1 gene mutations in those individuals meeting clinical criteria for the disease. A cohort of 131 unrelated Mexican T1DM patients was collected, including 77 females and 54 males. Additional clinical anomalies suggesting WS were identified through review of medical files, detailed physical examination and/or specialized tests. WFS1 gene analysis was performed using exon-by-exon PCR amplification and direct Sanger sequencing on genomic DNA from patients reaching WS clinical criteria. Clinical criteria for a WS diagnosis were reached in 6 probands, corresponding to a 4.58% frequency of the disease. WFS1 mutations were identified in 4 out of 5 (80%) individuals fulfilling WS clinical criteria, including two homozygous, one compound heterozygous, and one patient with a single allele mutation. No WFS1 mutations were identified in the remaining subject. In our cohort, approximately 6% of cases diagnosed as T1DM were in fact patients with Wolfram syndrome. WFS1 mutations were identified in 4 out of 5 individuals (80%) fulfilling clinical criteria for WS. Clinical and genetic analyses of large cohorts of T1DM patients from different ethnic origins would help to better estimate the occurrence of WS and will lead to a better management of such patients. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Perturbations of the Friedmann universe

    International Nuclear Information System (INIS)

    Novello, M.; Salim, J.M.; Heintzmann, H.

    1982-01-01

    Correcting and extending previous work by Hawking (1966) and Olson (1976) the complete set of perturbation equations of a Friedmann Universe in the quasi-Maxwellian form is derived and analized. The formalism is then applied to scalar, vector and tensor perturbations of a phenomenological fluid, which is modelled such as to comprise shear and heat flux. Depending on the equation of state of the background it is found that there exist unstable (growing) modes of purely rotational character. It is further found that (to linear order at least) any vortex perturbation is equivalent to a certain heat flux vector. The equation for the gravitational waves are derived in a completely equivalent method as in case of the propagation, in a curved space-time, of electromagnetic waves in a plasma endowed with some definite constitutive relations. (Author) [pt

  12. Analytic continuation in perturbative QCD

    International Nuclear Information System (INIS)

    Caprini, Irinel

    2002-01-01

    We discuss some attempts to improve standard perturbative expansion in QCD by using the analytic continuation in the momentum and the Borel complex planes. We first analyse the momentum-plane analyticity properties of the Borel-summed Green functions in perturbative QCD and the connection between the Landau singularities and the infrared renormalons. By using the analytic continuation in the Borel complex plane, we propose a new perturbative series replacing the standard expansion in powers of the normalized coupling constant a. The new expansion functions have branch point and essential singularities at the origin of the complex a-plane and divergent Taylor expansions in powers of a. On the other hand the modified expansion of the QCD correlators is convergent under rather conservative conditions. (author)

  13. Perturbative coherence in field theory

    International Nuclear Information System (INIS)

    Aldrovandi, R.; Kraenkel, R.A.

    1987-01-01

    A general condition for coherent quantization by perturbative methods is given, because the basic field equations of a fild theory are not always derivable from a Lagrangian. It's seen that non-lagrangian models way have well defined vertices, provided they satisfy what they call the 'coherence condition', which is less stringent than the condition for the existence of a Lagrangian. They note that Lagrangian theories are perturbatively coherent, in the sense that they have well defined vertices, and that they satisfy automatically that condition. (G.D.F.) [pt

  14. Physics in Screening Environments

    Science.gov (United States)

    Certik, Ondrej

    In the current study, we investigated atoms in screening environments like plasmas. It is common practice to extract physical data, such as temperature and electron densities, from plasma experiments. We present results that address inherent computational difficulties that arise when the screening approach is extended to include the interaction between the atomic electrons. We show that there may arise an ambiguity in the interpretation of physical properties, such as temperature and charge density, from experimental data due to the opposing effects of electron-nucleus screening and electron-electron screening. The focus of the work, however, is on the resolution of inherent computational challenges that appear in the computation of two-particle matrix elements. Those enter already at the Hartree-Fock level. Furthermore, as examples of post Hartree-Fock calculations, we show second-order Green's function results and many body perturbation theory results of second order. A self-contained derivation of all necessary equations has been included. The accuracy of the implementation of the method is established by comparing standard unscreened results for various atoms and molecules against literature for Hartree-Fock as well as Green's function and many body perturbation theory. The main results of the thesis are presented in the chapter called Screened Results, where the behavior of several atomic systems depending on electron-electron and electron-nucleus Debye screening was studied. The computer code that we have developed has been made available for anybody to use. Finally, we present and discuss results obtained for screened interactions. We also examine thoroughly the computational details of the calculations and particular implementations of the method.

  15. Cosmological perturbation theory and quantum gravity

    Energy Technology Data Exchange (ETDEWEB)

    Brunetti, Romeo [Dipartimento di Matematica, Università di Trento,Via Sommarive 14, 38123 Povo TN (Italy); Fredenhagen, Klaus [II Institute für Theoretische Physik, Universität Hamburg,Luruper Chaussee 149, 22761 Hamburg (Germany); Hack, Thomas-Paul [Institute für Theoretische Physik, Universität Leipzig,Brüderstr. 16, 04103 Leipzig (Germany); Pinamonti, Nicola [Dipartimento di Matematica, Università di Genova,Via Dodecaneso 35, 16146 Genova (Italy); INFN, Sezione di Genova,Via Dodecaneso 33, 16146 Genova (Italy); Rejzner, Katarzyna [Department of Mathematics, University of York,Heslington, York YO10 5DD (United Kingdom)

    2016-08-04

    It is shown how cosmological perturbation theory arises from a fully quantized perturbative theory of quantum gravity. Central for the derivation is a non-perturbative concept of gauge-invariant local observables by means of which perturbative invariant expressions of arbitrary order are generated. In particular, in the linearised theory, first order gauge-invariant observables familiar from cosmological perturbation theory are recovered. Explicit expressions of second order quantities are presented as well.

  16. Chaotic inflation with metric and matter perturbations

    International Nuclear Information System (INIS)

    Feldman, H.A.; Brandenberger, R.H.

    1989-01-01

    A perturbative scheme to analyze the evolution of both metric and scalar field perturbations in an expanding universe is developed. The scheme is applied to study chaotic inflation with initial metric and scalar field perturbations present. It is shown that initial gravitational perturbations with wavelength smaller than the Hubble radius rapidly decay. The metric simultaneously picks up small perturbations determined by the matter inhomogeneities. Both are frozen in once the wavelength exceeds the Hubble radius. (orig.)

  17. Non-perturbative QCD correlation functions

    Energy Technology Data Exchange (ETDEWEB)

    Cyrol, Anton Konrad

    2017-11-27

    Functional methods provide access to the non-perturbative regime of quantum chromo- dynamics. Hence, they allow investigating confinement and chiral symmetry breaking. In this dissertation, correlation functions of Yang-Mills theory and unquenched two-flavor QCD are computed from the functional renormalization group. Employing a self-consistent vertex expansion of the effective action, Yang-Mills correlation functions are obtained in four as well as in three spacetime dimensions. To this end, confinement and Slavnov-Taylor identities are discussed. Our numerical results show very good agreement with corresponding lattice results. Next, unquenched two-flavor QCD is considered where it is shown that the unquenched two-flavor gluon propagator is insensitive to the pion mass. Furthermore, the necessity for consistent truncations is emphasized. Finally, correlation functions of finite-temperature Yang-Mills theory are computed in a truncation that includes the splitting of the gluon field into directions that are transverse and longitudinal to the heat bath. In particular, it includes the splitting of the three- and four-gluon vertices. The obtained gluon propagator allows to extract a Debye screening mass that coincides with the hard thermal loop screening mass at high temperatures, but is meaningful also at temperatures below the phase transition temperature.

  18. Development and validation of concurrent preimplantation genetic diagnosis for single gene disorders and comprehensive chromosomal aneuploidy screening without whole genome amplification.

    Science.gov (United States)

    Zimmerman, Rebekah S; Jalas, Chaim; Tao, Xin; Fedick, Anastasia M; Kim, Julia G; Pepe, Russell J; Northrop, Lesley E; Scott, Richard T; Treff, Nathan R

    2016-02-01

    To develop a novel and robust protocol for multifactorial preimplantation genetic testing of trophectoderm biopsies using quantitative polymerase chain reaction (qPCR). Prospective and blinded. Not applicable. Couples indicated for preimplantation genetic diagnosis (PGD). None. Allele dropout (ADO) and failed amplification rate, genotyping consistency, chromosome screening success rate, and clinical outcomes of qPCR-based screening. The ADO frequency on a single cell from a fibroblast cell line was 1.64% (18/1,096). When two or more cells were tested, the ADO frequency dropped to 0.02% (1/4,426). The rate of amplification failure was 1.38% (55/4,000) overall, with 2.5% (20/800) for single cells and 1.09% (35/3,200) for samples that had two or more cells. Among 152 embryos tested in 17 cases by qPCR-based PGD and CCS, 100% were successfully given a diagnosis, with 0% ADO or amplification failure. Genotyping consistency with reference laboratory results was >99%. Another 304 embryos from 43 cases were included in the clinical application of qPCR-based PGD and CCS, for which 99.7% (303/304) of the embryos were given a definitive diagnosis, with only 0.3% (1/304) having an inconclusive result owing to recombination. In patients receiving a transfer with follow-up, the pregnancy rate was 82% (27/33). This study demonstrates that the use of qPCR for PGD testing delivers consistent and more reliable results than existing methods and that single gene disorder PGD can be run concurrently with CCS without the need for additional embryo biopsy or whole genome amplification. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  19. Modelling of Plasma Response to Resonant Magnetic Perturbations and its Influence on Divertor Strike Points

    Energy Technology Data Exchange (ETDEWEB)

    Cahyna, P.; Peterka, M.; Panek, R., E-mail: cahyna@ipp.cas.cz [Institute of Plasma Physics AS CR, Prague (Czech Republic); Liu, Y.; Kirk, A.; Harrison, J.; Thornton, A.; Chapman, I. [EURATOM/CCFE Fusion Association, Culham Science Centre, Abingdon (United Kingdom); Nardon, E. [Association Euratom/CEA, CEA Cadarache, St. Paul-lez-Durance (France); Schmitz, O. [Forschung Zentrum Juelich, Juelich (Germany)

    2012-09-15

    Full text: Resonant magnetic perturbations (RMPs) for edge localized mode (ELM) mitigation in tokamaks can be modified by the plasma response and indeed strong screening of the applied perturbation is in some cases predicted by simulations. In this contribution we investigate what effect would such screening have on the spiralling patterns (footprints) which may appear at the divertor when RMPs are applied. We use two theoretical tools for investigation of the impact of plasma response on footprints: a simple model of the assumed screening currents, which can be used to translate the screening predicted by MHD codes in a simplified geometry into the real geometry, and the MHD code MARS-F. The former consistently predicts that footprints are significantly reduced when complete screening of the resonant perturbation modes (like it is the case in ideal MHD) is assumed. This result is supported by the result of MARS-F in ideal mode for the case of the MAST tokamak. To predict observed patterns of fluxes it is necessary to take into account the deformation of the scrape-off layer, and for this we developed an approximative method based on the Melnikov integral. If the screening of perturbations indeed reduces the footprints, it would provide us with an important tool to evaluate the amount of screening in experiments, as the footprints can be easily observed. We thus present a comparison between predictions and experimental data, especially for the MAST tokamak, where a significant amount of data has been collected. (author)

  20. Basics of QCD perturbation theory

    International Nuclear Information System (INIS)

    Soper, D.E.

    1997-01-01

    This is an introduction to the use of QCD perturbation theory, emphasizing generic features of the theory that enable one to separate short-time and long-time effects. The author also covers some important classes of applications: electron-positron annihilation to hadrons, deeply inelastic scattering, and hard processes in hadron-hadron collisions. 31 refs., 38 figs

  1. Current issues in perturbative QCD

    International Nuclear Information System (INIS)

    Hinchliffe, I.

    1994-12-01

    This review talk discusses some issues of active research in perturbative QCD. The following topics are discussed: (1) current value of αs; (2) heavy quark production in hadron collisions; (3) production of Ψ and Υ in p anti p collisions; (4) prompt photon production; (5) small-x and related phenomena; and (6) particle multiplicity in heavy quark jets

  2. New results in perturbative QCD

    International Nuclear Information System (INIS)

    Ellis, R.K.

    1986-01-01

    Three topics in perturbative QCD important for Super-collider physics are reviewed. The topics are: 1. (2 → 2) jet phenomena calculated in O(αs 3 ). 2. New techniques for the calculation of tree graphs. 3. Color coherence in jet phenomena. 31 references, 6 figures

  3. Perturbation theory from stochastic quantization

    International Nuclear Information System (INIS)

    Hueffel, H.

    1984-01-01

    By using a diagrammatical method it is shown that in scalar theories the stochastic quantization method of Parisi and Wu gives the usual perturbation series in Feynman diagrams. It is further explained how to apply the diagrammatical method to gauge theories, discussing the origin of ghost effects. (Author)

  4. Seven topics in perturbative QCD

    International Nuclear Information System (INIS)

    Buras, A.J.

    1980-09-01

    The following topics of perturbative QCD are discussed: (1) deep inelastic scattering; (2) higher order corrections to e + e - annihilation, to photon structure functions and to quarkonia decays; (3) higher order corrections to fragmentation functions and to various semi-inclusive processes; (4) higher twist contributions; (5) exclusive processes; (6) transverse momentum effects; (7) jet and photon physics

  5. Reggeon interactions in perturbative QCD

    International Nuclear Information System (INIS)

    Kirschner, R.

    1994-08-01

    We study the pairwise interaction of reggeized gluons and quarks in the Regge limit of perturbative QCD. The interactions are represented as integral kernels in the transverse momentum space and as operators in the impact parameter space. We observe conformal symmetry and holomorphic factorization in all cases. (orig.)

  6. Basics of QCD perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Soper, D.E. [Univ. of Oregon, Eugene, OR (United States). Inst. of Theoretical Science

    1997-06-01

    This is an introduction to the use of QCD perturbation theory, emphasizing generic features of the theory that enable one to separate short-time and long-time effects. The author also covers some important classes of applications: electron-positron annihilation to hadrons, deeply inelastic scattering, and hard processes in hadron-hadron collisions. 31 refs., 38 figs.

  7. Status of chiral perturbation theory

    International Nuclear Information System (INIS)

    Ecker, G.

    1996-10-01

    A survey is made of semileptonic and nonleptonic kaon decays in the framework of chiral perturbation theory. The emphasis is on what has been done rather than how it was done. The theoretical predictions are compared with available experimental results. (author)

  8. Principles of chiral perturbation theory

    International Nuclear Information System (INIS)

    Leutwyler, H.

    1995-01-01

    An elementary discussion of the main concepts used in chiral perturbation theory is given in textbooks and a more detailed picture of the applications may be obtained from the reviews. Concerning the foundations of the method, the literature is comparatively scarce. So, I will concentrate on the basic concepts and explain why the method works. (author)

  9. Superfield perturbation theory and renormalization

    International Nuclear Information System (INIS)

    Delbourgo, R.

    1975-01-01

    The perturbation theory graphs and divergences in super-symmetric Lagrangian models are studied by using superfield techniques. In super PHI 3 -theory very little effort is needed to arrive at the single infinite (wave function) renormalization counterterm, while in PHI 4 -theory the method indicates the counter-Lagrangians needed at the one-loop level and possibly beyond

  10. Chiral symmetry in perturbative QCD

    International Nuclear Information System (INIS)

    Trueman, T.L.

    1979-04-01

    The chiral symmetry of quantum chromodynamics with massless quarks is unbroken in perturbation theory. Dimensional regularization is used. The ratio of the vector and axial vector renormalization constante is shown to be independent of the renormalization mass. The general results are explicitly verified to fourth order in g, the QCD coupling constant

  11. Perturbative QCD and exclusive processes

    International Nuclear Information System (INIS)

    Bennett, J.; Hawes, F.; Zhao, M.; Zyla, P.

    1991-01-01

    The authors discuss perturbation theory as applied to particle physics calculations. In particle physics one is generally interested in the scattering amplitude for a system going from some initial state to a final state. The intermediate state or states are unknown. To get the scattering amplitude it is necessary to sum the contributions from processes which pass through all possible intermediate states. Intermediate states involve the exchange of intermediate vector bosons between the particles, and with this interaction is associated a coupling constant α. Each additional boson exchange involves an additional contribution of α to the coupling. If α is less than 1, one can see that the relative contribution of higher order processes is less and less important as α falls. In QCD the gluons serve as the intermediate vector bosons exchanged by quarks and gluons, and the interaction constant is not really a constant, but depends upon the distance between the particles. At short distances the coupling is small, and one can assume perturbative expansions may converge rapidly. Exclusive scattering processes, as opposed to inclusive, are those in which all of the final state products are detected. The authors then discuss the application of perturbative QCD to the deuteron. The issues of chiral conservation and color transparancy are also discussed, in the scheme of large Q 2 interations, where perturbative QCD should be applicable

  12. Perturbative treatment of nuclear rotations

    International Nuclear Information System (INIS)

    Civitarese, O.

    1980-01-01

    In this work, it is described the case corresponding to perturbative quantum treatment of a fermion system in free rotation and the divergences which resulted from the 'break' in symmetry, associated by the adoption of a deformed basis as a non pertubed solution. (A.C.A.S.) [pt

  13. Genome-wide identification of key modulators of gene-gene interaction networks in breast cancer.

    Science.gov (United States)

    Chiu, Yu-Chiao; Wang, Li-Ju; Hsiao, Tzu-Hung; Chuang, Eric Y; Chen, Yidong

    2017-10-03

    With the advances in high-throughput gene profiling technologies, a large volume of gene interaction maps has been constructed. A higher-level layer of gene-gene interaction, namely modulate gene interaction, is composed of gene pairs of which interaction strengths are modulated by (i.e., dependent on) the expression level of a key modulator gene. Systematic investigations into the modulation by estrogen receptor (ER), the best-known modulator gene, have revealed the functional and prognostic significance in breast cancer. However, a genome-wide identification of key modulator genes that may further unveil the landscape of modulated gene interaction is still lacking. We proposed a systematic workflow to screen for key modulators based on genome-wide gene expression profiles. We designed four modularity parameters to measure the ability of a putative modulator to perturb gene interaction networks. Applying the method to a dataset of 286 breast tumors, we comprehensively characterized the modularity parameters and identified a total of 973 key modulator genes. The modularity of these modulators was verified in three independent breast cancer datasets. ESR1, the encoding gene of ER, appeared in the list, and abundant novel modulators were illuminated. For instance, a prognostic predictor of breast cancer, SFRP1, was found the second modulator. Functional annotation analysis of the 973 modulators revealed involvements in ER-related cellular processes as well as immune- and tumor-associated functions. Here we present, as far as we know, the first comprehensive analysis of key modulator genes on a genome-wide scale. The validity of filtering parameters as well as the conservativity of modulators among cohorts were corroborated. Our data bring new insights into the modulated layer of gene-gene interaction and provide candidates for further biological investigations.

  14. Systematic immunohistochemical screening for mismatch repair and ERCC1 gene expression from colorectal cancers in China: Clinicopathological characteristics and effects on survival.

    Directory of Open Access Journals (Sweden)

    Pan Li

    Full Text Available We performed a systematic screening of colorectal cancer (CRC tissues to investigate whether mismatch repair (MMR status and ERCC1 protein expression could be predictive of clinical outcomes for these patients following the recommendation of The Evaluation of Genomic Applications in Practice of Prevention (EGAPP.The expression of four MMR genes and ERCC1 were assessed by immunohistochemistry (IHC from cancer tissue samples of 2233 consecutive CRC patients.We observed that most CRC patients with a proficient MMR (pMMR status tended to have simultaneous ERCC1 protein expression (P< 0.001. Stage III CRC patients with deficient MMR (dMMR had higher prognoses than the same stage patients with pMMR (DFS: 74% vs 65%, P = 0.04; OS: 79% vs 69%, P = 0.04. Here, dMMR is also associated with poorer survival for stage II patients after chemotherapy (DFS: 66% vs 78%, P = 0.04. Stage II and III patients that were shown to express ERCC1 protein had higher DFS and OS than those that were deficient in expression (stage II, DFS: 83% vs 70%, P = 0.006; OS 85% vs 73%, P = 0.02. Stage III, DFS: 67% vs56%, P = 0.03; OS: 71% vs 57%, P = 0.04.Our results indicate that dMMR appeared to predictive of a survival benefit for stage III CRC patients. We also found the determination of ERCC1 expression to be useful for predicting DFS or OS for stage II and III CRC patients. In addition, the expression of MMR genes and ERCC1 showed a significant relationship.

  15. Characterization of the human nasal embryonic LHRH factor gene, NELF, and a mutation screening among 65 patients with idiopathic hypogonadotropic hypogonadism (IHH).

    Science.gov (United States)

    Miura, Kiyonori; Acierno, James S; Seminara, Stephanie B

    2004-01-01

    As the mouse nasal embryonic LHRH factor gene (Nelf) encodes a guidance molecule for the migration of the olfactory axon and gonadotropin-releasing hormone neurons, its human homolog, NELF, is a candidate gene for Kallmann syndrome, a disease of idiopathic hypogonadotropic hypogonadism (IHH) with anosmia or hyposmia. We report here characterization of NELF and results of mutation analysis in 65 IHH patients. Assembling EST clones, RACE, and sequencing showed that NELF mapped to 9q34.3 is composed of 16 exons and 15 introns with a 1,590-bp ORF encoding 530 amino acids. RT-PCR on a fetal brain cDNA library revealed five alternatively spliced variants. Among them, NELF-v1 has 93-94% identity at the amino acid level to mouse/rat Nelf, and four other transcripts are also highly conserved among the three species. A 3.0-kb transcript is expressed most highly in the adult and fetal brain, testis, and kidney, indicating that NELF plays a role in the function of these tissues. Mutation screening detected in a patient with IHH one novel heterozygous missense mutation (1438A>G, T480A) at the donor-splice site in exon 15 of NELF. As this mutation was not found in 100 normal control individuals, T480A may be associated with IHH. Four other novel SNPs (102C > T and 1029C > T within the coding region, and two IVS14+47C > T and IVS15+41G > A) were also identified in NELF.

  16. The E-screen test and the MELN gene-reporter assay used for determination of estrogenic activity in fruits and vegetables in relation to pesticide residues.

    Science.gov (United States)

    Schilirò, Tiziana; Porfido, Arianna; Longo, Annalisa; Coluccia, Sara; Gilli, Giorgio

    2013-12-01

    Endocrine-disrupting chemicals (EDCs) may lead to adverse systemic effects by interfering with normal hormone homeostasis, and diet is considered to be among the main routes of EDC exposure. The present study investigated the total estrogenic activity of fruits and vegetables by calculating the 17-β-estradiol equivalent quantity (EEQ) using two in vitro tests: the human breast cancer cell line (MCF-7 BUS) proliferation assay (E-screen test) and the luciferase-transfected human breast cancer cell line (MELN) gene-reporter assay. Of the 24 analyzed fruits and vegetables, 14 contained from 1 to 4 pesticide residues in concentrations ranging from 0.02 to 1.19 ppm, whereas the other 10 did not contain any pesticide residues. The EEQ values for all positive samples ranged from 0.010 to 0.616 μg/100g for the above in vitro tests. Our study demonstrates that estrogenic activity was present in fruits and vegetables and that the concentration of allowable pesticide residues and EEQ values were positively correlated; however, no correlation was found by comparing the estrogenic activity and the intrinsic content of phytoestrogens obtained from the available literature. A theoretical adult dietary intake of 0.7-0.9 ng EEQ/L/day from fruits and vegetables was calculated. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Perturbations in electromagnetic dark energy

    International Nuclear Information System (INIS)

    Jiménez, Jose Beltrán; Maroto, Antonio L.; Koivisto, Tomi S.; Mota, David F.

    2009-01-01

    It has been recently proposed that the presence of a temporal electromagnetic field on cosmological scales could explain the phase of accelerated expansion that the universe is currently undergoing. The field contributes as a cosmological constant and therefore, the homogeneous cosmology produced by such a model is exactly the same as that of ΛCDM. However, unlike a cosmological constant term, electromagnetic fields can acquire perturbations which in principle could affect CMB anisotropies and structure formation. In this work, we study the evolution of inhomogeneous scalar perturbations in this model. We show that provided the initial electromagnetic fluctuations generated during inflation are small, the model is perfectly compatible with both CMB and large scale structure observations at the same level of accuracy as ΛCDM

  18. Perturbative instabilities in Horava gravity

    International Nuclear Information System (INIS)

    Bogdanos, Charalampos; Saridakis, Emmanuel N

    2010-01-01

    We investigate the scalar and tensor perturbations in Horava gravity, with and without detailed balance, around a flat background. Once both types of perturbations are taken into account, it is revealed that the theory is plagued by ghost-like scalar instabilities in the range of parameters which would render it power-counting renormalizable, that cannot be overcome by simple tricks such as analytic continuation. Implementing a consistent flow between the UV and IR limits seems thus more challenging than initially presumed, regardless of whether the theory approaches general relativity at low energies or not. Even in the phenomenologically viable parameter space, the tensor sector leads to additional potential problems, such as fine-tunings and super-luminal propagation.

  19. The status of perturbative QCD

    International Nuclear Information System (INIS)

    Ellis, R.K.

    1988-10-01

    The advances in perturbative QCD are reviewed. The status of determinations of the coupling constant α/sub S/ and the parton distribution functions is presented. New theoretical results on the spin dependent structure functions of the proton are also reviewed. The theoretical description of the production of vector bosons, jets and heavy quarks is outlined with special emphasis on new results. Expected rates for top quark production at hadronic colliders are presented. 111 refs., 8 figs

  20. Scalar perturbations and conformal transformation

    International Nuclear Information System (INIS)

    Fabris, J.C.; Tossa, J.

    1995-11-01

    The non-minimal coupling of gravity to a scalar field can be transformed into a minimal coupling through a conformal transformation. We show how to connect the results of a perturbation calculation, performed around a Friedman-Robertson-Walker background solution, before and after the conformal transformation. We work in the synchronous gauge, but we discuss the implications of employing other frames. (author). 16 refs

  1. Perturbative QCD at finite temperature

    International Nuclear Information System (INIS)

    Altherr, T.

    1989-03-01

    We discuss an application of finite temperature QCD to lepton-pair production in a quark-gluon plasma. The perturbative calculation is performed within the realtime formalism. After cancellation of infrared and mass singularities, the corrections at O (α s ) are found to be very small in the region where the mass of the Drell-Yan pair is much larger than the temperature of the plasma. Interesting effects, however, appear at the annihilation threshold of the thermalized quarks

  2. Gauge-invariant cosmological density perturbations

    International Nuclear Information System (INIS)

    Sasaki, Misao.

    1986-06-01

    Gauge-invariant formulation of cosmological density perturbation theory is reviewed with special emphasis on its geometrical aspects. Then the gauge-invariant measure of the magnitude of a given perturbation is presented. (author)

  3. Perturbation of an exact strong gravity solution

    International Nuclear Information System (INIS)

    Baran, S.A.

    1982-10-01

    Perturbations of an exact strong gravity solution are investigated. It is shown, by using the new multipole expansions previously presented, that this exact and static spherically symmetric solution is stable under odd parity perturbations. (author)

  4. Network perturbation by recurrent regulatory variants in cancer.

    Directory of Open Access Journals (Sweden)

    Kiwon Jang

    2017-03-01

    Full Text Available Cancer driving genes have been identified as recurrently affected by variants that alter protein-coding sequences. However, a majority of cancer variants arise in noncoding regions, and some of them are thought to play a critical role through transcriptional perturbation. Here we identified putative transcriptional driver genes based on combinatorial variant recurrence in cis-regulatory regions. The identified genes showed high connectivity in the cancer type-specific transcription regulatory network, with high outdegree and many downstream genes, highlighting their causative role during tumorigenesis. In the protein interactome, the identified transcriptional drivers were not as highly connected as coding driver genes but appeared to form a network module centered on the coding drivers. The coding and regulatory variants associated via these interactions between the coding and transcriptional drivers showed exclusive and complementary occurrence patterns across tumor samples. Transcriptional cancer drivers may act through an extensive perturbation of the regulatory network and by altering protein network modules through interactions with coding driver genes.

  5. Geometric Hamiltonian structures and perturbation theory

    International Nuclear Information System (INIS)

    Omohundro, S.

    1984-08-01

    We have been engaged in a program of investigating the Hamiltonian structure of the various perturbation theories used in practice. We describe the geometry of a Hamiltonian structure for non-singular perturbation theory applied to Hamiltonian systems on symplectic manifolds and the connection with singular perturbation techniques based on the method of averaging

  6. Multiplicative perturbations of local C-semigroups

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... In this paper, we establish some left and right multiplicative perturbation theorems concerning local -semigroups when the generator of a perturbed local -semigroup S(⋅) may not be densely defined and the perturbation operator is a bounded linear operator from ¯D(A) into () such that = ...

  7. Multiplicative perturbations of local C-semigroups

    Indian Academy of Sciences (India)

    In this paper, we establish some left and right multiplicative perturbation theorems concerning local -semigroups when the generator of a perturbed local -semigroup S ( ⋅ ) may not be densely defined and the perturbation operator is a bounded linear operator from D ( A ) ¯ into () such that = on D ( A ) ¯ ...

  8. FRW Cosmological Perturbations in Massive Bigravity

    CERN Document Server

    Comelli, D; Pilo, L

    2014-01-01

    Cosmological perturbations of FRW solutions in ghost free massive bigravity, including also a second matter sector, are studied in detail. At early time, we find that sub horizon exponential instabilities are unavoidable and they lead to a premature departure from the perturbative regime of cosmological perturbations.

  9. Mutations of the GLA gene in young patients with stroke: the PORTYSTROKE study--screening genetic conditions in Portuguese young stroke patients.

    Science.gov (United States)

    Baptista, Miguel Viana; Ferreira, Susana; Pinho-E-Melo, Teresa; Carvalho, Marta; Cruz, Vítor T; Carmona, Cátia; Silva, Fernando A; Tuna, Assunção; Rodrigues, Miguel; Ferreira, Carla; Pinto, Ana A N; Leitão, André; Gabriel, João Paulo; Calado, Sofia; Oliveira, João Paulo; Ferro, José M

    2010-03-01

    Fabry disease is an X-linked monogenic disorder caused by mutations in the GLA gene. Recent data suggest that stroke in young adults may be associated with Fabry disease. We aimed to ascertain the prevalence of this disorder among young adult patients with stroke in Portugal by GLA genotyping. During 1 year, all patients aged 18 to 55 years with first-ever stroke, who were admitted into any of 12 neurology hospital departments in Portugal, were prospectively enrolled (n=625). Ischemic stroke was classified according to Trial of Org 10172 in Acute Stroke Treatment criteria. Alpha-galactosidase activity was further assayed in all patients with GLA mutations. Four hundred ninety-three patients (mean age, 45.4 years; 61% male) underwent genetic analyses: 364 with ischemic stroke, 89 with intracerebral hemorrhage, 26 with subarachnoid hemorrhage, and 14 with cerebral venous thrombosis. Twelve patients had missense GLA mutations: 9 with ischemic stroke (p.R118C: n=4; p.D313Y: n=5), including 5 patients with an identified cause of stroke (cardiac embolism: n=2; small vessel disease: n=2; other cause: n=1), 2 with intracerebral hemorrhage (p.R118C: n=1; p.D313Y: n=1), and one with cerebral venous thrombosis (p.R118C: n=1). Leukocyte alpha-galactosidase activity was subnormal in the hemizygous males and subnormal or low-normal in the heterozygous females. Estimated prevalence of missense GLA mutations was 2.4% (95% CI, 1.3% to 4.1%). Despite a low diagnostic yield, screening for GLA mutations should probably be considered in different types of stroke. Restricting investigation to patients with cryptogenic stroke may underestimate the true prevalence of Fabry disease in young patients with stroke.

  10. Screening for the genes involved in bombykol biosynthesis: Identification and functional characterization of Bombyx mori acyl carrier protein (BmACP

    Directory of Open Access Journals (Sweden)

    Atsushi eOhnishi

    2011-12-01

    Full Text Available Species-specific sex pheromones released by female moths to attract conspecific male moths are synthesized de novo in the pheromone gland (PG via fatty acid synthesis (FAS. Biosynthesis of moth sex pheromones is usually regulated by a neurohormone termed pheromone biosynthesis activating neuropeptide (PBAN, a 33-aa peptide that originates in the subesophageal ganglion. In the silkmoth, Bombyx mori, cytoplasmic lipid droplets (LDs, which store the sex pheromone (bombykol precursor fatty acid, accumulate in PG cells prior to eclosion. PBAN activation of the PBAN receptor stimulates lipolysis of the stored LD triacylglycerols (TAGs resulting in release of the bombykol precursor for final modification. While we have previously characterized a number of molecules involved in bombykol biosynthesis, little is known about the mechanisms of PBAN signaling that regulate the TAG lipolysis in PG cells. In the current study, we sought to further identify genes involved in bombykol biosynthesis as well as PBAN signaling, by using a subset of 312 expressed sequence tag (EST clones that are in either our B. mori PG cDNA library or the public B. mori EST databases, SilkBase and CYBERGATE, and which are preferentially expressed in the PG. Using RT-PCR expression analysis and an RNAi screening approach, we have identified another 8 EST clones involved in bombykol biosynthesis. Furthermore, we have determined the functional role of a clone designated BmACP that encodes B. mori acyl carrier protein (ACP. Our results indicate that BmACP plays an essential role in the biosynthesis of the bombykol precursor fatty acid via the canonical FAS pathway during pheromonogenesis.

  11. Evaluation of an hPXR reporter gene assay for the detection of aquatic emerging pollutants: screening of chemicals and application to water samples

    Energy Technology Data Exchange (ETDEWEB)

    Creusot, Nicolas; Kinani, Said; Maillot-Marechal, Emmanuelle; Porcher, Jean-Marc; Ait-Aissa, Selim [Unite Ecotoxicologie, INERIS, Verneuil-en-Halatte (France); Balaguer, Patrick [IRCM-UM1-CRLC Val d' Aurelle, INSERM U896, Montpellier (France); Tapie, Nathalie; LeMenach, Karyn; Budzinski, Helene [ISM/LPTC-UMR 5255 CNRS Universite Bordeaux 1, Talence (France)

    2010-01-15

    Many environmental endocrine-disrupting compounds act as ligands for nuclear receptors. Among these receptors, the human pregnane X receptor (hPXR) is well described as a xenobiotic sensor to various classes of chemicals, including pharmaceuticals, pesticides, and steroids. To assess the potential use of PXR as a sensor for aquatic emerging pollutants, we employed an in vitro reporter gene assay (HG5LN-hPXR cells) to screen a panel of environmental chemicals and to assess PXR-active chemicals in (waste) water samples. Of the 57 compounds tested, 37 were active in the bioassay and 10 were identified as new PXR agonists: triazin pesticides (promethryn, terbuthryn, terbutylazine), pharmaceuticals (fenofibrate, bezafibrate, clonazepam, medazepam) and non co-planar polychlorobiphenyls (PCBs; PCB101, 138, 180). Furthermore, we detected potent PXR activity in two types of water samples: passive polar organic compounds integrative sampler (POCIS) extracts from a river moderately impacted by agricultural and urban inputs and three effluents from sewage treatment works (STW). Fractionation of POCIS samples showed the highest PXR activity in the less polar fraction, while in the effluents, PXR activity was mainly associated with the dissolved water phase. Chemical analyses quantified several PXR-active substances (i.e., alkylphenols, hormones, pharmaceuticals, pesticides, PCBs, bisphenol A) in POCIS fractions and effluent extracts. However, mass-balance calculations showed that the analyzed compounds explained only 0.03% and 1.4% of biological activity measured in POCIS and STW samples, respectively. In effluents, bisphenol A and 4-tert-octylphenol were identified as main contributors of instrumentally derived PXR activities. Finally, the PXR bioassay provided complementary information as compared to estrogenic, androgenic, and dioxin-like activity measured in these samples. This study shows the usefulness of HG5LN-hPXR cells to detect PXR-active compounds in water samples

  12. Circulating Tfh1 (cTfh1 cell numbers and PD1 expression are elevated in low-grade B-cell non-Hodgkin's lymphoma and cTfh gene expression is perturbed in marginal zone lymphoma.

    Directory of Open Access Journals (Sweden)

    Elliot T Byford

    Full Text Available CD4+ T-cell subsets are found in the tumour microenvironment (TME of low-grade B-cell non-Hodgkin's lymphomas such as marginal zone lymphoma (MZL or follicular lymphoma (FL. Both numbers and architecture of activating follicular helper T-cells (Tfh and suppressive Treg in the TME of FL are associated with clinical outcomes. There has been almost no previous work on CD4+ T-cells in MZL. It is now recognised that circulating CD4+CXCR5+ T-cells are the memory compartment of Tfh cells. We determined differences in number of circulating Tfh (cTfh cells and cTfh subsets between normal subjects and patients with FL or MZL. Lymphoma patients showed increased numbers of cTfh1 and reduced cTfh17 cells due to decreased expression of the subset-defining marker CCR6 in patients. PD1, a surface marker associated with Tfh cells, showed increased expression on cTfh subsets in patients. Focusing on MZL we determined expression of 96 T-cell associated genes by microfluidic qRT-PCR. Analysis of differentially expressed genes showed significant differences between normal subjects and patients both for bulk cTfh (CCL4 and the cTfh1 subset (JAK3. While our findings require confirmation in larger studies we suggest that analysis of number and gene expression of circulating T-cells might be a source of clinically useful information as is the case for T-cells within lymphoma lymph nodes.

  13. Hadronic Structure from Perturbative Dressing

    Energy Technology Data Exchange (ETDEWEB)

    Arash, Firooz [Physics Department, Tafresh University, Tafresh, Iran and Center for theoretical physics and Mathematics, AEOI, P.O. Box 11365-8486, Tehran (Iran, Islamic Republic of)]. E-mail: farash@cic.aut.ac.ir

    2005-09-15

    Perturbative dressing of a valence quark in QCD produces the internal structure of an extended object, the so-called Valon. The valon structure is universal and independent of the hosting hadron. Polarized and unpolarized proton and pion structure functions are calculated in the valon representation. One finds that although all the available data on g{sub 1}{sup p,n,d} are easily reproduced, a sizable orbital angular momentum associated with the partonic structure of the valon is required in order to have a spin 1/2 valon.

  14. Perturbations in loop quantum cosmology

    International Nuclear Information System (INIS)

    Nelson, W; Agullo, I; Ashtekar, A

    2014-01-01

    The era of precision cosmology has allowed us to accurately determine many important cosmological parameters, in particular via the CMB. Confronting Loop Quantum Cosmology with these observations provides us with a powerful test of the theory. For this to be possible, we need a detailed understanding of the generation and evolution of inhomogeneous perturbations during the early, quantum gravity phase of the universe. Here, we have described how Loop Quantum Cosmology provides a completion of the inflationary paradigm, that is consistent with the observed power spectra of the CMB

  15. Perturbation calculations with Wilson loop

    International Nuclear Information System (INIS)

    Peixoto Junior, L.B.

    1984-01-01

    We present perturbative calculations with the Wilson loop (WL). The dimensional regularization method is used with a special attention concerning to the problem of divergences in the WL expansion in second and fourth orders, in three and four dimensions. We show that the residue in the pole, in 4d, of the fourth order graphs contribution sum is important for the charge renormalization. We compute up to second order the exact expression of the WL, in three-dimensional gauge theories with topological mass as well as its assimptotic behaviour for small and large distances. the author [pt

  16. Mobile ankle and knee perturbator.

    Science.gov (United States)

    Andersen, Jacob Buus; Sinkjaer, Thomas

    2003-10-01

    A mobile ankle and knee perturbator has been developed. It consists of a functional joint with an integrated clutch. Four Bowden wires connect the joint to a powerful motor and a double pneumatic cylinder. When needed during any time of the gait cycle, it is possible to impose an ankle rotation by engaging the clutch and rotating the ankle or knee joint with a predefined displacement. The system is designed to investigate electrophysiological and biomechanical features of the human ankle or knee joint during gait.

  17. "Phonon" scattering beyond perturbation theory

    Science.gov (United States)

    Qiu, WuJie; Ke, XueZhi; Xi, LiLi; Wu, LiHua; Yang, Jiong; Zhang, WenQing

    2016-02-01

    Searching and designing materials with intrinsically low lattice thermal conductivity (LTC) have attracted extensive consideration in thermoelectrics and thermal management community. The concept of part-crystalline part-liquid state, or even part-crystalline part-amorphous state, has recently been proposed to describe the exotic structure of materials with chemical- bond hierarchy, in which a set of atoms is weakly bonded to the rest species while the other sublattices retain relatively strong rigidity. The whole system inherently manifests the coexistence of rigid crystalline sublattices and fluctuating noncrystalline substructures. Representative materials in the unusual state can be classified into two categories, i.e., caged and non-caged ones. LTCs in both systems deviate from the traditional T -1 relationship ( T, the absolute temperature), which can hardly be described by small-parameter-based perturbation approaches. Beyond the classical perturbation theory, an extra rattling-like scattering should be considered to interpret the liquid-like and sublattice-amorphization-induced heat transport. Such a kind of compounds could be promising high-performance thermoelectric materials, due to the extremely low LTCs. Other physical properties for these part-crystalline substances should also exhibit certain novelty and deserve further exploration.

  18. Perturbation theory for Alfven wave

    International Nuclear Information System (INIS)

    Yoshida, Z.; Mahajan, S.M.

    1995-01-01

    The Alfven wave is the dominant low frequency transverse mode of a magnetized plasma. The Alfven wave propagation along the magnetic field, and displays a continuous spectrum even in a bounded plasma. This is essentially due to the degeneracy of the wave characteristics, i.e. the frequency (ω) is primarily determined by the wave number in the direction parallel to the ambient magnetic field (k parallel ) and is independent of the perpendicular wavenumbers. The characteristics, that are the direction along which the wave energy propagates, are identical to the ambient magnetic field lines. Therefore, the spectral structure of the Alfven wave has a close relationship with the geometric structure of the magnetic field lines. In an inhomogeneous plasma, the Alfven resonance constitutes a singularity for the defining wave equation; this results in a singular eigenfunction corresponding to the continuous spectrum. The aim of this review is to present an overview of the perturbation theory for the Alfven wave. Emphasis is placed on those perturbations of the continuous spectrum which lead to the creation of point spectra. Such qualitative changes in the spectrum are relevant to many plasma phenomena

  19. Non-perturbative Debye mass in finite-T QCD

    CERN Document Server

    Kajantie, Keijo; Peisa, J; Rajantie, A; Rummukainen, K; Shaposhnikov, Mikhail E

    1997-01-01

    Employing a non-perturbative gauge invariant definition of the Debye screening mass m_D in the effective field theory approach to finite T QCD, we use 3d lattice simulations to determine the leading O(g^2) and to estimate the next-to-leading O(g^3) corrections to m_D in the high temperature region. The O(g^2) correction is large and modifies qualitatively the standard power-counting hierarchy picture of correlation lengths in high temperature QCD.

  20. Characterizing metabolic pathway diversification in the context of perturbation size.

    Science.gov (United States)

    Yang, Laurence; Srinivasan, Shyamsundhar; Mahadevan, Radhakrishnan; Cluett, William R

    2015-03-01

    Cell metabolism is an important platform for sustainable biofuel, chemical and pharmaceutical production but its complexity presents a major challenge for scientists and engineers. Although in silico strains have been designed in the past with predicted performances near the theoretical maximum, real-world performance is often sub-optimal. Here, we simulate how strain performance is impacted when subjected to many randomly varying perturbations, including discrepancies between gene expression and in vivo flux, osmotic stress, and substrate uptake perturbations due to concentration gradients in bioreactors. This computational study asks whether robust performance can be achieved by adopting robustness-enhancing mechanisms from naturally evolved organisms-in particular, redundancy. Our study shows that redundancy, typically perceived as a ubiquitous robustness-enhancing strategy in nature, can either improve or undermine robustness depending on the magnitude of the perturbations. We also show that the optimal number of redundant pathways used can be predicted for a given perturbation size. Copyright © 2015. Published by Elsevier Inc.

  1. Perturbations i have Known and Loved

    Science.gov (United States)

    Field, Robert W.

    2011-06-01

    A spectroscopic perturbation is a disruption of a ^1Σ-^1Σ-like regular pattern that can embody level-shifts, extra lines, and intensity anomalies. Once upon a time, when a band was labeled ``perturbed,'' it was considered worthless because it could at best yield molecular constants unsuited for archival tables. Nevertheless, a few brave spectroscopists, notably Albin Lagerqvist and Richard Barrow, collected perturbations because they knew that the pattern of multiple perturbations formed an intricate puzzle that would eventually reveal the presence and electronic symmetry of otherwise unobservable electronic states. There are many kinds of patterns of broken patterns. In my PhD thesis I showed how to determine absolute vibrational assignments for the perturber from patterns among the observed values of perturbation matrix elements. When a ^3Π state is perturbed, its six (Ω, parity) components capture a pattern of level shifts and intensity anomalies that reveals more about the nature of the perturber than a simple perturbation of the single component of a ^1Σ state. In perturbation-facilitated OODR, a perturbed singlet level acts as a spectroscopic doorway through which the entire triplet manifold may be systematically explored. For polyatomic molecule vibrations, a vibrational polyad (a group of mutually perturbing vibrational levels, among which the perturbation matrix elements are expected to follow harmonic oscillator scaling rules) can contain more components than a ^3Π state and intrapolyad patterns can be exquisitely sensitive not merely to the nature of an interloper within the polyad but also to the eigenvector character of the vibronic state from which the polyad is viewed. Variation of scaled polyad interaction parameters from one polyad to the next, a pattern of patterns, can signal proximity to an isomerization barrier. Everything in Rydberg-land seems to scale as N⋆-3, yet a trespassing valence state causes all scaling and propensity rules go

  2. New Methods in Non-Perturbative QCD

    Energy Technology Data Exchange (ETDEWEB)

    Unsal, Mithat [North Carolina State Univ., Raleigh, NC (United States)

    2017-01-31

    In this work, we investigate the properties of quantum chromodynamics (QCD), by using newly developing mathematics and physics formalisms. Almost all of the mass in the visible universe emerges from a quantum chromodynamics (QCD), which has a completely negligible microscopic mass content. An intimately related issue in QCD is the quark confinement problem. Answers to non-perturbative questions in QCD remained largely elusive despite much effort over the years. It is also believed that the usual perturbation theory is inadequate to address these kinds of problems. Perturbation theory gives a divergent asymptotic series (even when the theory is properly renormalized), and there are non-perturbative phenomena which never appear at any order in perturbation theory. Recently, a fascinating bridge between perturbation theory and non-perturbative effects has been found: a formalism called resurgence theory in mathematics tells us that perturbative data and non-perturbative data are intimately related. Translating this to the language of quantum field theory, it turns out that non-perturbative information is present in a coded form in perturbation theory and it can be decoded. We take advantage of this feature, which is particularly useful to understand some unresolved mysteries of QCD from first principles. In particular, we use: a) Circle compactifications which provide a semi-classical window to study confinement and mass gap problems, and calculable prototypes of the deconfinement phase transition; b) Resurgence theory and transseries which provide a unified framework for perturbative and non-perturbative expansion; c) Analytic continuation of path integrals and Lefschetz thimbles which may be useful to address sign problem in QCD at finite density.

  3. Toxicology screen

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003578.htm Toxicology screen To use the sharing features on this page, please enable JavaScript. A toxicology screen refers to various tests that determine the ...

  4. Perturbativity in the seesaw mechanism

    International Nuclear Information System (INIS)

    Asaka, Takehiko; Tsuyuki, Takanao

    2016-01-01

    We consider the Standard Model extended by right-handed neutrinos to explain massive neutrinos through the seesaw mechanism. The new fermion can be observed when it has a sufficiently small mass and large mixings to left-handed neutrinos. If such a particle is the lightest right-handed neutrino, its contribution to the mass matrix of active neutrinos needs to be canceled by that of a heavier one. Yukawa couplings of the heavier one are then larger than those of the lightest one. We show that the perturbativity condition gives a severe upper bound on the mixing of the lightest right-handed neutrino, depending on the masses of heavier ones. Models of high energy phenomena, such as leptogenesis, can be constrained by low energy experiments.

  5. Initial conditions for cosmological perturbations

    Science.gov (United States)

    Ashtekar, Abhay; Gupt, Brajesh

    2017-02-01

    Penrose proposed that the big bang singularity should be constrained by requiring that the Weyl curvature vanishes there. The idea behind this past hypothesis is attractive because it constrains the initial conditions for the universe in geometric terms and is not confined to a specific early universe paradigm. However, the precise statement of Penrose’s hypothesis is tied to classical space-times and furthermore restricts only the gravitational degrees of freedom. These are encapsulated only in the tensor modes of the commonly used cosmological perturbation theory. Drawing inspiration from the underlying idea, we propose a quantum generalization of Penrose’s hypothesis using the Planck regime in place of the big bang, and simultaneously incorporating tensor as well as scalar modes. Initial conditions selected by this generalization constrain the universe to be as homogeneous and isotropic in the Planck regime as permitted by the Heisenberg uncertainty relations.

  6. Initial conditions for cosmological perturbations

    International Nuclear Information System (INIS)

    Ashtekar, Abhay; Gupt, Brajesh

    2017-01-01

    Penrose proposed that the big bang singularity should be constrained by requiring that the Weyl curvature vanishes there. The idea behind this past hypothesis is attractive because it constrains the initial conditions for the universe in geometric terms and is not confined to a specific early universe paradigm. However, the precise statement of Penrose’s hypothesis is tied to classical space-times and furthermore restricts only the gravitational degrees of freedom. These are encapsulated only in the tensor modes of the commonly used cosmological perturbation theory. Drawing inspiration from the underlying idea, we propose a quantum generalization of Penrose’s hypothesis using the Planck regime in place of the big bang, and simultaneously incorporating tensor as well as scalar modes. Initial conditions selected by this generalization constrain the universe to be as homogeneous and isotropic in the Planck regime as permitted by the Heisenberg uncertainty relations . (paper)

  7. Curvature perturbations from dimensional decoupling

    CERN Document Server

    Giovannini, Massimo

    2005-01-01

    The scalar modes of the geometry induced by dimensional decoupling are investigated. In the context of the low energy string effective action, solutions can be found where the spatial part of the background geometry is the direct product of two maximally symmetric Euclidean manifolds whose related scale factors evolve at a dual rate so that the expanding dimensions first accelerate and then decelerate while the internal dimensions always contract. After introducing the perturbative treatment of the inhomogeneities, a class of five-dimensional geometries is discussed in detail. Quasi-normal modes of the system are derived and the numerical solution for the evolution of the metric inhomogeneities shows that the fluctuations of the internal dimensions provide a term that can be interpreted, in analogy with the well-known four-dimensional situation, as a non-adiabatic pressure density variation. Implications of this result are discussed with particular attention to string cosmological scenarios.

  8. Revealing the Determinants of Widespread Alternative Splicing Perturbation in Cancer

    Directory of Open Access Journals (Sweden)

    Yongsheng Li

    2017-10-01

    Full Text Available It is increasingly appreciated that alternative splicing plays a key role in generating functional specificity and diversity in cancer. However, the mechanisms by which cancer mutations perturb splicing remain unknown. Here, we developed a network-based strategy, DrAS-Net, to investigate more than 2.5 million variants across cancer types and link somatic mutations with cancer-specific splicing events. We identified more than 40,000 driver variant candidates and their 80,000 putative splicing targets deregulated in 33 cancer types and inferred their functional impact. Strikingly, tumors with splicing perturbations show reduced expression of immune system-related genes and increased expression of cell proliferation markers. Tumors harboring different mutations in the same gene often exhibit distinct splicing perturbations. Further stratification of 10,000 patients based on their mutation-splicing relationships identifies subtypes with distinct clinical features, including survival rates. Our work reveals how single-nucleotide changes can alter the repertoires of splicing isoforms, providing insights into oncogenic mechanisms for precision medicine.

  9. Detection of perturbation phases and developmental stages in organisms from DNA microarray time series data.

    Directory of Open Access Journals (Sweden)

    Marianne Rooman

    Full Text Available Available DNA microarray time series that record gene expression along the developmental stages of multicellular eukaryotes, or in unicellular organisms subject to external perturbations such as stress and diauxie, are analyzed. By pairwise comparison of the gene expression profiles on the basis of a translation-invariant and scale-invariant distance measure corresponding to least-rectangle regression, it is shown that peaks in the average distance values are noticeable and are localized around specific time points. These points systematically coincide with the transition points between developmental phases or just follow the external perturbations. This approach can thus be used to identify automatically, from microarray time series alone, the presence of external perturbations or the succession of developmental stages in arbitrary cell systems. Moreover, our results show that there is a striking similarity between the gene expression responses to these a priori very different phenomena. In contrast, the cell cycle does not involve a perturbation-like phase, but rather continuous gene expression remodeling. Similar analyses were conducted using three other standard distance measures, showing that the one we introduced was superior. Based on these findings, we set up an adapted clustering method that uses this distance measure and classifies the genes on the basis of their expression profiles within each developmental stage or between perturbation phases.

  10. Mathematical inference and control of molecular networks from perturbation experiments

    Science.gov (United States)

    Mohammed-Rasheed, Mohammed

    One of the main challenges facing biologists and mathematicians in the post genomic era is to understand the behavior of molecular networks and harness this understanding into an educated intervention of the cell. The cell maintains its function via an elaborate network of interconnecting positive and negative feedback loops of genes, RNA and proteins that send different signals to a large number of pathways and molecules. These structures are referred to as genetic regulatory networks (GRNs) or molecular networks. GRNs can be viewed as dynamical systems with inherent properties and mechanisms, such as steady-state equilibriums and stability, that determine the behavior of the cell. The biological relevance of the mathematical concepts are important as they may predict the differentiation of a stem cell, the maintenance of a normal cell, the development of cancer and its aberrant behavior, and the design of drugs and response to therapy. Uncovering the underlying GRN structure from gene/protein expression data, e.g., microarrays or perturbation experiments, is called inference or reverse engineering of the molecular network. Because of the high cost and time consuming nature of biological experiments, the number of available measurements or experiments is very small compared to the number of molecules (genes, RNA and proteins). In addition, the observations are noisy, where the noise is due to the measurements imperfections as well as the inherent stochasticity of genetic expression levels. Intra-cellular activities and extra-cellular environmental attributes are also another source of variability. Thus, the inference of GRNs is, in general, an under-determined problem with a highly noisy set of observations. The ultimate goal of GRN inference and analysis is to be able to intervene within the network, in order to force it away from undesirable cellular states and into desirable ones. However, it remains a major challenge to design optimal intervention strategies

  11. Closed form bound-state perturbation theory

    Directory of Open Access Journals (Sweden)

    Ollie J. Rose

    1980-01-01

    Full Text Available The perturbed Schrödinger eigenvalue problem for bound states is cast into integral form using Green's Functions. A systematic algorithm is developed and applied to the resulting equation giving rise to approximate solutions expressed as functions of the given perturbation parameter. As a by-product, convergence radii for the traditional Rayleigh-Schrödinger and Brillouin-Wigner perturbation theories emerge in a natural way.

  12. Aminoacidopathies: Prevalence, Etiology, Screening, and Treatment Options.

    Science.gov (United States)

    Wasim, Muhammad; Awan, Fazli Rabbi; Khan, Haq Nawaz; Tawab, Abdul; Iqbal, Mazhar; Ayesha, Hina

    2018-04-01

    Inborn errors of metabolism (IEMs) are a group of inherited metabolic disorders which are caused by mutations in the specific genes that lead to impaired proteins or enzymes production. Different metabolic pathways are perturbed due to the deficiency or lack of enzymes. To date, more than 500 IEMs have been reported with most of them being untreatable. However, fortunately 91 such disorders are potentially treatable, if diagnosed at an earlier stage of life. IEMs have been classified into different categories and one class of IEMs, characterized by the physiological disturbances of amino acids is called as aminoacidopathies. Out of 91 treatable IEM, thirteen disorders are amino acid related. Aminoacidopathies can be detected by chromatography and mass spectrometry based analytical techniques (e.g., HPLC, GC-MS, LC-MS/MS) for amino acid level changes, and through genetic assays (e.g., PCR, TaqMan Genotyping, DNA sequencing) at the mutation level in the corresponding genes. Hence, this review is focused to describe thirteen common aminoacidopathies namely: Phenylketonuria (PKU), Maple Syrup Urine Disease (MSUD), Homocystinuria/Methylene Tetrahydrofolate Reductase (MTHFR) deficiency, Tyrosinemia type II, Citrullinemia type I and type II, Argininosuccinic aciduria, Carbamoyl Phosphate Synthetase I (CPS) deficiency, Argininemia (arginase deficiency), Hyperornithinemia-Hyperammonemia-Homocitrullinuria (HHH) syndrome, N-Acetylglutamate Synthase (NAGS) deficiency, Ornithine Transcarbamylase (OTC) deficiency, and Pyruvate Dehydrogenase (PDH) complex deficiency. Furthermore, the etiology, prevalence and commonly used analytical techniques for screening of aminoacidopathies are briefly described. This information would be helpful to researchers and clinicians especially from developing countries to initiate newborn screening programs for aminoacidopathies.

  13. Kato expansion in quantum canonical perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Nikolaev, Andrey, E-mail: Andrey.Nikolaev@rdtex.ru [Institute of Computing for Physics and Technology, Protvino, Moscow Region, Russia and RDTeX LTD, Moscow (Russian Federation)

    2016-06-15

    This work establishes a connection between canonical perturbation series in quantum mechanics and a Kato expansion for the resolvent of the Liouville superoperator. Our approach leads to an explicit expression for a generator of a block-diagonalizing Dyson’s ordered exponential in arbitrary perturbation order. Unitary intertwining of perturbed and unperturbed averaging superprojectors allows for a description of ambiguities in the generator and block-diagonalized Hamiltonian. We compare the efficiency of the corresponding computational algorithm with the efficiencies of the Van Vleck and Magnus methods for high perturbative orders.

  14. Perturbative spacetimes from Yang-Mills theory

    Energy Technology Data Exchange (ETDEWEB)

    Luna, Andrés [School of Physics and Astronomy, University of Glasgow,Glasgow G12 8QQ, Scotland (United Kingdom); Monteiro, Ricardo [Theoretical Physics Department, CERN,Geneva (Switzerland); Nicholson, Isobel; Ochirov, Alexander; O’Connell, Donal [Higgs Centre for Theoretical Physics,School of Physics and Astronomy, The University of Edinburgh,Edinburgh EH9 3JZ, Scotland (United Kingdom); Westerberg, Niclas [Institute of Photonics and Quantum Sciences,School of Engineering and Physical Sciences, Heriot-Watt University,Edinburgh (United Kingdom); Higgs Centre for Theoretical Physics,School of Physics and Astronomy, The University of Edinburgh,Edinburgh EH9 3JZ, Scotland (United Kingdom); White, Chris D. [Centre for Research in String Theory,School of Physics and Astronomy, Queen Mary University of London,327 Mile End Road, London E1 4NS (United Kingdom)

    2017-04-12

    The double copy relates scattering amplitudes in gauge and gravity theories. In this paper, we expand the scope of the double copy to construct spacetime metrics through a systematic perturbative expansion. The perturbative procedure is based on direct calculation in Yang-Mills theory, followed by squaring the numerator of certain perturbative diagrams as specified by the double-copy algorithm. The simplest spherically symmetric, stationary spacetime from the point of view of this procedure is a particular member of the Janis-Newman-Winicour family of naked singularities. Our work paves the way for applications of the double copy to physically interesting problems such as perturbative black-hole scattering.

  15. Kato expansion in quantum canonical perturbation theory

    International Nuclear Information System (INIS)

    Nikolaev, Andrey

    2016-01-01

    This work establishes a connection between canonical perturbation series in quantum mechanics and a Kato expansion for the resolvent of the Liouville superoperator. Our approach leads to an explicit expression for a generator of a block-diagonalizing Dyson’s ordered exponential in arbitrary perturbation order. Unitary intertwining of perturbed and unperturbed averaging superprojectors allows for a description of ambiguities in the generator and block-diagonalized Hamiltonian. We compare the efficiency of the corresponding computational algorithm with the efficiencies of the Van Vleck and Magnus methods for high perturbative orders.

  16. Perturbation methods for power and reactivity reconstruction

    International Nuclear Information System (INIS)

    Palmiotti, G.; Salvatores, M.; Estiot, J.C.; Broccoli, U.; Bruna, G.; Gomit, J.M.

    1987-01-01

    This paper deals with recent developments and applications in perturbation methods. Two types of methods are used. The first one is an explicit method, which allows the explicit reconstruction of a perturbed flux using a linear combination of a library of functions. In our application, these functions are the harmonics (i.e. the high order eigenfunctions of the system). The second type is based on the Generalized Perturbation Theory GPT and needs the calculation of an importance function for each integral parameter of interest. Recent developments of a particularly useful high order formulation allows to obtain satisfactory results also for very large perturbations

  17. On adiabatic perturbations in the ekpyrotic scenario

    International Nuclear Information System (INIS)

    Linde, A.; Mukhanov, V.; Vikman, A.

    2010-01-01

    In a recent paper, Khoury and Steinhardt proposed a way to generate adiabatic cosmological perturbations with a nearly flat spectrum in a contracting Universe. To produce these perturbations they used a regime in which the equation of state exponentially rapidly changed during a short time interval. Leaving aside the singularity problem and the difficult question about the possibility to transmit these perturbations from a contracting Universe to the expanding phase, we will show that the methods used in Khoury are inapplicable for the description of the cosmological evolution and of the process of generation of perturbations in this scenario

  18. New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion.

    Science.gov (United States)

    Shinohara, Masakazu; Ar Rochmah, Mawaddah; Nakanishi, Kenta; Harahap, Nur Imma Fatimah; Niba, Emma Tabe Eko; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Bouike, Yoshihiro; Nishio, Hisahide

    2017-09-07

    Spinal muscular atrophy (SMA) is a frequent autosomal recessive disorder, characterized by lower motor neuron loss in the spinal cord. More than 95% of SMA patients show homozygous survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique. However, non-specific amplification products were observed with mCOP-PCR, which might lead to erroneous interpretation of the screening results. To establish an improved version of the mCOP-PCR screening system without non-specific amplification. DNA samples were assayed using a new version of the mCOP-PCR screening system. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The new mCOP-PCR method contained a targeted pre-amplification step of the region, including an SMN1-specific nucleotide, prior to the mCOP-PCR step. mCOP-PCR products were electrophoresed on agarose gels. No non-specific amplification products were detected in electrophoresis gels with the new mCOP-PCR screening system. An additional targeted pre-amplification step eliminated non-specific amplification from mCOP-PCR screening.

  19. Development and Validation of a P-35S, T-nos, T-35S and P-FMV Tetraplex Real-time PCR Screening Method to Detect Regulatory Genes of Genetically Modified Organisms in Food.

    Science.gov (United States)

    Eugster, Albert; Murmann, Petra; Kaenzig, Andre; Breitenmoser, Alda

    2014-10-01

    In routine analysis screening methods based on real-time PCR (polymerase chain reaction) are most commonly used for the detection of genetically modified (GM) plant material in food and feed. Screening tests are based on sequences frequently used for GM development, allowing the detection of a large number of GMOs (genetically modified organisms). Here, we describe the development and validation of a tetraplex real-time PCR screening assay comprising detection systems for the regulatory genes Cauliflower Mosaic Virus 35S promoter, Agrobacterium tumefaciens nos terminator, Cauliflower Mosaic Virus 35S terminator and Figwort Mosaic Virus 34S promoter. Three of the four primer and probe combinations have already been published elsewhere, whereas primers and probe for the 35S terminator have been developed in-house. Adjustment of primer and probe concentrations revealed a high PCR sensitivity with insignificant physical cross-talk between the four detection channels. The sensitivity of each PCR-system is sufficient to detect a GMO concentration as low as 0.05% of the containing respective element. The specificity of the described tetraplex is high when tested on DNA from GM maize, soy, rapeseed and tomato. We also demonstrate the robustness of the system by inter-laboratory tests. In conclusion, this method provides a sensitive and reliable screening procedure for the detection of the most frequently used regulatory elements present in GM crops either authorised or unauthorised for food.

  20. Colon cancer screening

    Science.gov (United States)

    Screening for colon cancer; Colonoscopy - screening; Sigmoidoscopy - screening; Virtual colonoscopy - screening; Fecal immunochemical test; Stool DNA test; sDNA test; Colorectal cancer - screening; Rectal ...

  1. Clofazimine inhibits human Kv1.3 potassium channel by perturbing calcium oscillation in T lymphocytes.

    Directory of Open Access Journals (Sweden)

    Yunzhao R Ren

    Full Text Available The Kv1.3 potassium channel plays an essential role in effector memory T cells and has been implicated in several important autoimmune diseases including multiple sclerosis, psoriasis and type 1 diabetes. A number of potent small molecule inhibitors of Kv1.3 channel have been reported, some of which were found to be effective in various animal models of autoimmune diseases. We report herein the identification of clofazimine, a known anti-mycobacterial drug, as a novel inhibitor of human Kv1.3. Clofazimine was initially identified as an inhibitor of intracellular T cell receptor-mediated signaling leading to the transcriptional activation of human interleukin-2 gene in T cells from a screen of the Johns Hopkins Drug Library. A systematic mechanistic deconvolution revealed that clofazimine selectively blocked the Kv1.3 channel activity, perturbing the oscillation frequency of the calcium-release activated calcium channel, which in turn led to the inhibition of the calcineurin-NFAT signaling pathway. These effects of clofazimine provide the first line of experimental evidence in support of a causal relationship between Kv1.3 and calcium oscillation in human T cells. Furthermore, clofazimine was found to be effective in blocking human T cell-mediated skin graft rejection in an animal model in vivo. Together, these results suggest that clofazimine is a promising immunomodulatory drug candidate for treating a variety of autoimmune disorders.

  2. Perturbation-expression analysis identifies RUNX1 as a regulator of human mammary stem cell differentiation.

    Directory of Open Access Journals (Sweden)

    Ethan S Sokol

    2015-04-01

    Full Text Available The search for genes that regulate stem cell self-renewal and differentiation has been hindered by a paucity of markers that uniquely label stem cells and early progenitors. To circumvent this difficulty we have developed a method that identifies cell-state regulators without requiring any markers of differentiation, termed Perturbation-Expression Analysis of Cell States (PEACS. We have applied this marker-free approach to screen for transcription factors that regulate mammary stem cell differentiation in a 3D model of tissue morphogenesis and identified RUNX1 as a stem cell regulator. Inhibition of RUNX1 expanded bipotent stem cells and blocked their differentiation into ductal and lobular tissue rudiments. Reactivation of RUNX1 allowed exit from the bipotent state and subsequent differentiation and mammary morphogenesis. Collectively, our findings show that RUNX1 is required for mammary stem cells to exit a bipotent state, and provide a new method for discovering cell-state regulators when markers are not available.

  3. Perturbed angular correlations and distributions

    International Nuclear Information System (INIS)

    Makaryunas, K.

    1976-01-01

    The present index comprises original works and review papers on the perturbed angular correlations (PAC) and distributions (PAD). The articles published in the Soviet and foreign journals as well as the materials of conferences, monographs and collections published in the USSR and abroad, the preprints produced by various institutes and abstracts of disertations are included from 1948 up to 1973. The whole material compiled in this index is divided into three parts. Part one is a bibliographic index. All papers in this part are divided into three sections. Section one comprises the papers devoted to the theoretical works on PAC, review papers, monographs, materials of conferences. Section two deals with the works of methodical character where correlation spectrometers as well as the treatment of experimental data are described. In section three experimental works with concrete nuclei are compiled. Part two gives the characteristic of works performed with concrete nuclei. This part is presented in the form of the table in which the works are systematized according to the chemical elements and isotopes. The table shows the characteristics of the nuclear levels used in the investigations by PAC as well as brief characteristics of experiments and results obtained. Part three - appendix contains alphabetic index of the authors, the list of the used editions with the abbreviations of the titles of these editions. The lists indicating the dynamic of the quantity of works on PAC and the distribution according to the literature sources are also given

  4. Chiral perturbation theory with nucleons

    International Nuclear Information System (INIS)

    Meissner, U.G.

    1991-09-01

    I review the constraints posed on the interactions of pions, nucleons and photons by the spontaneously broken chiral symmetry of QCD. The framework to perform these calculations, chiral perturbation theory, is briefly discussed in the meson sector. The method is a simultaneous expansion of the Greens functions in powers of external moments and quark masses around the massless case, the chiral limit. To perform this expansion, use is made of a phenomenological Lagrangian which encodes the Ward-identities and pertinent symmetries of QCD. The concept of chiral power counting is introduced. The main part of the lectures of consists in describing how to include baryons (nucleons) and how the chiral structure is modified by the fact that the nucleon mass in the chiral limit does not vanish. Particular emphasis is put on working out applications to show the strengths and limitations of the methods. Some processes which are discussed are threshold photopion production, low-energy compton scattering off nucleons, πN scattering and the σ-term. The implications of the broken chiral symmetry on the nuclear forces are briefly described. An alternative approach, in which the baryons are treated as very heavy fields, is touched upon

  5. Massive states in chiral perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Mallik, S [Saha Inst. of Nuclear Physics, Calcutta (India)

    1995-08-01

    It is shown that the chiral nonanalytic terms generated by {Delta}{sub 33} resonance in the nucleon self-energy is reproduced in chiral perturbation theory by perturbing appropriate local operators contained in the pion-nucleon effective Lagrangian itself. (orig.)

  6. On the non-perturbative effects

    International Nuclear Information System (INIS)

    Manjavidze, J.; Voronyuk, V.

    2004-01-01

    The quantum correspondence principle based on the time reversibility is adopted to take into account the non-Abelian symmetry constrains. The main properties of the new strong-coupling perturbation theory which take into account non-perturbative effects are described. (author)

  7. Scalar Quantum Electrodynamics: Perturbation Theory and Beyond

    International Nuclear Information System (INIS)

    Bashir, A.; Gutierrez-Guerrero, L. X.; Concha-Sanchez, Y.

    2006-01-01

    In this article, we calculate scalar propagator in arbitrary dimensions and gauge and the three-point scalar-photon vertex in arbitrary dimensions and Feynman gauge, both at the one loop level. We also discuss constraints on their non perturbative structure imposed by requirements of gauge invariance and perturbation theory

  8. Mutation screening of brain-expressed X-chromosomal miRNA genes in 464 patients with nonsyndromic X-linked mental retardation.

    NARCIS (Netherlands)

    Chen, W.; Jensen, L.R.; Gecz, J.; Fryns, J.P.; Moraine, C.; Brouwer, A.; Chelly, J.; Moser, B.; Ropers, H.H.; Kuss, A.W.

    2007-01-01

    MiRNAs are small noncoding RNAs that control the expression of target genes at the post-transcriptional level and have been reported to modulate various biological processes. Their function as regulatory factors in gene expression renders them attractive candidates for harbouring genetic variants

  9. Mutational screening of CHX10, GDF6, OTX2, RAX and SOX2 genes in 50 unrelated microphthalmia-anophthalmia-coloboma (MAC) spectrum cases.

    Science.gov (United States)

    Gonzalez-Rodriguez, J; Pelcastre, E L; Tovilla-Canales, J L; Garcia-Ortiz, J E; Amato-Almanza, M; Villanueva-Mendoza, C; Espinosa-Mattar, Z; Zenteno, J C

    2010-08-01

    Microphthalmia-anophthalmia-coloboma (MAC) are congenital eye malformations causing a significant percentage of visually impairments in children. Although these anomalies can arise from prenatal exposure to teratogens, mutations in well-defined genes originate potentially heritable forms of MAC. Mutations in genes such as CHX10, GDF6, RAX, SOX2 and OTX2, among others, have been recognised in dominant or recessive MAC. SOX2 and OTX2 are the two most commonly mutated genes in monogenic MAC. However, as more numerous samples of MAC subjects would be analysed, a better estimation of the actual involvement of specific MAC-genes could be made. Here, a comprehensive mutational analysis of the CHX10, GDF6, RAX, SOX2 and OTX2 genes was performed in 50 MAC subjects. PCR amplification and direct automated DNA sequencing of all five genes in 50 unrelated subjects. Eight mutations (16% prevalence) were recognised, including four GDF6 mutations (one novel), two novel RAX mutations, one novel OTX2 mutation and one SOX2 mutation. Anophthalmia and nanophthalmia, not previously associated with GDF6 mutations, were observed in two subjects carrying defects in this gene, expanding the spectrum of GDF6-linked ocular anomalies. Our study underscores the importance of genotyping large groups of patients from distinct ethnic origins for improving the estimation of the global involvement of particular MAC-causing genes.

  10. Genome-Wide Screening of Genes Showing Altered Expression in Liver Metastases of Human Colorectal Cancers by cDNA Microarray

    Directory of Open Access Journals (Sweden)

    Rempei Yanagawa

    2001-01-01

    Full Text Available In spite of intensive and increasingly successful attempts to determine the multiple steps involved in colorectal carcinogenesis, the mechanisms responsible for metastasis of colorectal tumors to the liver remain to be clarified. To identify genes that are candidates for involvement in the metastatic process, we analyzed genome-wide expression profiles of 10 primary colorectal cancers and their corresponding metastatic lesions by means of a cDNA microarray consisting of 9121 human genes. This analysis identified 40 genes whose expression was commonly upregulated in metastatic lesions, and 7 that were commonly downregulated. The upregulated genes encoded proteins involved in cell adhesion, or remodeling of the actin cytoskeleton. Investigation of the functions of more of the altered genes should improve our understanding of metastasis and may identify diagnostic markers and/or novel molecular targets for prevention or therapy of metastatic lesions.

  11. Development of in vitro transposon assisted signal sequence trapping and its use in screening Bacillus halodurans C125 and Sulfolobus solfataricus P2 gene libraries

    DEFF Research Database (Denmark)

    Becker, F.; Schnorr, K.; Wilting, R.

    2004-01-01

    To identify genes encoding extracytosolic proteins, a minitransposon, TnSig, containing a signal-less beta-lactamase ('bla) as reporter gene, was constructed and used for in vitro transposition of genomic libraries made in Escherichia coli. The 'bla gene was cloned into a bacteriophage MU...... minitransposon enabling translational fusions between 'bla and target genes. Fusion of TnSig in the correct reading frame to a protein carrying transmembrane domains or signal peptides resulted in ampicillin resistance of the corresponding clone. Prokaryotic gene libraries from the alkaliphilic bacterium...... Bacillus halodurans C125 and the hyperthermophilic archaeon Sulfolobus solfataricus P2 were tagged with TnSig. The genomic sequences, which are publicly available (EMBL BA000004 and EMBL AE006641), were used for rapid open reading frame (ORF) identification and prediction of protein localisation...

  12. Limited agreement of independent RNAi screens for virus-required host genes owes more to false-negative than false-positive factors.

    Directory of Open Access Journals (Sweden)

    Linhui Hao

    Full Text Available Systematic, genome-wide RNA interference (RNAi analysis is a powerful approach to identify gene functions that support or modulate selected biological processes. An emerging challenge shared with some other genome-wide approaches is that independent RNAi studies often show limited agreement in their lists of implicated genes. To better understand this, we analyzed four genome-wide RNAi studies that identified host genes involved in influenza virus replication. These studies collectively identified and validated the roles of 614 cell genes, but pair-wise overlap among the four gene lists was only 3% to 15% (average 6.7%. However, a number of functional categories were overrepresented in multiple studies. The pair-wise overlap of these enriched-category lists was high, ∼19%, implying more agreement among studies than apparent at the gene level. Probing this further, we found that the gene lists implicated by independent studies were highly connected in interacting networks by independent functional measures such as protein-protein interactions, at rates significantly higher than predicted by chance. We also developed a general, model-based approach to gauge the effects of false-positive and false-negative factors and to estimate, from a limited number of studies, the total number of genes involved in a process. For influenza virus replication, this novel statistical approach estimates the total number of cell genes involved to be ∼2,800. This and multiple other aspects of our experimental and computational results imply that, when following good quality control practices, the low overlap between studies is primarily due to false negatives rather than false-positive gene identifications. These results and methods have implications for and applications to multiple forms of genome-wide analysis.

  13. Screening Information - JSNP | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us JSNP Screening Information Data detail Data name Screening Information DOI 10.18908/lsdba.nb...dc00114-003 Description of data contents Information from polymorphism screening experiments. Derived from E...the sequence for polymorphism screening Screened Position position of the polymorphism in the sequence for polymorphism screeni...ng Screened Symbol gene name related to the sequence for polymorphism screening Screened ...OMIM-ID OMIM ID related to the sequence for polymorphism screening About This Dat

  14. A Panel of High Resolution Melting (HRM Technology-Based Assays with Direct Sequencing Possibility for Effective Mutation Screening of EGFR and K-ras Genes

    Directory of Open Access Journals (Sweden)

    D. A. M. Heideman

    2009-01-01

    Full Text Available Background: Increasing data from clinical trials support EGFR and K-ras mutation status as predictive markers of tumour response to EGFR-targeted therapies. Consequently, rapid and reliable mutation screening assays are demanded to guide rational use of EGFR-targeted therapies.

  15. An siRNA-based functional genomics screen for the identification of regulators of ciliogenesis and ciliopathy genes

    NARCIS (Netherlands)

    Wheway, Gabrielle; Schmidts, Miriam; Mans, Dorus A; Szymanska, Katarzyna; Nguyen, Thanh-Minh T; Racher, Hilary; Phelps, Ian G; Toedt, Grischa; Kennedy, Julie; Wunderlich, Kirsten A; Sorusch, Nasrin; Abdelhamed, Zakia A; Natarajan, Subaashini; Herridge, Warren; van Reeuwijk, Jeroen; Horn, Nicola; Boldt, Karsten; Parry, David A; Letteboer, Stef J F; Roosing, Susanne; Adams, Matthew; Bell, Sandra M; Bond, Jacquelyn; Higgins, Julie; Morrison, Ewan E; Tomlinson, Darren C; Slaats, Gisela G; van Dam, Teunis J P; Huang, Lijia; Kessler, Kristin; Giessl, Andreas; Logan, Clare V; Boyle, Evan A; Shendure, Jay; Anazi, Shamsa; Aldahmesh, Mohammed; Al Hazzaa, Selwa; Hegele, Robert A; Ober, Carole; Frosk, Patrick; Mhanni, Aizeddin A; Chodirker, Bernard N; Chudley, Albert E; Lamont, Ryan; Bernier, Francois P; Beaulieu, Chandree L; Gordon, Paul; Pon, Richard T; Donahue, Clem; Barkovich, A James; Wolf, Louis; Toomes, Carmel; Thiel, Christian T; Boycott, Kym M; McKibbin, Martin; Inglehearn, Chris F; Stewart, Fiona; Omran, Heymut; Huynen, Martijn A; Sergouniotis, Panagiotis I; Alkuraya, Fowzan S; Parboosingh, Jillian S; Innes, A Micheil; Willoughby, Colin E; Giles, Rachel H; Webster, Andrew R; Ueffing, Marius; Blacque, Oliver; Gleeson, Joseph G; Wolfrum, Uwe; Beales, Philip L; Gibson, Toby; Doherty, Dan; Mitchison, Hannah M; Roepman, Ronald; Johnson, Colin A

    Defects in primary cilium biogenesis underlie the ciliopathies, a growing group of genetic disorders. We describe a whole-genome siRNA-based reverse genetics screen for defects in biogenesis and/or maintenance of the primary cilium, obtaining a global resource. We identify 112 candidate ciliogenesis

  16. Microarray-Based Screening of Differentially Expressed Genes of E. coli O157:H7 Sakai during Preharvest Survival on Butterhead Lettuce

    Directory of Open Access Journals (Sweden)

    Inge Van der Linden

    2016-01-01

    Full Text Available Numerous outbreaks of Escherichia coli O157:H7 have been linked to the consumption of leafy vegetables. However, up to the present, little has been known about E. coli O157:H7’s adaptive responses to survival on actively growing (and thus responsive plants. In this study, whole genome transcriptional profiles were generated from E. coli O157:H7 cells (isolate Sakai, stx- one hour and two days after inoculation on the leaves of growing butterhead lettuce, and compared with an inoculum control. A total of 273 genes of E. coli O157:H7 Sakai (5.04% of the whole genome were significantly induced or repressed by at least two-fold (p < 0.01 in at least one of the analyzed time points in comparison with the control. Several E. coli O157:H7 genes associated with oxidative stress and antimicrobial resistance were upregulated, including the iron-sulfur cluster and the multiple antibiotic resistance (mar operon, whereas the Shiga toxin virulence genes were downregulated. Nearly 40% of the genes with significantly different expression were poorly characterized genes or genes with unknown functions. These genes are of special interest for future research as they may play an important role in the pathogens’ adaptation to a lifestyle on plants. In conclusion, these findings suggest that the pathogen actively interacts with the plant environment by adapting its metabolism and responding to oxidative stress.

  17. Metabolic Genetic Screens Reveal Multidimensional Regulation of Virulence Gene Expression in Listeria monocytogenes and an Aminopeptidase That Is Critical for PrfA Protein Activation.

    Science.gov (United States)

    Friedman, Sivan; Linsky, Marika; Lobel, Lior; Rabinovich, Lev; Sigal, Nadejda; Herskovits, Anat A

    2017-06-01

    Listeria monocytogenes is an environmental saprophyte and intracellular bacterial pathogen. Upon invading mammalian cells, the bacterium senses abrupt changes in its metabolic environment, which are rapidly transduced to regulation of virulence gene expression. To explore the relationship between L. monocytogenes metabolism and virulence, we monitored virulence gene expression dynamics across a library of genetic mutants grown under two metabolic conditions known to activate the virulent state: charcoal-treated rich medium containing glucose-1-phosphate and minimal defined medium containing limiting concentrations of branched-chain amino acids (BCAAs). We identified over 100 distinct mutants that exhibit aberrant virulence gene expression profiles, the majority of which mapped to nonessential metabolic genes. Mutants displayed enhanced, decreased, and early and late virulence gene expression profiles, as well as persistent levels, demonstrating a high plasticity in virulence gene regulation. Among the mutants, one was noteworthy for its particularly low virulence gene expression level and mapped to an X-prolyl aminopeptidase (PepP). We show that this peptidase plays a role in posttranslational activation of the major virulence regulator, PrfA. Specifically, PepP mediates recruitment of PrfA to the cytoplasmic membrane, a step identified as critical for PrfA protein activation. This study establishes a novel step in the complex mechanism of PrfA activation and further highlights the cross regulation of metabolism and virulence. Copyright © 2017 American Society for Microbiology.

  18. Difference scheme for a singularly perturbed parabolic convection-diffusion equation in the presence of perturbations

    Science.gov (United States)

    Shishkin, G. I.

    2015-11-01

    An initial-boundary value problem is considered for a singularly perturbed parabolic convection-diffusion equation with a perturbation parameter ɛ (ɛ ∈ (0, 1]) multiplying the highest order derivative. The stability of a standard difference scheme based on monotone approximations of the problem on a uniform mesh is analyzed, and the behavior of discrete solutions in the presence of perturbations is examined. The scheme does not converge ɛ-uniformly in the maximum norm as the number of its grid nodes is increased. When the solution of the difference scheme converges, which occurs if N -1 ≪ ɛ and N -1 0 ≪ 1, where N and N 0 are the numbers of grid intervals in x and t, respectively, the scheme is not ɛ-uniformly well conditioned or stable to data perturbations in the grid problem and to computer perturbations. For the standard difference scheme in the presence of data perturbations in the grid problem and/or computer perturbations, conditions on the "parameters" of the difference scheme and of the computer (namely, on ɛ, N, N 0, admissible data perturbations in the grid problem, and admissible computer perturbations) are obtained that ensure the convergence of the perturbed solutions. Additionally, the conditions are obtained under which the perturbed numerical solution has the same order of convergence as the solution of the unperturbed standard difference scheme.

  19. Human synthetic lethal inference as potential anti-cancer target gene detection

    Directory of Open Access Journals (Sweden)

    Solé Ricard V

    2009-12-01

    Full Text Available Abstract Background Two genes are called synthetic lethal (SL if mutation of either alone is not lethal, but mutation of both leads to death or a significant decrease in organism's fitness. The detection of SL gene pairs constitutes a promising alternative for anti-cancer therapy. As cancer cells exhibit a large number of mutations, the identification of these mutated genes' SL partners may provide specific anti-cancer drug candidates, with minor perturbations to the healthy cells. Since existent SL data is mainly restricted to yeast screenings, the road towards human SL candidates is limited to inference methods. Results In the present work, we use phylogenetic analysis and database manipulation (BioGRID for interactions, Ensembl and NCBI for homology, Gene Ontology for GO attributes in order to reconstruct the phylogenetically-inferred SL gene network for human. In addition, available data on cancer mutated genes (COSMIC and Cancer Gene Census databases as well as on existent approved drugs (DrugBank database supports our selection of cancer-therapy candidates. Conclusions Our work provides a complementary alternative to the current methods for drug discovering and gene target identification in anti-cancer research. Novel SL screening analysis and the use of highly curated databases would contribute to improve the results of this methodology.

  20. Strings as perturbations of evolving spin networks

    International Nuclear Information System (INIS)

    Smolin, Lee

    2000-01-01

    One step in the construction of a background independent formulation of string theory is detailed, in which it is shown how perturbative strings may arise as small fluctuations around histories in a formulation of non-perturbative dynamics of spin networks due to Markopoulou. In this formulation the dynamics of spin network states and their generalizations is described in terms of histories which have discrete analogues of the causal structure and many fingered time of Lorentzian spacetimes. Perturbations of these histories turn out to be described in terms of spin systems defined on 2-dimensional timelike surfaces embedded in the discrete spacetime. When the history has a classical limit which is Minkowski spacetime, the action of the perturbation theory is given to leading order by the spacetime area of the surface, as in bosonic string theory. This map between a non-perturbative formulation of quantum gravity and a 1+1 dimensional theory generalizes to a large class of theories in which the group SU(2) i s extended to any quantum group or supergroup. It is argued that a necessary condition for the non-perturbative theory to have a good classical limit is that the resulting 1+1 dimensional theory defines a consistent and stable perturbative string theory

  1. Framework for network modularization and Bayesian network analysis to investigate the perturbed metabolic network

    Directory of Open Access Journals (Sweden)

    Kim Hyun

    2011-12-01

    Full Text Available Abstract Background Genome-scale metabolic network models have contributed to elucidating biological phenomena, and predicting gene targets to engineer for biotechnological applications. With their increasing importance, their precise network characterization has also been crucial for better understanding of the cellular physiology. Results We herein introduce a framework for network modularization and Bayesian network analysis (FMB to investigate organism’s metabolism under perturbation. FMB reveals direction of influences among metabolic modules, in which reactions with similar or positively correlated flux variation patterns are clustered, in response to specific perturbation using metabolic flux data. With metabolic flux data calculated by constraints-based flux analysis under both control and perturbation conditions, FMB, in essence, reveals the effects of specific perturbations on the biological system through network modularization and Bayesian network analysis at metabolic modular level. As a demonstration, this framework was applied to the genetically perturbed Escherichia coli metabolism, which is a lpdA gene knockout mutant, using its genome-scale metabolic network model. Conclusions After all, it provides alternative scenarios of metabolic flux distributions in response to the perturbation, which are complementary to the data obtained from conventionally available genome-wide high-throughput techniques or metabolic flux analysis.

  2. Framework for network modularization and Bayesian network analysis to investigate the perturbed metabolic network.

    Science.gov (United States)

    Kim, Hyun Uk; Kim, Tae Yong; Lee, Sang Yup

    2011-01-01

    Genome-scale metabolic network models have contributed to elucidating biological phenomena, and predicting gene targets to engineer for biotechnological applications. With their increasing importance, their precise network characterization has also been crucial for better understanding of the cellular physiology. We herein introduce a framework for network modularization and Bayesian network analysis (FMB) to investigate organism's metabolism under perturbation. FMB reveals direction of influences among metabolic modules, in which reactions with similar or positively correlated flux variation patterns are clustered, in response to specific perturbation using metabolic flux data. With metabolic flux data calculated by constraints-based flux analysis under both control and perturbation conditions, FMB, in essence, reveals the effects of specific perturbations on the biological system through network modularization and Bayesian network analysis at metabolic modular level. As a demonstration, this framework was applied to the genetically perturbed Escherichia coli metabolism, which is a lpdA gene knockout mutant, using its genome-scale metabolic network model. After all, it provides alternative scenarios of metabolic flux distributions in response to the perturbation, which are complementary to the data obtained from conventionally available genome-wide high-throughput techniques or metabolic flux analysis.

  3. Genome wide transcriptional response of Saccharomyces cerevisiae to stress-induced perturbations

    Directory of Open Access Journals (Sweden)

    Hilal eTaymaz-Nikerel

    2016-02-01

    Full Text Available Cells respond to environmental and/or genetic perturbations in order to survive and proliferate. Characterization of the changes after various stimuli at different -omics levels is crucial to comprehend the adaptation of cells to changing conditions. Genome wide quantification and analysis of transcript levels, the genes affected by perturbations, extends our understanding of cellular metabolism by pointing out the mechanisms that play role in sensing the stress caused by those perturbations and related signaling pathways, and in this way guides us to achieve endeavors such as rational engineering of cells or interpretation of disease mechanisms. Saccharomyces cerevisiae as a model system has been studied in response to different perturbations and corresponding transcriptional profiles were followed either statically or/and dynamically, short- and long- term. This review focuses on response of yeast cells to diverse stress inducing perturbations including nutritional changes, ionic stress, salt stress, oxidative stress, osmotic shock, as well as to genetic interventions such as deletion and over-expression of genes. It is aimed to conclude on common regulatory phenomena that allow yeast to organize its transcriptomic response after any perturbation under different external conditions.

  4. The natural compound sanguinarine perturbs the regenerative capabilities of planarians.

    Science.gov (United States)

    Balestrini, Linda; Di Donfrancesco, Alessia; Rossi, Leonardo; Marracci, Silvia; Isolani, Maria E; Bianucci, Anna M; Batistoni, Renata

    2017-01-01

    The natural alkaloid sanguinarine has remarkable therapeutic properties and has been used for centuries as a folk remedy. This compound exhibits interesting anticancer properties and is currently receiving attention as a potential chemotherapeutic agent. Nevertheless, limited information exists regarding its safety for developing organisms. Planarians are an animal model known for their extraordinary stem cell-based regenerative capabilities and are increasingly used for toxicological and pharmacological studies. Here, we report that sanguinarine, at micromolar concentrations, perturbs the regeneration process in the planarian Dugesia japonica. We show that sanguinarine exposure causes defects during anterior regeneration and visual system recovery, as well as anomalous remodelling of pre-existing structures. Investigating the effects of sanguinarine on stem cells, we found that sanguinarine perturbs the transcriptional profile of early and late stem cell progeny markers. Our results indicate that sanguinarine exposure alters cell dynamics and induces apoptosis without affecting cell proliferation. Finally, sanguinarine exposure influences the expression level of H + , K + -ATPase α subunit, a gene of the P-type-ATPase pump family which plays a crucial role during anterior regeneration in planaria. On the whole, our data reveal that sanguinarine perturbs multiple mechanisms which regulate regeneration dynamics and contribute to a better understanding of the safety profile of this alkaloid in developing organisms.

  5. Perturbation analysis of linear control problems

    International Nuclear Information System (INIS)

    Petkov, Petko; Konstantinov, Mihail

    2017-01-01

    The paper presents a brief overview of the technique of splitting operators, proposed by the authors and intended for perturbation analysis of control problems involving unitary and orthogonal matrices. Combined with the technique of Lyapunov majorants and the implementation of the Banach and Schauder fixed point principles, it allows to obtain rigorous non-local perturbation bounds for a set of sensitivity analysis problems. Among them are the reduction of linear systems into orthogonal canonical forms, the feedback synthesis problem and pole assignment problem in particular, as well as other important problems in control theory and linear algebra. Key words: perturbation analysis, canonical forms, feedback synthesis

  6. Kerr-CFT and gravitational perturbations

    International Nuclear Information System (INIS)

    Dias, Oscar J.C.; Reall, Harvey S.; Santos, Jorge E.

    2009-01-01

    Motivated by the Kerr-CFT conjecture, we investigate perturbations of the near-horizon extreme Kerr spacetime. The Teukolsky equation for a massless field of arbitrary spin is solved. Solutions fall into two classes: normal modes and traveling waves. Imposing suitable (outgoing) boundary conditions, we find that there are no unstable modes. The explicit form of metric perturbations is obtained using the Hertz potential formalism, and compared with the Kerr-CFT boundary conditions. The energy and angular momentum associated with scalar field and gravitational normal modes are calculated. The energy is positive in all cases. The behaviour of second order perturbations is discussed.

  7. Resolution of ambiguities in perturbative QCD

    International Nuclear Information System (INIS)

    Nakkagawa, Hisao; Niegawa, Akira.

    1984-01-01

    In the perturbative QCD analyses of the deeply inelastic processes, the coupling constant depends on at least two mass-scales, the renormalization scale and the factorization scale. By integrating the coupled renormalization group equations with respect to these two mass-scales, the running coupling constant is defined. A perturbative approximation then introduces a new ambiguity, the integration-path dependence, into the theory. We show that the problem of this new ambiguity is resolved by imposing Stevenson's principle of minimal sensitivity. Together with the analogous analysis of the operator matrix element or the cut vertex, we can completely solve the problem of getting an unambiguous perturbative QCD prediction. (author)

  8. Mass generation in perturbed massless integrable models

    International Nuclear Information System (INIS)

    Controzzi, D.; Mussardo, G.

    2005-01-01

    We extend form-factor perturbation theory to non-integrable deformations of massless integrable models, in order to address the problem of mass generation in such systems. With respect to the standard renormalisation group analysis this approach is more suitable for studying the particle content of the perturbed theory. Analogously to the massive case, interesting information can be obtained already at first order, such as the identification of the operators which create a mass gap and those which induce the confinement of the massless particles in the perturbed theory

  9. Non-perturbative effects in supersymmetry

    International Nuclear Information System (INIS)

    Veneziano, G.

    1987-01-01

    Some non perturbative aspects of globally supersymmetric (SUSY) gauge theories are discussed. These share with their non-supersymmetric analogues interesting non perturbative features, such as the spontaneous breaking of chiral symmetries via condensates. What is peculiar about supersymmetric theories, however, is that one is able to say a lot about non-perturbative effects even without resorting to elaborate numerical calculations: general arguments, supersymmetric and chiral Ward identities and analytic, dynamical calculations will turn out to effectively determine most of the supersymmetric vacuum properties. 28 references, 5 figures

  10. On perturbation theory for distance dependent statistics.

    Energy Technology Data Exchange (ETDEWEB)

    Mashkevich, S V

    1994-12-31

    It is known that perturbation theory for anyons has to be modified near Bose statistics in order to get correct finite results. For ``distance dependent statistics`` or anyons with smeared flux tubes, perturbation theory is in principle applicable directly but gives results which hold for too small values of the statistical parameter and, in particular, are not valid as the flux tube radius tends to zero. In this paper we discuss the way to modify perturbation theory for this situation, which allows to obtain the appropriate results. (author). 6 refs.

  11. Solitonic Integrable Perturbations of Parafermionic Theories

    CERN Document Server

    Fernández-Pousa, C R; Hollowood, Timothy J; Miramontes, J L

    1997-01-01

    The quantum integrability of a class of massive perturbations of the parafermionic conformal field theories associated to compact Lie groups is established by showing that they have quantum conserved densities of scale dimension 2 and 3. These theories are integrable for any value of a continuous vector coupling constant, and they generalize the perturbation of the minimal parafermionic models by their first thermal operator. The classical equations-of-motion of these perturbed theories are the non-abelian affine Toda equations which admit (charged) soliton solutions whose semi-classical quantization is expected to permit the identification of the exact S-matrix of the theory.

  12. Critical behaviors of gravity under quantum perturbations

    Directory of Open Access Journals (Sweden)

    ZHANG Hongsheng

    2014-02-01

    Full Text Available Phase transition and critical phenomenon is a very interesting topic in thermodynamics and statistical mechanics. Gravity is believed to have deep and inherent relation to thermodynamics. Near the critical point,the perturbation becomes significant. Thus for ordinary matter (governed by interactions besides gravity the critical behavior will become very different if we ignore the perturbations around the critical point,such as mean field theory. We find that the critical exponents for RN-AdS spacetime keep the same values even when we consider the full quantum perturbations. This indicates a key difference between gravity and ordinary thermodynamic system.

  13. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  14. AOPs and Biomarkers: Bridging High Throughput Screening ...

    Science.gov (United States)

    As high throughput screening (HTS) plays a larger role in toxicity testing, camputational toxicology has emerged as a critical component in interpreting the large volume of