High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

Science.gov (United States)

Kassir, Yona

2017-01-01

Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

FUN-L: gene prioritization for RNAi screens.

Science.gov (United States)

Lees, Jonathan G; Hériché, Jean-Karim; Morilla, Ian; Fernández, José M; Adler, Priit; Krallinger, Martin; Vilo, Jaak; Valencia, Alfonso; Ellenberg, Jan; Ranea, Juan A; Orengo, Christine

2015-06-15

Most biological processes remain only partially characterized with many components still to be identified. Given that a whole genome can usually not be tested in a functional assay, identifying the genes most likely to be of interest is of critical importance to avoid wasting resources. Given a set of known functionally related genes and using a state-of-the-art approach to data integration and mining, our Functional Lists (FUN-L) method provides a ranked list of candidate genes for testing. Validation of predictions from FUN-L with independent RNAi screens confirms that FUN-L-produced lists are enriched in genes with the expected phenotypes. In this article, we describe a website front end to FUN-L. The website is freely available to use at http://funl.org © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Ortholog-based screening and identification of genes related to intracellular survival.

Science.gov (United States)

Yang, Xiaowen; Wang, Jiawei; Bing, Guoxia; Bie, Pengfei; De, Yanyan; Lyu, Yanli; Wu, Qingmin

2018-04-20

Bioinformatics and comparative genomics analysis methods were used to predict unknown pathogen genes based on homology with identified or functionally clustered genes. In this study, the genes of common pathogens were analyzed to screen and identify genes associated with intracellular survival through sequence similarity, phylogenetic tree analysis and the λ-Red recombination system test method. The total 38,952 protein-coding genes of common pathogens were divided into 19,775 clusters. As demonstrated through a COG analysis, information storage and processing genes might play an important role intracellular survival. Only 19 clusters were present in facultative intracellular pathogens, and not all were present in extracellular pathogens. Construction of a phylogenetic tree selected 18 of these 19 clusters. Comparisons with the DEG database and previous research revealed that seven other clusters are considered essential gene clusters and that seven other clusters are associated with intracellular survival. Moreover, this study confirmed that clusters screened by orthologs with similar function could be replaced with an approved uvrY gene and its orthologs, and the results revealed that the usg gene is associated with intracellular survival. The study improves the current understanding of intracellular pathogens characteristics and allows further exploration of the intracellular survival-related gene modules in these pathogens. Copyright © 2018. Published by Elsevier B.V.

Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

OpenAIRE

Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

2003-01-01

Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

Genome-wide RNAi screening identifies genes inhibiting the migration of glioblastoma cells.

Directory of Open Access Journals (Sweden)

Jian Yang

Full Text Available Glioblastoma Multiforme (GBM cells are highly invasive, infiltrating into the surrounding normal brain tissue, making it impossible to completely eradicate GBM tumors by surgery or radiation. Increasing evidence also shows that these migratory cells are highly resistant to cytotoxic reagents, but decreasing their migratory capability can re-sensitize them to chemotherapy. These evidences suggest that the migratory cell population may serve as a better therapeutic target for more effective treatment of GBM. In order to understand the regulatory mechanism underlying the motile phenotype, we carried out a genome-wide RNAi screen for genes inhibiting the migration of GBM cells. The screening identified a total of twenty-five primary hits; seven of them were confirmed by secondary screening. Further study showed that three of the genes, FLNA, KHSRP and HCFC1, also functioned in vivo, and knocking them down caused multifocal tumor in a mouse model. Interestingly, two genes, KHSRP and HCFC1, were also found to be correlated with the clinical outcome of GBM patients. These two genes have not been previously associated with cell migration.

High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

Science.gov (United States)

Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

2018-01-01

Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

Screening strategies for a highly polymorphic gene: DHPLC analysis of the Fanconi anemia group A gene.

Science.gov (United States)

Rischewski, J; Schneppenheim, R

2001-01-30

Patients with Fanconi anemia (Fanc) are at risk of developing leukemia. Mutations of the group A gene (FancA) are most common. A multitude of polymorphisms and mutations within the 43 exons of the gene are described. To examine the role of heterozygosity as a risk factor for malignancies, a partially automatized screening method to identify aberrations was needed. We report on our experience with DHPLC (WAVE (Transgenomic)). PCR amplification of all 43 exons from one individual was performed on one microtiter plate on a gradient thermocycler. DHPLC analysis conditions were established via melting curves, prediction software, and test runs with aberrant samples. PCR products were analyzed twice: native, and after adding a WT-PCR product. Retention patterns were compared with previously identified polymorphic PCR products or mutants. We have defined the mutation screening conditions for all 43 exons of FancA using DHPLC. So far, 40 different sequence variations have been detected in more than 100 individuals. The native analysis identifies heterozygous individuals, and the second run detects homozygous aberrations. Retention patterns are specific for the underlying sequence aberration, thus reducing sequencing demand and costs. DHPLC is a valuable tool for reproducible recognition of known sequence aberrations and screening for unknown mutations in the highly polymorphic FancA gene.

Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea.

Science.gov (United States)

Nakahara, Yoshiki; Sawabe, Shogo; Kainuma, Kenta; Katsuhara, Maki; Shibasaka, Mineo; Suzuki, Masanori; Yamamoto, Kosuke; Oguri, Suguru; Sakamoto, Hikaru

2015-01-01

Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1) a novel protein highly homologous to thaumatin-like proteins, (2) a novel coiled-coil protein of unknown function, and (3) a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea

Directory of Open Access Journals (Sweden)

Yoshiki eNakahara

2015-10-01

Full Text Available Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1 a novel protein highly homologous to thaumatin-like proteins, (2 a novel coiled-coil protein of unknown function, and (3 a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues.

Science.gov (United States)

Pei, Wuhong; Xu, Lisha; Huang, Sunny C; Pettie, Kade; Idol, Jennifer; Rissone, Alberto; Jimenez, Erin; Sinclair, Jason W; Slevin, Claire; Varshney, Gaurav K; Jones, MaryPat; Carrington, Blake; Bishop, Kevin; Huang, Haigen; Sood, Raman; Lin, Shuo; Burgess, Shawn M

2018-01-01

Regenerative medicine holds great promise for both degenerative diseases and traumatic tissue injury which represent significant challenges to the health care system. Hearing loss, which affects hundreds of millions of people worldwide, is caused primarily by a permanent loss of the mechanosensory receptors of the inner ear known as hair cells. This failure to regenerate hair cells after loss is limited to mammals, while all other non-mammalian vertebrates tested were able to completely regenerate these mechanosensory receptors after injury. To understand the mechanism of hair cell regeneration and its association with regeneration of other tissues, we performed a guided mutagenesis screen using zebrafish lateral line hair cells as a screening platform to identify genes that are essential for hair cell regeneration, and further investigated how genes essential for hair cell regeneration were involved in the regeneration of other tissues. We created genetic mutations either by retroviral insertion or CRISPR/Cas9 approaches, and developed a high-throughput screening pipeline for analyzing hair cell development and regeneration. We screened 254 gene mutations and identified 7 genes specifically affecting hair cell regeneration. These hair cell regeneration genes fell into distinct and somewhat surprising functional categories. By examining the regeneration of caudal fin and liver, we found these hair cell regeneration genes often also affected other types of tissue regeneration. Therefore, our results demonstrate guided screening is an effective approach to discover regeneration candidates, and hair cell regeneration is associated with other tissue regeneration.

The Candidate Cancer Gene Database: a database of cancer driver genes from forward genetic screens in mice.

Science.gov (United States)

Abbott, Kenneth L; Nyre, Erik T; Abrahante, Juan; Ho, Yen-Yi; Isaksson Vogel, Rachel; Starr, Timothy K

2015-01-01

Identification of cancer driver gene mutations is crucial for advancing cancer therapeutics. Due to the overwhelming number of passenger mutations in the human tumor genome, it is difficult to pinpoint causative driver genes. Using transposon mutagenesis in mice many laboratories have conducted forward genetic screens and identified thousands of candidate driver genes that are highly relevant to human cancer. Unfortunately, this information is difficult to access and utilize because it is scattered across multiple publications using different mouse genome builds and strength metrics. To improve access to these findings and facilitate meta-analyses, we developed the Candidate Cancer Gene Database (CCGD, http://ccgd-starrlab.oit.umn.edu/). The CCGD is a manually curated database containing a unified description of all identified candidate driver genes and the genomic location of transposon common insertion sites (CISs) from all currently published transposon-based screens. To demonstrate relevance to human cancer, we performed a modified gene set enrichment analysis using KEGG pathways and show that human cancer pathways are highly enriched in the database. We also used hierarchical clustering to identify pathways enriched in blood cancers compared to solid cancers. The CCGD is a novel resource available to scientists interested in the identification of genetic drivers of cancer. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

A genetic screen identifies interferon-α effector genes required to suppress hepatitis C virus replication.

Science.gov (United States)

Fusco, Dahlene N; Brisac, Cynthia; John, Sinu P; Huang, Yi-Wen; Chin, Christopher R; Xie, Tiao; Zhao, Hong; Jilg, Nikolaus; Zhang, Leiliang; Chevaliez, Stephane; Wambua, Daniel; Lin, Wenyu; Peng, Lee; Chung, Raymond T; Brass, Abraham L

2013-06-01

Hepatitis C virus (HCV) infection is a leading cause of end-stage liver disease. Interferon-α (IFNα) is an important component of anti-HCV therapy; it up-regulates transcription of IFN-stimulated genes, many of which have been investigated for their antiviral effects. However, all of the genes required for the antiviral function of IFNα (IFN effector genes [IEGs]) are not known. IEGs include not only IFN-stimulated genes, but other nontranscriptionally induced genes that are required for the antiviral effect of IFNα. In contrast to candidate approaches based on analyses of messenger RNA (mRNA) expression, identification of IEGs requires a broad functional approach. We performed an unbiased genome-wide small interfering RNA screen to identify IEGs that inhibit HCV. Huh7.5.1 hepatoma cells were transfected with small interfering RNAs incubated with IFNα and then infected with JFH1 HCV. Cells were stained using HCV core antibody, imaged, and analyzed to determine the percent infection. Candidate IEGs detected in the screen were validated and analyzed further. The screen identified 120 previously unreported IEGs. From these, we more fully evaluated the following: asparagine-linked glycosylation 10 homolog (yeast, α-1,2-glucosyltransferase); butyrylcholinesterase; dipeptidyl-peptidase 4 (CD26, adenosine deaminase complexing protein 2); glucokinase (hexokinase 4) regulator; guanylate cyclase 1, soluble, β 3; MYST histone acetyltransferase 1; protein phosphatase 3 (formerly 2B), catalytic subunit, β isoform; peroxisomal proliferator-activated receptor-γ-DBD-interacting protein 1; and solute carrier family 27 (fatty acid transporter), member 2; and demonstrated that they enabled IFNα-mediated suppression of HCV at multiple steps of its life cycle. Expression of these genes had more potent effects against flaviviridae because a subset was required for IFNα to suppress dengue virus but not influenza A virus. In addition, many of the host genes detected in this

Utilization of gene mapping and candidate gene mutation screening for diagnosing clinically equivocal conditions: a Norrie disease case study.

Science.gov (United States)

Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem

2014-06-01

Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.

Network perturbation by recurrent regulatory variants in cancer.

Directory of Open Access Journals (Sweden)

Kiwon Jang

2017-03-01

Full Text Available Cancer driving genes have been identified as recurrently affected by variants that alter protein-coding sequences. However, a majority of cancer variants arise in noncoding regions, and some of them are thought to play a critical role through transcriptional perturbation. Here we identified putative transcriptional driver genes based on combinatorial variant recurrence in cis-regulatory regions. The identified genes showed high connectivity in the cancer type-specific transcription regulatory network, with high outdegree and many downstream genes, highlighting their causative role during tumorigenesis. In the protein interactome, the identified transcriptional drivers were not as highly connected as coding driver genes but appeared to form a network module centered on the coding drivers. The coding and regulatory variants associated via these interactions between the coding and transcriptional drivers showed exclusive and complementary occurrence patterns across tumor samples. Transcriptional cancer drivers may act through an extensive perturbation of the regulatory network and by altering protein network modules through interactions with coding driver genes.

Modelling of Plasma Response to Resonant Magnetic Perturbations and its Influence on Divertor Strike Points

Energy Technology Data Exchange (ETDEWEB)

Cahyna, P.; Peterka, M.; Panek, R., E-mail: cahyna@ipp.cas.cz [Institute of Plasma Physics AS CR, Prague (Czech Republic); Liu, Y.; Kirk, A.; Harrison, J.; Thornton, A.; Chapman, I. [EURATOM/CCFE Fusion Association, Culham Science Centre, Abingdon (United Kingdom); Nardon, E. [Association Euratom/CEA, CEA Cadarache, St. Paul-lez-Durance (France); Schmitz, O. [Forschung Zentrum Juelich, Juelich (Germany)

2012-09-15

Full text: Resonant magnetic perturbations (RMPs) for edge localized mode (ELM) mitigation in tokamaks can be modified by the plasma response and indeed strong screening of the applied perturbation is in some cases predicted by simulations. In this contribution we investigate what effect would such screening have on the spiralling patterns (footprints) which may appear at the divertor when RMPs are applied. We use two theoretical tools for investigation of the impact of plasma response on footprints: a simple model of the assumed screening currents, which can be used to translate the screening predicted by MHD codes in a simplified geometry into the real geometry, and the MHD code MARS-F. The former consistently predicts that footprints are significantly reduced when complete screening of the resonant perturbation modes (like it is the case in ideal MHD) is assumed. This result is supported by the result of MARS-F in ideal mode for the case of the MAST tokamak. To predict observed patterns of fluxes it is necessary to take into account the deformation of the scrape-off layer, and for this we developed an approximative method based on the Melnikov integral. If the screening of perturbations indeed reduces the footprints, it would provide us with an important tool to evaluate the amount of screening in experiments, as the footprints can be easily observed. We thus present a comparison between predictions and experimental data, especially for the MAST tokamak, where a significant amount of data has been collected. (author)

A Morpholino-based screen to identify novel genes involved in craniofacial morphogenesis

Science.gov (United States)

Melvin, Vida Senkus; Feng, Weiguo; Hernandez-Lagunas, Laura; Artinger, Kristin Bruk; Williams, Trevor

2014-01-01

BACKGROUND The regulatory mechanisms underpinning facial development are conserved between diverse species. Therefore, results from model systems provide insight into the genetic causes of human craniofacial defects. Previously, we generated a comprehensive dataset examining gene expression during development and fusion of the mouse facial prominences. Here, we used this resource to identify genes that have dynamic expression patterns in the facial prominences, but for which only limited information exists concerning developmental function. RESULTS This set of ~80 genes was used for a high throughput functional analysis in the zebrafish system using Morpholino gene knockdown technology. This screen revealed three classes of cranial cartilage phenotypes depending upon whether knockdown of the gene affected the neurocranium, viscerocranium, or both. The targeted genes that produced consistent phenotypes encoded proteins linked to transcription (meis1, meis2a, tshz2, vgll4l), signaling (pkdcc, vlk, macc1, wu:fb16h09), and extracellular matrix function (smoc2). The majority of these phenotypes were not altered by reduction of p53 levels, demonstrating that both p53 dependent and independent mechanisms were involved in the craniofacial abnormalities. CONCLUSIONS This Morpholino-based screen highlights new genes involved in development of the zebrafish craniofacial skeleton with wider relevance to formation of the face in other species, particularly mouse and human. PMID:23559552

Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

Science.gov (United States)

Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

2013-01-01

We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

Directory of Open Access Journals (Sweden)

Peter Schierack

Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response.

Science.gov (United States)

Watson, Emma; MacNeil, Lesley T; Arda, H Efsun; Zhu, Lihua Julie; Walhout, Albertha J M

2013-03-28

Expression profiles are tailored according to dietary input. However, the networks that control dietary responses remain largely uncharacterized. Here, we combine forward and reverse genetic screens to delineate a network of 184 genes that affect the C. elegans dietary response to Comamonas DA1877 bacteria. We find that perturbation of a mitochondrial network composed of enzymes involved in amino acid metabolism and the TCA cycle affects the dietary response. In humans, mutations in the corresponding genes cause inborn diseases of amino acid metabolism, most of which are treated by dietary intervention. We identify several transcription factors (TFs) that mediate the changes in gene expression upon metabolic network perturbations. Altogether, our findings unveil a transcriptional response system that is poised to sense dietary cues and metabolic imbalances, illustrating extensive communication between metabolic networks in the mitochondria and gene regulatory networks in the nucleus. Copyright © 2013 Elsevier Inc. All rights reserved.

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Method for Screening Compounds That Influence Virulence Gene Expression in Staphylococcus aureus

DEFF Research Database (Denmark)

Nielsen, A.; Nielsen, Kristian Fog; Frees, D.

2010-01-01

We present a simple assay to examine effects of compounds on virulence gene expression in the human pathogen Staphylococcus aureus. The assay employs transcriptional reporter strains carrying lacZ fused to central virulence genes. Compounds affecting virulence gene expression and activity...... of the agr locus are scored based on color change in the presence of a chromogenic beta-galactosidase substrate. The assay can be used to screen for novel antivirulence compounds from many different sources, such as fungi, as demonstrated here....

A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death.

Science.gov (United States)

Ma, Hongming; Dang, Ying; Wu, Yonggan; Jia, Gengxiang; Anaya, Edgar; Zhang, Junli; Abraham, Sojan; Choi, Jang-Gi; Shi, Guojun; Qi, Ling; Manjunath, N; Wu, Haoquan

2015-07-28

West Nile virus (WNV) causes an acute neurological infection attended by massive neuronal cell death. However, the mechanism(s) behind the virus-induced cell death is poorly understood. Using a library containing 77,406 sgRNAs targeting 20,121 genes, we performed a genome-wide screen followed by a second screen with a sub-library. Among the genes identified, seven genes, EMC2, EMC3, SEL1L, DERL2, UBE2G2, UBE2J1, and HRD1, stood out as having the strongest phenotype, whose knockout conferred strong protection against WNV-induced cell death with two different WNV strains and in three cell lines. Interestingly, knockout of these genes did not block WNV replication. Thus, these appear to be essential genes that link WNV replication to downstream cell death pathway(s). In addition, the fact that all of these genes belong to the ER-associated protein degradation (ERAD) pathway suggests that this might be the primary driver of WNV-induced cell death. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Screening of potential biomarkers in uterine leiomyomas disease via gene expression profiling analysis.

Science.gov (United States)

Liu, Xuhui; Liu, Yanfei; Zhao, Jingrong; Liu, Yan

2018-05-01

The present study aimed to screen potential biomarkers for uterine leiomyomas disease, particularly target genes associated with the mediator of RNA polymerase II transcription subunit 12 (MED12) mutation. The microarray data of GSE30673, including 10 MED12 wild-type myometrium, 8 MED12 mutation leiomyoma and 2 MED12 wild-type leiomyoma samples, were downloaded from the Gene Expression Omnibus database. Compared with myometrium samples, differently-expressed genes (DEGs) in the MED12 mutation and wild-type leiomyoma samples were identified using the Limma package. The two sets of DEGs obtained were intersected to screen common DEGs. The DEGs in the MED12 mutation and wild-type leiomyoma samples, and common DEGs were defined as group A, B and C. Gene Ontology (GO) and pathway enrichment analyses were performed using the Database for Annotation, Visualization and Integrated Discovery online tool. Based on the Kyoto Encyclopedia of Genes and Genomes database, pathway relation networks were constructed. DEGs in GO terms and pathways were intersected to screen important DEGs. Subsequently, a gene co‑expression network was constructed and visualized using Cytoscape software. Reverse transcription‑quantitative polymerase chain reaction was used to detect the expression levels of important DEGs. A total of 1,258 DEGs in group A were screened, and enriched for extracellular matrix (ECM) organization and ECM‑receptor interaction. In addition, a total of 1,571 DEGs in group B were enriched for cell adhesion. Furthermore, 391 DEGs were involved in extracellular matrix organization. Pathway relation networks of group A, B and C were constructed with nodes of 48, 39, and 28, respectively. Finally, 135 important DEGs were obtained, including Acyl‑CoA synthetase medium‑chain family member 3, protein S (α) (PROS1) and F11 receptor. A gene co‑expression network with 68 nodes was constructed. The expression of caspase 1 (CASP1) and aldehyde dehydrogenase 1 family member

RPE65 gene: multiplex PCR and mutation screening in patients from ...

Indian Academy of Sciences (India)

Unknown

The RPE65 protein is believed to play an important role in the metabolism of vitamin A in the ... PCR and mutation screening in patients from India with retinal degenerative diseases. ..... Bennett J. 2001 Gene therapy restores vision in a canine.

Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

Science.gov (United States)

Firnhaber, Christopher; Hammarlund, Marc

2013-11-01

Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

Screening for susceptibility genes in hereditary non-polyposis colorectal cancer.

Science.gov (United States)

Yu, Li; Yin, Bo; Qu, Kaiying; Li, Jingjing; Jin, Qiao; Liu, Ling; Liu, Chunlan; Zhu, Yuxing; Wang, Qi; Peng, Xiaowei; Zhou, Jianda; Cao, Peiguo; Cao, Ke

2018-06-01

In the present study, hereditary non-polyposis colorectal cancer (HNPCC) susceptibility genes were screened for using whole exome sequencing in 3 HNPCC patients from 1 family and using single nucleotide polymorphism (SNP) genotyping assays in 96 other colorectal cancer and control samples. Peripheral blood was obtained from 3 HNPCC patients from 1 family; the proband and the proband's brother and cousin. High-throughput sequencing was performed using whole exome capture technology. Sequences were aligned against the HAPMAP, dbSNP130 and 1,000 Genome Project databases. Reported common variations and synonymous mutations were filtered out. Non-synonymous single nucleotide variants in the 3 HNPCC patients were integrated and the candidate genes were identified. Finally, SNP genotyping was performed for the genes in 96 peripheral blood samples. In total, 60.4 Gb of data was retrieved from the 3 HNPCC patients using whole exome capture technology. Subsequently, according to certain screening criteria, 15 candidate genes were identified. Among the 96 samples that had been SNP genotyped, 92 were successfully genotyped for 15 gene loci, while genotyping for HTRA1 failed in 4 sporadic colorectal cancer patient samples. In 12 control subjects and 81 sporadic colorectal cancer patients, genotypes at 13 loci were wild-type, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 . The CEP290 genotype was mutant in 1 sporadic colorectal cancer patient and was wild-type in all other subjects. A total of 5 of the 12 control subjects and 30 of the 81 sporadic colorectal cancer patients had a mutant HTRA1 genotype. In all 3 HNPCC patients, the same mutant genotypes were identified at all 15 gene loci. Overall, 13 potential susceptibility genes for HNPCC were identified, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 .

Application of microarray and functional-based screening methods for the detection of antimicrobial resistance genes in the microbiomes of healthy humans.

Directory of Open Access Journals (Sweden)

Roderick M Card

Full Text Available The aim of this study was to screen for the presence of antimicrobial resistance genes within the saliva and faecal microbiomes of healthy adult human volunteers from five European countries. Two non-culture based approaches were employed to obviate potential bias associated with difficult to culture members of the microbiota. In a gene target-based approach, a microarray was employed to screen for the presence of over 70 clinically important resistance genes in the saliva and faecal microbiomes. A total of 14 different resistance genes were detected encoding resistances to six antibiotic classes (aminoglycosides, β-lactams, macrolides, sulphonamides, tetracyclines and trimethoprim. The most commonly detected genes were erm(B, blaTEM, and sul2. In a functional-based approach, DNA prepared from pooled saliva samples was cloned into Escherichia coli and screened for expression of resistance to ampicillin or sulphonamide, two of the most common resistances found by array. The functional ampicillin resistance screen recovered genes encoding components of a predicted AcrRAB efflux pump. In the functional sulphonamide resistance screen, folP genes were recovered encoding mutant dihydropteroate synthase, the target of sulphonamide action. The genes recovered from the functional screens were from the chromosomes of commensal species that are opportunistically pathogenic and capable of exchanging DNA with related pathogenic species. Genes identified by microarray were not recovered in the activity-based screen, indicating that these two methods can be complementary in facilitating the identification of a range of resistance mechanisms present within the human microbiome. It also provides further evidence of the diverse reservoir of resistance mechanisms present in bacterial populations in the human gut and saliva. In future the methods described in this study can be used to monitor changes in the resistome in response to antibiotic therapy.

A modifier screen for Bazooka/PAR-3 interacting genes in the Drosophila embryo epithelium.

Directory of Open Access Journals (Sweden)

Wei Shao

2010-04-01

Full Text Available The development and homeostasis of multicellular organisms depends on sheets of epithelial cells. Bazooka (Baz; PAR-3 localizes to the apical circumference of epithelial cells and is a key hub in the protein interaction network regulating epithelial structure. We sought to identify additional proteins that function with Baz to regulate epithelial structure in the Drosophila embryo.The baz zygotic mutant cuticle phenotype could be dominantly enhanced by loss of known interaction partners. To identify additional enhancers, we screened molecularly defined chromosome 2 and 3 deficiencies. 37 deficiencies acted as strong dominant enhancers. Using deficiency mapping, bioinformatics, and available single gene mutations, we identified 17 interacting genes encoding known and predicted polarity, cytoskeletal, transmembrane, trafficking and signaling proteins. For each gene, their loss of function enhanced adherens junction defects in zygotic baz mutants during early embryogenesis. To further evaluate involvement in epithelial polarity, we generated GFP fusion proteins for 15 of the genes which had not been found to localize to the apical domain previously. We found that GFP fusion proteins for Drosophila ASAP, Arf79F, CG11210, Septin 5 and Sds22 could be recruited to the apical circumference of epithelial cells. Nine of the other proteins showed various intracellular distributions, and one was not detected.Our enhancer screen identified 17 genes that function with Baz to regulate epithelial structure in the Drosophila embryo. Our secondary localization screen indicated that some of the proteins may affect epithelial cell polarity by acting at the apical cell cortex while others may act through intracellular processes. For 13 of the 17 genes, this is the first report of a link to baz or the regulation of epithelial structure.

Genome wide transcriptional response of Saccharomyces cerevisiae to stress-induced perturbations

Directory of Open Access Journals (Sweden)

Hilal eTaymaz-Nikerel

2016-02-01

Full Text Available Cells respond to environmental and/or genetic perturbations in order to survive and proliferate. Characterization of the changes after various stimuli at different -omics levels is crucial to comprehend the adaptation of cells to changing conditions. Genome wide quantification and analysis of transcript levels, the genes affected by perturbations, extends our understanding of cellular metabolism by pointing out the mechanisms that play role in sensing the stress caused by those perturbations and related signaling pathways, and in this way guides us to achieve endeavors such as rational engineering of cells or interpretation of disease mechanisms. Saccharomyces cerevisiae as a model system has been studied in response to different perturbations and corresponding transcriptional profiles were followed either statically or/and dynamically, short- and long- term. This review focuses on response of yeast cells to diverse stress inducing perturbations including nutritional changes, ionic stress, salt stress, oxidative stress, osmotic shock, as well as to genetic interventions such as deletion and over-expression of genes. It is aimed to conclude on common regulatory phenomena that allow yeast to organize its transcriptomic response after any perturbation under different external conditions.

Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

Directory of Open Access Journals (Sweden)

Fernanda Veronese Oliveira

2014-01-01

Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.

Overexpression screens identify conserved dosage chromosome instability genes in yeast and human cancer

Science.gov (United States)

Duffy, Supipi; Fam, Hok Khim; Wang, Yi Kan; Styles, Erin B.; Kim, Jung-Hyun; Ang, J. Sidney; Singh, Tejomayee; Larionov, Vladimir; Shah, Sohrab P.; Andrews, Brenda; Boerkoel, Cornelius F.; Hieter, Philip

2016-01-01

Somatic copy number amplification and gene overexpression are common features of many cancers. To determine the role of gene overexpression on chromosome instability (CIN), we performed genome-wide screens in the budding yeast for yeast genes that cause CIN when overexpressed, a phenotype we refer to as dosage CIN (dCIN), and identified 245 dCIN genes. This catalog of genes reveals human orthologs known to be recurrently overexpressed and/or amplified in tumors. We show that two genes, TDP1, a tyrosyl-DNA-phosphdiesterase, and TAF12, an RNA polymerase II TATA-box binding factor, cause CIN when overexpressed in human cells. Rhabdomyosarcoma lines with elevated human Tdp1 levels also exhibit CIN that can be partially rescued by siRNA-mediated knockdown of TDP1. Overexpression of dCIN genes represents a genetic vulnerability that could be leveraged for selective killing of cancer cells through targeting of an unlinked synthetic dosage lethal (SDL) partner. Using SDL screens in yeast, we identified a set of genes that when deleted specifically kill cells with high levels of Tdp1. One gene was the histone deacetylase RPD3, for which there are known inhibitors. Both HT1080 cells overexpressing hTDP1 and rhabdomyosarcoma cells with elevated levels of hTdp1 were more sensitive to histone deacetylase inhibitors valproic acid (VPA) and trichostatin A (TSA), recapitulating the SDL interaction in human cells and suggesting VPA and TSA as potential therapeutic agents for tumors with elevated levels of hTdp1. The catalog of dCIN genes presented here provides a candidate list to identify genes that cause CIN when overexpressed in cancer, which can then be leveraged through SDL to selectively target tumors. PMID:27551064

Screening Reliable Reference Genes for RT-qPCR Analysis of Gene Expression in Moringa oleifera.

Science.gov (United States)

Deng, Li-Ting; Wu, Yu-Ling; Li, Jun-Cheng; OuYang, Kun-Xi; Ding, Mei-Mei; Zhang, Jun-Jie; Li, Shu-Qi; Lin, Meng-Fei; Chen, Han-Bin; Hu, Xin-Sheng; Chen, Xiao-Yang

2016-01-01

Moringa oleifera is a promising plant species for oil and forage, but its genetic improvement is limited. Our current breeding program in this species focuses on exploiting the functional genes associated with important agronomical traits. Here, we screened reliable reference genes for accurately quantifying the expression of target genes using the technique of real-time quantitative polymerase chain reaction (RT-qPCR) in M. oleifera. Eighteen candidate reference genes were selected from a transcriptome database, and their expression stabilities were examined in 90 samples collected from the pods in different developmental stages, various tissues, and the roots and leaves under different conditions (low or high temperature, sodium chloride (NaCl)- or polyethyleneglycol (PEG)- simulated water stress). Analyses with geNorm, NormFinder and BestKeeper algorithms revealed that the reliable reference genes differed across sample designs and that ribosomal protein L1 (RPL1) and acyl carrier protein 2 (ACP2) were the most suitable reference genes in all tested samples. The experiment results demonstrated the significance of using the properly validated reference genes and suggested the use of more than one reference gene to achieve reliable expression profiles. In addition, we applied three isotypes of the superoxide dismutase (SOD) gene that are associated with plant adaptation to abiotic stress to confirm the efficacy of the validated reference genes under NaCl and PEG water stresses. Our results provide a valuable reference for future studies on identifying important functional genes from their transcriptional expressions via RT-qPCR technique in M. oleifera.

A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

Science.gov (United States)

Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

2012-06-01

Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

Science.gov (United States)

Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

2018-02-12

Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

Human synthetic lethal inference as potential anti-cancer target gene detection

Directory of Open Access Journals (Sweden)

Solé Ricard V

2009-12-01

Full Text Available Abstract Background Two genes are called synthetic lethal (SL if mutation of either alone is not lethal, but mutation of both leads to death or a significant decrease in organism's fitness. The detection of SL gene pairs constitutes a promising alternative for anti-cancer therapy. As cancer cells exhibit a large number of mutations, the identification of these mutated genes' SL partners may provide specific anti-cancer drug candidates, with minor perturbations to the healthy cells. Since existent SL data is mainly restricted to yeast screenings, the road towards human SL candidates is limited to inference methods. Results In the present work, we use phylogenetic analysis and database manipulation (BioGRID for interactions, Ensembl and NCBI for homology, Gene Ontology for GO attributes in order to reconstruct the phylogenetically-inferred SL gene network for human. In addition, available data on cancer mutated genes (COSMIC and Cancer Gene Census databases as well as on existent approved drugs (DrugBank database supports our selection of cancer-therapy candidates. Conclusions Our work provides a complementary alternative to the current methods for drug discovering and gene target identification in anti-cancer research. Novel SL screening analysis and the use of highly curated databases would contribute to improve the results of this methodology.

CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome.

Science.gov (United States)

Klann, Tyler S; Black, Joshua B; Chellappan, Malathi; Safi, Alexias; Song, Lingyun; Hilton, Isaac B; Crawford, Gregory E; Reddy, Timothy E; Gersbach, Charles A

2017-06-01

Large genome-mapping consortia and thousands of genome-wide association studies have identified non-protein-coding elements in the genome as having a central role in various biological processes. However, decoding the functions of the millions of putative regulatory elements discovered in these studies remains challenging. CRISPR-Cas9-based epigenome editing technologies have enabled precise perturbation of the activity of specific regulatory elements. Here we describe CRISPR-Cas9-based epigenomic regulatory element screening (CERES) for improved high-throughput screening of regulatory element activity in the native genomic context. Using dCas9 KRAB repressor and dCas9 p300 activator constructs and lentiviral single guide RNA libraries to target DNase I hypersensitive sites surrounding a gene of interest, we carried out both loss- and gain-of-function screens to identify regulatory elements for the β-globin and HER2 loci in human cells. CERES readily identified known and previously unidentified regulatory elements, some of which were dependent on cell type or direction of perturbation. This technology allows the high-throughput functional annotation of putative regulatory elements in their native chromosomal context.

A modified screening system for loss-of-function and dominant negative alleles of essential MCMV genes.

Directory of Open Access Journals (Sweden)

Madlen Pogoda

Full Text Available Inactivation of gene products by dominant negative mutants is a valuable tool to assign functions to yet uncharacterized proteins, to map protein-protein interactions or to dissect physiological pathways. Detailed functional and structural knowledge about the target protein would allow the construction of inhibitory mutants by targeted mutagenesis. Yet, such data are limited for the majority of viral proteins, so that the target gene needs to be subjected to random mutagenesis to identify suitable mutants. However, for cytomegaloviruses this requires a two-step screening approach, which is time-consuming and labor-intensive. Here, we report the establishment of a high-throughput suitable screening system for the identification of inhibitory alleles of essential genes of the murine cytomegalovirus (MCMV. In this screen, the site-specific recombination of a specifically modified MCMV genome was transferred from the bacterial background to permissive host cells, thereby combining the genetic engineering and the rescue test in one step. Using a reference set of characterized pM53 mutants it was shown that the novel system is applicable to identify non-complementing as well as inhibitory mutants in a high-throughput suitable setup. The new cis-complementation assay was also applied to a basic genetic characterization of pM99, which was identified as essential for MCMV growth. We believe that the here described novel genetic screening approach can be adapted for the genetic characterization of essential genes of any large DNA viruses.

Detection of perturbation phases and developmental stages in organisms from DNA microarray time series data.

Directory of Open Access Journals (Sweden)

Marianne Rooman

Full Text Available Available DNA microarray time series that record gene expression along the developmental stages of multicellular eukaryotes, or in unicellular organisms subject to external perturbations such as stress and diauxie, are analyzed. By pairwise comparison of the gene expression profiles on the basis of a translation-invariant and scale-invariant distance measure corresponding to least-rectangle regression, it is shown that peaks in the average distance values are noticeable and are localized around specific time points. These points systematically coincide with the transition points between developmental phases or just follow the external perturbations. This approach can thus be used to identify automatically, from microarray time series alone, the presence of external perturbations or the succession of developmental stages in arbitrary cell systems. Moreover, our results show that there is a striking similarity between the gene expression responses to these a priori very different phenomena. In contrast, the cell cycle does not involve a perturbation-like phase, but rather continuous gene expression remodeling. Similar analyses were conducted using three other standard distance measures, showing that the one we introduced was superior. Based on these findings, we set up an adapted clustering method that uses this distance measure and classifies the genes on the basis of their expression profiles within each developmental stage or between perturbation phases.

Genome-wide analysis of E. coli cell-gene interactions.

Science.gov (United States)

Cardinale, S; Cambray, G

2017-11-23

The pursuit of standardization and reliability in synthetic biology has achieved, in recent years, a number of advances in the design of more predictable genetic parts for biological circuits. However, even with the development of high-throughput screening methods and whole-cell models, it is still not possible to predict reliably how a synthetic genetic construct interacts with all cellular endogenous systems. This study presents a genome-wide analysis of how the expression of synthetic genes is affected by systematic perturbations of cellular functions. We found that most perturbations modulate expression indirectly through an effect on cell size, putting forward the existence of a generic Size-Expression interaction in the model prokaryote Escherichia coli. The Size-Expression interaction was quantified by inserting a dual fluorescent reporter gene construct into each of the 3822 single-gene deletion strains comprised in the KEIO collection. Cellular size was measured for single cells via flow cytometry. Regression analyses were used to discriminate between expression-specific and gene-specific effects. Functions of the deleted genes broadly mapped onto three systems with distinct primary influence on the Size-Expression map. Perturbations in the Division and Biosynthesis (DB) system led to a large-cell and high-expression phenotype. In contrast, disruptions of the Membrane and Motility (MM) system caused small-cell and low-expression phenotypes. The Energy, Protein synthesis and Ribosome (EPR) system was predominantly associated with smaller cells and positive feedback on ribosome function. Feedback between cell growth and gene expression is widespread across cell systems. Even though most gene disruptions proximally affect one component of the Size-Expression interaction, the effect therefore ultimately propagates to both. More specifically, we describe the dual impact of growth on cell size and gene expression through cell division and ribosomal content

Screening Key Genes Associated with the Development and Progression of Non-small Cell Lung Cancer Based on Gene-enrichment Analysis and Meta-analysis

Directory of Open Access Journals (Sweden)

Wenwu HE

2012-07-01

Full Text Available Background and objective Non-small cell lung cancer (NSCLC is one of the most common malignant tumors; however, its causes are still not completely understood. This study was designed to screen the key genes and pathways related to NSCLC occurrence and development and to establish the scientific foundation for the genetic mechanisms and targeted therapy of NSCLC. Methods Both gene set-enrichment analysis (GSEA and meta-analysis (meta were used to screen the critical pathways and genes that might be corretacted with the development and progression of lung cancer at the transcription level. Results Using the GSEA and meta methods, focal adhesion and regulation of actin cytoskeleton were determined to be the more prominent overlapping significant pathways. In the focal adhesion pathway, 31 genes were statistically significant (P<0.05, whereas in the regulation of actin cytoskeleton pathway, 32 genes were statistically significant (P<0.05. Conclusion The focal adhesion and the regulation of actin cytoskeleton pathways might play important roles in the occurrence and development of NSCLC. Further studies are needed to determine the biological function for the positiue genes.

A powerful nonparametric method for detecting differentially co-expressed genes: distance correlation screening and edge-count test.

Science.gov (United States)

Zhang, Qingyang

2018-05-16

Differential co-expression analysis, as a complement of differential expression analysis, offers significant insights into the changes in molecular mechanism of different phenotypes. A prevailing approach to detecting differentially co-expressed genes is to compare Pearson's correlation coefficients in two phenotypes. However, due to the limitations of Pearson's correlation measure, this approach lacks the power to detect nonlinear changes in gene co-expression which is common in gene regulatory networks. In this work, a new nonparametric procedure is proposed to search differentially co-expressed gene pairs in different phenotypes from large-scale data. Our computational pipeline consisted of two main steps, a screening step and a testing step. The screening step is to reduce the search space by filtering out all the independent gene pairs using distance correlation measure. In the testing step, we compare the gene co-expression patterns in different phenotypes by a recently developed edge-count test. Both steps are distribution-free and targeting nonlinear relations. We illustrate the promise of the new approach by analyzing the Cancer Genome Atlas data and the METABRIC data for breast cancer subtypes. Compared with some existing methods, the new method is more powerful in detecting nonlinear type of differential co-expressions. The distance correlation screening can greatly improve computational efficiency, facilitating its application to large data sets.

PCR Screening of Antibiotic Resistance Genes in Faecal Samples from Australian and Chinese Children.

Science.gov (United States)

Ravensdale, Joshua T; Xian, Darren Ten Wei; Wei, Chooi Ming; Lv, Quanjun; Wen, Xiajian; Guo, Jing; Coorey, Ranil; LeSouëf, Peter; Lu, Fengmin; Zhang, Brad; Dykes, Gary A

2018-03-31

Recent public awareness campaigns on the risk of antibiotic resistance in pathogenic microbes has placed pressure on governments to enforce stricter antimicrobial stewardship policies on the hospital and agricultural industry. This study aimed to screen faecal samples from Australian and Chinese children for the presence of antibiotic resistance genes to identify demographics at risk of carriage of these genes and examine antimicrobial stewardship policies from the two countries which may influence carriage. Faecal samples from 46 Australian and 53 Chinese children were screened for the presence of six clinically relevant antibiotic resistance genes using PCR. Clinical and demographic data was also collected from each patient. Over 90% of faecal samples from Chinese children tested positive for β-lactam, macrolide, tetracycline, and aminoglycoside resistance genes, which was substantially higher than Australian samples. Besides country of origin, no clear trend could be seen to predict carriage of resistance genes. The exception to this was Chinese born children who immigrated to Australia having higher rates of carriage for bla TEM and tetM genes than children born and still living in Australia. These data indicated that Chinese children were more likely to carry certain antibiotic resistance genes than Australian children. The Chinese government has recently implemented strict policies to control the overuse of antibiotics in hospitals. However, many of these policies do not extend to the agricultural industry which could explain the differences seen in this study. Copyright © 2018. Published by Elsevier Ltd.

Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

Science.gov (United States)

Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

2018-01-01

Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

RNA Interference Screen to Identify Pathways That Enhance or Reduce Nonviral Gene Transfer During Lipofection

OpenAIRE

Barker, Gregory A; Diamond, Scott L

2008-01-01

Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In con...

Dynamic screening and electron dynamics in low-dimensional metal systems

International Nuclear Information System (INIS)

Silkin, V.M.; Quijada, M.; Vergniory, M.G.; Alducin, M.; Borisov, A.G.; Diez Muino, R.; Juaristi, J.I.; Sanchez-Portal, D.; Chulkov, E.V.; Echenique, P.M.

2007-01-01

Recent advances in the theoretical description of dynamic screening and electron dynamics in metallic media are reviewed. The time-dependent building-up of screening in different situations is addressed. Perturbative and non-perturbative theories are used to study electron dynamics in low-dimensional systems, such as metal clusters, image states, surface states and quantum wells. Modification of the electronic lifetimes due to confinement effects is analyzed as well

Protocols for screening antimicrobial peptides that influence virulence gene expression in Staphylococcus aureus

DEFF Research Database (Denmark)

Bojer, Martin Saxtorph; Baldry, Mara; Ingmer, Hanne

2017-01-01

Compounds that inhibit virulence gene expression in bacterial pathogens have received increasing interest as possible alternatives to the traditional antibiotic treatment of infections. For the human pathogen Staphylococcus aureus, we have developed two simple assays based on reporter gene fusions...... to central virulence genes that are easily applicable for screening various sources of natural and synthetic peptides for anti-virulence effects. The plate assay is qualitative but simultaneously assesses the effect of gradient concentrations of the investigated compound, whereas the liquid assay...... is quantitative and can be employed to address whether a compound is acting on the central quorum sensing regulatory system, agr, that controls a large number of virulence genes in S. aureus....

A small interfering RNA screen of genes involved in DNA repair identifies tumor-specific radiosensitization by POLQ knockdown

DEFF Research Database (Denmark)

Higgins, Geoff S; Prevo, Remko; Lee, Yin-Fai

2010-01-01

The effectiveness of radiotherapy treatment could be significantly improved if tumor cells could be rendered more sensitive to ionizing radiation (IR) without altering the sensitivity of normal tissues. However, many of the key therapeutically exploitable mechanisms that determine intrinsic tumor...... radiosensitivity are largely unknown. We have conducted a small interfering RNA (siRNA) screen of 200 genes involved in DNA damage repair aimed at identifying genes whose knockdown increased tumor radiosensitivity. Parallel siRNA screens were conducted in irradiated and unirradiated tumor cells (SQ20B......) and irradiated normal tissue cells (MRC5). Using gammaH2AX foci at 24 hours after IR, we identified several genes, such as BRCA2, Lig IV, and XRCC5, whose knockdown is known to cause increased cell radiosensitivity, thereby validating the primary screening end point. In addition, we identified POLQ (DNA...

Nonlinearly perturbed semi-Markov processes

CERN Document Server

Silvestrov, Dmitrii

2017-01-01

The book presents new methods of asymptotic analysis for nonlinearly perturbed semi-Markov processes with a finite phase space. These methods are based on special time-space screening procedures for sequential phase space reduction of semi-Markov processes combined with the systematical use of operational calculus for Laurent asymptotic expansions. Effective recurrent algorithms are composed for getting asymptotic expansions, without and with explicit upper bounds for remainders, for power moments of hitting times, stationary and conditional quasi-stationary distributions for nonlinearly perturbed semi-Markov processes. These results are illustrated by asymptotic expansions for birth-death-type semi-Markov processes, which play an important role in various applications. The book will be a useful contribution to the continuing intensive studies in the area. It is an essential reference for theoretical and applied researchers in the field of stochastic processes and their applications that will cont...

A genome scale RNAi screen identifies GLI1 as a novel gene regulating vorinostat sensitivity.

Science.gov (United States)

Falkenberg, K J; Newbold, A; Gould, C M; Luu, J; Trapani, J A; Matthews, G M; Simpson, K J; Johnstone, R W

2016-07-01

Vorinostat is an FDA-approved histone deacetylase inhibitor (HDACi) that has proven clinical success in some patients; however, it remains unclear why certain patients remain unresponsive to this agent and other HDACis. Constitutive STAT (signal transducer and activator of transcription) activation, overexpression of prosurvival Bcl-2 proteins and loss of HR23B have been identified as potential biomarkers of HDACi resistance; however, none have yet been used to aid the clinical utility of HDACi. Herein, we aimed to further elucidate vorinostat-resistance mechanisms through a functional genomics screen to identify novel genes that when knocked down by RNA interference (RNAi) sensitized cells to vorinostat-induced apoptosis. A synthetic lethal functional screen using a whole-genome protein-coding RNAi library was used to identify genes that when knocked down cooperated with vorinostat to induce tumor cell apoptosis in otherwise resistant cells. Through iterative screening, we identified 10 vorinostat-resistance candidate genes that sensitized specifically to vorinostat. One of these vorinostat-resistance genes was GLI1, an oncogene not previously known to regulate the activity of HDACi. Treatment of vorinostat-resistant cells with the GLI1 small-molecule inhibitor, GANT61, phenocopied the effect of GLI1 knockdown. The mechanism by which GLI1 loss of function sensitized tumor cells to vorinostat-induced apoptosis is at least in part through interactions with vorinostat to alter gene expression in a manner that favored apoptosis. Upon GLI1 knockdown and vorinostat treatment, BCL2L1 expression was repressed and overexpression of BCL2L1 inhibited GLI1-knockdown-mediated vorinostat sensitization. Taken together, we present the identification and characterization of GLI1 as a new HDACi resistance gene, providing a strong rationale for development of GLI1 inhibitors for clinical use in combination with HDACi therapy.

Construction of the BAC Library of Small Abalone (Haliotis diversicolor) for Gene Screening and Genome Characterization.

Science.gov (United States)

Jiang, Likun; You, Weiwei; Zhang, Xiaojun; Xu, Jian; Jiang, Yanliang; Wang, Kai; Zhao, Zixia; Chen, Baohua; Zhao, Yunfeng; Mahboob, Shahid; Al-Ghanim, Khalid A; Ke, Caihuan; Xu, Peng

2016-02-01

The small abalone (Haliotis diversicolor) is one of the most important aquaculture species in East Asia. To facilitate gene cloning and characterization, genome analysis, and genetic breeding of it, we constructed a large-insert bacterial artificial chromosome (BAC) library, which is an important genetic tool for advanced genetics and genomics research. The small abalone BAC library includes 92,610 clones with an average insert size of 120 Kb, equivalent to approximately 7.6× of the small abalone genome. We set up three-dimensional pools and super pools of 18,432 BAC clones for target gene screening using PCR method. To assess the approach, we screened 12 target genes in these 18,432 BAC clones and identified 16 positive BAC clones. Eight positive BAC clones were then sequenced and assembled with the next generation sequencing platform. The assembled contigs representing these 8 BAC clones spanned 928 Kb of the small abalone genome, providing the first batch of genome sequences for genome evaluation and characterization. The average GC content of small abalone genome was estimated as 40.33%. A total of 21 protein-coding genes, including 7 target genes, were annotated into the 8 BACs, which proved the feasibility of PCR screening approach with three-dimensional pools in small abalone BAC library. One hundred fifty microsatellite loci were also identified from the sequences for marker development in the future. The BAC library and clone pools provided valuable resources and tools for genetic breeding and conservation of H. diversicolor.

Mathematical inference and control of molecular networks from perturbation experiments

Science.gov (United States)

Mohammed-Rasheed, Mohammed

One of the main challenges facing biologists and mathematicians in the post genomic era is to understand the behavior of molecular networks and harness this understanding into an educated intervention of the cell. The cell maintains its function via an elaborate network of interconnecting positive and negative feedback loops of genes, RNA and proteins that send different signals to a large number of pathways and molecules. These structures are referred to as genetic regulatory networks (GRNs) or molecular networks. GRNs can be viewed as dynamical systems with inherent properties and mechanisms, such as steady-state equilibriums and stability, that determine the behavior of the cell. The biological relevance of the mathematical concepts are important as they may predict the differentiation of a stem cell, the maintenance of a normal cell, the development of cancer and its aberrant behavior, and the design of drugs and response to therapy. Uncovering the underlying GRN structure from gene/protein expression data, e.g., microarrays or perturbation experiments, is called inference or reverse engineering of the molecular network. Because of the high cost and time consuming nature of biological experiments, the number of available measurements or experiments is very small compared to the number of molecules (genes, RNA and proteins). In addition, the observations are noisy, where the noise is due to the measurements imperfections as well as the inherent stochasticity of genetic expression levels. Intra-cellular activities and extra-cellular environmental attributes are also another source of variability. Thus, the inference of GRNs is, in general, an under-determined problem with a highly noisy set of observations. The ultimate goal of GRN inference and analysis is to be able to intervene within the network, in order to force it away from undesirable cellular states and into desirable ones. However, it remains a major challenge to design optimal intervention strategies

RNA interference screen to identify pathways that enhance or reduce nonviral gene transfer during lipofection.

Science.gov (United States)

Barker, Gregory A; Diamond, Scott L

2008-09-01

Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In confirmation tests with single siRNAs, 18 of the 130 hits showed enhanced lipofection with two or more individual siRNAs in the absence of cytotoxicity. Of these confirmed gene targets, we identified five leading candidates, two of which are isoforms of the regulatory subunit of protein phosphatase 2A (PP2A). The best candidate siRNA targeted the PPP2R2C gene and produced a 65% increase in luminescence from lipofection, with a quantitative PCR-validated knockdown of approximately 76%. Flow cytometric analysis confirmed that the silencing of the PPP2R2C gene resulted in an improvement of 10% in transfection efficiency, thereby demonstrating an increase in the number of transfected cells. These results show that an RNA interference (RNAi) high-throughput screen (HTS) can be applied to nonviral gene transfer. We have also demonstrated that siRNAs can be co-delivered with lipofected DNA to increase the transfection efficiency in vitro.

Perturbations of gut microbiome genes in infants with atopic dermatitis according to feeding type.

Science.gov (United States)

Lee, Min-Jung; Kang, Mi-Jin; Lee, So-Yeon; Lee, Eun; Kim, Kangjin; Won, Sungho; Suh, Dong In; Kim, Kyung Won; Sheen, Youn Ho; Ahn, Kangmo; Kim, Bong-Soo; Hong, Soo-Jong

2018-04-01

Perturbations of the infant gut microbiota can shape development of the immune system and link to the risk of allergic diseases. We sought to understand the role of the gut microbiome in patients with atopic dermatitis (AD). The metagenome of the infant gut microbiome was analyzed according to feeding types. Composition of the gut microbiota was analyzed in fecal samples from 129 infants (6 months old) by using pyrosequencing, including 66 healthy infants and 63 infants with AD. The functional profile of the gut microbiome was analyzed by means of whole-metagenome sequencing (20 control subjects and 20 patients with AD). In addition, the total number of bacteria in the feces was determined by using real-time PCR. The gut microbiome of 6-month-old infants was different based on feeding types, and 2 microbiota groups (Bifidobacterium species-dominated and Escherichia/Veillonella species-dominated groups) were found in breast-fed and mixed-fed infants. Bacterial cell amounts in the feces were lower in infants with AD than in control infants. Although no specific taxa directly correlated with AD in 16S rRNA gene results, whole-metagenome analysis revealed differences in functional genes related to immune development. The reduction in genes for oxidative phosphorylation, phosphatidylinositol 3-kinase-Akt signaling, estrogen signaling, nucleotide-binding domain-like receptor signaling, and antigen processing and presentation induced by reduced colonization of mucin-degrading bacteria (Akkermansia muciniphila, Ruminococcus gnavus, and Lachnospiraceae bacterium 2_1_58FAA) was significantly associated with stunted immune development in the AD group compared with the control group (P gut microbiome can be associated with AD because of different bacterial genes that can modulate host immune cell function. Copyright © 2018 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Revealing the Determinants of Widespread Alternative Splicing Perturbation in Cancer

Directory of Open Access Journals (Sweden)

Yongsheng Li

2017-10-01

Full Text Available It is increasingly appreciated that alternative splicing plays a key role in generating functional specificity and diversity in cancer. However, the mechanisms by which cancer mutations perturb splicing remain unknown. Here, we developed a network-based strategy, DrAS-Net, to investigate more than 2.5 million variants across cancer types and link somatic mutations with cancer-specific splicing events. We identified more than 40,000 driver variant candidates and their 80,000 putative splicing targets deregulated in 33 cancer types and inferred their functional impact. Strikingly, tumors with splicing perturbations show reduced expression of immune system-related genes and increased expression of cell proliferation markers. Tumors harboring different mutations in the same gene often exhibit distinct splicing perturbations. Further stratification of 10,000 patients based on their mutation-splicing relationships identifies subtypes with distinct clinical features, including survival rates. Our work reveals how single-nucleotide changes can alter the repertoires of splicing isoforms, providing insights into oncogenic mechanisms for precision medicine.

RNAi screen of DAF-16/FOXO target genes in C. elegans links pathogenesis and dauer formation.

Directory of Open Access Journals (Sweden)

Victor L Jensen

2010-12-01

Full Text Available The DAF-16/FOXO transcription factor is the major downstream output of the insulin/IGF1R signaling pathway controlling C. elegans dauer larva development and aging. To identify novel downstream genes affecting dauer formation, we used RNAi to screen candidate genes previously identified to be regulated by DAF-16. We used a sensitized genetic background [eri-1(mg366; sdf-9(m708], which enhances both RNAi efficiency and constitutive dauer formation (Daf-c. Among 513 RNAi clones screened, 21 displayed a synthetic Daf-c (SynDaf phenotype with sdf-9. One of these genes, srh-100, was previously identified to be SynDaf, but twenty have not previously been associated with dauer formation. Two of the latter genes, lys-1 and cpr-1, are known to participate in innate immunity and six more are predicted to do so, suggesting that the immune response may contribute to the dauer decision. Indeed, we show that two of these genes, lys-1 and clc-1, are required for normal resistance to Staphylococcus aureus. clc-1 is predicted to function in epithelial cohesion. Dauer formation exhibited by daf-8(m85, sdf-9(m708, and the wild-type N2 (at 27°C were all enhanced by exposure to pathogenic bacteria, while not enhanced in a daf-22(m130 background. We conclude that knockdown of the genes required for proper pathogen resistance increases pathogenic infection, leading to increased dauer formation in our screen. We propose that dauer larva formation is a behavioral response to pathogens mediated by increased dauer pheromone production.

Screen for genes involved in radiation survival of Escherichia coli and construction of a reference database

Energy Technology Data Exchange (ETDEWEB)

Sargentini, Neil J., E-mail: nsargentini@atsu.edu; Gularte, Nicholas P.; Hudman, Deborah A.

2016-11-15

Highlights: • 3907 Keio knockout mutants of E. coli screened for UV and X-radiation sensitivity. • 76 mutants showed significantly increased radiation sensitivity. • A database of 9 screening studies listed 352 genes only once; 103 genes, 2–7 times. • 33 genes from this study are uncommon and potentially novel. • Common and uncommon genes differ in gene function profile. - Abstract: A set of 3907 single-gene knockout (Keio collection) strains of Escherichia coli K-12 was examined for strains with increased susceptibility to killing by X- or UV-radiation. After screening with a high-throughput resazurin-based assay and determining radiation survival with triplicate clonogenic assays, we identified 76 strains (and associated deleted genes) showing statistically-significant increased radiation sensitivity compared to a control strain. To determine gene novelty, we constructed a reference database comprised of genes found in nine similar studies including ours. This database contains 455 genes comprised of 103 common genes (found 2–7 times), and 352 uncommon genes (found once). Our 76 genes includes 43 common genes and 33 uncommon (potentially novel) genes, i.e., appY, atoS, betB, bglJ, clpP, cpxA, cysB, cysE, ddlA, dgkA, dppF, dusB, elfG, eutK, fadD, glnA, groL, guaB, intF, prpR, queA, rplY, seqA, sufC,yadG, yagJ, yahD, yahO, ybaK, ybfA, yfaL, yhjV, and yiaL. Of our 33 uncommon gene mutants, 4 (12%) were sensitive only to UV-radiation, 10 (30%) only to X-radiation, and 19 (58%) to both radiations. Our uncommon mutants vs. our common mutants showed more radiation specificity, i.e., 12% vs. 9% (sensitive only to UV-); 30% vs. 16% (X-) and 58% vs. 74% (both radiations). Considering just our radiation-sensitive mutants, the median UV-radiation survival (75 J m{sup −2}) for 23 uncommon mutants was 6.84E-3 compared to 1.85E-3 for 36 common mutants (P = 0.025). Similarly, the average X-radiation survival for 29 uncommon mutants was 1.08E-2, compared to 6.19E

A Genome-Wide Screen for Dendritically Localized RNAs Identifies Genes Required for Dendrite Morphogenesis

Directory of Open Access Journals (Sweden)

Mala Misra

2016-08-01

Full Text Available Localizing messenger RNAs at specific subcellular sites is a conserved mechanism for targeting the synthesis of cytoplasmic proteins to distinct subcellular domains, thereby generating the asymmetric protein distributions necessary for cellular and developmental polarity. However, the full range of transcripts that are asymmetrically distributed in specialized cell types, and the significance of their localization, especially in the nervous system, are not known. We used the EP-MS2 method, which combines EP transposon insertion with the MS2/MCP in vivo fluorescent labeling system, to screen for novel localized transcripts in polarized cells, focusing on the highly branched Drosophila class IV dendritic arborization neurons. Of a total of 541 lines screened, we identified 55 EP-MS2 insertions producing transcripts that were enriched in neuronal processes, particularly in dendrites. The 47 genes identified by these insertions encode molecularly diverse proteins, and are enriched for genes that function in neuronal development and physiology. RNAi-mediated knockdown confirmed roles for many of the candidate genes in dendrite morphogenesis. We propose that the transport of mRNAs encoded by these genes into the dendrites allows their expression to be regulated on a local scale during the dynamic developmental processes of dendrite outgrowth, branching, and/or remodeling.

A high-throughput fluorescence-based assay system for appetite-regulating gene and drug screening.

Directory of Open Access Journals (Sweden)

Yasuhito Shimada

Full Text Available The increasing number of people suffering from metabolic syndrome and obesity is becoming a serious problem not only in developed countries, but also in developing countries. However, there are few agents currently approved for the treatment of obesity. Those that are available are mainly appetite suppressants and gastrointestinal fat blockers. We have developed a simple and rapid method for the measurement of the feeding volume of Danio rerio (zebrafish. This assay can be used to screen appetite suppressants and enhancers. In this study, zebrafish were fed viable paramecia that were fluorescently-labeled, and feeding volume was measured using a 96-well microplate reader. Gene expression analysis of brain-derived neurotrophic factor (bdnf, knockdown of appetite-regulating genes (neuropeptide Y, preproinsulin, melanocortin 4 receptor, agouti related protein, and cannabinoid receptor 1, and the administration of clinical appetite suppressants (fluoxetine, sibutramine, mazindol, phentermine, and rimonabant revealed the similarity among mechanisms regulating appetite in zebrafish and mammals. In combination with behavioral analysis, we were able to evaluate adverse effects on locomotor activities from gene knockdown and chemical treatments. In conclusion, we have developed an assay that uses zebrafish, which can be applied to high-throughput screening and target gene discovery for appetite suppressants and enhancers.

Physics in Screening Environments

Science.gov (United States)

Certik, Ondrej

In the current study, we investigated atoms in screening environments like plasmas. It is common practice to extract physical data, such as temperature and electron densities, from plasma experiments. We present results that address inherent computational difficulties that arise when the screening approach is extended to include the interaction between the atomic electrons. We show that there may arise an ambiguity in the interpretation of physical properties, such as temperature and charge density, from experimental data due to the opposing effects of electron-nucleus screening and electron-electron screening. The focus of the work, however, is on the resolution of inherent computational challenges that appear in the computation of two-particle matrix elements. Those enter already at the Hartree-Fock level. Furthermore, as examples of post Hartree-Fock calculations, we show second-order Green's function results and many body perturbation theory results of second order. A self-contained derivation of all necessary equations has been included. The accuracy of the implementation of the method is established by comparing standard unscreened results for various atoms and molecules against literature for Hartree-Fock as well as Green's function and many body perturbation theory. The main results of the thesis are presented in the chapter called Screened Results, where the behavior of several atomic systems depending on electron-electron and electron-nucleus Debye screening was studied. The computer code that we have developed has been made available for anybody to use. Finally, we present and discuss results obtained for screened interactions. We also examine thoroughly the computational details of the calculations and particular implementations of the method.

Genes and gene expression: Localization, damage and control -- A multilevel and inter-disciplinary study

International Nuclear Information System (INIS)

Ts'o, P.O.P.

1990-09-01

All projects are working toward a goal for describing the three dimensional nuclear topography in terms of relative spatial relationships among genes (specific DNA sequence). Methods are now being perfected to detect these genes, quantitatively and spatially, to perturb these genes specifically, and to measure the perturbation in order to assure specificity. We are developing methods to assay, after perturbation of the target DNA within living cells, whether or not only the target sequence are attacked while other sequences remain unharmed. We are now at the stage to do chemical gene modification or masking within living cells in a strictly sequence-specific manner. Soon, we will be able to study the function and the physical location of each gene in living cells with exquisite specificity. 25 refs., 15 figs

Comprehensive Maturity Onset Diabetes of the Young (MODY) Gene Screening in Pregnant Women with Diabetes in India.

Science.gov (United States)

Doddabelavangala Mruthyunjaya, Mahesh; Chapla, Aaron; Hesarghatta Shyamasunder, Asha; Varghese, Deny; Varshney, Manika; Paul, Johan; Inbakumari, Mercy; Christina, Flory; Varghese, Ron Thomas; Kuruvilla, Kurien Anil; V Paul, Thomas; Jose, Ruby; Regi, Annie; Lionel, Jessie; Jeyaseelan, L; Mathew, Jiji; Thomas, Nihal

2017-01-01

Pregnant women with diabetes may have underlying beta cell dysfunction due to mutations/rare variants in genes associated with Maturity Onset Diabetes of the Young (MODY). MODY gene screening would reveal those women genetically predisposed and previously unrecognized with a monogenic form of diabetes for further clinical management, family screening and genetic counselling. However, there are minimal data available on MODY gene variants in pregnant women with diabetes from India. In this study, utilizing the Next generation sequencing (NGS) based protocol fifty subjects were screened for variants in a panel of thirteen MODY genes. Of these subjects 18% (9/50) were positive for definite or likely pathogenic or uncertain MODY variants. The majority of these variants was identified in subjects with autosomal dominant family history, of whom five were in women with pre-GDM and four with overt-GDM. The identified variants included one patient with HNF1A Ser3Cys, two PDX1 Glu224Lys, His94Gln, two NEUROD1 Glu59Gln, Phe318Ser, one INS Gly44Arg, one GCK, one ABCC8 Arg620Cys and one BLK Val418Met variants. In addition, three of the seven offspring screened were positive for the identified variant. These identified variants were further confirmed by Sanger sequencing. In conclusion, these findings in pregnant women with diabetes, imply that a proportion of GDM patients with autosomal dominant family history may have MODY. Further NGS based comprehensive studies with larger samples are required to confirm these finding.

Comprehensive Maturity Onset Diabetes of the Young (MODY Gene Screening in Pregnant Women with Diabetes in India.

Directory of Open Access Journals (Sweden)

Mahesh Doddabelavangala Mruthyunjaya

Full Text Available Pregnant women with diabetes may have underlying beta cell dysfunction due to mutations/rare variants in genes associated with Maturity Onset Diabetes of the Young (MODY. MODY gene screening would reveal those women genetically predisposed and previously unrecognized with a monogenic form of diabetes for further clinical management, family screening and genetic counselling. However, there are minimal data available on MODY gene variants in pregnant women with diabetes from India. In this study, utilizing the Next generation sequencing (NGS based protocol fifty subjects were screened for variants in a panel of thirteen MODY genes. Of these subjects 18% (9/50 were positive for definite or likely pathogenic or uncertain MODY variants. The majority of these variants was identified in subjects with autosomal dominant family history, of whom five were in women with pre-GDM and four with overt-GDM. The identified variants included one patient with HNF1A Ser3Cys, two PDX1 Glu224Lys, His94Gln, two NEUROD1 Glu59Gln, Phe318Ser, one INS Gly44Arg, one GCK, one ABCC8 Arg620Cys and one BLK Val418Met variants. In addition, three of the seven offspring screened were positive for the identified variant. These identified variants were further confirmed by Sanger sequencing. In conclusion, these findings in pregnant women with diabetes, imply that a proportion of GDM patients with autosomal dominant family history may have MODY. Further NGS based comprehensive studies with larger samples are required to confirm these finding.

Comprehensive Maturity Onset Diabetes of the Young (MODY) Gene Screening in Pregnant Women with Diabetes in India

Science.gov (United States)

Hesarghatta Shyamasunder, Asha; Varghese, Deny; Varshney, Manika; Paul, Johan; Inbakumari, Mercy; Christina, Flory; Varghese, Ron Thomas; Kuruvilla, Kurien Anil; V. Paul, Thomas; Jose, Ruby; Regi, Annie; Lionel, Jessie; Jeyaseelan, L.; Mathew, Jiji; Thomas, Nihal

2017-01-01

Pregnant women with diabetes may have underlying beta cell dysfunction due to mutations/rare variants in genes associated with Maturity Onset Diabetes of the Young (MODY). MODY gene screening would reveal those women genetically predisposed and previously unrecognized with a monogenic form of diabetes for further clinical management, family screening and genetic counselling. However, there are minimal data available on MODY gene variants in pregnant women with diabetes from India. In this study, utilizing the Next generation sequencing (NGS) based protocol fifty subjects were screened for variants in a panel of thirteen MODY genes. Of these subjects 18% (9/50) were positive for definite or likely pathogenic or uncertain MODY variants. The majority of these variants was identified in subjects with autosomal dominant family history, of whom five were in women with pre-GDM and four with overt-GDM. The identified variants included one patient with HNF1A Ser3Cys, two PDX1 Glu224Lys, His94Gln, two NEUROD1 Glu59Gln, Phe318Ser, one INS Gly44Arg, one GCK, one ABCC8 Arg620Cys and one BLK Val418Met variants. In addition, three of the seven offspring screened were positive for the identified variant. These identified variants were further confirmed by Sanger sequencing. In conclusion, these findings in pregnant women with diabetes, imply that a proportion of GDM patients with autosomal dominant family history may have MODY. Further NGS based comprehensive studies with larger samples are required to confirm these finding PMID:28095440

Framework for network modularization and Bayesian network analysis to investigate the perturbed metabolic network

Directory of Open Access Journals (Sweden)

Kim Hyun

2011-12-01

Full Text Available Abstract Background Genome-scale metabolic network models have contributed to elucidating biological phenomena, and predicting gene targets to engineer for biotechnological applications. With their increasing importance, their precise network characterization has also been crucial for better understanding of the cellular physiology. Results We herein introduce a framework for network modularization and Bayesian network analysis (FMB to investigate organism’s metabolism under perturbation. FMB reveals direction of influences among metabolic modules, in which reactions with similar or positively correlated flux variation patterns are clustered, in response to specific perturbation using metabolic flux data. With metabolic flux data calculated by constraints-based flux analysis under both control and perturbation conditions, FMB, in essence, reveals the effects of specific perturbations on the biological system through network modularization and Bayesian network analysis at metabolic modular level. As a demonstration, this framework was applied to the genetically perturbed Escherichia coli metabolism, which is a lpdA gene knockout mutant, using its genome-scale metabolic network model. Conclusions After all, it provides alternative scenarios of metabolic flux distributions in response to the perturbation, which are complementary to the data obtained from conventionally available genome-wide high-throughput techniques or metabolic flux analysis.

Framework for network modularization and Bayesian network analysis to investigate the perturbed metabolic network.

Science.gov (United States)

Kim, Hyun Uk; Kim, Tae Yong; Lee, Sang Yup

2011-01-01

Genome-scale metabolic network models have contributed to elucidating biological phenomena, and predicting gene targets to engineer for biotechnological applications. With their increasing importance, their precise network characterization has also been crucial for better understanding of the cellular physiology. We herein introduce a framework for network modularization and Bayesian network analysis (FMB) to investigate organism's metabolism under perturbation. FMB reveals direction of influences among metabolic modules, in which reactions with similar or positively correlated flux variation patterns are clustered, in response to specific perturbation using metabolic flux data. With metabolic flux data calculated by constraints-based flux analysis under both control and perturbation conditions, FMB, in essence, reveals the effects of specific perturbations on the biological system through network modularization and Bayesian network analysis at metabolic modular level. As a demonstration, this framework was applied to the genetically perturbed Escherichia coli metabolism, which is a lpdA gene knockout mutant, using its genome-scale metabolic network model. After all, it provides alternative scenarios of metabolic flux distributions in response to the perturbation, which are complementary to the data obtained from conventionally available genome-wide high-throughput techniques or metabolic flux analysis.

Screening for the Most Suitable Reference Genes for Gene Expression Studies in Equine Milk Somatic Cells.

Directory of Open Access Journals (Sweden)

Jakub Cieslak

Full Text Available Apart from the well-known role of somatic cell count as a parameter reflecting the inflammatory status of the mammary gland, the composition of cells isolated from milk is considered as a valuable material for gene expression studies in mammals. Due to its unique composition, in recent years an increasing interest in mare's milk consumption has been observed. Thus, investigating the genetic background of horse's milk variability presents and interesting study model. Relying on 39 milk samples collected from mares representing three breeds (Polish Primitive Horse, Polish Cold-blooded Horse, Polish Warmblood Horse we aimed to investigate the utility of equine milk somatic cells as a source of mRNA and to screen the best reference genes for RT-qPCR using geNorm and NormFinder algorithms. The results showed that despite relatively low somatic cell counts in mare's milk, the amount and the quality of the extracted RNA are sufficient for gene expression studies. The analysis of the utility of 7 potential reference genes for RT-qPCR experiments for the normalization of equine milk somatic cells revealed some differences between the outcomes of the applied algorithms, although in both cases the KRT8 and TOP2B genes were pointed as the most stable. Analysis by geNorm showed that the combination of 4 reference genes (ACTB, GAPDH, TOP2B and KRT8 is required for apropriate RT-qPCR experiments normalization, whereas NormFinder algorithm pointed the combination of KRT8 and RPS9 genes as the most suitable. The trial study of the relative transcript abundance of the beta-casein gene with the use of various types and numbers of internal control genes confirmed once again that the selection of proper reference gene combinations is crucial for the final results of each real-time PCR experiment.

RBC Antibody Screen

Science.gov (United States)

... C Cystic Fibrosis (CF) Gene Mutations Testing Cytomegalovirus (CMV) Tests D-dimer Dengue Fever Testing Des-gamma- ... Index of Screening Recommendations Not Listed? Not Listed? Newborn Screening Screening Tests for Infants Screening Tests for ...

A genome-wide immunodetection screen in S. cerevisiae uncovers novel genes involved in lysosomal vacuole function and morphology.

Directory of Open Access Journals (Sweden)

Florante Ricarte

Full Text Available Vacuoles of yeast Saccharomyces cerevisiae are functionally analogous to mammalian lysosomes. Both are cellular organelles responsible for macromolecular degradation, ion/pH homeostasis, and stress survival. We hypothesized that undefined gene functions remain at post-endosomal stage of vacuolar events and performed a genome-wide screen directed at such functions at the late endosome and vacuole interface - ENV genes. The immunodetection screen was designed to identify mutants that internally accumulate precursor form of the vacuolar hydrolase carboxypeptidase Y (CPY. Here, we report the uncovering and initial characterizations of twelve ENV genes. The small size of the collection and the lack of genes previously identified with vacuolar events are suggestive of the intended exclusive functional interface of the screen. Most notably, the collection includes four novel genes ENV7, ENV9, ENV10, and ENV11, and three genes previously linked to mitochondrial processes - MAM3, PCP1, PPE1. In all env mutants, vesicular trafficking stages were undisturbed in live cells as assessed by invertase and active α-factor secretion, as well as by localization of the endocytic fluorescent marker FM4-64 to the vacuole. Several mutants exhibit defects in stress survival functions associated with vacuoles. Confocal fluorescence microscopy revealed the collection to be significantly enriched in vacuolar morphologies suggestive of fusion and fission defects. These include the unique phenotype of lumenal vesicles within vacuoles in the novel env9Δ mutant and severely fragmented vacuoles upon deletion of GET4, a gene recently implicated in tail anchored membrane protein insertion. Thus, our results establish new gene functions in vacuolar function and morphology, and suggest a link between vacuolar and mitochondrial events.

Identification of immune protective genes of Eimeria maxima through cDNA expression library screening.

Science.gov (United States)

Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai

2017-02-16

Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our

Live imaging of muscles in Drosophila metamorphosis: Towards high-throughput gene identification and function analysis.

Science.gov (United States)

Puah, Wee Choo; Wasser, Martin

2016-03-01

Time-lapse microscopy in developmental biology is an emerging tool for functional genomics. Phenotypic effects of gene perturbations can be studied non-invasively at multiple time points in chronological order. During metamorphosis of Drosophila melanogaster, time-lapse microscopy using fluorescent reporters allows visualization of alternative fates of larval muscles, which are a model for the study of genes related to muscle wasting. While doomed muscles enter hormone-induced programmed cell death, a smaller population of persistent muscles survives to adulthood and undergoes morphological remodeling that involves atrophy in early, and hypertrophy in late pupation. We developed a method that combines in vivo imaging, targeted gene perturbation and image analysis to identify and characterize genes involved in muscle development. Macrozoom microscopy helps to screen for interesting muscle phenotypes, while confocal microscopy in multiple locations over 4-5 days produces time-lapse images that are used to quantify changes in cell morphology. Performing a similar investigation using fixed pupal tissues would be too time-consuming and therefore impractical. We describe three applications of our pipeline. First, we show how quantitative microscopy can track and measure morphological changes of muscle throughout metamorphosis and analyze genes involved in atrophy. Second, our assay can help to identify genes that either promote or prevent histolysis of abdominal muscles. Third, we apply our approach to test new fluorescent proteins as live markers for muscle development. We describe mKO2 tagged Cysteine proteinase 1 (Cp1) and Troponin-I (TnI) as examples of proteins showing developmental changes in subcellular localization. Finally, we discuss strategies to improve throughput of our pipeline to permit genome-wide screens in the future. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Systems Perturbation Analysis of a Large-Scale Signal Transduction Model Reveals Potentially Influential Candidates for Cancer Therapeutics

Science.gov (United States)

Puniya, Bhanwar Lal; Allen, Laura; Hochfelder, Colleen; Majumder, Mahbubul; Helikar, Tomáš

2016-01-01

Dysregulation in signal transduction pathways can lead to a variety of complex disorders, including cancer. Computational approaches such as network analysis are important tools to understand system dynamics as well as to identify critical components that could be further explored as therapeutic targets. Here, we performed perturbation analysis of a large-scale signal transduction model in extracellular environments that stimulate cell death, growth, motility, and quiescence. Each of the model’s components was perturbed under both loss-of-function and gain-of-function mutations. Using 1,300 simulations under both types of perturbations across various extracellular conditions, we identified the most and least influential components based on the magnitude of their influence on the rest of the system. Based on the premise that the most influential components might serve as better drug targets, we characterized them for biological functions, housekeeping genes, essential genes, and druggable proteins. The most influential components under all environmental conditions were enriched with several biological processes. The inositol pathway was found as most influential under inactivating perturbations, whereas the kinase and small lung cancer pathways were identified as the most influential under activating perturbations. The most influential components were enriched with essential genes and druggable proteins. Moreover, known cancer drug targets were also classified in influential components based on the affected components in the network. Additionally, the systemic perturbation analysis of the model revealed a network motif of most influential components which affect each other. Furthermore, our analysis predicted novel combinations of cancer drug targets with various effects on other most influential components. We found that the combinatorial perturbation consisting of PI3K inactivation and overactivation of IP3R1 can lead to increased activity levels of apoptosis

Identification of genes important for cutaneous function revealed by a large scale reverse genetic screen in the mouse.

Directory of Open Access Journals (Sweden)

Tia DiTommaso

2014-10-01

Full Text Available The skin is a highly regenerative organ which plays critical roles in protecting the body and sensing its environment. Consequently, morbidity and mortality associated with skin defects represent a significant health issue. To identify genes important in skin development and homeostasis, we have applied a high throughput, multi-parameter phenotype screen to the conditional targeted mutant mice generated by the Wellcome Trust Sanger Institute's Mouse Genetics Project (Sanger-MGP. A total of 562 different mouse lines were subjected to a variety of tests assessing cutaneous expression, macroscopic clinical disease, histological change, hair follicle cycling, and aberrant marker expression. Cutaneous lesions were associated with mutations in 23 different genes. Many of these were not previously associated with skin disease in the organ (Mysm1, Vangl1, Trpc4ap, Nom1, Sparc, Farp2, and Prkab1, while others were ascribed new cutaneous functions on the basis of the screening approach (Krt76, Lrig1, Myo5a, Nsun2, and Nf1. The integration of these skin specific screening protocols into the Sanger-MGP primary phenotyping pipelines marks the largest reported reverse genetic screen undertaken in any organ and defines approaches to maximise the productivity of future projects of this nature, while flagging genes for further characterisation.

High-Throughput Screening Using iPSC-Derived Neuronal Progenitors to Identify Compounds Counteracting Epigenetic Gene Silencing in Fragile X Syndrome.

Science.gov (United States)

Kaufmann, Markus; Schuffenhauer, Ansgar; Fruh, Isabelle; Klein, Jessica; Thiemeyer, Anke; Rigo, Pierre; Gomez-Mancilla, Baltazar; Heidinger-Millot, Valerie; Bouwmeester, Tewis; Schopfer, Ulrich; Mueller, Matthias; Fodor, Barna D; Cobos-Correa, Amanda

2015-10-01

Fragile X syndrome (FXS) is the most common form of inherited mental retardation, and it is caused in most of cases by epigenetic silencing of the Fmr1 gene. Today, no specific therapy exists for FXS, and current treatments are only directed to improve behavioral symptoms. Neuronal progenitors derived from FXS patient induced pluripotent stem cells (iPSCs) represent a unique model to study the disease and develop assays for large-scale drug discovery screens since they conserve the Fmr1 gene silenced within the disease context. We have established a high-content imaging assay to run a large-scale phenotypic screen aimed to identify compounds that reactivate the silenced Fmr1 gene. A set of 50,000 compounds was tested, including modulators of several epigenetic targets. We describe an integrated drug discovery model comprising iPSC generation, culture scale-up, and quality control and screening with a very sensitive high-content imaging assay assisted by single-cell image analysis and multiparametric data analysis based on machine learning algorithms. The screening identified several compounds that induced a weak expression of fragile X mental retardation protein (FMRP) and thus sets the basis for further large-scale screens to find candidate drugs or targets tackling the underlying mechanism of FXS with potential for therapeutic intervention. © 2015 Society for Laboratory Automation and Screening.

A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

Science.gov (United States)

Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

2008-11-01

Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

NMD Microarray Analysis for Rapid Genome-Wide Screen of Mutated Genes in Cancer

Directory of Open Access Journals (Sweden)

Maija Wolf

2005-01-01

Full Text Available Gene mutations play a critical role in cancer development and progression, and their identification offers possibilities for accurate diagnostics and therapeutic targeting. Finding genes undergoing mutations is challenging and slow, even in the post-genomic era. A new approach was recently developed by Noensie and Dietz to prioritize and focus the search, making use of nonsense-mediated mRNA decay (NMD inhibition and microarray analysis (NMD microarrays in the identification of transcripts containing nonsense mutations. We combined NMD microarrays with array-based CGH (comparative genomic hybridization in order to identify inactivation of tumor suppressor genes in cancer. Such a “mutatomics” screening of prostate cancer cell lines led to the identification of inactivating mutations in the EPHB2 gene. Up to 8% of metastatic uncultured prostate cancers also showed mutations of this gene whose loss of function may confer loss of tissue architecture. NMD microarray analysis could turn out to be a powerful research method to identify novel mutated genes in cancer cell lines, providing targets that could then be further investigated for their clinical relevance and therapeutic potential.

Dried blood spots of pooled samples for RHD gene screening in blood donors of mixed ancestry.

Science.gov (United States)

Silva-Malta, M C F; Araujo, N C Fidélis; Vieira, O V Neves; Schmidt, L Cayres; Gonçalves, P de Cassia; Martins, M Lobato

2015-10-01

In this study, we present a strategy for RHD gene screening based on real-time polymerase chain reaction (PCR) using dried blood spots of pooled samples. Molecular analysis of blood donors may be used to detect RHD variants among the presumed D-negative individuals. RHD genotyping using pooled samples is a strategy to test a large number of samples at a more reasonable cost. RHD gene detection based on real-time PCR using dried blood spots of pooled samples was standardised and used to evaluate 1550 Brazilian blood donors phenotyped as RhD-negative. Positive results were re-evaluated by retesting single samples using real-time PCR and conventional multiplex PCR to amplify five RHD-specific exons. PCR-sequence-specific primers was used to amplify RHDψ allele. We devised a strategy for RHD gene screening using dried blood spots of five pooled samples. Among 1550 serologically D-negative blood donors, 58 (3.74%) had the RHD gene. The non-functional RHDψ allele was detected in 47 samples (3.02%). The present method is a promising strategy to detect the RHD gene among presumed RhD-negative blood donors, particularly for populations with African ancestry. © 2015 British Blood Transfusion Society.

Dual gene activation and knockout screen reveals directional dependencies in genetic networks. | Office of Cancer Genomics

Science.gov (United States)

Understanding the direction of information flow is essential for characterizing how genetic networks affect phenotypes. However, methods to find genetic interactions largely fail to reveal directional dependencies. We combine two orthogonal Cas9 proteins from Streptococcus pyogenes and Staphylococcus aureus to carry out a dual screen in which one gene is activated while a second gene is deleted in the same cell. We analyze the quantitative effects of activation and knockout to calculate genetic interaction and directionality scores for each gene pair.

Novel gene function revealed by mouse mutagenesis screens for models of age-related disease.

Science.gov (United States)

Potter, Paul K; Bowl, Michael R; Jeyarajan, Prashanthini; Wisby, Laura; Blease, Andrew; Goldsworthy, Michelle E; Simon, Michelle M; Greenaway, Simon; Michel, Vincent; Barnard, Alun; Aguilar, Carlos; Agnew, Thomas; Banks, Gareth; Blake, Andrew; Chessum, Lauren; Dorning, Joanne; Falcone, Sara; Goosey, Laurence; Harris, Shelley; Haynes, Andy; Heise, Ines; Hillier, Rosie; Hough, Tertius; Hoslin, Angela; Hutchison, Marie; King, Ruairidh; Kumar, Saumya; Lad, Heena V; Law, Gemma; MacLaren, Robert E; Morse, Susan; Nicol, Thomas; Parker, Andrew; Pickford, Karen; Sethi, Siddharth; Starbuck, Becky; Stelma, Femke; Cheeseman, Michael; Cross, Sally H; Foster, Russell G; Jackson, Ian J; Peirson, Stuart N; Thakker, Rajesh V; Vincent, Tonia; Scudamore, Cheryl; Wells, Sara; El-Amraoui, Aziz; Petit, Christine; Acevedo-Arozena, Abraham; Nolan, Patrick M; Cox, Roger; Mallon, Anne-Marie; Brown, Steve D M

2016-08-18

Determining the genetic bases of age-related disease remains a major challenge requiring a spectrum of approaches from human and clinical genetics to the utilization of model organism studies. Here we report a large-scale genetic screen in mice employing a phenotype-driven discovery platform to identify mutations resulting in age-related disease, both late-onset and progressive. We have utilized N-ethyl-N-nitrosourea mutagenesis to generate pedigrees of mutagenized mice that were subject to recurrent screens for mutant phenotypes as the mice aged. In total, we identify 105 distinct mutant lines from 157 pedigrees analysed, out of which 27 are late-onset phenotypes across a range of physiological systems. Using whole-genome sequencing we uncover the underlying genes for 44 of these mutant phenotypes, including 12 late-onset phenotypes. These genes reveal a number of novel pathways involved with age-related disease. We illustrate our findings by the recovery and characterization of a novel mouse model of age-related hearing loss.

Combined Gene Expression and RNAi Screening to Identify Alkylation Damage Survival Pathways from Fly to Human.

Science.gov (United States)

Zanotto-Filho, Alfeu; Dashnamoorthy, Ravi; Loranc, Eva; de Souza, Luis H T; Moreira, José C F; Suresh, Uthra; Chen, Yidong; Bishop, Alexander J R

2016-01-01

Alkylating agents are a key component of cancer chemotherapy. Several cellular mechanisms are known to be important for its survival, particularly DNA repair and xenobiotic detoxification, yet genomic screens indicate that additional cellular components may be involved. Elucidating these components has value in either identifying key processes that can be modulated to improve chemotherapeutic efficacy or may be altered in some cancers to confer chemoresistance. We therefore set out to reevaluate our prior Drosophila RNAi screening data by comparison to gene expression arrays in order to determine if we could identify any novel processes in alkylation damage survival. We noted a consistent conservation of alkylation survival pathways across platforms and species when the analysis was conducted on a pathway/process level rather than at an individual gene level. Better results were obtained when combining gene lists from two datasets (RNAi screen plus microarray) prior to analysis. In addition to previously identified DNA damage responses (p53 signaling and Nucleotide Excision Repair), DNA-mRNA-protein metabolism (transcription/translation) and proteasome machinery, we also noted a highly conserved cross-species requirement for NRF2, glutathione (GSH)-mediated drug detoxification and Endoplasmic Reticulum stress (ER stress)/Unfolded Protein Responses (UPR) in cells exposed to alkylation. The requirement for GSH, NRF2 and UPR in alkylation survival was validated by metabolomics, protein studies and functional cell assays. From this we conclude that RNAi/gene expression fusion is a valid strategy to rapidly identify key processes that may be extendable to other contexts beyond damage survival.

Combined Gene Expression and RNAi Screening to Identify Alkylation Damage Survival Pathways from Fly to Human.

Directory of Open Access Journals (Sweden)

Alfeu Zanotto-Filho

Full Text Available Alkylating agents are a key component of cancer chemotherapy. Several cellular mechanisms are known to be important for its survival, particularly DNA repair and xenobiotic detoxification, yet genomic screens indicate that additional cellular components may be involved. Elucidating these components has value in either identifying key processes that can be modulated to improve chemotherapeutic efficacy or may be altered in some cancers to confer chemoresistance. We therefore set out to reevaluate our prior Drosophila RNAi screening data by comparison to gene expression arrays in order to determine if we could identify any novel processes in alkylation damage survival. We noted a consistent conservation of alkylation survival pathways across platforms and species when the analysis was conducted on a pathway/process level rather than at an individual gene level. Better results were obtained when combining gene lists from two datasets (RNAi screen plus microarray prior to analysis. In addition to previously identified DNA damage responses (p53 signaling and Nucleotide Excision Repair, DNA-mRNA-protein metabolism (transcription/translation and proteasome machinery, we also noted a highly conserved cross-species requirement for NRF2, glutathione (GSH-mediated drug detoxification and Endoplasmic Reticulum stress (ER stress/Unfolded Protein Responses (UPR in cells exposed to alkylation. The requirement for GSH, NRF2 and UPR in alkylation survival was validated by metabolomics, protein studies and functional cell assays. From this we conclude that RNAi/gene expression fusion is a valid strategy to rapidly identify key processes that may be extendable to other contexts beyond damage survival.

Genome-wide screening for genes whose deletions confer sensitivity to mutagenic purine base analogs in yeast

Directory of Open Access Journals (Sweden)

Kozmin Stanislav G

2005-06-01

Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.

Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

Science.gov (United States)

Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

2016-01-01

Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis.

Science.gov (United States)

Meeske, Alexander J; Rodrigues, Christopher D A; Brady, Jacqueline; Lim, Hoong Chuin; Bernhardt, Thomas G; Rudner, David Z

2016-01-01

The differentiation of the bacterium Bacillus subtilis into a dormant spore is among the most well-characterized developmental pathways in biology. Classical genetic screens performed over the past half century identified scores of factors involved in every step of this morphological process. More recently, transcriptional profiling uncovered additional sporulation-induced genes required for successful spore development. Here, we used transposon-sequencing (Tn-seq) to assess whether there were any sporulation genes left to be discovered. Our screen identified 133 out of the 148 genes with known sporulation defects. Surprisingly, we discovered 24 additional genes that had not been previously implicated in spore formation. To investigate their functions, we used fluorescence microscopy to survey early, middle, and late stages of differentiation of null mutants from the B. subtilis ordered knockout collection. This analysis identified mutants that are delayed in the initiation of sporulation, defective in membrane remodeling, and impaired in spore maturation. Several mutants had novel sporulation phenotypes. We performed in-depth characterization of two new factors that participate in cell-cell signaling pathways during sporulation. One (SpoIIT) functions in the activation of σE in the mother cell; the other (SpoIIIL) is required for σG activity in the forespore. Our analysis also revealed that as many as 36 sporulation-induced genes with no previously reported mutant phenotypes are required for timely spore maturation. Finally, we discovered a large set of transposon insertions that trigger premature initiation of sporulation. Our results highlight the power of Tn-seq for the discovery of new genes and novel pathways in sporulation and, combined with the recently completed null mutant collection, open the door for similar screens in other, less well-characterized processes.

High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis

Science.gov (United States)

Brady, Jacqueline; Lim, Hoong Chuin; Bernhardt, Thomas G.; Rudner, David Z.

2016-01-01

The differentiation of the bacterium Bacillus subtilis into a dormant spore is among the most well-characterized developmental pathways in biology. Classical genetic screens performed over the past half century identified scores of factors involved in every step of this morphological process. More recently, transcriptional profiling uncovered additional sporulation-induced genes required for successful spore development. Here, we used transposon-sequencing (Tn-seq) to assess whether there were any sporulation genes left to be discovered. Our screen identified 133 out of the 148 genes with known sporulation defects. Surprisingly, we discovered 24 additional genes that had not been previously implicated in spore formation. To investigate their functions, we used fluorescence microscopy to survey early, middle, and late stages of differentiation of null mutants from the B. subtilis ordered knockout collection. This analysis identified mutants that are delayed in the initiation of sporulation, defective in membrane remodeling, and impaired in spore maturation. Several mutants had novel sporulation phenotypes. We performed in-depth characterization of two new factors that participate in cell–cell signaling pathways during sporulation. One (SpoIIT) functions in the activation of σE in the mother cell; the other (SpoIIIL) is required for σG activity in the forespore. Our analysis also revealed that as many as 36 sporulation-induced genes with no previously reported mutant phenotypes are required for timely spore maturation. Finally, we discovered a large set of transposon insertions that trigger premature initiation of sporulation. Our results highlight the power of Tn-seq for the discovery of new genes and novel pathways in sporulation and, combined with the recently completed null mutant collection, open the door for similar screens in other, less well-characterized processes. PMID:26735940

Screening Effect of Plasma Flow on RMP Penetration in EXTRAP T2R

Science.gov (United States)

Frassinetti, Lorenzo; Olofsson, Erik; Brunsell, Per; Menmuir, Sheena; Drake, James

2011-10-01

The penetration of resonant magnetic perturbations (RMP) can be screened by plasma flow and the understanding of this phenomenon is important for ELM mitigation techniques. This work studies the screening effect in EXTRAP T2R. EXTRAP T2R is equipped with a feedback system able to suppress all error fields and to produce one or more external perturbations in a controlled fashion. The EXTRAP T2R feedback system is used to generate a RMP that interacts with the dynamics of its corresponding tearing mode (TM). The level of RMP penetration is quantified by analyzing the RMP effect on the TM amplitude and velocity. To study the screening effect, the flow is changed by applying a second perturbation that is non resonant (non-RMP). This produces the flow reduction without perturbing significantly the other parameters. By modifying the amplitude of the non-RMP, an experimental study of the flow effect on the RMP penetration is performed. Experimental results are compared with the model described in [Fitzpatrick R et al., Phys. Plasmas 8, 4489 (2001)].

Thalidomide induced early gene expression perturbations indicative of human embryopathy in mouse embryonic stem cells

International Nuclear Information System (INIS)

Gao, Xiugong; Sprando, Robert L.; Yourick, Jeffrey J.

2015-01-01

Developmental toxicity testing has traditionally relied on animal models which are costly, time consuming, and require the sacrifice of large numbers of animals. In addition, there are significant disparities between human beings and animals in their responses to chemicals. Thalidomide is a species-specific developmental toxicant that causes severe limb malformations in humans but not in mice. Here, we used microarrays to study transcriptomic changes induced by thalidomide in an in vitro model based on differentiation of mouse embryonic stem cells (mESCs). C57BL/6 mESCs were allowed to differentiate spontaneously and RNA was collected at 24, 48, and 72 h after exposure to 0.25 mM thalidomide. Global gene expression analysis using microarrays revealed hundreds of differentially expressed genes upon thalidomide exposure that were enriched in gene ontology (GO) terms and canonical pathways associated with embryonic development and differentiation. In addition, many genes were found to be involved in small GTPases-mediated signal transduction, heart development, and inflammatory responses, which coincide with clinical evidences and may represent critical embryotoxicities of thalidomide. These results demonstrate that transcriptomics in combination with mouse embryonic stem cell differentiation is a promising alternative model for developmental toxicity assessment. - Highlights: • Studied genomic changes in mouse embryonic stem cells upon thalidomide exposure • Identified gene expression changes that may represent thalidomide embryotoxicity • The toxicogenomic changes coincide well with known thalidomide clinical outcomes. • The mouse embryonic stem cell model is suitable for developmental toxicity testing. • The model has the potential for high-throughput screening of a multitude of compounds

Thalidomide induced early gene expression perturbations indicative of human embryopathy in mouse embryonic stem cells

Energy Technology Data Exchange (ETDEWEB)

Gao, Xiugong, E-mail: xiugong.gao@fda.hhs.gov; Sprando, Robert L.; Yourick, Jeffrey J.

2015-08-15

Developmental toxicity testing has traditionally relied on animal models which are costly, time consuming, and require the sacrifice of large numbers of animals. In addition, there are significant disparities between human beings and animals in their responses to chemicals. Thalidomide is a species-specific developmental toxicant that causes severe limb malformations in humans but not in mice. Here, we used microarrays to study transcriptomic changes induced by thalidomide in an in vitro model based on differentiation of mouse embryonic stem cells (mESCs). C57BL/6 mESCs were allowed to differentiate spontaneously and RNA was collected at 24, 48, and 72 h after exposure to 0.25 mM thalidomide. Global gene expression analysis using microarrays revealed hundreds of differentially expressed genes upon thalidomide exposure that were enriched in gene ontology (GO) terms and canonical pathways associated with embryonic development and differentiation. In addition, many genes were found to be involved in small GTPases-mediated signal transduction, heart development, and inflammatory responses, which coincide with clinical evidences and may represent critical embryotoxicities of thalidomide. These results demonstrate that transcriptomics in combination with mouse embryonic stem cell differentiation is a promising alternative model for developmental toxicity assessment. - Highlights: • Studied genomic changes in mouse embryonic stem cells upon thalidomide exposure • Identified gene expression changes that may represent thalidomide embryotoxicity • The toxicogenomic changes coincide well with known thalidomide clinical outcomes. • The mouse embryonic stem cell model is suitable for developmental toxicity testing. • The model has the potential for high-throughput screening of a multitude of compounds.

Development of a High-Throughput Gene Expression Screen for Modulators of RAS-MAPK Signaling in a Mutant RAS Cellular Context.

Science.gov (United States)

Severyn, Bryan; Nguyen, Thi; Altman, Michael D; Li, Lixia; Nagashima, Kumiko; Naumov, George N; Sathyanarayanan, Sriram; Cook, Erica; Morris, Erick; Ferrer, Marc; Arthur, Bill; Benita, Yair; Watters, Jim; Loboda, Andrey; Hermes, Jeff; Gilliland, D Gary; Cleary, Michelle A; Carroll, Pamela M; Strack, Peter; Tudor, Matt; Andersen, Jannik N

2016-10-01

The RAS-MAPK pathway controls many cellular programs, including cell proliferation, differentiation, and apoptosis. In colorectal cancers, recurrent mutations in this pathway often lead to increased cell signaling that may contribute to the development of neoplasms, thereby making this pathway attractive for therapeutic intervention. To this end, we developed a 26-member gene signature of RAS-MAPK pathway activity utilizing the Affymetrix QuantiGene Plex 2.0 reagent system and performed both primary and confirmatory gene expression-based high-throughput screens (GE-HTSs) using KRAS mutant colon cancer cells (SW837) and leveraging a highly annotated chemical library. The screen achieved a hit rate of 1.4% and was able to enrich for hit compounds that target RAS-MAPK pathway members such as MEK and EGFR. Sensitivity and selectivity performance measurements were 0.84 and 1.00, respectively, indicating high true-positive and true-negative rates. Active compounds from the primary screen were confirmed in a dose-response GE-HTS assay, a GE-HTS assay using 14 additional cancer cell lines, and an in vitro colony formation assay. Altogether, our data suggest that this GE-HTS assay will be useful for larger unbiased chemical screens to identify novel compounds and mechanisms that may modulate the RAS-MAPK pathway. © 2016 Society for Laboratory Automation and Screening.

Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

DEFF Research Database (Denmark)

Alvaro, D.; Sunjevaric, I.; Reid, R. J.

2006-01-01

We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background......, to minimize the contribution of unpredicted recessive genetic factors present in the individual library strains. We utilize a set of strains where each contains a conditional centromere construct on one of the 16 yeast chromosomes that allows the destabilization and selectable loss of that chromosome. After...... complementation of any spurious recessive mutations in the library strain, facilitating attribution of the observed phenotype to the documented gene deletion and dramatically reducing false positive results commonly obtained in library screens. The systematic hybrid LOH method can be applied to virtually any...

Supersingular quantum perturbations

International Nuclear Information System (INIS)

Detwiler, L.C.; Klauder, J.R.

1975-01-01

A perturbation potential is called supersingular whenever generally every matrix element of the perturbation in the unperturbed eigenstates is infinite. It follows that supersingular perturbations do not have conventional perturbation expansions, say for energy eigenvalues. By invoking variational arguments, we determine the asymptotic behavior of the energy eigenvalues for asymptotically small values of the coupling constant of the supersingular perturbation

Non-perturbative Debye mass in finite-T QCD

CERN Document Server

Kajantie, Keijo; Peisa, J; Rajantie, A; Rummukainen, K; Shaposhnikov, Mikhail E

1997-01-01

Employing a non-perturbative gauge invariant definition of the Debye screening mass m_D in the effective field theory approach to finite T QCD, we use 3d lattice simulations to determine the leading O(g^2) and to estimate the next-to-leading O(g^3) corrections to m_D in the high temperature region. The O(g^2) correction is large and modifies qualitatively the standard power-counting hierarchy picture of correlation lengths in high temperature QCD.

Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.

Science.gov (United States)

Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid

2009-04-01

Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.

Microarray-based apoptosis gene screening technique in trichostatin A-induced drug-resisted lung cancer A549/CDDP cells

Directory of Open Access Journals (Sweden)

Ya-jun WANG

2016-09-01

Full Text Available Objective 　To detect the expression profile changes of apoptosis-related genes in trichostatin A (TSA-induced drug-resisted lung cancer cells A549/CDDP by microarray, in order to screen the target genes in TSA treating cisplatin-resisted lung cancer. Methods 　A549/CDDP cells were treated by TSA for 24 hours. Total RNA was extracted and reversely transcribed into cDNA. Gene expression levels were detected by the NimbleGen whole genome microarray. Differences of expression profiles between TSA-treated and control group were measured by NimbleScan 2.5 software and GO analysis. Apoptosis and proliferation related genes were screened from the expression changed genes. Results 　Compared with the control group, 85 apoptosis-related genes were up-regulated and 43 growth or proliferation related genes were down-regulated in the TSA-treated group. GO analysis showed that the functions of these genes are mainly regulating apoptosis, cell resistance to chem ical stimuli protein, as well as regulating cell growth, proliferation and the biological process of maintaining the cell biological quality. TSA-activated not only the mitochondrial apoptotic pathways, but also the death receptor related apoptosis pathway, and down-regulated the drug resistance related genes BAG3 and ABCC2. Conclusion 　TSA may cause the expression changes of apoptotic and proliferation genes in A549/CDDP cells, these genes may play a role in TSA treating cisplatin-resisted lung cancer. DOI: 10.11855/j.issn.0577-7402.2016.08.07

Novel Genes Involved in Controlling Specification of Drosophila FMRFamide Neuropeptide Cells.

Science.gov (United States)

Bivik, Caroline; Bahrampour, Shahrzad; Ulvklo, Carina; Nilsson, Patrik; Angel, Anna; Fransson, Fredrik; Lundin, Erika; Renhorn, Jakob; Thor, Stefan

2015-08-01

The expression of neuropeptides is often extremely restricted in the nervous system, making them powerful markers for addressing cell specification . In the developing Drosophila ventral nerve cord, only six cells, the Ap4 neurons, of some 10,000 neurons, express the neuropeptide FMRFamide (FMRFa). Each Ap4/FMRFa neuron is the last-born cell generated by an identifiable and well-studied progenitor cell, neuroblast 5-6 (NB5-6T). The restricted expression of FMRFa and the wealth of information regarding its gene regulation and Ap4 neuron specification makes FMRFa a valuable readout for addressing many aspects of neural development, i.e., spatial and temporal patterning cues, cell cycle control, cell specification, axon transport, and retrograde signaling. To this end, we have conducted a forward genetic screen utilizing an Ap4-specific FMRFa-eGFP transgenic reporter as our readout. A total of 9781 EMS-mutated chromosomes were screened for perturbations in FMRFa-eGFP expression, and 611 mutants were identified. Seventy-nine of the strongest mutants were mapped down to the affected gene by deficiency mapping or whole-genome sequencing. We isolated novel alleles for previously known FMRFa regulators, confirming the validity of the screen. In addition, we identified novel essential genes, including several with previously undefined functions in neural development. Our identification of genes affecting most major steps required for successful terminal differentiation of Ap4 neurons provides a comprehensive view of the genetic flow controlling the generation of highly unique neuronal cell types in the developing nervous system. Copyright © 2015 by the Genetics Society of America.

Characterizing metabolic pathway diversification in the context of perturbation size.

Science.gov (United States)

Yang, Laurence; Srinivasan, Shyamsundhar; Mahadevan, Radhakrishnan; Cluett, William R

2015-03-01

Cell metabolism is an important platform for sustainable biofuel, chemical and pharmaceutical production but its complexity presents a major challenge for scientists and engineers. Although in silico strains have been designed in the past with predicted performances near the theoretical maximum, real-world performance is often sub-optimal. Here, we simulate how strain performance is impacted when subjected to many randomly varying perturbations, including discrepancies between gene expression and in vivo flux, osmotic stress, and substrate uptake perturbations due to concentration gradients in bioreactors. This computational study asks whether robust performance can be achieved by adopting robustness-enhancing mechanisms from naturally evolved organisms-in particular, redundancy. Our study shows that redundancy, typically perceived as a ubiquitous robustness-enhancing strategy in nature, can either improve or undermine robustness depending on the magnitude of the perturbations. We also show that the optimal number of redundant pathways used can be predicted for a given perturbation size. Copyright © 2015. Published by Elsevier Inc.

A genetic screen for modifiers of Drosophila caspase Dcp-1 reveals caspase involvement in autophagy and novel caspase-related genes

Directory of Open Access Journals (Sweden)

Ahnn Joohong

2010-01-01

Full Text Available Abstract Background Caspases are cysteine proteases with essential functions in the apoptotic pathway; their proteolytic activity toward various substrates is associated with the morphological changes of cells. Recent reports have described non-apoptotic functions of caspases, including autophagy. In this report, we searched for novel modifiers of the phenotype of Dcp-1 gain-of-function (GF animals by screening promoter element- inserted Drosophila melanogaster lines (EP lines. Results We screened ~15,000 EP lines and identified 72 Dcp-1-interacting genes that were classified into 10 groups based on their functions and pathways: 4 apoptosis signaling genes, 10 autophagy genes, 5 insulin/IGF and TOR signaling pathway genes, 6 MAP kinase and JNK signaling pathway genes, 4 ecdysone signaling genes, 6 ubiquitination genes, 11 various developmental signaling genes, 12 transcription factors, 3 translation factors, and 11 other unclassified genes including 5 functionally undefined genes. Among them, insulin/IGF and TOR signaling pathway, MAP kinase and JNK signaling pathway, and ecdysone signaling are known to be involved in autophagy. Together with the identification of autophagy genes, the results of our screen suggest that autophagy counteracts Dcp-1-induced apoptosis. Consistent with this idea, we show that expression of eGFP-Atg5 rescued the eye phenotype caused by Dcp-1 GF. Paradoxically, we found that over-expression of full-length Dcp-1 induced autophagy, as Atg8b-GFP, an indicator of autophagy, was increased in the eye imaginal discs and in the S2 cell line. Taken together, these data suggest that autophagy suppresses Dcp-1-mediated apoptotic cell death, whereas Dcp-1 positively regulates autophagy, possibly through feedback regulation. Conclusions We identified a number of Dcp-1 modifiers that genetically interact with Dcp-1-induced cell death. Our results showing that Dcp-1 and autophagy-related genes influence each other will aid future

Non-perturbative versus perturbative renormalization of lattice operators

International Nuclear Information System (INIS)

Goeckeler, M.; Technische Hochschule Aachen; Horsley, R.; Ilgenfritz, E.M.; Oelrich, H.; Forschungszentrum Juelich GmbH; Schierholz, G.; Forschungszentrum Juelich GmbH; Perlt, H.; Schiller, A.; Rakow, P.

1995-09-01

Our objective is to compute the moments of the deep-inelastic structure functions of the nucleon on the lattice. A major source of uncertainty is the renormalization of the lattice operators that enter the calculation. In this talk we compare the renormalization constants of the most relevant twist-two bilinear quark operators which we have computed non-perturbatively and perturbatively to one loop order. Furthermore, we discuss the use of tadpole improved perturbation theory. (orig.)

Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I.

Science.gov (United States)

Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J

2012-01-01

PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

Energy Technology Data Exchange (ETDEWEB)

Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

2005-01-05

A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

Genome-wide identification of key modulators of gene-gene interaction networks in breast cancer.

Science.gov (United States)

Chiu, Yu-Chiao; Wang, Li-Ju; Hsiao, Tzu-Hung; Chuang, Eric Y; Chen, Yidong

2017-10-03

With the advances in high-throughput gene profiling technologies, a large volume of gene interaction maps has been constructed. A higher-level layer of gene-gene interaction, namely modulate gene interaction, is composed of gene pairs of which interaction strengths are modulated by (i.e., dependent on) the expression level of a key modulator gene. Systematic investigations into the modulation by estrogen receptor (ER), the best-known modulator gene, have revealed the functional and prognostic significance in breast cancer. However, a genome-wide identification of key modulator genes that may further unveil the landscape of modulated gene interaction is still lacking. We proposed a systematic workflow to screen for key modulators based on genome-wide gene expression profiles. We designed four modularity parameters to measure the ability of a putative modulator to perturb gene interaction networks. Applying the method to a dataset of 286 breast tumors, we comprehensively characterized the modularity parameters and identified a total of 973 key modulator genes. The modularity of these modulators was verified in three independent breast cancer datasets. ESR1, the encoding gene of ER, appeared in the list, and abundant novel modulators were illuminated. For instance, a prognostic predictor of breast cancer, SFRP1, was found the second modulator. Functional annotation analysis of the 973 modulators revealed involvements in ER-related cellular processes as well as immune- and tumor-associated functions. Here we present, as far as we know, the first comprehensive analysis of key modulator genes on a genome-wide scale. The validity of filtering parameters as well as the conservativity of modulators among cohorts were corroborated. Our data bring new insights into the modulated layer of gene-gene interaction and provide candidates for further biological investigations.

Screening for Glucosyltransferase gene (gtf from exopolysaccahride producing lactic acid bacteria

Directory of Open Access Journals (Sweden)

Donna M. Ariestanti

2008-04-01

Full Text Available Glucosyltransferase (GTF is an enzyme involved in exopolysaccharide (EPS polymer synthesis in microbes. One example of EPS that has been used in pharmaceutical and medical application is dextran. Dextran has been used in conjugated-drug delivery system as matrix. As a group of microbes producing EPS, lactic acid bacteria (LAB have been well reported carrying sucrase genes glucosyltransferase (gtf, as well as fructosyltransferases (ftf. In an attempt to search for novel gtf genes as the aim of this study, LAB collection isolated from local sources yielded from previous study were screened performing PCR using degenerate primers DegFor and DegRev. An approximately 660 base pairs (bp amplicons were obtained by using genomic DNAs of those LAB isolates as templates with conserved region of gtf genes catalytic domain as target. Two out of 20 LAB strains were yielded no amplicon as observed on agarose gel, while one strain exhibited non-specific amplicon DNA bands with sizes other than 660 bp. The two negative ones were isolated from soil obtained from dairy product waste field and from waste of soy sauce from previous study, while the latter was isolated from waste of soy sauce.

Aminoacidopathies: Prevalence, Etiology, Screening, and Treatment Options.

Science.gov (United States)

Wasim, Muhammad; Awan, Fazli Rabbi; Khan, Haq Nawaz; Tawab, Abdul; Iqbal, Mazhar; Ayesha, Hina

2018-04-01

Inborn errors of metabolism (IEMs) are a group of inherited metabolic disorders which are caused by mutations in the specific genes that lead to impaired proteins or enzymes production. Different metabolic pathways are perturbed due to the deficiency or lack of enzymes. To date, more than 500 IEMs have been reported with most of them being untreatable. However, fortunately 91 such disorders are potentially treatable, if diagnosed at an earlier stage of life. IEMs have been classified into different categories and one class of IEMs, characterized by the physiological disturbances of amino acids is called as aminoacidopathies. Out of 91 treatable IEM, thirteen disorders are amino acid related. Aminoacidopathies can be detected by chromatography and mass spectrometry based analytical techniques (e.g., HPLC, GC-MS, LC-MS/MS) for amino acid level changes, and through genetic assays (e.g., PCR, TaqMan Genotyping, DNA sequencing) at the mutation level in the corresponding genes. Hence, this review is focused to describe thirteen common aminoacidopathies namely: Phenylketonuria (PKU), Maple Syrup Urine Disease (MSUD), Homocystinuria/Methylene Tetrahydrofolate Reductase (MTHFR) deficiency, Tyrosinemia type II, Citrullinemia type I and type II, Argininosuccinic aciduria, Carbamoyl Phosphate Synthetase I (CPS) deficiency, Argininemia (arginase deficiency), Hyperornithinemia-Hyperammonemia-Homocitrullinuria (HHH) syndrome, N-Acetylglutamate Synthase (NAGS) deficiency, Ornithine Transcarbamylase (OTC) deficiency, and Pyruvate Dehydrogenase (PDH) complex deficiency. Furthermore, the etiology, prevalence and commonly used analytical techniques for screening of aminoacidopathies are briefly described. This information would be helpful to researchers and clinicians especially from developing countries to initiate newborn screening programs for aminoacidopathies.

Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

International Nuclear Information System (INIS)

Wang Xiaojuan; Song, Yu; Ma Yanhua; Zhuo Renying; Jin Liang

2011-01-01

In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: → Evaluate Cd tolerance in wide sources of alfalfa accessions. → Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. → Cloned differentially expressed metallothionein (MT) genes. → Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. → MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

Energy Technology Data Exchange (ETDEWEB)

Wang Xiaojuan, E-mail: xiaojuanwang@lzu.edu.cn [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Song, Yu [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Environment Management College of China, Qinhuangdao 066004 (China); Ma Yanhua [Hebei Normal University of Science and Technology, Qinhuangdao 066004 (China); Zhuo Renying [Key Lab of Tree Genomics, Research Institute of Subtropical of Forest, Chinese Academy of Forest, Fuyang 311400 (China); Jin Liang [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China)

2011-12-15

In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: > Evaluate Cd tolerance in wide sources of alfalfa accessions. > Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. > Cloned differentially expressed metallothionein (MT) genes. > Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. > MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

Some physical properties of GaX (X=P, As and Sb) semiconductor compounds using higher-order perturbation theory

International Nuclear Information System (INIS)

Jivani, A.R.; Trivedi, H.J.; Gajjar, P.N.; Jani, A.R.

2005-01-01

Recently proposed model potential for describing the electron-ion interaction is employed to calculate total energy, energy band gap at Jones-zone face at X, equation of state and bulk modulus of GaP, GaAs and GaSb compounds using higher-order perturbation theory. The covalent correction term corresponding to third- and fourth-order perturbation energy terms are used to take account of covalent bonding effect in such semiconductors. The significant value of the covalent bonding term shows the essentiality of higher-order correction for zincblende-type crystals. We have employed five different screening functions along with the latest screening function proposed by Sarkar et al. in the present work. The numerical results for the total energy, energy band gap at Jones-zone face and bulk modulus of these compounds are in good agreement with the experimental data and found better than other such theoretical findings. The pressure and bulk modulus at different volumes are obtained by using such higher-order perturbation theory with the application of our model potential. The pressure obtained by this method is compared with pressure obtained by equations proposed by Murnarghan and Vinet et al. The present study also shows that the incorporation of different screening functions generates distinct effects

Screening for mutations in the androgen receptor gene (AR) causing infertility in Syrian men using real-time PCR

International Nuclear Information System (INIS)

Madania, A.; Ghouri, I.; Abou-Alshamat, Gh.; Issa, M.; Al-Halabi, M.

2012-01-01

14 known point mutations in the androgen receptor gene (AR) causing male infertility were screened by real time PCR and by DNA sequencing, in order to identify point mutations in the AR gene causing infertility in azoospermic men. We screened 110 Syrian patients suffering from non-obstructive azoospermia with no chromosomal aberrations or AZF micro deletions. We discovered a new AR mutation, del 57Leu, described for the first time as a possible cause of male infertility. Furthermore, we found two patients with the Ala474Val mutation and one patient bearing the Pro390Ser mutation. Our results indicate that these mutations are significant markers for idiopathic male infertility in the Syrian society and in Mediterranean populations in general. (author)

Radioresistance related genes screened by protein-protein interaction network analysis in nasopharyngeal carcinoma

International Nuclear Information System (INIS)

Zhu Xiaodong; Guo Ya; Qu Song; Li Ling; Huang Shiting; Li Danrong; Zhang Wei

2012-01-01

Objective: To discover radioresistance associated molecular biomarkers and its mechanism in nasopharyngeal carcinoma by protein-protein interaction network analysis. Methods: Whole genome expression microarray was applied to screen out differentially expressed genes in two cell lines CNE-2R and CNE-2 with different radiosensitivity. Four differentially expressed genes were randomly selected for further verification by the semi-quantitative RT-PCR analysis with self-designed primers. The common differentially expressed genes from two experiments were analyzed with the SNOW online database in order to find out the central node related to the biomarkers of nasopharyngeal carcinoma radioresistance. The expression of STAT1 in CNE-2R and CNE-2 cells was measured by Western blot. Results: Compared with CNE-2 cells, 374 genes in CNE-2R cells were differentially expressed while 197 genes showed significant differences. Four randomly selected differentially expressed genes were verified by RT-PCR and had same change trend in consistent with the results of chip assay. Analysis with the SNOW database demonstrated that those 197 genes could form a complicated interaction network where STAT1 and JUN might be two key nodes. Indeed, the STAT1-α expression in CNE-2R was higher than that in CNE-2 (t=4.96, P<0.05). Conclusions: The key nodes of STAT1 and JUN may be the molecular biomarkers leading to radioresistance in nasopharyngeal carcinoma, and STAT1-α might have close relationship with radioresistance. (authors)

Effectiveness of Modified Agility and Perturbation Training in Patients with Osteoarthritis Knee: A Case Control Study

Directory of Open Access Journals (Sweden)

Nikhil Choudhary

2013-04-01

Full Text Available Objectives: To check and compare the effectiveness of modified agility and perturbation training over conventional physical therapy in patients with knee osteoarthritis. Methods: Subjects were screened on the basis of inclusion and exclusion criteria and a total of 50 subjects were recruited for the study. They were randomly divided into Group A and group B with n=25 each. Results: Group receiving conventional knee exercises with modified agility and perturbation training showed statistically significant results. Discussion: It was found that supplementing rehabilitation programs for people with knee OA with a modified agility and perturbation training program assist them in returning to higher levels of physical activity with less pain and instability following rehabilitation.

Perturbation-expression analysis identifies RUNX1 as a regulator of human mammary stem cell differentiation.

Directory of Open Access Journals (Sweden)

Ethan S Sokol

2015-04-01

Full Text Available The search for genes that regulate stem cell self-renewal and differentiation has been hindered by a paucity of markers that uniquely label stem cells and early progenitors. To circumvent this difficulty we have developed a method that identifies cell-state regulators without requiring any markers of differentiation, termed Perturbation-Expression Analysis of Cell States (PEACS. We have applied this marker-free approach to screen for transcription factors that regulate mammary stem cell differentiation in a 3D model of tissue morphogenesis and identified RUNX1 as a stem cell regulator. Inhibition of RUNX1 expanded bipotent stem cells and blocked their differentiation into ductal and lobular tissue rudiments. Reactivation of RUNX1 allowed exit from the bipotent state and subsequent differentiation and mammary morphogenesis. Collectively, our findings show that RUNX1 is required for mammary stem cells to exit a bipotent state, and provide a new method for discovering cell-state regulators when markers are not available.

Mutation screening and association analysis of six candidate genes for autism on chromosome 7q

DEFF Research Database (Denmark)

Bonora, E.; Lamb, J.A.; Barnby, G.

2005-01-01

in the genes CUTL1, LAMB1 and PTPRZ1. Analysis of genetic variants provided evidence for association with autism for one of the new missense changes identified in LAMB1; this effect was stronger in a subgroup of affected male sibling pair families, implying a possible specific sex-related effect......Genetic studies have provided evidence for an autism susceptibility locus (AUTS1) on chromosome 7q. Screening for mutations in six genes mapping to 7q, CUTL1, SRPK2, SYPL, LAMB1, NRCAM and PTPRZ1 in 48 unrelated individuals with autism led to the identification of several new coding variants...

Diagnostic yield, interpretation, and clinical utility of mutation screening of sarcomere encoding genes in Danish hypertrophic cardiomyopathy patients and relatives

DEFF Research Database (Denmark)

Andersen, Paal Skytt; Havndrup, Ole; Hougs, Lotte

2008-01-01

persons. Index patients were screened for mutations in all coding regions of 10 sarcomere genes (MYH7, MYL3, MYBPC3, TNNI3, TNNT2, TPM1, ACTC, CSRP3, TCAP, and TNNC1) and five exons of TTN. Relatives were screened for presence of minor or major diagnostic criteria for HCM and tracking of DNA variants...

Social Health Insurance-Based Simultaneous Screening for 154 Mutations in 19 Deafness Genes Efficiently Identified Causative Mutations in Japanese Hearing Loss Patients.

Directory of Open Access Journals (Sweden)

Kentaro Mori

Full Text Available Sensorineural hearing loss is one of the most common neurosensory disorders in humans. The incidence of SNHL is estimated to be 1 in 500-1000 newborns. In more than half of these patients, the hearing loss is associated with genetic causes. In Japan, genetic testing for the patients with SNHL using the Invader assay to screen for 46 mutations in 13 deafness genes was approved by the Ministry of Health, Labour and Welfare for inclusion in social health insurance coverage in 2012. Furthermore, from August 2015, this genetic testing has been expanded to screen for 154 mutations in 19 deafness genes using targeted genomic enrichment with massively parallel DNA sequencing combined with the Invader assay and TaqMan genotyping. For this study we analyzed 717 unrelated Japanese hearing loss patients. The total allele frequency of 154 mutations in 19 deafness genes was 32.64% (468/1434 and the total numbers of cases associated with at least one mutation was 44.07% (316/717. Among these, we were able to diagnose 212 (30% patients, indicating that the present screening could efficiently identify causative mutations in hearing loss patients. It is noteworthy that 27 patients (3.8% had coexistent multiple mutations in different genes. Five of these 27 patients (0.7%, 5/717 overall were diagnosed with genetic hearing loss affected by concomitant with responsible mutations in more than two different genes. For patients identified with multiple mutations in different genes, it is necessary to consider that several genes might have an impact on their phenotypes.

Genes Required for Growth at High Hydrostatic Pressure in Escherichia coli K-12 Identified by Genome-Wide Screening

Science.gov (United States)

Black, S. Lucas; Dawson, Angela; Ward, F. Bruce; Allen, Rosalind J.

2013-01-01

Despite the fact that much of the global microbial biosphere is believed to exist in high pressure environments, the effects of hydrostatic pressure on microbial physiology remain poorly understood. We use a genome-wide screening approach, combined with a novel high-throughput high-pressure cell culture method, to investigate the effects of hydrostatic pressure on microbial physiology in vivo. The Keio collection of single-gene deletion mutants in Escherichia coli K-12 was screened for growth at a range of pressures from 0.1 MPa to 60 MPa. This led to the identification of 6 genes, rodZ, holC, priA, dnaT, dedD and tatC, whose products were required for growth at 30 MPa and a further 3 genes, tolB, rffT and iscS, whose products were required for growth at 40 MPa. Our results support the view that the effects of pressure on cell physiology are pleiotropic, with DNA replication, cell division, the cytoskeleton and cell envelope physiology all being potential failure points for cell physiology during growth at elevated pressure. PMID:24040140

Screening for common copy-number variants in cancer genes.

Science.gov (United States)

Tyson, Jess; Majerus, Tamsin M O; Walker, Susan; Armour, John A L

2010-12-01

For most cases of colorectal cancer that arise without a family history of the disease, it is proposed that an appreciable heritable component of predisposition is the result of contributions from many loci. Although progress has been made in identifying single nucleotide variants associated with colorectal cancer risk, the involvement of low-penetrance copy number variants is relatively unexplored. We have used multiplex amplifiable probe hybridization (MAPH) in a fourfold multiplex (QuadMAPH), positioned at an average resolution of one probe per 2 kb, to screen a total of 1.56 Mb of genomic DNA for copy number variants around the genes APC, AXIN1, BRCA1, BRCA2, CTNNB1, HRAS, MLH1, MSH2, and TP53. Two deletion events were detected, one upstream of MLH1 in a control individual and the other in APC in a colorectal cancer patient, but these do not seem to correspond to copy number polymorphisms with measurably high population frequencies. In summary, by means of our QuadMAPH assay, copy number measurement data were of sufficient resolution and accuracy to detect any copy number variants with high probability. However, this study has demonstrated a very low incidence of deletion and duplication variants within intronic and flanking regions of these nine genes, in both control individuals and colorectal cancer patients. Copyright © 2010 Elsevier Inc. All rights reserved.

A temperature-tolerant multiplex elements and genes screening system for genetically modified organisms based on dual priming oligonucleotide primers and capillary electrophoresis.

Science.gov (United States)

Fu, Wei; Wei, Shuang; Wang, Chenguang; Du, Zhixin; Zhu, Pengyu; Wu, Xiyang; Wu, Gang; Zhu, Shuifang

2017-08-15

High throughput screening systems are the preferred solution to meet the urgent requirement of increasing number of genetically modified organisms (GMOs). In this study, we have successfully developed a multiplex GMO element screening system with dual priming oligonucleotide (DPO) primers. This system can detect the cauliflower mosaic virus 35S (CaMV 35S), terminator of nopaline synthase gene (NOS), figwort mosaic virus 35S (FMV 35S) promoter, neomycin phosphotransferaseII (NPTII), Bt Cry 1Ab, phosphinothricin acetyltransferase genes (bar) and Streptomyces viridochromogenes (pat) simultaneously, which covers more than 90% of all authorized GMO species worldwide. This system exhibits a high tolerance to annealing temperatures, high specificity and a limit of detection equal to conventional PCR. A total of 214 samples from markets, national entry-exit agencies, the Institute for Reference Materials and Measurement (IRMM) and the American Oil Chemists' Society (AOCS) were also tested for applicability. This screening system is therefore suitable for GMO screening. Copyright © 2017 Elsevier Ltd. All rights reserved.

Simulation and estimation of gene number in a biological pathway using almost complete saturation mutagenesis screening of haploid mouse cells.

Science.gov (United States)

Tokunaga, Masahiro; Kokubu, Chikara; Maeda, Yusuke; Sese, Jun; Horie, Kyoji; Sugimoto, Nakaba; Kinoshita, Taroh; Yusa, Kosuke; Takeda, Junji

2014-11-24

Genome-wide saturation mutagenesis and subsequent phenotype-driven screening has been central to a comprehensive understanding of complex biological processes in classical model organisms such as flies, nematodes, and plants. The degree of "saturation" (i.e., the fraction of possible target genes identified) has been shown to be a critical parameter in determining all relevant genes involved in a biological function, without prior knowledge of their products. In mammalian model systems, however, the relatively large scale and labor intensity of experiments have hampered the achievement of actual saturation mutagenesis, especially for recessive traits that require biallelic mutations to manifest detectable phenotypes. By exploiting the recently established haploid mouse embryonic stem cells (ESCs), we present an implementation of almost complete saturation mutagenesis in a mammalian system. The haploid ESCs were mutagenized with the chemical mutagen N-ethyl-N-nitrosourea (ENU) and processed for the screening of mutants defective in various steps of the glycosylphosphatidylinositol-anchor biosynthetic pathway. The resulting 114 independent mutant clones were characterized by a functional complementation assay, and were shown to be defective in any of 20 genes among all 22 known genes essential for this well-characterized pathway. Ten mutants were further validated by whole-exome sequencing. The predominant generation of single-nucleotide substitutions by ENU resulted in a gene mutation rate proportional to the length of the coding sequence, which facilitated the experimental design of saturation mutagenesis screening with the aid of computational simulation. Our study enables mammalian saturation mutagenesis to become a realistic proposition. Computational simulation, combined with a pilot mutagenesis experiment, could serve as a tool for the estimation of the number of genes essential for biological processes such as drug target pathways when a positive selection of

Discovering perturbation of modular structure in HIV progression by integrating multiple data sources through non-negative matrix factorization.

Science.gov (United States)

Ray, Sumanta; Maulik, Ujjwal

2016-12-20

Detecting perturbation in modular structure during HIV-1 disease progression is an important step to understand stage specific infection pattern of HIV-1 virus in human cell. In this article, we proposed a novel methodology on integration of multiple biological information to identify such disruption in human gene module during different stages of HIV-1 infection. We integrate three different biological information: gene expression information, protein-protein interaction information and gene ontology information in single gene meta-module, through non negative matrix factorization (NMF). As the identified metamodules inherit those information so, detecting perturbation of these, reflects the changes in expression pattern, in PPI structure and in functional similarity of genes during the infection progression. To integrate modules of different data sources into strong meta-modules, NMF based clustering is utilized here. Perturbation in meta-modular structure is identified by investigating the topological and intramodular properties and putting rank to those meta-modules using a rank aggregation algorithm. We have also analyzed the preservation structure of significant GO terms in which the human proteins of the meta-modules participate. Moreover, we have performed an analysis to show the change of coregulation pattern of identified transcription factors (TFs) over the HIV progression stages.

Global Screening of Antiviral Genes that Suppress Baculovirus Transgene Expression in Mammalian Cells.

Science.gov (United States)

Wang, Chia-Hung; Naik, Nenavath Gopal; Liao, Lin-Li; Wei, Sung-Chan; Chao, Yu-Chan

2017-09-15

Although baculovirus has been used as a safe and convenient gene delivery vector in mammalian cells, baculovirus-mediated transgene expression is less effective in various mammalian cell lines. Identification of the negative regulators in host cells is necessary to improve baculovirus-based expression systems. Here, we performed high-throughput shRNA library screening, targeting 176 antiviral innate immune genes, and identified 43 host restriction factor genes in a human A549 lung carcinoma cell line. Among them, suppression of receptor interaction protein kinase 1 (RIP1, also known as RIPK1) significantly increased baculoviral transgene expression without resulting in significant cell death. Silencing of RIP1 did not affect viral entry or cell viability, but it did inhibit nuclear translocation of the IRF3 and NF-κB transcription factors. Also, activation of downstream signaling mediators (such as TBK1 and IRF7) was affected, and subsequent interferon and cytokine gene expression levels were abolished. Further, Necrostatin-1 (Nec-1)-an inhibitor of RIP1 kinase activity-dramatically increased baculoviral transgene expression in RIP1-silenced cells. Using baculovirus as a model system, this study presents an initial investigation of large numbers of human cell antiviral innate immune response factors against a "nonadaptive virus." In addition, our study has made baculovirus a more efficient gene transfer vector for some of the most frequently used mammalian cell systems.

On the screening of static electromagnetic fields in hot QED plasmas

International Nuclear Information System (INIS)

Blaizot, J.P.

1995-01-01

The screening of static magnetic and electric fields was studied in massless quantum electrodynamics (QED) and massless scalar electrodynamics (SQED) at temperature T. Various exact relations for the static polarization tensor are first reviewed, and then verified perturbatively to fifth order (in the coupling) in QED and fourth order in SQED, using different resummation techniques. The magnetic and electric screening masses squared, as defined through the pole of the static propagators, are also calculated to fifth order in QED and fourth order in SQED, and their gauge-independence and renormalisation-group invariance is checked. Finally, arguments are provided for the vanishing of the magnetic mass to all orders in perturbation theory. (author) 26 refs

Genetic basis of prune belly syndrome: screening for HNF1β gene.

Science.gov (United States)

Granberg, Candace F; Harrison, Steven M; Dajusta, Daniel; Zhang, Shaohua; Hajarnis, Sachin; Igarashi, Peter; Baker, Linda A

2012-01-01

Although the cause of prune belly syndrome is unknown, familial evidence suggests a genetic component. Recently 2 nonfamilial cases of prune belly syndrome with chromosome 17q12 deletions encompassing the HNF1β gene have made this a candidate gene for prune belly syndrome. To date, there has been no large-scale screening of patients with prune belly syndrome for HNF1β mutations. We assessed the role of HNF1β in prune belly syndrome by screening for genomic mutations with functional characterization of any detected mutations. We studied patients with prune belly syndrome who were prospectively enrolled in our Pediatric Genitourinary DNA Repository since 2001. DNA from patient samples was amplified by polymerase chain reaction, sequenced for coding and splice regions of the HNF1β gene, and compared to control databases. We performed functional assay testing of the ability of mutant HNF1β to activate a luciferase construct with an HNF1β DNA binding site. From 32 prune belly syndrome probands (30 males, 2 females) HNF1β sequencing detected a missense mutation (V61G) in 1 child with prune belly syndrome. Absent in control databases, V61G was previously reported in 2 patients without prune belly syndrome who had congenital genitourinary anomalies. Functional testing showed similar luciferase activity compared to wild-type HNF1β, suggesting the V61G substitution does not disturb HNF1β function. One genomic HNF1β mutation was detected in 3% of patients with prune belly syndrome but found to be functionally normal. Thus, functionally significant HNF1β mutations are uncommon in prune belly syndrome, despite case reports of HNF1β deletions. Further genetic study is necessary, as identification of the genetic basis of prune belly syndrome may ultimately lead to prevention and improved treatments for this rare but severe syndrome. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Fungal Screening on Olive Oil for Extracellular Triacylglycerol Lipases: Selection of a Trichoderma harzianum Strain and Genome Wide Search for the Genes

Science.gov (United States)

Canseco-Pérez, Miguel Angel; Castillo-Avila, Genny Margarita; Islas-Flores, Ignacio; Apolinar-Hernández, Max M.; Rivera-Muñoz, Gerardo; Gamboa-Angulo, Marcela; Couoh-Uicab, Yeny

2018-01-01

A lipolytic screening with fungal strains isolated from lignocellulosic waste collected in banana plantation dumps was carried out. A Trichoderma harzianum strain (B13-1) showed good extracellular lipolytic activity (205 UmL−1). Subsequently, functional screening of the lipolytic activity on Rhodamine B enriched with olive oil as the only carbon source was performed. The successful growth of the strain allows us to suggest that a true lipase is responsible for the lipolytic activity in the B13-1 strain. In order to identify the gene(s) encoding the protein responsible for the lipolytic activity, in silico identification and characterization of triacylglycerol lipases from T. harzianum is reported for the first time. A survey in the genome of this fungus retrieved 50 lipases; however, bioinformatic analyses and putative functional descriptions in different databases allowed us to choose seven lipases as candidates. Suitability of the bioinformatic screening to select the candidates was confirmed by reverse transcription polymerase chain reaction (RT-PCR). The gene codifying 526309 was expressed when the fungus grew in a medium with olive oil as carbon source. This protein shares homology with commercial lipases, making it a candidate for further applications. The success in identifying a lipase gene inducible with olive oil and the suitability of the functional screening and bioinformatic survey carried out herein, support the premise that the strategy can be used in other microorganisms with sequenced genomes to search for true lipases, or other enzymes belonging to large protein families. PMID:29370083

Improved genome-scale multi-target virtual screening via a novel collaborative filtering approach to cold-start problem.

Science.gov (United States)

Lim, Hansaim; Gray, Paul; Xie, Lei; Poleksic, Aleksandar

2016-12-13

Conventional one-drug-one-gene approach has been of limited success in modern drug discovery. Polypharmacology, which focuses on searching for multi-targeted drugs to perturb disease-causing networks instead of designing selective ligands to target individual proteins, has emerged as a new drug discovery paradigm. Although many methods for single-target virtual screening have been developed to improve the efficiency of drug discovery, few of these algorithms are designed for polypharmacology. Here, we present a novel theoretical framework and a corresponding algorithm for genome-scale multi-target virtual screening based on the one-class collaborative filtering technique. Our method overcomes the sparseness of the protein-chemical interaction data by means of interaction matrix weighting and dual regularization from both chemicals and proteins. While the statistical foundation behind our method is general enough to encompass genome-wide drug off-target prediction, the program is specifically tailored to find protein targets for new chemicals with little to no available interaction data. We extensively evaluate our method using a number of the most widely accepted gene-specific and cross-gene family benchmarks and demonstrate that our method outperforms other state-of-the-art algorithms for predicting the interaction of new chemicals with multiple proteins. Thus, the proposed algorithm may provide a powerful tool for multi-target drug design.

Facile high-throughput forward chemical genetic screening by in situ monitoring of glucuronidase-based reporter gene expression in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Vivek eHalder

2015-01-01

Full Text Available The use of biologically active small molecules to perturb biological functions holds enormous potential for investigating complex signaling networks. However, in contrast to animal systems, the search for and application of chemical tools for basic discovery in the plant sciences, generally referred to as ‘chemical genetics’, has only recently gained momentum. In addition to cultured cells, the well-characterized, small-sized model plant Arabidopsis thaliana is suitable for cultivation in microplates, which allows employing diverse cell- or phenotype-based chemical screens. In such screens, a chemical’s bioactivity is typically assessed either through scoring its impact on morphological traits or quantifying molecular attributes such as enzyme or reporter activities. Here, we describe a facile forward chemical screening methodology for intact Arabidopsis seedlings harboring the β-glucuronidase (GUS reporter by directly quantifying GUS activity in situ with 4-methylumbelliferyl-β-D-glucuronide (4-MUG as substrate. The quantitative nature of this screening assay has an obvious advantage over the also convenient histochemical GUS staining method, as it allows application of statistical procedures and unbiased hit selection based on threshold values as well as distinction between compounds with strong or weak bioactivity. At the same time, the in situ bioassay is very convenient requiring less effort and time for sample handling in comparison to the conventional quantitative in vitro GUS assay using 4-MUG, as validated with several Arabidopsis lines harboring different GUS reporter constructs. To demonstrate that the developed assays is particularly suitable for large-scale screening projects, we performed a pilot screen for chemical activators or inhibitors of salicylic acid-mediated defense signaling using the Arabidopsis PR1p::GUS line. Importantly, the screening methodology provided here can be adopted for any inducible GUS reporter line.

Non-perturbative QCD correlation functions

Energy Technology Data Exchange (ETDEWEB)

Cyrol, Anton Konrad

2017-11-27

Functional methods provide access to the non-perturbative regime of quantum chromo- dynamics. Hence, they allow investigating confinement and chiral symmetry breaking. In this dissertation, correlation functions of Yang-Mills theory and unquenched two-flavor QCD are computed from the functional renormalization group. Employing a self-consistent vertex expansion of the effective action, Yang-Mills correlation functions are obtained in four as well as in three spacetime dimensions. To this end, confinement and Slavnov-Taylor identities are discussed. Our numerical results show very good agreement with corresponding lattice results. Next, unquenched two-flavor QCD is considered where it is shown that the unquenched two-flavor gluon propagator is insensitive to the pion mass. Furthermore, the necessity for consistent truncations is emphasized. Finally, correlation functions of finite-temperature Yang-Mills theory are computed in a truncation that includes the splitting of the gluon field into directions that are transverse and longitudinal to the heat bath. In particular, it includes the splitting of the three- and four-gluon vertices. The obtained gluon propagator allows to extract a Debye screening mass that coincides with the hard thermal loop screening mass at high temperatures, but is meaningful also at temperatures below the phase transition temperature.

Perturbed effects at radiation physics

International Nuclear Information System (INIS)

Külahcı, Fatih; Şen, Zekâi

2013-01-01

Perturbation methodology is applied in order to assess the linear attenuation coefficient, mass attenuation coefficient and cross-section behavior with random components in the basic variables such as the radiation amounts frequently used in the radiation physics and chemistry. Additionally, layer attenuation coefficient (LAC) and perturbed LAC (PLAC) are proposed for different contact materials. Perturbation methodology provides opportunity to obtain results with random deviations from the average behavior of each variable that enters the whole mathematical expression. The basic photon intensity variation expression as the inverse exponential power law (as Beer–Lambert's law) is adopted for perturbation method exposition. Perturbed results are presented not only in terms of the mean but additionally the standard deviation and the correlation coefficients. Such perturbation expressions provide one to assess small random variability in basic variables. - Highlights: • Perturbation methodology is applied to Radiation Physics. • Layer attenuation coefficient (LAC) and perturbed LAC are proposed for contact materials. • Perturbed linear attenuation coefficient is proposed. • Perturbed mass attenuation coefficient (PMAC) is proposed. • Perturbed cross-section is proposed

Domain walls and perturbation theory in high-temperature gauge theory: SU(2) in 2+1 dimensions

International Nuclear Information System (INIS)

Korthals Altes, C.; Michels, A.; Teper, M.; Stephanov, M.

1997-01-01

We study the detailed properties of Z 2 domain walls in the deconfined high-temperature phase of the d=2+1 SU(2) gauge theory. These walls are studied both by computer simulations of the lattice theory and by one-loop perturbative calculations. The latter are carried out both in the continuum and on the lattice. We find that leading order perturbation theory reproduces the detailed properties of these domain walls remarkably accurately even at temperatures where the effective dimensionless expansion parameter g 2 /T is close to unity. The quantities studied include the surface tension, the action density profiles, roughening, and the electric screening mass. It is only for the last quantity that we find an exception to the precocious success of perturbation theory. All this shows that, despite the presence of infrared divergences at higher orders, high-T perturbation theory can be an accurate calculational tool. copyright 1997 The American Physical Society

Perturbative anyon gas

International Nuclear Information System (INIS)

Dasnieres de Veigy, A.; Ouvry, S.; Paris-6 Univ., 75

1992-06-01

The problem of the statistical mechanics of an anyon gas is addressed. A perturbative analysis in the anyonic coupling constant α is reviewed, and the thermodynamical potential is computed at first and second order. An adequate second quantized formalism (field theory at finite temperature) is proposed. At first order in perturbation theory, the results are strikingly simple: only the second virial coefficient close to bosonic statistics is corrected. At second order, however, the complexity of the anyon model appears. One can compute exactly the perturbative correction to each cluster coefficient. However, and contrary to first order, a closed expression for the equation of state seems out of reach. As an illustration, the perturbative expressions of a 3 , a 4 , a 5 and a 6 are given at second order. Finally, using the same formalism, the equation of state of an anyon gas in a constant magnetic field is analyzed at first order in perturbation theory. (K.A.) 16 refs.; 3 figs.; 7 tabs

Screening for mutations in the uroporphyrinogen decarboxylase gene using denaturing gradient gel electrophoresis

DEFF Research Database (Denmark)

Christiansen, L; Ged, C; Hombrados, I

1999-01-01

to exon skipping, and a 2-bp deletion (415-416delTA) resulting in a frameshift and the introduction of a premature stop codon. Heterologous expression and enzymatic studies of the mutant proteins demonstrate that the three mutations leading to shortening or truncation of the UROD protein have no residual......, confirming the heterogeneity of the underlying genetic defects of these diseases. We have established a denaturing gradient gel electrophoresis (DGGE) assay for mutation detection in the UROD gene, enabling the simultaneous screening for known and unknown mutations. The established assay has proved able...

Perturbation theory

International Nuclear Information System (INIS)

Bartlett, R.; Kirtman, B.; Davidson, E.R.

1978-01-01

After noting some advantages of using perturbation theory some of the various types are related on a chart and described, including many-body nonlinear summations, quartic force-field fit for geometry, fourth-order correlation approximations, and a survey of some recent work. Alternative initial approximations in perturbation theory are also discussed. 25 references

Large-scale functional RNAi screen in C. elegans identifies genes that regulate the dysfunction of mutant polyglutamine neurons.

Science.gov (United States)

Lejeune, François-Xavier; Mesrob, Lilia; Parmentier, Frédéric; Bicep, Cedric; Vazquez-Manrique, Rafael P; Parker, J Alex; Vert, Jean-Philippe; Tourette, Cendrine; Neri, Christian

2012-03-13

A central goal in Huntington's disease (HD) research is to identify and prioritize candidate targets for neuroprotective intervention, which requires genome-scale information on the modifiers of early-stage neuron injury in HD. Here, we performed a large-scale RNA interference screen in C. elegans strains that express N-terminal huntingtin (htt) in touch receptor neurons. These neurons control the response to light touch. Their function is strongly impaired by expanded polyglutamines (128Q) as shown by the nearly complete loss of touch response in adult animals, providing an in vivo model in which to manipulate the early phases of expanded-polyQ neurotoxicity. In total, 6034 genes were examined, revealing 662 gene inactivations that either reduce or aggravate defective touch response in 128Q animals. Several genes were previously implicated in HD or neurodegenerative disease, suggesting that this screen has effectively identified candidate targets for HD. Network-based analysis emphasized a subset of high-confidence modifier genes in pathways of interest in HD including metabolic, neurodevelopmental and pro-survival pathways. Finally, 49 modifiers of 128Q-neuron dysfunction that are dysregulated in the striatum of either R/2 or CHL2 HD mice, or both, were identified. Collectively, these results highlight the relevance to HD pathogenesis, providing novel information on the potential therapeutic targets for neuroprotection in HD. © 2012 Lejeune et al; licensee BioMed Central Ltd.

Screening of SHOX gene sequence variants in Saudi Arabian children with idiopathic short stature.

Science.gov (United States)

Alharthi, Abdulla A; El-Hallous, Ehab I; Talaat, Iman M; Alghamdi, Hamed A; Almalki, Matar I; Gaber, Ahmed

2017-10-01

Short stature affects approximately 2%-3% of children, representing one of the most frequent disorders for which clinical attention is sought during childhood. Despite assumed genetic heterogeneity, mutations or deletions in the short stature homeobox-containing gene ( SHOX ) are frequently detected in subjects with short stature. Idiopathic short stature (ISS) refers to patients with short stature for various unknown reasons. The goal of this study was to screen all the exons of SHOX to identify related mutations. We screened all the exons of SHOX for mutations analysis in 105 ISS children patients (57 girls and 48 boys) living in Taif governorate, KSA using a direct DNA sequencing method. Height, arm span, and sitting height were recorded, and subischial leg length was calculated. A total of 30 of 105 ISS patients (28%) contained six polymorphic variants in exons 1, 2, 4, and 6. One mutation was found in the DNA domain binding region of exon 4. Three of these polymorphic variants were novel, while the others were reported previously. There were no significant differences in anthropometric measures in ISS patients with and without identifiable polymorphic variants in SHOX . In Saudi Arabia ISS patients, rather than SHOX , it is possible that new genes are involved in longitudinal growth. Additional molecular analysis is required to diagnose and understand the etiology of this disease.

Parameterised post-Newtonian expansion in screened regions

Science.gov (United States)

McManus, Ryan; Lombriser, Lucas; Peñarrubia, Jorge

2017-12-01

The parameterised post-Newtonian (PPN) formalism has enabled stringent tests of static weak-field gravity in a theory-independent manner. Here we incorporate screening mechanisms of modified gravity theories into the framework by introducing an effective gravitational coupling and defining the PPN parameters as functions of position. To determine these functions we develop a general method for efficiently performing the post-Newtonian expansion in screened regimes. For illustration, we derive all the PPN functions for a cubic galileon and a chameleon model. We also analyse the Shapiro time delay effect for these two models and find no deviations from General Relativity insofar as the signal path and the perturbing mass reside in a screened region of space.

SCREENING OF ANTIMICROBIAL ACTIVITY AND GENES CODING POLYKETIDE SYNTHETASE AND NONRIBOSOMAL PEPTIDE SYNTHETASE OF ACTINOMYCETE ISOLATES

Directory of Open Access Journals (Sweden)

Silvia Kovácsová

2013-12-01

Full Text Available The aim of this study was to observe antimicrobial activity using agar plate diffusion method and screening genes coding polyketide synthetase (PKS-I and nonribosomal peptide synthetase (NRPS from actinomycetes. A total of 105 actinomycete strains were isolated from arable soil. Antimicrobial activity was demonstrated at 54 strains against at least 1 of total 12 indicator organisms. Antifungal properties were recorded more often than antibacterial properties. The presence of PKS-I and NRPS genes were founded at 61 of total 105 strains. The number of strains with mentioned biosynthetic enzyme gene fragments matching the anticipated length were 19 (18% and 50 (47% respectively. Overall, five actinomycete strains carried all the biosynthetical genes, yet no antimicrobial activity was found against any of tested pathogens. On the other hand, twenty-one strains showed antimicrobial activity even though we were not able to amplify any of the PKS or NRPS genes from them. Combination of the two methods showed broad-spectrum antimicrobial activity of actinomycetes isolated from arable soil, which indicate that actinomycetes are valuable reservoirs of novel bioactive compounds.

Analysis of the robustness of network-based disease-gene prioritization methods reveals redundancy in the human interactome and functional diversity of disease-genes.

Directory of Open Access Journals (Sweden)

Emre Guney

Full Text Available Complex biological systems usually pose a trade-off between robustness and fragility where a small number of perturbations can substantially disrupt the system. Although biological systems are robust against changes in many external and internal conditions, even a single mutation can perturb the system substantially, giving rise to a pathophenotype. Recent advances in identifying and analyzing the sequential variations beneath human disorders help to comprehend a systemic view of the mechanisms underlying various disease phenotypes. Network-based disease-gene prioritization methods rank the relevance of genes in a disease under the hypothesis that genes whose proteins interact with each other tend to exhibit similar phenotypes. In this study, we have tested the robustness of several network-based disease-gene prioritization methods with respect to the perturbations of the system using various disease phenotypes from the Online Mendelian Inheritance in Man database. These perturbations have been introduced either in the protein-protein interaction network or in the set of known disease-gene associations. As the network-based disease-gene prioritization methods are based on the connectivity between known disease-gene associations, we have further used these methods to categorize the pathophenotypes with respect to the recoverability of hidden disease-genes. Our results have suggested that, in general, disease-genes are connected through multiple paths in the human interactome. Moreover, even when these paths are disturbed, network-based prioritization can reveal hidden disease-gene associations in some pathophenotypes such as breast cancer, cardiomyopathy, diabetes, leukemia, parkinson disease and obesity to a greater extend compared to the rest of the pathophenotypes tested in this study. Gene Ontology (GO analysis highlighted the role of functional diversity for such diseases.

Developments in perturbation theory

International Nuclear Information System (INIS)

Greenspan, E.

1976-01-01

Included are sections dealing with perturbation expressions for reactivity, methods for the calculation of perturbed fluxes, integral transport theory formulations for reactivity, generalized perturbation theory, sensitivity and optimization studies, multigroup calculations of bilinear functionals, and solution of inhomogeneous Boltzmann equations with singular operators

Comparative Plasmodium gene overexpression reveals distinct perturbation of sporozoite transmission by profilin.

Science.gov (United States)

Sato, Yuko; Hliscs, Marion; Dunst, Josefine; Goosmann, Christian; Brinkmann, Volker; Montagna, Georgina N; Matuschewski, Kai

2016-07-15

Plasmodium relies on actin-based motility to migrate from the site of infection and invade target cells. Using a substrate-dependent gliding locomotion, sporozoites are able to move at fast speed (1-3 μm/s). This motility relies on a minimal set of actin regulatory proteins and occurs in the absence of detectable filamentous actin (F-actin). Here we report an overexpression strategy to investigate whether perturbations of F-actin steady-state levels affect gliding locomotion and host invasion. We selected two vital Plasmodium berghei G-actin-binding proteins, C-CAP and profilin, in combination with three stage-specific promoters and mapped the phenotypes afforded by overexpression in all three extracellular motile stages. We show that in merozoites and ookinetes, additional expression does not impair life cycle progression. In marked contrast, overexpression of C-CAP and profilin in sporozoites impairs circular gliding motility and salivary gland invasion. The propensity for productive motility correlates with actin accumulation at the parasite tip, as revealed by combinations of an actin-stabilizing drug and transgenic parasites. Strong expression of profilin, but not C-CAP, resulted in complete life cycle arrest. Comparative overexpression is an alternative experimental genetic strategy to study essential genes and reveals effects of regulatory imbalances that are not uncovered from deletion-mutant phenotyping. © 2016 Sato et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Screening of Dystrophin Gene Deletions in Egyptian Patients with DMD/BMD Muscular Dystrophies

Directory of Open Access Journals (Sweden)

Laila K. Effat

2000-01-01

Full Text Available Duchenne muscular dystrophy (DMD and Becker muscular dystrophy (BMD are allelic disorders caused by mutations within the dystrophin gene. Our study has identified 100 Egyptian families collected from the Human Genetics Clinic, National Research Center, Cairo. All cases were subjected to complete clinical evaluation pedigree analysis, electromyography studies, estimation of serum creatine phosphokinase enzyme (CPK levels and DNA analysis. Multiplex PCR using 18 pairs of specific primers were used for screening of deletion mutations within the dystrophin gene. A frequency of 55% among the families. Sixty per cent of detected deletions involved multiple exons spanning the major or the minor hot spot of the dystrophin gene. The remainder 40% which mainly involved exon 45. Comparing these findings with frequencies of other countries it was found that our figures fall within the reported range of 40%– for deletions. The distribution of deletions in our study and other different studies was variable and specific ethnic differences do not apparently account for specific deletions. In addition this study concluded that employment of the 18 exon analysis is a cost effective and a highly accurate (97% to launch a nationwide program.

PerturbationAnalyzer: a tool for investigating the effects of concentration perturbation on protein interaction networks.

Science.gov (United States)

Li, Fei; Li, Peng; Xu, Wenjian; Peng, Yuxing; Bo, Xiaochen; Wang, Shengqi

2010-01-15

The propagation of perturbations in protein concentration through a protein interaction network (PIN) can shed light on network dynamics and function. In order to facilitate this type of study, PerturbationAnalyzer, which is an open source plugin for Cytoscape, has been developed. PerturbationAnalyzer can be used in manual mode for simulating user-defined perturbations, as well as in batch mode for evaluating network robustness and identifying significant proteins that cause large propagation effects in the PINs when their concentrations are perturbed. Results from PerturbationAnalyzer can be represented in an intuitive and customizable way and can also be exported for further exploration. PerturbationAnalyzer has great potential in mining the design principles of protein networks, and may be a useful tool for identifying drug targets. PerturbationAnalyzer can be accessed from the Cytoscape web site http://www.cytoscape.org/plugins/index.php or http://biotech.bmi.ac.cn/PerturbationAnalyzer. Supplementary data are available at Bioinformatics online.

Genetic screens in Caenorhabditis elegans models for neurodegenerative diseases

NARCIS (Netherlands)

Alvarenga Fernandes Sin, Olga; Michels, Helen; Nollen, Ellen A. A.

2014-01-01

Caenorhabditis elegans comprises unique features that make it an attractive model organism in diverse fields of biology. Genetic screens are powerful to identify genes and C. elegans can be customized to forward or reverse genetic screens and to establish gene function. These genetic screens can be

The Identification of Genes Important in Pseudomonas syringae pv. phaseolicola Plant Colonisation Using In Vitro Screening of Transposon Libraries.

Directory of Open Access Journals (Sweden)

Bharani Manoharan

Full Text Available The bacterial plant pathogen Pseudomonas syringae pv. phaseolicola (Pph colonises the surface of common bean plants before moving into the interior of plant tissue, via wounds and stomata. In the intercellular spaces the pathogen proliferates in the apoplastic fluid and forms microcolonies (biofilms around plant cells. If the pathogen can suppress the plant's natural resistance response, it will cause halo blight disease. The process of resistance suppression is fairly well understood, but the mechanisms used by the pathogen in colonisation are less clear. We hypothesised that we could apply in vitro genetic screens to look for changes in motility, colony formation, and adhesion, which are proxies for infection, microcolony formation and cell adhesion. We made transposon (Tn mutant libraries of Pph strains 1448A and 1302A and found 106/1920 mutants exhibited alterations in colony morphology, motility and biofilm formation. Identification of the insertion point of the Tn identified within the genome highlighted, as expected, a number of altered motility mutants bearing mutations in genes encoding various parts of the flagellum. Genes involved in nutrient biosynthesis, membrane associated proteins, and a number of conserved hypothetical protein (CHP genes were also identified. A mutation of one CHP gene caused a positive increase in in planta bacterial growth. This rapid and inexpensive screening method allows the discovery of genes important for in vitro traits that can be correlated to roles in the plant interaction.

Difference scheme for a singularly perturbed parabolic convection-diffusion equation in the presence of perturbations

Science.gov (United States)

Shishkin, G. I.

2015-11-01

An initial-boundary value problem is considered for a singularly perturbed parabolic convection-diffusion equation with a perturbation parameter ɛ (ɛ ∈ (0, 1]) multiplying the highest order derivative. The stability of a standard difference scheme based on monotone approximations of the problem on a uniform mesh is analyzed, and the behavior of discrete solutions in the presence of perturbations is examined. The scheme does not converge ɛ-uniformly in the maximum norm as the number of its grid nodes is increased. When the solution of the difference scheme converges, which occurs if N -1 ≪ ɛ and N -1 0 ≪ 1, where N and N 0 are the numbers of grid intervals in x and t, respectively, the scheme is not ɛ-uniformly well conditioned or stable to data perturbations in the grid problem and to computer perturbations. For the standard difference scheme in the presence of data perturbations in the grid problem and/or computer perturbations, conditions on the "parameters" of the difference scheme and of the computer (namely, on ɛ, N, N 0, admissible data perturbations in the grid problem, and admissible computer perturbations) are obtained that ensure the convergence of the perturbed solutions. Additionally, the conditions are obtained under which the perturbed numerical solution has the same order of convergence as the solution of the unperturbed standard difference scheme.

Non-Perturbative Asymptotic Improvement of Perturbation Theory and Mellin-Barnes Representation

Directory of Open Access Journals (Sweden)

Samuel Friot

2010-10-01

Full Text Available Using a method mixing Mellin-Barnes representation and Borel resummation we show how to obtain hyperasymptotic expansions from the (divergent formal power series which follow from the perturbative evaluation of arbitrary ''N-point'' functions for the simple case of zero-dimensional φ4 field theory. This hyperasymptotic improvement appears from an iterative procedure, based on inverse factorial expansions, and gives birth to interwoven non-perturbative partial sums whose coefficients are related to the perturbative ones by an interesting resurgence phenomenon. It is a non-perturbative improvement in the sense that, for some optimal truncations of the partial sums, the remainder at a given hyperasymptotic level is exponentially suppressed compared to the remainder at the preceding hyperasymptotic level. The Mellin-Barnes representation allows our results to be automatically valid for a wide range of the phase of the complex coupling constant, including Stokes lines. A numerical analysis is performed to emphasize the improved accuracy that this method allows to reach compared to the usual perturbative approach, and the importance of hyperasymptotic optimal truncation schemes.

Genome-wide screen in Saccharomyces cerevisiae identifies vacuolar protein sorting, autophagy, biosynthetic, and tRNA methylation genes involved in life span regulation.

Science.gov (United States)

Fabrizio, Paola; Hoon, Shawn; Shamalnasab, Mehrnaz; Galbani, Abdulaye; Wei, Min; Giaever, Guri; Nislow, Corey; Longo, Valter D

2010-07-15

The study of the chronological life span of Saccharomyces cerevisiae, which measures the survival of populations of non-dividing yeast, has resulted in the identification of homologous genes and pathways that promote aging in organisms ranging from yeast to mammals. Using a competitive genome-wide approach, we performed a screen of a complete set of approximately 4,800 viable deletion mutants to identify genes that either increase or decrease chronological life span. Half of the putative short-/long-lived mutants retested from the primary screen were confirmed, demonstrating the utility of our approach. Deletion of genes involved in vacuolar protein sorting, autophagy, and mitochondrial function shortened life span, confirming that respiration and degradation processes are essential for long-term survival. Among the genes whose deletion significantly extended life span are ACB1, CKA2, and TRM9, implicated in fatty acid transport and biosynthesis, cell signaling, and tRNA methylation, respectively. Deletion of these genes conferred heat-shock resistance, supporting the link between life span extension and cellular protection observed in several model organisms. The high degree of conservation of these novel yeast longevity determinants in other species raises the possibility that their role in senescence might be conserved.

Incidence, Antimicrobial Susceptibility, and Toxin Genes Possession Screening of Staphylococcus aureus in Retail Chicken Livers and Gizzards

Directory of Open Access Journals (Sweden)

Lubna S. Abdalrahman

2015-04-01

Full Text Available Few recent outbreaks in Europe and the US involving Campylobacter and Salmonella were linked to the consumption of chicken livers. Studies investigating Staphylococcus aureus in chicken livers and gizzards are very limited. The objectives of this study were to determine the prevalence, antimicrobial resistance, and virulence of S. aureus and MRSA (Methicillin-Resistant Staphylococcus aureus in retail chicken livers and gizzards in Tulsa, Oklahoma. In this study, 156 chicken livers and 39 chicken gizzards samples of two brands were collected. While one of the brands showed very low prevalence of 1% (1/100 for S. aureus in chicken livers and gizzards, the second brand showed prevalence of 37% (31/95. No MRSA was detected since none harbored the mecA or mecC gene. Eighty seven S. aureus isolates from livers and 28 from gizzards were screened for antimicrobial resistance to 16 antimicrobials and the possession of 18 toxin genes. Resistance to most of the antimicrobials screened including cefoxitin and oxacillin was higher in the chicken gizzards isolates. While the prevalence of enterotoxin genes seg and sei was higher in the gizzards isolates, the prevalence of hemolysin genes hla, hlb, and hld was higher in the livers ones. The lucocidin genes lukE-lukD was equally prevalent in chicken livers and gizzards isolates. Using spa typing, a subset of the recovered isolates showed that they are not known to be livestock associated and, hence, may be of a human origin. In conclusion, this study stresses the importance of thorough cooking of chicken livers and gizzards since it might contain multidrug resistant enterotoxigenic S. aureus. To our knowledge this is the first study to specifically investigate the prevalence of S. aureus in chicken livers and gizzards in the US.

Communication: Random phase approximation renormalized many-body perturbation theory

International Nuclear Information System (INIS)

Bates, Jefferson E.; Furche, Filipp

2013-01-01

We derive a renormalized many-body perturbation theory (MBPT) starting from the random phase approximation (RPA). This RPA-renormalized perturbation theory extends the scope of single-reference MBPT methods to small-gap systems without significantly increasing the computational cost. The leading correction to RPA, termed the approximate exchange kernel (AXK), substantially improves upon RPA atomization energies and ionization potentials without affecting other properties such as barrier heights where RPA is already accurate. Thus, AXK is more balanced than second-order screened exchange [A. Grüneis et al., J. Chem. Phys. 131, 154115 (2009)], which tends to overcorrect RPA for systems with stronger static correlation. Similarly, AXK avoids the divergence of second-order Møller-Plesset (MP2) theory for small gap systems and delivers a much more consistent performance than MP2 across the periodic table at comparable cost. RPA+AXK thus is an accurate, non-empirical, and robust tool to assess and improve semi-local density functional theory for a wide range of systems previously inaccessible to first-principles electronic structure calculations

GNAI3: Another Candidate Gene to Screen in Persons with Ocular Albinism

Science.gov (United States)

Young, Alejandra; Sader, Avery; Farber, Debora B.

2016-01-01

Ocular albinism type 1 (OA), caused by mutations in the OA1 gene, encodes a G-protein coupled receptor, OA1, localized in melanosomal membranes of the retinal pigment epithelium (RPE). This disorder is characterized by both RPE macro-melanosomes and abnormal decussation of ganglion cell axons at the brain’s optic chiasm. We demonstrated previously that Oa1 specifically activates Gαi3, which also signals in the Oa1 transduction pathway that regulates melanosomal biogenesis. In this study, we screened the human Gαi3 gene, GNAI3, in DNA samples from 26 patients who had all clinical characteristics of OA but in whom a specific mutation in the OA1 gene had not been found, and in 6 normal control individuals. Using the Agilent HaloPlex Target Enrichment System and next-generation sequencing (NGS) on the Illumina MiSeq platform, we identified 518 variants after rigorous filtering. Many of these variants were corroborated by Sanger sequencing. Overall, 98.8% coverage of the GNAI3 gene was obtained by the HaloPlex amplicons. Of all variants, 6 non-synonymous and 3 synonymous were in exons, 41 in a non-coding exon embedded in the 3’ untranslated region (UTR), 6 in the 5’ UTR, and 462 in introns. These variants included novel SNVs, insertions, deletions, and a frameshift mutation. All were found in at least one patient but none in control samples. Using computational methods, we modeled the GNAI3 protein and its non-synonymous exonic mutations and determined that several of these may be the cause of disease in the patients studied. Thus, we have identified GNAI3 as a second gene possibly responsible for X-linked ocular albinism. PMID:27607449

GNAI3: Another Candidate Gene to Screen in Persons with Ocular Albinism.

Directory of Open Access Journals (Sweden)

Alejandra Young

Full Text Available Ocular albinism type 1 (OA, caused by mutations in the OA1 gene, encodes a G-protein coupled receptor, OA1, localized in melanosomal membranes of the retinal pigment epithelium (RPE. This disorder is characterized by both RPE macro-melanosomes and abnormal decussation of ganglion cell axons at the brain's optic chiasm. We demonstrated previously that Oa1 specifically activates Gαi3, which also signals in the Oa1 transduction pathway that regulates melanosomal biogenesis. In this study, we screened the human Gαi3 gene, GNAI3, in DNA samples from 26 patients who had all clinical characteristics of OA but in whom a specific mutation in the OA1 gene had not been found, and in 6 normal control individuals. Using the Agilent HaloPlex Target Enrichment System and next-generation sequencing (NGS on the Illumina MiSeq platform, we identified 518 variants after rigorous filtering. Many of these variants were corroborated by Sanger sequencing. Overall, 98.8% coverage of the GNAI3 gene was obtained by the HaloPlex amplicons. Of all variants, 6 non-synonymous and 3 synonymous were in exons, 41 in a non-coding exon embedded in the 3' untranslated region (UTR, 6 in the 5' UTR, and 462 in introns. These variants included novel SNVs, insertions, deletions, and a frameshift mutation. All were found in at least one patient but none in control samples. Using computational methods, we modeled the GNAI3 protein and its non-synonymous exonic mutations and determined that several of these may be the cause of disease in the patients studied. Thus, we have identified GNAI3 as a second gene possibly responsible for X-linked ocular albinism.

Preconception Screening for Gene Polymorphisms Associated with Thrombophilia and Hyperhomocysteinemia Risk in Healthy Young Women

Directory of Open Access Journals (Sweden)

Elena Yu. Glotova

2013-09-01

Full Text Available The frequency characteristics of the gene polymorphisms (FVL G1691A, FII G20210A, MTHFR C677T, MTHFR A1298C, MTRR A66G associated with thrombophilia, hyperhomocysteinemia risk and different perinatal or pregnancy complications were studied. This examination was conducted among 130 planned-pregnancy healthy young women aged between 19 and 29 years. A gene mutation analysis was performed using a real-time polymerase chain reaction (real-time PCR. Factor V Leiden (FVL G1691A and prothrombin gene (FII G20210A mutations were not identified in the women surveyed. The frequency of the occurrence of the heterozygous FVL 1691G/A genotype associated with the risk of thrombosis during pregnancy was very low in these women (0.8%. The frequency of the MTHFR (methylenetetrahydrofolate reductase 1298C/С mutant genotype was 11.5%, MTHFR 677T/Т – 5.4%, and MTRR (methionine synthase reductase 66G/G – 31.5%. A combination of the MTHFR 677TT/1298CC and MTHFR 677TТ/MTRR 66GG mutant genotypes, which significantly increased the risk of pregnancy loss and neural tube defects, were found to occur in 0.8% of the cases.We concluded that selective thrombophilia screening (FVL G1691A and FII G20210A based on prior personal and/or family history of venous thromboembolism was more cost-effective than a universal preconception screening in all planning pregnancy women. However, in order to decrease the risk of congenital anomalies and pregnancy complications associated with folate dependent homocysteine metabolism, preconception care should include folate supplementation

Paternal irradiation perturbs the expression of circadian genes in offspring

Energy Technology Data Exchange (ETDEWEB)

Gomes, Andre M.G.F.; Barber, Ruth C.; Dubrova, Yuri E., E-mail: yed2@le.ac.uk

2015-05-15

Highlights: • We have analysed gene expression in the offspring of irradiated male mice. • CBA/Ca and BALB/c male mice were used in our study. • The pattern of gene expression was established in four tissues. • Expression of genes in involved in rhythmic process/circadian rhythm is compromised. • Our data may explain the phenomenon of transgenerational genomic instability. - Abstract: The circadian system represents a complex network which influences the timing of many biological processes. Recent studies have established that circadian alterations play an important role in the susceptibility to many human diseases, including cancer. Here we report that paternal irradiation in mice significantly affects the expression of genes involved in rhythmic processes in their first-generation offspring. Using microarrays, the patterns of gene expression were established for brain, kidney, liver and spleen samples from the non-exposed offspring of irradiated CBA/Ca and BALB/c male mice. The most over-represented categories among the genes differentially expressed in the offspring of control and irradiated males were those involved in rhythmic process, circadian rhythm and DNA-dependent regulation of transcription. The results of our study therefore provide a plausible explanation for the transgenerational effects of paternal irradiation, including increased transgenerational carcinogenesis described in other studies.

Paternal irradiation perturbs the expression of circadian genes in offspring

International Nuclear Information System (INIS)

Gomes, Andre M.G.F.; Barber, Ruth C.; Dubrova, Yuri E.

2015-01-01

Highlights: • We have analysed gene expression in the offspring of irradiated male mice. • CBA/Ca and BALB/c male mice were used in our study. • The pattern of gene expression was established in four tissues. • Expression of genes in involved in rhythmic process/circadian rhythm is compromised. • Our data may explain the phenomenon of transgenerational genomic instability. - Abstract: The circadian system represents a complex network which influences the timing of many biological processes. Recent studies have established that circadian alterations play an important role in the susceptibility to many human diseases, including cancer. Here we report that paternal irradiation in mice significantly affects the expression of genes involved in rhythmic processes in their first-generation offspring. Using microarrays, the patterns of gene expression were established for brain, kidney, liver and spleen samples from the non-exposed offspring of irradiated CBA/Ca and BALB/c male mice. The most over-represented categories among the genes differentially expressed in the offspring of control and irradiated males were those involved in rhythmic process, circadian rhythm and DNA-dependent regulation of transcription. The results of our study therefore provide a plausible explanation for the transgenerational effects of paternal irradiation, including increased transgenerational carcinogenesis described in other studies

Discovering cancer vulnerabilities using high-throughput micro-RNA screening.

Science.gov (United States)

Nikolic, Iva; Elsworth, Benjamin; Dodson, Eoin; Wu, Sunny Z; Gould, Cathryn M; Mestdagh, Pieter; Marshall, Glenn M; Horvath, Lisa G; Simpson, Kaylene J; Swarbrick, Alexander

2017-12-15

Micro-RNAs (miRNAs) are potent regulators of gene expression and cellular phenotype. Each miRNA has the potential to target hundreds of transcripts within the cell thus controlling fundamental cellular processes such as survival and proliferation. Here, we exploit this important feature of miRNA networks to discover vulnerabilities in cancer phenotype, and map miRNA-target relationships across different cancer types. More specifically, we report the results of a functional genomics screen of 1280 miRNA mimics and inhibitors in eight cancer cell lines, and its presentation in a sophisticated interactive data portal. This resource represents the most comprehensive survey of miRNA function in oncology, incorporating breast cancer, prostate cancer and neuroblastoma. A user-friendly web portal couples this experimental data with multiple tools for miRNA target prediction, pathway enrichment analysis and visualization. In addition, the database integrates publicly available gene expression and perturbation data enabling tailored and context-specific analysis of miRNA function in a particular disease. As a proof-of-principle, we use the database and its innovative features to uncover novel determinants of the neuroblastoma malignant phenotype. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

A negative screen for mutations in calstabin 1 and 2 genes in patients with dilated cardiomyopathy

Directory of Open Access Journals (Sweden)

Biagi Diogo G

2012-01-01

Full Text Available Abstract Background Calstabins 1 and 2 bind to Ryanodine receptors regulating muscle excitation-contraction coupling. Mutations in Ryanodine receptors affecting their interaction with calstabins lead to different cardiac pathologies. Animal studies suggest the involvement of calstabins with dilated cardiomyopathy. Results We tested the hypothesis that calstabins mutations may cause dilated cardiomyopathy in humans screening 186 patients with idiopathic dilated cardiomyopathy for genetic alterations in calstabins 1 and 2 genes (FKBP12 and FKBP12.6. No missense variant was found. Five no-coding variations were found but not related to the disease. Conclusions These data corroborate other studies suggesting that mutations in FKBP12 and FKBP12.6 genes are not commonly related to cardiac diseases.

Stationary axially symmetric perturbations of a rotating black hole. [Space-time perturbation, Newman-Penrose formalism

Energy Technology Data Exchange (ETDEWEB)

Demianski, M [California Inst. of Tech., Pasadena (USA)

1976-07-01

A stationary axially symmetric perturbation of a rotating black hole due to a distribution of test matter is investigated. The Newman-Penrose spin coefficient formalism is used to derive a general set of equations describing the perturbed space-time. In a linear approximation it is shown that the mass and angular momentum of a rotating black hole is not affected by the perturbation. The metric perturbations near the horizon are given. It is concluded that given a perturbing test fluid distribution, one can always find a corresponding metric perturbation such that the mass and angular momentum of the black hole are not changed. It was also noticed that when a tends to M, those perturbed spin coefficients and components of the Weyl tensor which determine the intrinsic properties of the incoming null cone near the horizon grow indefinitely.

Digital Gene Expression Analysis to Screen Disease Resistance-Relevant Genes from Leaves of Herbaceous Peony (Paeonia lactiflora Pall. Infected by Botrytis cinerea.

Directory of Open Access Journals (Sweden)

Saijie Gong

Full Text Available Herbaceous peony (Paeonia lactiflora Pall. is a well-known traditional flower in China and is widely used for landscaping and garden greening due to its high ornamental value. However, disease spots usually appear after the flowering of the plant and may result in the withering of the plant in severe cases. This study examined the disease incidence in an herbaceous peony field in the Yangzhou region, Jiangsu Province. Based on morphological characteristics and molecular data, the disease in this area was identified as a gray mold caused by Botrytis cinerea. Based on previously obtained transcriptome data, eight libraries generated from two herbaceous peony cultivars 'Zifengyu' and 'Dafugui' with different susceptibilities to the disease were then analyzed using digital gene expression profiling (DGE. Thousands of differentially expressed genes (DEGs were screened by comparing the eight samples, and these genes were annotated using the Gene ontology (GO and Kyoto encyclopedia of genes and genomes (KEGG database. The pathways related to plant-pathogen interaction, secondary metabolism synthesis and antioxidant system were concentrated, and 51, 76, and 13 disease resistance-relevant candidate genes were identified, respectively. The expression patterns of these candidate genes differed between the two cultivars: their expression of the disease-resistant cultivar 'Zifengyu' sharply increased during the early stages of infection, while it was relatively subdued in the disease-sensitive cultivar 'Dafugui'. A selection of ten candidate genes was evaluated by quantitative real-time PCR (qRT-PCR to validate the DGE data. These results revealed the transcriptional changes that took place during the interaction of herbaceous peony with B. cinerea, providing insight into the molecular mechanisms of host resistance to gray mold.

Microsatellite-Aided Screening for Fertility Restoration Genes (Rf Facilitates Hybrid Improvement

Directory of Open Access Journals (Sweden)

Raafat El-Namaky

2016-05-01

Full Text Available DNA markers enabled to determine the chromosomal locations of the two Rf genes (Rf3 and Rf4 in the wild-abortive cytoplasmic male sterility (WA-CMS system. Four simple sequence repeats (SSRs RM171, RM258, RM315 and RM443 were used to detect the allelic status with respect to the fertility restoration genes (Rf3 and Rf4 in 300 rice cultivars or breeding lines. The results revealed that out of 300 lines, 90 lines screened had Rf3, 65 lines had Rf4, and 45 lines had Rf3 and Rf4 alleles. Furthermore, 45 lines selected using SSR markers were mated with a CMS line (IR58025A to analyze their restoring ability. Offspring of all the test lines except HHZ8-SAL9DT1-Y1, HHZ5-SAL9-Y3-1 and IDSA77 exhibited higher pollen and spikelet fertility (> 80%, thus confirming they bear the Rf alleles. The hybrid offspring of ARH12-6-1-1-B-3-1, IR32307-10-3-2-1 and Sahel 329 had the highest pollen fertility (97.39%, 98.30% and 97.10%, respectively and spikelet fertility (95.10%, 97.07% and 96.10%, respectively.

Screening the Drug Sensitivity Genes Related to GEM and CDDP in the Lung Cancer Cell-lines

Directory of Open Access Journals (Sweden)

Chunyu YANG

2009-10-01

Full Text Available Background and objective Screening of small-cell lung cancer (SCLC and non-small cell lung cancer (NSCLC cell lines with gemcitabine hydrochloride (GEM and cisplatin (CDDP related to drug sensitivity gene might clarify the action mechanism of anti-cancer drugs and provide a new clue for overcoming drug resistance and the development of new anti-cancer drugs, and also provide theoretical basis for the clinical treatment of individual. Methods The drug sensitivity of CDDP and GEM in 4 SCLC cell lines and 6 NSCLC cell lines was determined using MTT colorimetric assay, while the cDNA macroarray was applied to detect the gene expression state related to drug sensitivity of 10 lung cancer cell line in 1 291, and the correlation between the two was analysized. Results There were 6 genes showing significant positive correlation (r≥0.632, P < 0.05 with GEM sensitivity; 45 genes positively related to CDDP; another 41 genes related to both GEM and CDDP (r≥± 0.4. Lung cancer with GEM and CDDP sensitivity of two types of drugs significantly related genes were Metallothinein (Signal transduction molecules, Cathepsin B (Organization protease B and TIMP1 (Growth factor; the GEM, CDDP sensitivity associated genes of lung cancer cell lines mainly distributed in Metallothinein, Cathepsin B, growth factor TIMP1 categories. Conclusion There existed drug-related sensitive genes of GEM, CDDP in SCLC and NSCLC cell lines; of these genes, Metallothinein, Cathepsin B and TIMP1 genes presented a significant positive correlation with GEM drug sensitivity, a significant negative correlation with CDDP drug sensitivity.

Functional Genomic Screening Reveals Core Modulators of Echinocandin Stress Responses in Candida albicans

Directory of Open Access Journals (Sweden)

Tavia Caplan

2018-05-01

Full Text Available Summary: Candida albicans is a leading cause of death due to fungal infection. Treatment of systemic candidiasis often relies on echinocandins, which disrupt cell wall synthesis. Resistance is readily acquired via mutations in the drug target gene, FKS1. Both basal tolerance and resistance to echinocandins require cellular stress responses. We performed a systematic analysis of 3,030 C. albicans mutants to define circuitry governing cellular responses to echinocandins. We identified 16 genes for which deletion or transcriptional repression enhanced echinocandin susceptibility, including components of the Pkc1-MAPK signaling cascade. We discovered that the molecular chaperone Hsp90 is required for the stability of Pkc1 and Bck1, establishing key mechanisms through which Hsp90 mediates echinocandin resistance. We also discovered that perturbation of the CCT chaperonin complex causes enhanced echinocandin sensitivity, altered cell wall architecture, and aberrant septin localization. Thus, we provide insights into the mechanisms by which cellular chaperones enable crucial responses to echinocandin-induced stress. : Caplan et al. screen 3,030 Candida albicans mutants to define circuitry governing cellular responses to echinocandins, the first-line therapy for systemic candidiasis. They reveal that the molecular chaperone Hsp90 is required for stability of Pkc1 and Bck1 and that the CCT chaperonin complex is a key modulator of echinocandin susceptibility. Keywords: fungal pathogen, Candida albicans, echinocandins, Hsp90, Pkc1, CCT complex, client protein, stress response, functional genomic screen, drug resistance

A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.

Science.gov (United States)

Parsons, Linda M; Grzeschik, Nicola A; Amaratunga, Kasun; Burke, Peter; Quinn, Leonie M; Richardson, Helena E

2017-08-07

In both Drosophila melanogaster and mammalian systems, epithelial structure and underlying cell polarity are essential for proper tissue morphogenesis and organ growth. Cell polarity interfaces with multiple cellular processes that are regulated by the phosphorylation status of large protein networks. To gain insight into the molecular mechanisms that coordinate cell polarity with tissue growth, we screened a boutique collection of RNAi stocks targeting the kinome for their capacity to modify Drosophila "cell polarity" eye and wing phenotypes. Initially, we identified kinase or phosphatase genes whose depletion modified adult eye phenotypes associated with the manipulation of cell polarity complexes (via overexpression of Crb or aPKC). We next conducted a secondary screen to test whether these cell polarity modifiers altered tissue overgrowth associated with depletion of Lgl in the wing. These screens identified Hippo, Jun kinase (JNK), and Notch signaling pathways, previously linked to cell polarity regulation of tissue growth. Furthermore, novel pathways not previously connected to cell polarity regulation of tissue growth were identified, including Wingless (Wg/Wnt), Ras, and lipid/Phospho-inositol-3-kinase (PI3K) signaling pathways. Additionally, we demonstrated that the "nutrient sensing" kinases Salt Inducible Kinase 2 and 3 ( SIK2 and 3 ) are potent modifiers of cell polarity phenotypes and regulators of tissue growth. Overall, our screen has revealed novel cell polarity-interacting kinases and phosphatases that affect tissue growth, providing a platform for investigating molecular mechanisms coordinating cell polarity and tissue growth during development. Copyright © 2017 Parsons et al.

Path from schizophrenia genomics to biology: gene regulation and perturbation in neurons derived from induced pluripotent stem cells and genome editing.

Science.gov (United States)

Duan, Jubao

2015-02-01

Schizophrenia (SZ) is a devastating mental disorder afflicting 1% of the population. Recent genome-wide association studies (GWASs) of SZ have identified >100 risk loci. However, the causal variants/genes and the causal mechanisms remain largely unknown, which hinders the translation of GWAS findings into disease biology and drug targets. Most risk variants are noncoding, thus likely regulate gene expression. A major mechanism of transcriptional regulation is chromatin remodeling, and open chromatin is a versatile predictor of regulatory sequences. MicroRNA-mediated post-transcriptional regulation plays an important role in SZ pathogenesis. Neurons differentiated from patient-specific induced pluripotent stem cells (iPSCs) provide an experimental model to characterize the genetic perturbation of regulatory variants that are often specific to cell type and/or developmental stage. The emerging genome-editing technology enables the creation of isogenic iPSCs and neurons to efficiently characterize the effects of SZ-associated regulatory variants on SZ-relevant molecular and cellular phenotypes involving dopaminergic, glutamatergic, and GABAergic neurotransmissions. SZ GWAS findings equipped with the emerging functional genomics approaches provide an unprecedented opportunity for understanding new disease biology and identifying novel drug targets.

Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

DEFF Research Database (Denmark)

Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

2005-01-01

Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

Hydrogen atom with a Yukawa potential: Perturbation theory and continued-fractions--Pade approximants at large order

International Nuclear Information System (INIS)

Vrscay, E.R.

1986-01-01

A simple power-series method is developed to calculate to large order the Rayleigh-Schroedinger perturbation expansions for energy levels of a hydrogen atom with a Yukawa-type screened Coulomb potential. Perturbation series for the 1s, 2s, and 2p levels, shown not to be of the Stieltjes type, are calculated to 100th order. Nevertheless, the poles of the Pade approximants to these series generally avoid the region of the positive real axis 0 < lambda < lambda(, where lambda( represents the coupling constant threshold. As a result, the Pade sums afford accurate approximations to E(lambda) in this domain. The continued-fraction representations to these perturbation series have been accurately calculated to large (100th) order and demonstrate a curious ''quasioscillatory,'' but non-Stieltjes, behavior. Accurate values of E(lambda) as well as lambda( for the 1s, 2s, and 2p levels are reported

New genes tied to endocrine, metabolic, and dietary regulation of lifespan from a Caenorhabditis elegans genomic RNAi screen.

Directory of Open Access Journals (Sweden)

Malene Hansen

2005-07-01

Full Text Available Most of our knowledge about the regulation of aging comes from mutants originally isolated for other phenotypes. To ask whether our current view of aging has been affected by selection bias, and to deepen our understanding of known longevity pathways, we screened a genomic Caenorhabditis elegans RNAi library for clones that extend lifespan. We identified 23 new longevity genes affecting signal transduction, the stress response, gene expression, and metabolism and assigned these genes to specific longevity pathways. Our most important findings are (i that dietary restriction extends C. elegans' lifespan by down-regulating expression of key genes, including a gene required for methylation of many macromolecules, (ii that integrin signaling is likely to play a general, evolutionarily conserved role in lifespan regulation, and (iii that specific lipophilic hormones may influence lifespan in a DAF-16/FOXO-dependent fashion. Surprisingly, of the new genes that have conserved sequence domains, only one could not be associated with a known longevity pathway. Thus, our current view of the genetics of aging has probably not been distorted substantially by selection bias.

New Genes Tied to Endocrine, Metabolic, and Dietary Regulation of Lifespan from a Caenorhabditis elegans Genomic RNAi Screen.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Most of our knowledge about the regulation of aging comes from mutants originally isolated for other phenotypes. To ask whether our current view of aging has been affected by selection bias, and to deepen our understanding of known longevity pathways, we screened a genomic Caenorhabditis elegans RNAi library for clones that extend lifespan. We identified 23 new longevity genes affecting signal transduction, the stress response, gene expression, and metabolism and assigned these genes to specific longevity pathways. Our most important findings are (i that dietary restriction extends C. elegans' lifespan by down-regulating expression of key genes, including a gene required for methylation of many macromolecules, (ii that integrin signaling is likely to play a general, evolutionarily conserved role in lifespan regulation, and (iii that specific lipophilic hormones may influence lifespan in a DAF-16/FOXO-dependent fashion. Surprisingly, of the new genes that have conserved sequence domains, only one could not be associated with a known longevity pathway. Thus, our current view of the genetics of aging has probably not been distorted substantially by selection bias.

Genome-wide screen in Saccharomyces cerevisiae identifies vacuolar protein sorting, autophagy, biosynthetic, and tRNA methylation genes involved in life span regulation.

Directory of Open Access Journals (Sweden)

Paola Fabrizio

2010-07-01

Full Text Available The study of the chronological life span of Saccharomyces cerevisiae, which measures the survival of populations of non-dividing yeast, has resulted in the identification of homologous genes and pathways that promote aging in organisms ranging from yeast to mammals. Using a competitive genome-wide approach, we performed a screen of a complete set of approximately 4,800 viable deletion mutants to identify genes that either increase or decrease chronological life span. Half of the putative short-/long-lived mutants retested from the primary screen were confirmed, demonstrating the utility of our approach. Deletion of genes involved in vacuolar protein sorting, autophagy, and mitochondrial function shortened life span, confirming that respiration and degradation processes are essential for long-term survival. Among the genes whose deletion significantly extended life span are ACB1, CKA2, and TRM9, implicated in fatty acid transport and biosynthesis, cell signaling, and tRNA methylation, respectively. Deletion of these genes conferred heat-shock resistance, supporting the link between life span extension and cellular protection observed in several model organisms. The high degree of conservation of these novel yeast longevity determinants in other species raises the possibility that their role in senescence might be conserved.

Reference Gene Screening for Analyzing Gene Expression Across Goat Tissue

Directory of Open Access Journals (Sweden)

Yu Zhang

2013-12-01

Full Text Available Real-time quantitative PCR (qRT-PCR is one of the important methods for investigating the changes in mRNA expression levels in cells and tissues. Selection of the proper reference genes is very important when calibrating the results of real-time quantitative PCR. Studies on the selection of reference genes in goat tissues are limited, despite the economic importance of their meat and dairy products. We used real-time quantitative PCR to detect the expression levels of eight reference gene candidates (18S, TBP, HMBS, YWHAZ, ACTB, HPRT1, GAPDH and EEF1A2 in ten tissues types sourced from Boer goats. The optimal reference gene combination was selected according to the results determined by geNorm, NormFinder and Bestkeeper software packages. The analyses showed that tissue is an important variability factor in genes expression stability. When all tissues were considered, 18S, TBP and HMBS is the optimal reference combination for calibrating quantitative PCR analysis of gene expression from goat tissues. Dividing data set by tissues, ACTB was the most stable in stomach, small intestine and ovary, 18S in heart and spleen, HMBS in uterus and lung, TBP in liver, HPRT1 in kidney and GAPDH in muscle. Overall, this study provided valuable information about the goat reference genes that can be used in order to perform a proper normalisation when relative quantification by qRT-PCR studies is undertaken.

Children’s Hospital of Pittsburgh and Diabetes Institute of the Walter Reed Health Care System Genetic Screening in Diabetes: Candidate Gene Analysis for Diabetic Retinopathy

Science.gov (United States)

2010-05-01

Screening in Diabetes : Candidate Gene Analysis for Diabetic Retinopathy PRINCIPAL INVESTIGATOR: Robert A. Vigersky, COL MC CONTRACTING ORGANIZATION... Diabetes Institute of the Walter Reed Health Care System Genetic Screening in Diabetes : Candidate Gene Analysis for Diabetic Retinopathy 5c. PROGRAM... diabetic  neuropathy, and  diabetic   retinopathy .  This was an observational study in which the investigators obtained DNA samples from the blood of

Mutation screening of the TP53 gene by temporal temperature gradient gel electrophoresis.

Science.gov (United States)

Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise

2005-01-01

A protocol for detection of mutations in the TP53 gene using temporal temperature gradient gel electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques denaturing gradient gel electrophoresis (DGGE) and constant denaturant gel electrophoresis (CDGE) and eliminates some of the problems. The result is a rapid and sensitive screening technique that is robust and easily set up in smaller laboratory environments.

Mutation screening of the TP53 gene by temporal temperature gel electrophoresis (TTGE).

Science.gov (United States)

Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise

2014-01-01

A protocol for detection of mutations in the TP53 gene using temporal temperature gradient electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques, denaturing gradient gel electrophoresis and constant denaturant gel electrophoresis, and eliminates some of the problems. The result is a rapid and sensitive screening technique which is robust and easily set up in smaller laboratory environments.

Perturbative and constructive renormalization

International Nuclear Information System (INIS)

Veiga, P.A. Faria da

2000-01-01

These notes are a survey of the material treated in a series of lectures delivered at the X Summer School Jorge Andre Swieca. They are concerned with renormalization in Quantum Field Theories. At the level of perturbation series, we review classical results as Feynman graphs, ultraviolet and infrared divergences of Feynman integrals. Weinberg's theorem and Hepp's theorem, the renormalization group and the Callan-Symanzik equation, the large order behavior and the divergence of most perturbation series. Out of the perturbative regime, as an example of a constructive method, we review Borel summability and point out how it is possible to circumvent the perturbation diseases. These lectures are a preparation for the joint course given by professor V. Rivasseau at the same school, where more sophisticated non-perturbative analytical methods based on rigorous renormalization group techniques are presented, aiming at furthering our understanding about the subject and bringing field theoretical models to a satisfactory mathematical level. (author)

Combined mutation and rearrangement screening by quantitative PCR high-resolution melting: is it relevant for hereditary recurrent Fever genes?

Directory of Open Access Journals (Sweden)

Nathalie Pallares-Ruiz

2010-11-01

Full Text Available The recent identification of genes implicated in hereditary recurrent fevers has allowed their specific diagnosis. So far however, only punctual mutations have been identified and a significant number of patients remain with no genetic confirmation of their disease after routine molecular approaches such as sequencing. The possible involvement of sequence rearrangements in these patients has only been examined in familial Mediterranean fever and was found to be unlikely. To assess the existence of larger genetic alterations in 3 other concerned genes, MVK (Mevalonate kinase, NLRP3 (Nod like receptor family, pyrin domain containing 3 and TNFRSF1A (TNF receptor superfamily 1A, we adapted the qPCR-HRM method to study possible intragenic deletions and duplications. This single-tube approach, combining both qualitative (mutations and quantitative (rearrangement screening, has proven effective in Lynch syndrome diagnosis. Using this approach, we studied 113 unselected (prospective group and 88 selected (retrospective group patients and identified no intragenic rearrangements in the 3 genes. Only qualitative alterations were found with a sensitivity similar to that obtained using classical molecular techniques for screening punctual mutations. Our results support that deleterious copy number alterations in MVK, NLRP3 and TNFRSF1A are rare or absent from the mutational spectrum of hereditary recurrent fevers, and demonstrate that a routine combined method such as qPCR-HRM provides no further help in genetic diagnosis. However, quantitative approaches such as qPCR or SQF-PCR did prove to be quick and effective and could still be useful after non contributory punctual mutation screening in the presence of clinically evocative signs.

A comparative genomics screen identifies a Sinorhizobium meliloti 1021 sodM-like gene strongly expressed within host plant nodules

Directory of Open Access Journals (Sweden)

Queiroux Clothilde

2012-05-01

Full Text Available Abstract Background We have used the genomic data in the Integrated Microbial Genomes system of the Department of Energy’s Joint Genome Institute to make predictions about rhizobial open reading frames that play a role in nodulation of host plants. The genomic data was screened by searching for ORFs conserved in α-proteobacterial rhizobia, but not conserved in closely-related non-nitrogen-fixing α-proteobacteria. Results Using this approach, we identified many genes known to be involved in nodulation or nitrogen fixation, as well as several new candidate genes. We knocked out selected new genes and assayed for the presence of nodulation phenotypes and/or nodule-specific expression. One of these genes, SMc00911, is strongly expressed by bacterial cells within host plant nodules, but is expressed minimally by free-living bacterial cells. A strain carrying an insertion mutation in SMc00911 is not defective in the symbiosis with host plants, but in contrast to expectations, this mutant strain is able to out-compete the S. meliloti 1021 wild type strain for nodule occupancy in co-inoculation experiments. The SMc00911 ORF is predicted to encode a “SodM-like” (superoxide dismutase-like protein containing a rhodanese sulfurtransferase domain at the N-terminus and a chromate-resistance superfamily domain at the C-terminus. Several other ORFs (SMb20360, SMc01562, SMc01266, SMc03964, and the SMc01424-22 operon identified in the screen are expressed at a moderate level by bacteria within nodules, but not by free-living bacteria. Conclusions Based on the analysis of ORFs identified in this study, we conclude that this comparative genomics approach can identify rhizobial genes involved in the nitrogen-fixing symbiosis with host plants, although none of the newly identified genes were found to be essential for this process.

SPINE: SParse eIgengene NEtwork linking gene expression clusters in Dehalococcoides mccartyi to perturbations in experimental conditions.

Directory of Open Access Journals (Sweden)

Cresten B Mansfeldt

Full Text Available We present a statistical model designed to identify the effect of experimental perturbations on the aggregate behavior of the transcriptome expressed by the bacterium Dehalococcoides mccartyi strain 195. Strains of Dehalococcoides are used in sub-surface bioremediation applications because they organohalorespire tetrachloroethene and trichloroethene (common chlorinated solvents that contaminate the environment to non-toxic ethene. However, the biochemical mechanism of this process remains incompletely described. Additionally, the response of Dehalococcoides to stress-inducing conditions that may be encountered at field-sites is not well understood. The constructed statistical model captured the aggregate behavior of gene expression phenotypes by modeling the distinct eigengenes of 100 transcript clusters, determining stable relationships among these clusters of gene transcripts with a sparse network-inference algorithm, and directly modeling the effect of changes in experimental conditions by constructing networks conditioned on the experimental state. Based on the model predictions, we discovered new response mechanisms for DMC, notably when the bacterium is exposed to solvent toxicity. The network identified a cluster containing thirteen gene transcripts directly connected to the solvent toxicity condition. Transcripts in this cluster include an iron-dependent regulator (DET0096-97 and a methylglyoxal synthase (DET0137. To validate these predictions, additional experiments were performed. Continuously fed cultures were exposed to saturating levels of tetrachloethene, thereby causing solvent toxicity, and transcripts that were predicted to be linked to solvent toxicity were monitored by quantitative reverse-transcription polymerase chain reaction. Twelve hours after being shocked with saturating levels of tetrachloroethene, the control transcripts (encoding for a key hydrogenase and the 16S rRNA did not significantly change. By contrast

Genetic dissection of mammalian ERAD through comparative haploid and CRISPR forward genetic screens

DEFF Research Database (Denmark)

Timms, Richard T.; Menzies, Sam A.; Tchasovnikarova, Iva A.

2016-01-01

The application of forward genetic screens to cultured human cells represents a powerful method to study gene function. The repurposing of the bacterial CRISPR/Cas9 system provides an effective method to disrupt gene function in mammalian cells, and has been applied to genome-wide screens. Here, we...... compare the efficacy of genome-wide CRISPR/Cas9-mediated forward genetic screens versus gene-trap mutagenesis screens in haploid human cells, which represent the existing ‘gold standard’ method. This head-to-head comparison aimed to identify genes required for the endoplasmic reticulum....../3-associated disulphide reductase. Genome-wide CRISPR/Cas9-mediated screens together with haploid genetic screens provide a powerful addition to the forward genetic toolbox....

Identifying genes that extend life span using a high-throughput screening system.

Science.gov (United States)

Chen, Cuiying; Contreras, Roland

2007-01-01

We developed a high-throughput functional genomic screening system that allows identification of genes prolonging lifespan in the baker's yeast Saccharomyces cerevisiae. The method is based on isolating yeast mother cells with a higher than average number of cell divisions as indicated by the number of bud scars on their surface. Fluorescently labeled wheat germ agglutinin (WGA) was used for specific staining of chitin, a major component of bud scars. The critical new steps in our bud-scar-sorting system are the use of small microbeads, which allows successive rounds of purification and regrowth of the mother cells (M-cell), and utilization of flow cytometry to sort and isolate cells with a longer lifespan based on the number of bud scars specifically labeled with WGA.

A Simplified Method for Gene Knockout and Direct Screening of Recombinant Clones for Application in Paenibacillus polymyxa.

Directory of Open Access Journals (Sweden)

Seong-Bin Kim

Full Text Available Paenibacillus polymyxa is a bacterium widely used in agriculture, industry, and environmental remediation because it has multiple functions including nitrogen fixation and produces various biologically active compounds. Among these compounds are the antibiotics polymyxins, and the bacterium is currently being reassessed for medical application. However, a lack of genetic tools for manipulation of P. polymyxa has limited our understanding of the biosynthesis of these compounds.To facilitate an understanding of the genetic determinants of the bacterium, we have developed a system for marker exchange mutagenesis directly on competent cells of P. polymyxa under conditions where homologous recombination is enhanced by denaturation of the suicide plasmid DNA. To test this system, we targeted P. polymyxa α-and β-amylase genes for disruption. Chloramphenicol or erythromycin resistance genes were inserted into the suicide plasmid pGEM7Z-f+ (Promega. To mediate homologous recombination and replacement of the targeted genes with the antibiotic resistance genes nucleotide sequences of the α-and β-amylase genes were cloned into the plasmid flanking the antibiotic resistance genes.We have created a simple system for targeted gene deletion in P. polymyxa E681. We propose that P. polymyxa isogenic mutants could be developed using this system of marker exchange mutagenesis. α-and β-amylase genes provide a useful tool for direct recombinant screening in P. polymyxa.

New Methods in Non-Perturbative QCD

Energy Technology Data Exchange (ETDEWEB)

Unsal, Mithat [North Carolina State Univ., Raleigh, NC (United States)

2017-01-31

In this work, we investigate the properties of quantum chromodynamics (QCD), by using newly developing mathematics and physics formalisms. Almost all of the mass in the visible universe emerges from a quantum chromodynamics (QCD), which has a completely negligible microscopic mass content. An intimately related issue in QCD is the quark confinement problem. Answers to non-perturbative questions in QCD remained largely elusive despite much effort over the years. It is also believed that the usual perturbation theory is inadequate to address these kinds of problems. Perturbation theory gives a divergent asymptotic series (even when the theory is properly renormalized), and there are non-perturbative phenomena which never appear at any order in perturbation theory. Recently, a fascinating bridge between perturbation theory and non-perturbative effects has been found: a formalism called resurgence theory in mathematics tells us that perturbative data and non-perturbative data are intimately related. Translating this to the language of quantum field theory, it turns out that non-perturbative information is present in a coded form in perturbation theory and it can be decoded. We take advantage of this feature, which is particularly useful to understand some unresolved mysteries of QCD from first principles. In particular, we use: a) Circle compactifications which provide a semi-classical window to study confinement and mass gap problems, and calculable prototypes of the deconfinement phase transition; b) Resurgence theory and transseries which provide a unified framework for perturbative and non-perturbative expansion; c) Analytic continuation of path integrals and Lefschetz thimbles which may be useful to address sign problem in QCD at finite density.

Cosmological perturbation theory and quantum gravity

Energy Technology Data Exchange (ETDEWEB)

Brunetti, Romeo [Dipartimento di Matematica, Università di Trento,Via Sommarive 14, 38123 Povo TN (Italy); Fredenhagen, Klaus [II Institute für Theoretische Physik, Universität Hamburg,Luruper Chaussee 149, 22761 Hamburg (Germany); Hack, Thomas-Paul [Institute für Theoretische Physik, Universität Leipzig,Brüderstr. 16, 04103 Leipzig (Germany); Pinamonti, Nicola [Dipartimento di Matematica, Università di Genova,Via Dodecaneso 35, 16146 Genova (Italy); INFN, Sezione di Genova,Via Dodecaneso 33, 16146 Genova (Italy); Rejzner, Katarzyna [Department of Mathematics, University of York,Heslington, York YO10 5DD (United Kingdom)

2016-08-04

It is shown how cosmological perturbation theory arises from a fully quantized perturbative theory of quantum gravity. Central for the derivation is a non-perturbative concept of gauge-invariant local observables by means of which perturbative invariant expressions of arbitrary order are generated. In particular, in the linearised theory, first order gauge-invariant observables familiar from cosmological perturbation theory are recovered. Explicit expressions of second order quantities are presented as well.

Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

Directory of Open Access Journals (Sweden)

Jorge S.B.

2003-01-01

Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

Miniature short hairpin RNA screens to characterize antiproliferative drugs.

Science.gov (United States)

Kittanakom, Saranya; Arnoldo, Anthony; Brown, Kevin R; Wallace, Iain; Kunavisarut, Tada; Torti, Dax; Heisler, Lawrence E; Surendra, Anuradha; Moffat, Jason; Giaever, Guri; Nislow, Corey

2013-08-07

The application of new proteomics and genomics technologies support a view in which few drugs act solely by inhibiting a single cellular target. Indeed, drug activity is modulated by complex, often incompletely understood cellular mechanisms. Therefore, efforts to decipher mode of action through genetic perturbation such as RNAi typically yields "hits" that fall into several categories. Of particular interest to the present study, we aimed to characterize secondary activities of drugs on cells. Inhibiting a known target can result in clinically relevant synthetic phenotypes. In one scenario, drug perturbation could, for example, improperly activate a protein that normally inhibits a particular kinase. In other cases, additional, lower affinity targets can be inhibited as in the example of inhibition of c-Kit observed in Bcr-Abl-positive cells treated with Gleevec. Drug transport and metabolism also play an important role in the way any chemicals act within the cells. Finally, RNAi per se can also affect cell fitness by more general off-target effects, e.g., via the modulation of apoptosis or DNA damage repair. Regardless of the root cause of these unwanted effects, understanding the scope of a drug's activity and polypharmacology is essential for better understanding its mechanism(s) of action, and such information can guide development of improved therapies. We describe a rapid, cost-effective approach to characterize primary and secondary effects of small-molecules by using small-scale libraries of virally integrated short hairpin RNAs. We demonstrate this principle using a "minipool" composed of shRNAs that target the genes encoding the reported protein targets of approved drugs. Among the 28 known reported drug-target pairs, we successfully identify 40% of the targets described in the literature and uncover several unanticipated drug-target interactions based on drug-induced synthetic lethality. We provide a detailed protocol for performing such screens and for

Tiered High-Throughput Screening Approach to Identify Thyroperoxidase Inhibitors within the ToxCast Phase I and II Chemical Libraries

Science.gov (United States)

High-throughput screening (HTS) for potential thyroid–disrupting chemicals requires a system of assays to capture multiple molecular-initiating events (MIEs) that converge on perturbed thyroid hormone (TH) homeostasis. Screening for MIEs specific to TH-disrupting pathways is limi...

Genome-wide screening and transcriptional profile analysis of desaturase genes in the European corn borer moth

Institute of Scientific and Technical Information of China (English)

Bingye Xue; Alejandro P. Rooney; Wendell L. Roelofs

2012-01-01

Acyl-coenzyme A (Acyl-CoA) desaturases play a key role in the biosynthesis of female moth sex pheromones.Desaturase genes are encoded by a large multigene family,and they have been divided into five subgroups on the basis of biochemical functionality and phylogenetic affinity.In this study both copy numbers and transcriptional levels of desaturase genes in the European corn borer (ECB),Ostrinia nubilalis,were investigated.The results from genome-wide screening of ECB bacterial artificial chromosome (BAC)library indicated there are many copies of some desaturase genes in the genome.An open reading frame (ORF) has been isolated for the novel desaturase gene ECB ezi-△11β from ECB gland complementary DNA and its functionality has been analyzed by two yeast expression systems.No functional activities have been detected for it.The expression levels of the four desaturase genes both in the pheromone gland and fat body of ECB and Asian corn borer (ACB),O.furnacalis,were determined by real-time polymerase chain reaction.In the ECB gland,△ 11 is the most abundant,although the amount of △14 is also considerable.In the ACB gland,△14 is the most abundant and is 100 times more abundant than all the other three combined.The results from the analysis of evolution of desaturase gene transcription in the ECB,ACB and other moths indicate that the pattern of △ 11 gene transcription is significantly different from the transcriptional patterns of other desaturase genes and this difference is tied to the underlying nucleotide composition bias of the genome.

Perturbations i have Known and Loved

Science.gov (United States)

Field, Robert W.

2011-06-01

A spectroscopic perturbation is a disruption of a ^1Σ-^1Σ-like regular pattern that can embody level-shifts, extra lines, and intensity anomalies. Once upon a time, when a band was labeled ``perturbed,'' it was considered worthless because it could at best yield molecular constants unsuited for archival tables. Nevertheless, a few brave spectroscopists, notably Albin Lagerqvist and Richard Barrow, collected perturbations because they knew that the pattern of multiple perturbations formed an intricate puzzle that would eventually reveal the presence and electronic symmetry of otherwise unobservable electronic states. There are many kinds of patterns of broken patterns. In my PhD thesis I showed how to determine absolute vibrational assignments for the perturber from patterns among the observed values of perturbation matrix elements. When a ^3Π state is perturbed, its six (Ω, parity) components capture a pattern of level shifts and intensity anomalies that reveals more about the nature of the perturber than a simple perturbation of the single component of a ^1Σ state. In perturbation-facilitated OODR, a perturbed singlet level acts as a spectroscopic doorway through which the entire triplet manifold may be systematically explored. For polyatomic molecule vibrations, a vibrational polyad (a group of mutually perturbing vibrational levels, among which the perturbation matrix elements are expected to follow harmonic oscillator scaling rules) can contain more components than a ^3Π state and intrapolyad patterns can be exquisitely sensitive not merely to the nature of an interloper within the polyad but also to the eigenvector character of the vibronic state from which the polyad is viewed. Variation of scaled polyad interaction parameters from one polyad to the next, a pattern of patterns, can signal proximity to an isomerization barrier. Everything in Rydberg-land seems to scale as N⋆-3, yet a trespassing valence state causes all scaling and propensity rules go

Edge localized modes control by resonant magnetic perturbations; Controle des instabilites de bord par perturbations magnetiques resonantes

Energy Technology Data Exchange (ETDEWEB)

Nardon, E

2007-10-15

The present work is dedicated to one of the most promising methods of control of the ELMs (Edge Localized Modes), based on a system of coils producing Resonant Magnetic Perturbations (RMPs). Our main objectives are, on the one hand, to improve the physical understanding of the mechanisms at play, and on the other hand to propose a concrete design of ELMs control coils for ITER. In order to calculate and analyze the magnetic perturbations produced by a given set of coils, we have developed the ERGOS code. The first ERGOS calculation was for the DIII-D ELMs control coils, the I-coils. It showed that they produce magnetic islands chains which overlap at the edge of the plasma, resulting in the ergodization of the magnetic field. We have then used ERGOS for the modelling of the experiments on ELMs control using the error field correction coils at JET and MAST. In the case of JET, we have shown the existence of a correlation between the mitigation of the ELMs and the ergodization of the magnetic field at the edge, in agreement with the DIII-D result. In order to design the ELMs control coils for ITER we have used ERGOS intensively, taking the case of the DIII-D I-coils as a reference. Three candidate designs came out, which we presented at the ITER Design Review, in 2007. Recently, the ITER management decided to provide a budget for building ELMs control coils, the design of which remains to be chosen between two of the three options that we proposed. Finally, in order to understand better the non-linear magnetohydrodynamics phenomena taking place in ELMs control by RMPs, we performed numerical simulations, in particular with the JOREK code for a DIII-D case. The simulations reveal the existence of convection cells induced at the edge by the magnetic perturbations, and the possible screening of the RMPs in presence of rotation.

One-Pot Parallel Synthesis of Lipid Library via Thiolactone Ring Opening and Screening for Gene Delivery.

Science.gov (United States)

Molla, Mijanur R; Böser, Alexander; Rana, Akshita; Schwarz, Karina; Levkin, Pavel A

2018-04-18

Efficient delivery of nucleic acids into cells is of great interest in the field of cell biology and gene therapy. Despite a lot of research, transfection efficiency and structural diversity of gene-delivery vectors are still limited. A better understanding of the structure-function relationship of gene delivery vectors is also essential for the design of novel and intelligent delivery vectors, efficient in "difficult-to-transfect" cells and in vivo clinical applications. Most of the existing strategies for the synthesis of gene-delivery vectors require multiple steps and lengthy procedures. Here, we demonstrate a facile, three-component one-pot synthesis of a combinatorial library of 288 structurally diverse lipid-like molecules termed "lipidoids" via a thiolactone ring opening reaction. This strategy introduces the possibility to synthesize lipidoids with hydrophobic tails containing both unsaturated bonds and reducible disulfide groups. The whole synthesis and purification are convenient, extremely fast, and can be accomplished within a few hours. Screening of the produced lipidoids using HEK293T cells without addition of helper lipids resulted in identification of highly stable liposomes demonstrating ∼95% transfection efficiency with low toxicity.

Dynamics of the cell-cycle network under genome-rewiring perturbations

International Nuclear Information System (INIS)

Katzir, Yair; Elhanati, Yuval; Braun, Erez; Averbukh, Inna

2013-01-01

The cell-cycle progression is regulated by a specific network enabling its ordered dynamics. Recent experiments supported by computational models have shown that a core of genes ensures this robust cycle dynamics. However, much less is known about the direct interaction of the cell-cycle regulators with genes outside of the cell-cycle network, in particular those of the metabolic system. Following our recent experimental work, we present here a model focusing on the dynamics of the cell-cycle core network under rewiring perturbations. Rewiring is achieved by placing an essential metabolic gene exclusively under the regulation of a cell-cycle's promoter, forcing the cell-cycle network to function under a multitasking challenging condition; operating in parallel the cell-cycle progression and a metabolic essential gene. Our model relies on simple rate equations that capture the dynamics of the relevant protein–DNA and protein–protein interactions, while making a clear distinction between these two different types of processes. In particular, we treat the cell-cycle transcription factors as limited ‘resources’ and focus on the redistribution of resources in the network during its dynamics. This elucidates the sensitivity of its various nodes to rewiring interactions. The basic model produces the correct cycle dynamics for a wide range of parameters. The simplicity of the model enables us to study the interface between the cell-cycle regulation and other cellular processes. Rewiring a promoter of the network to regulate a foreign gene, forces a multitasking regulatory load. The higher the load on the promoter, the longer is the cell-cycle period. Moreover, in agreement with our experimental results, the model shows that different nodes of the network exhibit variable susceptibilities to the rewiring perturbations. Our model suggests that the topology of the cell-cycle core network ensures its plasticity and flexible interface with other cellular processes

Nonabelian Debye screening and the {open_quotes}tsunami{close_quotes} problem

Energy Technology Data Exchange (ETDEWEB)

Pisarski, R.D. [Brookhaven National Lab., Upton, NY (United States)

1997-09-22

The phenomenon of Debye screening is familiar from electrolytes and many other systems. Recently, it has been recognized that in nonabelian gauge theories at high temperature, even perturbatively Debye screening is much more complicated than in nonrelativistic systems. This was originally derived as {open_quotes}hard thermal loops{close_quotes}. Hard thermal loops have been derived perturbatively, by a semiclassical truncation of the Schwinger-Dyson equations, and by classical kinetic theory. In this talk I give a pedagogical derivation, following that of Kelly, Liu, Lucchesi, and Manuel. The derivation is valid not just for a thermal distribution, but (modulo certain obvious restrictions) for an arbitrary initial distribution of particles. Consider, for example, the {open_quotes}tsunami{close_quotes} problem: suppose that one starts, at time t = 0, with a spatially homogenous, infinite wall of particles, all moving with the same velocity at the speed of light.

Exploration for the Salinity Tolerance-Related Genes from Xero-Halophyte Atriplex canescens Exploiting Yeast Functional Screening System

Directory of Open Access Journals (Sweden)

Gang Yu

2017-11-01

Full Text Available Plant productivity is limited by salinity stress, both in natural and agricultural systems. Identification of salt stress-related genes from halophyte can provide insights into mechanisms of salt stress tolerance in plants. Atriplex canescens is a xero-halophyte that exhibits optimum growth in the presence of 400 mM NaCl. A cDNA library derived from highly salt-treated A. canescens plants was constructed based on a yeast expression system. A total of 53 transgenic yeast clones expressing enhanced salt tolerance were selected from 105 transformants. Their plasmids were sequenced and the gene characteristics were annotated using a BLASTX search. Retransformation of yeast cells with the selected plasmids conferred salt tolerance to the resulting transformants. The expression patterns of 28 of these stress-related genes were further investigated in A. canescens leaves by quantitative reverse transcription-PCR. In this study, we provided a rapid and robust assay system for large-scale screening of genes for varied abiotic stress tolerance with high efficiency in A. canescens.

Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon.

Directory of Open Access Journals (Sweden)

Qiusheng Kong

Full Text Available Melon (Cucumis melo. L is not only an economically important cucurbitaceous crop but also an attractive model for studying many biological characteristics. Screening appropriate reference genes is essential to reverse transcription quantitative real-time PCR (RT-qPCR, which is key to many studies involving gene expression analysis. In this study, 14 candidate reference genes were selected, and the variations in their expression in roots and leaves of plants subjected to biotic stress, abiotic stress, and plant growth regulator treatment were assessed by RT-qPCR. The stability of the expression of the selected genes was determined and ranked using geNorm and NormFinder. geNorm identified the two most stable genes for each set of conditions: CmADP and CmUBIep across all samples, CmUBIep and CmRPL in roots, CmRAN and CmACT in leaves, CmADP and CmRPL under abiotic stress conditions, CmTUA and CmACT under biotic stress conditions, and CmRAN and CmACT under plant growth regulator treatments. NormFinder determined CmRPL to be the best reference gene in roots and under biotic stress conditions and CmADP under the other experimental conditions. CmUBC2 and CmPP2A were not found to be suitable under many experimental conditions. The catalase family genes CmCAT1, CmCAT2, and CmCAT3 were identified in melon genome and used as target genes to validate the reliability of identified reference genes. The catalase family genes showed the most upregulation 3 days after inoculation with Fusarium wilt in roots, after which they were downregulated. Their levels of expression were significantly overestimated when the unsuitable reference gene was used for normalization. These results not only provide guidelines for the selection of reference genes for gene expression analyses in melons but may also provide valuable information for studying the functions of catalase family genes in stress responses.

Optimal random perturbations for stochastic approximation using a simultaneous perturbation gradient approximation

DEFF Research Database (Denmark)

Sadegh, Payman; Spall, J. C.

1998-01-01

simultaneous perturbation approximation to the gradient based on loss function measurements. SPSA is based on picking a simultaneous perturbation (random) vector in a Monte Carlo fashion as part of generating the approximation to the gradient. This paper derives the optimal distribution for the Monte Carlo...

Perturbation of B Cell Gene Expression Persists in HIV-Infected Children Despite Effective Antiretroviral Therapy and Predicts H1N1 Response.

Science.gov (United States)

Cotugno, Nicola; De Armas, Lesley; Pallikkuth, Suresh; Rinaldi, Stefano; Issac, Biju; Cagigi, Alberto; Rossi, Paolo; Palma, Paolo; Pahwa, Savita

2017-01-01

Despite effective antiretroviral therapy (ART), HIV-infected individuals with apparently similar clinical and immunological characteristics can vary in responsiveness to vaccinations. However, molecular mechanisms responsible for such impairment, as well as biomarkers able to predict vaccine responsiveness in HIV-infected children, remain unknown. Following the hypothesis that a B cell qualitative impairment persists in HIV-infected children (HIV) despite effective ART and phenotypic B cell immune reconstitution, the aim of the current study was to investigate B cell gene expression of HIV compared to age-matched healthy controls (HCs) and to determine whether distinct gene expression patterns could predict the ability to respond to influenza vaccine. To do so, we analyzed prevaccination transcriptional levels of a 96-gene panel in equal numbers of sort-purified B cell subsets (SPBS) isolated from peripheral blood mononuclear cells using multiplexed RT-PCR. Immune responses to H1N1 antigen were determined by hemaglutination inhibition and memory B cell ELISpot assays following trivalent-inactivated influenza vaccination (TIV) for all study participants. Although there were no differences in terms of cell frequencies of SPBS between HIV and HC, the groups were distinguishable based upon gene expression analyses. Indeed, a 28-gene signature, characterized by higher expression of genes involved in the inflammatory response and immune activation was observed in activated memory B cells (CD27 + CD21 - ) from HIV when compared to HC despite long-term viral control (>24 months). Further analysis, taking into account H1N1 responses after TIV in HIV participants, revealed that a 25-gene signature in resting memory (RM) B cells (CD27 + CD21 + ) was able to distinguish vaccine responders from non-responders (NR). In fact, prevaccination RM B cells of responders showed a higher expression of gene sets involved in B cell adaptive immune responses ( APRIL, BTK, BLIMP1 ) and

Disformal transformation of cosmological perturbations

Directory of Open Access Journals (Sweden)

Masato Minamitsuji

2014-10-01

Full Text Available We investigate the gauge-invariant cosmological perturbations in the gravity and matter frames in the general scalar–tensor theory where two frames are related by the disformal transformation. The gravity and matter frames are the extensions of the Einstein and Jordan frames in the scalar–tensor theory where two frames are related by the conformal transformation, respectively. First, it is shown that the curvature perturbation in the comoving gauge to the scalar field is disformally invariant as well as conformally invariant, which gives the predictions from the cosmological model where the scalar field is responsible both for inflation and cosmological perturbations. Second, in case that the disformally coupled matter sector also contributes to curvature perturbations, we derive the evolution equations of the curvature perturbation in the uniform matter energy density gauge from the energy (nonconservation in the matter sector, which are independent of the choice of the gravity sector. While in the matter frame the curvature perturbation in the uniform matter energy density gauge is conserved on superhorizon scales for the vanishing nonadiabatic pressure, in the gravity frame it is not conserved even if the nonadiabatic pressure vanishes. The formula relating two frames gives the amplitude of the curvature perturbation in the matter frame, once it is evaluated in the gravity frame.

Disformal transformation of cosmological perturbations

International Nuclear Information System (INIS)

Minamitsuji, Masato

2014-01-01

We investigate the gauge-invariant cosmological perturbations in the gravity and matter frames in the general scalar–tensor theory where two frames are related by the disformal transformation. The gravity and matter frames are the extensions of the Einstein and Jordan frames in the scalar–tensor theory where two frames are related by the conformal transformation, respectively. First, it is shown that the curvature perturbation in the comoving gauge to the scalar field is disformally invariant as well as conformally invariant, which gives the predictions from the cosmological model where the scalar field is responsible both for inflation and cosmological perturbations. Second, in case that the disformally coupled matter sector also contributes to curvature perturbations, we derive the evolution equations of the curvature perturbation in the uniform matter energy density gauge from the energy (non)conservation in the matter sector, which are independent of the choice of the gravity sector. While in the matter frame the curvature perturbation in the uniform matter energy density gauge is conserved on superhorizon scales for the vanishing nonadiabatic pressure, in the gravity frame it is not conserved even if the nonadiabatic pressure vanishes. The formula relating two frames gives the amplitude of the curvature perturbation in the matter frame, once it is evaluated in the gravity frame

Overlapping gene expression profiles of model compounds provide opportunities for immunotoxicity screening

International Nuclear Information System (INIS)

Baken, Kirsten A.; Pennings, Jeroen L.A.; Jonker, Martijs J.; Schaap, Mirjam M.; Vries, Annemieke de; Steeg, Harry van; Breit, Timo M.; Loveren, Henk van

2008-01-01

In order to investigate immunotoxic effects of a set of model compounds in mice, a toxicogenomics approach was combined with information on macroscopical and histopathological effects on spleens and on modulation of immune function. Bis(tri-n-butyltin)oxide (TBTO), cyclosporin A (CsA), and benzo[a]pyrene (B[a]P) were administered to C57BL/6 mice at immunosuppressive dose levels. Acetaminophen (APAP) was included in the study since indications of immunomodulating properties of this compound have appeared in the literature. TBTO exposure caused the most pronounced effect on gene expression and also resulted in the most severe reduction of body weight gain and induction of splenic irregularities. All compounds caused inhibition of cell division in the spleen as shown by microarray analysis as well as by suppression of lymphocyte proliferation after application of a contact sensitizer as demonstrated in an immune function assay that was adapted from the local lymph node assay. The immunotoxicogenomics approach applied in this study thus pointed to immunosuppression through cell cycle arrest as a common mechanism of action of immunotoxicants, including APAP. Genes related to cell division such as Ccna2, Brca1, Birc5, Incenp, and Cdkn1a (p21) were identified as candidate genes to indicate anti-proliferative effects of xenobiotics in immune cells for future screening assays. The results of our experiments also show the value of group wise pathway analysis for detection of more subtle transcriptional effects and the potency of evaluation of effects in the spleen to demonstrate immunotoxicity

Preheating curvaton perturbations

International Nuclear Information System (INIS)

Bastero-Gil, M.; Di Clemente, V.; King, S.F.

2005-01-01

We discuss the potentially important role played by preheating in certain variants of the curvaton mechanism in which isocurvature perturbations of a D-flat (and F-flat) direction become converted to curvature perturbations during reheating. We discover that parametric resonance of the isocurvature components amplifies the superhorizon fluctuations by a significant amount. As an example of these effects we develop a particle physics motivated model which involves hybrid inflation with the waterfall field N being responsible for generating the μ term, the right-handed neutrino mass scale, and the Peccei-Quinn symmetry breaking scale. The role of the curvaton field can be played either by usual Higgs field, or the lightest right-handed sneutrino. Our new results show that it is possible to achieve the correct curvature perturbations for initial values of the curvaton fields of order the weak scale. In this model we show that the prediction for the spectral index of the final curvature perturbation only depends on the mass of the curvaton during inflation, where consistency with current observational data requires the ratio of this mass to the Hubble constant to be 0.3

GoGene: gene annotation in the fast lane.

Science.gov (United States)

Plake, Conrad; Royer, Loic; Winnenburg, Rainer; Hakenberg, Jörg; Schroeder, Michael

2009-07-01

High-throughput screens such as microarrays and RNAi screens produce huge amounts of data. They typically result in hundreds of genes, which are often further explored and clustered via enriched GeneOntology terms. The strength of such analyses is that they build on high-quality manual annotations provided with the GeneOntology. However, the weakness is that annotations are restricted to process, function and location and that they do not cover all known genes in model organisms. GoGene addresses this weakness by complementing high-quality manual annotation with high-throughput text mining extracting co-occurrences of genes and ontology terms from literature. GoGene contains over 4,000,000 associations between genes and gene-related terms for 10 model organisms extracted from more than 18,000,000 PubMed entries. It does not cover only process, function and location of genes, but also biomedical categories such as diseases, compounds, techniques and mutations. By bringing it all together, GoGene provides the most recent and most complete facts about genes and can rank them according to novelty and importance. GoGene accepts keywords, gene lists, gene sequences and protein sequences as input and supports search for genes in PubMed, EntrezGene and via BLAST. Since all associations of genes to terms are supported by evidence in the literature, the results are transparent and can be verified by the user. GoGene is available at http://gopubmed.org/gogene.

In Vivo RNAi-Based Screens: Studies in Model Organisms

Directory of Open Access Journals (Sweden)

Miki Yamamoto-Hino

2013-11-01

Full Text Available RNA interference (RNAi is a technique widely used for gene silencing in organisms and cultured cells, and depends on sequence homology between double-stranded RNA (dsRNA and target mRNA molecules. Numerous cell-based genome-wide screens have successfully identified novel genes involved in various biological processes, including signal transduction, cell viability/death, and cell morphology. However, cell-based screens cannot address cellular processes such as development, behavior, and immunity. Drosophila and Caenorhabditis elegans are two model organisms whose whole bodies and individual body parts have been subjected to RNAi-based genome-wide screening. Moreover, Drosophila RNAi allows the manipulation of gene function in a spatiotemporal manner when it is implemented using the Gal4/UAS system. Using this inducible RNAi technique, various large-scale screens have been performed in Drosophila, demonstrating that the method is straightforward and valuable. However, accumulated results reveal that the results of RNAi-based screens have relatively high levels of error, such as false positives and negatives. Here, we review in vivo RNAi screens in Drosophila and the methods that could be used to remove ambiguity from screening results.

Rapid screening of spontaneous and radiation-induced structural changes at the vestigial gene of Drosophila melanogaster by polymerase chain reaction

International Nuclear Information System (INIS)

Aleksandrov, I.D.; Lapidus, I.L.; Aleksandrova, M.V.; Karpovskij, A.L.; Korablinova, S.V.; Levkovich, N.V.

1998-01-01

A total of 27 independent isolated spontaneous and gamma-ray-induced heritable mutations at the vestigial gene of Drosophila melanogaster were analysed by a rapid deletion screening method with polymerase chain reaction (PCR) amplification. According to the results obtained 36.4% (4 of 11) of spontaneous mutants and 62.5% (10 of 16) of gamma-ray-induced ones have revealed deficiency of one or more fragments studied. The rest of spontaneous and radiation mutants showed no alterations in the PCR patterns, indicating possible small scale changes (point mutations) inside the gene region studied or, probably, the gross lesions situated elsewhere. The distribution of the mutation damages in the gene region studied are discussed

Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis.

Science.gov (United States)

Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R

2017-08-07

The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.

The natural compound sanguinarine perturbs the regenerative capabilities of planarians.

Science.gov (United States)

Balestrini, Linda; Di Donfrancesco, Alessia; Rossi, Leonardo; Marracci, Silvia; Isolani, Maria E; Bianucci, Anna M; Batistoni, Renata

2017-01-01

The natural alkaloid sanguinarine has remarkable therapeutic properties and has been used for centuries as a folk remedy. This compound exhibits interesting anticancer properties and is currently receiving attention as a potential chemotherapeutic agent. Nevertheless, limited information exists regarding its safety for developing organisms. Planarians are an animal model known for their extraordinary stem cell-based regenerative capabilities and are increasingly used for toxicological and pharmacological studies. Here, we report that sanguinarine, at micromolar concentrations, perturbs the regeneration process in the planarian Dugesia japonica. We show that sanguinarine exposure causes defects during anterior regeneration and visual system recovery, as well as anomalous remodelling of pre-existing structures. Investigating the effects of sanguinarine on stem cells, we found that sanguinarine perturbs the transcriptional profile of early and late stem cell progeny markers. Our results indicate that sanguinarine exposure alters cell dynamics and induces apoptosis without affecting cell proliferation. Finally, sanguinarine exposure influences the expression level of H + , K + -ATPase α subunit, a gene of the P-type-ATPase pump family which plays a crucial role during anterior regeneration in planaria. On the whole, our data reveal that sanguinarine perturbs multiple mechanisms which regulate regeneration dynamics and contribute to a better understanding of the safety profile of this alkaloid in developing organisms.

A Systematic Genetic Screen to Dissect the MicroRNA Pathway in Drosophila.

Science.gov (United States)

Pressman, Sigal; Reinke, Catherine A; Wang, Xiaohong; Carthew, Richard W

2012-04-01

A central goal of microRNA biology is to elucidate the genetic program of miRNA function and regulation. However, relatively few of the effectors that execute miRNA repression have been identified. Because such genes may function in many developmental processes, mutations in them are expected to be pleiotropic and thus are discarded in most standard genetic screens. Here, we describe a systematic screen designed to identify all Drosophila genes in ∼40% of the genome that function in the miRNA pathway. To identify potentially pleiotropic genes, the screen analyzed clones of homozygous mutant cells in heterozygous animals. We identified 45 mutations representing 24 genes, and we molecularly characterized 9 genes. These include 4 previously known genes that encode core components of the miRNA pathway, including Drosha, Pasha, Dicer-1, and Ago1. The rest are new genes that function through chromatin remodeling, signaling, and mRNA decapping. The results suggest genetic screens that use clonal analysis can elucidate the miRNA program and that ∼100 genes are required to execute the miRNA program.

Screening of heavy quarks and hadrons at finite temperature and density

Energy Technology Data Exchange (ETDEWEB)

Doering, M.

2006-09-22

Heavy quarks and hadrons placed in a strongly interacting thermal and baryon chemical quantum field are screened by the medium. I calculate the free energies of heavy quarks and anti-quarks and hadron correlation functions on a 16{sup 3} x 4 lattice in 2-flavour QCD with a bare quark mass of m/T=0.4. The dependence on the interparticle distance determines the screening masses as a function of temperature and density. The Taylor expansion method is used for the baryon chemical potential. The heavy quark screening masses turn out to be in good agreement with perturbation theory for temperatures T>2T{sub c}. The hadron screening masses are consistent with the free quark propagation in the large temperature regime. (orig.)

Screening of heavy quarks and hadrons at finite temperature and density

International Nuclear Information System (INIS)

Doering, M.

2006-01-01

Heavy quarks and hadrons placed in a strongly interacting thermal and baryon chemical quantum field are screened by the medium. I calculate the free energies of heavy quarks and anti-quarks and hadron correlation functions on a 16 3 x 4 lattice in 2-flavour QCD with a bare quark mass of m/T=0.4. The dependence on the interparticle distance determines the screening masses as a function of temperature and density. The Taylor expansion method is used for the baryon chemical potential. The heavy quark screening masses turn out to be in good agreement with perturbation theory for temperatures T>2T c . The hadron screening masses are consistent with the free quark propagation in the large temperature regime. (orig.)

Retrofit Strategies for Incorporating Xenobiotic Metabolism into High Throughput Screening Assays (EMGS)

Science.gov (United States)

The US EPA’s ToxCast program is designed to assess chemical perturbations of molecular and cellular endpoints using a variety of high-throughput screening (HTS) assays. However, existing HTS assays have limited or no xenobiotic metabolism which could lead to a mischaracterization...

Singular perturbation of simple eigenvalues

International Nuclear Information System (INIS)

Greenlee, W.M.

1976-01-01

Two operator theoretic theorems which generalize those of asymptotic regular perturbation theory and which apply to singular perturbation problems are proved. Application of these theorems to concrete problems is involved, but the perturbation expansions for eigenvalues and eigenvectors are developed in terms of solutions of linear operator equations. The method of correctors, as well as traditional boundary layer techniques, can be used to apply these theorems. The current formulation should be applicable to highly singular ''hard core'' potential perturbations of the radial equation of quantum mechanics. The theorems are applied to a comparatively simple model problem whose analysis is basic to that of the quantum mechanical problem

Base case and perturbation scenarios

Energy Technology Data Exchange (ETDEWEB)

Edmunds, T

1998-10-01

This report describes fourteen energy factors that could affect electricity markets in the future (demand, process, source mix, etc.). These fourteen factors are believed to have the most influence on the State's energy environment. A base case, or most probable, characterization is given for each of these fourteen factors over a twenty year time horizon. The base case characterization is derived from quantitative and qualitative information provided by State of California government agencies, where possible. Federal government databases are nsed where needed to supplement the California data. It is envisioned that a initial selection of issue areas will be based upon an evaluation of them under base case conditions. For most of the fourteen factors, the report identities possible perturbations from base case values or assumptions that may be used to construct additional scenarios. Only those perturbations that are plausible and would have a significant effect on energy markets are included in the table. The fourteen factors and potential perturbations of the factors are listed in Table 1.1. These perturbations can be combined to generate internally consist.ent. combinations of perturbations relative to the base case. For example, a low natural gas price perturbation should be combined with a high natural gas demand perturbation. The factor perturbations are based upon alternative quantitative forecasts provided by other institutions (the Department of Energy - Energy Information Administration in some cases), changes in assumptions that drive the quantitative forecasts, or changes in assumptions about the structure of the California energy markets. The perturbations are intended to be used for a qualitative reexamination of issue areas after an initial evaluation under the base case. The perturbation information would be used as a "tiebreaker;" to make decisions regarding those issue areas that were marginally accepted or rejected under the base case. Hf a

Scalar cosmological perturbations

International Nuclear Information System (INIS)

Uggla, Claes; Wainwright, John

2012-01-01

Scalar perturbations of Friedmann-Lemaitre cosmologies can be analyzed in a variety of ways using Einstein's field equations, the Ricci and Bianchi identities, or the conservation equations for the stress-energy tensor, and possibly introducing a timelike reference congruence. The common ground is the use of gauge invariants derived from the metric tensor, the stress-energy tensor, or from vectors associated with a reference congruence, as basic variables. Although there is a complication in that there is no unique choice of gauge invariants, we will show that this can be used to advantage. With this in mind our first goal is to present an efficient way of constructing dimensionless gauge invariants associated with the tensors that are involved, and of determining their inter-relationships. Our second goal is to give a unified treatment of the various ways of writing the governing equations in dimensionless form using gauge-invariant variables, showing how simplicity can be achieved by a suitable choice of variables and normalization factors. Our third goal is to elucidate the connection between the metric-based approach and the so-called 1 + 3 gauge-invariant approach to cosmological perturbations. We restrict our considerations to linear perturbations, but our intent is to set the stage for the extension to second-order perturbations. (paper)

Divergent Perturbation Series

International Nuclear Information System (INIS)

Suslov, I.M.

2005-01-01

Various perturbation series are factorially divergent. The behavior of their high-order terms can be determined by Lipatov's method, which involves the use of instanton configurations of appropriate functional integrals. When the Lipatov asymptotic form is known and several lowest order terms of the perturbation series are found by direct calculation of diagrams, one can gain insight into the behavior of the remaining terms of the series, which can be resummed to solve various strong-coupling problems in a certain approximation. This approach is demonstrated by determining the Gell-Mann-Low functions in φ 4 theory, QED, and QCD with arbitrary coupling constants. An overview of the mathematical theory of divergent series is presented, and interpretation of perturbation series is discussed. Explicit derivations of the Lipatov asymptotic form are presented for some basic problems in theoretical physics. A solution is proposed to the problem of renormalon contributions, which hampered progress in this field in the late 1970s. Practical perturbation-series summation schemes are described both for a coupling constant of order unity and in the strong-coupling limit. An interpretation of the Borel integral is given for 'non-Borel-summable' series. Higher order corrections to the Lipatov asymptotic form are discussed

[Key effect genes responding to nerve injury identified by gene ontology and computer pattern recognition].

Science.gov (United States)

Pan, Qian; Peng, Jin; Zhou, Xue; Yang, Hao; Zhang, Wei

2012-07-01

In order to screen out important genes from large gene data of gene microarray after nerve injury, we combine gene ontology (GO) method and computer pattern recognition technology to find key genes responding to nerve injury, and then verify one of these screened-out genes. Data mining and gene ontology analysis of gene chip data GSE26350 was carried out through MATLAB software. Cd44 was selected from screened-out key gene molecular spectrum by comparing genes' different GO terms and positions on score map of principal component. Function interferences were employed to influence the normal binding of Cd44 and one of its ligands, chondroitin sulfate C (CSC), to observe neurite extension. Gene ontology analysis showed that the first genes on score map (marked by red *) mainly distributed in molecular transducer activity, receptor activity, protein binding et al molecular function GO terms. Cd44 is one of six effector protein genes, and attracted us with its function diversity. After adding different reagents into the medium to interfere the normal binding of CSC and Cd44, varying-degree remissions of CSC's inhibition on neurite extension were observed. CSC can inhibit neurite extension through binding Cd44 on the neuron membrane. This verifies that important genes in given physiological processes can be identified by gene ontology analysis of gene chip data.

Large-order perturbation theory

International Nuclear Information System (INIS)

Wu, T.T.

1982-01-01

The original motivation for studying the asymptotic behavior of the coefficients of perturbation series came from quantum field theory. An overview is given of some of the attempts to understand quantum field theory beyond finite-order perturbation series. At least is the case of the Thirring model and probably in general, the full content of a relativistic quantum field theory cannot be recovered from its perturbation series. This difficulty, however, does not occur in quantum mechanics, and the anharmonic oscillator is used to illustrate the methods used in large-order perturbation theory. Two completely different methods are discussed, the first one using the WKB approximation, and a second one involving the statistical analysis of Feynman diagrams. The first one is well developed and gives detailed information about the desired asymptotic behavior, while the second one is still in its infancy and gives instead information about the distribution of vertices of the Feynman diagrams

Perturbation theory in light-cone gauge

International Nuclear Information System (INIS)

Vianello, Eliana

2000-01-01

Perturbation calculations are presented for the light-cone gauge Schwinger model. Eigenstates can be calculated perturbatively but the perturbation theory is nonstandard. We hope to extend the work to QCD 2 to resolve some outstanding issues in those theories

On dark energy isocurvature perturbation

International Nuclear Information System (INIS)

Liu, Jie; Zhang, Xinmin; Li, Mingzhe

2011-01-01

Determining the equation of state of dark energy with astronomical observations is crucially important to understand the nature of dark energy. In performing a likelihood analysis of the data, especially of the cosmic microwave background and large scale structure data the dark energy perturbations have to be taken into account both for theoretical consistency and for numerical accuracy. Usually, one assumes in the global fitting analysis that the dark energy perturbations are adiabatic. In this paper, we study the dark energy isocurvature perturbation analytically and discuss its implications for the cosmic microwave background radiation and large scale structure. Furthermore, with the current astronomical observational data and by employing Markov Chain Monte Carlo method, we perform a global analysis of cosmological parameters assuming general initial conditions for the dark energy perturbations. The results show that the dark energy isocurvature perturbations are very weakly constrained and that purely adiabatic initial conditions are consistent with the data

Genome-wide screen for salmonella genes required for long-term systemic infection of the mouse.

Directory of Open Access Journals (Sweden)

2006-02-01

Full Text Available A microarray-based negative selection screen was performed to identify Salmonella enterica serovar Typhimurium (serovar Typhimurium genes that contribute to long-term systemic infection in 129X1/SvJ (Nramp1(r mice. A high-complexity transposon-mutagenized library was used to infect mice intraperitoneally, and the selective disappearance of mutants was monitored after 7, 14, 21, and 28 d postinfection. One hundred and eighteen genes were identified to contribute to serovar Typhimurium infection of the spleens of mice by 28 d postinfection. The negatively selected mutants represent many known aspects of Salmonella physiology and pathogenesis, although the majority of the identified genes are of putative or unknown function. Approximately 30% of the negatively selected genes correspond to horizontally acquired regions such as those within Salmonella pathogenicity islands (SPI 1-5, prophages (Gifsy-1 and -2 and remnant, and the pSLT virulence plasmid. In addition, mutations in genes responsible for outer membrane structure and remodeling, such as LPS- and PhoP-regulated and fimbrial genes, were also selected against. Competitive index experiments demonstrated that the secreted SPI2 effectors SseK2 and SseJ as well as the SPI4 locus are attenuated relative to wild-type bacteria during systemic infection. Interestingly, several SPI1-encoded type III secretion system effectors/translocases are required by serovar Typhimurium to establish and, unexpectedly, to persist systemically, challenging the present description of Salmonella pathogenesis. Moreover, we observed a progressive selection against serovar Typhimurium mutants based upon the duration of the infection, suggesting that different classes of genes may be required at distinct stages of infection. Overall, these data indicate that Salmonella long-term systemic infection in the mouse requires a diverse repertoire of virulence factors. This diversity of genes presumably reflects the fact that

Perturbation Theory of Embedded Eigenvalues

DEFF Research Database (Denmark)

Engelmann, Matthias

project gives a general and systematic approach to analytic perturbation theory of embedded eigenvalues. The spectral deformation technique originally developed in the theory of dilation analytic potentials in the context of Schrödinger operators is systematized by the use of Mourre theory. The group...... of dilations is thereby replaced by the unitary group generated y the conjugate operator. This then allows to treat the perturbation problem with the usual Kato theory.......We study problems connected to perturbation theory of embedded eigenvalues in two different setups. The first part deals with second order perturbation theory of mass shells in massive translation invariant Nelson type models. To this end an expansion of the eigenvalues w.r.t. fiber parameter up...

UV Suppression by Smearing and Screening Correlators

OpenAIRE

Gupta, Sourendu; Karthik, Nikhil

2013-01-01

We investigate the mechanism of smearing in the APE, Stout, HYP and HEX schemes through their effect on glue and quark Fourier modes. Using this, we non-perturbatively tune the smearing parameters to their optimum values. Smearing causes a super-linear improvement in taste symmetry breaking in the high temperature phase of QCD. We use optimal smearing in the high temperature phase and find close agreement of meson screening masses with weak coupling predictions.

Chiral perturbation theory

International Nuclear Information System (INIS)

Ecker, G.

1996-06-01

After a general introduction to the structure of effective field theories, the main ingredients of chiral perturbation theory are reviewed. Applications include the light quark mass ratios and pion-pion scattering to two-loop accuracy. In the pion-nucleon system, the linear σ model is contrasted with chiral perturbation theory. The heavy-nucleon expansion is used to construct the effective pion-nucleon Lagrangian to third order in the low-energy expansion, with applications to nucleon Compton scattering. (author)

Dynamics of a single ion in a perturbed Penning trap: Octupolar perturbation

International Nuclear Information System (INIS)

Lara, Martin; Salas, J. Pablo

2004-01-01

Imperfections in the design or implementation of Penning traps may give rise to electrostatic perturbations that introduce nonlinearities in the dynamics. In this paper we investigate, from the point of view of classical mechanics, the dynamics of a single ion trapped in a Penning trap perturbed by an octupolar perturbation. Because of the axial symmetry of the problem, the system has two degrees of freedom. Hence, this model is ideal to be managed by numerical techniques like continuation of families of periodic orbits and Poincare surfaces of section. We find that, through the variation of the two parameters controlling the dynamics, several periodic orbits emanate from two fundamental periodic orbits. This process produces important changes (bifurcations) in the phase space structure leading to chaotic behavior

Status of perturbative QCD

International Nuclear Information System (INIS)

Collins, J.C.

1985-01-01

Progress in quantum chromodynamics in the past year is reviewed in these specific areas: proof of factorization for hadron-hadron collisions, fast calculation of higher order graphs, perturbative Monte Carlo calculations for hadron-hadron scattering, applicability of perturbative methods to heavy quark production, and understanding of the small-x problem. 22 refs

FRW Cosmological Perturbations in Massive Bigravity

CERN Document Server

Comelli, D; Pilo, L

2014-01-01

Cosmological perturbations of FRW solutions in ghost free massive bigravity, including also a second matter sector, are studied in detail. At early time, we find that sub horizon exponential instabilities are unavoidable and they lead to a premature departure from the perturbative regime of cosmological perturbations.

Screened Coulomb interactions in metallic alloys. II. Screening beyond the single-site and atomic-sphere approximations

DEFF Research Database (Denmark)

Ruban, Andrei; Simak, S.I.; Korzhavyi, P.A.

2002-01-01

-electron potential and energy. In the case of a random alloy such interactions can be accounted for only by lifting the atomic-sphere and single-site approximations, in order to include the polarization due to local environment effects. Nevertheless, a simple parametrization of the screened Coulomb interactions...... for the ordinary single-site methods, including the generalized perturbation method, is still possible. We obtained such a parametrization for bulk and surface NiPt alloys, which allows one to obtain quantitatively accurate effective interactions in this system....

Chaotic inflation with metric and matter perturbations

International Nuclear Information System (INIS)

Feldman, H.A.; Brandenberger, R.H.

1989-01-01

A perturbative scheme to analyze the evolution of both metric and scalar field perturbations in an expanding universe is developed. The scheme is applied to study chaotic inflation with initial metric and scalar field perturbations present. It is shown that initial gravitational perturbations with wavelength smaller than the Hubble radius rapidly decay. The metric simultaneously picks up small perturbations determined by the matter inhomogeneities. Both are frozen in once the wavelength exceeds the Hubble radius. (orig.)

Cosmological perturbations in antigravity

Science.gov (United States)

Oltean, Marius; Brandenberger, Robert

2014-10-01

We compute the evolution of cosmological perturbations in a recently proposed Weyl-symmetric theory of two scalar fields with oppositely signed conformal couplings to Einstein gravity. It is motivated from the minimal conformal extension of the standard model, such that one of these scalar fields is the Higgs while the other is a new particle, the dilaton, introduced to make the Higgs mass conformally symmetric. At the background level, the theory admits novel geodesically complete cyclic cosmological solutions characterized by a brief period of repulsive gravity, or "antigravity," during each successive transition from a big crunch to a big bang. For simplicity, we consider scalar perturbations in the absence of anisotropies, with potential set to zero and without any radiation. We show that despite the necessarily wrong-signed kinetic term of the dilaton in the full action, these perturbations are neither ghostlike nor tachyonic in the limit of strongly repulsive gravity. On this basis, we argue—pending a future analysis of vector and tensor perturbations—that, with respect to perturbative stability, the cosmological solutions of this theory are viable.

Gauge-invariant cosmological density perturbations

International Nuclear Information System (INIS)

Sasaki, Misao.

1986-06-01

Gauge-invariant formulation of cosmological density perturbation theory is reviewed with special emphasis on its geometrical aspects. Then the gauge-invariant measure of the magnitude of a given perturbation is presented. (author)

Twisting perturbed parafermions

Directory of Open Access Journals (Sweden)

A.V. Belitsky

2017-07-01

Full Text Available The near-collinear expansion of scattering amplitudes in maximally supersymmetric Yang–Mills theory at strong coupling is governed by the dynamics of stings propagating on the five sphere. The pentagon transitions in the operator product expansion which systematize the series get reformulated in terms of matrix elements of branch-point twist operators in the two-dimensional O(6 nonlinear sigma model. The facts that the latter is an asymptotically free field theory and that there exists no local realization of twist fields prevents one from explicit calculation of their scaling dimensions and operator product expansion coefficients. This complication is bypassed making use of the equivalence of the sigma model to the infinite-level limit of WZNW models perturbed by current–current interactions, such that one can use conformal symmetry and conformal perturbation theory for systematic calculations. Presently, to set up the formalism, we consider the O(3 sigma model which is reformulated as perturbed parafermions.

Effect of Hydrotherapy on Static and Dynamic Balance in Older Adults: Comparison of Perturbed and Non-Perturbed Programs

Directory of Open Access Journals (Sweden)

Elham Azimzadeh

2013-01-01

Full Text Available Objectives: Falling is a main cause of mortality in elderly. Balance training exercises can help to prevent falls in older adults. According to the principle of specificity of training, the perturbation-based trainings are more similar to the real world. So these training programs can improve balance in elderly. Furthermore, exercising in an aquatic environment can reduce the limitations for balance training rather than a non-aquatic on. The aim of this study is comparing the effectiveness of perturbed and non-perturbed balance training programs in water on static and dynamic balance in aforementioned population group. Methods & Materials: 37 old women (age 80-65, were randomized to the following groups: perturbation-based training (n=12, non-perturbation-based training (n=12 and control (n=13 groups. Static and dynamic balance had been tested before and after the eight weeks of training by the postural stability test of the Biodex balance system using dynamic (level 4 and static platform. The data were analyzed by one sample paired t-test, Independent t-test and ANOVA. Results: There was a significant improvement for all indexes of static and dynamic balance in perturbation-based training (P<0.05. However, in non-perturbed group, all indexes were improved except ML (P<0.05. ANOVA showed that perturbed training was more effective than non-perturbed training on both static and dynamic balances. Conclusion: The findings confirmed the specificity principle of training. Although balance training can improve balance abilities, these kinds of trainings are not such specific for improving balance neuromuscular activities.The perturbation-based trainings can activate postural compensatory responses and reduce falling risk. According to results, we can conclude that hydrotherapy especially with perturbation-based programs will be useful for rehabilitation interventions in elderly .

High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

Science.gov (United States)

Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

2018-01-02

Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and

Multiplicative perturbations of local C-semigroups

Indian Academy of Sciences (India)

In this paper, we establish some left and right multiplicative perturbation theorems concerning local -semigroups when the generator of a perturbed local -semigroup S ( ⋅ ) may not be densely defined and the perturbation operator is a bounded linear operator from D ( A ) ¯ into () such that = on D ( A ) ¯ ...

Multiplicative perturbations of local C-semigroups

Indian Academy of Sciences (India)

2016-08-26

Aug 26, 2016 ... In this paper, we establish some left and right multiplicative perturbation theorems concerning local -semigroups when the generator of a perturbed local -semigroup S(⋅) may not be densely defined and the perturbation operator is a bounded linear operator from ¯D(A) into () such that = ...

Perturbative QCD (1/3)

CERN Multimedia

CERN. Geneva

2013-01-01

Perturbative QCD is the general theoretical framework for describing hard scattering processes yielding multiparticle production at hadron colliders. In these lectures, we shall introduce fundamental features of perturbative QCD and describe its application to several high energy collider processes, including jet production in electron-positron annihilation, deep inelastic scattering, Higgs boson and gauge boson production at the LHC.

Determination of the stochastic layer properties induced by magnetic perturbations via heat pulse experiments at ASDEX upgrade

Directory of Open Access Journals (Sweden)

D. Brida

2017-08-01

Full Text Available A heat pulse experiment was carried out in the tokamak ASDEX Upgrade to estimate the stochastic layer width of a deuterium L-mode discharge with externally applied Magnetic Perturbations. The method relies on the deposition of ECRH pulses in the plasma edge while measuring the divertor target heat flux with high temporal resolution IR thermography and Langmuir probes. The experimental results were compared to simulations of the time dependent heat pulse propagation on a constant plasma background with the EMC3-EIRENE code package, using an ad-hoc screening model. If no screening was taken into account in the simulations a decrease in the characteristic heat pulse propagation time was observed, which shows that the heat transport is enhanced compared to the screened cases. No such enhancement was found in the experiment, indicating strong screening. In further simulations the effect of screening on the target fluxes was investigated for varying densities. For low densities it was found that screening reduces the strike line splitting strongly, while for higher densities no strong strike line splitting was found, independent of the screening degree. For strongly detached L-mode conditions with MPs experiments at AUG indicate that the lobe structures vanish completely.

Screening Information - JSNP | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available List Contact us JSNP Screening Information Data detail Data name Screening Information DOI 10.18908/lsdba.nb...dc00114-003 Description of data contents Information from polymorphism screening experiments. Derived from E...the sequence for polymorphism screening Screened Position position of the polymorphism in the sequence for polymorphism screeni...ng Screened Symbol gene name related to the sequence for polymorphism screening Screened ...OMIM-ID OMIM ID related to the sequence for polymorphism screening About This Dat

Geometric Hamiltonian structures and perturbation theory

International Nuclear Information System (INIS)

Omohundro, S.

1984-08-01

We have been engaged in a program of investigating the Hamiltonian structure of the various perturbation theories used in practice. We describe the geometry of a Hamiltonian structure for non-singular perturbation theory applied to Hamiltonian systems on symplectic manifolds and the connection with singular perturbation techniques based on the method of averaging

In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.

Directory of Open Access Journals (Sweden)

Juan Du

Full Text Available Hedgehog (Hh signaling is highly conserved in all metazoan animals and plays critical roles in many developmental processes. Dysregulation of the Hh signaling cascade has been implicated in many diseases, including cancer. Although key components of the Hh pathway have been identified, significant gaps remain in our understanding of the regulation of individual Hh signaling molecules. Here, we report the identification of novel regulators of the Hh pathway, obtained from an in vivo RNA interference (RNAi screen in Drosophila. By selectively targeting critical genes functioning in post-translational modification systems utilizing ubiquitin (Ub and Ub-like proteins, we identify two novel genes (dUba3 and dUbc12 that negatively regulate Hh signaling activity. We provide in vivo and in vitro evidence illustrating that dUba3 and dUbc12 are essential components of the neddylation pathway; they function in an enzyme cascade to conjugate the ubiquitin-like NEDD8 modifier to Cullin proteins. Neddylation activates the Cullin-containing ubiquitin ligase complex, which in turn promotes the degradation of Cubitus interruptus (Ci, the downstream transcription factor of the Hh pathway. Our study reveals a conserved molecular mechanism of the neddylation pathway in Drosophila and sheds light on the complex post-translational regulations in Hh signaling.

Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua.

Science.gov (United States)

Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei

2013-01-01

The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (Ppest control.

Small-molecule screen identifies modulators of EWS/FLI1 target gene expression and cell survival in Ewing's sarcoma.

Science.gov (United States)

Boro, Aleksandar; Prêtre, Kathya; Rechfeld, Florian; Thalhammer, Verena; Oesch, Susanne; Wachtel, Marco; Schäfer, Beat W; Niggli, Felix K

2012-11-01

Ewing's sarcoma family of tumors (EFT) is characterized by the presence of chromosomal translocations leading to the expression of oncogenic transcription factors such as, in the majority of cases, EWS/FLI1. Because of its key role in Ewing's sarcoma development and maintenance, EWS/FLI1 represents an attractive therapeutic target. Here, we characterize PHLDA1 as a novel direct target gene whose expression is repressed by EWS/FLI1. Using this gene and additional specific well-characterized target genes such as NROB1, NKX2.2 and CAV1, all activated by EWS/FLI1, as a read-out system, we screened a small-molecule compound library enriched for FDA-approved drugs that modulated the expression of EWS/FLI1 target genes. Among a hit-list of nine well-known drugs such as camptothecin, fenretinide, etoposide and doxorubicin, we also identified the kinase inhibitor midostaurin (PKC412). Subsequent experiments demonstrated that midostaurin is able to induce apoptosis in a panel of six Ewing's sarcoma cell lines in vitro and can significantly suppress xenograft tumor growth in vivo. These results suggest that midostaurin might be a novel drug that is active against Ewing's cells, which might act by modulating the expression of EWS/FLI1 target genes. Copyright © 2012 UICC.

Development of automatic image analysis methods for high-throughput and high-content screening

NARCIS (Netherlands)

Di, Zi

2013-01-01

This thesis focuses on the development of image analysis methods for ultra-high content analysis of high-throughput screens where cellular phenotype responses to various genetic or chemical perturbations that are under investigation. Our primary goal is to deliver efficient and robust image analysis

Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

Science.gov (United States)

Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

2016-01-01

Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

Directory of Open Access Journals (Sweden)

Arno Steinacher

Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest

Inactivating Mutation screening of Exon 6 and Exon 10E of FSHR gene in women with Polycystic Ovarian Syndrome in Vellore population

Science.gov (United States)

Sekar, Nishu; Sapre, Madhura; Kale, Vaikhari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

2017-11-01

Polycystic Ovarian syndrome (PCOS) is a major cause of infertility in females of reproducing age and is typified by oligo-anovulation, hyperandrogenism, hirsutism and polycystic ovaries. FSHR gene located on chromosome 2 p21 is responsible for the normal follicular development and any deletion or mutation in the gene affects the interaction of FSH with its receptor. Thus, it becomes the candidate gene for PCOS study. Inactivating mutation in FSHR gene limits the receptor’s function by creating a complete block, changing the receptor-ligand complex or the basic hormone signal transduction.To screen the inactivating mutations in Exon 6 and Exon 10E of FSHR gene in women diagnosed with PCOS.PCR-RFLP analysis indicated that there were no inactivating mutations found in Exon 6 and Exon 10E. Variations in hormone levels were seen amongst the PCOS patients. There were no inactivating mutations found in FSHR gene of the women diagnosed with PCOS according to the Rotterdam criteria in Vellore population.

Non-perturbative effects in supersymmetry

International Nuclear Information System (INIS)

Veneziano, G.

1987-01-01

Some non perturbative aspects of globally supersymmetric (SUSY) gauge theories are discussed. These share with their non-supersymmetric analogues interesting non perturbative features, such as the spontaneous breaking of chiral symmetries via condensates. What is peculiar about supersymmetric theories, however, is that one is able to say a lot about non-perturbative effects even without resorting to elaborate numerical calculations: general arguments, supersymmetric and chiral Ward identities and analytic, dynamical calculations will turn out to effectively determine most of the supersymmetric vacuum properties. 28 references, 5 figures

The theory of singular perturbations

CERN Document Server

De Jager, E M

1996-01-01

The subject of this textbook is the mathematical theory of singular perturbations, which despite its respectable history is still in a state of vigorous development. Singular perturbations of cumulative and of boundary layer type are presented. Attention has been given to composite expansions of solutions of initial and boundary value problems for ordinary and partial differential equations, linear as well as quasilinear; also turning points are discussed. The main emphasis lies on several methods of approximation for solutions of singularly perturbed differential equations and on the mathemat

A comprehensive platform for highly multiplexed mammalian functional genetic screens

Directory of Open Access Journals (Sweden)

Cheung-Ong Kahlin

2011-05-01

Full Text Available Abstract Background Genome-wide screening in human and mouse cells using RNA interference and open reading frame over-expression libraries is rapidly becoming a viable experimental approach for many research labs. There are a variety of gene expression modulation libraries commercially available, however, detailed and validated protocols as well as the reagents necessary for deconvolving genome-scale gene screens using these libraries are lacking. As a solution, we designed a comprehensive platform for highly multiplexed functional genetic screens in human, mouse and yeast cells using popular, commercially available gene modulation libraries. The Gene Modulation Array Platform (GMAP is a single microarray-based detection solution for deconvolution of loss and gain-of-function pooled screens. Results Experiments with specially constructed lentiviral-based plasmid pools containing ~78,000 shRNAs demonstrated that the GMAP is capable of deconvolving genome-wide shRNA "dropout" screens. Further experiments with a larger, ~90,000 shRNA pool demonstrate that equivalent results are obtained from plasmid pools and from genomic DNA derived from lentivirus infected cells. Parallel testing of large shRNA pools using GMAP and next-generation sequencing methods revealed that the two methods provide valid and complementary approaches to deconvolution of genome-wide shRNA screens. Additional experiments demonstrated that GMAP is equivalent to similar microarray-based products when used for deconvolution of open reading frame over-expression screens. Conclusion Herein, we demonstrate four major applications for the GMAP resource, including deconvolution of pooled RNAi screens in cells with at least 90,000 distinct shRNAs. We also provide detailed methodologies for pooled shRNA screen readout using GMAP and compare next-generation sequencing to GMAP (i.e. microarray based deconvolution methods.

Local perturbations perturb—exponentially–locally

International Nuclear Information System (INIS)

De Roeck, W.; Schütz, M.

2015-01-01

We elaborate on the principle that for gapped quantum spin systems with local interaction, “local perturbations [in the Hamiltonian] perturb locally [the groundstate].” This principle was established by Bachmann et al. [Commun. Math. Phys. 309, 835–871 (2012)], relying on the “spectral flow technique” or “quasi-adiabatic continuation” [M. B. Hastings, Phys. Rev. B 69, 104431 (2004)] to obtain locality estimates with sub-exponential decay in the distance to the spatial support of the perturbation. We use ideas of Hamza et al. [J. Math. Phys. 50, 095213 (2009)] to obtain similarly a transformation between gapped eigenvectors and their perturbations that is local with exponential decay. This allows to improve locality bounds on the effect of perturbations on the low lying states in certain gapped models with a unique “bulk ground state” or “topological quantum order.” We also give some estimate on the exponential decay of correlations in models with impurities where some relevant correlations decay faster than one would naively infer from the global gap of the system, as one also expects in disordered systems with a localized groundstate

Perturbation theory in large order

International Nuclear Information System (INIS)

Bender, C.M.

1978-01-01

For many quantum mechanical models, the behavior of perturbation theory in large order is strikingly simple. For example, in the quantum anharmonic oscillator, which is defined by -y'' + (x 2 /4 + ex 4 /4 - E) y = 0, y ( +- infinity) = 0, the perturbation coefficients, A/sub n/, in the expansion for the ground-state energy, E(ground state) approx. EPSILON/sub n = 0//sup infinity/ A/sub n/epsilon/sup n/, simplify dramatically as n → infinity: A/sub n/ approx. (6/π 3 )/sup 1/2/(-3)/sup n/GAMMA(n + 1/2). Methods of applied mathematics are used to investigate the nature of perturbation theory in quantum mechanics and show that its large-order behavior is determined by the semiclassical content of the theory. In quantum field theory the perturbation coefficients are computed by summing Feynman graphs. A statistical procedure in a simple lambda phi 4 model for summing the set of all graphs as the number of vertices → infinity is presented. Finally, the connection between the large-order behavior of perturbation theory in quantum electrodynamics and the value of α, the charge on the electron, is discussed. 7 figures

Tiered High-Throughput Screening Approach to Identify ...

Science.gov (United States)

High-throughput screening (HTS) for potential thyroid–disrupting chemicals requires a system of assays to capture multiple molecular-initiating events (MIEs) that converge on perturbed thyroid hormone (TH) homeostasis. Screening for MIEs specific to TH-disrupting pathways is limited in the US EPA ToxCast screening assay portfolio. To fill one critical screening gap, the Amplex UltraRed-thyroperoxidase (AUR-TPO) assay was developed to identify chemicals that inhibit TPO, as decreased TPO activity reduces TH synthesis. The ToxCast Phase I and II chemical libraries, comprised of 1,074 unique chemicals, were initially screened using a single, high concentration to identify potential TPO inhibitors. Chemicals positive in the single concentration screen were retested in concentration-response. Due to high false positive rates typically observed with loss-of-signal assays such as AUR-TPO, we also employed two additional assays in parallel to identify possible sources of nonspecific assay signal loss, enabling stratification of roughly 300 putative TPO inhibitors based upon selective AUR-TPO activity. A cell-free luciferase inhibition assay was used to identify nonspecific enzyme inhibition among the putative TPO inhibitors, and a cytotoxicity assay using a human cell line was used to estimate the cellular tolerance limit. Additionally, the TPO inhibition activities of 150 chemicals were compared between the AUR-TPO and an orthogonal peroxidase oxidation assay using

Identification of neural outgrowth genes using genome-wide RNAi.

Directory of Open Access Journals (Sweden)

Katharine J Sepp

2008-07-01

Full Text Available While genetic screens have identified many genes essential for neurite outgrowth, they have been limited in their ability to identify neural genes that also have earlier critical roles in the gastrula, or neural genes for which maternally contributed RNA compensates for gene mutations in the zygote. To address this, we developed methods to screen the Drosophila genome using RNA-interference (RNAi on primary neural cells and present the results of the first full-genome RNAi screen in neurons. We used live-cell imaging and quantitative image analysis to characterize the morphological phenotypes of fluorescently labelled primary neurons and glia in response to RNAi-mediated gene knockdown. From the full genome screen, we focused our analysis on 104 evolutionarily conserved genes that when downregulated by RNAi, have morphological defects such as reduced axon extension, excessive branching, loss of fasciculation, and blebbing. To assist in the phenotypic analysis of the large data sets, we generated image analysis algorithms that could assess the statistical significance of the mutant phenotypes. The algorithms were essential for the analysis of the thousands of images generated by the screening process and will become a valuable tool for future genome-wide screens in primary neurons. Our analysis revealed unexpected, essential roles in neurite outgrowth for genes representing a wide range of functional categories including signalling molecules, enzymes, channels, receptors, and cytoskeletal proteins. We also found that genes known to be involved in protein and vesicle trafficking showed similar RNAi phenotypes. We confirmed phenotypes of the protein trafficking genes Sec61alpha and Ran GTPase using Drosophila embryo and mouse embryonic cerebral cortical neurons, respectively. Collectively, our results showed that RNAi phenotypes in primary neural culture can parallel in vivo phenotypes, and the screening technique can be used to identify many new

Some remarks on perturbation in flame photometry; Quelques remarques sur les perturbations dans la photometrie de flamme

Energy Technology Data Exchange (ETDEWEB)

Malinowski, J [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

1960-07-01

After classifying the various types of perturbations, the author attempts to explain their causes. He then gives examples of possibilities of suppressing them. (author) [French] Ayant classe les divers types de perturbations en categories, l'auteur essaie d'expliquer les causes de ces perturbations. Il donne ensuite des exemples de possibilites de les supprimer. (auteur)

Perturbation theory of effective Hamiltonians

International Nuclear Information System (INIS)

Brandow, B.H.

1975-01-01

This paper constitutes a review of the many papers which have used perturbation theory to derive ''effective'' or ''model'' Hamiltonians. It begins with a brief review of nondegenerate and non-many-body perturbation theory, and then considers the degenerate but non-many-body problem in some detail. It turns out that the degenerate perturbation problem is not uniquely defined, but there are some practical criteria for choosing among the various possibilities. Finally, the literature dealing with the linked-cluster aspects of open-shell many-body systems is reviewed. (U.S.)

Identification of Hematopoietic Stem Cell Engraftment Genes in Gene Therapy Studies.

Science.gov (United States)

Powers, John M; Trobridge, Grant D

2013-09-01

Hematopoietic stem cell (HSC) therapy using replication-incompetent retroviral vectors is a promising approach to provide life-long correction for genetic defects. HSC gene therapy clinical studies have resulted in functional cures for several diseases, but in some studies clonal expansion or leukemia has occurred. This is due to the dyregulation of endogenous host gene expression from vector provirus insertional mutagenesis. Insertional mutagenesis screens using replicating retroviruses have been used extensively to identify genes that influence oncogenesis. However, retroviral mutagenesis screens can also be used to determine the role of genes in biological processes such as stem cell engraftment. The aim of this review is to describe the potential for vector insertion site data from gene therapy studies to provide novel insights into mechanisms of HSC engraftment. In HSC gene therapy studies dysregulation of host genes by replication-incompetent vector proviruses may lead to enrichment of repopulating clones with vector integrants near genes that influence engraftment. Thus, data from HSC gene therapy studies can be used to identify novel candidate engraftment genes. As HSC gene therapy use continues to expand, the vector insertion site data collected will be of great interest to help identify novel engraftment genes and may ultimately lead to new therapies to improve engraftment.

Dynamical screening of the van der Waals interaction between graphene layers

International Nuclear Information System (INIS)

Dappe, Y J; Bolcatto, P G; Ortega, J; Flores, F

2012-01-01

The interaction between graphene layers is analyzed combining local orbital DFT and second order perturbation theory. For this purpose we use the linear combination of atomic orbitals-orbital occupancy (LCAO-OO) formalism, that allows us to separate the interaction energy as the sum of a weak chemical interaction between graphene layers plus the van der Waals interaction (Dappe et al 2006 Phys. Rev. B 74 205434). In this work, the weak chemical interaction is calculated by means of corrected-LDA calculations using an atomic-like sp 3 d 5 basis set. The van der Waals interaction is calculated by means of second order perturbation theory using an atom-atom interaction approximation and the atomic-like-orbital occupancies. We also analyze the effect of dynamical screening in the van der Waals interaction using a simple model. We find that this dynamical screening reduces by 40% the van der Waals interaction. Taking this effect into account, we obtain a graphene-graphene interaction energy of 70 ± 5 meV/atom in reasonable agreement with the experimental evidence.

Dynamical screening of the van der Waals interaction between graphene layers.

Science.gov (United States)

Dappe, Y J; Bolcatto, P G; Ortega, J; Flores, F

2012-10-24

The interaction between graphene layers is analyzed combining local orbital DFT and second order perturbation theory. For this purpose we use the linear combination of atomic orbitals-orbital occupancy (LCAO-OO) formalism, that allows us to separate the interaction energy as the sum of a weak chemical interaction between graphene layers plus the van der Waals interaction (Dappe et al 2006 Phys. Rev. B 74 205434). In this work, the weak chemical interaction is calculated by means of corrected-LDA calculations using an atomic-like sp(3)d(5) basis set. The van der Waals interaction is calculated by means of second order perturbation theory using an atom-atom interaction approximation and the atomic-like-orbital occupancies. We also analyze the effect of dynamical screening in the van der Waals interaction using a simple model. We find that this dynamical screening reduces by 40% the van der Waals interaction. Taking this effect into account, we obtain a graphene-graphene interaction energy of 70 ± 5 meV/atom in reasonable agreement with the experimental evidence.

High-Throughput Behavioral Screens: the First Step towards Finding Genes Involved in Vertebrate Brain Function Using Zebrafish

Directory of Open Access Journals (Sweden)

Robert Gerlai

2010-04-01

Full Text Available The zebrafish has been in the forefront of developmental biology for three decades and has become a favorite of geneticists. Due to the accumulated genetic knowledge and tools developed for the zebrafish it is gaining popularity in other disciplines, including neuroscience. The zebrafish offers a compromise between system complexity (it is a vertebrate similar in many ways to our own species and practical simplicity (it is small, easy to keep, and prolific. Such features make zebrafish an excellent choice for high throughput mutation and drug screening. For the identification of mutation or drug induced alteration of brain function arguably the best methods are behavioral test paradigms. This review does not present experimental examples for the identification of particular genes or drugs. Instead it describes how behavioral screening methods may enable one to find functional alterations in the vertebrate brain. Furthermore, the review is not comprehensive. The behavioral test examples presented are biased according to the personal interests of the author. They will cover research areas including learning and memory, fear and anxiety, and social behavior. Nevertheless, the general principles will apply to other functional domains and should represent a snapshot of the rapidly evolving behavioral screening field with zebrafish.

Chemical Screening for Bioactivated Electrophilic Metabolites Using Alginate Immobilization of Metabolic Enzymes (AIME) (SOT)

Science.gov (United States)

The US EPA's ToxCast program is designed to assess chemical perturbations of molecular and cellular endpoints using a variety of high-throughput screening (HTS) assays. However, existing HTS assays have limited or no xenobiotic metabolism which could lead to a mischaracterization...

On the non-perturbative effects

International Nuclear Information System (INIS)

Manjavidze, J.; Voronyuk, V.

2004-01-01

The quantum correspondence principle based on the time reversibility is adopted to take into account the non-Abelian symmetry constrains. The main properties of the new strong-coupling perturbation theory which take into account non-perturbative effects are described. (author)

Systematic screen for mutants resistant to TORC1 inhibition in fission yeast reveals genes involved in cellular ageing and growth

Directory of Open Access Journals (Sweden)

Charalampos Rallis

2014-01-01

Target of rapamycin complex 1 (TORC1, which controls growth in response to nutrients, promotes ageing in multiple organisms. The fission yeast Schizosaccharomyces pombe emerges as a valuable genetic model system to study TORC1 function and cellular ageing. Here we exploited the combinatorial action of rapamycin and caffeine, which inhibit fission yeast growth in a TORC1-dependent manner. We screened a deletion library, comprising ∼84% of all non-essential fission yeast genes, for drug-resistant mutants. This screen identified 33 genes encoding functions such as transcription, kinases, mitochondrial respiration, biosynthesis, intra-cellular trafficking, and stress response. Among the corresponding mutants, 5 showed shortened and 21 showed increased maximal chronological lifespans; 15 of the latter mutants showed no further lifespan increase with rapamycin and might thus represent key targets downstream of TORC1. We pursued the long-lived sck2 mutant with additional functional analyses, revealing that the Sck2p kinase functions within the TORC1 network and is required for normal cell growth, global protein translation, and ribosomal S6 protein phosphorylation in a nutrient-dependent manner. Notably, slow cell growth was associated with all long-lived mutants while oxidative-stress resistance was not.

XRN2 Autoregulation and Control of Polycistronic Gene Expresssion in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Takashi S Miki

2016-09-01

Full Text Available XRN2 is a conserved 5'→3' exoribonuclease that complexes with proteins that contain XRN2-binding domains (XTBDs. In Caenorhabditis elegans (C. elegans, the XTBD-protein PAXT-1 stabilizes XRN2 to retain its activity. XRN2 activity is also promoted by 3'(2',5'-bisphosphate nucleotidase 1 (BPNT1 through hydrolysis of an endogenous XRN inhibitor 3'-phosphoadenosine-5'-phosphate (PAP. Here, we find through unbiased screening that loss of bpnt-1 function suppresses lethality caused by paxt-1 deletion. This unexpected finding is explained by XRN2 autoregulation, which occurs through repression of a cryptic promoter activity and destabilization of the xrn-2 transcript. De-repression appears to be triggered such that more robust XRN2 perturbation, by elimination of both PAXT-1 and BPNT1, is less detrimental to worm viability than absence of PAXT-1 alone. Indeed, we find that two distinct XRN2 repression mechanisms are alleviated at different thresholds of XRN2 inactivation. Like more than 15% of C. elegans genes, xrn-2 occurs in an operon, and we identify additional operons under its control, consistent with a broader function of XRN2 in polycistronic gene regulation. Regulation occurs through intercistronic regions that link genes in an operon, but a part of the mechanisms may allow XRN2 to operate on monocistronic genes in organisms lacking operons.

The dynamic ergodic divertor in TEXTOR-A novel tool for studying magnetic perturbation field effects

International Nuclear Information System (INIS)

Neubauer, O.; Czymek, G.; Finken, K.H.; Giesen, B.; Huettemann, P.W.; Lambertz, H.T.; Schruff, J.

2005-01-01

Recently TEXTOR has been upgraded by the installation of the dynamic ergodic divertor (DED). The purpose of the DED is to influence transport parameters in plasma edge and core and to study the resulting effects on heat exhaust, edge cooling, impurity screening, plasma confinement and stability. Alternatively, the DED creates static or rotating multipolar helical magnetic perturbation fields of different mode patterns. A set of 16 helical coils has been installed on the inboard high-field side of the vacuum vessel. Rotating fields of up to 10 kHz can be generated. A novel coil design has been developed which fulfills the various mechanical, electrical, high frequency, thermal, and vacuum requirements. In addition to the various technical aspects of the DED design, implementation and commissioning, highlights of recent experiments will be presented. In particular the impact of the perturbation field on MHD stability and plasma rotation will be addressed

Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.

Science.gov (United States)

Konermann, Silvana; Brigham, Mark D; Trevino, Alexandro E; Joung, Julia; Abudayyeh, Omar O; Barcena, Clea; Hsu, Patrick D; Habib, Naomi; Gootenberg, Jonathan S; Nishimasu, Hiroshi; Nureki, Osamu; Zhang, Feng

2015-01-29

Systematic interrogation of gene function requires the ability to perturb gene expression in a robust and generalizable manner. Here we describe structure-guided engineering of a CRISPR-Cas9 complex to mediate efficient transcriptional activation at endogenous genomic loci. We used these engineered Cas9 activation complexes to investigate single-guide RNA (sgRNA) targeting rules for effective transcriptional activation, to demonstrate multiplexed activation of ten genes simultaneously, and to upregulate long intergenic non-coding RNA (lincRNA) transcripts. We also synthesized a library consisting of 70,290 guides targeting all human RefSeq coding isoforms to screen for genes that, upon activation, confer resistance to a BRAF inhibitor. The top hits included genes previously shown to be able to confer resistance, and novel candidates were validated using individual sgRNA and complementary DNA overexpression. A gene expression signature based on the top screening hits correlated with markers of BRAF inhibitor resistance in cell lines and patient-derived samples. These results collectively demonstrate the potential of Cas9-based activators as a powerful genetic perturbation technology.

Evolution of the curvature perturbations during warm inflation

International Nuclear Information System (INIS)

Matsuda, Tomohiro

2009-01-01

This paper considers warm inflation as an interesting application of multi-field inflation. Delta-N formalism is used for the calculation of the evolution of the curvature perturbations during warm inflation. Although the perturbations considered in this paper are decaying after the horizon exit, the corrections to the curvature perturbations sourced by these perturbations can remain and dominate the curvature perturbations at large scales. In addition to the typical evolution of the curvature perturbations, inhomogeneous diffusion rate is considered for warm inflation, which may lead to significant non-Gaussianity of the spectrum

[Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

Science.gov (United States)

Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

2014-10-18

the different subtype have the similar clinical manifestations, signs, enzyme detection and electromyography changes. Muscle biopsy plays an important role in the selection of genes to be detected. Hot spot mutation in C-terminal of the RYR1 gene can only be identified in patients with central core disease, so we suggest this hot spot gene mutation screening apply to the suspicious patient with central core disease only.

Perturbative spacetimes from Yang-Mills theory

Energy Technology Data Exchange (ETDEWEB)

Luna, Andrés [School of Physics and Astronomy, University of Glasgow,Glasgow G12 8QQ, Scotland (United Kingdom); Monteiro, Ricardo [Theoretical Physics Department, CERN,Geneva (Switzerland); Nicholson, Isobel; Ochirov, Alexander; O’Connell, Donal [Higgs Centre for Theoretical Physics,School of Physics and Astronomy, The University of Edinburgh,Edinburgh EH9 3JZ, Scotland (United Kingdom); Westerberg, Niclas [Institute of Photonics and Quantum Sciences,School of Engineering and Physical Sciences, Heriot-Watt University,Edinburgh (United Kingdom); Higgs Centre for Theoretical Physics,School of Physics and Astronomy, The University of Edinburgh,Edinburgh EH9 3JZ, Scotland (United Kingdom); White, Chris D. [Centre for Research in String Theory,School of Physics and Astronomy, Queen Mary University of London,327 Mile End Road, London E1 4NS (United Kingdom)

2017-04-12

The double copy relates scattering amplitudes in gauge and gravity theories. In this paper, we expand the scope of the double copy to construct spacetime metrics through a systematic perturbative expansion. The perturbative procedure is based on direct calculation in Yang-Mills theory, followed by squaring the numerator of certain perturbative diagrams as specified by the double-copy algorithm. The simplest spherically symmetric, stationary spacetime from the point of view of this procedure is a particular member of the Janis-Newman-Winicour family of naked singularities. Our work paves the way for applications of the double copy to physically interesting problems such as perturbative black-hole scattering.

Nonperturbative perturbation theory

International Nuclear Information System (INIS)

Bender, C.M.

1989-01-01

In this talk we describe a recently proposed graphical perturbative calculational scheme for quantum field theory. The basic idea is to expand in the power of the interaction term. For example, to solve a λφ 4 theory in d-dimensional space-time, we introduce a small parameter δ and consider a λ(φ 2 ) 1+δ field theory. We show how to expand such a theory as a series in powers of δ. The resulting perturbation series appears to have a finite radius of convergence and numerical results for low-dimensional models are good. We have computed the two-point and four-point Green's functions to second order in powers of δ and the 2n-point Green's functions (n>2) to order δ. We explain how to renormalize the theory and show that, to first order in powers of δ, when δ>0 and d≥4 the theory is free. This conclusion remains valid to second order in powers of δ, and we believe that it remains valid to all orders in powers of δ. The new perturbative scheme is consistent with global supersymmetry invariance. We examine a two-dimensional supersymmetric quantum field theory in which we do not know of any other means for doing analytical calculations. We illustrate the power of this new technique by computing the ground-state energy density E to second order in this new perturbation theory. We show that there is a beautiful and delicate cancellation between infinite classes of graphs which leads to the result that E=0. (orig.)

Screening key genes for abdominal aortic aneurysm based on gene expression omnibus dataset.

Science.gov (United States)

Wan, Li; Huang, Jingyong; Ni, Haizhen; Yu, Guanfeng

2018-02-13

Abdominal aortic aneurysm (AAA) is a common cardiovascular system disease with high mortality. The aim of this study was to identify potential genes for diagnosis and therapy in AAA. We searched and downloaded mRNA expression data from the Gene Expression Omnibus (GEO) database to identify differentially expressed genes (DEGs) from AAA and normal individuals. Then, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analysis, transcriptional factors (TFs) network and protein-protein interaction (PPI) network were used to explore the function of genes. Additionally, immunohistochemical (IHC) staining was used to validate the expression of identified genes. Finally, the diagnostic value of identified genes was accessed by receiver operating characteristic (ROC) analysis in GEO database. A total of 1199 DEGs (188 up-regulated and 1011 down-regulated) were identified between AAA and normal individual. KEGG pathway analysis displayed that vascular smooth muscle contraction and pathways in cancer were significantly enriched signal pathway. The top 10 up-regulated and top 10 down-regulated DEGs were used to construct TFs and PPI networks. Some genes with high degrees such as NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16 and FOXO1 were identified to be related to AAA. The consequences of IHC staining showed that CCR7 and PDGFA were up-regulated in tissue samples of AAA. ROC analysis showed that NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16, FOXO1 and PDGFA had the potential diagnostic value for AAA. The identified genes including NELL2, CCR7, MGAM, HBB, CSNK2A2, ZBTB16, FOXO1 and PDGFA might be involved in the pathology of AAA.

Edge localized modes control by resonant magnetic perturbations

International Nuclear Information System (INIS)

Nardon, E.

2007-10-01

The present work is dedicated to one of the most promising methods of control of the ELMs (Edge Localized Modes), based on a system of coils producing Resonant Magnetic Perturbations (RMPs). Our main objectives are, on the one hand, to improve the physical understanding of the mechanisms at play, and on the other hand to propose a concrete design of ELMs control coils for ITER. In order to calculate and analyze the magnetic perturbations produced by a given set of coils, we have developed the ERGOS code. The first ERGOS calculation was for the DIII-D ELMs control coils, the I-coils. It showed that they produce magnetic islands chains which overlap at the edge of the plasma, resulting in the ergodization of the magnetic field. We have then used ERGOS for the modelling of the experiments on ELMs control using the error field correction coils at JET and MAST. In the case of JET, we have shown the existence of a correlation between the mitigation of the ELMs and the ergodization of the magnetic field at the edge, in agreement with the DIII-D result. In order to design the ELMs control coils for ITER we have used ERGOS intensively, taking the case of the DIII-D I-coils as a reference. Three candidate designs came out, which we presented at the ITER Design Review, in 2007. Recently, the ITER management decided to provide a budget for building ELMs control coils, the design of which remains to be chosen between two of the three options that we proposed. Finally, in order to understand better the non-linear magnetohydrodynamics phenomena taking place in ELMs control by RMPs, we performed numerical simulations, in particular with the JOREK code for a DIII-D case. The simulations reveal the existence of convection cells induced at the edge by the magnetic perturbations, and the possible screening of the RMPs in presence of rotation

Kerr-CFT and gravitational perturbations

International Nuclear Information System (INIS)

Dias, Oscar J.C.; Reall, Harvey S.; Santos, Jorge E.

2009-01-01

Motivated by the Kerr-CFT conjecture, we investigate perturbations of the near-horizon extreme Kerr spacetime. The Teukolsky equation for a massless field of arbitrary spin is solved. Solutions fall into two classes: normal modes and traveling waves. Imposing suitable (outgoing) boundary conditions, we find that there are no unstable modes. The explicit form of metric perturbations is obtained using the Hertz potential formalism, and compared with the Kerr-CFT boundary conditions. The energy and angular momentum associated with scalar field and gravitational normal modes are calculated. The energy is positive in all cases. The behaviour of second order perturbations is discussed.

The power of perturbation theory

Energy Technology Data Exchange (ETDEWEB)

Serone, Marco [SISSA International School for Advanced Studies and INFN Trieste, Via Bonomea 265, 34136, Trieste (Italy); Abdus Salam International Centre for Theoretical Physics, Strada Costiera 11, 34151, Trieste (Italy); Spada, Gabriele [SISSA International School for Advanced Studies and INFN Trieste, Via Bonomea 265, 34136, Trieste (Italy); Villadoro, Giovanni [Abdus Salam International Centre for Theoretical Physics, Strada Costiera 11, 34151, Trieste (Italy)

2017-05-10

We study quantum mechanical systems with a discrete spectrum. We show that the asymptotic series associated to certain paths of steepest-descent (Lefschetz thimbles) are Borel resummable to the full result. Using a geometrical approach based on the Picard-Lefschetz theory we characterize the conditions under which perturbative expansions lead to exact results. Even when such conditions are not met, we explain how to define a different perturbative expansion that reproduces the full answer without the need of transseries, i.e. non-perturbative effects, such as real (or complex) instantons. Applications to several quantum mechanical systems are presented.

Comparison of Perturbed Pathways in Two Different Cell Models for Parkinson's Disease with Structural Equation Model.

Science.gov (United States)

Pepe, Daniele; Do, Jin Hwan

2015-12-16

Increasing evidence indicates that different morphological types of cell death coexist in the brain of patients with Parkinson's disease (PD), but the molecular explanation for this is still under investigation. In this study, we identified perturbed pathways in two different cell models for PD through the following procedures: (1) enrichment pathway analysis with differentially expressed genes and the Reactome pathway database, and (2) construction of the shortest path model for the enriched pathway and detection of significant shortest path model with fitting time-course microarray data of each PD cell model to structural equation model. Two PD cell models constructed by the same neurotoxin showed different perturbed pathways. That is, one showed perturbation of three Reactome pathways, including cellular senescence, chromatin modifying enzymes, and chromatin organization, while six modules within metabolism pathway represented perturbation in the other. This suggests that the activation of common upstream cell death pathways in PD may result in various down-stream processes, which might be associated with different morphological types of cell death. In addition, our results might provide molecular clues for coexistence of different morphological types of cell death in PD patients.

A simple screening method for detection of Klinefelter syndrome and other X-chromosome aneuploidies based on copy number of the androgen receptor gene

DEFF Research Database (Denmark)

Ottesen, A M; Garn, I D; Aksglaede, L

2007-01-01

Due to the high prevalence and variable phenotype of patients with Klinefelter syndrome, there is a need for a robust and rapid screening method allowing early diagnosis. Here, we report on the development and detailed clinical validation of a quantitative real-time PCR (qPCR)-based method...... of the copy number assessment of the androgen receptor (AR) gene, located to Xq11.2-q12. We analysed samples from 50 individuals, including a healthy male and female controls and patients with Klinefelter syndrome (47,XXY; 48,XXXY) (n = 28), mosaicisms (46,XX/47,XXY/48XXYY; 45,X/46,XY) (n = 3), other sex......-gene expression. The XIST-expression based assay was correct in only 29/36 samples (81%). Our findings demonstrated that the AR-qPCR technique is a simple and reliable screening method for diagnosis of patients with Klinefelter syndrome or other chromosomal disorders involving an aberrant number of X-chromosomes....

SCREENING OF COMMON FLAX FAD GENES BY PCR

Directory of Open Access Journals (Sweden)

Veronika Štefúnová

2013-02-01

Full Text Available Currently, flax (Linum usitatissimum L. is an important crop from commercial and economical aspects. In the spotlight is the linseed oil as a source of α-linolenic acid. The aim of presented study was to analyse fatty acid desaturase (FAD genes in flax. Several genotypes of flax (Hohenheim, La Plata 1938, Redwing USA and Escalina were used. The primers described by Vrinten et al. (2005 were used for PCR amplification reactions. Two FAD3 genes, LuFAD3A and LuFAD3B, were identified in a genome of flax. Subsequently the nucleotide sequences between origins and genotypes of flax FAD genes were compared. Primarily were used the nucleotide sequences of FAD2 and FAD3C genes available in NCBI database. Differences were found using BLAST program in nucleotide sequences of FAD genes and the specific primers were designed to amplify a specific target sequences in a genome of flax. These primers were used in PCR amplification reactions to identification of FAD2 and FAD3C genes. The PCR products were separated by electrophoresis on agarose gel.

Non-adiabatic perturbations in multi-component perfect fluids

Energy Technology Data Exchange (ETDEWEB)

Koshelev, N.A., E-mail: koshna71@inbox.ru [Ulyanovsk State University, Leo Tolstoy str 42, 432970 (Russian Federation)

2011-04-01

The evolution of non-adiabatic perturbations in models with multiple coupled perfect fluids with non-adiabatic sound speed is considered. Instead of splitting the entropy perturbation into relative and intrinsic parts, we introduce a set of symmetric quantities, which also govern the non-adiabatic pressure perturbation in models with energy transfer. We write the gauge invariant equations for the variables that determine on a large scale the non-adiabatic pressure perturbation and the rate of changes of the comoving curvature perturbation. The analysis of evolution of the non-adiabatic pressure perturbation has been made for several particular models.

Non-adiabatic perturbations in multi-component perfect fluids

International Nuclear Information System (INIS)

Koshelev, N.A.

2011-01-01

The evolution of non-adiabatic perturbations in models with multiple coupled perfect fluids with non-adiabatic sound speed is considered. Instead of splitting the entropy perturbation into relative and intrinsic parts, we introduce a set of symmetric quantities, which also govern the non-adiabatic pressure perturbation in models with energy transfer. We write the gauge invariant equations for the variables that determine on a large scale the non-adiabatic pressure perturbation and the rate of changes of the comoving curvature perturbation. The analysis of evolution of the non-adiabatic pressure perturbation has been made for several particular models

Screening non-classical 21-hydroxylase gene deficiency from patients diagnosed as polycystic ovary syndrome by gene assay

Directory of Open Access Journals (Sweden)

Jie HU

2016-04-01

Full Text Available Objective 　To screen non-classical 21-hydroxylase deficiency (NC-21OHD from patients diagnosed as polycystic ovary syndrome (PCOS by gene assay. Methods 　Ninety-eight patients with PCOS were enrolled according to 2003 Rotterdam criteria from Department of Endocrinology, Tangdu Hospital of Fourth Military Medical University, and they were divided into three groups according to the modified Ferriman-Gallway (mF-G score as follows: group A with score 0-2; group B with score 3-5, and group C with score ≥6. Meanwhile, 30 healthy subjects from the Medical Center of the Hospital were recruited as control group. Peripheral blood of all subjects were collected for extracting DNA, the CYP21A2 gene were amplified by 5 pairs of specific primers, and then the PCR products were sequenced by Shanghai Sangon Co. The subjects would accept test for serum cortisol and adrenocorticotropic hormone (ACTH at 8:00am if their CYP21A2 was proved to be abnormal. Results 　Thirty subjects of control group had no any defects in CYP21A2, but 5 of 98 patients with PCOS were proved to be deficient in CYP21A2, and the genotypes were V281L/920-921insT (P1, V281L/I230M (P2, V281L/Normal (P3, P4, P5, respectively, and all of them were heterozygous mutations. The incidences of NC-21OHD in group C and B were 28.6% and 3.3%, respectively. Genotype P1 had been identified to belong to NC-21OHD, which was consistent with its clinical phenotype. All genotypes P3, P4 and P5 belonged to carriers. But for P2, since I230M hadn't been reported in literature, the patient with V281L/I230M couldn't be classified now. Serum biochemical results showed that only in P1 the cortisol was close to the normal lower level, and ACTH was close to the normal upper limit of the reported level in the literature, and the remainders were all normal. Conclusions 　Although PCOS and NC-21OHD are very similar in clinical manifestations, they are different completely in the pathogenesis and treatment. So it

Cell-specific prediction and application of drug-induced gene expression profiles.

Science.gov (United States)

Hodos, Rachel; Zhang, Ping; Lee, Hao-Chih; Duan, Qiaonan; Wang, Zichen; Clark, Neil R; Ma'ayan, Avi; Wang, Fei; Kidd, Brian; Hu, Jianying; Sontag, David; Dudley, Joel

2018-01-01

Gene expression profiling of in vitro drug perturbations is useful for many biomedical discovery applications including drug repurposing and elucidation of drug mechanisms. However, limited data availability across cell types has hindered our capacity to leverage or explore the cell-specificity of these perturbations. While recent efforts have generated a large number of drug perturbation profiles across a variety of human cell types, many gaps remain in this combinatorial drug-cell space. Hence, we asked whether it is possible to fill these gaps by predicting cell-specific drug perturbation profiles using available expression data from related conditions--i.e. from other drugs and cell types. We developed a computational framework that first arranges existing profiles into a three-dimensional array (or tensor) indexed by drugs, genes, and cell types, and then uses either local (nearest-neighbors) or global (tensor completion) information to predict unmeasured profiles. We evaluate prediction accuracy using a variety of metrics, and find that the two methods have complementary performance, each superior in different regions in the drug-cell space. Predictions achieve correlations of 0.68 with true values, and maintain accurate differentially expressed genes (AUC 0.81). Finally, we demonstrate that the predicted profiles add value for making downstream associations with drug targets and therapeutic classes.

A Screening Method for the ALK Fusion Gene in NSCLC

International Nuclear Information System (INIS)

Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

2012-01-01

Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

Closed form bound-state perturbation theory

Directory of Open Access Journals (Sweden)

Ollie J. Rose

1980-01-01

Full Text Available The perturbed Schrödinger eigenvalue problem for bound states is cast into integral form using Green's Functions. A systematic algorithm is developed and applied to the resulting equation giving rise to approximate solutions expressed as functions of the given perturbation parameter. As a by-product, convergence radii for the traditional Rayleigh-Schrödinger and Brillouin-Wigner perturbation theories emerge in a natural way.

On summation of perturbation expansions

International Nuclear Information System (INIS)

Horzela, A.

1985-04-01

The problem of the restoration of physical quantities defined by divergent perturbation expansions is analysed. The Pad'e and Borel summability is proved for alternating perturbation expansions with factorially growing coefficients. The proof is based on the methods of the classical moments theory. 17 refs. (author)

Perturbation theory and collision probability formalism. Vol. 2

Energy Technology Data Exchange (ETDEWEB)

Nasr, M [National Center for Nuclear Safety and Radiation Control, Atomic Energy Authority, Cairo (Egypt)

1996-03-01

Perturbation theory is commonly used in evaluating the activity effects, particularly those resulting from small and localized perturbation in multiplying media., e.g. in small sample reactivity measurements. The Boltzmann integral transport equation is generally used for evaluating the direct and adjoint fluxes in the heterogenous lattice cells to be used in the perturbation equations. When applying perturbation theory in this formalism, a term involving the perturbation effects on the special transfer kernel arises. This term is difficult to evaluate correctly, since it involves an integration all over the entire system. The main advantage of the perturbation theory which is the limitation of the integration procedure on the perturbation region is found to be of no practical use in such cases. In the present work, the perturbation equation in the collision probability formalism is analyzed. A mathematical treatment of the term in question is performed. A new mathematical expression for this term is derived. The new expression which can be estimated easily is derived.

Anticipation of direction and time of perturbation modulates the onset latency of trunk muscle responses during sitting perturbations.

Science.gov (United States)

Milosevic, Matija; Shinya, Masahiro; Masani, Kei; Patel, Kramay; McConville, Kristiina M V; Nakazawa, Kimitaka; Popovic, Milos R

2016-02-01

Trunk muscles are responsible for maintaining trunk stability during sitting. However, the effects of anticipation of perturbation on trunk muscle responses are not well understood. The objectives of this study were to identify the responses of trunk muscles to sudden support surface translations and quantify the effects of anticipation of direction and time of perturbation on the trunk neuromuscular responses. Twelve able-bodied individuals participated in the study. Participants were seated on a kneeling chair and support surface translations were applied in the forward and backward directions with and without direction and time of perturbation cues. The trunk started moving on average approximately 40ms after the perturbation. During unanticipated perturbations, average latencies of the trunk muscle contractions were in the range between 103.4 and 117.4ms. When participants anticipated the perturbations, trunk muscle latencies were reduced by 16.8±10.0ms and the time it took the trunk to reach maximum velocity was also reduced, suggesting a biomechanical advantage caused by faster muscle responses. These results suggested that trunk muscles have medium latency responses and use reflexive mechanisms. Moreover, anticipation of perturbation decreased trunk muscles latencies, suggesting that the central nervous system modulated readiness of the trunk based on anticipatory information. Copyright © 2015 Elsevier Ltd. All rights reserved.

Secondary isocurvature perturbations from acoustic reheating

Science.gov (United States)

Ota, Atsuhisa; Yamaguchi, Masahide

2018-06-01

The superhorizon (iso)curvature perturbations are conserved if the following conditions are satisfied: (i) (each) non adiabatic pressure perturbation is zero, (ii) the gradient terms are ignored, that is, at the leading order of the gradient expansion (iii) (each) total energy momentum tensor is conserved. We consider the case with the violation of the last two requirements and discuss the generation of secondary isocurvature perturbations during the late time universe. Second order gradient terms are not necessarily ignored even if we are interested in the long wavelength modes because of the convolutions which may pick products of short wavelength perturbations up. We then introduce second order conserved quantities on superhorizon scales under the conditions (i) and (iii) even in the presence of the gradient terms by employing the full second order cosmological perturbation theory. We also discuss the violation of the condition (iii), that is, the energy momentum tensor is conserved for the total system but not for each component fluid. As an example, we explicitly evaluate second order heat conduction between baryons and photons due to the weak Compton scattering, which dominates during the period just before recombination. We show that such secondary effects can be recast into the isocurvature perturbations on superhorizon scales if the local type primordial non Gaussianity exists a priori.

Generalized chiral perturbation theory

International Nuclear Information System (INIS)

Knecht, M.; Stern, J.

1994-01-01

The Generalized Chiral Perturbation Theory enlarges the framework of the standard χPT (Chiral Perturbation Theory), relaxing certain assumptions which do not necessarily follow from QCD or from experiment, and which are crucial for the usual formulation of the low energy expansion. In this way, experimental tests of the foundations of the standard χPT become possible. Emphasis is put on physical aspects rather than on formal developments of GχPT. (author). 31 refs

Impact of gene patents and licensing practices on access to genetic testing and carrier screening for Tay-Sachs and Canavan disease.

Science.gov (United States)

Colaianni, Alessandra; Chandrasekharan, Subhashini; Cook-Deegan, Robert

2010-04-01

Genetic testing for Tay-Sachs and Canavan disease is particularly important for Ashkenazi Jews, because both conditions are more frequent in that population. This comparative case study was possible because of different patenting and licensing practices. The role of DNA testing differs between Tay-Sachs and Canavan diseases. The first-line screening test for Tay-Sachs remains an enzyme activity test rather than genotyping. Genotyping is used for preimplantation diagnosis and confirmatory testing. In contrast, DNA-based testing is the basis for Canavan screening and diagnosis. The HEXA gene for Tay-Sachs was cloned at the National Institutes of Health, and the gene was patented but has not been licensed. The ASPA gene for Canavan disease was cloned and patented by Miami Children's Hospital. Miami Children's Hospital did not inform family members and patient groups that had contributed to the gene discovery that it was applying for a patent, and pursued restrictive licensing practices when a patent issued in 1997. This led to intense controversy, litigation, and a sealed, nonpublic 2003 settlement that apparently allowed for nonexclusive licensing. A survey of laboratories revealed a possible price premium for ASPA testing, with per-unit costs higher than for other genetic tests in the Secretary's Advisory Committee on Genetics, Health, and Society case studies. The main conclusion from comparing genetic testing for Tay-Sachs and Canavan diseases, however, is that patenting and licensing conducted without communication with patients and advocates cause mistrust and can lead to controversy and litigation, a negative model to contrast with the positive model of patenting and licensing for genetic testing of cystic fibrosis.

Stepping stability: effects of sensory perturbation

Directory of Open Access Journals (Sweden)

Krebs David E

2005-05-01

Full Text Available Abstract Background Few tools exist for quantifying locomotor stability in balance impaired populations. The objective of this study was to develop and evaluate a technique for quantifying stability of stepping in healthy people and people with peripheral (vestibular hypofunction, VH and central (cerebellar pathology, CB balance dysfunction by means a sensory (auditory perturbation test. Methods Balance impaired and healthy subjects performed a repeated bench stepping task. The perturbation was applied by suddenly changing the cadence of the metronome (100 beat/min to 80 beat/min at a predetermined time (but unpredictable by the subject during the trial. Perturbation response was quantified by computing the Euclidian distance, expressed as a fractional error, between the anterior-posterior center of gravity attractor trajectory before and after the perturbation was applied. The error immediately after the perturbation (Emax, error after recovery (Emin and the recovery response (Edif were documented for each participant, and groups were compared with ANOVA. Results Both balance impaired groups exhibited significantly higher Emax (p = .019 and Emin (p = .028 fractional errors compared to the healthy (HE subjects, but there were no significant differences between CB and VH groups. Although response recovery was slower for CB and VH groups compared to the HE group, the difference was not significant (p = .051. Conclusion The findings suggest that individuals with balance impairment have reduced ability to stabilize locomotor patterns following perturbation, revealing the fragility of their impairment adaptations and compensations. These data suggest that auditory perturbations applied during a challenging stepping task may be useful for measuring rehabilitation outcomes.

Genome wide expression analysis suggests perturbation of vascular homeostasis during high altitude pulmonary edema.

Directory of Open Access Journals (Sweden)

Manish Sharma

Full Text Available BACKGROUND: High altitude pulmonary edema (HAPE is a life-threatening form of non-cardiogenic edema which occurs in unacclimatized but otherwise normal individuals within two to four days after rapid ascent to altitude beyond 3000 m. The precise pathoetiology and inciting mechanisms regulating HAPE remain unclear. METHODOLOGY/PRINCIPLE FINDINGS: We performed global gene expression profiling in individuals with established HAPE compared to acclimatized individuals. Our data suggests concurrent modulation of multiple pathways which regulate vascular homeostasis and consequently lung fluid dynamics. These pathways included those which regulate vasoconstriction through smooth muscle contraction, cellular actin cytoskeleton rearrangements and endothelial permeability/dysfunction. Some notable genes within these pathways included MYLK; rho family members ARGEF11, ARHGAP24; cell adhesion molecules such as CLDN6, CLDN23, PXN and VCAM1 besides other signaling intermediates. Further, several important regulators of systemic/pulmonary hypertension including ADRA1D, ECE1, and EDNRA were upregulated in HAPE. We also observed significant upregulation of genes involved in paracrine signaling through chemokines and lymphocyte activation pathways during HAPE represented by transcripts of TNF, JAK2, MAP2K2, MAP2K7, MAPK10, PLCB1, ARAF, SOS1, PAK3 and RELA amongst others. Perturbation of such pathways can potentially skew vascular homeostatic equilibrium towards altered vascular permeability. Additionally, differential regulation of hypoxia-sensing, hypoxia-response and OXPHOS pathway genes in individuals with HAPE were also observed. CONCLUSIONS/SIGNIFICANCE: Our data reveals specific components of the complex molecular circuitry underlying HAPE. We show concurrent perturbation of multiple pathways regulating vascular homeostasis and suggest multi-genic nature of regulation of HAPE.

Cosmological perturbations beyond linear order

CERN Multimedia

CERN. Geneva

2013-01-01

Cosmological perturbation theory is the standard tool to understand the formation of the large scale structure in the Universe. However, its degree of applicability is limited by the growth of the amplitude of the matter perturbations with time. This problem can be tackled with by using N-body simulations or analytical techniques that go beyond the linear calculation. In my talk, I'll summarise some recent efforts in the latter that ameliorate the bad convergence of the standard perturbative expansion. The new techniques allow better analytical control on observables (as the matter power spectrum) over scales very relevant to understand the expansion history and formation of structure in the Universe.

Instabilities in mimetic matter perturbations

Energy Technology Data Exchange (ETDEWEB)

Firouzjahi, Hassan; Gorji, Mohammad Ali [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), P.O. Box 19395-5531, Tehran (Iran, Islamic Republic of); Mansoori, Seyed Ali Hosseini, E-mail: firouz@ipm.ir, E-mail: gorji@ipm.ir, E-mail: shosseini@shahroodut.ac.ir, E-mail: shossein@ipm.ir [Physics Department, Shahrood University of Technology, P.O. Box 3619995161 Shahrood (Iran, Islamic Republic of)

2017-07-01

We study cosmological perturbations in mimetic matter scenario with a general higher derivative function. We calculate the quadratic action and show that both the kinetic term and the gradient term have the wrong sings. We perform the analysis in both comoving and Newtonian gauges and confirm that the Hamiltonians and the associated instabilities are consistent with each other in both gauges. The existence of instabilities is independent of the specific form of higher derivative function which generates gradients for mimetic field perturbations. It is verified that the ghost instability in mimetic perturbations is not associated with the higher derivative instabilities such as the Ostrogradsky ghost.

Gauge-invariant perturbations in a spatially flat anisotropic universe

International Nuclear Information System (INIS)

Den, Mitsue.

1986-12-01

The gauge-invariant perturbations in a spatially flat anisotropic universe with an arbitrary dimension (= N) are studied. In a previous paper the equations for the perturbations with a wave vector k a in one of the axial directions were derived and their solutions were shown. In this paper the perturbations with k a in arbitrary directions are treated. The remarkable properties are that all three types (scalar, vector, and tensor) of perturbations are generally coupled, so that a density perturbation can be produced also by vector or tensor perturbations. The formulation is quite general, but the behavior of the perturbations is discussed in a simple case such that N = 4 and k a is orthogonal to one of the axial directions. In this case, the perturbations are divided into two groups which are dynamically decoupled from each other. The asymptotic behavior of the perturbations in the group containing the density perturbation is discussed. (author)

Genome-wide screening of the genes required for tolerance to vanillin, which is a potential inhibitor of bioethanol fermentation, in Saccharomyces cerevisiae.

Science.gov (United States)

Endo, Ayako; Nakamura, Toshihide; Ando, Akira; Tokuyasu, Ken; Shima, Jun

2008-04-15

Lignocellulosic materials are abundant and among the most important potential sources for bioethanol production. Although the pretreatment of lignocellulose is necessary for efficient saccharification and fermentation, numerous by-products, including furan derivatives, weak acids, and phenolic compounds, are generated in the pretreatment step. Many of these components inhibit the growth and fermentation of yeast. In particular, vanillin is one of the most effective inhibitors in lignocellulose hydrolysates because it inhibits fermentation at very low concentrations. To identify the genes required for tolerance to vanillin, we screened a set of diploid yeast deletion mutants, which are powerful tools for clarifying the function of particular genes. Seventy-six deletion mutants were identified as vanillin-sensitive mutants. The numerous deleted genes in the vanillin-sensitive mutants were classified under the functional categories for 'chromatin remodeling' and 'vesicle transport', suggesting that these functions are important for vanillin tolerance. The cross-sensitivity of the vanillin-sensitive mutants to furan derivatives, weak acids, and phenolic compounds was also examined. Genes for ergosterol biosynthesis were required for tolerance to all inhibitory compounds tested, suggesting that ergosterol is a key component of tolerance to various inhibitors. Our analysis predicts that vanillin tolerance in Saccharomyces cerevisiae is affected by various complicated processes that take place on both the molecular and the cellular level. In addition, the ergosterol biosynthetic process is important for achieving a tolerance to various inhibitors. Our findings provide a biotechnological basis for the molecular engineering as well as for screening of more robust yeast strains that may potentially be useful in bioethanol fermentation.

A genome-wide screen for genetic variants that modify the recruitment of REST to its target genes.

Directory of Open Access Journals (Sweden)

Rory Johnson

Full Text Available Increasing numbers of human diseases are being linked to genetic variants, but our understanding of the mechanistic links leading from DNA sequence to disease phenotype is limited. The majority of disease-causing nucleotide variants fall within the non-protein-coding portion of the genome, making it likely that they act by altering gene regulatory sequences. We hypothesised that SNPs within the binding sites of the transcriptional repressor REST alter the degree of repression of target genes. Given that changes in the effective concentration of REST contribute to several pathologies-various cancers, Huntington's disease, cardiac hypertrophy, vascular smooth muscle proliferation-these SNPs should alter disease-susceptibility in carriers. We devised a strategy to identify SNPs that affect the recruitment of REST to target genes through the alteration of its DNA recognition element, the RE1. A multi-step screen combining genetic, genomic, and experimental filters yielded 56 polymorphic RE1 sequences with robust and statistically significant differences of affinity between alleles. These SNPs have a considerable effect on the the functional recruitment of REST to DNA in a range of in vitro, reporter gene, and in vivo analyses. Furthermore, we observe allele-specific biases in deeply sequenced chromatin immunoprecipitation data, consistent with predicted differenes in RE1 affinity. Amongst the targets of polymorphic RE1 elements are important disease genes including NPPA, PTPRT, and CDH4. Thus, considerable genetic variation exists in the DNA motifs that connect gene regulatory networks. Recently available ChIP-seq data allow the annotation of human genetic polymorphisms with regulatory information to generate prior hypotheses about their disease-causing mechanism.

A Genome-Wide Screen for Genetic Variants That Modify the Recruitment of REST to Its Target Genes

Science.gov (United States)

Johnson, Rory; Richter, Nadine; Bogu, Gireesh K.; Bhinge, Akshay; Teng, Siaw Wei; Choo, Siew Hua; Andrieux, Lise O.; de Benedictis, Cinzia; Jauch, Ralf; Stanton, Lawrence W.

2012-01-01

Increasing numbers of human diseases are being linked to genetic variants, but our understanding of the mechanistic links leading from DNA sequence to disease phenotype is limited. The majority of disease-causing nucleotide variants fall within the non-protein-coding portion of the genome, making it likely that they act by altering gene regulatory sequences. We hypothesised that SNPs within the binding sites of the transcriptional repressor REST alter the degree of repression of target genes. Given that changes in the effective concentration of REST contribute to several pathologies—various cancers, Huntington's disease, cardiac hypertrophy, vascular smooth muscle proliferation—these SNPs should alter disease-susceptibility in carriers. We devised a strategy to identify SNPs that affect the recruitment of REST to target genes through the alteration of its DNA recognition element, the RE1. A multi-step screen combining genetic, genomic, and experimental filters yielded 56 polymorphic RE1 sequences with robust and statistically significant differences of affinity between alleles. These SNPs have a considerable effect on the the functional recruitment of REST to DNA in a range of in vitro, reporter gene, and in vivo analyses. Furthermore, we observe allele-specific biases in deeply sequenced chromatin immunoprecipitation data, consistent with predicted differenes in RE1 affinity. Amongst the targets of polymorphic RE1 elements are important disease genes including NPPA, PTPRT, and CDH4. Thus, considerable genetic variation exists in the DNA motifs that connect gene regulatory networks. Recently available ChIP–seq data allow the annotation of human genetic polymorphisms with regulatory information to generate prior hypotheses about their disease-causing mechanism. PMID:22496669

Lattice regularized chiral perturbation theory

International Nuclear Information System (INIS)

Borasoy, Bugra; Lewis, Randy; Ouimet, Pierre-Philippe A.

2004-01-01

Chiral perturbation theory can be defined and regularized on a spacetime lattice. A few motivations are discussed here, and an explicit lattice Lagrangian is reviewed. A particular aspect of the connection between lattice chiral perturbation theory and lattice QCD is explored through a study of the Wess-Zumino-Witten term

Output synchronization of chaotic systems under nonvanishing perturbations

Energy Technology Data Exchange (ETDEWEB)

Lopez-Mancilla, Didier [Departamento de Ciencias Exactas y Tecnologicas, Centro Universitario de los Lagos, Universidad de Guadalajara (CULagos-UdeG), Enrique Diaz de Leon s/n, 47460 Lagos de Moreno, Jal. (Mexico)], E-mail: didier@uabc.mx; Cruz-Hernandez, Cesar [Electronics and Telecommunications Department, Scientific Research and Advanced Studies of Ensenada (CICESE), Km. 107, Carretera Tijuana-Ensenada, 22860 Ensenada, B.C. (Mexico)], E-mail: ccruz@cicese.mx

2008-08-15

In this paper, an analysis for chaos synchronization under nonvanishing perturbations is presented. In particular, we use model-matching approach from nonlinear control theory for output synchronization of identical and nonidentical chaotic systems under nonvanishing perturbations in a master-slave configuration. We show that the proposed approach is indeed suitable to synchronize a class of perturbed slaves with a chaotic master system; that is the synchronization error trajectories remain bounded if the perturbations satisfy some conditions. In order to illustrate this robustness synchronization property, we present two cases of study: (i) for identical systems, a pair of coupled Roessler systems, the first like a master and the other like a perturbed slave, and (ii) for nonidentical systems, a Chua's circuit driving a Roessler/slave system with a perturbed control law, in both cases a quantitative analysis on the perturbation is included.

Output synchronization of chaotic systems under nonvanishing perturbations

International Nuclear Information System (INIS)

Lopez-Mancilla, Didier; Cruz-Hernandez, Cesar

2008-01-01

In this paper, an analysis for chaos synchronization under nonvanishing perturbations is presented. In particular, we use model-matching approach from nonlinear control theory for output synchronization of identical and nonidentical chaotic systems under nonvanishing perturbations in a master-slave configuration. We show that the proposed approach is indeed suitable to synchronize a class of perturbed slaves with a chaotic master system; that is the synchronization error trajectories remain bounded if the perturbations satisfy some conditions. In order to illustrate this robustness synchronization property, we present two cases of study: (i) for identical systems, a pair of coupled Roessler systems, the first like a master and the other like a perturbed slave, and (ii) for nonidentical systems, a Chua's circuit driving a Roessler/slave system with a perturbed control law, in both cases a quantitative analysis on the perturbation is included

Two-body perturbation theory versus first order perturbation theory: A comparison based on the square-well fluid.

Science.gov (United States)

Mercier Franco, Luís Fernando; Castier, Marcelo; Economou, Ioannis G

2017-12-07

We show that the Zwanzig first-order perturbation theory can be obtained directly from a truncated Taylor series expansion of a two-body perturbation theory and that such truncation provides a more accurate prediction of thermodynamic properties than the full two-body perturbation theory. This unexpected result is explained by the quality of the resulting approximation for the fluid radial distribution function. We prove that the first-order and the two-body perturbation theories are based on different approximations for the fluid radial distribution function. To illustrate the calculations, the square-well fluid is adopted. We develop an analytical expression for the two-body perturbed Helmholtz free energy for the square-well fluid. The equation of state obtained using such an expression is compared to the equation of state obtained from the first-order approximation. The vapor-liquid coexistence curve and the supercritical compressibility factor of a square-well fluid are calculated using both equations of state and compared to Monte Carlo simulation data. Finally, we show that the approximation for the fluid radial distribution function given by the first-order perturbation theory provides closer values to the ones calculated via Monte Carlo simulations. This explains why such theory gives a better description of the fluid thermodynamic behavior.

BRCA1 and BRCA2 Gene Mutations Screening In Sporadic Breast Cancer Patients In Kazakhstan.

Directory of Open Access Journals (Sweden)

Ainur R. Akilzhanova

2013-05-01

Full Text Available Background: A large number of distinct mutations in the BRCA1 and BRCA2 genes have been reported worldwide, but little is known regarding the role of these inherited susceptibility genes in breast cancer risk among Kazakhstan women. Aim: To evaluate the role of BRCA1/2 mutations in Kazakhstan women presenting with sporadic breast cancer. Methods: We investigated the distribution and nature of polymorphisms in BRCA1 and BRCA2 entire coding regions in 156 Kazakhstan sporadic breast cancer cases and 112 age-matched controls using automatic direct sequencing. Results: We identified 22 distinct variants, including 16 missense mutations and 6 polymorphisms in BRCA1/2 genes. In BRCA1, 9 missense mutations and 3 synonymous polymorphisms were observed. In BRCA2, 7 missense mutations and 3 polymorphisms were detected. There was a higher prevalence of observed mutations in Caucasian breast cancer cases compared to Asian cases (p<0.05; higher frequencies of sequence variants were observed in Asian controls. No recurrent or founder mutations were observed in BRCA1/2 genes. There were no statistically significant differences in age at diagnosis, tumor histology, size of tumor, and lymph node involvement between women with breast cancer with or without the BRCA sequence alterations. Conclusions: Considering the majority of breast cancer cases are sporadic, the present study will be helpful in the evaluation of the need for the genetic screening of BRCA1/2 mutations and reliable genetic counseling for Kazakhstan sporadic breast cancer patients. Evaluation of common polymorphisms and mutations and breast cancer risk in families with genetic predisposition to breast cancer is ongoing in another current investigation. 

The performance of the SEPT9 gene methylation assay and a comparison with other CRC screening tests: A meta-analysis.

Science.gov (United States)

Song, Lele; Jia, Jia; Peng, Xiumei; Xiao, Wenhua; Li, Yuemin

2017-06-08

The SEPT9 gene methylation assay is the first FDA-approved blood assay for colorectal cancer (CRC) screening. Fecal immunochemical test (FIT), FIT-DNA test and CEA assay are also in vitro diagnostic (IVD) tests used in CRC screening. This meta-analysis aims to review the SEPT9 assay performance and compare it with other IVD CRC screening tests. By searching the Ovid MEDLINE, EMBASE, CBMdisc and CJFD database, 25 out of 180 studies were identified to report the SEPT9 assay performance. 2613 CRC cases and 6030 controls were included, and sensitivity and specificity were used to evaluate its performance at various algorithms. 1/3 algorithm exhibited the best sensitivity while 2/3 and 1/1 algorithm exhibited the best balance between sensitivity and specificity. The performance of the blood SEPT9 assay is superior to that of the serum protein markers and the FIT test in symptomatic population, while appeared to be less potent than FIT and FIT-DNA tests in asymptomatic population. In conclusion, 1/3 algorithm is recommended for CRC screening, and 2/3 or 1/1 algorithms are suitable for early detection for diagnostic purpose. The SEPT9 assay exhibited better performance in symptomatic population than in asymptomatic population.

Isocurvature perturbations in the Ekpyrotic Universe

International Nuclear Information System (INIS)

Notari, A.; Riotto, A.

2002-01-01

The Ekpyrotic scenario assumes that our visible Universe is a boundary brane in a five-dimensional bulk and that the hot Big Bang occurs when a nearly supersymmetric five-brane travelling along the fifth dimension collides with our visible brane. We show that the generation of isocurvature perturbations is a generic prediction of the Ekpyrotic Universe. This is due to the interactions in the kinetic terms between the brane modulus parameterizing the position of the five-brane in the bulk and the dilaton and volume moduli. We show how to separate explicitly the adiabatic and isocurvature modes by performing a rotation in field space. Our results indicate that adiabatic and isocurvature perturbations might be cross-correlated and that curvature perturbations might be entirely seeded by isocurvature perturbations

Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs

DEFF Research Database (Denmark)

Khan, Aly A; Betel, Doron; Miller, Martin L

2009-01-01

Transfection of small RNAs (such as small interfering RNAs (siRNAs) and microRNAs (miRNAs)) into cells typically lowers expression of many genes. Unexpectedly, increased expression of genes also occurs. We investigated whether this upregulation results from a saturation effect--that is, competiti...

A Knockout Screen of ApiAP2 Genes Reveals Networks of Interacting Transcriptional Regulators Controlling the Plasmodium Life Cycle.

Science.gov (United States)

Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver

2017-01-11

A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Continual integral in perturbation theory

International Nuclear Information System (INIS)

Slavnov, A.A.

1975-01-01

It is shown that all results obtained by means of continual integration within the framework of perturbation theory are completely equivalent to those obtained by the usual diagram technique and are therfore just as rigorous. A rigorous justification is given for the rules for operating with continual integrals in perturbation theory. (author)

Quantitative high-throughput gene expression profiling of human striatal development to screen stem cell–derived medium spiny neurons

Directory of Open Access Journals (Sweden)

Marco Straccia

Full Text Available A systematic characterization of the spatio-temporal gene expression during human neurodevelopment is essential to understand brain function in both physiological and pathological conditions. In recent years, stem cell technology has provided an in vitro tool to recapitulate human development, permitting also the generation of human models for many diseases. The correct differentiation of human pluripotent stem cell (hPSC into specific cell types should be evaluated by comparison with specific cells/tissue profiles from the equivalent adult in vivo organ. Here, we define by a quantitative high-throughput gene expression analysis the subset of specific genes of the whole ganglionic eminence (WGE and adult human striatum. Our results demonstrate that not only the number of specific genes is crucial but also their relative expression levels between brain areas. We next used these gene profiles to characterize the differentiation of hPSCs. Our findings demonstrate a temporal progression of gene expression during striatal differentiation of hPSCs from a WGE toward an adult striatum identity. Present results establish a gene expression profile to qualitatively and quantitatively evaluate the telencephalic hPSC-derived progenitors eventually used for transplantation and mature striatal neurons for disease modeling and drug-screening.

Gastric Cancer Associated Genes Identified by an Integrative Analysis of Gene Expression Data

Directory of Open Access Journals (Sweden)

Bing Jiang

2017-01-01

Full Text Available Gastric cancer is one of the most severe complex diseases with high morbidity and mortality in the world. The molecular mechanisms and risk factors for this disease are still not clear since the cancer heterogeneity caused by different genetic and environmental factors. With more and more expression data accumulated nowadays, we can perform integrative analysis for these data to understand the complexity of gastric cancer and to identify consensus players for the heterogeneous cancer. In the present work, we screened the published gene expression data and analyzed them with integrative tool, combined with pathway and gene ontology enrichment investigation. We identified several consensus differentially expressed genes and these genes were further confirmed with literature mining; at last, two genes, that is, immunoglobulin J chain and C-X-C motif chemokine ligand 17, were screened as novel gastric cancer associated genes. Experimental validation is proposed to further confirm this finding.

Kato expansion in quantum canonical perturbation theory

International Nuclear Information System (INIS)

Nikolaev, Andrey

2016-01-01

This work establishes a connection between canonical perturbation series in quantum mechanics and a Kato expansion for the resolvent of the Liouville superoperator. Our approach leads to an explicit expression for a generator of a block-diagonalizing Dyson’s ordered exponential in arbitrary perturbation order. Unitary intertwining of perturbed and unperturbed averaging superprojectors allows for a description of ambiguities in the generator and block-diagonalized Hamiltonian. We compare the efficiency of the corresponding computational algorithm with the efficiencies of the Van Vleck and Magnus methods for high perturbative orders.

Kato expansion in quantum canonical perturbation theory

Energy Technology Data Exchange (ETDEWEB)

Nikolaev, Andrey, E-mail: Andrey.Nikolaev@rdtex.ru [Institute of Computing for Physics and Technology, Protvino, Moscow Region, Russia and RDTeX LTD, Moscow (Russian Federation)

2016-06-15

This work establishes a connection between canonical perturbation series in quantum mechanics and a Kato expansion for the resolvent of the Liouville superoperator. Our approach leads to an explicit expression for a generator of a block-diagonalizing Dyson’s ordered exponential in arbitrary perturbation order. Unitary intertwining of perturbed and unperturbed averaging superprojectors allows for a description of ambiguities in the generator and block-diagonalized Hamiltonian. We compare the efficiency of the corresponding computational algorithm with the efficiencies of the Van Vleck and Magnus methods for high perturbative orders.

Invariant exchange perturbation theory for multicenter systems: Time-dependent perturbations

International Nuclear Information System (INIS)

Orlenko, E. V.; Evstafev, A. V.; Orlenko, F. E.

2015-01-01

A formalism of exchange perturbation theory (EPT) is developed for the case of interactions that explicitly depend on time. Corrections to the wave function obtained in any order of perturbation theory and represented in an invariant form include exchange contributions due to intercenter electron permutations in complex multicenter systems. For collisions of atomic systems with an arbitrary type of interaction, general expressions are obtained for the transfer (T) and scattering (S) matrices in which intercenter electron permutations between overlapping nonorthogonal states belonging to different centers (atoms) are consistently taken into account. The problem of collision of alpha particles with lithium atoms accompanied by the redistribution of electrons between centers is considered. The differential and total charge-exchange cross sections of lithium are calculated

Strings as perturbations of evolving spin networks

International Nuclear Information System (INIS)

Smolin, Lee

2000-01-01

One step in the construction of a background independent formulation of string theory is detailed, in which it is shown how perturbative strings may arise as small fluctuations around histories in a formulation of non-perturbative dynamics of spin networks due to Markopoulou. In this formulation the dynamics of spin network states and their generalizations is described in terms of histories which have discrete analogues of the causal structure and many fingered time of Lorentzian spacetimes. Perturbations of these histories turn out to be described in terms of spin systems defined on 2-dimensional timelike surfaces embedded in the discrete spacetime. When the history has a classical limit which is Minkowski spacetime, the action of the perturbation theory is given to leading order by the spacetime area of the surface, as in bosonic string theory. This map between a non-perturbative formulation of quantum gravity and a 1+1 dimensional theory generalizes to a large class of theories in which the group SU(2) i s extended to any quantum group or supergroup. It is argued that a necessary condition for the non-perturbative theory to have a good classical limit is that the resulting 1+1 dimensional theory defines a consistent and stable perturbative string theory

Dynamic Neuromuscular Control of the Lower Limbs in Response to Unexpected Single-Planar versus Multi-Planar Support Perturbations in Young, Active Adults.

Science.gov (United States)

Malfait, Bart; Staes, Filip; de Vries, Aijse; Smeets, Annemie; Hawken, Malcolm; Robinson, Mark A; Vanrenterghem, Jos; Verschueren, Sabine

2015-01-01

An anterior cruciate ligament (ACL) injury involves a multi-planar injury mechanism. Nevertheless, unexpected multi-planar perturbations have not been used to screen athletes in the context of ACL injury prevention yet could reveal those more at risk. The objective of this study was to compare neuromuscular responses to multi-planar (MPP) and single-planar perturbations (SPP) during a stepping-down task. These results might serve as a basis for future implementation of external perturbations in ACL injury screening programs. Thirteen young adults performed a single leg stepping-down task in eight conditions (four MPP and four SPP with a specified amplitude and velocity). The amplitudes of vastus lateralis (VL), vastus medialis (VM), hamstrings lateralis (HL), hamstrings medialis (HM) EMG activity, medio-lateral and anterior-posterior centre of mass (COM) displacements, the peak knee flexion and abduction angles were compared between conditions using an one-way ANOVA. Number of stepping responses were monitored during all conditions. Significantly greater muscle activity levels were found in response to the more challenging MPP and SPP compared to the less challenging conditions (p neuromuscular activity were found between the MPP conditions and their equivalents in the SPP. Eighteen stepping responses were monitored in the SPP versus nine in the MPP indicating that the overall neuromuscular control was even more challenged during the SPP which was supported by greater COM displacements in the SPP. The more intense MPP and SPP evoked different neuromuscular responses resulting in greater muscle activity levels compared to small perturbations. Based on the results of COM displacements and based on the amount of stepping responses, dynamic neuromuscular control of the knee joint appeared less challenged during the MPP. Therefore, future work should investigate extensively if other neuromuscular differences (i.e. co-activation patterns and kinetics) exist between MPP

Acoustic anisotropic wavefields through perturbation theory

KAUST Repository

Alkhalifah, Tariq Ali

2013-09-01

Solving the anisotropic acoustic wave equation numerically using finite-difference methods introduces many problems and media restriction requirements, and it rarely contributes to the ability to resolve the anisotropy parameters. Among these restrictions are the inability to handle media with η<0 and the presence of shear-wave artifacts in the solution. Both limitations do not exist in the solution of the elliptical anisotropic acoustic wave equation. Using perturbation theory in developing the solution of the anisotropic acoustic wave equation allows direct access to the desired limitation-free solutions, that is, solutions perturbed from the elliptical anisotropic background medium. It also provides a platform for parameter estimation because of the ability to isolate the wavefield dependency on the perturbed anisotropy parameters. As a result, I derive partial differential equations that relate changes in the wavefield to perturbations in the anisotropy parameters. The solutions of the perturbation equations represented the coefficients of a Taylor-series-type expansion of the wavefield as a function of the perturbed parameter, which is in this case η or the tilt of the symmetry axis. The expansion with respect to the symmetry axis allows use of an acoustic transversely isotropic media with a vertical symmetry axis (VTI) kernel to estimate the background wavefield and the corresponding perturbation coefficients. The VTI extrapolation kernel is about one-fourth the cost of the transversely isotropic model with a tilt in the symmetry axis kernel. Thus, for a small symmetry axis tilt, the cost of migration using a first-order expansion can be reduced. The effectiveness of the approach was demonstrated on the Marmousi model.

Screening of Oryza sativa L. for HptGene and Evaluation of Hpt Positive Samples Using Houba Retransposon-Based IRAP Markers

Directory of Open Access Journals (Sweden)

Gözde YÜZBAŞIOĞLU

2017-02-01

Full Text Available Increasing world population needs to enhance agricultural production because of food starvation. Genetically modified organism(GMOis a way to solve this problem. During gene transfers, DNA is inserted into a plant’s genome in a random way. Thisproducesspontaneous genetic changeswith movement of transposable elements, and even increasesvariations. Houbawas described as one of the active retrotransposonsin rice. The aim of this study was to screen rice samples collected from Turkey, and analyse Houba retrotransposon movements with IRAP technique intransgenic ones and their controls. For this purpose, 71 different rice seeds obtained from different regions of Turkey were used for GMO analysis.All samples were screened by real time PCR to test cauliflower mosaic virus (CaMV 35S promoter (P-35S regions, T-NOS (nopaline synthase terminator regions, figwort mosaic virus (FMV regions, bar, patand Cry1ab/ac,and hpt(hygromycin resistance genes. Hptgene was identified in 6samples as a result of real time PCR analysis. These 6transgenic samples with their controls were used for IRAP-PCRanalysisand 0-56% polymorphism ratios were observed in analysed samples. This study is one of the first detailed experimental data of transgenic Oryza sativaL. samples in terms of retrotransposon-based variation.

Identification of new genes involved in human adipogenesis and fat storage.

Directory of Open Access Journals (Sweden)

Jörn Söhle

Full Text Available Since the worldwide increase in obesity represents a growing challenge for health care systems, new approaches are needed to effectively treat obesity and its associated diseases. One prerequisite for advances in this field is the identification of genes involved in adipogenesis and/or lipid storage. To provide a systematic analysis of genes that regulate adipose tissue biology and to establish a target-oriented compound screening, we performed a high throughput siRNA screen with primary (preadipocytes, using a druggable siRNA library targeting 7,784 human genes. The primary screen showed that 459 genes affected adipogenesis and/or lipid accumulation after knock-down. Out of these hits, 333 could be validated in a secondary screen using independent siRNAs and 110 genes were further regulated on the gene expression level during adipogenesis. Assuming that these genes are involved in neutral lipid storage and/or adipocyte differentiation, we performed InCell-Western analysis for the most striking hits to distinguish between the two phenotypes. Beside well known regulators of adipogenesis and neutral lipid storage (i.e. PPARγ, RXR, Perilipin A the screening revealed a large number of genes which have not been previously described in the context of fatty tissue biology such as axonemal dyneins. Five out of ten axonemal dyneins were identified in our screen and quantitative RT-PCR-analysis revealed that these genes are expressed in preadipocytes and/or maturing adipocytes. Finally, to show that the genes identified in our screen are per se druggable we performed a proof of principle experiment using an antagonist for HTR2B. The results showed a very similar phenotype compared to knock-down experiments proofing the "druggability". Thus, we identified new adipogenesis-associated genes and those involved in neutral lipid storage. Moreover, by using a druggable siRNA library the screen data provides a very attractive starting point to identify anti

Perturbations of higher-dimensional spacetimes

Energy Technology Data Exchange (ETDEWEB)

Durkee, Mark; Reall, Harvey S, E-mail: M.N.Durkee@damtp.cam.ac.uk, E-mail: H.S.Reall@damtp.cam.ac.uk [DAMTP, Centre for Mathematical Sciences, University of Cambridge, Wilberforce Road, Cambridge, CB3 0WA (United Kingdom)

2011-02-07

We discuss linearized gravitational perturbations of higher-dimensional spacetimes. For algebraically special spacetimes (e.g. Myers-Perry black holes), we show that there exist local gauge invariant quantities linear in the metric perturbation. These are the higher-dimensional generalizations of the 4D Newman-Penrose scalars that (in an algebraically special vacuum spacetime) satisfy decoupled equations of motion. We show that decoupling occurs in more than four dimensions if, and only if, the spacetime admits a null geodesic congruence with vanishing expansion, rotation and shear. Decoupling of electromagnetic perturbations occurs under the same conditions. Although these conditions are not satisfied in black hole spacetimes, they are satisfied in the near-horizon geometry of an extreme black hole.

Application of linear and higher perturbation theory in reactor physics

International Nuclear Information System (INIS)

Woerner, D.

1978-01-01

For small perturbations in the material composition of a reactor according to the first approximation of perturbation theory the eigenvalue perturbation is proportional to the perturbation of the system. This assumption is true for the neutron flux not influenced by the perturbance. The two-dimensional code LINESTO developed for such problems in this paper on the basis of diffusion theory determines the relative change of the multiplication constant. For perturbations varying the neutron flux in the space of energy and position the eigenvalue perturbation is also influenced by this changed neutron flux. In such cases linear perturbation theory yields larger errors. Starting from the methods of calculus of variations there is additionally developed in this paper a perturbation method of calculation permitting in a quick and simple manner to assess the influence of flux perturbation on the eigenvalue perturbation. While the source of perturbations is evaluated in isotropic approximation of diffusion theory the associated inhomogeneous equation may be used to determine the flux perturbation by means of diffusion or transport theory. Possibilities of application and limitations of this method are studied in further systematic investigations on local perturbations. It is shown that with the integrated code system developed in this paper a number of local perturbations may be checked requiring little computing time. With it flux perturbations in first approximation and perturbations of the multiplication constant in second approximation can be evaluated. (orig./RW) [de

Hypomethylation and Aberrant Expression of the Glioma Pathogenesis-Related 1 Gene in Wilms Tumors

Directory of Open Access Journals (Sweden)

Laxmi Chilukamarri

2007-11-01

Full Text Available Wilms tumors (WTs have a complex etiology, displaying genetic and epigenetic changes, including loss of imprinting (LOI and tumor suppressor gene silencing. To identify new regions of epigenetic perturbation in WTs, we screened kidney and tumor DNA using CpG island (CGI tags associated with cancer-specific DNA methylation changes. One such tag corresponded to a paralog of the glioma pathogenesis-related 1/related to testis-specific, vespid, and pathogenesis proteins 1 (GLIPR1/RTVP-1 gene, previously reported to be a tumor-suppressor gene silenced by hypermethylation in prostate cancer. Here we report methylation analysis of the GLIPR1/RTVP-1 gene in WTs and normal fetal and pediatric kidneys. Hypomethylation of the GLIPR1/RTVP-1 5'-region in WTs relative to normal tissue is observed in 21/24 (87.5% of WTs analyzed. Quantitative analysis of GLIPR1/RTVP-1 expression in 24 WTs showed elevated transcript levels in 16/24 WTs (67%, with 12 WTs displaying in excess of 20-fold overexpression relative to fetal kidney (FK control samples. Immunohistochemical analysis of FK and WT corroborates the RNA expression data and reveals high GLIPR1/RTVP-1 in WT blastemal cells together with variable levels in stromal and epithelial components. Hypomethylation is also evident in the WT precursor lesions and nephrogenic rests (NRs, supporting a role for GLIPR1/RTVP-1 deregulation early in Wilms tumorigenesis. Our data show that, in addition to gene dosage changes arising from LOI and hypermethylation-induced gene silencing, gene activation resulting from hypomethylation is also prevalent in WTs.

't Hooft loops and perturbation theory

CERN Document Server

De Forcrand, Philippe; Noth, D; Forcrand, Philippe de; Lucini, Biagio; Noth, David

2005-01-01

We show that high-temperature perturbation theory describes extremely well the area law of SU(N) spatial 't Hooft loops, or equivalently the tension of the interface between different Z_N vacua in the deconfined phase. For SU(2), the disagreement between Monte Carlo data and lattice perturbation theory for sigma(T)/T^2 is less than 2%, down to temperatures O(10) T_c. For SU(N), N>3, the ratios of interface tensions, (sigma_k/sigma_1)(T), agree with perturbation theory, which predicts tiny deviations from the ratio of Casimirs, down to nearly T_c. In contrast, individual tensions differ markedly from the perturbative expression. In all cases, the required precision Monte Carlo measurements are made possible by a simple but powerful modification of the 'snake' algorithm.

Alkylation sensitivity screens reveal a conserved cross-species functionome

Science.gov (United States)

Svilar, David; Dyavaiah, Madhu; Brown, Ashley R.; Tang, Jiang-bo; Li, Jianfeng; McDonald, Peter R.; Shun, Tong Ying; Braganza, Andrea; Wang, Xiao-hong; Maniar, Salony; St Croix, Claudette M.; Lazo, John S.; Pollack, Ian F.; Begley, Thomas J.; Sobol, Robert W.

2013-01-01

To identify genes that contribute to chemotherapy resistance in glioblastoma, we conducted a synthetic lethal screen in a chemotherapy-resistant glioblastoma derived cell line with the clinical alkylator temozolomide (TMZ) and an siRNA library tailored towards “druggable” targets. Select DNA repair genes in the screen were validated independently, confirming the DNA glycosylases UNG and MYH as well as MPG to be involved in the response to high dose TMZ. The involvement of UNG and MYH is likely the result of a TMZ-induced burst of reactive oxygen species. We then compared the human TMZ sensitizing genes identified in our screen with those previously identified from alkylator screens conducted in E. coli and S. cerevisiae. The conserved biological processes across all three species composes an Alkylation Functionome that includes many novel proteins not previously thought to impact alkylator resistance. This high-throughput screen, validation and cross-species analysis was then followed by a mechanistic analysis of two essential nodes: base excision repair (BER) DNA glycosylases (UNG, human and mag1, S. cerevisiae) and protein modification systems, including UBE3B and ICMT in human cells or pby1, lip22, stp22 and aim22 in S. cerevisiae. The conserved processes of BER and protein modification were dual targeted and yielded additive sensitization to alkylators in S. cerevisiae. In contrast, dual targeting of BER and protein modification genes in human cells did not increase sensitivity, suggesting an epistatic relationship. Importantly, these studies provide potential new targets to overcome alkylating agent resistance. PMID:23038810

Biases in Drosophila melanogaster protein trap screens

Directory of Open Access Journals (Sweden)

Müller Ilka

2009-05-01

Full Text Available Abstract Background The ability to localise or follow endogenous proteins in real time in vivo is of tremendous utility for cell biology or systems biology studies. Protein trap screens utilise the random genomic insertion of a transposon-borne artificial reporter exon (e.g. encoding the green fluorescent protein, GFP into an intron of an endogenous gene to generate a fluorescent fusion protein. Despite recent efforts aimed at achieving comprehensive coverage of the genes encoded in the Drosophila genome, the repertoire of genes that yield protein traps is still small. Results We analysed the collection of available protein trap lines in Drosophila melanogaster and identified potential biases that are likely to restrict genome coverage in protein trap screens. The protein trap screens investigated here primarily used P-element vectors and thus exhibit some of the same positional biases associated with this transposon that are evident from the comprehensive Drosophila Gene Disruption Project. We further found that protein trap target genes usually exhibit broad and persistent expression during embryonic development, which is likely to facilitate better detection. In addition, we investigated the likely influence of the GFP exon on host protein structure and found that protein trap insertions have a significant bias for exon-exon boundaries that encode disordered protein regions. 38.8% of GFP insertions land in disordered protein regions compared with only 23.4% in the case of non-trapping P-element insertions landing in coding sequence introns (p -4. Interestingly, even in cases where protein domains are predicted, protein trap insertions frequently occur in regions encoding surface exposed areas that are likely to be functionally neutral. Considering the various biases observed, we predict that less than one third of intron-containing genes are likely to be amenable to trapping by the existing methods. Conclusion Our analyses suggest that the

Propagation of Ion Acoustic Perturbations

DEFF Research Database (Denmark)

Pécseli, Hans

1975-01-01

Equations describing the propagation of ion acoustic perturbations are considered, using the assumption that the electrons are Boltzman distributed and isothermal at all times. Quasi-neutrality is also considered.......Equations describing the propagation of ion acoustic perturbations are considered, using the assumption that the electrons are Boltzman distributed and isothermal at all times. Quasi-neutrality is also considered....

An siRNA-based functional genomics screen for the identification of regulators of ciliogenesis and ciliopathy genes

Science.gov (United States)

Racher, Hilary; Phelps, Ian G.; Toedt, Grischa; Kennedy, Julie; Wunderlich, Kirsten A.; Sorusch, Nasrin; Abdelhamed, Zakia A.; Natarajan, Subaashini; Herridge, Warren; van Reeuwijk, Jeroen; Horn, Nicola; Boldt, Karsten; Parry, David A.; Letteboer, Stef J.F.; Roosing, Susanne; Adams, Matthew; Bell, Sandra M.; Bond, Jacquelyn; Higgins, Julie; Morrison, Ewan E.; Tomlinson, Darren C.; Slaats, Gisela G.; van Dam, Teunis J. P.; Huang, Lijia; Kessler, Kristin; Giessl, Andreas; Logan, Clare V.; Boyle, Evan A.; Shendure, Jay; Anazi, Shamsa; Aldahmesh, Mohammed; Al Hazzaa, Selwa; Hegele, Robert A.; Ober, Carole; Frosk, Patrick; Mhanni, Aizeddin A.; Chodirker, Bernard N.; Chudley, Albert E.; Lamont, Ryan; Bernier, Francois P.; Beaulieu, Chandree L.; Gordon, Paul; Pon, Richard T.; Donahue, Clem; Barkovich, A. James; Wolf, Louis; Toomes, Carmel; Thiel, Christian T.; Boycott, Kym M.; McKibbin, Martin; Inglehearn, Chris F.; Stewart, Fiona; Omran, Heymut; Huynen, Martijn A.; Sergouniotis, Panagiotis I.; Alkuraya, Fowzan S.; Parboosingh, Jillian S.; Innes, A Micheil; Willoughby, Colin E.; Giles, Rachel H.; Webster, Andrew R.; Ueffing, Marius; Blacque, Oliver; Gleeson, Joseph G.; Wolfrum, Uwe; Beales, Philip L.; Gibson, Toby

2015-01-01

Defects in primary cilium biogenesis underlie the ciliopathies, a growing group of genetic disorders. We describe a whole genome siRNA-based reverse genetics screen for defects in biogenesis and/or maintenance of the primary cilium, obtaining a global resource. We identify 112 candidate ciliogenesis and ciliopathy genes, including 44 components of the ubiquitin-proteasome system, 12 G-protein-coupled receptors, and three pre-mRNA processing factors (PRPF6, PRPF8 and PRPF31) mutated in autosomal dominant retinitis pigmentosa. The PRPFs localise to the connecting cilium, and PRPF8- and PRPF31-mutated cells have ciliary defects. Combining the screen with exome sequencing data identified recessive mutations in PIBF1/CEP90 and C21orf2/LRRC76 as causes of the ciliopathies Joubert and Jeune syndromes. Biochemical approaches place C21orf2 within key ciliopathy-associated protein modules, offering an explanation for the skeletal and retinal involvement observed in individuals with C21orf2-variants. Our global, unbiased approaches provide insights into ciliogenesis complexity and identify roles for unanticipated pathways in human genetic disease. PMID:26167768

An overexpression screen in Drosophila for genes that restrict growth or cell-cycle progression in the developing eye.

OpenAIRE

Tseng, Ai-Sun Kelly; Hariharan, Iswar K

2002-01-01

We screened for genes that, when overexpressed in the proliferating cells of the eye imaginal disc, result in a reduction in the size of the adult eye. After crossing the collection of 2296 EP lines to the ey-GAL4 driver, we identified 46 lines, corresponding to insertions in 32 different loci, that elicited a small eye phenotype. These lines were classified further by testing for an effect in postmitotic cells using the sev-GAL4 driver, by testing for an effect in the wing using en-GAL4, and...

EDITORIAL: Non-linear and non-Gaussian cosmological perturbations Non-linear and non-Gaussian cosmological perturbations

Science.gov (United States)

Sasaki, Misao; Wands, David

2010-06-01

In recent years there has been a resurgence of interest in the study of non-linear perturbations of cosmological models. This has been the result of both theoretical developments and observational advances. New theoretical challenges arise at second and higher order due to mode coupling and the need to develop new gauge-invariant variables beyond first order. In particular, non-linear interactions lead to deviations from a Gaussian distribution of primordial perturbations even if initial vacuum fluctuations are exactly Gaussian. These non-Gaussianities provide an important probe of models for the origin of structure in the very early universe. We now have a detailed picture of the primordial distribution of matter from surveys of the cosmic microwave background, notably NASA's WMAP satellite. The situation will continue to improve with future data from the ESA Planck satellite launched in 2009. To fully exploit these data cosmologists need to extend non-linear cosmological perturbation theory beyond the linear theory that has previously been sufficient on cosmological scales. Another recent development has been the realization that large-scale structure, revealed in high-redshift galaxy surveys, could also be sensitive to non-linearities in the primordial curvature perturbation. This focus section brings together a collection of invited papers which explore several topical issues in this subject. We hope it will be of interest to theoretical physicists and astrophysicists alike interested in understanding and interpreting recent developments in cosmological perturbation theory and models of the early universe. Of course it is only an incomplete snapshot of a rapidly developing field and we hope the reader will be inspired to read further work on the subject and, perhaps, fill in some of the missing pieces. This focus section is dedicated to the memory of Lev Kofman (1957-2009), an enthusiastic pioneer of inflationary cosmology and non-Gaussian perturbations.

Synchronous versus asynchronous modeling of gene regulatory networks.

Science.gov (United States)

Garg, Abhishek; Di Cara, Alessandro; Xenarios, Ioannis; Mendoza, Luis; De Micheli, Giovanni

2008-09-01

In silico modeling of gene regulatory networks has gained some momentum recently due to increased interest in analyzing the dynamics of biological systems. This has been further facilitated by the increasing availability of experimental data on gene-gene, protein-protein and gene-protein interactions. The two dynamical properties that are often experimentally testable are perturbations and stable steady states. Although a lot of work has been done on the identification of steady states, not much work has been reported on in silico modeling of cellular differentiation processes. In this manuscript, we provide algorithms based on reduced ordered binary decision diagrams (ROBDDs) for Boolean modeling of gene regulatory networks. Algorithms for synchronous and asynchronous transition models have been proposed and their corresponding computational properties have been analyzed. These algorithms allow users to compute cyclic attractors of large networks that are currently not feasible using existing software. Hereby we provide a framework to analyze the effect of multiple gene perturbation protocols, and their effect on cell differentiation processes. These algorithms were validated on the T-helper model showing the correct steady state identification and Th1-Th2 cellular differentiation process. The software binaries for Windows and Linux platforms can be downloaded from http://si2.epfl.ch/~garg/genysis.html.

Perturbation methods for power and reactivity reconstruction

International Nuclear Information System (INIS)

Palmiotti, G.; Salvatores, M.; Estiot, J.C.; Broccoli, U.; Bruna, G.; Gomit, J.M.

1987-01-01

This paper deals with recent developments and applications in perturbation methods. Two types of methods are used. The first one is an explicit method, which allows the explicit reconstruction of a perturbed flux using a linear combination of a library of functions. In our application, these functions are the harmonics (i.e. the high order eigenfunctions of the system). The second type is based on the Generalized Perturbation Theory GPT and needs the calculation of an importance function for each integral parameter of interest. Recent developments of a particularly useful high order formulation allows to obtain satisfactory results also for very large perturbations

On adiabatic perturbations in the ekpyrotic scenario

International Nuclear Information System (INIS)

Linde, A.; Mukhanov, V.; Vikman, A.

2010-01-01

In a recent paper, Khoury and Steinhardt proposed a way to generate adiabatic cosmological perturbations with a nearly flat spectrum in a contracting Universe. To produce these perturbations they used a regime in which the equation of state exponentially rapidly changed during a short time interval. Leaving aside the singularity problem and the difficult question about the possibility to transmit these perturbations from a contracting Universe to the expanding phase, we will show that the methods used in Khoury are inapplicable for the description of the cosmological evolution and of the process of generation of perturbations in this scenario

Application of functional analysis to perturbation theory of differential equations. [nonlinear perturbation of the harmonic oscillator

Science.gov (United States)

Bogdan, V. M.; Bond, V. B.

1980-01-01

The deviation of the solution of the differential equation y' = f(t, y), y(O) = y sub O from the solution of the perturbed system z' = f(t, z) + g(t, z), z(O) = z sub O was investigated for the case where f and g are continuous functions on I x R sup n into R sup n, where I = (o, a) or I = (o, infinity). These functions are assumed to satisfy the Lipschitz condition in the variable z. The space Lip(I) of all such functions with suitable norms forms a Banach space. By introducing a suitable norm in the space of continuous functions C(I), introducing the problem can be reduced to an equivalent problem in terminology of operators in such spaces. A theorem on existence and uniqueness of the solution is presented by means of Banach space technique. Norm estimates on the rate of growth of such solutions are found. As a consequence, estimates of deviation of a solution due to perturbation are obtained. Continuity of the solution on the initial data and on the perturbation is established. A nonlinear perturbation of the harmonic oscillator is considered a perturbation of equations of the restricted three body problem linearized at libration point.

Coupling graph perturbation theory with scalable parallel algorithms for large-scale enumeration of maximal cliques in biological graphs

International Nuclear Information System (INIS)

Samatova, N F; Schmidt, M C; Hendrix, W; Breimyer, P; Thomas, K; Park, B-H

2008-01-01

Data-driven construction of predictive models for biological systems faces challenges from data intensity, uncertainty, and computational complexity. Data-driven model inference is often considered a combinatorial graph problem where an enumeration of all feasible models is sought. The data-intensive and the NP-hard nature of such problems, however, challenges existing methods to meet the required scale of data size and uncertainty, even on modern supercomputers. Maximal clique enumeration (MCE) in a graph derived from such biological data is often a rate-limiting step in detecting protein complexes in protein interaction data, finding clusters of co-expressed genes in microarray data, or identifying clusters of orthologous genes in protein sequence data. We report two key advances that address this challenge. We designed and implemented the first (to the best of our knowledge) parallel MCE algorithm that scales linearly on thousands of processors running MCE on real-world biological networks with thousands and hundreds of thousands of vertices. In addition, we proposed and developed the Graph Perturbation Theory (GPT) that establishes a foundation for efficiently solving the MCE problem in perturbed graphs, which model the uncertainty in the data. GPT formulates necessary and sufficient conditions for detecting the differences between the sets of maximal cliques in the original and perturbed graphs and reduces the enumeration time by more than 80% compared to complete recomputation

Clofazimine inhibits human Kv1.3 potassium channel by perturbing calcium oscillation in T lymphocytes.

Directory of Open Access Journals (Sweden)

Yunzhao R Ren

Full Text Available The Kv1.3 potassium channel plays an essential role in effector memory T cells and has been implicated in several important autoimmune diseases including multiple sclerosis, psoriasis and type 1 diabetes. A number of potent small molecule inhibitors of Kv1.3 channel have been reported, some of which were found to be effective in various animal models of autoimmune diseases. We report herein the identification of clofazimine, a known anti-mycobacterial drug, as a novel inhibitor of human Kv1.3. Clofazimine was initially identified as an inhibitor of intracellular T cell receptor-mediated signaling leading to the transcriptional activation of human interleukin-2 gene in T cells from a screen of the Johns Hopkins Drug Library. A systematic mechanistic deconvolution revealed that clofazimine selectively blocked the Kv1.3 channel activity, perturbing the oscillation frequency of the calcium-release activated calcium channel, which in turn led to the inhibition of the calcineurin-NFAT signaling pathway. These effects of clofazimine provide the first line of experimental evidence in support of a causal relationship between Kv1.3 and calcium oscillation in human T cells. Furthermore, clofazimine was found to be effective in blocking human T cell-mediated skin graft rejection in an animal model in vivo. Together, these results suggest that clofazimine is a promising immunomodulatory drug candidate for treating a variety of autoimmune disorders.

Advances in genome-wide RNAi cellular screens: a case study using the Drosophila JAK/STAT pathway

Science.gov (United States)

2012-01-01

Background Genome-scale RNA-interference (RNAi) screens are becoming ever more common gene discovery tools. However, whilst every screen identifies interacting genes, less attention has been given to how factors such as library design and post-screening bioinformatics may be effecting the data generated. Results Here we present a new genome-wide RNAi screen of the Drosophila JAK/STAT signalling pathway undertaken in the Sheffield RNAi Screening Facility (SRSF). This screen was carried out using a second-generation, computationally optimised dsRNA library and analysed using current methods and bioinformatic tools. To examine advances in RNAi screening technology, we compare this screen to a biologically very similar screen undertaken in 2005 with a first-generation library. Both screens used the same cell line, reporters and experimental design, with the SRSF screen identifying 42 putative regulators of JAK/STAT signalling, 22 of which verified in a secondary screen and 16 verified with an independent probe design. Following reanalysis of the original screen data, comparisons of the two gene lists allows us to make estimates of false discovery rates in the SRSF data and to conduct an assessment of off-target effects (OTEs) associated with both libraries. We discuss the differences and similarities between the resulting data sets and examine the relative improvements in gene discovery protocols. Conclusions Our work represents one of the first direct comparisons between first- and second-generation libraries and shows that modern library designs together with methodological advances have had a significant influence on genome-scale RNAi screens. PMID:23006893

Detention of HPV L1 Capsid Protein and hTERC Gene in Screening of Cervical Cancer

Directory of Open Access Journals (Sweden)

Huang Bin

2013-06-01

Full Text Available   Objective(s: To investigate the expression of human papilloma virus (HPV L1 capsid protein, and human telomerase RNA component (hTERC in cervical cancer and the role of detection of both genes in screening of cervical cancer.   Materials and Methods: A total of 309 patients were recruited and cervical exfoliated cells were collected. Immunocytochemistry was employed to detect HPV L1 capsid protein, and fluorescent in situ hybridization (FISH was performed to detect the hTERC. Results: The expression of HPV L1 capsid protein reduced with the increase of the histological grade of cervical cells and was negatively related to the grade of cervical lesions. However, the expression of hTERC increased with the increase of the histological grade and positively associated with the grade of cervical lesions. The proportion of patients with L1(-/hTERC(+ was higher in patients with histological grade of CIN2 or higher than that in those with histological grade of CIN1. The L1(+/hTERC(- and L1(-/hTERC(- were negatively related to the grade of cervical lesions. L1(-/hTERC(+ was positively associated with the grade of cervical lesions. The L1/hTERC ratio increased. The negative predictive value of both HPV L1 and hTERC was higher than that of HPV L1 or hTERC, but there was no marked difference in the screening efficacy of cervical cancer among HPV L1, hTERC and HPV L1+hTERC. Conclusion: HPV L1 capsid protein and hTERC gene may serve as markers for the early diagnosis and prediction of cervical lesions. The increase in L1/hTERC ratio reflects the progression of cervical lesions to a certain extent.

The leukemia-specific fusion gene ETV6/RUNX1 perturbs distinct key biological functions primarily by gene repression.

Directory of Open Access Journals (Sweden)

Gerhard Fuka

Full Text Available BACKGROUND: ETV6/RUNX1 (E/R (also known as TEL/AML1 is the most frequent gene fusion in childhood acute lymphoblastic leukemia (ALL and also most likely the crucial factor for disease initiation; its role in leukemia propagation and maintenance, however, remains largely elusive. To address this issue we performed a shRNA-mediated knock-down (KD of the E/R fusion gene and investigated the ensuing consequences on genome-wide gene expression patterns and deducible regulatory functions in two E/R-positive leukemic cell lines. FINDINGS: Microarray analyses identified 777 genes whose expression was substantially altered. Although approximately equal proportions were either up- (KD-UP or down-regulated (KD-DOWN, the effects on biological processes and pathways differed considerably. The E/R KD-UP set was significantly enriched for genes included in the "cell activation", "immune response", "apoptosis", "signal transduction" and "development and differentiation" categories, whereas in the E/R KD-DOWN set only the "PI3K/AKT/mTOR signaling" and "hematopoietic stem cells" categories became evident. Comparable expression signatures obtained from primary E/R-positive ALL samples underline the relevance of these pathways and molecular functions. We also validated six differentially expressed genes representing the categories "stem cell properties", "B-cell differentiation", "immune response", "cell adhesion" and "DNA damage" with RT-qPCR. CONCLUSION: Our analyses provide the first preliminary evidence that the continuous expression of the E/R fusion gene interferes with key regulatory functions that shape the biology of this leukemia subtype. E/R may thus indeed constitute the essential driving force for the propagation and maintenance of the leukemic process irrespective of potential consequences of associated secondary changes. Finally, these findings may also provide a valuable source of potentially attractive therapeutic targets.

Reconstruction of gene regulatory modules from RNA silencing of IFN-α modulators: experimental set-up and inference method.

Science.gov (United States)

Grassi, Angela; Di Camillo, Barbara; Ciccarese, Francesco; Agnusdei, Valentina; Zanovello, Paola; Amadori, Alberto; Finesso, Lorenzo; Indraccolo, Stefano; Toffolo, Gianna Maria

2016-03-12

Inference of gene regulation from expression data may help to unravel regulatory mechanisms involved in complex diseases or in the action of specific drugs. A challenging task for many researchers working in the field of systems biology is to build up an experiment with a limited budget and produce a dataset suitable to reconstruct putative regulatory modules worth of biological validation. Here, we focus on small-scale gene expression screens and we introduce a novel experimental set-up and a customized method of analysis to make inference on regulatory modules starting from genetic perturbation data, e.g. knockdown and overexpression data. To illustrate the utility of our strategy, it was applied to produce and analyze a dataset of quantitative real-time RT-PCR data, in which interferon-α (IFN-α) transcriptional response in endothelial cells is investigated by RNA silencing of two candidate IFN-α modulators, STAT1 and IFIH1. A putative regulatory module was reconstructed by our method, revealing an intriguing feed-forward loop, in which STAT1 regulates IFIH1 and they both negatively regulate IFNAR1. STAT1 regulation on IFNAR1 was object of experimental validation at the protein level. Detailed description of the experimental set-up and of the analysis procedure is reported, with the intent to be of inspiration for other scientists who want to realize similar experiments to reconstruct gene regulatory modules starting from perturbations of possible regulators. Application of our approach to the study of IFN-α transcriptional response modulators in endothelial cells has led to many interesting novel findings and new biological hypotheses worth of validation.

Analytic continuation in perturbative QCD

International Nuclear Information System (INIS)

Caprini, Irinel

2002-01-01

We discuss some attempts to improve standard perturbative expansion in QCD by using the analytic continuation in the momentum and the Borel complex planes. We first analyse the momentum-plane analyticity properties of the Borel-summed Green functions in perturbative QCD and the connection between the Landau singularities and the infrared renormalons. By using the analytic continuation in the Borel complex plane, we propose a new perturbative series replacing the standard expansion in powers of the normalized coupling constant a. The new expansion functions have branch point and essential singularities at the origin of the complex a-plane and divergent Taylor expansions in powers of a. On the other hand the modified expansion of the QCD correlators is convergent under rather conservative conditions. (author)

Massive states in chiral perturbation theory

Energy Technology Data Exchange (ETDEWEB)

Mallik, S [Saha Inst. of Nuclear Physics, Calcutta (India)

1995-08-01

It is shown that the chiral nonanalytic terms generated by {Delta}{sub 33} resonance in the nucleon self-energy is reproduced in chiral perturbation theory by perturbing appropriate local operators contained in the pion-nucleon effective Lagrangian itself. (orig.)

Sensitivity of neuroprogenitor cells to chemical-induced apoptosis using a multiplexed assay suitable for high-throughput screening*

Science.gov (United States)

AbstractHigh-throughput methods are useful for rapidly screening large numbers of chemicals for biological activity, including the perturbation of pathways that may lead to adverse cellular effects. In vitro assays for the key events of neurodevelopment, including apoptosis, may ...

Genome-wide screening of the genes required for tolerance to vanillin, which is a potential inhibitor of bioethanol fermentation, in Saccharomyces cerevisiae

Directory of Open Access Journals (Sweden)

Tokuyasu Ken

2008-04-01

Full Text Available Abstract Background Lignocellulosic materials are abundant and among the most important potential sources for bioethanol production. Although the pretreatment of lignocellulose is necessary for efficient saccharification and fermentation, numerous by-products, including furan derivatives, weak acids, and phenolic compounds, are generated in the pretreatment step. Many of these components inhibit the growth and fermentation of yeast. In particular, vanillin is one of the most effective inhibitors in lignocellulose hydrolysates because it inhibits fermentation at very low concentrations. To identify the genes required for tolerance to vanillin, we screened a set of diploid yeast deletion mutants, which are powerful tools for clarifying the function of particular genes. Results Seventy-six deletion mutants were identified as vanillin-sensitive mutants. The numerous deleted genes in the vanillin-sensitive mutants were classified under the functional categories for 'chromatin remodeling' and 'vesicle transport', suggesting that these functions are important for vanillin tolerance. The cross-sensitivity of the vanillin-sensitive mutants to furan derivatives, weak acids, and phenolic compounds was also examined. Genes for ergosterol biosynthesis were required for tolerance to all inhibitory compounds tested, suggesting that ergosterol is a key component of tolerance to various inhibitors. Conclusion Our analysis predicts that vanillin tolerance in Saccharomyces cerevisiae is affected by various complicated processes that take place on both the molecular and the cellular level. In addition, the ergosterol biosynthetic process is important for achieving a tolerance to various inhibitors. Our findings provide a biotechnological basis for the molecular engineering as well as for screening of more robust yeast strains that may potentially be useful in bioethanol fermentation.

AOPs and Biomarkers: Bridging High Throughput Screening ...

Science.gov (United States)

As high throughput screening (HTS) plays a larger role in toxicity testing, camputational toxicology has emerged as a critical component in interpreting the large volume of data produced. Computational models designed to quantify potential adverse effects based on HTS data will benefit from additional data sources that connect the magnitude of perturbation from the in vitro system to a level of concern at the organism or population level. The adverse outcome pathway (AOP) concept provides an ideal framework for combining these complementary data. Recent international efforts under the auspices of the Organization for Economic Co-operation and Development (OECD) have resulted in an AOP wiki designed to house formal descriptions of AOPs suitable for use in regulatory decision making. Recent efforts have built upon this to include an ontology describing the AOP with linkages to biological pathways, physiological terminology, and taxonomic applicability domains. Incorporation of an AOP network tool developed by the U.S. Army Corps of Engineers also allows consideration of cumulative risk from chemical and non-chemical stressors. Biomarkers are an important complement to formal AOP descriptions, particularly when dealing with susceptible subpopulations or lifestages in human health risk assessment. To address the issue of nonchemical stressors than may modify effects of criteria air pollutants, a novel method was used to integrate blood gene expression data with hema

Mutational screening of the USH2A gene in Spanish USH patients reveals 23 novel pathogenic mutations

Directory of Open Access Journals (Sweden)

Diaz-Llopis Manuel

2011-10-01

Full Text Available Abstract Background Usher Syndrome type II (USH2 is an autosomal recessive disorder, characterized by moderate to severe hearing impairment and retinitis pigmentosa (RP. Among the three genes implicated, mutations in the USH2A gene account for 74-90% of the USH2 cases. Methods To identify the genetic cause of the disease and determine the frequency of USH2A mutations in a cohort of 88 unrelated USH Spanish patients, we carried out a mutation screening of the 72 coding exons of this gene by direct sequencing. Moreover, we performed functional minigene studies for those changes that were predicted to affect splicing. Results As a result, a total of 144 DNA sequence variants were identified. Based upon previous studies, allele frequencies, segregation analysis, bioinformatics' predictions and in vitro experiments, 37 variants (23 of them novel were classified as pathogenic mutations. Conclusions This report provide a wide spectrum of USH2A mutations and clinical features, including atypical Usher syndrome phenotypes resembling Usher syndrome type I. Considering only the patients clearly diagnosed with Usher syndrome type II, and results obtained in this and previous studies, we can state that mutations in USH2A are responsible for 76.1% of USH2 disease in patients of Spanish origin.

Geometry of perturbed Gaussian states and quantum estimation

International Nuclear Information System (INIS)

Genoni, Marco G; Giorda, Paolo; Paris, Matteo G A

2011-01-01

We address the non-Gaussianity (nG) of states obtained by weakly perturbing a Gaussian state and investigate the relationships with quantum estimation. For classical perturbations, i.e. perturbations to eigenvalues, we found that the nG of the perturbed state may be written as the quantum Fisher information (QFI) distance minus a term depending on the infinitesimal energy change, i.e. it provides a lower bound to statistical distinguishability. Upon moving on isoenergetic surfaces in a neighbourhood of a Gaussian state, nG thus coincides with a proper distance in the Hilbert space and exactly quantifies the statistical distinguishability of the perturbations. On the other hand, for perturbations leaving the covariance matrix unperturbed, we show that nG provides an upper bound to the QFI. Our results show that the geometry of non-Gaussian states in the neighbourhood of a Gaussian state is definitely not trivial and cannot be subsumed by a differential structure. Nevertheless, the analysis of perturbations to a Gaussian state reveals that nG may be a resource for quantum estimation. The nG of specific families of perturbed Gaussian states is analysed in some detail with the aim of finding the maximally non-Gaussian state obtainable from a given Gaussian one. (fast track communication)

Extended multi-configuration quasi-degenerate perturbation theory: the new approach to multi-state multi-reference perturbation theory.

Science.gov (United States)

Granovsky, Alexander A

2011-06-07

The distinctive desirable features, both mathematically and physically meaningful, for all partially contracted multi-state multi-reference perturbation theories (MS-MR-PT) are explicitly formulated. The original approach to MS-MR-PT theory, called extended multi-configuration quasi-degenerate perturbation theory (XMCQDPT), having most, if not all, of the desirable properties is introduced. The new method is applied at the second order of perturbation theory (XMCQDPT2) to the 1(1)A(')-2(1)A(') conical intersection in allene molecule, the avoided crossing in LiF molecule, and the 1(1)A(1) to 2(1)A(1) electronic transition in cis-1,3-butadiene. The new theory has several advantages compared to those of well-established approaches, such as second order multi-configuration quasi-degenerate perturbation theory and multi-state-second order complete active space perturbation theory. The analysis of the prevalent approaches to the MS-MR-PT theory performed within the framework of the XMCQDPT theory unveils the origin of their common inherent problems. We describe the efficient implementation strategy that makes XMCQDPT2 an especially useful general-purpose tool in the high-level modeling of small to large molecular systems. © 2011 American Institute of Physics

Perturbation Theory for Open Two-Level Nonlinear Quantum Systems

International Nuclear Information System (INIS)

Zhang Zhijie; Jiang Dongguang; Wang Wei

2011-01-01

Perturbation theory is an important tool in quantum mechanics. In this paper, we extend the traditional perturbation theory to open nonlinear two-level systems, treating decoherence parameter γ as a perturbation. By this virtue, we give a perturbative solution to the master equation, which describes a nonlinear open quantum system. The results show that for small decoherence rate γ, the ratio of the nonlinear rate C to the tunneling coefficient V (i.e., r = C/V) determines the validity of the perturbation theory. For small ratio r, the perturbation theory is valid, otherwise it yields wrong results. (general)

Nonlinear spherical perturbations in quintessence models of dark energy

Science.gov (United States)

Pratap Rajvanshi, Manvendra; Bagla, J. S.

2018-06-01

Observations have confirmed the accelerated expansion of the universe. The accelerated expansion can be modelled by invoking a cosmological constant or a dynamical model of dark energy. A key difference between these models is that the equation of state parameter w for dark energy differs from ‑1 in dynamical dark energy (DDE) models. Further, the equation of state parameter is not constant for a general DDE model. Such differences can be probed using the variation of scale factor with time by measuring distances. Another significant difference between the cosmological constant and DDE models is that the latter must cluster. Linear perturbation analysis indicates that perturbations in quintessence models of dark energy do not grow to have a significant amplitude at small length scales. In this paper we study the response of quintessence dark energy to non-linear perturbations in dark matter. We use a fully relativistic model for spherically symmetric perturbations. In this study we focus on thawing models. We find that in response to non-linear perturbations in dark matter, dark energy perturbations grow at a faster rate than expected in linear perturbation theory. We find that dark energy perturbation remains localised and does not diffuse out to larger scales. The dominant drivers of the evolution of dark energy perturbations are the local Hubble flow and a supression of gradients of the scalar field. We also find that the equation of state parameter w changes in response to perturbations in dark matter such that it also becomes a function of position. The variation of w in space is correlated with density contrast for matter. Variation of w and perturbations in dark energy are more pronounced in response to large scale perturbations in matter while the dependence on the amplitude of matter perturbations is much weaker.

A Perturbation Analysis of Harmonics Generation from Saturated Elements in Power Systems

Science.gov (United States)

Kumano, Teruhisa

Nonlinear phenomena such as saturation in magnetic flux give considerable effects in power system analysis. It is reported that a failure in a real 500kV system triggered islanding operation, where resultant even harmonics caused malfunctions in protective relays. It is also reported that the major origin of this wave distortion is nothing but unidirectional magnetization of the transformer iron core. Time simulation is widely used today to analyze this type of phenomena, but it has basically two shortcomings. One is that the time simulation takes two much computing time in the vicinity of inflection points in the saturation characteristic curve because certain iterative procedure such as N-R (Newton-Raphson) should be used and such methods tend to be caught in an ill conditioned numerical hunting. The other is that such simulation methods sometimes do not help intuitive understanding of the studied phenomenon because the whole nonlinear equations are treated in a matrix form and not properly divided into understandable parts as done in linear systems. This paper proposes a new computation scheme which is based on so called perturbation method. Magnetic saturation in iron cores in a generator and a transformer are taken into account. The proposed method has a special feature against the first shortcoming of the N-R based time simulation method stated above. In the proposed method no iterative process is used to reduce the equation residue but uses perturbation series, which means free from the ill condition problem. Users have only to calculate each perturbation terms one by one until he reaches necessary accuracy. In a numerical example treated in the present paper the first order perturbation can make reasonably high accuracy, which means very fast computing. In numerical study three nonlinear elements are considered. Calculated results are almost identical to the conventional Newton-Raphson based time simulation, which shows the validity of the method. The

Mediator complex cooperatively regulates transcription of retinoic acid target genes with Polycomb Repressive Complex 2 during neuronal differentiation.

Science.gov (United States)

Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki

2015-11-01

The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

A comparative study of mutation screening of sarcomeric genes (MYBPC3, MYH7, TNNT2 using single gene approach versus targeted gene panel next generation sequencing in a cohort of HCM patients in Egypt

Directory of Open Access Journals (Sweden)

Heba Sh. Kassem

2017-10-01

Full Text Available Background: NGS enables simultaneous sequencing of large numbers of associated genes in genetic heterogeneous disorders, in a more rapid and cost-effective manner than traditional technologies. However there have been limited direct comparisons between NGS and more established technologies to assess the sensitivity and false negative rates of this new approach. The scope of the present manuscript is to compare variants detected in MYBPC3, MYH7 and TNNT2 genes using the stepwise dHPLC/Sanger versus targeted NGS. Methods: In this study, we have analysed a group of 150 samples of patients from the Bibliotheca Alexandrina-Aswan Heart Centre National HCM program. The genetic testing was simultaneously undertaken by high throughput denaturing high-performance liquid chromatography (dHPLC followed by Sanger based sequencing and targeted next generation deep sequencing using panel of inherited cardiac genes (ICC. The panel included over 100 genes including the 3 sarcomeric genes. Analysis of the sequencing data of the 3 genes was undertaken in a double blinded strategy. Results: NGS analysis detected all pathogenic and likely pathogenic variants identified by dHPLC (50 in total, some samples had double hits. There was a 0% false negative rate for NGS based analysis. Nineteen variants were missed by dHPLC and detected by NGS, thus increasing the diagnostic yield in this co- analysed cohort from 22.0% (33/150 to 31.3% (47/150.Of interest to note that the mutation spectrum in this Egyptian HCM population revealed a high rate of homozygosity in MYBPC3 and MYH7 genes in comparison to other population studies (6/150, 4%. None of the homozygous samples were detected by dHPLC analysis. Conclusion: NGS provides a useful and rapid tool to allow panoramic screening of several genes simultaneously with a high sensitivity rate amongst genes of known etiologic role allowing high throughput analysis of HCM patients and relevant control series in a less characterised

Very high order lattice perturbation theory for Wilson loops

International Nuclear Information System (INIS)

Horsley, R.

2010-10-01

We calculate perturbativeWilson loops of various sizes up to loop order n=20 at different lattice sizes for pure plaquette and tree-level improved Symanzik gauge theories using the technique of Numerical Stochastic Perturbation Theory. This allows us to investigate the behavior of the perturbative series at high orders. We observe differences in the behavior of perturbative coefficients as a function of the loop order. Up to n=20 we do not see evidence for the often assumed factorial growth of the coefficients. Based on the observed behavior we sum this series in a model with hypergeometric functions. Alternatively we estimate the series in boosted perturbation theory. Subtracting the estimated perturbative series for the average plaquette from the non-perturbative Monte Carlo result we estimate the gluon condensate. (orig.)

Odd-parity perturbations of the self-similar LTB spacetime

Energy Technology Data Exchange (ETDEWEB)

Duffy, Emily M; Nolan, Brien C, E-mail: emilymargaret.duffy27@mail.dcu.ie, E-mail: brien.nolan@dcu.ie [School of Mathematical Sciences, Dublin City University, Glasnevin, Dublin 9 (Ireland)

2011-05-21

We consider the behaviour of odd-parity perturbations of those self-similar LemaItre-Tolman-Bondi spacetimes which admit a naked singularity. We find that a perturbation which evolves from initially regular data remains finite on the Cauchy horizon. Finiteness is demonstrated by considering the behaviour of suitable energy norms of the perturbation (and pointwise values of these quantities) on natural spacelike hypersurfaces. This result holds for a general choice of initial data and initial data surface. Finally, we examine the perturbed Weyl scalars in order to provide a physical interpretation of our results. Taken on its own, this result does not support cosmic censorship; however, a full perturbation of this spacetime would include even-parity perturbations, so we cannot conclude that this spacetime is stable to all linear perturbations.

Solitonic Integrable Perturbations of Parafermionic Theories

CERN Document Server

Fernández-Pousa, C R; Hollowood, Timothy J; Miramontes, J L

1997-01-01

The quantum integrability of a class of massive perturbations of the parafermionic conformal field theories associated to compact Lie groups is established by showing that they have quantum conserved densities of scale dimension 2 and 3. These theories are integrable for any value of a continuous vector coupling constant, and they generalize the perturbation of the minimal parafermionic models by their first thermal operator. The classical equations-of-motion of these perturbed theories are the non-abelian affine Toda equations which admit (charged) soliton solutions whose semi-classical quantization is expected to permit the identification of the exact S-matrix of the theory.

Gauge-invariant perturbations in hybrid quantum cosmology

Energy Technology Data Exchange (ETDEWEB)

Gomar, Laura Castelló; Marugán, Guillermo A. Mena [Instituto de Estructura de la Materia, CSIC, Serrano 121, 28006 Madrid (Spain); Martín-Benito, Mercedes, E-mail: laura.castello@iem.cfmac.csic.es, E-mail: m.martin@hef.ru.nl, E-mail: mena@iem.cfmac.csic.es [Institute for Mathematics, Astrophysics and Particle Physics, Radboud University Nijmegen, Heyendaalseweg 135, NL-6525 AJ Nijmegen (Netherlands)

2015-06-01

We consider cosmological perturbations around homogeneous and isotropic spacetimes minimally coupled to a scalar field and present a formulation which is designed to preserve covariance. We truncate the action at quadratic perturbative order and particularize our analysis to flat compact spatial sections and a field potential given by a mass term, although the formalism can be extended to other topologies and potentials. The perturbations are described in terms of Mukhanov-Sasaki gauge invariants, linear perturbative constraints, and variables canonically conjugate to them. This set is completed into a canonical one for the entire system, including the homogeneous degrees of freedom. We find the global Hamiltonian constraint of the model, in which the contribution of the homogeneous sector is corrected with a term quadratic in the perturbations, that can be identified as the Mukhanov-Sasaki Hamiltonian in our formulation. We then adopt a hybrid approach to quantize the model, combining a quantum representation of the homogeneous sector with a more standard field quantization of the perturbations. Covariance is guaranteed in this approach inasmuch as no gauge fixing is adopted. Next, we adopt a Born-Oppenheimer ansatz for physical states and show how to obtain a Schrödinger-like equation for the quantum evolution of the perturbations. This evolution is governed by the Mukhanov-Sasaki Hamiltonian, with the dependence on the homogeneous geometry evaluated at quantum expectation values, and with a time parameter defined also in terms of suitable expectation values on that geometry. Finally, we derive effective equations for the dynamics of the Mukhanov-Sasaki gauge invariants, that include quantum contributions, but have the same ultraviolet limit as the classical equations. They provide the master equation to extract predictions about the power spectrum of primordial scalar perturbations.

Gauge-invariant perturbations in hybrid quantum cosmology

International Nuclear Information System (INIS)

Gomar, Laura Castelló; Marugán, Guillermo A. Mena; Martín-Benito, Mercedes

2015-01-01

We consider cosmological perturbations around homogeneous and isotropic spacetimes minimally coupled to a scalar field and present a formulation which is designed to preserve covariance. We truncate the action at quadratic perturbative order and particularize our analysis to flat compact spatial sections and a field potential given by a mass term, although the formalism can be extended to other topologies and potentials. The perturbations are described in terms of Mukhanov-Sasaki gauge invariants, linear perturbative constraints, and variables canonically conjugate to them. This set is completed into a canonical one for the entire system, including the homogeneous degrees of freedom. We find the global Hamiltonian constraint of the model, in which the contribution of the homogeneous sector is corrected with a term quadratic in the perturbations, that can be identified as the Mukhanov-Sasaki Hamiltonian in our formulation. We then adopt a hybrid approach to quantize the model, combining a quantum representation of the homogeneous sector with a more standard field quantization of the perturbations. Covariance is guaranteed in this approach inasmuch as no gauge fixing is adopted. Next, we adopt a Born-Oppenheimer ansatz for physical states and show how to obtain a Schrödinger-like equation for the quantum evolution of the perturbations. This evolution is governed by the Mukhanov-Sasaki Hamiltonian, with the dependence on the homogeneous geometry evaluated at quantum expectation values, and with a time parameter defined also in terms of suitable expectation values on that geometry. Finally, we derive effective equations for the dynamics of the Mukhanov-Sasaki gauge invariants, that include quantum contributions, but have the same ultraviolet limit as the classical equations. They provide the master equation to extract predictions about the power spectrum of primordial scalar perturbations

Cosmological perturbations in the new Higgs inflation

Energy Technology Data Exchange (ETDEWEB)

Germani, Cristiano [Arnold Sommerfeld Center, Ludwig-Maximilians-University, Theresienstr, 37 80333 Muenchen (Germany); Kehagias, Alex, E-mail: cristiano.germani@lmu.de, E-mail: kehagias@central.ntua.gr [Physics Division, National Technical University of Athens, 15780 Zografou Campus, Athens (Greece)

2010-05-01

We study the cosmological perturbations created during the New Higgs inflationary phase. In the New Higgs Inflation, the Higgs boson is kinetically coupled to the Einstein tensor and only three perturbative degrees of freedom, a scalar and two tensorial (gravitational waves), propagate during Inflation. Scalar perturbations are found to match the latest WMAP-7yrs data within Standard Model Higgs parameters. Primordial gravitational waves also, although propagating with superluminal speed, are consistent with present data. Finally, we estimate the values of the parameter of the New Higgs Inflation in relation to the Higgs mass, the spectral index and amplitude of the primordial scalar perturbations showing that the unitarity bound of the theory is not violated.

Inflationary perturbations in anisotropic, shear-free universes

International Nuclear Information System (INIS)

Pereira, Thiago S.; Carneiro, Saulo; Marugan, Guillermo A. Mena

2012-01-01

In this work, the linear and gauge-invariant theory of cosmological perturbations in a class of anisotropic and shear-free spacetimes is developed. After constructing an explicit set of complete eigenfunctions in terms of which perturbations can be expanded, we identify the effective degrees of freedom during a generic slow-roll inflationary phase. These correspond to the anisotropic equivalent of the standard Mukhanov-Sasaki variables. The associated equations of motion present a remarkable resemblance to those found in perturbed Friedmann-Robertson-Walker spacetimes with curvature, apart from the spectrum of the Laplacian, which exhibits the characteristic frequencies of the underlying geometry. In particular, it is found that the perturbations cannot develop arbitrarily large super-Hubble modes

Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli.

Science.gov (United States)

Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael

2008-04-16

The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.

Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli

Directory of Open Access Journals (Sweden)

Andrade-Garda José

2008-04-01

Full Text Available Abstract Background The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. Results We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Conclusion Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.

Developing a Bacteroides System for Function-Based Screening of DNA from the Human Gut Microbiome.

Science.gov (United States)

Lam, Kathy N; Martens, Eric C; Charles, Trevor C

2018-01-01

Functional metagenomics is a powerful method that allows the isolation of genes whose role may not have been predicted from DNA sequence. In this approach, first, environmental DNA is cloned to generate metagenomic libraries that are maintained in Escherichia coli, and second, the cloned DNA is screened for activities of interest. Typically, functional screens are carried out using E. coli as a surrogate host, although there likely exist barriers to gene expression, such as lack of recognition of native promoters. Here, we describe efforts to develop Bacteroides thetaiotaomicron as a surrogate host for screening metagenomic DNA from the human gut. We construct a B. thetaiotaomicron-compatible fosmid cloning vector, generate a fosmid clone library using DNA from the human gut, and show successful functional complementation of a B. thetaiotaomicron glycan utilization mutant. Though we were unable to retrieve the physical fosmid after complementation, we used genome sequencing to identify the complementing genes derived from the human gut microbiome. Our results demonstrate that the use of B. thetaiotaomicron to express metagenomic DNA is promising, but they also exemplify the challenges that can be encountered in the development of new surrogate hosts for functional screening. IMPORTANCE Human gut microbiome research has been supported by advances in DNA sequencing that make it possible to obtain gigabases of sequence data from metagenomes but is limited by a lack of knowledge of gene function that leads to incomplete annotation of these data sets. There is a need for the development of methods that can provide experimental data regarding microbial gene function. Functional metagenomics is one such method, but functional screens are often carried out using hosts that may not be able to express the bulk of the environmental DNA being screened. We expand the range of current screening hosts and demonstrate that human gut-derived metagenomic libraries can be

Singular perturbations of empty Robertson-Walker cosmologies

International Nuclear Information System (INIS)

Newman, R.P.A.C.

1979-02-01

An investigation is presented which concerns a class of cosmological models defined by McVittie (1931): the universe is envisaged as a set of galaxies, idealised as point particles, which provide singular perturbations of Robertson-Walker cosmologies. The perturbations are considered only to first order in the gravitational coupling constant (8πG)/c 2 . Attention will only be given to such perturbations of empty Robertson-Walker cosmologies. Chapter 1 summarises the observational support for the type of model employed and for the smallness of the quantities to be used as perturbation coefficients. Chapter 2 provides the prerequisite analysis of Robertson-Walker cosmologies. Perturbations of empty Robertson-Walker cosmologies of non-vanishing cosmical constant are considered in general in Chapter 3. The structure of McVittie's singularly perturbed Robertson-Walker cosmologies are considered in detail in Chapter 4. The remaining chapters seek to investigate them further by way of their optical properties. Chapter 5 provides the necessary theory of geometric optics with particular regard to the intensity and distortion of a beam of light, and Chapter 6 applies this theory to the McVittie cosmologies. Chapter 7 sees the definition of an averaging procedure which leads to expressions for the intensity and distortion of a typical beam of light from a point source. (author)

Perturbation Theory of the Cosmological Log-Density Field

DEFF Research Database (Denmark)

Wang, Xin; Neyrinck, Mark; Szapudi, István

2011-01-01

, motivating an analytic study of it. In this paper, we develop cosmological perturbation theory for the power spectrum of this field. Our formalism is developed in the context of renormalized perturbation theory, which helps to regulate the convergence behavior of the perturbation series, and of the Taylor...

Endocrine disruption screening by protein and gene expression of vitellogenin in freshly isolated and cryopreserved rainbow trout hepatocytes.

Science.gov (United States)

Markell, Lauren K; Mingoia, Robert T; Peterson, Heather M; Yao, Jianhong; Waters, Stephanie M; Finn, James P; Nabb, Diane L; Han, Xing

2014-08-18

Xenobiotics may activate the estrogen receptor, resulting in alteration of normal endocrine functions in animals and humans. Consequently, this necessitates development of assay end points capable of identifying estrogenic xenobiotics. In the present study, we screened the potential estrogenicity of chemicals via their ability to induce vitellogenin (VTG) expression in cultured primary hepatocytes from male trout. A routine method for VTG detection measures the secretion of the protein by enzyme-linked immunosorbent assay (ELISA) in freshly isolated trout hepatocytes. However, this lengthy (6 days) culturing procedure requires that hepatocyte isolation is performed each time the assay is run. We optimized this methodology by investigating the utility of cryopreserved hepatocytes, shortening the incubation time, performing a quantitative real-time PCR (qPCR) method for VTG quantification, and verifying the model system with reference chemicals 17β-estradiol, estrone, diethylstilbestrol, hexestrol, genistein, and a negative control, corticosterone. To test the performance of both freshly isolated and cryopreserved hepatocytes, mRNA was collected from hepatocytes following 24 h treatment for VTG gene expression analysis, whereas cell culture media was collected for a VTG ELISA 96 h post-treatment. EC50 values were obtained for each reference chemical except for corticosterone, which exhibited no induction of VTG gene or protein level. Our results show linear concordance between ELISA and qPCR detection methods. Although there was approximately 50% reduction in VTG inducibility following cryopreservation, linear concordance of EC50 values was found between freshly isolated and cryopreserved hepatocytes, indicating that cryopreservation does not alter the functional assessment of estrogen receptor activation and therefore VTG expression. These studies demonstrate that qPCR is a sensitive and specific method for detecting VTG gene expression that can be used together

Divergence of perturbation theory in large scale structures

Science.gov (United States)

Pajer, Enrico; van der Woude, Drian

2018-05-01

We make progress towards an analytical understanding of the regime of validity of perturbation theory for large scale structures and the nature of some non-perturbative corrections. We restrict ourselves to 1D gravitational collapse, for which exact solutions before shell crossing are known. We review the convergence of perturbation theory for the power spectrum, recently proven by McQuinn and White [1], and extend it to non-Gaussian initial conditions and the bispectrum. In contrast, we prove that perturbation theory diverges for the real space two-point correlation function and for the probability density function (PDF) of the density averaged in cells and all the cumulants derived from it. We attribute these divergences to the statistical averaging intrinsic to cosmological observables, which, even on very large and "perturbative" scales, gives non-vanishing weight to all extreme fluctuations. Finally, we discuss some general properties of non-perturbative effects in real space and Fourier space.

Species identification in meat products: A new screening method based on high resolution melting analysis of cyt b gene.

Science.gov (United States)

Lopez-Oceja, A; Nuñez, C; Baeta, M; Gamarra, D; de Pancorbo, M M

2017-12-15

Meat adulteration by substitution with lower value products and/or mislabeling involves economic, health, quality and socio-religious issues. Therefore, identification and traceability of meat species has become an important subject to detect possible fraudulent practices. In the present study the development of a high resolution melt (HRM) screening method for the identification of eight common meat species is reported. Samples from Bos taurus, Ovis aries, Sus scrofa domestica, Equus caballus, Oryctolagus cuniculus, Gallus gallus domesticus, Meleagris gallopavo and Coturnix coturnix were analyzed through the amplification of a 148 bp fragment from the cyt b gene with a universal primer pair in HRM analyses. Melting profiles from each species, as well as from several DNA mixtures of these species and blind samples, allowed a successful species differentiation. The results demonstrated that the HRM method here proposed is a fast, reliable, and low-cost screening technique. Copyright © 2017 Elsevier Ltd. All rights reserved.

Oestrogenic activity of a textile industrial wastewater treatment plant effluent evaluated by the E-screen test and MELN gene-reporter luciferase assay

Energy Technology Data Exchange (ETDEWEB)

Schiliro, Tiziana, E-mail: tiziana.schiliro@unito.it [Department of Public Health and Microbiology, University of Torino, Via Santena 5bis, 10126 Torino (Italy); Porfido, Arianna [Department of Public Health and Microbiology, University of Torino, Via Santena 5bis, 10126 Torino (Italy); Spina, Federica; Varese, Giovanna Cristina [Department of Life Sciences and Systems Biology, University of Torino, Viale Mattioli 25, 10125 Torino (Italy); Gilli, Giorgio [Department of Public Health and Microbiology, University of Torino, Via Santena 5bis, 10126 Torino (Italy)

2012-08-15

This study quantified the biological oestrogenic activity in the effluent of a textile industrial wastewater treatment plant (IWWTP) in northwestern Italy. Samples of the IWWTP effluent were collected monthly, both before and after tertiary treatment (ozonation). After solid phase extraction, all samples were subjected to two in vitro tests of total estrogenic activity, the human breast cancer cell line (MCF-7 BUS) proliferation assay, or E-screen test, and the luciferase-transfected human breast cancer cell line (MELN) gene-reporter assay, to measure the 17{beta}-oestradiol equivalent quantity (EEQ). In the E-screen test, the mean EEQ values were 2.35 {+-} 1.68 ng/L pre-ozonation and 0.72 {+-} 0.58 ng/L post-ozonation; in the MELN gene-reporter luciferase assay, the mean EEQ values were 4.18 {+-} 3.54 ng/L pre-ozonation and 2.53 {+-} 2.48 ng/L post-ozonation. These results suggest that the post-ozonation IWWTP effluent had a lower oestrogenic activity (simple paired t-tests, p < 0.05). The average reduction of estrogenic activity of IWWTP effluent after ozonation was 67 {+-} 26% and 52 {+-} 27% as measured by E-screen test and MELN gene-reporter luciferase assay, respectively. There was a positive and significant correlation between the two tests (Rho S = 0.650, p = 0.022). This study indicates that the environmental risk is low because oestrogenic substances are deposited into the river via IWWTP at concentrations lower than those at which chronic exposure has been reported to affect the endocrine system of living organisms. -- Highlights: Black-Right-Pointing-Pointer The two in vitro tests are suited for oestrogenic activity assessment in textile WWTP. Black-Right-Pointing-Pointer There is a significant correlation between the results of the two in vitro tests. Black-Right-Pointing-Pointer The oestrogenic activity of the effluent is reduced by ozonation. Black-Right-Pointing-Pointer The input of estrogenic substances into the river via textile WWTP is low.

Non-hard sphere thermodynamic perturbation theory.

Science.gov (United States)

Zhou, Shiqi

2011-08-21

A non-hard sphere (HS) perturbation scheme, recently advanced by the present author, is elaborated for several technical matters, which are key mathematical details for implementation of the non-HS perturbation scheme in a coupling parameter expansion (CPE) thermodynamic perturbation framework. NVT-Monte Carlo simulation is carried out for a generalized Lennard-Jones (LJ) 2n-n potential to obtain routine thermodynamic quantities such as excess internal energy, pressure, excess chemical potential, excess Helmholtz free energy, and excess constant volume heat capacity. Then, these new simulation data, and available simulation data in literatures about a hard core attractive Yukawa fluid and a Sutherland fluid, are used to test the non-HS CPE 3rd-order thermodynamic perturbation theory (TPT) and give a comparison between the non-HS CPE 3rd-order TPT and other theoretical approaches. It is indicated that the non-HS CPE 3rd-order TPT is superior to other traditional TPT such as van der Waals/HS (vdW/HS), perturbation theory 2 (PT2)/HS, and vdW/Yukawa (vdW/Y) theory or analytical equation of state such as mean spherical approximation (MSA)-equation of state and is at least comparable to several currently the most accurate Ornstein-Zernike integral equation theories. It is discovered that three technical issues, i.e., opening up new bridge function approximation for the reference potential, choosing proper reference potential, and/or using proper thermodynamic route for calculation of f(ex-ref), chiefly decide the quality of the non-HS CPE TPT. Considering that the non-HS perturbation scheme applies for a wide variety of model fluids, and its implementation in the CPE thermodynamic perturbation framework is amenable to high-order truncation, the non-HS CPE 3rd-order or higher order TPT will be more promising once the above-mentioned three technological advances are established. © 2011 American Institute of Physics

Functional Screening of Antibiotic Resistance Genes from a Representative Metagenomic Library of Food Fermenting Microbiota

Directory of Open Access Journals (Sweden)

Chiara Devirgiliis

2014-01-01

Full Text Available Lactic acid bacteria (LAB represent the predominant microbiota in fermented foods. Foodborne LAB have received increasing attention as potential reservoir of antibiotic resistance (AR determinants, which may be horizontally transferred to opportunistic pathogens. We have previously reported isolation of AR LAB from the raw ingredients of a fermented cheese, while AR genes could be detected in the final, marketed product only by PCR amplification, thus pointing at the need for more sensitive microbial isolation techniques. We turned therefore to construction of a metagenomic library containing microbial DNA extracted directly from the food matrix. To maximize yield and purity and to ensure that genomic complexity of the library was representative of the original bacterial population, we defined a suitable protocol for total DNA extraction from cheese which can also be applied to other lipid-rich foods. Functional library screening on different antibiotics allowed recovery of ampicillin and kanamycin resistant clones originating from Streptococcus salivarius subsp. thermophilus and Lactobacillus helveticus genomes. We report molecular characterization of the cloned inserts, which were fully sequenced and shown to confer AR phenotype to recipient bacteria. We also show that metagenomics can be applied to food microbiota to identify underrepresented species carrying specific genes of interest.

Operator Decomposition Framework for Perturbation Theory

Energy Technology Data Exchange (ETDEWEB)

Abdel-Khalik, Hany S.; Wang, Congjian; Bang, Young Suk [North Carolina State University, Raleigh (United States)

2012-05-15

This summary describes a new framework for perturbation theory intended to improve its performance, in terms of the associated computational cost and the complexity of implementation, for routine reactor calculations in support of design, analysis, and regulation. Since its first introduction in reactor analysis by Winger, perturbation theory has assumed an aura of sophistication with regard to its implementation and its capabilities. Only few reactor physicists, typically mathematically proficient, have contributed to its development, with the general body of the nuclear engineering community remaining unaware of its current status, capabilities, and challenges. Given its perceived sophistication and the small body of community users, the application of perturbation theory has been limited to investigatory analyses only. It is safe to say that the nuclear community is split into two groups, a small one which understands the theory and, and a much bigger group with the perceived notion that perturbation theory is nothing but a fancy mathematical approach that has very little use in practice. Over the past three years, research has demonstrated two goals. First, reduce the computational cost of perturbation theory in order to enable its use for routine reactor calculations. Second, expose some of the myth about perturbation theory and present it in a form that is simple and relatable in order to stimulate the interest of nuclear practitioners, especially those who are currently working on the development of next generation reactor design and analysis tools. The operator decomposition approach has its roots in linear algebra and can be easily understood by code developers, especially those involved in the design of iterative numerical solution strategies

Perturbations of the Friedmann universe

International Nuclear Information System (INIS)

Novello, M.; Salim, J.M.; Heintzmann, H.

1982-01-01

Correcting and extending previous work by Hawking (1966) and Olson (1976) the complete set of perturbation equations of a Friedmann Universe in the quasi-Maxwellian form is derived and analized. The formalism is then applied to scalar, vector and tensor perturbations of a phenomenological fluid, which is modelled such as to comprise shear and heat flux. Depending on the equation of state of the background it is found that there exist unstable (growing) modes of purely rotational character. It is further found that (to linear order at least) any vortex perturbation is equivalent to a certain heat flux vector. The equation for the gravitational waves are derived in a completely equivalent method as in case of the propagation, in a curved space-time, of electromagnetic waves in a plasma endowed with some definite constitutive relations. (Author) [pt

Screening Technologies for Target Identification in Pancreatic Cancer

Energy Technology Data Exchange (ETDEWEB)

Michl, Patrick, E-mail: michlp@med.uni-marburg.de; Ripka, Stefanie; Gress, Thomas; Buchholz, Malte [Department of Gastroenterology and Endocrinology, University Hospital, Philipps-University Marburg, Baldinger Strasse, D-35043 Marburg (Germany)

2010-12-29

Pancreatic cancer exhibits an extraordinarily high level of resistance to almost any kind of systemic therapy evaluated in clinical trials so far. Therefore, the identification of novel therapeutic targets is urgently required. High-throughput screens have emerged as an important tool to identify putative targets for diagnosis and therapy in an unbiased manner. More than a decade ago, microarray technology was introduced to identify differentially expressed genes in pancreatic cancer as compared to normal pancreas, chronic pancreatitis and other cancer types located in close proximity to the pancreas. In addition, proteomic screens have facilitated the identification of differentially secreted proteins in body fluids of pancreatic cancer patients, serving as possible biomarkers. Recently, RNA interference-based loss-of-function screens have been used to identify functionally relevant genes, whose knock-down has impact on pancreatic cancer cell viability, thereby representing potential new targets for therapeutic intervention. This review summarizes recent results of transcriptional, proteomic and functional screens in pancreatic cancer and discusses potentials and limitations of the respective technologies as well as their impact on future therapeutic developments.

Screening Technologies for Target Identification in Pancreatic Cancer

International Nuclear Information System (INIS)

Michl, Patrick; Ripka, Stefanie; Gress, Thomas; Buchholz, Malte

2010-01-01

Pancreatic cancer exhibits an extraordinarily high level of resistance to almost any kind of systemic therapy evaluated in clinical trials so far. Therefore, the identification of novel therapeutic targets is urgently required. High-throughput screens have emerged as an important tool to identify putative targets for diagnosis and therapy in an unbiased manner. More than a decade ago, microarray technology was introduced to identify differentially expressed genes in pancreatic cancer as compared to normal pancreas, chronic pancreatitis and other cancer types located in close proximity to the pancreas. In addition, proteomic screens have facilitated the identification of differentially secreted proteins in body fluids of pancreatic cancer patients, serving as possible biomarkers. Recently, RNA interference-based loss-of-function screens have been used to identify functionally relevant genes, whose knock-down has impact on pancreatic cancer cell viability, thereby representing potential new targets for therapeutic intervention. This review summarizes recent results of transcriptional, proteomic and functional screens in pancreatic cancer and discusses potentials and limitations of the respective technologies as well as their impact on future therapeutic developments

Resolution of ambiguities in perturbative QCD

International Nuclear Information System (INIS)

Nakkagawa, Hisao; Niegawa, Akira.

1984-01-01

In the perturbative QCD analyses of the deeply inelastic processes, the coupling constant depends on at least two mass-scales, the renormalization scale and the factorization scale. By integrating the coupled renormalization group equations with respect to these two mass-scales, the running coupling constant is defined. A perturbative approximation then introduces a new ambiguity, the integration-path dependence, into the theory. We show that the problem of this new ambiguity is resolved by imposing Stevenson's principle of minimal sensitivity. Together with the analogous analysis of the operator matrix element or the cut vertex, we can completely solve the problem of getting an unambiguous perturbative QCD prediction. (author)

Perturbation analysis of linear control problems

International Nuclear Information System (INIS)

Petkov, Petko; Konstantinov, Mihail

2017-01-01

The paper presents a brief overview of the technique of splitting operators, proposed by the authors and intended for perturbation analysis of control problems involving unitary and orthogonal matrices. Combined with the technique of Lyapunov majorants and the implementation of the Banach and Schauder fixed point principles, it allows to obtain rigorous non-local perturbation bounds for a set of sensitivity analysis problems. Among them are the reduction of linear systems into orthogonal canonical forms, the feedback synthesis problem and pole assignment problem in particular, as well as other important problems in control theory and linear algebra. Key words: perturbation analysis, canonical forms, feedback synthesis

COLA with scale-dependent growth: applications to screened modified gravity models

Energy Technology Data Exchange (ETDEWEB)

Winther, Hans A.; Koyama, Kazuya; Wright, Bill S. [Institute of Cosmology and Gravitation, University of Portsmouth, Dennis Sciama Building, Burnaby Road, Portsmouth, PO1 3FX (United Kingdom); Manera, Marc [Centre for Theoretical Cosmology, Department of Applied Mathematics and Theoretical Physics, University of Cambridge, Wilberforce Road, Cambridge CB3 0WA (United Kingdom); Zhao, Gong-Bo, E-mail: hans.a.winther@gmail.com, E-mail: kazuya.koyama@port.ac.uk, E-mail: manera.work@gmail.com, E-mail: bill.wright@port.ac.uk, E-mail: gong-bo.Zhao@port.ac.uk [National Astronomy Observatories, Chinese Academy of Science, Beijing, 100012 (China)

2017-08-01

We present a general parallelized and easy-to-use code to perform numerical simulations of structure formation using the COLA (COmoving Lagrangian Acceleration) method for cosmological models that exhibit scale-dependent growth at the level of first and second order Lagrangian perturbation theory. For modified gravity theories we also include screening using a fast approximate method that covers all the main examples of screening mechanisms in the literature. We test the code by comparing it to full simulations of two popular modified gravity models, namely f ( R ) gravity and nDGP, and find good agreement in the modified gravity boost-factors relative to ΛCDM even when using a fairly small number of COLA time steps.

Cumulants in perturbation expansions for non-equilibrium field theory

International Nuclear Information System (INIS)

Fauser, R.

1995-11-01

The formulation of perturbation expansions for a quantum field theory of strongly interacting systems in a general non-equilibrium state is discussed. Non-vanishing initial correlations are included in the formulation of the perturbation expansion in terms of cumulants. The cumulants are shown to be the suitable candidate for summing up the perturbation expansion. Also a linked-cluster theorem for the perturbation series with cumulants is presented. Finally a generating functional of the perturbation series with initial correlations is studied. We apply the methods to a simple model of a fermion-boson system. (orig.)

High-throughput screening of effective siRNAs using luciferase-linked chimeric mRNA.

Directory of Open Access Journals (Sweden)

Shen Pang

Full Text Available The use of siRNAs to knock down gene expression can potentially be an approach to treat various diseases. To avoid siRNA toxicity the less transcriptionally active H1 pol III promoter, rather than the U6 promoter, was proposed for siRNA expression. To identify highly efficacious siRNA sequences, extensive screening is required, since current computer programs may not render ideal results. Here, we used CCR5 gene silencing as a model to investigate a rapid and efficient screening approach. We constructed a chimeric luciferase-CCR5 gene for high-throughput screening of siRNA libraries. After screening approximately 900 shRNA clones, 12 siRNA sequences were identified. Sequence analysis demonstrated that most (11 of the 12 sequences of these siRNAs did not match those identified by available siRNA prediction algorithms. Significant inhibition of CCR5 in a T-lymphocyte cell line and primary T cells by these identified siRNAs was confirmed using the siRNA lentiviral vectors to infect these cells. The inhibition of CCR5 expression significantly protected cells from R5 HIV-1JRCSF infection. These results indicated that the high-throughput screening method allows efficient identification of siRNA sequences to inhibit the target genes at low levels of expression.

Traffic Perturbation

CERN Multimedia

C. Colloca TS/FM

2004-01-01

TS/FM group informs you that, for the progress of the works at the Prévessin site entrance, some perturbation of the traffic may occur during the week between the 14th and 18th of June for a short duration. Access will be assured at any time. For more information, please contact 160239. C. Colloca TS/FM

Mode coupling of Schwarzschild perturbations: Ringdown frequencies

International Nuclear Information System (INIS)

Pazos, Enrique; Brizuela, David; Martin-Garcia, Jose M.; Tiglio, Manuel

2010-01-01

Within linearized perturbation theory, black holes decay to their final stationary state through the well-known spectrum of quasinormal modes. Here we numerically study whether nonlinearities change this picture. For that purpose we study the ringdown frequencies of gauge-invariant second-order gravitational perturbations induced by self-coupling of linearized perturbations of Schwarzschild black holes. We do so through high-accuracy simulations in the time domain of first and second-order Regge-Wheeler-Zerilli type equations, for a variety of initial data sets. We consider first-order even-parity (l=2, m=±2) perturbations and odd-parity (l=2, m=0) ones, and all the multipoles that they generate through self-coupling. For all of them and all the initial data sets considered we find that--in contrast to previous predictions in the literature--the numerical decay frequencies of second-order perturbations are the same ones of linearized theory, and we explain the observed behavior. This would indicate, in particular, that when modeling or searching for ringdown gravitational waves, appropriately including the standard quasinormal modes already takes into account nonlinear effects.

Supersymmetry restoration in superstring perturbation theory

International Nuclear Information System (INIS)

Sen, Ashoke

2015-01-01

Superstring perturbation theory based on the 1PI effective theory approach has been useful for addressing the problem of mass renormalization and vacuum shift. We derive Ward identities associated with space-time supersymmetry transformation in this approach. This leads to a proof of the equality of renormalized masses of bosons and fermions and identities relating fermionic amplitudes to bosonic amplitudes after taking into account the effect of mass renormalization. This also relates unbroken supersymmetry to a given order in perturbation theory to absence of tadpoles of massless scalars to higher order. The results are valid at the perturbative vacuum as well as in the shifted vacuum when the latter describes the correct ground state of the theory. We apply this to SO(32) heterotic string theory on Calabi-Yau 3-folds where a one loop Fayet-Iliopoulos term apparently breaks supersymmetry at one loop, but analysis of the low energy effective field theory indicates that there is a nearby vacuum where supersymmetry is restored. We explicitly prove that the perturbative amplitudes of this theory around the shifted vacuum indeed satisfy the Ward identities associated with unbroken supersymmetry. We also test the general arguments by explicitly verifying the equality of bosonic and fermionic masses at one loop order in the shifted vacuum, and the appearance of two loop dilaton tadpole in the perturbative vacuum where supersymmetry is expected to be broken.

Supersymmetry restoration in superstring perturbation theory

Energy Technology Data Exchange (ETDEWEB)

Sen, Ashoke [Harish-Chandra Research Institute,Chhatnag Road, Jhusi, Allahabad 211019 (India)

2015-12-14

Superstring perturbation theory based on the 1PI effective theory approach has been useful for addressing the problem of mass renormalization and vacuum shift. We derive Ward identities associated with space-time supersymmetry transformation in this approach. This leads to a proof of the equality of renormalized masses of bosons and fermions and identities relating fermionic amplitudes to bosonic amplitudes after taking into account the effect of mass renormalization. This also relates unbroken supersymmetry to a given order in perturbation theory to absence of tadpoles of massless scalars to higher order. The results are valid at the perturbative vacuum as well as in the shifted vacuum when the latter describes the correct ground state of the theory. We apply this to SO(32) heterotic string theory on Calabi-Yau 3-folds where a one loop Fayet-Iliopoulos term apparently breaks supersymmetry at one loop, but analysis of the low energy effective field theory indicates that there is a nearby vacuum where supersymmetry is restored. We explicitly prove that the perturbative amplitudes of this theory around the shifted vacuum indeed satisfy the Ward identities associated with unbroken supersymmetry. We also test the general arguments by explicitly verifying the equality of bosonic and fermionic masses at one loop order in the shifted vacuum, and the appearance of two loop dilaton tadpole in the perturbative vacuum where supersymmetry is expected to be broken.

Nonperturbative Quantum Physics from Low-Order Perturbation Theory.

Science.gov (United States)

Mera, Héctor; Pedersen, Thomas G; Nikolić, Branislav K

2015-10-02

The Stark effect in hydrogen and the cubic anharmonic oscillator furnish examples of quantum systems where the perturbation results in a certain ionization probability by tunneling processes. Accordingly, the perturbed ground-state energy is shifted and broadened, thus acquiring an imaginary part which is considered to be a paradigm of nonperturbative behavior. Here we demonstrate how the low order coefficients of a divergent perturbation series can be used to obtain excellent approximations to both real and imaginary parts of the perturbed ground state eigenenergy. The key is to use analytic continuation functions with a built-in singularity structure within the complex plane of the coupling constant, which is tailored by means of Bender-Wu dispersion relations. In the examples discussed the analytic continuation functions are Gauss hypergeometric functions, which take as input fourth order perturbation theory and return excellent approximations to the complex perturbed eigenvalue. These functions are Borel consistent and dramatically outperform widely used Padé and Borel-Padé approaches, even for rather large values of the coupling constant.

On the existence of perturbed Robertson-Walker universes

International Nuclear Information System (INIS)

D'Eath, P.D.

1976-01-01

Solutions of the full nonlinear field equations of general relativity near the Robertson-Walker universes are examined, together with their relation to linearized perturbations. A method due to Choquet-Bruhat and Deser is used to prove existence theorems for solutions near Robertson-Walker constraint data of the constraint equations on a spacelike hypersurface. These theorems allow one to regard the matter fluctuations as independent quantities, ranging over certain function spaces. In the k=-1 case the existence theory describes perturbations which may vary within uniform bounds throughout space. When k=+1 a modification of the method leads to a theorem which clarifies some unusual features of these constraint perturbations. The k=0 existence theorem refers only to perturbations which die away at large distances. The connection between linearized constraint solutions and solutions of the full constraints is discussed. For k= +- 1 backgrounds, solutions of the linearized constraints are analyzed using transverse-traceless decompositions of symmetric tensors. Finally the time-evolution of perturbed constraint data and the validity of linearized perturbation theory for Robertson-Walker universes are considered

Finite field-dependent symmetries in perturbative quantum gravity

International Nuclear Information System (INIS)

Upadhyay, Sudhaker

2014-01-01

In this paper we discuss the absolutely anticommuting nilpotent symmetries for perturbative quantum gravity in general curved spacetime in linear and non-linear gauges. Further, we analyze the finite field-dependent BRST (FFBRST) transformation for perturbative quantum gravity in general curved spacetime. The FFBRST transformation changes the gauge-fixing and ghost parts of the perturbative quantum gravity within functional integration. However, the operation of such symmetry transformation on the generating functional of perturbative quantum gravity does not affect the theory on physical ground. The FFBRST transformation with appropriate choices of finite BRST parameter connects non-linear Curci–Ferrari and Landau gauges of perturbative quantum gravity. The validity of the results is also established at quantum level using Batalin–Vilkovisky (BV) formulation. -- Highlights: •The perturbative quantum gravity is treated as gauge theory. •BRST and anti-BRST transformations are developed in linear and non-linear gauges. •BRST transformation is generalized by making it finite and field dependent. •Connection between linear and non-linear gauges is established. •Using BV formulation the results are established at quantum level also

High-order perturbations of a spherical collapsing star

International Nuclear Information System (INIS)

Brizuela, David; Martin-Garcia, Jose M.; Sperhake, Ulrich; Kokkotas, Kostas D.

2010-01-01

A formalism to deal with high-order perturbations of a general spherical background was developed in earlier work [D. Brizuela, J. M. Martin-Garcia, and G. A. Mena Marugan, Phys. Rev. D 74, 044039 (2006); D. Brizuela, J. M. Martin-Garcia, and G. A. Mena Marugan, Phys. Rev. D 76, 024004 (2007)]. In this paper, we apply it to the particular case of a perfect fluid background. We have expressed the perturbations of the energy-momentum tensor at any order in terms of the perturbed fluid's pressure, density, and velocity. In general, these expressions are not linear and have sources depending on lower-order perturbations. For the second-order case we make the explicit decomposition of these sources in tensor spherical harmonics. Then, a general procedure is given to evolve the perturbative equations of motions of the perfect fluid for any value of the harmonic label. Finally, with the problem of a spherical collapsing star in mind, we discuss the high-order perturbative matching conditions across a timelike surface, in particular, the surface separating the perfect fluid interior from the exterior vacuum.

In vitro screening of environmental chemicals for targeted testing prioritization: the ToxCast project.

Science.gov (United States)

Judson, Richard S; Houck, Keith A; Kavlock, Robert J; Knudsen, Thomas B; Martin, Matthew T; Mortensen, Holly M; Reif, David M; Rotroff, Daniel M; Shah, Imran; Richard, Ann M; Dix, David J

2010-04-01

Chemical toxicity testing is being transformed by advances in biology and computer modeling, concerns over animal use, and the thousands of environmental chemicals lacking toxicity data. The U.S. Environmental Protection Agency's ToxCast program aims to address these concerns by screening and prioritizing chemicals for potential human toxicity using in vitro assays and in silico approaches. This project aims to evaluate the use of in vitro assays for understanding the types of molecular and pathway perturbations caused by environmental chemicals and to build initial prioritization models of in vivo toxicity. We tested 309 mostly pesticide active chemicals in 467 assays across nine technologies, including high-throughput cell-free assays and cell-based assays, in multiple human primary cells and cell lines plus rat primary hepatocytes. Both individual and composite scores for effects on genes and pathways were analyzed. Chemicals displayed a broad spectrum of activity at the molecular and pathway levels. We saw many expected interactions, including endocrine and xenobiotic metabolism enzyme activity. Chemicals ranged in promiscuity across pathways, from no activity to affecting dozens of pathways. We found a statistically significant inverse association between the number of pathways perturbed by a chemical at low in vitro concentrations and the lowest in vivo dose at which a chemical causes toxicity. We also found associations between a small set of in vitro assays and rodent liver lesion formation. This approach promises to provide meaningful data on the thousands of untested environmental chemicals and to guide targeted testing of environmental contaminants.

The Screening of Genes Sensitive to Long-Term, Low-Level Microwave Exposure and Bioinformatic Analysis of Potential Correlations to Learning and Memory

Institute of Scientific and Technical Information of China (English)

ZHAO Ya Li; LI Ying Xian; MA Hong Bo; LI Dong; LI Hai Liang; JIANG Rui; KAN Guang Han; YANG Zhen Zhong; HUANG Zeng Xin

2015-01-01

Objective To gain a better understanding of gene expression changes in the brain following microwave exposure in mice. This study hopes to reveal mechanisms contributing to microwave-induced learning and memory dysfunction. Methods Mice were exposed to whole body 2100 MHz microwaves with specific absorption rates (SARs) of 0.45 W/kg, 1.8 W/kg, and 3.6 W/kg for 1 hour daily for 8 weeks. Differentially expressing genes in the brains were screened using high-density oligonucleotide arrays, with genes showing more significant differences further confirmed by RT-PCR. Results The gene chip results demonstrated that 41 genes (0.45 W/kg group), 29 genes (1.8 W/kg group), and 219 genes (3.6 W/kg group) were differentially expressed. GO analysis revealed that these differentially expressed genes were primarily involved in metabolic processes, cellular metabolic processes, regulation of biological processes, macromolecular metabolic processes, biosynthetic processes, cellular protein metabolic processes, transport, developmental processes, cellular component organization, etc. KEGG pathway analysis showed that these genes are mainly involved in pathways related to ribosome, Alzheimer's disease, Parkinson's disease, long-term potentiation, Huntington's disease, and Neurotrophin signaling. Construction of a protein interaction network identified several important regulatory genes including synbindin (sbdn), Crystallin (CryaB), PPP1CA, Ywhaq, Psap, Psmb1, Pcbp2, etc., which play important roles in the processes of learning and memory. Conclusion Long-term, low-level microwave exposure may inhibit learning and memory by affecting protein and energy metabolic processes and signaling pathways relating to neurological functions or diseases.

The spectrum of density perturbations in an expanding universe

Science.gov (United States)

Silk, J.

1974-01-01

The basic dynamic equations that govern the evolution of perturbations in a Friedmann-Lemaitre universe are derived. General solutions describing the evolution of adiabatic perturbations in the density of matter are obtained, and the choice of the appropriate initial conditions is examined. The various perturbation modes are compared, and the effects of decoupling on the perturbation spectrum are studied. The scheme used to follow the evolution of density perturbations through decoupling is based on an extension of the Eddington approximation to the radiative transfer equation, and is strictly valid in both optically thick and thin limits.

A perturbation-based model for rectifier circuits

Directory of Open Access Journals (Sweden)

Vipin B. Vats

2006-01-01

Full Text Available A perturbation-theoretic analysis of rectifier circuits is presented. The governing differential equation of the half-wave rectifier with capacitor filter is analyzed by expanding the output voltage as a Taylor series with respect to an artificially introduced parameter in the nonlinearity of the diode characteristic as is done in quantum theory. The perturbation parameter introduced in the analysis is independent of the circuit components as compared to the method presented by multiple scales. The various terms appearing in the perturbation series are then modeled in the form of an equivalent circuit. This model is subsequently used in the analysis of full-wave rectifier. Matlab simulation results are included which confirm the validity of the theoretical formulations. Perturbation analysis acts a helpful tool in analyzing time-varying systems and chaotic systems.

SHARP ENTRYWISE PERTURBATION BOUNDS FOR MARKOV CHAINS.

Science.gov (United States)

Thiede, Erik; VAN Koten, Brian; Weare, Jonathan

For many Markov chains of practical interest, the invariant distribution is extremely sensitive to perturbations of some entries of the transition matrix, but insensitive to others; we give an example of such a chain, motivated by a problem in computational statistical physics. We have derived perturbation bounds on the relative error of the invariant distribution that reveal these variations in sensitivity. Our bounds are sharp, we do not impose any structural assumptions on the transition matrix or on the perturbation, and computing the bounds has the same complexity as computing the invariant distribution or computing other bounds in the literature. Moreover, our bounds have a simple interpretation in terms of hitting times, which can be used to draw intuitive but rigorous conclusions about the sensitivity of a chain to various types of perturbations.

Schroedinger operators with singular perturbation potentials

International Nuclear Information System (INIS)

Harrell, E.M. II.

1976-01-01

This is a perturbative analysis of the eigenvalues and eigenfunctions of Schroedinger operators of the form -Δ + A + lambda V, defined on the Hilbert space L 2 (R/sup n/). A is a potential function (a smooth, real multiplication operator), and V is a ''spikelike'' perturbation, i.e., a perturbative potential function which diverges at some finite point. Lambda is a small real or complex parameter. The emphasis is on one-dimensional problems, and in particular the typical example is the ''spiked harmonic oscillator'' Hamiltonian, -d 2 /dx 2 + x 2 + lambda x/sup -α/, where α is a positive constant. An earlier study by L. Detwiler and J. R. Klauder [Phys. Rev. D 11 (1975) 1436] indicated that the lowest-order corrections to the ground-state eigenvalue of the spiked harmonic oscillator with lambda greater than 0 were proportional to lambda ln lambda when α = 3, and to lambda/sup 1/(α-2) when α is greater than 3. These and analogous results for a large class of operators and arbitrary eigenvalues are proved. Explicit constants in a modified perturbation series with a complicated dependence on lambda are determined and exhibited. Higher-order corrections for real lambda and lowest-order corrections for complex lambda are also discussed. While the substance of the dissertation is mathematical, its main applications are to quantum physics. The immediate cause of interest in such problems was the use of their peculiar convergence properties by J. R. Klauder as models for the behavior of nonrenormalizable quantum field theories. However, the results of this study are likely to be of greater importance in chemical or nuclear physics, as positive spikelike perturbations represent repulsive core interactions for quantum mechanical particles. The modified perturbation series are a new calculation technique for this situation

HNF1 alpha gene coding regions mutations screening, in a Caucasian population clinically characterized as MODY from Argentina.

Science.gov (United States)

Lopez, Ariel Pablo; Foscaldi, Sabrina Andrea; Perez, Maria Silvia; Rodriguez, Martín; Traversa, Mercedes; Puchulu, Félix Miguel; Bergada, Ignacio; Frechtel, Gustavo Daniel

2011-02-01

There are at least six subtypes of Maturity Onset Diabetes of the Young (MODY) with distinctive genetic causes. MODY 3 is caused by mutations in HNF1A gene, an insulin transcription factor, so mutations in this gene are associated with impaired insulin secretion. MODY 3 prevalence differs according to the population analyzed, but it is one of the most frequent subtypes. Therefore, our aims in this work were to find mutations present in the HNF1A gene and provide information on their prevalence. Mutations screening was done in a group of 80 unrelated patients (average age 17.1 years) selected by clinical characterization of MODY, by SSCP electrophoresis followed by sequenciation. We found eight mutations, of which six were novel and four sequence variants, which were all novel. Therefore the prevalence of MODY 3 in this group was 10%. Compared clinical data between the non-MODY 3 patients and the MODY 3 diagnosed patients did not show any significant difference. Eight patients were diagnosed as MODY 3 and new data about the prevalence of that subtype is provided. Our results contribute to reveal novel mutations, providing new data about the prevalence of that subtype. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Wilson loops in very high order lattice perturbation theory

International Nuclear Information System (INIS)

Ilgenfritz, E.M.; Nakamura, Y.; Perlt, H.; Schiller, A.; Rakow, P.E.L.; Schierholz, G.; Regensburg Univ.

2009-10-01

We calculate Wilson loops of various sizes up to loop order n=20 for lattice sizes of L 4 (L=4,6,8,12) using the technique of Numerical Stochastic Perturbation Theory in quenched QCD. This allows to investigate the behaviour of the perturbative series at high orders. We discuss three models to estimate the perturbative series: a renormalon inspired fit, a heuristic fit based on an assumed power-law singularity and boosted perturbation theory. We have found differences in the behavior of the perturbative series for smaller and larger Wilson loops at moderate n. A factorial growth of the coefficients could not be confirmed up to n=20. From Monte Carlo measured plaquette data and our perturbative result we estimate a value of the gluon condensate left angle (α)/(π)GG right angle. (orig.)

Exact perturbation theory of multiphoton processes at high intensities. [Schroedinger equation, perturbation theory, matrix

Energy Technology Data Exchange (ETDEWEB)

Faisal, F H.M. [Bielefeld Univ. (Germany, F.R.). Fakultaet fuer Physik

1976-06-11

In this work the perturbation theory for multiphoton processes at high intensities is investigated and it is described an analytical method of summing the perturbation series to extract the contribution from all terms that give rise to the absorption of N photons by an atomic system. The method is first applied to the solution of a simple model problem and the result is confirmed by direct integration of the model Schroedinger equation. The usual lowest (nonvanishing)-order perturbation-theoretical calculation is also carried out for this model to demonstrate explicitly that the full result correctly reproduces that of the lowest-order theory in the limit of low intensity. The method is then extended to the case of an atomic system with well-developed spectrum (e.g. H atom) and the N-photon T-matrix is derived in terms of a ''photon matrix'' asub(N), for which a three-term recurrence relation is established. Next, from the vantage point of the general result obtained here, A probe is made into the nature of several approximate nonperturbative solutions that have appeared in the literature in the past. It is shown here that their applicability is severely restricted by the requirement of the essential spectral degeneracy of the atomic system. Finally, appendix A outlines a prescription of computing the photon matrix asub(N), which (as in the usual lowest-order perturbation-theoretical calculation)requires a knowledge of the eigenfunctions and eigenvalues of the atomic Hamiltonian only.

A FRET-based high throughput screening assay to identify inhibitors of anthrax protective antigen binding to capillary morphogenesis gene 2 protein.

Directory of Open Access Journals (Sweden)

Michael S Rogers

Full Text Available Anti-angiogenic therapies are effective for the treatment of cancer, a variety of ocular diseases, and have potential benefits in cardiovascular disease, arthritis, and psoriasis. We have previously shown that anthrax protective antigen (PA, a non-pathogenic component of anthrax toxin, is an inhibitor of angiogenesis, apparently as a result of interaction with the cell surface receptors capillary morphogenesis gene 2 (CMG2 protein and tumor endothelial marker 8 (TEM8. Hence, molecules that bind the anthrax toxin receptors may be effective to slow or halt pathological vascular growth. Here we describe development and testing of an effective homogeneous steady-state fluorescence resonance energy transfer (FRET high throughput screening assay designed to identify molecules that inhibit binding of PA to CMG2. Molecules identified in the screen can serve as potential lead compounds for the development of anti-angiogenic and anti-anthrax therapies. The assay to screen for inhibitors of this protein-protein interaction is sensitive and robust, with observed Z' values as high as 0.92. Preliminary screens conducted with a library of known bioactive compounds identified tannic acid and cisplatin as inhibitors of the PA-CMG2 interaction. We have confirmed that tannic acid both binds CMG2 and has anti-endothelial properties. In contrast, cisplatin appears to inhibit PA-CMG2 interaction by binding both PA and CMG2, and observed cisplatin anti-angiogenic effects are not mediated by interaction with CMG2. This work represents the first reported high throughput screening assay targeting CMG2 to identify possible inhibitors of both angiogenesis and anthrax intoxication.

Introduction and overview to some topics in perturbative QCD and their relationship to non perturbative effects

International Nuclear Information System (INIS)

West, G.

1990-01-01

The main thrust of this talk is to review and discuss various topics in both perturbative and non-perturbative QCD that are, by and large, model independent. This inevitably means that we shall rely heavily on the renormalization group and asymptotic freedom. Although this usually means that one has to concentrate on high energy phenomena, there are some physical processes even involving bound states which are certainly highly non-perturbative, where one can make some progress without becoming overly model independent. Experience with the EMC effect, where there are about as many ''explanations'' as authors, has surely taught us that it may well be worth returning to ''basics'' and thinking about general properties of QCD rather than guessing, essentially arbitrarily, what we think is its low energy structure. No doubt we shall have to await further numerical progress or for some inspired theoretical insight before we can, with confidence, attack these extremely difficult problems. So, with this in mine, I shall review a smattering of problems which do have a non-perturbative component and where some rather modest progress can actually be made; I emphasize the adjective ''modest''exclamation point

Effective field theory of cosmological perturbations

International Nuclear Information System (INIS)

Piazza, Federico; Vernizzi, Filippo

2013-01-01

The effective field theory of cosmological perturbations stems from considering a cosmological background solution as a state displaying spontaneous breaking of time translations and (adiabatic) perturbations as the related Nambu–Goldstone modes. With this insight, one can systematically develop a theory for the cosmological perturbations during inflation and, with minor modifications, also describe in full generality the gravitational interactions of dark energy, which are relevant for late-time cosmology. The formalism displays a unique set of Lagrangian operators containing an increasing number of cosmological perturbations and derivatives. We give an introductory description of the unitary gauge formalism for theories with broken gauge symmetry—that allows us to write down the most general Lagrangian—and of the Stückelberg ‘trick’—that allows to recover gauge invariance and to make the scalar field explicit. We show how to apply this formalism to gravity and cosmology and we reproduce the detailed analysis of the action in the ADM variables. We also review some basic applications to inflation and dark energy. (paper)

Privacy Is Become with, Data Perturbation

Science.gov (United States)

Singh, Er. Niranjan; Singhai, Niky

2011-06-01

Privacy is becoming an increasingly important issue in many data mining applications that deal with health care, security, finance, behavior and other types of sensitive data. Is particularly becoming important in counterterrorism and homeland security-related applications. We touch upon several techniques of masking the data, namely random distortion, including the uniform and Gaussian noise, applied to the data in order to protect it. These perturbation schemes are equivalent to additive perturbation after the logarithmic Transformation. Due to the large volume of research in deriving private information from the additive noise perturbed data, the security of these perturbation schemes is questionable Many artificial intelligence and statistical methods exist for data analysis interpretation, Identifying and measuring the interestingness of patterns and rules discovered, or to be discovered is essential for the evaluation of the mined knowledge and the KDD process as a whole. While some concrete measurements exist, assessing the interestingness of discovered knowledge is still an important research issue. As the tool for the algorithm implementations we chose the language of choice in industrial world MATLAB.

Effective field theory of cosmological perturbations

Science.gov (United States)

Piazza, Federico; Vernizzi, Filippo

2013-11-01

The effective field theory of cosmological perturbations stems from considering a cosmological background solution as a state displaying spontaneous breaking of time translations and (adiabatic) perturbations as the related Nambu-Goldstone modes. With this insight, one can systematically develop a theory for the cosmological perturbations during inflation and, with minor modifications, also describe in full generality the gravitational interactions of dark energy, which are relevant for late-time cosmology. The formalism displays a unique set of Lagrangian operators containing an increasing number of cosmological perturbations and derivatives. We give an introductory description of the unitary gauge formalism for theories with broken gauge symmetry—that allows us to write down the most general Lagrangian—and of the Stückelberg ‘trick’—that allows to recover gauge invariance and to make the scalar field explicit. We show how to apply this formalism to gravity and cosmology and we reproduce the detailed analysis of the action in the ADM variables. We also review some basic applications to inflation and dark energy.

Perturbation of an exact strong gravity solution

International Nuclear Information System (INIS)

Baran, S.A.

1982-10-01

Perturbations of an exact strong gravity solution are investigated. It is shown, by using the new multipole expansions previously presented, that this exact and static spherically symmetric solution is stable under odd parity perturbations. (author)

Gene screening in a Chinese family with Marfan syndrome

Directory of Open Access Journals (Sweden)

Wen-Jiao Xia

2016-05-01

Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

On the singular perturbations for fractional differential equation.

Science.gov (United States)

Atangana, Abdon

2014-01-01

The goal of this paper is to examine the possible extension of the singular perturbation differential equation to the concept of fractional order derivative. To achieve this, we presented a review of the concept of fractional calculus. We make use of the Laplace transform operator to derive exact solution of singular perturbation fractional linear differential equations. We make use of the methodology of three analytical methods to present exact and approximate solution of the singular perturbation fractional, nonlinear, nonhomogeneous differential equation. These methods are including the regular perturbation method, the new development of the variational iteration method, and the homotopy decomposition method.

Microfluidic mixing through oscillatory transverse perturbations

Science.gov (United States)

Wu, J. W.; Xia, H. M.; Zhang, Y. Y.; Zhu, P.

2018-05-01

Fluid mixing in miniaturized fluidic devices is a challenging task. In this work, the mixing enhancement through oscillatory transverse perturbations coupling with divergent circular chambers is studied. To simplify the design, an autonomous microfluidic oscillator is used to produce the oscillatory flow. It is then applied to four side-channels that intersect with a central channel of constant flow. The mixing performance is tested at high fluid viscosities of up to 16 cP. Results show that the oscillatory flow can cause strong transverse perturbations which effectively enhance the mixing. The influence of a fluidic capacitor in the central channel is also examined, which at low viscosities can intensify the perturbations and further improve the mixing.

Perturbative QCD and exclusive processes

International Nuclear Information System (INIS)

Bennett, J.; Hawes, F.; Zhao, M.; Zyla, P.

1991-01-01

The authors discuss perturbation theory as applied to particle physics calculations. In particle physics one is generally interested in the scattering amplitude for a system going from some initial state to a final state. The intermediate state or states are unknown. To get the scattering amplitude it is necessary to sum the contributions from processes which pass through all possible intermediate states. Intermediate states involve the exchange of intermediate vector bosons between the particles, and with this interaction is associated a coupling constant α. Each additional boson exchange involves an additional contribution of α to the coupling. If α is less than 1, one can see that the relative contribution of higher order processes is less and less important as α falls. In QCD the gluons serve as the intermediate vector bosons exchanged by quarks and gluons, and the interaction constant is not really a constant, but depends upon the distance between the particles. At short distances the coupling is small, and one can assume perturbative expansions may converge rapidly. Exclusive scattering processes, as opposed to inclusive, are those in which all of the final state products are detected. The authors then discuss the application of perturbative QCD to the deuteron. The issues of chiral conservation and color transparancy are also discussed, in the scheme of large Q 2 interations, where perturbative QCD should be applicable

Perturbative analysis of multiple-field cosmological inflation

International Nuclear Information System (INIS)

Lahiri, Joydev; Bhattacharya, Gautam

2006-01-01

We develop a general formalism for analyzing linear perturbations in multiple-field cosmological inflation based on the gauge-ready approach. Our inflationary model consists of an arbitrary number of scalar fields with non-minimal kinetic terms. We solve the equations for scalar- and tensor-type perturbations during inflation to the first order in slow roll, and then obtain the super-horizon solutions for adiabatic and isocurvature perturbations after inflation. Analytic expressions for power-spectra and spectral indices arising from multiple-field inflation are presented

Exact Controllability and Perturbation Analysis for Elastic Beams

International Nuclear Information System (INIS)

Moreles, Miguel Angel

2004-01-01

The Rayleigh beam is a perturbation of the Bernoulli-Euler beam. We establish convergence of the solution of the Exact Controllability Problem for the Rayleigh beam to the corresponding solution of the Bernoulli-Euler beam. Convergence is related to a Singular Perturbation Problem. The main tool in solving this perturbation problem is a weak version of a lower bound for hyperbolic polynomials

Modeling Small-Amplitude Perturbations in Inertial Confinement Fusion Pellets

Science.gov (United States)

Zalesak, Steven; Metzler, N.; Velikovich, A. L.; Gardner, J. H.; Manheimer, W.

2005-10-01

Recent advances in inertial confinement fusion (ICF) technology serve to ensure that imploding laser-driven ICF pellets will spend a significantly larger portion of their time in what is regarded as the ``linear'' portion of their perturbation evolution, i.e., in the presence of small-amplitude but nonetheless evolving perturbations. Since the evolution of these linear perturbations collectively form the initial conditions for the subsequent nonlinear evolution of the pellet, which in turn determines the energy yield of the pellet, the accurate numerical modeling of these small-amplitude perturbations has taken on an increased importance. This modeling is difficult despite the expected linear evolution of the perturbations themselves, because these perturbations are embedded in a highly nonlinear, strongly-shocked, and highly complex flow field which in and of itself stresses numerical computation capabilities, and whose simulation often employs numerical techniques which were not designed with the proper treatment of small-amplitude perturbations in mind. In this paper we will review some of the techniques that we have recently found to be of use toward this end.

Cosmological perturbations on the phantom brane