WorldWideScience

Sample records for gene order variation

  1. Pathogenicity gene variations within the order Entomophthorales

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    Fungi within the order Entomophthorales (subphylum Entomophthoromycotina) are obligate biotrophic pathogens of arthropods with a remarkable narrow host range. Infection takes place through the cuticle when conidia hit a susceptible host, facilitated by enzymatic and mechanical mechanisms. In the ...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin....

  2. Pathogenicity gene variations within the order Entomophthorales

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    , conidia are produced and discharged when humidity gets high—usually during night. In an earlier secretome study of field-collected grain aphids (Sitobion avenae) infected with entomophthoralean fungi, a number of pathogenesis-related, secreted enzymes were discovered (Fungal Genetics and Biology 2011, vol...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin....

  3. Phylogeny and mitochondrial gene order variation in Lophotrochozoa in the light of new mitogenomic data from Nemertea

    Directory of Open Access Journals (Sweden)

    von Döhren Jörn

    2009-08-01

    Full Text Available Abstract Background The new animal phylogeny established several taxa which were not identified by morphological analyses, most prominently the Ecdysozoa (arthropods, roundworms, priapulids and others and Lophotrochozoa (molluscs, annelids, brachiopods and others. Lophotrochozoan interrelationships are under discussion, e.g. regarding the position of Nemertea (ribbon worms, which were discussed to be sister group to e.g. Mollusca, Brachiozoa or Platyhelminthes. Mitochondrial genomes contributed well with sequence data and gene order characters to the deep metazoan phylogeny debate. Results In this study we present the first complete mitochondrial genome record for a member of the Nemertea, Lineus viridis. Except two trnP and trnT, all genes are located on the same strand. While gene order is most similar to that of the brachiopod Terebratulina retusa, sequence based analyses of mitochondrial genes place nemerteans close to molluscs, phoronids and entoprocts without clear preference for one of these taxa as sister group. Conclusion Almost all recent analyses with large datasets show good support for a taxon comprising Annelida, Mollusca, Brachiopoda, Phoronida and Nemertea. But the relationships among these taxa vary between different studies. The analysis of gene order differences gives evidence for a multiple independent occurrence of a large inversion in the mitochondrial genome of Lophotrochozoa and a re-inversion of the same part in gastropods. We hypothesize that some regions of the genome have a higher chance for intramolecular recombination than others and gene order data have to be analysed carefully to detect convergent rearrangement events.

  4. Phylogeny and mitochondrial gene order variation in Lophotrochozoa in the light of new mitogenomic data from Nemertea.

    Science.gov (United States)

    Podsiadlowski, Lars; Braband, Anke; Struck, Torsten H; von Döhren, Jörn; Bartolomaeus, Thomas

    2009-08-06

    The new animal phylogeny established several taxa which were not identified by morphological analyses, most prominently the Ecdysozoa (arthropods, roundworms, priapulids and others) and Lophotrochozoa (molluscs, annelids, brachiopods and others). Lophotrochozoan interrelationships are under discussion, e.g. regarding the position of Nemertea (ribbon worms), which were discussed to be sister group to e.g. Mollusca, Brachiozoa or Platyhelminthes. Mitochondrial genomes contributed well with sequence data and gene order characters to the deep metazoan phylogeny debate. In this study we present the first complete mitochondrial genome record for a member of the Nemertea, Lineus viridis. Except two trnP and trnT, all genes are located on the same strand. While gene order is most similar to that of the brachiopod Terebratulina retusa, sequence based analyses of mitochondrial genes place nemerteans close to molluscs, phoronids and entoprocts without clear preference for one of these taxa as sister group. Almost all recent analyses with large datasets show good support for a taxon comprising Annelida, Mollusca, Brachiopoda, Phoronida and Nemertea. But the relationships among these taxa vary between different studies. The analysis of gene order differences gives evidence for a multiple independent occurrence of a large inversion in the mitochondrial genome of Lophotrochozoa and a re-inversion of the same part in gastropods. We hypothesize that some regions of the genome have a higher chance for intramolecular recombination than others and gene order data have to be analysed carefully to detect convergent rearrangement events.

  5. Total variation projection with first order schemes.

    Science.gov (United States)

    Fadili, Jalal M; Peyre, Gabriel

    2011-03-01

    This article proposes a new algorithm to compute the projection on the set of images whose total variation is bounded by a constant. The projection is computed through a dual formulation that is solved by first order non-smooth optimization methods. This yields an iterative algorithm that applies iterative soft thresholding to the dual vector field, and for which we establish convergence rate on the primal iterates. This projection algorithm can then be used as a building block in a variety of applications such as solving inverse problems under a total variation constraint, or for texture synthesis. Numerical results are reported to illustrate the usefulness and potential applicability of our TV projection algorithm on various examples including denoising, texture synthesis, inpainting, deconvolution and tomography problems. We also show that our projection algorithm competes favorably with state-of-the-art TV projection methods in terms of convergence speed.

  6. Invariant Higher-Order Variational Problems II

    Science.gov (United States)

    Gay-Balmaz, François; Holm, Darryl D.; Meier, David M.; Ratiu, Tudor S.; Vialard, François-Xavier

    2012-08-01

    Motivated by applications in computational anatomy, we consider a second-order problem in the calculus of variations on object manifolds that are acted upon by Lie groups of smooth invertible transformations. This problem leads to solution curves known as Riemannian cubics on object manifolds that are endowed with normal metrics. The prime examples of such object manifolds are the symmetric spaces. We characterize the class of cubics on object manifolds that can be lifted horizontally to cubics on the group of transformations. Conversely, we show that certain types of non-horizontal geodesic on the group of transformations project to cubics. Finally, we apply second-order Lagrange-Poincaré reduction to the problem of Riemannian cubics on the group of transformations. This leads to a reduced form of the equations that reveals the obstruction for the projection of a cubic on a transformation group to again be a cubic on its object manifold.

  7. A novel mitochondrial gene order in shorebirds (Scolopacidae, Charadriiformes)

    NARCIS (Netherlands)

    Verkuil, Yvonne I.; Piersma, Theunis; Baker, Allan J.

    2010-01-01

    Although the mitochondrial genome in birds has highly conserved features, with protein genes similar to mammals and amphibians, several variations in gene order around the hypervariable control region have been found. Here we report a novel gene arrangement around the control region in shorebirds (C

  8. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly.

    Science.gov (United States)

    Wells, Jonathan N; Bergendahl, L Therese; Marsh, Joseph A

    2016-02-02

    The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization.

  9. Variational formulas of higher order mean curvatures

    CERN Document Server

    Xu, Ling

    2011-01-01

    In this paper, we establish the first variational formula and its Euler-Lagrange equation for the total $2p$-th mean curvature functional $\\mathcal {M}_{2p}$ of a submanifold $M^n$ in a general Riemannian manifold $N^{n+m}$ for $p=0,1,...,[\\frac{n}{2}]$. As an example, we prove that closed complex submanifolds in complex projective spaces are critical points of the functional $\\mathcal {M}_{2p}$, called relatively $2p$-minimal submanifolds, for all $p$. At last, we discuss the relations between relatively $2p$-minimal submanifolds and austere submanifolds in real space forms, as well as a special variational problem.

  10. Variational principles for multisymplectic second-order classical field theories

    Science.gov (United States)

    Prieto-Martínez, Pedro Daniel; Román-Roy, Narciso

    2015-06-01

    We state a unified geometrical version of the variational principles for second-order classical field theories. The standard Lagrangian and Hamiltonian variational principles and the corresponding field equations are recovered from this unified framework.

  11. Variational principles for multisymplectic second-order classical field theories

    OpenAIRE

    Román Roy, Narciso; Prieto Martínez, Pedro Daniel

    2015-01-01

    We state a unified geometrical version of the variational principles for second-order classical field theories. The standard Lagrangian and Hamiltonian variational principles and the corresponding field equations are recovered from this unified framework. Peer Reviewed

  12. Parkinson's disease and mitochondrial gene variations

    DEFF Research Database (Denmark)

    Andalib, Sasan; Vafaee, Manouchehr Seyedi; Gjedde, Albert

    2014-01-01

    Parkinson's disease (PD) is a common disorder of the central nervous system in the elderly. The pathogenesis of PD is a complex process, with genetics as an important contributing factor. This factor may stem from mitochondrial gene variations and mutations as well as from nuclear gene variations...... and mutations. More recently, a particular role of mitochondrial dysfunction has been suggested, arising from mitochondrial DNA variations or acquired mutations in PD pathogenesis. The present review summarizes and weighs the evidence in support of mitochondrial DNA (mtDNA) variations as important contributors...

  13. Variable Order Fractional Variational Calculus for Double Integrals

    OpenAIRE

    Odzijewicz, Tatiana; Malinowska, Agnieszka B.; Torres, Delfim F. M.

    2012-01-01

    We introduce three types of partial fractional operators of variable order. An integration by parts formula for partial fractional integrals of variable order and an extension of Green's theorem are proved. These results allow us to obtain a fractional Euler-Lagrange necessary optimality condition for variable order two-dimensional fractional variational problems.

  14. Variable Order Fractional Variational Calculus for Double Integrals

    OpenAIRE

    Odzijewicz, Tatiana; Malinowska, Agnieszka B.; Torres, Delfim F. M.

    2012-01-01

    We introduce three types of partial fractional operators of variable order. An integration by parts formula for partial fractional integrals of variable order and an extension of Green's theorem are proved. These results allow us to obtain a fractional Euler-Lagrange necessary optimality condition for variable order two-dimensional fractional variational problems.

  15. Evolution of mitochondrial gene orders in echinoderms.

    Science.gov (United States)

    Perseke, Marleen; Fritzsch, Guido; Ramsch, Kai; Bernt, Matthias; Merkle, Daniel; Middendorf, Martin; Bernhard, Detlef; Stadler, Peter F; Schlegel, Martin

    2008-05-01

    A comprehensive analysis of the mitochondrial gene orders of all previously published and two novel Antedon mediterranea (Crinoidea) and Ophiura albida (Ophiuroidea) complete echinoderm mitochondrial genomes shows that all major types of rearrangement operations are necessary to explain the evolution of mitochondrial genomes. In addition to protein coding genes we include all tRNA genes as well as the control region in our analysis. Surprisingly, 7 of the 16 genomes published in the GenBank database contain misannotations, mostly unannotated tRNAs and/or mistakes in the orientation of tRNAs, which we have corrected here. Although the gene orders of mt genomes appear very different, only 8 events are necessary to explain the evolutionary history of echinoderms with the exception of the ophiuroids. Only two of these rearrangements are inversions, while we identify three tandem-duplication-random-loss events and three transpositions.

  16. Gene order phylogeny of the genus Prochlorococcus.

    Directory of Open Access Journals (Sweden)

    Haiwei Luo

    Full Text Available BACKGROUND: Using gene order as a phylogenetic character has the potential to resolve previously unresolved species relationships. This character was used to resolve the evolutionary history within the genus Prochlorococcus, a group of marine cyanobacteria. METHODOLOGY/PRINCIPAL FINDINGS: Orthologous gene sets and their genomic positions were identified from 12 species of Prochlorococcus and 1 outgroup species of Synechococcus. From this data, inversion and breakpoint distance-based phylogenetic trees were computed by GRAPPA and FastME. Statistical support of the resulting topology was obtained by application of a 50% jackknife resampling technique. The result was consistent and congruent with nucleotide sequence-based and gene-content based trees. Also, a previously unresolved clade was resolved, that of MIT9211 and SS120. CONCLUSIONS/SIGNIFICANCE: This is the first study to use gene order data to resolve a bacterial phylogeny at the genus level. It suggests that the technique is useful in resolving the Tree of Life.

  17. Second-order variational equations for N-body simulations

    Science.gov (United States)

    Rein, Hanno; Tamayo, Daniel

    2016-07-01

    First-order variational equations are widely used in N-body simulations to study how nearby trajectories diverge from one another. These allow for efficient and reliable determinations of chaos indicators such as the Maximal Lyapunov characteristic Exponent (MLE) and the Mean Exponential Growth factor of Nearby Orbits (MEGNO). In this paper we lay out the theoretical framework to extend the idea of variational equations to higher order. We explicitly derive the differential equations that govern the evolution of second-order variations in the N-body problem. Going to second order opens the door to new applications, including optimization algorithms that require the first and second derivatives of the solution, like the classical Newton's method. Typically, these methods have faster convergence rates than derivative-free methods. Derivatives are also required for Riemann manifold Langevin and Hamiltonian Monte Carlo methods which provide significantly shorter correlation times than standard methods. Such improved optimization methods can be applied to anything from radial-velocity/transit-timing-variation fitting to spacecraft trajectory optimization to asteroid deflection. We provide an implementation of first- and second-order variational equations for the publicly available REBOUND integrator package. Our implementation allows the simultaneous integration of any number of first- and second-order variational equations with the high-accuracy IAS15 integrator. We also provide routines to generate consistent and accurate initial conditions without the need for finite differencing.

  18. Inferring Phylogenetic Networks from Gene Order Data

    Directory of Open Access Journals (Sweden)

    Alexey Anatolievich Morozov

    2013-01-01

    Full Text Available Existing algorithms allow us to infer phylogenetic networks from sequences (DNA, protein or binary, sets of trees, and distance matrices, but there are no methods to build them using the gene order data as an input. Here we describe several methods to build split networks from the gene order data, perform simulation studies, and use our methods for analyzing and interpreting different real gene order datasets. All proposed methods are based on intermediate data, which can be generated from genome structures under study and used as an input for network construction algorithms. Three intermediates are used: set of jackknife trees, distance matrix, and binary encoding. According to simulations and case studies, the best intermediates are jackknife trees and distance matrix (when used with Neighbor-Net algorithm. Binary encoding can also be useful, but only when the methods mentioned above cannot be used.

  19. Higher-order discrete variational problems with constraints

    Science.gov (United States)

    Colombo, Leonardo; Martín de Diego, David; Zuccalli, Marcela

    2013-09-01

    An interesting family of geometric integrators for Lagrangian systems can be defined using discretizations of the Hamilton's principle of critical action. This family of geometric integrators is called variational integrators. In this paper, we derive new variational integrators for higher-order Lagrangian mechanical system subjected to higher-order constraints. From the discretization of the variational principles, we show that our methods are automatically symplectic and, in consequence, with a very good energy behavior. Additionally, the symmetries of the discrete Lagrangian imply that momentum is conserved by the integrator. Moreover, we extend our construction to variational integrators where the Lagrangian is explicitly time-dependent. Finally, some motivating applications of higher-order problems are considered; in particular, optimal control problems for explicitly time-dependent underactuated systems and an interpolation problem on Riemannian manifolds.

  20. Second-order variational equations for N-body simulations

    CERN Document Server

    Rein, Hanno

    2016-01-01

    First-order variational equations are widely used in N-body simulations to study how nearby trajectories diverge from one another. These allow for efficient and reliable determinations of chaos indicators such as the Maximal Lyapunov characteristic Exponent (MLE) and the Mean Exponential Growth factor of Nearby Orbits (MEGNO). In this paper we lay out the theoretical framework to extend the idea of variational equations to higher order. We explicitly derive the differential equations that govern the evolution of second-order variations in the N-body problem. Going to second order opens the door to new applications, including optimization algorithms that require the first and second derivatives of the solution, like the classical Newton's method. Typically, these methods have faster convergence rates than derivative-free methods. Derivatives are also required for Riemann manifold Langevin and Hamiltonian Monte Carlo methods which provide significantly shorter correlation times than standard methods. Such impro...

  1. New Variations of Order Crossover for Travelling Salesman Problem

    Directory of Open Access Journals (Sweden)

    Kusum Deep

    2011-01-01

    Full Text Available Davis presented the order crossover operator for solving the travelling salesman problem (TSP using genetic algorithm and has described two basic variants of this order crossover operator. In order to improve the efficiency and validity of these variants, in this paper three new variations of the order crossover operator are presented. These are programmed in C++ and implemented on a set of benchmark test problems taken from TSPLIB.The analysis of results based on the numerical and graphical analysis indicated that the new variations of the order crossover proposed in this paper have a definite supremacy over the existing variants for TSP with number of cities less than or equal to 100 as well as greater than 100 for some instances.

  2. Second-order multisymplectic field theory: A variational approach to second-order multisymplectic field theory

    OpenAIRE

    Kouranbaeva, Shinar; Shkoller, Steve

    1999-01-01

    This paper presents a geometric-variational approach to continuous and discrete {\\it second-order} field theories following the methodology of \\cite{MPS}. Staying entirely in the Lagrangian framework and letting $Y$ denote the configuration fiber bundle, we show that both the multisymplectic structure on $J^3Y$ as well as the Noether theorem arise from the first variation of the action function. We generalize the multisymplectic form formula derived for first order field theories in \\cite{MPS...

  3. Speckle reduction via higher order total variation approach.

    Science.gov (United States)

    Wensen Feng; Hong Lei; Yang Gao

    2014-04-01

    Multiplicative noise (also known as speckle) reduction is a prerequisite for many image-processing tasks in coherent imaging systems, such as the synthetic aperture radar. One approach extensively used in this area is based on total variation (TV) regularization, which can recover significantly sharp edges of an image, but suffers from the staircase-like artifacts. In order to overcome the undesirable deficiency, we propose two novel models for removing multiplicative noise based on total generalized variation (TGV) penalty. The TGV regularization has been mathematically proven to be able to eliminate the staircasing artifacts by being aware of higher order smoothness. Furthermore, an efficient algorithm is developed for solving the TGV-based optimization problems. Numerical experiments demonstrate that our proposed methods achieve state-of-the-art results, both visually and quantitatively. In particular, when the image has some higher order smoothness, our methods outperform the TV-based algorithms.

  4. TTVFaster: First order eccentricity transit timing variations (TTVs)

    Science.gov (United States)

    Agol, Eric; Deck, Katherine

    2016-04-01

    TTVFaster implements analytic formulae for transit time variations (TTVs) that are accurate to first order in the planet-star mass ratios and in the orbital eccentricities; the implementations are available in several languages, including IDL, Julia, Python and C. These formulae compare well with more computationally expensive N-body integrations in the low-eccentricity, low mass-ratio regime when applied to simulated and to actual multi-transiting Kepler planet systems.

  5. Mixed Higher Order Variational Model for Image Recovery

    Directory of Open Access Journals (Sweden)

    Pengfei Liu

    2014-01-01

    Full Text Available A novel mixed higher order regularizer involving the first and second degree image derivatives is proposed in this paper. Using spectral decomposition, we reformulate the new regularizer as a weighted L1-L2 mixed norm of image derivatives. Due to the equivalent formulation of the proposed regularizer, an efficient fast projected gradient algorithm combined with monotone fast iterative shrinkage thresholding, called, FPG-MFISTA, is designed to solve the resulting variational image recovery problems under majorization-minimization framework. Finally, we demonstrate the effectiveness of the proposed regularization scheme by the experimental comparisons with total variation (TV scheme, nonlocal TV scheme, and current second degree methods. Specifically, the proposed approach achieves better results than related state-of-the-art methods in terms of peak signal to ratio (PSNR and restoration quality.

  6. Gene ordering in partitive clustering using microarray expressions.

    Science.gov (United States)

    Ray, Shubhra Sankar; Bandyopadhyay, Sanghamitra; Pal, Sankar K

    2007-08-01

    A central step in the analysis of gene expression data is the identification of groups of genes that exhibit similar expression patterns. Clustering and ordering the genes using gene expression data into homogeneous groups was shown to be useful in functional annotation, tissue classification, regulatory motif identification, and other applications. Although there is a rich literature on gene ordering in hierarchical clustering framework for gene expression analysis, there is no work addressing and evaluating the importance of gene ordering in partitive clustering framework, to the best knowledge of the authors. Outside the framework of hierarchical clustering, different gene ordering algorithms are applied on the whole data set, and the domain of partitive clustering is still unexplored with gene ordering approaches. A new hybrid method is proposed for ordering genes in each of the clusters obtained from partitive clustering solution, using microarray gene expressions.Two existing algorithms for optimally ordering cities in travelling salesman problem (TSP), namely, FRAG_GALK and Concorde, are hybridized individually with self organizing MAP to show the importance of gene ordering in partitive clustering framework. We validated our hybrid approach using yeast and fibroblast data and showed that our approach improves the result quality of partitive clustering solution, by identifying subclusters within big clusters, grouping functionally correlated genes within clusters, minimization of summation of gene expression distances, and the maximization of biological gene ordering using MIPS categorization. Moreover, the new hybrid approach, finds comparable or sometimes superior biological gene order in less computation time than those obtained by optimal leaf ordering in hierarchical clustering solution.

  7. Gene ordering in partitive clustering using microarray expressions

    Indian Academy of Sciences (India)

    Shubhra Sankar Ray; Sanghamitra Bandyopadhyay; Sankar K Pal

    2007-08-01

    A central step in the analysis of gene expression data is the identification of groups of genes that exhibit similar expression patterns. Clustering and ordering the genes using gene expression data into homogeneous groups was shown to be useful in functional annotation, tissue classification, regulatory motif identification, and other applications. Although there is a rich literature on gene ordering in hierarchical clustering framework for gene expression analysis, there is no work addressing and evaluating the importance of gene ordering in partitive clustering framework, to the best knowledge of the authors. Outside the framework of hierarchical clustering, different gene ordering algorithms are applied on the whole data set, and the domain of partitive clustering is still unexplored with gene ordering approaches. A new hybrid method is proposed for ordering genes in each of the clusters obtained from partitive clustering solution, using microarray gene expressions. Two existing algorithms for optimally ordering cities in travelling salesman problem (TSP), namely, FRAG_GALK and Concorde, are hybridized individually with self organizing MAP to show the importance of gene ordering in partitive clustering framework. We validated our hybrid approach using yeast and fibroblast data and showed that our approach improves the result quality of partitive clustering solution, by identifying subclusters within big clusters, grouping functionally correlated genes within clusters, minimization of summation of gene expression distances, and the maximization of biological gene ordering using MIPS categorization. Moreover, the new hybrid approach, finds comparable or sometimes superior biological gene order in less computation time than those obtained by optimal leaf ordering in hierarchical clustering solution.

  8. Genetic variation in genes affecting milk composition and quality

    DEFF Research Database (Denmark)

    Bertelsen, Henriette Pasgaard

    In the past decade major advances in next generation sequencing technologies have provided new opportuneties for the detection of genetic variation. Combining the knowlegde of genetic variation with phenotypic distributions provides considerable possibilites for detection of candidate genes....... In addition, exploring genetic variation related to the major milk proteins of bovine milk indntified genetic variations with possitive effects on milk coagulation...

  9. Genomic variation in Salmonella enterica core genes for epidemiological typing

    Directory of Open Access Journals (Sweden)

    Leekitcharoenphon Pimlapas

    2012-03-01

    Full Text Available Abstract Background Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over time. The core genes--the genes that are conserved in all (or most members of a genus or species--are potentially good candidates for investigating genomic variation in phylogeny and epidemiology. Results We identify a set of 2,882 core genes clusters based on 73 publicly available Salmonella enterica genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher confidence. The core genes can be divided into two categories: a few highly variable genes and a larger set of conserved core genes, with low variance. For the most variable core genes, the variance in amino acid sequences is higher than for the corresponding nucleotide sequences, suggesting that there is a positive selection towards mutations leading to amino acid changes. Conclusions Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important especially in trend analysis.

  10. [Evolution of gene orders in genomes of cyanobacteria].

    Science.gov (United States)

    Markov, A V; Zakharov, I A

    2009-08-01

    Genomes of 23 strains of cyanobacteria were comparatively analyzed using quantitative methods of estimation of gene order similarity. It has been found that reconstructions of phylogenesis of cyanobacteria based on the comparison of the orders of genes in chromosomes and nucleotide sequences appear to be similar. This confirms the applicability of quantitative measures of similarity of gene orders for phylogenetic reconstructions. In the evolution of marine unicellular plankton cyanobacteria, genome rearrangements are fixed with a low rate (about 3% of gene order changes per 1% of 16S rRNA changes), whereas in other groups of cyanobacteria the gene order can change several times more rapidly. The gene orders in genomes of cyanobacteria and chloroplasts preserve a considerable degree of similarity. The closest relatives of chloroplasts among the analyzed cyanobacteria are likely to be strains from hot springs belonging to the genus Synechococcus. Comparative analysis of gene orders and nucleotide sequences strongly suggests that Synechococcus strains from diferent environments (sea, fresh waters, hot springs) are not related and belong to evolutionally distant lines.

  11. Mitochondrial gene order change in Schistosoma (Platyhelminthes: Digenea: Schistosomatidae).

    Science.gov (United States)

    Webster, Bonnie L; Littlewood, D Timothy J

    2012-01-01

    In the flatworm genus Schistosoma, species of which include parasites of biomedical and veterinary importance, mitochondrial gene order is radically different in some species. A PCR-based survey of 19 schistosomatid spp. established which of 14 Schistosoma spp. have the ancestral (plesiomorphic) or derived gene order condition. A phylogeny for Schistosoma was estimated and used to infer the origin of the gene order change which is present in all members of a clade containing Schistosoma incognitum and members of the traditionally recognised Schistosoma indicum, Schistosoma mansoni and Schistosomahaematobium spp. groups. Schistosoma turkestanicum, with the plesiomorphic gene order state, is sister to this clade. Common interval analysis suggests change in gene order, from ancestral to derived, consisted of two sequential transposition events: (a) nad1_nad3 to nad3_nad1 and (b) [atp6,nad2]_[nad3,-nad1,cox1,rrnL,rrnS,cox2,nad6] to [nad3,nad1,cox1,rrnL,rrnS,cox2,nad6]_[atp6,nad2], where gene order offragments within square brackets remain unchanged. Gene order change is rare in parasitic flatworms and is a robust synapomorphy for schistosome spp. that exhibit it. The schistosomatid phylogeny casts some doubt on the origin of Schistosoma (Asian or African), highlights the propensity for species to hosts witch amongst mammalian (definitive) hosts, and indicates the likely importance of snail (intermediate)hosts in determining and defining patterns of schistosome radiation and continental invasion. Mitogenomic sampling of Schistosoma dattai and Schistosoma harinasutai to determine gene order, and within key species, especially S. turkestanicum and S. incognitum, to determine ancestral ranges, may help discover the geographic origins of gene order change in the genus. Samples of S. incognitum from India and Thailand suggest this taxon may include cryptic species. Crown Copyright 2012 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc. Allrights

  12. Global properties and functional complexity of human gene regulatory variation.

    Directory of Open Access Journals (Sweden)

    Daniel J Gaffney

    2013-05-01

    Full Text Available Identification and functional interpretation of gene regulatory variants is a major focus of modern genomics. The application of genetic mapping to molecular and cellular traits has enabled the detection of regulatory variation on genome-wide scales and revealed an enormous diversity of regulatory architecture in humans and other species. In this review I summarise the insights gained and questions raised by a decade of genetic mapping of gene expression variation. I discuss recent extensions of this approach using alternative molecular phenotypes that have revealed some of the biological mechanisms that drive gene expression variation between individuals. Finally, I highlight outstanding problems and future directions for development.

  13. Word order variation and foregrounding of complement clauses

    DEFF Research Database (Denmark)

    Christensen, Tanya Karoli; Jensen, Torben Juel

    2015-01-01

    Through mixed models analyses of complement clauses in a corpus of spoken Danish we examine the role of sentence adverbials in relation to a word order distinction in Scandinavian signalled by the relative position of sentence adverbials and finite verb (V>Adv vs. Adv>V). The type of sentence...

  14. Cluster Variation Study of Ordering in FCC Solid Solutions.

    Science.gov (United States)

    1980-07-01

    despite the fact that the CVM represents a remarkable improvement over other approximate methods such as the molecular field and quasichemical...Brasileiro de Pesquisas Fisicas , Rio de Janeiro, Brazil, August 10, 1979. -43- Sanchez, J. N., "Classical Approach to Order-Disbrder", Instituto de Fisica

  15. Conservation of ribosomal protein gene ordering in 16 complete genomes

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The organization of ribosomal proteins in 16 prokaryotic genomes was studied as an example of comparative genome analyses of gene systems. Hypothetical ribosomal protein-containing operons were constructed. These operons also contained putative genes and other non-ribosomal genes. The correspondences among these genes across different organisms were clarified by sequence homology computations. In this way a cross tabulation of 70 ribosomal proteins genes was constructed. On average, these were organized into 9-14 operons in each genome. There were also 25 non-ribosomal or putative genes in these mainly ribosomal protein operons. Hence the table contains 95 genes in total. It was found that: (i) the conservation of the block of about 20 r-proteins in the L3 and L4 operons across almost the entire eubacteria and archaebacteria is remarkable; (ii) some operons only belong to eubacteria or archaebacteria; (iii) although the ribosomal protein operons are highly conserved within domain, there are fine variations in some operons across different organisms within each domain, and these variations are informative on the evolutionary relations among the organisms. This method provides a new potential for studying the origin and evolution of old species.

  16. Genomic variation in Salmonella enterica core genes for epidemiological typing

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Rundsten, Carsten Friis

    2012-01-01

    Background: Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS) available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over...... genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher...... that there is a positive selection towards mutations leading to amino acid changes. Conclusions: Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important...

  17. Theories of Population Variation in Genes and Genomes

    DEFF Research Database (Denmark)

    Christiansen, Freddy

    genetics, while emphasizing the close interplay between theory and empiricism. Traditional topics such as genetic and phenotypic variation, mutation, migration, and linkage are covered and advanced by contemporary coalescent theory, which describes the genealogy of genes in a population, ultimately...

  18. Population genetic variation in gene expression is associated withphenotypic variation in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Fay, Justin C.; McCullough, Heather L.; Sniegowski, Paul D.; Eisen, Michael B.

    2004-02-25

    The relationship between genetic variation in gene expression and phenotypic variation observable in nature is not well understood. Identifying how many phenotypes are associated with differences in gene expression and how many gene-expression differences are associated with a phenotype is important to understanding the molecular basis and evolution of complex traits. Results: We compared levels of gene expression among nine natural isolates of Saccharomyces cerevisiae grown either in the presence or absence of copper sulfate. Of the nine strains, two show a reduced growth rate and two others are rust colored in the presence of copper sulfate. We identified 633 genes that show significant differences in expression among strains. Of these genes,20 were correlated with resistance to copper sulfate and 24 were correlated with rust coloration. The function of these genes in combination with their expression pattern suggests the presence of both correlative and causative expression differences. But the majority of differentially expressed genes were not correlated with either phenotype and showed the same expression pattern both in the presence and absence of copper sulfate. To determine whether these expression differences may contribute to phenotypic variation under other environmental conditions, we examined one phenotype, freeze tolerance, predicted by the differential expression of the aquaporin gene AQY2. We found freeze tolerance is associated with the expression of AQY2. Conclusions: Gene expression differences provide substantial insight into the molecular basis of naturally occurring traits and can be used to predict environment dependent phenotypic variation.

  19. Gene order computation using Alzheimer's DNA microarray gene expression data and the Ant Colony Optimisation algorithm.

    Science.gov (United States)

    Pang, Chaoyang; Jiang, Gang; Wang, Shipeng; Hu, Benqiong; Liu, Qingzhong; Deng, Youping; Huang, Xudong

    2012-01-01

    As Alzheimer's Disease (AD) is the most common form of dementia, the study of AD-related genes via biocomputation is an important research topic. One method of studying AD-related gene is to cluster similar genes together into a gene order. Gene order is a good clustering method as the results can be optimal globally while other clustering methods are only optimal locally. Herein we use the Ant Colony Optimisation (ACO)-based algorithm to calculate the gene order from an Alzheimer's DNA microarray dataset. We test it with four distance measurements: Pearson distance, Spearmen distance, Euclidean distance, and squared Euclidean distance. Our computing results indicate: a different distance formula generated a different quality of gene order, the squared Euclidean distance approach produced the optimal AD-related gene order.

  20. MEFV gene variations in patients with systemic lupus erythematosus.

    Science.gov (United States)

    Erer, Burak; Cosan, Fulya; Oku, Basar; Ustek, Duran; Inanc, Murat; Aral, Orhan; Gul, Ahmet

    2014-01-01

    The aim of this study was to investigate the frequency of familial Mediterranean fever (FMF)-associated MEFV gene variations in patients with systemic lupus erythematosus (SLE). The study group comprised 190 SLE patients and 101 healthy controls of Turkish origin with no clinical features of FMF. All individuals were genotyped for the four most common MEFV gene variations (M694V, M680I, V726A and E148Q) by PCR-restriction fragment length polymorphism analysis. The frequency of carrying any of the four MEFV gene variations under study was 15 % in patients with SLE and 10 % in the healthy controls (p = 0.23). After the exclusion of the less penetrant E148Q variation, re-analysis for the three penetrant mutations revealed a significant association between exon 10 variations and pericarditis [p = 0.038, odds ratio (OR) 3.5, 95 % confidence interval (CI) 1.0-12.1], and pleural effusion (p = 0.043, OR 5.2, 95 % CI 0.8-30.9). No significant association was detected between the MEFV gene variations and a higher acute phase response. The MEFV gene variations analyzed in our study do not seem to increase the overall susceptibility to SLE and do not have any strong association with its clinical manifestations. The possibility of a modest effect of penetrant exon 10 MEFV variants on the development of serosal effusions needs to be explored in a larger series of patients.

  1. Computational fitness landscape for all gene-order permutations of an RNA virus.

    Directory of Open Access Journals (Sweden)

    Kwang-il Lim

    2009-02-01

    Full Text Available How does the growth of a virus depend on the linear arrangement of genes in its genome? Answering this question may enhance our basic understanding of virus evolution and advance applications of viruses as live attenuated vaccines, gene-therapy vectors, or anti-tumor therapeutics. We used a mathematical model for vesicular stomatitis virus (VSV, a prototype RNA virus that encodes five genes (N-P-M-G-L, to simulate the intracellular growth of all 120 possible gene-order variants. Simulated yields of virus infection varied by 6,000-fold and were found to be most sensitive to gene-order permutations that increased levels of the L gene transcript or reduced levels of the N gene transcript, the lowest and highest expressed genes of the wild-type virus, respectively. Effects of gene order on virus growth also depended upon the host-cell environment, reflecting different resources for protein synthesis and different cell susceptibilities to infection. Moreover, by computationally deleting intergenic attenuations, which define a key mechanism of transcriptional regulation in VSV, the variation in growth associated with the 120 gene-order variants was drastically narrowed from 6,000- to 20-fold, and many variants produced higher progeny yields than wild-type. These results suggest that regulation by intergenic attenuation preceded or co-evolved with the fixation of the wild type gene order in the evolution of VSV. In summary, our models have begun to reveal how gene functions, gene regulation, and genomic organization of viruses interact with their host environments to define processes of viral growth and evolution.

  2. Combined First and Second Order Total Variation Inpainting using Split Bregman

    Directory of Open Access Journals (Sweden)

    Konstantinos Papafitsoros

    2013-07-01

    Full Text Available In this article we discuss the implementation of the combined first and second order total variation inpainting that was introduced by Papafitsoros and Schdönlieb. We describe the algorithm we use (split Bregman in detail, and we give some examples that indicate the difference between pure first and pure second order total variation inpainting.

  3. Combined First and Second Order Total Variation Inpainting using Split Bregman

    KAUST Repository

    Papafitsoros, Konstantinos

    2013-07-12

    In this article we discuss the implementation of the combined first and second order total variation inpainting that was introduced by Papafitsoros and Schdönlieb. We describe the algorithm we use (split Bregman) in detail, and we give some examples that indicate the difference between pure first and pure second order total variation inpainting.

  4. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  5. Conservation of ribosomal protein gene ordering in 16 complete genomes

    Institute of Scientific and Technical Information of China (English)

    王宁; 陈润生; 王永雄

    2000-01-01

    The organization of ribosomal proteins in 16 prokaryotic genomes was studied as an example of comparative genome analyses of gene systems. Hypothetical ribosomal protein-containing operons were constructed. These operons also contained putative genes and other non-ribosomal genes. The correspondences among these genes across different organisms were clarified by sequence homology computations. In this way a cross tabulation of 70 ribosomal proteins genes was constructed. On average, these were organized into 9-14 operons in each genome. There were also 25 non-ribosomal or putative genes in these mainly ribosomal protein operons. Hence the table contains 95 genes in total. It was found that: (i) the conservation of the block of about 20 r-proteins in the L3 and L4 operons across almost the entire eubacteria and ar-chaebacteria is remarkable; (ii) some operons only belong to eubacteria or archaebacte-ria; (iii) although the ribosomal protein operons are highly conserved within domain, there are fine variat

  6. Epigenetic variation in the Egfr gene generates quantitative variation in a complex trait in ants.

    Science.gov (United States)

    Alvarado, Sebastian; Rajakumar, Rajendhran; Abouheif, Ehab; Szyf, Moshe

    2015-03-11

    Complex quantitative traits, like size and behaviour, are a pervasive feature of natural populations. Quantitative trait variation is the product of both genetic and environmental factors, yet little is known about the mechanisms through which their interaction generates this variation. Epigenetic processes, such as DNA methylation, can mediate gene-by-environment interactions during development to generate discrete phenotypic variation. We therefore investigated the developmental role of DNA methylation in generating continuous size variation of workers in an ant colony, a key trait associated with division of labour. Here we show that, in the carpenter ant Camponotus floridanus, global (genome-wide) DNA methylation indirectly regulates quantitative methylation of the conserved cell-signalling gene Epidermal growth factor receptor to generate continuous size variation of workers. DNA methylation can therefore generate quantitative variation in a complex trait by quantitatively regulating the transcription of a gene. This mechanism, alongside genetic variation, may determine the phenotypic possibilities of loci for generating quantitative trait variation in natural populations.

  7. Empirical Study of the Origins and Causes of Variation Orders in Building Projects

    Directory of Open Access Journals (Sweden)

    Dr. Simon Eigbe

    2016-10-01

    Full Text Available Variations or changes to construction plans have been identified as a major problem in construction projects. Variations have adverse impact on project delivery. Effective management of variations, therefore, is critical to accomplishing project objectives; and this commences with identifying the sources and causes of variations. This paper presents the results of a study of the origins and causes of variation orders in building projects within the Federal Government of Nigeria (FGN: Ministries, Departments, and Agencies (MDGs. Extensive review of relevant literature has been provided. The methodology adopted involved the use of structured questionnaires administered on the MDGs ensuring a fair representation of the geo-political zones of the country. Use was made of field assistants to facilitate the administration of questionnaires. An ex-post facto research design was also employed in the data gathering. Analysis of data was done using descriptive and inferential statistics. The results reveal that variation orders are common in building projects. The client was shown to be the most frequently involved origin agent of variation orders as a result of inadequate or unclear brief, and change in plan or scope. The study concludes with recommendations that project planning; and engagement of project officers are effective means of formulating clear project briefs in order to minimize variation orders and enhance project performance

  8. Variation in the Major Surface Glycoprotein Genes in Pneumocystis jirovecii

    Science.gov (United States)

    Kutty, Geetha; Maldarelli, Frank; Achaz, Guillaume; Kovacs, Joseph A.

    2008-01-01

    The genome of Pneumocystis, which causes life-threatening pneumonia in immunosuppressed patients, contains a multi-copy gene family that encodes the major surface glycoprotein (Msg). Pneumocystis can vary the expressed Msg, presumably as a mechanism to avoid host immune responses. Analysis of 24 msg gene sequences obtained from a single human Pneumocystis isolate demonstrated that the sequences segregate into two branches. Based on a number of analyses, recombination among msg genes appears to be an important mechanism for generating msg diversity. Intra-branch recombination occurred more frequently than inter-branch recombination. Restriction fragment length polymorphism analysis demonstrated substantial variation in the repertoire of the msg gene family among isolates of human Pneumocystis, which was not observed in laboratory isolates of rat or mouse Pneumocystis; this may be the result of examining outbred vs. captive populations. Increased diversity in the Msg repertoire, generated in part by recombination, increases the potential for antigenic variation in this abundant surface protein. PMID:18627244

  9. Propagation of genetic variation in gene regulatory networks.

    Science.gov (United States)

    Plahte, Erik; Gjuvsland, Arne B; Omholt, Stig W

    2013-08-01

    A future quantitative genetics theory should link genetic variation to phenotypic variation in a causally cohesive way based on how genes actually work and interact. We provide a theoretical framework for predicting and understanding the manifestation of genetic variation in haploid and diploid regulatory networks with arbitrary feedback structures and intra-locus and inter-locus functional dependencies. Using results from network and graph theory, we define propagation functions describing how genetic variation in a locus is propagated through the network, and show how their derivatives are related to the network's feedback structure. Similarly, feedback functions describe the effect of genotypic variation of a locus on itself, either directly or mediated by the network. A simple sign rule relates the sign of the derivative of the feedback function of any locus to the feedback loops involving that particular locus. We show that the sign of the phenotypically manifested interaction between alleles at a diploid locus is equal to the sign of the dominant feedback loop involving that particular locus, in accordance with recent results for a single locus system. Our results provide tools by which one can use observable equilibrium concentrations of gene products to disclose structural properties of the network architecture. Our work is a step towards a theory capable of explaining the pleiotropy and epistasis features of genetic variation in complex regulatory networks as functions of regulatory anatomy and functional location of the genetic variation.

  10. A Probabilistic Approach to Second Order Variational Inequalities with Bilateral Constraints

    Indian Academy of Sciences (India)

    Mrinal K Ghosh; K S Mallikarjuna Rao

    2003-11-01

    We study a class of second order variational inequalities with bilateral constraints. Under certain conditions we show the existence of a unique viscosity solution of these variational inequalities and give a stochastic representation to this solution. As an application, we study a stochastic game with stopping times and show the existence of a saddle point equilibrium.

  11. Split Bregman Iteration Algorithm for Image Deblurring Using Fourth-Order Total Bounded Variation Regularization Model

    Directory of Open Access Journals (Sweden)

    Yi Xu

    2013-01-01

    Full Text Available We propose a fourth-order total bounded variation regularization model which could reduce undesirable effects effectively. Based on this model, we introduce an improved split Bregman iteration algorithm to obtain the optimum solution. The convergence property of our algorithm is provided. Numerical experiments show the more excellent visual quality of the proposed model compared with the second-order total bounded variation model which is proposed by Liu and Huang (2010.

  12. Exploiting natural variation to identify insect-resistance genes.

    Science.gov (United States)

    Broekgaarden, Colette; Snoeren, Tjeerd A L; Dicke, Marcel; Vosman, Ben

    2011-10-01

    Herbivorous insects are widespread and often serious constraints to crop production. The use of insect-resistant crops is a very effective way to control insect pests in agriculture, and the development of such crops can be greatly enhanced by knowledge on plant resistance mechanisms and the genes involved. Plants have evolved diverse ways to cope with insect attack that has resulted in natural variation for resistance towards herbivorous insects. Studying the molecular genetics and transcriptional background of this variation has facilitated the identification of resistance genes and processes that lead to resistance against insects. With the development of new technologies, molecular studies are not restricted to model plants anymore. This review addresses the need to exploit natural variation in resistance towards insects to increase our knowledge on resistance mechanisms and the genes involved. We will discuss how this knowledge can be exploited in breeding programmes to provide sustainable crop protection against insect pests. Additionally, we discuss the current status of genetic research on insect-resistance genes. We conclude that insect-resistance mechanisms are still unclear at the molecular level and that exploiting natural variation with novel technologies will contribute greatly to the development of insect-resistant crop varieties.

  13. A Unidirectional Total Variation and Second-Order Total Variation Model for Destriping of Remote Sensing Images

    Directory of Open Access Journals (Sweden)

    Min Wang

    2017-01-01

    Full Text Available Remote sensing images often suffer from stripe noise, which greatly degrades the image quality. Destriping of remote sensing images is to recover a good image from the image containing stripe noise. Since the stripes in remote sensing images have a directional characteristic (horizontal or vertical, the unidirectional total variation has been used to consider the directional information and preserve the edges. The remote sensing image contaminated by heavy stripe noise always has large width stripes and the pixels in the stripes have low correlations with the true pixels. On this occasion, the destriping process can be viewed as inpainting the wide stripe domains. In many works, high-order total variation has been proved to be a powerful tool to inpainting wide domains. Therefore, in this paper, we propose a variational destriping model that combines unidirectional total variation and second-order total variation regularization to employ the directional information and handle the wide stripes. In particular, the split Bregman iteration method is employed to solve the proposed model. Experimental results demonstrate the effectiveness of the proposed method.

  14. Copy number variations exploration of multiple genes in Graves' disease.

    Science.gov (United States)

    Song, Rong-Hua; Shao, Xiao-Qing; Li, Ling; Wang, Wen; Zhang, Jin-An

    2017-01-01

    Few previous published papers reported copy number variations of genes could affect the predisposition of Graves' disease (GD). Herein, the aim of this study was to explore the association between copy number variations (CNV) profile and GD. The preliminary copy number microarray used to screen copy number variant genes was performed in 6 GD patients. Five CNV candidate genes (CFH, CFHR1, KIAA0125, UGT2B15, and UGT2B17) were then validated in an independent set of samples (50 GD patients and 50 matched healthy ones) by the Accucopy assay method. The CNV of the other 2 genes TRY6 and CCL3L1 was investigated in 144 GD patients and 144 healthy volunteers by the definitive genotyping technique using the Taqman quantitative polymerase-chain-reaction (Taqman qPCR). TRY6 gene-associated single nucleotide polymorphism (SNP), rs13230029, was genotyped by the PCR-ligase detection reaction (LDR) in 675 GD patients and 898 healthy controls. There were no correlation of the gene copy number (GCN) of CFH, CFHR1, KIAA0125, UGT2B15, and UGT2B17 with GD. In comparison with that of controls, the GCN distribution of TRY6 and CCL3L1 in GD patients did not show significantly differ (P > 0.05). Furthermore, TRY6-related polymorphism (rs13230029) showed no difference between GD patients and controls. No correlation was found between CNV or SNP genotype and clinical phenotypes. Generally, there were no link of the copy numbers of several genes, including CFH, CFHR1, KIAA0125, UGT2B15, UGT2B17, TRY6, and CCL3L1 to GD. Our results clearly indicated that the copy number variations of multiple genes, namely CFH, CFHR1, KIAA0125, UGT2B15, UGT2B17, TRY6, and CCL3L1, were not associated with the development of GD.

  15. On the Variational Problems of the Functionals with Derivatives of Higher Orders and Undetermined Boundary

    Institute of Scientific and Technical Information of China (English)

    LAO Da-zhong; TAN Tian-min

    2007-01-01

    According to the necessary condition of the functional taking the extremum,that is its first variation is equal to zero,the variational problems of the functionals for the undetermined boundary in the calculus of variations are researched,the functionals depend on single argument,arbitrary unknown functions and their derivatives of higher orders.A new view point is posed and demonstrated,i.e.when the first variation of the functional is equal to zero,all the variational terms are not independent to each other,and at least one of them is equal to zero.Some theorems and corollaries of the variational problems of the functionals are obtained.

  16. Geometric Integrators for Higher-Order Variational Systems and Their Application to Optimal Control

    Science.gov (United States)

    Colombo, Leonardo; Ferraro, Sebastián; Martín de Diego, David

    2016-12-01

    Numerical methods that preserve geometric invariants of the system, such as energy, momentum or the symplectic form, are called geometric integrators. In this paper we present a method to construct symplectic-momentum integrators for higher-order Lagrangian systems. Given a regular higher-order Lagrangian L:T^{(k)}Q→ R with k≥ 1, the resulting discrete equations define a generally implicit numerical integrator algorithm on T^{(k-1)}Q× T^{(k-1)}Q that approximates the flow of the higher-order Euler-Lagrange equations for L. The algorithm equations are called higher-order discrete Euler-Lagrange equations and constitute a variational integrator for higher-order mechanical systems. The general idea for those variational integrators is to directly discretize Hamilton's principle rather than the equations of motion in a way that preserves the invariants of the original system, notably the symplectic form and, via a discrete version of Noether's theorem, the momentum map. We construct an exact discrete Lagrangian L_d^e using the locally unique solution of the higher-order Euler-Lagrange equations for L with boundary conditions. By taking the discrete Lagrangian as an approximation of L_d^e, we obtain variational integrators for higher-order mechanical systems. We apply our techniques to optimal control problems since, given a cost function, the optimal control problem is understood as a second-order variational problem.

  17. Structural variation of the ribosomal gene cluster within the class Insecta

    Energy Technology Data Exchange (ETDEWEB)

    Mukha, D.V.; Sidorenko, A.P.; Lazebnaya, I.V. [Vavilov Institute of General Genetics, Moscow (Russian Federation)] [and others

    1995-09-01

    General estimation of ribosomal DNA variation within the class Insecta is presented. It is shown that, using blot-hybridization, one can detect differences in the structure of the ribosomal gene cluster not only between genera within an order, but also between species within a genera, including sibling species. Structure of the ribosomal gene cluster of the Coccinellidae family (ladybirds) is analyzed. It is shown that cloned highly conservative regions of ribosomal DNA of Tetrahymena pyriformis can be used as probes for analyzing ribosomal genes in insects. 24 refs., 4 figs.

  18. Syntenator: Multiple gene order alignments with a gene-specific scoring function

    Directory of Open Access Journals (Sweden)

    Dieterich Christoph

    2008-11-01

    Full Text Available Abstract Background Identification of homologous regions or conserved syntenies across genomes is one crucial step in comparative genomics. This task is usually performed by genome alignment softwares like WABA or blastz. In case of conserved syntenies, such regions are defined as conserved gene orders. On the gene order level, homologous regions can even be found between distantly related genomes, which do not align on the nucleotide sequence level. Results We present a novel approach to identify regions of conserved synteny across multiple genomes. Syntenator represents genomes and alignments thereof as partial order graphs (POGs. These POGs are aligned by a dynamic programming approach employing a gene-specific scoring function. The scoring function reflects the level of protein sequence similarity for each possible gene pair. Our method consistently defines larger homologous regions in pairwise gene order alignments than nucleotide-level comparisons. Our method is superior to methods that work on predefined homology gene sets (as implemented in Blockfinder. Syntenator successfully reproduces 80% of the EnsEMBL man-mouse conserved syntenic blocks. The full potential of our method becomes visible by comparing remotely related genomes and multiple genomes. Gene order alignments potentially resolve up to 75% of the EnsEMBL 1:many orthology relations and 27% of the many:many orthology relations. Conclusion We propose Syntenator as a software solution to reliably infer conserved syntenies among distantly related genomes. The software is available from http://www2.tuebingen.mpg.de/abt4/plone.

  19. Higher order explicit solutions for nonlinear dynamic model of column buckling using variational approach and variational iteration algorithm-II

    Energy Technology Data Exchange (ETDEWEB)

    Bagheri, Saman; Nikkar, Ali [University of Tabriz, Tabriz (Iran, Islamic Republic of)

    2014-11-15

    This paper deals with the determination of approximate solutions for a model of column buckling using two efficient and powerful methods called He's variational approach and variational iteration algorithm-II. These methods are used to find analytical approximate solution of nonlinear dynamic equation of a model for the column buckling. First and second order approximate solutions of the equation of the system are achieved. To validate the solutions, the analytical results have been compared with those resulted from Runge-Kutta 4th order method. A good agreement of the approximate frequencies and periodic solutions with the numerical results and the exact solution shows that the present methods can be easily extended to other nonlinear oscillation problems in engineering. The accuracy and convenience of the proposed methods are also revealed in comparisons with the other solution techniques.

  20. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    Science.gov (United States)

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  1. Variation in the RAD51 gene and familial breast cancer

    Science.gov (United States)

    Lose, Felicity; Lovelock, Paul; Chenevix-Trench, Georgia; Mann, Graham J; Pupo, Gulietta M; Spurdle, Amanda B

    2006-01-01

    Introduction Human RAD51 is a homologue of the Escherichia coli RecA protein and is known to function in recombinational repair of double-stranded DNA breaks. Mutations in the lower eukaryotic homologues of RAD51 result in a deficiency in the repair of double-stranded DNA breaks. Loss of RAD51 function would therefore be expected to result in an elevated mutation rate, leading to accumulation of DNA damage and, hence, to increased cancer risk. RAD51 interacts directly or indirectly with a number of proteins implicated in breast cancer, such as BRCA1 and BRCA2. Similar to BRCA1 mice, RAD51-/- mice are embryonic lethal. The RAD51 gene region has been shown to exhibit loss of heterozygosity in breast tumours, and deregulated RAD51 expression in breast cancer patients has also been reported. Few studies have investigated the role of coding region variation in the RAD51 gene in familial breast cancer, with only one coding region variant – exon 6 c.449G>A (p.R150Q) – reported to date. Methods All nine coding exons of the RAD51 gene were analysed for variation in 46 well-characterised, BRCA1/2-negative breast cancer families using denaturing high-performance liquid chromatography. Genotyping of the exon 6 p.R150Q variant was performed in an additional 66 families. Additionally, lymphoblastoid cell lines from breast cancer patients were subjected to single nucleotide primer extension analysis to assess RAD51 expression. Results No coding region variation was found, and all intronic variation detected was either found in unaffected controls or was unlikely to have functional consequences. Single nucleotide primer extension analysis did not reveal any allele-specific changes in RAD51 expression in all lymphoblastoid cell lines tested. Conclusion Our study indicates that RAD51 is not a major familial breast cancer predisposition gene. PMID:16762046

  2. Revised Variational Iteration Method for Solving Systems of Nonlinear Fractional-Order Differential Equations

    Directory of Open Access Journals (Sweden)

    C. Ünlü

    2013-01-01

    Full Text Available A modification of the variational iteration method (VIM for solving systems of nonlinear fractional-order differential equations is proposed. The fractional derivatives are described in the Caputo sense. The solutions of fractional differential equations (FDE obtained using the traditional variational iteration method give good approximations in the neighborhood of the initial position. The main advantage of the present method is that it can accelerate the convergence of the iterative approximate solutions relative to the approximate solutions obtained using the traditional variational iteration method. Illustrative examples are presented to show the validity of this modification.

  3. A Combined First and Second Order Variational Approach for Image Reconstruction

    KAUST Repository

    Papafitsoros, K.

    2013-05-10

    In this paper we study a variational problem in the space of functions of bounded Hessian. Our model constitutes a straightforward higher-order extension of the well known ROF functional (total variation minimisation) to which we add a non-smooth second order regulariser. It combines convex functions of the total variation and the total variation of the first derivatives. In what follows, we prove existence and uniqueness of minimisers of the combined model and present the numerical solution of the corresponding discretised problem by employing the split Bregman method. The paper is furnished with applications of our model to image denoising, deblurring as well as image inpainting. The obtained numerical results are compared with results obtained from total generalised variation (TGV), infimal convolution and Euler\\'s elastica, three other state of the art higher-order models. The numerical discussion confirms that the proposed higher-order model competes with models of its kind in avoiding the creation of undesirable artifacts and blocky-like structures in the reconstructed images-a known disadvantage of the ROF model-while being simple and efficiently numerically solvable. ©Springer Science+Business Media New York 2013.

  4. Gene Tree Discordance Causes Apparent Substitution Rate Variation.

    Science.gov (United States)

    Mendes, Fábio K; Hahn, Matthew W

    2016-07-01

    Substitution rates are known to be variable among genes, chromosomes, species, and lineages due to multifarious biological processes. Here, we consider another source of substitution rate variation due to a technical bias associated with gene tree discordance. Discordance has been found to be rampant in genome-wide data sets, often due to incomplete lineage sorting (ILS). This apparent substitution rate variation is caused when substitutions that occur on discordant gene trees are analyzed in the context of a single, fixed species tree. Such substitutions have to be resolved by proposing multiple substitutions on the species tree, and we therefore refer to this phenomenon as Substitutions Produced by ILS (SPILS). We use simulations to demonstrate that SPILS has a larger effect with increasing levels of ILS, and on trees with larger numbers of taxa. Specific branches of the species trees are consistently, but erroneously, inferred to be longer or shorter, and we show that these branches can be predicted based on discordant tree topologies. Moreover, we observe that fixing a species tree topology when performing tests of positive selection increases the false positive rate, particularly for genes whose discordant topologies are most affected by SPILS. Finally, we use data from multiple Drosophila species to show that SPILS can be detected in nature. Although the effects of SPILS are modest per gene, it has the potential to affect substitution rate variation whenever high levels of ILS are present, particularly in rapid radiations. The problems outlined here have implications for character mapping of any type of trait, and for any biological process that causes discordance. We discuss possible solutions to these problems, and areas in which they are likely to have caused faulty inferences of convergence and accelerated evolution.

  5. Detection, Validation, and Downstream Analysis of Allelic Variation in Gene Expression

    Science.gov (United States)

    Ciobanu, Daniel C.; Lu, Lu; Mozhui, Khyobeni; Wang, Xusheng; Jagalur, Manjunatha; Morris, John A.; Taylor, William L.; Dietz, Klaus; Simon, Perikles; Williams, Robert W.

    2010-01-01

    Common sequence variants within a gene often generate important differences in expression of corresponding mRNAs. This high level of local (allelic) control—or cis modulation—rivals that produced by gene targeting, but expression is titrated finely over a range of levels. We are interested in exploiting this allelic variation to study gene function and downstream consequences of differences in expression dosage. We have used several bioinformatics and molecular approaches to estimate error rates in the discovery of cis modulation and to analyze some of the biological and technical confounds that contribute to the variation in gene expression profiling. Our analysis of SNPs and alternative transcripts, combined with eQTL maps and selective gene resequencing, revealed that between 17 and 25% of apparent cis modulation is caused by SNPs that overlap probes rather than by genuine quantitative differences in mRNA levels. This estimate climbs to 40–50% when qualitative differences between isoform variants are included. We have developed an analytical approach to filter differences in expression and improve the yield of genuine cis-modulated transcripts to ∼80%. This improvement is important because the resulting variation can be successfully used to study downstream consequences of altered expression on higher-order phenotypes. Using a systems genetics approach we show that two validated cis-modulated genes, Stk25 and Rasd2, are likely to control expression of downstream targets and affect disease susceptibility. PMID:19884314

  6. Genomic and gene variation in Mycoplasma hominis strains

    DEFF Research Database (Denmark)

    Christiansen, Gunna; Andersen, H; Birkelund, Svend

    1987-01-01

    DNAs from 14 strains of Mycoplasma hominis isolated from various habitats, including strain PG21, were analyzed for genomic heterogeneity. DNA-DNA filter hybridization values were from 51 to 91%. Restriction endonuclease digestion patterns, analyzed by agarose gel electrophoresis, revealed...... no identity or cluster formation between strains. Variation within M. hominis rRNA genes was analyzed by Southern hybridization of EcoRI-cleaved DNA hybridized with a cloned fragment of the rRNA gene from the mycoplasma strain PG50. Five of the M. hominis strains showed identical hybridization patterns....... These hybridization patterns were compared with those of 12 other mycoplasma species, which showed a much more complex band pattern. Cloned nonribosomal RNA gene fragments of M. hominis PG21 DNA were analyzed, and the fragments were used to demonstrate heterogeneity among the strains. A monoclonal antibody against...

  7. Hypertension and genetic variation in endothelial-specific genes.

    Directory of Open Access Journals (Sweden)

    Erik Larsson

    Full Text Available Genome-wide association (GWA studies usually detect common genetic variants with low-to-medium effect sizes. Many contributing variants are not revealed, since they fail to reach significance after strong correction for multiple comparisons. The WTCCC study for hypertension, for example, failed to identify genome-wide significant associations. We hypothesized that genetic variation in genes expressed specifically in the endothelium may be important for hypertension development. Results from the WTCCC study were combined with previously published gene expression data from mice to specifically investigate SNPs located within endothelial-specific genes, bypassing the requirement for genome-wide significance. Six SNPs from the WTCCC study were selected for independent replication in 5205 hypertensive patients and 5320 population-based controls, and successively in a cohort of 16,537 individuals. A common variant (rs10860812 in the DRAM (damage-regulated autophagy modulator locus showed association with hypertension (P = 0.008 in the replication study. The minor allele (A had a protective effect (OR = 0.93; 95% CI 0.88-0.98 per A-allele, which replicates the association in the WTCCC GWA study. However, a second follow-up, in the larger cohort, failed to reveal an association with blood pressure. We further tested the endothelial-specific genes for co-localization with a panel of newly discovered SNPs from large meta-GWAS on hypertension or blood pressure. There was no significant overlap between those genes and hypertension or blood pressure loci. The result does not support the hypothesis that genetic variation in genes expressed in endothelium plays an important role for hypertension development. Moreover, the discordant association of rs10860812 with blood pressure in the case control study versus the larger Malmö Preventive Project-study highlights the importance of rigorous replication in multiple large independent studies.

  8. Genome-Wide Associations of Gene Expression Variation in Humans.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  9. Genome-wide associations of gene expression variation in humans.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  10. Algorithms and software for total variation image reconstruction via first-order methods

    DEFF Research Database (Denmark)

    Dahl, Joahim; Hansen, Per Christian; Jensen, Søren Holdt

    2010-01-01

    This paper describes new algorithms and related software for total variation (TV) image reconstruction, more specifically: denoising, inpainting, and deblurring. The algorithms are based on one of Nesterov's first-order methods, tailored to the image processing applications in such a way that...

  11. Implementation of an optimal first-order method for strongly convex total variation regularization

    DEFF Research Database (Denmark)

    Jensen, Tobias Lindstrøm; Jørgensen, Jakob Heide; Hansen, Per Christian;

    2012-01-01

    We present a practical implementation of an optimal first-order method, due to Nesterov, for large-scale total variation regularization in tomographic reconstruction, image deblurring, etc. The algorithm applies to μ-strongly convex objective functions with L-Lipschitz continuous gradient...

  12. HIGHLY NONCONFORMING FINITE ELEMENT APPROXIMATIONS FOR A FOURTH ORDER VARIATIONAL INEQUALITY WITH CURVATURE OBSTACLE

    Institute of Scientific and Technical Information of China (English)

    SHI Dongyang; CHEN Shaochun; Ichiro Hagiwara

    2005-01-01

    The purpose of this paper is to obtain the optimal error estimates of O(h) for the highly nonconforming elements to a fourth order variational inequality with curvature obstacle in a convex domain with simply supported boundary by using the novel function splitting method and the orthogonal properties of the nonconforming finite element spaces.Morley's element approximation is our special case.

  13. Chloroplast gene arrangement variation within a closely related group of green algae (Trebouxiophyceae, Chlorophyta).

    Science.gov (United States)

    Letsch, Molly R; Lewis, Louise A

    2012-09-01

    The 22 published chloroplast genomes of green algae, representing sparse taxonomic sampling of diverse lineages that span over one billion years of evolution, each possess a unique gene arrangement. In contrast, many of the >190 published embryophyte (land plant) chloroplast genomes have relatively conserved architectures. To determine the phylogenetic depth at which chloroplast gene rearrangements occur in green algae, a 1.5-4 kb segment of the chloroplast genome was compared across nine species in three closely related genera of Trebouxiophyceae (Chlorophyta). In total, four distinct gene arrangements were obtained for the three genera Elliptochloris, Hemichloris, and Coccomyxa. In Elliptochloris, three distinct chloroplast gene arrangements were detected, one of which is shared with members of its sister genus Hemichloris. Both species of Coccomyxa examined share the fourth arrangement of this genome region, one characterized by very long spacers. Next, the order of genes found in this segment of the chloroplast genome was compared across green algae and land plants. As taxonomic ranks are not equivalent among different groups of organisms, the maximum molecular divergence among taxa sharing a common gene arrangement in this genome segment was compared. Well-supported clades possessing a single gene order had similar phylogenetic depth in green algae and embryophytes. When the dominant gene order of this chloroplast segment in embryophytes was assumed to be ancestral for land plants, the maximum molecular divergence was found to be over two times greater in embryophytes than in trebouxiophyte green algae. This study greatly expands information about chloroplast genome variation in green algae, is the first to demonstrate such variation among congeneric green algae, and further illustrates the fluidity of green algal chloroplast genome architecture in comparison to that of many embryophytes.

  14. A noisy-channel account of crosslinguistic word-order variation.

    Science.gov (United States)

    Gibson, Edward; Piantadosi, Steven T; Brink, Kimberly; Bergen, Leon; Lim, Eunice; Saxe, Rebecca

    2013-07-01

    The distribution of word orders across languages is highly nonuniform, with subject-verb-object (SVO) and subject-object-verb (SOV) orders being prevalent. Recent work suggests that the SOV order may be the default in human language. Why, then, is SVO order so common? We hypothesize that SOV/SVO variation can be explained by language users' sensitivity to the possibility of noise corrupting the linguistic signal. In particular, the noisy-channel hypothesis predicts a shift from the default SOV order to SVO order for semantically reversible events, for which potential ambiguity arises in SOV order because two plausible agents appear on the same side of the verb. We found support for this prediction in three languages (English, Japanese, and Korean) by using a gesture-production task, which reflects word-order preferences largely independent of native language. Other patterns of crosslinguistic variation (e.g., the prevalence of case marking in SOV languages and its relative absence in SVO languages) also straightforwardly follow from the noisy-channel hypothesis.

  15. Solution of Seventh Order Boundary Value Problems by Variation of Parameters Method

    Directory of Open Access Journals (Sweden)

    Muzammal Iftikhar

    2013-01-01

    Full Text Available The induction motor behavior is represented by a fifth order differential equation model. Addition of a torque correction factor to this model accurately reproduces the transient torques and instantaneous real and reactive power flows of the full seventh order differential equation model. The aim of this study is to solve the seventh order boundary value problems and the variation of parameters method is used for this purpose. The approximate solutions of the problems are obtained in terms of rapidly convergent series. Two numerical examples have been given to illustrate the efficiency and implementation of the method.

  16. PAX6 gene variations associated with aniridia in south India

    Directory of Open Access Journals (Sweden)

    Shashikant Shetty

    2004-04-01

    Full Text Available Abstract Background Mutations in the transcription factor gene PAX6 have been shown to be the cause of the aniridia phenotype. The purpose of this study was to analyze patients with aniridia to uncover PAX6 gene mutations in south Indian population. Methods Total genomic DNA was isolated from peripheral blood of twenty-eight members of six clinically diagnosed aniridia families and 60 normal healthy controls. The coding exons of the human PAX6 gene were amplified by PCR and allele specific variations were detected by single strand conformation polymorphism (SSCP followed by automated sequencing. Results The sequencing results revealed novel PAX6 mutations in three patients with sporadic aniridia: c.715ins5, [c.1201delA; c.1239A>G] and c.901delA. Two previously reported nonsense mutations were also found: c.482C>A, c.830G>A. A neutral polymorphism was detected (IVS9-12C>T at the boundary of intron 9 and exon 10. The two nonsense mutations found in the coding region of human PAX6 gene are reported for the first time in the south Indian population. Conclusion The genetic analysis confirms that haploinsuffiency of the PAX6 gene causes the classic aniridia phenotype. Most of the point mutations detected in our study results in stop codons. Here we add three novel PAX6 gene mutations in south Indian population to the existing spectrum of mutations, which is not a well-studied ethnic group. Our study supports the hypothesis that a mutation in the PAX6 gene correlates with expression of aniridia.

  17. Reduced order variational multiscale enrichment method for thermo-mechanical problems

    Science.gov (United States)

    Zhang, Shuhai; Oskay, Caglar

    2017-06-01

    This manuscript presents the formulation and implementation of the reduced order variational multiscale enrichment (ROVME) method for thermo-mechanical problems. ROVME is extended to model the inelastic behavior of heterogeneous structures, in which the constituent properties are temperature sensitive. The temperature-dependent coefficient tensors of the reduced order method are approximated in an efficient manner, retaining the computational efficiency of the reduced order model in the presence of spatial/temporal temperature variations. A Newton-Raphson iterative scheme is formulated and implemented for the numerical evaluation of nonlinear system of equations associated with the proposed ROVME method. Numerical verifications are performed to assess the efficiency and accuracy of the proposed computational framework. The results of the verifications reveal that ROVME retains reasonable accuracy and achieves high efficiency in the presence of hermo-mechanical loads.

  18. Study of rat neuronal genes with ordered differential display method

    Institute of Scientific and Technical Information of China (English)

    KANG; Jiansheng; (

    2001-01-01

    [1]Wang, Y., Du, Z. W., eds., Neurobiology and Molecular Biology, Beijing: People's Medical Publishing House, 1997, 184-207, 244-248.[2]Liang, P., Pardee, A., Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction, Science, 1992, 257: 967-971.[3]Michiels, L., Van Leuven, F., van den Oord, J. J. et al., Representational difference analysis using minute quantities of DNA, Nucleic Acids Res., 1998, 26(15): 3608-3610.[4]Diatchenko, L., Lau, Y. F., Campbell, A. P. et al., Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries, Proc. Natl. Acad. Sci. USA, 1996, 93(12): 6025-6030.[5]Matz, M., Lukyanov, S., Different strategies of differential display: areas of application, Nucleic Acids Res., 1998, 26: 5537-5543.[6]Matz, M., Usman, N., Shagin, D. et al., Ordered differential display: a simple method for systematic comparison of gene expression profiles, Nucleic Acids Res, 1997, 25: 2541-2542.[7]Chen, X. X., Guan, L. C., Bao, S. M. et al., Comparison and study of memory and open field behavior of four different mouse strain, Psychological Science, 1994, 17(1): 39-41.[8]Chapman, C. R., Casey, K. L., Dubner, R. et al., Pain measurement: an overview, Pain, 1985, 22: 1-31.[9]Mitchell, .D., Hellon, R. F., Neuronal and behavioral responses in rats during noxious stimulation of the tail, Proc. R. Soc. Lond., 1977, 197: 169-194.[10]Shen, Y., Yan, Y. S., eds., Medical Statistics, Shanghai: Shanghai Medical University Press, 1999, 39-44.[11]Kang, J. S., Li, R. X., Du, Y. C., Ordered differential display, Chemistry of Life, 1999, 19(6): 282-283.[12]Mou, L., Miller, H., Li, J. et al., Improvements to the differential display method for gene analysis, Biochem. Biophys. Res. Commun., 1994, 199: 564-569.[13]Lee, H. N., Weinstock, K. G., Kirkness, E. F. et al., Comparative expressed-sequence-tag analysis of differential gene

  19. Diurnal variation of hepatic antioxidant gene expression in mice.

    Directory of Open Access Journals (Sweden)

    Yi-Qiao Xu

    Full Text Available BACKGROUND: This study was aimed to examine circadian variations of hepatic antioxidant components, including the Nrf2- pathway, the glutathione (GSH system, antioxidant enzymes and metallothionein in mouse liver. METHODS AND RESULTS: Adult mice were housed in light- and temperature-controlled facilities for 2 weeks, and livers were collected every 4 h during the 24 h period. Total RNA was isolated, purified, and subjected to real-time RT-PCR analysis. Hepatic mRNA levels of Nrf2, Keap1, Nqo1 and Gclc were higher in the light-phase than the dark-phase, and were female-predominant. Hepatic GSH presented marked circadian fluctuations, along with glutathione S-transferases (GST-α1, GST-µ, GST-π and glutathione peroxidase (GPx1. The expressions of GPx1, GST-µ and GST-π mRNA were also higher in females. Antioxidant enzymes Cu/Zn superoxide dismutase (Sod1, catalase (CAT, cyclooxygenase-2 (Cox-2 and heme oxygenase-1 (Ho-1 showed circadian rhythms, with higher expressions of Cox-2 and CAT in females. Metallothionein, a small non-enzymatic antioxidant protein, showed dramatic circadian variation in males, but higher expression in females. The circadian variations of the clock gene Brain and Muscle Arnt-like Protein-1(Bmal1, albumin site D-binding protein (Dbp, nuclear receptor Rev-Erbα (Nr1d1, period protein (Per1 and Per2 and cryptochrome 1(Cry1 were in agreement with the literature. Furthermore, acetaminophen hepatotoxicity is more severe when administered in the afternoon when hepatic GSH was lowest. CONCLUSIONS: Circadian variations and gender differences in transcript levels of antioxidant genes exist in mouse liver, which could affect body responses to oxidative stress at different times of the day.

  20. The constancy of gene conservation across divergent bacterial orders

    Directory of Open Access Journals (Sweden)

    Ackermann Martin

    2009-01-01

    Full Text Available Abstract Background Orthologous genes are frequently presumed to perform similar functions. However, outside of model organisms, this is rarely tested. One means of inferring changes in function is if there are changes in the level of gene conservation and selective constraint. Here we compare levels of gene conservation across three bacterial groups to test for changes in gene functionality. Findings The level of gene conservation for different orthologous genes is highly correlated across clades, even for highly divergent groups of bacteria. These correlations do not arise from broad differences in gene functionality (e.g. informational genes vs. metabolic genes, but instead seem to result from very specific differences in gene function. Furthermore, these functional differences appear to be maintained over very long periods of time. Conclusion These results suggest that even over broad time scales, most bacterial genes are under a nearly constant level of purifying selection, and that bacterial evolution is thus dominated by selective and functional stasis.

  1. Variation within the Huntington's disease gene influences normal brain structure.

    Directory of Open Access Journals (Sweden)

    Mark Mühlau

    Full Text Available Genetics of the variability of normal and diseased brain structure largely remains to be elucidated. Expansions of certain trinucleotide repeats cause neurodegenerative disorders of which Huntington's disease constitutes the most common example. Here, we test the hypothesis that variation within the IT15 gene on chromosome 4, whose expansion causes Huntington's disease, influences normal human brain structure. In 278 normal subjects, we determined CAG repeat length within the IT15 gene on chromosome 4 and analyzed high-resolution T1-weighted magnetic resonance images by the use of voxel-based morphometry. We found an increase of GM with increasing long CAG repeat and its interaction with age within the pallidum, which is involved in Huntington's disease. Our study demonstrates that a certain trinucleotide repeat influences normal brain structure in humans. This result may have important implications for the understanding of both the healthy and diseased brain.

  2. Octocoral mitochondrial genomes provide insights into the phylogenetic history of gene order rearrangements, order reversals, and cnidarian phylogenetics.

    Science.gov (United States)

    Figueroa, Diego F; Baco, Amy R

    2014-12-24

    We use full mitochondrial genomes to test the robustness of the phylogeny of the Octocorallia, to determine the evolutionary pathway for the five known mitochondrial gene rearrangements in octocorals, and to test the suitability of using mitochondrial genomes for higher taxonomic-level phylogenetic reconstructions. Our phylogeny supports three major divisions within the Octocorallia and show that Paragorgiidae is paraphyletic, with Sibogagorgia forming a sister branch to the Coralliidae. Furthermore, Sibogagorgia cauliflora has what is presumed to be the ancestral gene order in octocorals, but the presence of a pair of inverted repeat sequences suggest that this gene order was not conserved but rather evolved back to this apparent ancestral state. Based on this we recommend the resurrection of the family Sibogagorgiidae to fix the paraphyly of the Paragorgiidae. This is the first study to show that in the Octocorallia, mitochondrial gene orders have evolved back to an ancestral state after going through a gene rearrangement, with at least one of the gene orders evolving independently in different lineages. A number of studies have used gene boundaries to determine the type of mitochondrial gene arrangement present. However, our findings suggest that this method known as gene junction screening may miss evolutionary reversals. Additionally, substitution saturation analysis demonstrates that while whole mitochondrial genomes can be used effectively for phylogenetic analyses within Octocorallia, their utility at higher taxonomic levels within Cnidaria is inadequate. Therefore for phylogenetic reconstruction at taxonomic levels higher than subclass within the Cnidaria, nuclear genes will be required, even when whole mitochondrial genomes are available.

  3. Variations of fine root diameter with root order in Manchurian ash and Dahurian larch plantations

    Institute of Scientific and Technical Information of China (English)

    WANG Xiangrong; WANG Zhengquan; HAN Youzhi; GU Jiacun; GUO Dali; MEI Li

    2007-01-01

    Fine root lifespan and turnover play an important role in carbon allocation and nutrient cycling in forest ecosystems.Fine roots are typically defined as less than 1 or 2mm in diameter.However,when categorizing roots by this diameter size,the position of an individual root on the complex lateral branching pattern has often been ignored,and our knowledge about relationships between branching order and root function thus remains limited.More recently,studies on root survivals found that longevity was remarkably different in the same branching level due to diameter variations.The objectives of this study were:(1) To examine variations of fine root diameter from the first-to fifth-orders in Fraxinus mandshurica Rupr and Larix gmelinii Rupr roots;and (2) To reveal how the season,soil nutrient,and water availability affect root diameter in different branch order in two species.This study was conducted at Maoershan Forest Research Station (45°21'-45°25'N,127°30'-127°34'E) owned by Northeast Forestry University in Harbin,northeast China.Both F.mandshurica and L.gmelinii were planted in 1986.In each plantation,fine roots of two species by sampling up to five fine root branch orders three times during the 2003 growing season from two soil depths (i.e.,0-10 and 10-20 cm)were obtained.The results showed that average diameters of fine roots were significantly different among the five branch orders.The first-order had the thinner roots and the fifth order had the thickest roots,the diameter increasing regularly with the ascending branch orders in both species.If the diameter of fine roots was defined as being smaller than 0.5 mm,the first three orders ofF.mandshurica roots and the first two orders of L.gmelinii roots would be included in the fine root population.The diameter ranges of the fine roots from first-order to fifth-order were 0.15-0.58,0.18-0.70,0.26-1.05,0.36-1.43,and 0.71-2.96 mm for F.mandshurica,and 0.17-0.76,0.23-1.02,0.26-1.10,0.38-1.77,and 0.84-2.80 mm for L

  4. Natural variation for gene expression responses to abiotic stress in maize.

    Science.gov (United States)

    Waters, Amanda J; Makarevitch, Irina; Noshay, Jaclyn; Burghardt, Liana T; Hirsch, Candice N; Hirsch, Cory D; Springer, Nathan M

    2017-02-01

    Plants respond to abiotic stress through a variety of physiological, biochemical, and transcriptional mechanisms. Many genes exhibit altered levels of expression in response to abiotic stress, which requires concerted action of both cis- and trans-regulatory features. In order to study the variability in transcriptome response to abiotic stress, RNA sequencing was performed using 14-day-old maize seedlings of inbreds B73, Mo17, Oh43, PH207 and B37 under control, cold and heat conditions. Large numbers of genes that responded differentially to stress between parental inbred lines were identified. RNA sequencing was also performed on similar tissues of the F1 hybrids produced by crossing B73 and each of the three other inbred lines. By evaluating allele-specific transcript abundance in the F1 hybrids, we were able to measure the abundance of cis- and trans-regulatory variation between genotypes for both steady-state and stress-responsive expression differences. Although examples of trans-regulatory variation were observed, cis-regulatory variation was more common for both steady-state and stress-responsive expression differences. The genes with cis-allelic variation for response to cold or heat stress provided an opportunity to study the basis for regulatory diversity.

  5. Sequence variations in the FAD2 gene in seeded pumpkins.

    Science.gov (United States)

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-12-21

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

  6. AGTR1 gene variation: association with depression and frontotemporal morphology.

    Science.gov (United States)

    Taylor, Warren D; Benjamin, Sophiya; McQuoid, Douglas R; Payne, Martha E; Krishnan, Ranga R; MacFall, James R; Ashley-Koch, Allison

    2012-05-31

    The renin-angiotensin system (RAS) is implicated in the response to physiological and psychosocial stressors, but its role in stress-related psychiatric disorders is poorly understood. We examined if variation in AGTR1, the gene coding for the type 1 angiotensin II receptor (AT(1)R), is associated with a diagnosis of depression and differences in white matter hyperintensities and frontotemporal brain volumes. Participants comprised 257 depressed and 116 nondepressed elderly Caucasian subjects who completed clinical assessments and provided blood samples for genotyping. We used a haplotype-tagging single nucleotide polymorphism (htSNP) analysis to test for variation in AGTR1. For measurement of hyperintense lesions, 1.5 Tesla magnetic resonance imaging (MRI) data were available on 33 subjects. For measurements of the hippocampus and dorsolateral prefrontal cortex (dlPFC), 3 Tesla MRI data were available on 70 subjects. Two htSNPs exhibited statistically significant frequency differences between diagnostic cohorts: rs10935724 and rs12721331. Although hyperintense lesion volume did not significantly differ by any htSNP, dlPFC and hippocampus volume differed significantly for several htSNPs. Intriguingly, for those htSNPs differing significantly for both dlPFC and hippocampus volume, the variant associated with smaller dlPFC volume was associated with larger hippocampal volume. This supports the idea that genetic variation in AGTR1 is associated with depression and differences in frontotemporal morphology. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  7. Unusual Gene Order and Organization of the Sea Urchin Hox Cluster

    OpenAIRE

    Richardson, Paul M.; Lucas, Susan; Cameron, R. Andrew; Rowen, Lee; Nesbitt, Ryan; Bloom, Scott; Rast, Jonathan P.; Berney, Kevin; Arenas-Mena, Cesar; Martinez, Pedro; Davidson, Eric H.; Peterson, Kevin J.; Hood, Leroy

    2005-01-01

    The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and...

  8. Convergence of Variational Iteration Method for Solving Singular Partial Differential Equations of Fractional Order

    Directory of Open Access Journals (Sweden)

    Asma Ali Elbeleze

    2014-01-01

    Full Text Available We are concerned here with singular partial differential equations of fractional order (FSPDEs. The variational iteration method (VIM is applied to obtain approximate solutions of this type of equations. Convergence analysis of the VIM is discussed. This analysis is used to estimate the maximum absolute truncated error of the series solution. A comparison between the results of VIM solutions and exact solution is given. The fractional derivatives are described in Caputo sense.

  9. Adaptive Second-Order Total Variation: An Approach Aware of Slope Discontinuities

    KAUST Repository

    Lenzen, Frank

    2013-01-01

    Total variation (TV) regularization, originally introduced by Rudin, Osher and Fatemi in the context of image denoising, has become widely used in the field of inverse problems. Two major directions of modifications of the original approach were proposed later on. The first concerns adaptive variants of TV regularization, the second focuses on higher-order TV models. In the present paper, we combine the ideas of both directions by proposing adaptive second-order TV models, including one anisotropic model. Experiments demonstrate that introducing adaptivity results in an improvement of the reconstruction error. © 2013 Springer-Verlag.

  10. Compact high order finite volume method on unstructured grids III: Variational reconstruction

    Science.gov (United States)

    Wang, Qian; Ren, Yu-Xin; Pan, Jianhua; Li, Wanai

    2017-05-01

    This paper presents a variational reconstruction for the high order finite volume method in solving the two-dimensional Navier-Stokes equations on arbitrary unstructured grids. In the variational reconstruction, an interfacial jump integration is defined to measure the jumps of the reconstruction polynomial and its spatial derivatives on each cell interface. The system of linear equations to determine the reconstruction polynomials is derived by minimizing the total interfacial jump integration in the computational domain using the variational method. On each control volume, the derived equations are implicit relations between the coefficients of the reconstruction polynomials defined on a compact stencil involving only the current cell and its direct face-neighbors. The reconstruction and time integration coupled iteration method proposed in our previous paper is used to achieve high computational efficiency. A problem-independent shock detector and the WBAP limiter are used to suppress non-physical oscillations in the simulation of flow with discontinuities. The advantages of the finite volume method using the variational reconstruction over the compact least-squares finite volume method proposed in our previous papers are higher accuracy, higher computational efficiency, more flexible boundary treatment and non-singularity of the reconstruction matrix. A number of numerical test cases are solved to verify the accuracy, efficiency and shock-capturing capability of the finite volume method using the variational reconstruction.

  11. Gene structure and evolution of transthyretin in the order Chiroptera.

    Science.gov (United States)

    Khwanmunee, Jiraporn; Leelawatwattana, Ladda; Prapunpoj, Porntip

    2016-02-01

    Bats are mammals in the order Chiroptera. Although many extensive morphologic and molecular genetics analyses have been attempted, phylogenetic relationships of bats has not been completely resolved. The paraphyly of microbats is of particular controversy that needs to be confirmed. In this study, we attempted to use the nucleotide sequence of transthyretin (TTR) intron 1 to resolve the relationship among bats. To explore its utility, the complete sequences of TTR gene and intron 1 region of bats in Vespertilionidae: genus Eptesicus (Eptesicus fuscus) and genus Myotis (Myotis brandtii, Myotis davidii, and Myotis lucifugus), and Pteropodidae (Pteropus alecto and Pteropus vampyrus) were extracted from the retrieved sequences, whereas those of Rhinoluphus affinis and Scotophilus kuhlii were amplified and sequenced. The derived overall amino sequences of bat TTRs were found to be very similar to those in other eutherians but differed from those in other classes of vertebrates. However, missing of amino acids from N-terminal or C-terminal region was observed. The phylogenetic analysis of amino acid sequences suggested bat and other eutherian TTRs lineal descent from a single most recent common ancestor which differed from those of non-placental mammals and the other classes of vertebrates. The splicing of bat TTR precursor mRNAs was similar to those of other eutherian but different from those of marsupial, bird, reptile and amphibian. Based on TTR intron 1 sequence, the inferred evolutionary relationship within Chiroptera revealed more closely relatedness of R. affinis to megabats than to microbats. Accordingly, the paraphyly of microbats was suggested.

  12. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Science.gov (United States)

    Onouchi, Yoshihiro; Fukazawa, Ryuji; Yamamura, Kenichiro; Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+)/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+) release activated Ca(2+) (CRAC) channel mediating store-operated Ca(2+) entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+)/NFAT pathway in the pathogenesis of this disorder.

  13. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Directory of Open Access Journals (Sweden)

    Yoshihiro Onouchi

    Full Text Available Kawasaki disease (KD; MIM#61175 is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+ release activated Ca(2+ (CRAC channel mediating store-operated Ca(2+ entry (SOCE on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596 was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls, P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method. Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012. These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+/NFAT pathway in the pathogenesis of this disorder.

  14. Variations in ORAI1 Gene Associated with Kawasaki Disease

    Science.gov (United States)

    Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca2+/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca2+ release activated Ca2+ (CRAC) channel mediating store-operated Ca2+ entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca2+/NFAT pathway in the pathogenesis of this disorder. PMID:26789410

  15. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Directory of Open Access Journals (Sweden)

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  16. Analysis of gene evolution and metabolic pathways using the Candida Gene Order Browser

    Science.gov (United States)

    2010-01-01

    Background Candida species are the most common cause of opportunistic fungal infection worldwide. Recent sequencing efforts have provided a wealth of Candida genomic data. We have developed the Candida Gene Order Browser (CGOB), an online tool that aids comparative syntenic analyses of Candida species. CGOB incorporates all available Candida clade genome sequences including two Candida albicans isolates (SC5314 and WO-1) and 8 closely related species (Candida dubliniensis, Candida tropicalis, Candida parapsilosis, Lodderomyces elongisporus, Debaryomyces hansenii, Pichia stipitis, Candida guilliermondii and Candida lusitaniae). Saccharomyces cerevisiae is also included as a reference genome. Results CGOB assignments of homology were manually curated based on sequence similarity and synteny. In total CGOB includes 65617 genes arranged into 13625 homology columns. We have also generated improved Candida gene sets by merging/removing partial genes in each genome. Interrogation of CGOB revealed that the majority of tandemly duplicated genes are under strong purifying selection in all Candida species. We identified clusters of adjacent genes involved in the same metabolic pathways (such as catabolism of biotin, galactose and N-acetyl glucosamine) and we showed that some clusters are species or lineage-specific. We also identified one example of intron gain in C. albicans. Conclusions Our analysis provides an important resource that is now available for the Candida community. CGOB is available at http://cgob.ucd.ie. PMID:20459735

  17. Analysis of gene evolution and metabolic pathways using the Candida Gene Order Browser

    LENUS (Irish Health Repository)

    Fitzpatrick, David A

    2010-05-10

    Abstract Background Candida species are the most common cause of opportunistic fungal infection worldwide. Recent sequencing efforts have provided a wealth of Candida genomic data. We have developed the Candida Gene Order Browser (CGOB), an online tool that aids comparative syntenic analyses of Candida species. CGOB incorporates all available Candida clade genome sequences including two Candida albicans isolates (SC5314 and WO-1) and 8 closely related species (Candida dubliniensis, Candida tropicalis, Candida parapsilosis, Lodderomyces elongisporus, Debaryomyces hansenii, Pichia stipitis, Candida guilliermondii and Candida lusitaniae). Saccharomyces cerevisiae is also included as a reference genome. Results CGOB assignments of homology were manually curated based on sequence similarity and synteny. In total CGOB includes 65617 genes arranged into 13625 homology columns. We have also generated improved Candida gene sets by merging\\/removing partial genes in each genome. Interrogation of CGOB revealed that the majority of tandemly duplicated genes are under strong purifying selection in all Candida species. We identified clusters of adjacent genes involved in the same metabolic pathways (such as catabolism of biotin, galactose and N-acetyl glucosamine) and we showed that some clusters are species or lineage-specific. We also identified one example of intron gain in C. albicans. Conclusions Our analysis provides an important resource that is now available for the Candida community. CGOB is available at http:\\/\\/cgob.ucd.ie.

  18. Analysis of gene evolution and metabolic pathways using the Candida Gene Order Browser

    Directory of Open Access Journals (Sweden)

    Byrne Kevin P

    2010-05-01

    Full Text Available Abstract Background Candida species are the most common cause of opportunistic fungal infection worldwide. Recent sequencing efforts have provided a wealth of Candida genomic data. We have developed the Candida Gene Order Browser (CGOB, an online tool that aids comparative syntenic analyses of Candida species. CGOB incorporates all available Candida clade genome sequences including two Candida albicans isolates (SC5314 and WO-1 and 8 closely related species (Candida dubliniensis, Candida tropicalis, Candida parapsilosis, Lodderomyces elongisporus, Debaryomyces hansenii, Pichia stipitis, Candida guilliermondii and Candida lusitaniae. Saccharomyces cerevisiae is also included as a reference genome. Results CGOB assignments of homology were manually curated based on sequence similarity and synteny. In total CGOB includes 65617 genes arranged into 13625 homology columns. We have also generated improved Candida gene sets by merging/removing partial genes in each genome. Interrogation of CGOB revealed that the majority of tandemly duplicated genes are under strong purifying selection in all Candida species. We identified clusters of adjacent genes involved in the same metabolic pathways (such as catabolism of biotin, galactose and N-acetyl glucosamine and we showed that some clusters are species or lineage-specific. We also identified one example of intron gain in C. albicans. Conclusions Our analysis provides an important resource that is now available for the Candida community. CGOB is available at http://cgob.ucd.ie.

  19. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Directory of Open Access Journals (Sweden)

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  20. Variation in the Ace Gene in Elite Polish Football Players

    Directory of Open Access Journals (Sweden)

    Cięszczyk Paweł

    2016-12-01

    Full Text Available Purpose. A common polymorphism in the angiotensin converting enzyme I gene (the ACE I/D variant represents one of the first characterized and the most widely studied genetic variants in the context of elite athletes status and performance related traits. The aim of the study was to determine the genotype and allele distribution of the allele and genotype of the ACE gene in Polish male football players. Methods. The total of 106 Polish male professional football players were recruited. They were divided into groups according to the position in the field: forwards, defenders, midfielders, and goalkeepers. For controls, samples were prepared with 115 unrelated volunteers. DNA was extracted from the buccal cells donated by the subjects, and the PCR amplification of the polymorphic region of the ACE gene containing either the insertion (I or deletion (D fragment was performed. Results. The genotype distribution and allele frequencies among all football players did not differ significantly when compared with sedentary control individuals (p = 0.887, p = 0.999, respectively. Likewise, the analysis of forwards, defenders, midfielders, and goalkeepers revealed no significant differences in either ACE genotype or allele frequencies. Conclusions. We did not provide evidence for difference of variation of the ACE I/D polymorphism between Polish football players and controls, as we did not obtain any statistically significantly higher frequency of either of the analysed alleles (I and D or genotypes (DD, ID, and II in the studied subgroups. It may be suspected that harbouring of I/D allelic variants of the ACE gene neither decreases nor increases the probability of being a professional football player in Poland.

  1. Caenorhabditis elegans Genes Affecting Interindividual Variation in Life-span Biomarker Gene Expression.

    Science.gov (United States)

    Mendenhall, Alexander; Crane, Matthew M; Tedesco, Patricia M; Johnson, Thomas E; Brent, Roger

    2017-10-01

    Genetically identical organisms grown in homogenous environments differ in quantitative phenotypes. Differences in one such trait, expression of a single biomarker gene, can identify isogenic cells or organisms that later manifest different fates. For example, in isogenic populations of young adult Caenorhabditis elegans, differences in Green Fluorescent Protein (GFP) expressed from the hsp-16.2 promoter predict differences in life span. Thus, it is of interest to determine how interindividual differences in biomarker gene expression arise. Prior reports showed that the thermosensory neurons and insulin signaling systems controlled the magnitude of the heat shock response, including absolute expression of hsp-16.2. Here, we tested whether these regulatory signals might also influence variation in hsp-16.2 reporter expression. Genetic experiments showed that the action of AFD thermosensory neurons increases interindividual variation in biomarker expression. Further genetic experimentation showed the insulin signaling system acts to decrease interindividual variation in life-span biomarker expression; in other words, insulin signaling canalizes expression of the hsp-16.2-driven life-span biomarker. Our results show that specific signaling systems regulate not only expression level, but also the amount of interindividual expression variation for a life-span biomarker gene. They raise the possibility that manipulation of these systems might offer means to reduce heterogeneity in the aging process. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Genes controlling mimetic colour pattern variation in butterflies.

    Science.gov (United States)

    Nadeau, Nicola J

    2016-10-01

    Butterfly wing patterns are made up of arrays of coloured scales. There are two genera in which within-species variation in wing patterning is common and has been investigated at the molecular level, Heliconius and Papilio. Both of these species have mimetic relationships with other butterfly species that increase their protection from predators. Heliconius have a 'tool-kit' of five genetic loci that control colour pattern, three of which have been identified at the gene level, and which have been repeatedly used to modify colour pattern by different species in the genus. By contrast, the three Papilio species that have been investigated each have different genetic mechanisms controlling their polymorphic wing patterns.

  3. Variational Iteration Method for Fifth-Order Boundary Value Problems Using He's Polynomials

    Directory of Open Access Journals (Sweden)

    Muhammad Aslam Noor

    2008-01-01

    Full Text Available We apply the variational iteration method using He's polynomials (VIMHP for solving the fifth-order boundary value problems. The proposed method is an elegant combination of variational iteration and the homotopy perturbation methods and is mainly due to Ghorbani (2007. The suggested algorithm is quite efficient and is practically well suited for use in these problems. The proposed iterative scheme finds the solution without any discritization, linearization, or restrictive assumptions. Several examples are given to verify the reliability and efficiency of the method. The fact that the proposed technique solves nonlinear problems without using Adomian's polynomials can be considered as a clear advantage of this algorithm over the decomposition method.

  4. Importance of globin gene order for correct developmental expression.

    NARCIS (Netherlands)

    O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)

    1991-01-01

    textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the

  5. The impact of gene expression variation on the robustness and evolvability of a developmental gene regulatory network.

    Directory of Open Access Journals (Sweden)

    David A Garfield

    2013-10-01

    Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.

  6. Quantitative gene-gene and gene-environment mapping for leaf shape variation using tree-based models

    Science.gov (United States)

    Leaf shape traits have long been a focus of many disciplines, but searching for complex genetic and environmental interactive mechanisms regulating leaf shape variation has not yet been well developed. The question of the respective roles of gene and environment and how they interplay to modulate l...

  7. Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici

    Directory of Open Access Journals (Sweden)

    Megan C. McDonald

    2016-04-01

    Full Text Available Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene.

  8. Parameter-invariant second-order variational problems in one variable

    Science.gov (United States)

    Muñoz Masqué, J.; Pozo Coronado, L. M.

    1998-07-01

    A projection is defined such that a second-order Lagrangian density factors through this projection modulo contact forms if and only if it is parameter invariant. In this way, a geometric interpretation of the parameter invariance conditions is obtained. The above projection is then used to prove the strict factorization of the Poincaré-Cartan form attached to a parameter-invariant variational problem thus leading us to state the Hamilton-Cartan formalism, the complete description of symmetries and regularity for such problems. The case of the squared curvature Lagrangian in the plane is analysed especially.

  9. Common themes and cell type specific variations of higher order chromatin arrangements in the mouse

    Directory of Open Access Journals (Sweden)

    Cremer Thomas

    2005-12-01

    Full Text Available Abstract Background Similarities as well as differences in higher order chromatin arrangements of human cell types were previously reported. For an evolutionary comparison, we now studied the arrangements of chromosome territories and centromere regions in six mouse cell types (lymphocytes, embryonic stem cells, macrophages, fibroblasts, myoblasts and myotubes with fluorescence in situ hybridization and confocal laser scanning microscopy. Both species evolved pronounced differences in karyotypes after their last common ancestors lived about 87 million years ago and thus seem particularly suited to elucidate common and cell type specific themes of higher order chromatin arrangements in mammals. Results All mouse cell types showed non-random correlations of radial chromosome territory positions with gene density as well as with chromosome size. The distribution of chromosome territories and pericentromeric heterochromatin changed during differentiation, leading to distinct cell type specific distribution patterns. We exclude a strict dependence of these differences on nuclear shape. Positional differences in mouse cell nuclei were less pronounced compared to human cell nuclei in agreement with smaller differences in chromosome size and gene density. Notably, the position of chromosome territories relative to each other was very variable. Conclusion Chromosome territory arrangements according to chromosome size and gene density provide common, evolutionary conserved themes in both, human and mouse cell types. Our findings are incompatible with a previously reported model of parental genome separation.

  10. Copy number variations in alternative splicing gene networks impact lifespan.

    Directory of Open Access Journals (Sweden)

    Joseph T Glessner

    Full Text Available Longevity has a strong genetic component evidenced by family-based studies. Lipoprotein metabolism, FOXO proteins, and insulin/IGF-1 signaling pathways in model systems have shown polygenic variations predisposing to shorter lifespan. To test the hypothesis that rare variants could influence lifespan, we compared the rates of CNVs in healthy children (0-18 years of age with individuals 67 years or older. CNVs at a significantly higher frequency in the pediatric cohort were considered risk variants impacting lifespan, while those enriched in the geriatric cohort were considered longevity protective variants. We performed a whole-genome CNV analysis on 7,313 children and 2,701 adults of European ancestry genotyped with 302,108 SNP probes. Positive findings were evaluated in an independent cohort of 2,079 pediatric and 4,692 geriatric subjects. We detected 8 deletions and 10 duplications that were enriched in the pediatric group (P=3.33×10(-8-1.6×10(-2 unadjusted, while only one duplication was enriched in the geriatric cohort (P=6.3×10(-4. Population stratification correction resulted in 5 deletions and 3 duplications remaining significant (P=5.16×10(-5-4.26×10(-2 in the replication cohort. Three deletions and four duplications were significant combined (combined P=3.7×10(-4-3.9×10(-2. All associated loci were experimentally validated using qPCR. Evaluation of these genes for pathway enrichment demonstrated ~50% are involved in alternative splicing (P=0.0077 Benjamini and Hochberg corrected. We conclude that genetic variations disrupting RNA splicing could have long-term biological effects impacting lifespan.

  11. Evolution of variation in presence and absence of genes in bacterial pathways

    Directory of Open Access Journals (Sweden)

    Francis Andrew R

    2012-04-01

    Full Text Available Abstract Background Bacterial genomes exhibit a remarkable degree of variation in the presence and absence of genes, which probably extends to the level of individual pathways. This variation may be a consequence of the significant evolutionary role played by horizontal gene transfer, but might also be explained by the loss of genes through mutation. A challenge is to understand why there would be variation in gene presence within pathways if they confer a benefit only when complete. Results Here, we develop a mathematical model to study how variation in pathway content is produced by horizontal transfer, gene loss and partial exposure of a population to a novel environment. Conclusions We discuss the possibility that variation in gene presence acts as cryptic genetic variation on which selection acts when the appropriate environment occurs. We find that a high level of variation in gene presence can be readily explained by decay of the pathway through mutation when there is no longer exposure to the selective environment, or when selection becomes too weak to maintain the genes. In the context of pathway variation the role of horizontal gene transfer is probably the initial introduction of a complete novel pathway rather than in building up the variation in a genome without the pathway.

  12. Serotonergic gene variation: implications for personality traits and psychopathology.

    Science.gov (United States)

    Lesch, K P

    1999-06-01

    Serotonin 5-hydroxytryptamine (5-HT) is an important regulator of morphogenetic activities during early central nervous system development, including cell proliferation, migration, and differentiation as well as synapto-genesis. Serotonergic raphe neurons diffusely project to a variety of brain regions (e.g. cortex, amygdala, hippocampus) and play known roles in integrating emotion, cognition, motor function as well as in food intake, sleep, pain, and sexual activity. The diversity of physiologic functions is due to the fact that 5-HT acts as a master control neurotransmitter within a highly complex system of neural communication mediated by multiple pre- and postsynaptic 5-HT receptors, thus orchestrating the activity and interaction of several other neurotransmitter systems. Since proteins involved in the regulation of central serotonergic activity (e.g. enzymes, receptors, transporter) play pivotal role in brain 5-HT homeostasis, polymorphisms in the regulatory regions of their genes resulting in variation of expression and function are likely to influence complex traits, such as temperament/personality and psychopathology.

  13. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  14. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  15. The Effect of Genetic and Environmental Variation on Metabolic Gene Expression

    Science.gov (United States)

    Scott, Cinda P.; Williams, Dean A.; Crawford, Douglas L.

    2009-01-01

    What is the relationship between genetic or environmental variation and the variation in mRNA expression? To address this, microarrays were used to examine the effect of genetic and environmental variation on cardiac mRNA expression for metabolic genes in three groups of Fundulus heteroclitus: (1) individuals sampled in the field (field), (2) field individuals acclimated for six months to laboratory conditions (acclimated) or (3) individuals bred for ten successive generations in a laboratory environment (G10). The G10 individuals have significantly less genetic variation than individuals obtained in the field and had a significantly lower variation in mRNA expression across all genes in comparison to the other two groups (p ≤ 0.001). When examining the gene specific variation, twenty-two genes had variation in expression that was significantly different among groups with lower variation in G10 individuals than in acclimated individuals. Additionally, there were fewer genes with significant differences in expression among G10 individuals versus either acclimated or field individuals: 66 genes have statistically different levels of expression versus 107 or 97 for Acclimated or Field groups. Based on the permutation of the data, these differences in the number of genes with significant differences among individuals within a group are unlikely to occur by chance (p < 0.01). Surprisingly, variation in mRNA expression in field individuals is lower than in acclimated individuals. Relative to the variation among individual within a group, few genes have significant differences in expression among groups (seven, 2.3%) and none of these are different between acclimated and field individuals. The results support the concept that genetic variation affects variation in mRNA expression and also suggests that temporal environmental variation associated with estuarine environments does not increase the variation among individuals or add to the differences among groups. PMID

  16. GeneFisher-P: variations of GeneFisher as processes in Bio-jETI

    Science.gov (United States)

    Lamprecht, Anna-Lena; Margaria, Tiziana; Steffen, Bernhard; Sczyrba, Alexander; Hartmeier, Sven; Giegerich, Robert

    2008-01-01

    Background PCR primer design is an everyday, but not trivial task requiring state-of-the-art software. We describe the popular tool GeneFisher and explain its recent restructuring using workflow techniques. We apply a service-oriented approach to model and implement GeneFisher-P, a process-based version of the GeneFisher web application, as a part of the Bio-jETI platform for service modeling and execution. We show how to introduce a flexible process layer to meet the growing demand for improved user-friendliness and flexibility. Results Within Bio-jETI, we model the process using the jABC framework, a mature model-driven, service-oriented process definition platform. We encapsulate remote legacy tools and integrate web services using jETI, an extension of the jABC for seamless integration of remote resources as basic services, ready to be used in the process. Some of the basic services used by GeneFisher are in fact already provided as individual web services at BiBiServ and can be directly accessed. Others are legacy programs, and are made available to Bio-jETI via the jETI technology. The full power of service-based process orientation is required when more bioinformatics tools, available as web services or via jETI, lead to easy extensions or variations of the basic process. This concerns for instance variations of data retrieval or alignment tools as provided by the European Bioinformatics Institute (EBI). Conclusions The resulting service- and process-oriented GeneFisher-P demonstrates how basic services from heterogeneous sources can be easily orchestrated in the Bio-jETI platform and lead to a flexible family of specialized processes tailored to specific tasks. PMID:18460174

  17. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought

    Directory of Open Access Journals (Sweden)

    Pei eXu

    2015-10-01

    Full Text Available Asparagus bean (Vigna unguiculata ssp. sesquipedalis is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS. Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding.

  18. 高阶非局部变分模型%Higher-order nonlocal variational model

    Institute of Scientific and Technical Information of China (English)

    李亚峰; 冯象初

    2012-01-01

    To describe the nonlocal structure of images better and remove noise, this paper proposes a higher-order nonlocal variational model by defining a new weighted function. Theoretical analysis and numerical experiments are presented to demonstrate the performance of the proposed model, which is better than the original in terms of both PSNR and visual perception. As a result, the new model keeps the advantages of the nonlocal variational model, while it can preserve image features better.%为了更好地描述图像的非局部结构并抑制噪声,通过定义新的权函数,提出了一个高阶非局部变分模型.理论分析和实验结果表明,相比于非局部平均去噪算子和非局部变分模型,提出的高阶非局部变分模型在去噪结果上有更高的信噪比和更好的视觉效果.因此,新模型保持了非局部变分模型的优点,同时能够更好地保留图像特征.

  19. Considerations on describing non-singlet spin states in variational second order density matrix methods.

    Science.gov (United States)

    van Aggelen, Helen; Verstichel, Brecht; Bultinck, Patrick; Van Neck, Dimitri; Ayers, Paul W

    2012-01-07

    Despite the importance of non-singlet molecules in chemistry, most variational second order density matrix calculations have focused on singlet states. Ensuring that a second order density matrix is derivable from a proper N-electron spin state is a difficult problem because the second order density matrix only describes one- and two-particle interactions. In pursuit of a consistent description of spin in second order density matrix theory, we propose and evaluate two main approaches: we consider constraints derived from a pure spin state and from an ensemble of spin states. This paper makes a comparative assessment of the different approaches by applying them to potential energy surfaces for different spin states of the oxygen and carbon dimer. We observe two major shortcomings of the applied spin constraints: they are not size consistent and they do not reproduce the degeneracy of the different states in a spin multiplet. First of all, the spin constraints are less strong when applied to a dissociated molecule than when they are applied to the dissociation products separately. Although they impose correct spin expectation values on the dissociated molecule, the dissociation products do not have correct spin expectation values. Secondly, both under "pure spin state conditions" and under "ensemble spin state" conditions is the energy a convex function of the spin projection. Potential energy surfaces for different spin projections of the same spin state may give a completely different picture of the molecule's bonding. The maximal spin projection always gives the most strongly constrained energy, but is also significantly more expensive to compute than a spin-averaged ensemble. In the dissociation limit, both the problem of nondegeneracy of equivalent spin projections, size-inconsistency and unphysical dissociation can be corrected by means of subspace energy constraints.

  20. Looking on the bright side of serotonin transporter gene variation.

    Science.gov (United States)

    Homberg, Judith R; Lesch, Klaus-Peter

    2011-03-15

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for depression in interaction with psychosocial adversity across the life span. However, genetically driven deficient serotonin transporter (5-HTT) function would not have been maintained throughout evolution if it only exerted negative effects without conveying any gain of function. Here, we review recent findings that humans and nonhuman primates carrying the s variant of the 5-HTTLPR outperform subjects carrying the long allele in an array of cognitive tasks and show increased social conformity. In addition, studies in 5-HTT knockout rodents are included that provide complementary insights in the beneficial effects of the 5-HTTLPR s-allele. We postulate that hypervigilance, mediated by hyperactivity in corticolimbic structures, may be the common denominator in the anxiety-related traits and (social) cognitive superiority of s-allele carriers and that environmental conditions determine whether a response will turn out to be negative (emotional) or positive (cognitive, in conformity with the social group). Taken together, these findings urge for a conceptual change in the current deficit-oriented connotation of the 5-HTTLPR variants. In fact, these factors may counterbalance or completely offset the negative consequences of the anxiety-related traits. This notion may not only explain the modest effect size of the 5-HTTLPR and inconsistent reports but may also lead to a more refined appreciation of allelic variation in 5-HTT function. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  1. Genome-wide association implicates numerous genes underlying ecological trait variation in natural populations of Populus trichocarpa.

    Science.gov (United States)

    McKown, Athena D; Klápště, Jaroslav; Guy, Robert D; Geraldes, Armando; Porth, Ilga; Hannemann, Jan; Friedmann, Michael; Muchero, Wellington; Tuskan, Gerald A; Ehlting, Jürgen; Cronk, Quentin C B; El-Kassaby, Yousry A; Mansfield, Shawn D; Douglas, Carl J

    2014-07-01

    In order to uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa) from much of its range in western North America. Extensive data from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34 K Populus single nucleotide polymorphism (SNP) array) of all accessions were used for gene discovery in a genome-wide association study (GWAS). We performed GWAS with 40 biomass, ecophysiology and phenology traits and 29,355 filtered SNPs representing 3518 genes. The association analyses were carried out using a Unified Mixed Model accounting for population structure effects among accessions. We uncovered 410 significant SNPs using a Bonferroni-corrected threshold (P<1.7×10(-6)). Markers were found across 19 chromosomes, explained 1-13% of trait variation, and implicated 275 unique genes in trait associations. Phenology had the largest number of associated genes (240 genes), followed by biomass (53 genes) and ecophysiology traits (25 genes). The GWAS results propose numerous loci for further investigation. Many traits had significant associations with multiple genes, underscoring their genetic complexity. Genes were also identified with multiple trait associations within and/or across trait categories. In some cases, traits were genetically correlated while in others they were not.

  2. Tandem gene arrays in Trypanosoma brucei: Comparative phylogenomic analysis of duplicate sequence variation

    Directory of Open Access Journals (Sweden)

    Jackson Andrew P

    2007-04-01

    Full Text Available Abstract Background The genome sequence of the protistan parasite Trypanosoma brucei contains many tandem gene arrays. Gene duplicates are created through tandem duplication and are expressed through polycistronic transcription, suggesting that the primary purpose of long, tandem arrays is to increase gene dosage in an environment where individual gene promoters are absent. This report presents the first account of the tandem gene arrays in the T. brucei genome, employing several related genome sequences to establish how variation is created and removed. Results A systematic survey of tandem gene arrays showed that substantial sequence variation existed across the genome; variation from different regions of an array often produced inconsistent phylogenetic affinities. Phylogenetic relationships of gene duplicates were consistent with concerted evolution being a widespread homogenising force. However, tandem duplicates were not usually identical; therefore, any homogenising effect was coincident with divergence among duplicates. Allelic gene conversion was detected using various criteria and was apparently able to both remove and introduce sequence variation. Tandem arrays containing structural heterogeneity demonstrated how sequence homogenisation and differentiation can occur within a single locus. Conclusion The use of multiple genome sequences in a comparative analysis of tandem gene arrays identified substantial sequence variation among gene duplicates. The distribution of sequence variation is determined by a dynamic balance of conservative and innovative evolutionary forces. Gene trees from various species showed that intraspecific duplicates evolve in concert, perhaps through frequent gene conversion, although this does not prevent sequence divergence, especially where structural heterogeneity physically separates a duplicate from its neighbours. In describing dynamics of sequence variation that have consequences beyond gene dosage, this

  3. Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in Aggressiveness of Prostate Cancer

    Science.gov (United States)

    2015-10-01

    occupation, and smoking . 2. To examine the modifying effect of genetic variants in ITC-metabolizing genes on the associations between cruciferous...AWARD NUMBER: W81XWH-14-1-0453 TITLE: Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in Aggressiveness of...COVERED 15 Sep 2014 - 14 Sep 2015 4. TITLE AND SUBTITLE Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in

  4. The Relationship between Gene Network Structure and Expression Variation among Individuals and Species.

    Directory of Open Access Journals (Sweden)

    Karen E Sears

    2015-08-01

    Full Text Available Variation among individuals is a prerequisite of evolution by natural selection. As such, identifying the origins of variation is a fundamental goal of biology. We investigated the link between gene interactions and variation in gene expression among individuals and species using the mammalian limb as a model system. We first built interaction networks for key genes regulating early (outgrowth; E9.5-11 and late (expansion and elongation; E11-13 limb development in mouse. This resulted in an Early (ESN and Late (LSN Stage Network. Computational perturbations of these networks suggest that the ESN is more robust. We then quantified levels of the same key genes among mouse individuals and found that they vary less at earlier limb stages and that variation in gene expression is heritable. Finally, we quantified variation in gene expression levels among four mammals with divergent limbs (bat, opossum, mouse and pig and found that levels vary less among species at earlier limb stages. We also found that variation in gene expression levels among individuals and species are correlated for earlier and later limb development. In conclusion, results are consistent with the robustness of the ESN buffering among-individual variation in gene expression levels early in mammalian limb development, and constraining the evolution of early limb development among mammalian species.

  5. Unusual Gene Order and Organization of the Sea Urchin Hox Cluster

    Energy Technology Data Exchange (ETDEWEB)

    Cameron, R A; Rowen, L; Nesbitt, R; Bloom, S; Rast, J P; Berney, K; Arenas-Mena, C; Martinez, P; Lucas, S; Richardson, P M; Davidson, E H; Peterson, K J; Hood, L

    2005-10-11

    The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3 gene is Hox5. (The gene order is : 5-Hox1, 2, 3, 11/13c, 11/13b, 11/13a, 9/10, 8, 7, 6, 5 - 3). The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.

  6. Unusual Gene Order and Organization of the Sea Urchin HoxCluster

    Energy Technology Data Exchange (ETDEWEB)

    Richardson, Paul M.; Lucas, Susan; Cameron, R. Andrew; Rowen,Lee; Nesbitt, Ryan; Bloom, Scott; Rast, Jonathan P.; Berney, Kevin; Arenas-Mena, Cesar; Martinez, Pedro; Davidson, Eric H.; Peterson, KevinJ.; Hood, Leroy

    2005-05-10

    The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3' gene is Hox5. (The gene order is : 5'-Hox1,2, 3, 11/13c, 11/13b, '11/13a, 9/10, 8, 7, 6, 5 - 3)'. The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.

  7. Effect of higher order non-linearity in frequency variation of self-phase modulation in optical fiber communication

    Institute of Scientific and Technical Information of China (English)

    Abhijit Sinha; Sourangshu Mukhopadhyay

    2004-01-01

    In optical soliton propagation through a single mode optical fiber,it is established that self-phase mod ulation is maintained by the third order non-linearity of the silica-based glass material of the fiber.In this paper we show that the fifth order non-linearity has also some contribution in frequency variation of self-phase modulation.

  8. Mosaics of gene variations in the Interleukin-10 gene promoter affect interleukin-10 production depending on the stimulation used.

    NARCIS (Netherlands)

    Mormann, M.; Rieth, H.; Hua, T.D.; Assohou-Luty, C.A.; Roupelieva, M.; Hu, S.L.; Kremsner, P.G.; Luty, J.F.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10), a cytokine involved in many aspects of the immune response shows interindividual variations in their expression. However, genetic variations of the 5'-flanking region of the IL-10 gene (PIL-10) are poorly characterised with respect to different stimuli. New extended haplo-

  9. Mosaics of gene variations in the Interleukin-10 gene promoter affect interleukin-10 production depending on the stimulation used.

    NARCIS (Netherlands)

    Mormann, M.; Rieth, H.; Hua, T.D.; Assohou-Luty, C.A.; Roupelieva, M.; Hu, S.L.; Kremsner, P.G.; Luty, J.F.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10), a cytokine involved in many aspects of the immune response shows interindividual variations in their expression. However, genetic variations of the 5'-flanking region of the IL-10 gene (PIL-10) are poorly characterised with respect to different stimuli. New extended haplo- an

  10. Natural variation in abiotic stress responsive gene expression and local adaptation to climate in Arabidopsis thaliana.

    Science.gov (United States)

    Lasky, Jesse R; Des Marais, David L; Lowry, David B; Povolotskaya, Inna; McKay, John K; Richards, James H; Keitt, Timothy H; Juenger, Thomas E

    2014-09-01

    Gene expression varies widely in natural populations, yet the proximate and ultimate causes of this variation are poorly known. Understanding how variation in gene expression affects abiotic stress tolerance, fitness, and adaptation is central to the field of evolutionary genetics. We tested the hypothesis that genes with natural genetic variation in their expression responses to abiotic stress are likely to be involved in local adaptation to climate in Arabidopsis thaliana. Specifically, we compared genes with consistent expression responses to environmental stress (expression stress responsive, "eSR") to genes with genetically variable responses to abiotic stress (expression genotype-by-environment interaction, "eGEI"). We found that on average genes that exhibited eGEI in response to drought or cold had greater polymorphism in promoter regions and stronger associations with climate than those of eSR genes or genomic controls. We also found that transcription factor binding sites known to respond to environmental stressors, especially abscisic acid responsive elements, showed significantly higher polymorphism in drought eGEI genes in comparison to eSR genes. By contrast, eSR genes tended to exhibit relatively greater pairwise haplotype sharing, lower promoter diversity, and fewer nonsynonymous polymorphisms, suggesting purifying selection or selective sweeps. Our results indicate that cis-regulatory evolution and genetic variation in stress responsive gene expression may be important mechanisms of local adaptation to climatic selective gradients.

  11. Genetic variation in a member of the laminin gene family affects variation in body composition in Drosophila and humans

    Directory of Open Access Journals (Sweden)

    Hunter Gary R

    2008-08-01

    Full Text Available Abstract Background The objective of the present study was to map candidate loci influencing naturally occurring variation in triacylglycerol (TAG storage using quantitative complementation procedures in Drosophila melanogaster. Based on our results from Drosophila, we performed a human population-based association study to investigate the effect of natural variation in LAMA5 gene on body composition in humans. Results We identified four candidate genes that contributed to differences in TAG storage between two strains of D. melanogaster, including Laminin A (LanA, which is a member of the α subfamily of laminin chains. We confirmed the effects of this gene using a viable LanA mutant and showed that female flies homozygous for the mutation had significantly lower TAG storage, body weight, and total protein content than control flies. Drosophila LanA is closely related to human LAMA5 gene, which maps to the well-replicated obesity-linkage region on chromosome 20q13.2-q13.3. We tested for association between three common single nucleotide polymorphisms (SNPs in the human LAMA5 gene and variation in body composition and lipid profile traits in a cohort of unrelated women of European American (EA and African American (AA descent. In both ethnic groups, we found that SNP rs659822 was associated with weight (EA: P = 0.008; AA: P = 0.05 and lean mass (EA: P= 0.003; AA: P = 0.03. We also found this SNP to be associated with height (P = 0.01, total fat mass (P = 0.01, and HDL-cholesterol (P = 0.003 but only in EA women. Finally, significant associations of SNP rs944895 with serum TAG levels (P = 0.02 and HDL-cholesterol (P = 0.03 were observed in AA women. Conclusion Our results suggest an evolutionarily conserved role of a member of the laminin gene family in contributing to variation in weight and body composition.

  12. Theoretical studies of gene substitution, geographic variation, and speciation

    Energy Technology Data Exchange (ETDEWEB)

    Felsenstein, J.

    1977-07-31

    Brief comments are given on the results of a research program dealing with population genetics of evolutionary processes. The various subjects studied included genetic variation in clines; speciation and disruptive selection; parapatric speciation in clines; macroevolutionary laws in a model ecosystem; migration matrices; lethal allelism; estimation of number of loci in quantitative inheritance; numerical taxonomy methods; and new mutants in Lesch-Nyhan disease.

  13. A bi-ordering approach to linking gene expression with clinical annotations in gastric cancer

    Directory of Open Access Journals (Sweden)

    Leckie Christopher

    2010-09-01

    Full Text Available Abstract Background In the study of cancer genomics, gene expression microarrays, which measure thousands of genes in a single assay, provide abundant information for the investigation of interesting genes or biological pathways. However, in order to analyze the large number of noisy measurements in microarrays, effective and efficient bioinformatics techniques are needed to identify the associations between genes and relevant phenotypes. Moreover, systematic tests are needed to validate the statistical and biological significance of those discoveries. Results In this paper, we develop a robust and efficient method for exploratory analysis of microarray data, which produces a number of different orderings (rankings of both genes and samples (reflecting correlation among those genes and samples. The core algorithm is closely related to biclustering, and so we first compare its performance with several existing biclustering algorithms on two real datasets - gastric cancer and lymphoma datasets. We then show on the gastric cancer data that the sample orderings generated by our method are highly statistically significant with respect to the histological classification of samples by using the Jonckheere trend test, while the gene modules are biologically significant with respect to biological processes (from the Gene Ontology. In particular, some of the gene modules associated with biclusters are closely linked to gastric cancer tumorigenesis reported in previous literature, while others are potentially novel discoveries. Conclusion In conclusion, we have developed an effective and efficient method, Bi-Ordering Analysis, to detect informative patterns in gene expression microarrays by ranking genes and samples. In addition, a number of evaluation metrics were applied to assess both the statistical and biological significance of the resulting bi-orderings. The methodology was validated on gastric cancer and lymphoma datasets.

  14. A bi-ordering approach to linking gene expression with clinical annotations in gastric cancer.

    Science.gov (United States)

    Shi, Fan; Leckie, Christopher; MacIntyre, Geoff; Haviv, Izhak; Boussioutas, Alex; Kowalczyk, Adam

    2010-09-23

    In the study of cancer genomics, gene expression microarrays, which measure thousands of genes in a single assay, provide abundant information for the investigation of interesting genes or biological pathways. However, in order to analyze the large number of noisy measurements in microarrays, effective and efficient bioinformatics techniques are needed to identify the associations between genes and relevant phenotypes. Moreover, systematic tests are needed to validate the statistical and biological significance of those discoveries. In this paper, we develop a robust and efficient method for exploratory analysis of microarray data, which produces a number of different orderings (rankings) of both genes and samples (reflecting correlation among those genes and samples). The core algorithm is closely related to biclustering, and so we first compare its performance with several existing biclustering algorithms on two real datasets - gastric cancer and lymphoma datasets. We then show on the gastric cancer data that the sample orderings generated by our method are highly statistically significant with respect to the histological classification of samples by using the Jonckheere trend test, while the gene modules are biologically significant with respect to biological processes (from the Gene Ontology). In particular, some of the gene modules associated with biclusters are closely linked to gastric cancer tumorigenesis reported in previous literature, while others are potentially novel discoveries. In conclusion, we have developed an effective and efficient method, Bi-Ordering Analysis, to detect informative patterns in gene expression microarrays by ranking genes and samples. In addition, a number of evaluation metrics were applied to assess both the statistical and biological significance of the resulting bi-orderings. The methodology was validated on gastric cancer and lymphoma datasets.

  15. Pangenome Analysis of Burkholderia pseudomallei: Genome Evolution Preserves Gene Order despite High Recombination Rates.

    Directory of Open Access Journals (Sweden)

    Senanu M Spring-Pearson

    Full Text Available The pangenomic diversity in Burkholderia pseudomallei is high, with approximately 5.8% of the genome consisting of genomic islands. Genomic islands are known hotspots for recombination driven primarily by site-specific recombination associated with tRNAs. However, recombination rates in other portions of the genome are also high, a feature we expected to disrupt gene order. We analyzed the pangenome of 37 isolates of B. pseudomallei and demonstrate that the pangenome is 'open', with approximately 136 new genes identified with each new genome sequenced, and that the global core genome consists of 4568±16 homologs. Genes associated with metabolism were statistically overrepresented in the core genome, and genes associated with mobile elements, disease, and motility were primarily associated with accessory portions of the pangenome. The frequency distribution of genes present in between 1 and 37 of the genomes analyzed matches well with a model of genome evolution in which 96% of the genome has very low recombination rates but 4% of the genome recombines readily. Using homologous genes among pairs of genomes, we found that gene order was highly conserved among strains, despite the high recombination rates previously observed. High rates of gene transfer and recombination are incompatible with retaining gene order unless these processes are either highly localized to specific sites within the genome, or are characterized by symmetrical gene gain and loss. Our results demonstrate that both processes occur: localized recombination introduces many new genes at relatively few sites, and recombination throughout the genome generates the novel multi-locus sequence types previously observed while preserving gene order.

  16. Pangenome Analysis of Burkholderia pseudomallei: Genome Evolution Preserves Gene Order despite High Recombination Rates.

    Science.gov (United States)

    Spring-Pearson, Senanu M; Stone, Joshua K; Doyle, Adina; Allender, Christopher J; Okinaka, Richard T; Mayo, Mark; Broomall, Stacey M; Hill, Jessica M; Karavis, Mark A; Hubbard, Kyle S; Insalaco, Joseph M; McNew, Lauren A; Rosenzweig, C Nicole; Gibbons, Henry S; Currie, Bart J; Wagner, David M; Keim, Paul; Tuanyok, Apichai

    2015-01-01

    The pangenomic diversity in Burkholderia pseudomallei is high, with approximately 5.8% of the genome consisting of genomic islands. Genomic islands are known hotspots for recombination driven primarily by site-specific recombination associated with tRNAs. However, recombination rates in other portions of the genome are also high, a feature we expected to disrupt gene order. We analyzed the pangenome of 37 isolates of B. pseudomallei and demonstrate that the pangenome is 'open', with approximately 136 new genes identified with each new genome sequenced, and that the global core genome consists of 4568±16 homologs. Genes associated with metabolism were statistically overrepresented in the core genome, and genes associated with mobile elements, disease, and motility were primarily associated with accessory portions of the pangenome. The frequency distribution of genes present in between 1 and 37 of the genomes analyzed matches well with a model of genome evolution in which 96% of the genome has very low recombination rates but 4% of the genome recombines readily. Using homologous genes among pairs of genomes, we found that gene order was highly conserved among strains, despite the high recombination rates previously observed. High rates of gene transfer and recombination are incompatible with retaining gene order unless these processes are either highly localized to specific sites within the genome, or are characterized by symmetrical gene gain and loss. Our results demonstrate that both processes occur: localized recombination introduces many new genes at relatively few sites, and recombination throughout the genome generates the novel multi-locus sequence types previously observed while preserving gene order.

  17. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    Science.gov (United States)

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  18. The Effect of Genetic and Environmental Variation on Metabolic Gene Expression

    OpenAIRE

    Cinda P Scott; Williams, Dean A; Crawford, Douglas L.

    2009-01-01

    What is the relationship between genetic or environmental variation and the variation in mRNA expression? To address this, microarrays were used to examine the effect of genetic and environmental variation on cardiac mRNA expression for metabolic genes in three groups of Fundulus heteroclitus: (1) individuals sampled in the field (field), (2) field individuals acclimated for six months to laboratory conditions (acclimated) or (3) individuals bred for ten successive generations in a laboratory...

  19. Looking on the bright side of serotonin transporter gene variation.

    NARCIS (Netherlands)

    Homberg, J.R.; Lesch, K.P.

    2011-01-01

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for

  20. Integrated analyses of copy number variations and gene expression in lung adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Tzu-Pin Lu

    Full Text Available Numerous efforts have been made to elucidate the etiology and improve the treatment of lung cancer, but the overall five-year survival rate is still only 15%. Identification of prognostic biomarkers for lung cancer using gene expression microarrays poses a major challenge in that very few overlapping genes have been reported among different studies. To address this issue, we have performed concurrent genome-wide analyses of copy number variation and gene expression to identify genes reproducibly associated with tumorigenesis and survival in non-smoking female lung adenocarcinoma. The genomic landscape of frequent copy number variable regions (CNVRs in at least 30% of samples was revealed, and their aberration patterns were highly similar to several studies reported previously. Further statistical analysis for genes located in the CNVRs identified 475 genes differentially expressed between tumor and normal tissues (p<10(-5. We demonstrated the reproducibility of these genes in another lung cancer study (p = 0.0034, Fisher's exact test, and showed the concordance between copy number variations and gene expression changes by elevated Pearson correlation coefficients. Pathway analysis revealed two major dysregulated functions in lung tumorigenesis: survival regulation via AKT signaling and cytoskeleton reorganization. Further validation of these enriched pathways using three independent cohorts demonstrated effective prediction of survival. In conclusion, by integrating gene expression profiles and copy number variations, we identified genes/pathways that may serve as prognostic biomarkers for lung tumorigenesis.

  1. Common variation in fatty acid metabolic genes and risk of incident sudden cardiac arrest

    NARCIS (Netherlands)

    R.N. Lemaitre (Rozenn ); C.O. Johnson (Catherine); S. Hesselson (Stephanie); N. Sotoodhenia (Nona); B. McKnight (Barbara); C.M. Sitlani (Colleen); D. Rea (Dan); I.B. King (Irena); P.-Y. Kwok (Pui-Yan); A. Mak (Angel); G. Li (Guo); J. Brody (Jennifer); E.B. Larson (Eric); D. Mozaffarian (Dariush); B.M. Psaty (Bruce); A. Huertas-Vazquez (Adriana); J.-C. Tardif (Jean-Claude); C.M. Albert (Christine); L.-P. Lyytikäinen (Leo-Pekka); D.E. Arking (Dan); S. Kääb (Stefan); H.V. Huikuri (Heikki); B.P. Krijthe (Bouwe); M. Eijgelsheim (Mark); Y.A. Wang (Ying); K. Reinier (Kyndaron); T. Lehtimäki (Terho); S.L. Pulit (Sara); R. Brugada (Ramon); M. Müller-Nurasyid (Martina); C. Newton-Cheh (Christopher); P.J. Karhunen (Pekka); B.H.Ch. Stricker (Bruno); P. Goyette (Philippe); J.I. Rotter (Jerome); S.S. Chugh (Sumeet); A. Chakravarti (Aravinda); X. Jouven (Xavier); D.S. Siscovick (David)

    2014-01-01

    textabstractBackground There is limited information on genetic factors associated with sudden cardiac arrest (SCA). Objective To assess the association of common variation in genes in fatty acid pathways with SCA risk. Methods We selected 85 candidate genes and 1155 single nucleotide polymorphisms (

  2. Unraveling the regulatory mechanisms underlying tissue-dependent genetic variation of gene expression

    NARCIS (Netherlands)

    Fu, Jingyuan; Wolfs, Marcel G M; Deelen, Patrick; Westra, Harm Jan; Fehrmann, Rudolf S N; te Meerman, Gerhardus; Buurman, Wim A; Rensen, Sander S M; Groen, Hendricus; Weersma, Rinse K; van den Berg, Leonard H; Veldink, Jan; Ophoff, Roel A; Snieder, Harold; van Heel, David; Jansen, Ritsert C; Hofker, Marten H; Wijmenga, Cisca; Franke, Lude

    2012-01-01

    It is known that genetic variants can affect gene expression, but it is not yet completely clear through what mechanisms genetic variation mediate this expression. We therefore compared the cis-effect of single nucleotide polymorphisms (SNPs) on gene expression between blood samples from 1,240 human

  3. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    DEFF Research Database (Denmark)

    Purrington, Kristen S; Slettedahl, Seth; Bolla, Manjeet K

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymor...

  4. Population transcriptomics uncovers the regulation of gene expression variation in adaptation to changing environment

    Science.gov (United States)

    Xu, Qin; Zhu, Caiyun; Fan, Yangyang; Song, Zhihong; Xing, Shilai; Liu, Wei; Yan, Juan; Sang, Tao

    2016-01-01

    Expression variation plays an important role in plant adaptation, but little is known about the factors impacting the expression variation when population adapts to changing environment. We used RNA-seq data from 80 individuals in 14 Miscanthus lutarioriparius populations, which were transplanted into a harsh environment from native habitat, to investigate the expression level, expression diversity and genetic diversity for genes expressed in both environments. The expression level of genes with lower expression level or without SNP tended to be more changeable in new environment, which suggested highly expressed genes experienced stronger purifying selection than those at lower level. Low proportion of genes with population effect confirmed the weak population structure and frequent gene flow in these populations. Meanwhile, the number of genes with environment effect was the most frequent compared with that with population effect. Our results showed that environment and genetic diversity were the main factors determining gene expression variation in population. This study could facilitate understanding the mechanisms of global gene expression variation when plant population adapts to changing environment. PMID:27150248

  5. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    Disruption in circadian gene expression, whether due to genetic variation or environmental factors (e.g., light at night, shiftwork), is associated with increased incidence of breast, prostate, gastrointestinal and hematologic cancers and gliomas. Circadian genes are highly expressed in the ovari...

  6. Natural variation of rice blast resistance gene Pi-d2

    Science.gov (United States)

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  7. NMDA receptor gene variations as modifiers in Huntington disease : a replication study

    NARCIS (Netherlands)

    Saft, Carsten; Epplen, Jörg T; Wieczorek, Stefan; Landwehrmeyer, G Bernhard; Roos, Raymund A C; de Yebenes, Justo Garcia; Dose, Matthias; Tabrizi, Sarah J; Craufurd, David; Arning, Larissa; Kremer, Berry

    2011-01-01

    Several candidate modifier genes which, in addition to the pathogenic CAG repeat expansion, influence the age at onset (AO) in Huntington disease (HD) have already been described. The aim of this study was to replicate association of variations in the N-methyl D-aspartate receptor subtype genes GRIN

  8. Drd4 gene polymorphisms are associated with personality variation in a passerine bird

    NARCIS (Netherlands)

    Fidler, A.E.; Van Oers, K.; Drent, P.J.; Kuhn, S.; Mueller, J.C.; Kempenaers, B.

    2007-01-01

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, gen

  9. Variation in the nucleotide sequence of a prolamin gene family in wild rice.

    Science.gov (United States)

    Barbier, P; Ishihama, A

    1990-07-01

    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  10. Drd4 gene polymorphisms are associated with personality variation in a passerine bird

    NARCIS (Netherlands)

    Fidler, A.E.; Van Oers, K.; Drent, P.J.; Kuhn, S.; Mueller, J.C.; Kempenaers, B.

    2007-01-01

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, gen

  11. Variability and Variation in Second Language Acquisition Orders : A Dynamic Reevaluation

    NARCIS (Netherlands)

    Lowie, Wander; Verspoor, Marjolijn

    2015-01-01

    The traditional morpheme order studies in second language acquisition have tried to demonstrate the existence of a fixed order of acquisition of English morphemes, regardless of the second language learner's background. Such orders have been taken as evidence of the preprogrammed nature of language

  12. Variability and Variation in Second Language Acquisition Orders: A Dynamic Reevaluation

    Science.gov (United States)

    Lowie, Wander; Verspoor, Marjolijn

    2015-01-01

    The traditional morpheme order studies in second language acquisition have tried to demonstrate the existence of a fixed order of acquisition of English morphemes, regardless of the second language learner's background. Such orders have been taken as evidence of the preprogrammed nature of language acquisition. This article argues for a…

  13. Application of He’s Variational Iteration Method to Nonlinear Helmholtz Equation and Fifth-Order KDV Equation

    DEFF Research Database (Denmark)

    Miansari, Mo; Miansari, Me; Barari, Amin

    2009-01-01

    In this article, He’s variational iteration method (VIM), is implemented to solve the linear Helmholtz partial differential equation and some nonlinear fifth-order Korteweg-de Vries (FKdV) partial differential equations with specified initial conditions. The initial approximations can be freely...... and nonlinear problems. It is predicted that VIM can be widely applied in engineering....

  14. CALCULUS OF VARIATIONS WITH DIRICHLET BOUNDARY VALUE PROBLEM FOR PERTURBED SECOND-ORDER DIFFERENTIAL EQUATIONS ON A HALF-LINE

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Dirichlet boundary value problems for perturbed second-order differential equations on a half line are investigated in this paper. The methods mainly depend on the calculus of variations to the classical functionals. Sufficient conditions are obtained for the existence of the solutions.

  15. A HIGH ORDER SOLUTION OF THREE DIMENSIONAL TIME DEPENDENT NONLINEAR CONVECTIVE-DIFFUSIVE PROBLEM USING MODIFIED VARIATIONAL ITERATION METHOD

    Directory of Open Access Journals (Sweden)

    Pratibha Joshi

    2014-12-01

    Full Text Available In this paper, we have achieved high order solution of a three dimensional nonlinear diffusive-convective problem using modified variational iteration method. The efficiency of this approach has been shown by solving two examples. All computational work has been performed in MATHEMATICA.

  16. NUCLEOTIDE SEQUENCE VARIATION IN LEPTIN GENE OF MURRAH BUFFALO (BUBALUS BUBALIS

    Directory of Open Access Journals (Sweden)

    Sanjoy Datta

    2012-12-01

    Full Text Available Leptin is a 16 kD protein, synthesized by adipose tissue and is involved in regulation of feed intake, energy balance, fertility and immune functions. Present study was undertaken with the objectives of sequence characterization and studying the nucleotide variation in leptin gene in Murrah buffalo. The leptin gene consists of three exons and two introns which spans about 18.9kb, of which the first exon is not transcribed into protein. In buffaloes, the leptin gene is located on chromosome eight and maps to BBU 8q32. The leptin gene was amplified by PCR using oligonucleotide primers to obtain 289 bp fragment comprising of exon 2 and 405 bp fragment containing exon 3 of leptin gene. The amplicons were sequenced to identify variation at nucleotide level. Sequence comparison of buffalo with cattle reveals variation at five nucleotide sequences at positions 983, 1083, 1147, 1152, 1221 and all the SNPs are synonymous resulting no in change in amino acids. Three of these eight nucleotide variations have been reported for the first time in buffalo. The results indicate conservation of DNA sequence between cattle and buffalo. Nucleotide sequence variations observed at leptin gene between Bubalus bubalis and Bos taurus species revealed 97% nucleotide identity.

  17. Duality for Multitime Multiobjective Ratio Variational Problems on First Order Jet Bundle

    Directory of Open Access Journals (Sweden)

    Mihai Postolache

    2012-01-01

    Full Text Available We consider a new class of multitime multiobjective variational problems of minimizing a vector of quotients of functionals of curvilinear integral type. Based on the efficiency conditions for multitime multiobjective ratio variational problems, we introduce a ratio dual of generalized Mond-Weir-Zalmai type, and under some assumptions of generalized convexity, duality theorems are stated. We prove our weak duality theorem for efficient solutions, showing that the value of the objective function of the primal cannot exceed the value of the dual. Direct and converse duality theorems are stated, underlying the connections between the values of the objective functions of the primal and dual programs. As special cases, duality results of Mond-Weir-Zalmai type for a multitime multiobjective variational problem are obtained. This work further develops our studies in (Pitea and Postolache (2011.

  18. The Max-Min High-Order Dynamic Bayesian Network for Learning Gene Regulatory Networks with Time-Delayed Regulations.

    Science.gov (United States)

    Li, Yifeng; Chen, Haifen; Zheng, Jie; Ngom, Alioune

    2016-01-01

    Accurately reconstructing gene regulatory network (GRN) from gene expression data is a challenging task in systems biology. Although some progresses have been made, the performance of GRN reconstruction still has much room for improvement. Because many regulatory events are asynchronous, learning gene interactions with multiple time delays is an effective way to improve the accuracy of GRN reconstruction. Here, we propose a new approach, called Max-Min high-order dynamic Bayesian network (MMHO-DBN) by extending the Max-Min hill-climbing Bayesian network technique originally devised for learning a Bayesian network's structure from static data. Our MMHO-DBN can explicitly model the time lags between regulators and targets in an efficient manner. It first uses constraint-based ideas to limit the space of potential structures, and then applies search-and-score ideas to search for an optimal HO-DBN structure. The performance of MMHO-DBN to GRN reconstruction was evaluated using both synthetic and real gene expression time-series data. Results show that MMHO-DBN is more accurate than current time-delayed GRN learning methods, and has an intermediate computing performance. Furthermore, it is able to learn long time-delayed relationships between genes. We applied sensitivity analysis on our model to study the performance variation along different parameter settings. The result provides hints on the setting of parameters of MMHO-DBN.

  19. Associations between Variation in X Chromosome Male Reproductive Genes and Sperm Competitive Ability in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Leah Greenspan

    2011-01-01

    Full Text Available Variation in reproductive success has long been thought to be mediated in part by genes encoding seminal proteins. Here we explore the effect on male reproductive phenotypes of X-linked polymorphisms, a chromosome that is depauperate in genes encoding seminal proteins. Using 57 X chromosome substitution lines, sperm competition was tested both when the males from the wild-extracted line were the first to mate (“defense” crosses, followed by a tester male, and when extracted-line males were the second to mate, after a tester male (“offfense” crosses. We scored the proportion of progeny sired by each male, the fecundity, the remating rate and refractoriness to remating, and tested the significance of variation among lines. Eleven candidate genes were chosen based on previous studies, and portions of these genes were sequenced in all 57 lines. A total of 131 polymorphisms were tested for associations with the reproductive phenotypes using linear models. Nine polymorphisms in 4 genes were found to show significant associations (at a 5% FDR. Overall, it appears that the X chromosomes harbor abundant variation in sperm competition, especially considering the paucity of seminal protein genes. This suggests that much of the male reproductive variation lies outside of genes that encode seminal proteins.

  20. Divergent selection for opsin gene variation in guppy (Poecilia reticulata) populations of Trinidad and Tobago.

    Science.gov (United States)

    Tezuka, A; Kasagi, S; van Oosterhout, C; McMullan, M; Iwasaki, W M; Kasai, D; Yamamichi, M; Innan, H; Kawamura, S; Kawata, M

    2014-11-01

    The guppy is known to exhibit remarkable interindividual variations in spectral sensitivity of middle to long wavelength-sensitive (M/LWS) cone photoreceptor cells. The guppy has four M/LWS-type opsin genes (LWS-1, LWS-2, LWS-3 and LWS-4) that are considered to be responsible for this sensory variation. However, the allelic variation of the opsin genes, particularly in terms of their absorption spectrum, has not been explored in wild populations. Thus, we examined nucleotide variations in the four M/LWS opsin genes as well as blue-sensitive SWS2-B and ultraviolet-sensitive SWS1 opsin genes for comparison and seven non-opsin nuclear loci as reference genes in 10 guppy populations from various light environments in Trinidad and Tobago. For the first time, we discovered a potential spectral variation (180 Ser/Ala) in LWS-1 that differed at an amino acid site known to affect the absorption spectra of opsins. Based on a coalescent simulation of the nucleotide variation of the reference genes, we showed that the interpopulation genetic differentiation of two opsin genes was significantly larger than the neutral expectation. Furthermore, this genetic differentiation was significantly related to differences in dissolved oxygen (DO) level, and it was not explained by the spatial distance between populations. The DO levels are correlated with eutrophication that possibly affects the color of aquatic environments. These results suggest that the population diversity of opsin genes is significantly driven by natural selection and that the guppy could adapt to various light environments through color vision changes.

  1. State derivative feedback in second-order linear systems: A comparative analysis of perturbed eigenvalues under coefficient variation

    Science.gov (United States)

    Araújo, José M.; Dórea, Carlos E. T.; Gonçalves, Luiz M. G.; Datta, Biswa N.

    2016-08-01

    This paper presents a comparative study of sensitivity to parameter variation in two feedback techniques applied in second-order linear systems: state feedback technique and the less conventional state derivative feedback technique. The former uses information on displacements and velocities whereas the latter uses velocities and accelerations. Several contributions on the problem of partial or full eigenvalue/eigenstructure assignment using the state feedback technique are presented in the literature. Recently, some interesting possibilities, such as solving the regularization problem in singular mass second-order systems, are approached using state derivative feedback. In this work, a general equivalence between state feedback and state derivative feedback is first established. Then, figures of merit on the resulting perturbed spectrum are proposed in order to assess the sensitivity of the closed-loop system to variations on the system matrices. Numerical examples are presented to support the obtained results.

  2. Genome-wide Gene Order Distances Support Clustering The Gram-Positive Bacteria

    Directory of Open Access Journals (Sweden)

    Christopher H House

    2015-01-01

    Full Text Available Initially using 143 genomes, we developed a method for calculating the pair-wise distance between prokaryotic genomes using a Monte Carlo method to estimate the conservation of gene order. The method was based on repeatedly selecting five or six non-adjacent random orthologs from each of two genomes and determining if the chosen orthologs were in the same order. The raw distances were then corrected for gene order convergence using an adaptation of the Jukes-Cantor model, as well as using the common distance correction D’ = -ln(1-D. First, we compared the distances found via the order of six orthologs to distances found based on ortholog gene content and small subunit rRNA sequences. The Jukes-Cantor gene order distances are reasonably well correlated with the divergence of rRNA (R2 = 0.24, especially at rRNA Jukes-Cantor distances of less than 0.2 (R2 = 0.52. Gene content is only weakly correlated with rRNA divergence (R2 = 0.04 over all distances, however, it is especially strongly correlated at rRNA Jukes-Cantor distances of less than 0.1 (R2 = 0.67. This initial work suggests that gene order may be useful in conjunction with other methods to help understand the relatedness of genomes. Using the gene order distances in 143 genomes, the relations of prokaryotes were studied using neighbor joining and agreement subtrees. We then repeated our study of the relations of prokaryotes using gene order in 172 complete genomes better representing a wider-diversity of prokaryotes. Consistently, our trees show the Actinobacteria as a sister group to the bulk of the Firmicutes. In fact, the robustness of gene order support was found to be considerably greater for uniting these two phyla than for uniting any of the proteobacterial classes together. The results are supportive of the idea that Actinobacteria and Firmicutes are closely related, which in turn implies a single origin for the gram-positive cell.

  3. A new approach to quantify the adaptive potential of gene expression variation in gymnosperms.

    Science.gov (United States)

    Renaut, Sébastien

    2013-05-01

    Variation in patterns of gene expression contributes to phenotypic diversity and can ultimately predict adaptive responses. However, in many cases, the consequences of regulatory mutations on patterns of gene expression and ultimately phenotypic differences remain elusive. A standard way to study the genetic architecture of expression variation in model systems has been to map gene expression variation to genetic loci (Fig. 1a). At the same time, in many nonmodel species, especially for long-lived organisms, controlled crosses are not feasible. If we are to expand our understanding of the role of regulatory mutations on phenotypes, we need to develop new methodologies to study species under ecologically relevant conditions. In this issue of Molecular Ecology, Verta et al. (2013) present a new approach to analyse gene expression variation and regulatory networks in gymnosperms (Fig. 1b). They capitalized on the fact that gymnosperm seeds contain an energy storage tissue (the megagametophyte) that is directly derived from a single haploid cell (the megaspore). The authors identified over 800 genes for which expression segregated in this maternally inherited haploid tissue. Based on the observed segregation patterns, these genes (Mendelian Expression Traits) are most probably controlled by biallelic variants at a single locus. Most of these genes also belonged to different regulatory networks, except for one large group of 180 genes under the control of a putative trans-acting factor. In addition, the approach developed here may also help to uncover the effect of rare recessive mutations, which usually remain hidden in a heterozygous state in diploid individuals. The appeal of the work by Verta et al. (2013) to study gene expression variation is in its simplicity, which circumvents several of the hurdles behind traditional expression quantitative trait locus (eQTL) studies, and could potentially be applied to a large number of species.

  4. Allelic variation in the NPY gene in 14 Indian populations.

    Science.gov (United States)

    Bhaskar, L V K S; Thangaraj, K; Shah, Anish M; Pardhasaradhi, G; Praveen Kumar, K; Reddy, A G; Papa Rao, A; Mulligan, C J; Singh, Lalji; Rao, V R

    2007-01-01

    NPY is a 36-aminoacid peptide expressed in several areas of the nervous system. Neuropeptide Y (NPY) receptors represent a widely diffused system that is involved in the regulation of multiple biological functions. The human NPY gene is located in chromosome 7. The functional significance of coding Leu7Pro polymorphism in the signal peptide of preproNPY is known. Six hundred and fifty four individuals of 14 ethnic Indian populations were screened for three mutations in the NPY gene, including Leu7Pro. We found that the Pro7 frequencies among the studied populations were much higher than in previous studies from other parts of the world. The highest allele frequency of Pro7 was detected in the Kota population in the Nilgiri Hill region of south India, and this may reflect a founder event in the past or genetic drift. All populations followed the Hardy-Weinberg equilibrium for the assayed markers. A total of five haplotypes were observed, only two of which were found to occur with a high frequency in all populations. No linkage disequilibrium (LD) was observed across the tested alleles in any population with the exception of Leu7Pro and Ser50Ser in the Badaga population (chi(2) = 13.969; p = 0.0001).

  5. Application of the cluster variation method to ordering in an interstitital solid solution

    DEFF Research Database (Denmark)

    Pekelharing, Marjon I.; Böttger, Amarante; Somers, Marcel A. J.

    1999-01-01

    atoms in the interstitial octahedral sites. The gamma-Fe[N]/gamma'-Fe4N1-x miscibility gap, short range ordering (SRO), and long-range ordering (LRO) of nitrogen in gamma-Fe[N] and gamma'-Fe4N1-x, respectively, and lattice parameters of gamma and gamm' were calculated. For the first time, N distribution...

  6. Ordering Reaction and Its Effect on Microstructure Variation in 316L Stainless Steel

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Soo; Kim, Young Suk [KAERI, Daejeon (Korea, Republic of)

    2016-05-15

    The short range ordering (SRO) reaction in 316 stainless steel has been investigated by a resistivity change at 400-500 .deg. C. It is reported that the SRO reaction occurs in a Ni-Cr-Fe (Ni-base alloys) and FeCr-Ni (stainless steel) alloys. This is important since the SRO reaction is an avoidable process during reaction environment. It is reported that the SRO reaction causes a lattice contraction [2] and a dimensional change of structure, and produces an additional stress, and provides a driving force for a primary water stress corrosion cracking (PWSCC) in Alloy 600 [4, 5]. In this study, the ordering reaction in 316L is systematically studied by a differential scanning calorimeter (DSC), and the activation energy for the ordering reaction is determined, and the effect of ordering treatment at 475 .deg. C on microstructure is investigated. 1. The ordering reaction in WQ 316L occurs at 450-550 .deg., this seems to be formation of sigma phase (FeCr). 2. The activation energy for the ordering reaction in WQ 316L is Q = 234 kJ/mol (2.42 eV/atom). 3. The cold work lowers the ordering temperature from 450-550 .deg. C to 200-600 .deg. C region, this is due to the driving force for the ordering reaction accumulated during cold rolling.

  7. Couple of the Variational Iteration Method and Fractional-Order Legendre Functions Method for Fractional Differential Equations

    Science.gov (United States)

    Song, Junqiang; Leng, Hongze; Lu, Fengshun

    2014-01-01

    We present a new numerical method to get the approximate solutions of fractional differential equations. A new operational matrix of integration for fractional-order Legendre functions (FLFs) is first derived. Then a modified variational iteration formula which can avoid “noise terms” is constructed. Finally a numerical method based on variational iteration method (VIM) and FLFs is developed for fractional differential equations (FDEs). Block-pulse functions (BPFs) are used to calculate the FLFs coefficient matrices of the nonlinear terms. Five examples are discussed to demonstrate the validity and applicability of the technique. PMID:24511303

  8. Natural Genetic Variation and Candidate Genes for Morphological Traits in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Valeria Paula Carreira

    Full Text Available Body size is a complex character associated to several fitness related traits that vary within and between species as a consequence of environmental and genetic factors. Latitudinal and altitudinal clines for different morphological traits have been described in several species of Drosophila and previous work identified genomic regions associated with such variation in D. melanogaster. However, the genetic factors that orchestrate morphological variation have been barely studied. Here, our main objective was to investigate genetic variation for different morphological traits associated to the second chromosome in natural populations of D. melanogaster along latitudinal and altitudinal gradients in Argentina. Our results revealed weak clinal signals and a strong population effect on morphological variation. Moreover, most pairwise comparisons between populations were significant. Our study also showed important within-population genetic variation, which must be associated to the second chromosome, as the lines are otherwise genetically identical. Next, we examined the contribution of different candidate genes to natural variation for these traits. We performed quantitative complementation tests using a battery of lines bearing mutated alleles at candidate genes located in the second chromosome and six second chromosome substitution lines derived from natural populations which exhibited divergent phenotypes. Results of complementation tests revealed that natural variation at all candidate genes studied, invected, Fasciclin 3, toucan, Reticulon-like1, jing and CG14478, affects the studied characters, suggesting that they are Quantitative Trait Genes for morphological traits. Finally, the phenotypic patterns observed suggest that different alleles of each gene might contribute to natural variation for morphological traits. However, non-additive effects cannot be ruled out, as wild-derived strains differ at myriads of second chromosome loci that may

  9. Gene co-expression network analysis identifies porcine genes associated with variation in metabolizing fenbendazole and flunixin meglumine in the liver.

    Science.gov (United States)

    Howard, Jeremy T; Ashwell, Melissa S; Baynes, Ronald E; Brooks, James D; Yeatts, James L; Maltecca, Christian

    2017-05-02

    Identifying individual genetic variation in drug metabolism pathways is of importance not only in livestock, but also in humans in order to provide the ultimate goal of giving the right drug at the right dose at the right time. Our objective was to identify individual genes and gene networks involved in metabolizing fenbendazole (FBZ) and flunixin meglumine (FLU) in swine liver. The population consisted of female and castrated male pigs that were sired by boars represented by 4 breeds. Progeny were randomly placed into groups: no drug (UNT), FLU or FBZ administered. Liver transcriptome profiles from 60 animals with extreme (i.e. fast or slow drug metabolism) pharmacokinetic (PK) profiles were generated from RNA sequencing. Multiple cytochrome P450 (CYP1A1, CYP2A19 and CYP2C36) genes displayed different transcript levels across treated versus UNT. Weighted gene co-expression network analysis identified 5 and 3 modules of genes correlated with PK parameters and a portion of these were enriched for biological processes relevant to drug metabolism for FBZ and FLU, respectively. Genes within identified modules were shown to have a higher transcript level relationship (i.e. connectivity) in treated versus UNT animals. Investigation into the identified genes would allow for greater insight into FBZ and FLU metabolism.

  10. Chimpanzee sociability is associated with vasopressin (Avpr1a) but not oxytocin receptor gene (OXTR) variation.

    Science.gov (United States)

    Staes, Nicky; Koski, Sonja E; Helsen, Philippe; Fransen, Erik; Eens, Marcel; Stevens, Jeroen M G

    2015-09-01

    The importance of genes in regulating phenotypic variation of personality traits in humans and animals is becoming increasingly apparent in recent studies. Here we focus on variation in the vasopressin receptor gene 1a (Avpr1a) and oxytocin receptor gene (OXTR) and their effects on social personality traits in chimpanzees. We combine newly available genetic data on Avpr1a and OXTR allelic variation of 62 captive chimpanzees with individual variation in personality, based on behavioral assessments. Our study provides support for the positive association of the Avpr1a promoter region, in particular the presence of DupB, and sociability in chimpanzees. This complements findings of previous studies on adolescent chimpanzees and studies that assessed personality using questionnaire data. In contrast, no significant associations were found for the single nucleotide polymorphism (SNP) ss1388116472 of the OXTR and any of the personality components. Most importantly, our study provides additional evidence for the regulatory function of the 5' promoter region of Avpr1a on social behavior and its evolutionary stable effect across species, including rodents, chimpanzees and humans. Although it is generally accepted that complex social behavior is regulated by a combination of genes, the environment and their interaction, our findings highlight the importance of candidate genes with large effects on behavioral variation.

  11. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2012-06-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is transformed via the didactic transposition into school science textbooks. The results indicate that a common textbook discourse on genes and their function exist in textbooks from the different countries. The structure of science as represented by conceptual variation and the use of multiple models was present in all the textbooks. However, the existence of conceptual variation and multiple models is implicit in these textbooks, i.e., the phenomenon of conceptual variation and multiple models are not addressed explicitly, nor its consequences and, thus, it ends up introducing conceptual incoherence about the gene concept and its function within the textbooks. We conclude that within the found textbook-discourse ontological aspects of the academic disciplines of genetics and molecular biology were retained, but without their epistemological underpinnings; these are lost in the didactic transposition. These results are of interest since students might have problems reconstructing the correct scientific understanding from the transformed school science knowledge as depicted within the high school textbooks. Implications for textbook writing as well as teaching are discussed in the paper.

  12. Degranulation of rat cerebellum induces selective variations in gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Eliyahu, D.; Soreq, H.

    1982-02-01

    Selective variations in the composition of poly(A)-containing mRNA were found to be induced in the rat cerebellum by X-irradiation. mRNA populations prepared from normal and X-irradiated rat cerebella at different stages of their development displayed equal efficiencies when translated in vitro in reticulocyte lysates. Specific differences were revealed, however, when the labeled translation products of both mRNA preparations were subjected to two-dimensional gel electrophoresis followed by fluorography of the dried gels. Of more than 100 polypeptide products, several showed marked intensity differences, indicating changes in the abundance of their directing mRNA species. These differences appear both in developing and in mature cerebellar mRNA, and the extent of modification in mRNA is much higher than the consequent changes in the composition of proteins in the irradiated cerebellum. The degranulation-induced modifications in levels of specific cerebellar mRNA species can be used to identify proteins whose biosynthesis depends on the presence of interneurons.

  13. Gene Silencing and Antigenic Variation in Malaria Parasites

    Directory of Open Access Journals (Sweden)

    Kirk W. Deitsch

    2001-01-01

    Full Text Available Malaria remains one of the most important infectious diseases in the world today, infecting 300 to 500 million people yearly and resulting in 1 to 2 million deaths, primarily of young African children[1]. The most severe form of this disease is caused by infection with the mosquito borne protozoan parasite Plasmodium falciparum. This parasite lives by invading and multiplying within the red blood cells of its host, causing disease through anemia resulting from red cell destruction, and also through modifications made to the surface of infected red cells. These modifications make infected cells cytoadherent or “sticky”, allowing them to adhere to the walls of blood vessels, leading to obstruction of blood flow and such clinical manifestations as the often fatal syndrome of cerebral malaria[2]. In addition, parasites are capable of undergoing antigenic variation, a process of continually changing the identity of proteins on the surface of infected cells and thus avoiding the immune response mounted by the host[3]. This process promotes a long term, persistent infection that is difficult to clear.

  14. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    Science.gov (United States)

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum.

  15. Gene diversity and genetic variation in lung flukes (genus Paragonimus).

    Science.gov (United States)

    Blair, David; Nawa, Yukifumi; Mitreva, Makedonka; Doanh, Pham Ngoc

    2016-01-01

    Paragonimiasis caused by lung flukes (genus Paragonimus) is a neglected disease occurring in Asia, Africa and the Americas. The genus is species-rich, ancient and widespread. Genetic diversity is likely to be considerable, but investigation of this remains confined to a few populations of a few species. In recent years, studies of genetic diversity have moved from isoenzyme analysis to molecular phylogenetic analysis based on selected DNA sequences. The former offered better resolution of questions relating to allelic diversity and gene flow, whereas the latter is more suitable for questions relating to molecular taxonomy and phylogeny. A picture is emerging of a highly diverse taxon of parasites, with the greatest diversity found in eastern and southern Asia where ongoing speciation might be indicated by the presence of several species complexes. Diversity of lung flukes in Africa and the Americas is very poorly sampled. Functional molecules that might be of value for immunodiagnosis, or as targets for medical intervention, are of great interest. Characterisation of these from Paragonimus species has been ongoing for a number of years. However, the imminent release of genomic and transcriptomic data for several species of Paragonimus will dramatically increase the rate of discovery of such molecules, and illuminate their diversity within and between species.

  16. [Association of schizophrenia with variations in genes encoding transcription factors].

    Science.gov (United States)

    Boyajyan, A S; Atshemyan, S A; Zakharyan, R V

    2015-01-01

    Alterations in neuronal plasticity and immune system play a key role in pathogenesis of schizophrenia. Identification of genetic factors contributing to these alterations will significantly encourage elucidation of molecular etiopathomechanisms of this disorder. Transcription factors c-Fos, c-Jun, and Ier5 are the important regulators of neuronal plasticity and immune response. In the present work we investigated a potential association of schizophrenia with a number of single nucleotide polymorphisms of c-Fos-,c-Jun and Ier5 encoding genes (FOS, JUN, and IER5 respectively). Genotyping of DNA samples of patients with schizophrenia and healthy individuals was performed using polymerase chain reaction with allele specific primers. The results obtained demonstrated association between schizophrenia and FOS rs1063169, FOS rs7101, JUN rs11688, and IER5 rs6425663 polymorphisms. Namely, it was found that the inheritance of FOS rs1063169*T, JUN rs11688*A, and IER5 rs6425663*T minor variants decreases risk for development of schizophrenia whereas the inheritance of FOS rs7101*T minor variant, especially its homozygous form, increases risk for development of this disorder.

  17. Genetic variation in V gene of class II Newcastle disease virus.

    Science.gov (United States)

    Hao, Huafang; Chen, Shengli; Liu, Peng; Ren, Shanhui; Gao, Xiaolong; Wang, Yanping; Wang, Xinglong; Zhang, Shuxia; Yang, Zengqi

    2016-01-01

    The genetic variation and molecular evolution of the V gene of the class II Newcastle disease virus (NDV) isolates with genotypes I-XVIII were determined using bioinformatics. Results indicated that low homology existed in different genotype viruses, whereas high homology often for the same genotypes, exception may be existed within genotypes I, V, VI, and XII. Sequence analysis showed that the genetic variation of V protein was consistent with virus genotype, and specific signatures on the V protein for nine genotypes were identified. Phylogenetic analysis demonstrated that the phylogenetic trees were highly consistent between the V and F genes, with slight discrepancies in the sub-genotypes. Evolutionary rate analyses based on V and F genes revealed the evolution rates varied in genotypes. These data indicate that the genetic variation of V protein is genotype-related and will help in elucidating the molecular evolution of NDV.

  18. Common variation of the CYP17 gene in Iraqi women with endometriosis disease.

    Science.gov (United States)

    Al-Rubae'i, Salwa H N; Naji, Tamara Sami; Turki, Kisma M

    2017-03-01

    Common variants among genes coding for enzymes in sex steroid biosynthetic pathways may influence the risk of endometriosis in Iraqi women patients in the last years. Cytochrome P450c17a1 (CYP17), a gene that codes for a key enzyme (cytochrome P450c17a1) in a rate-limiting step of estrogen biosynthesis has attracted considerable attention as an important gene for endometriosis. To evaluate the relationship between common genetic variations in CYP17 and endometriosis risk and determine the main effects of those variations on the gene expression. A women-based case control study of Iraqi women aged range (23-46), the associations between selected single-nucleotide polymorphisms (SNPs) in the CYP17 gene and endometriosis diagnosis in fifty women and thirty disease-free controls were evaluated. The study found a significant association (P ≤ 0.01)between endometriosis and selected SNPs of CYP17 gene, with the homozygous genotype conferring decreased risk. A highly significant difference (P ≤ 0.01) in CYP17 gene expression from women with versus without endometriosis and increased by 1.56-fold in women with endometriosis. These findings suggest that variation in or around CYP17 may be associated with endometriosis development in the Iraqi women.

  19. Common variation of the CYP17 gene in Iraqi women with endometriosis disease

    Directory of Open Access Journals (Sweden)

    Salwa H.N. Al-Rubae'i

    2017-03-01

    Full Text Available Common variants among genes coding for enzymes in sex steroid biosynthetic pathways may influence the risk of endometriosis in Iraqi women patients in the last years. Cytochrome P450c17a1 (CYP17, a gene that codes for a key enzyme (cytochrome P450c17a1 in a rate-limiting step of estrogen biosynthesis has attracted considerable attention as an important gene for endometriosis. To evaluate the relationship between common genetic variations in CYP17 and endometriosis risk and determine the main effects of those variations on the gene expression. A women-based case control study of Iraqi women aged range (23–46, the associations between selected single-nucleotide polymorphisms (SNPs in the CYP17 gene and endometriosis diagnosis in fifty women and thirty disease-free controls were evaluated. The study found a significant association (P ≤ 0.01between endometriosis and selected SNPs of CYP17 gene, with the homozygous genotype conferring decreased risk. A highly significant difference (P ≤ 0.01 in CYP17 gene expression from women with versus without endometriosis and increased by 1.56-fold in women with endometriosis. These findings suggest that variation in or around CYP17 may be associated with endometriosis development in the Iraqi women.

  20. Estimating the Robustness of Composite CBA and MCDA Assessments by Variation of Criteria Importance Order

    DEFF Research Database (Denmark)

    Jensen, Anders Vestergaard; Barfod, Michael Bruhn; Leleur, Steen

    2011-01-01

    Abstract This paper discusses the concept of using rank variation concerning the stakeholder prioritising of importance criteria for exploring the sensitivity of criteria weights in multi-criteria analysis (MCA). Thereby the robustness of the MCA-based decision support can be tested. The analysis....... Furthermore, the relative weights can make a large difference in the resulting assessment of alternatives (Hobbs and Meier 2000). Therefore it is highly relevant to introduce a procedure for estimating the importance of criteria weights. This paper proposes a methodology for estimating the robustness...

  1. Variational path integral molecular dynamics and hybrid Monte Carlo algorithms using a fourth order propagator with applications to molecular systems

    Science.gov (United States)

    Kamibayashi, Yuki; Miura, Shinichi

    2016-08-01

    In the present study, variational path integral molecular dynamics and associated hybrid Monte Carlo (HMC) methods have been developed on the basis of a fourth order approximation of a density operator. To reveal various parameter dependence of physical quantities, we analytically solve one dimensional harmonic oscillators by the variational path integral; as a byproduct, we obtain the analytical expression of the discretized density matrix using the fourth order approximation for the oscillators. Then, we apply our methods to realistic systems like a water molecule and a para-hydrogen cluster. In the HMC, we adopt two level description to avoid the time consuming Hessian evaluation. For the systems examined in this paper, the HMC method is found to be about three times more efficient than the molecular dynamics method if appropriate HMC parameters are adopted; the advantage of the HMC method is suggested to be more evident for systems described by many body interaction.

  2. Investigation of variation in gene expression profiling of human blood by extended principle component analysis.

    Directory of Open Access Journals (Sweden)

    Qinghua Xu

    Full Text Available BACKGROUND: Human peripheral blood is a promising material for biomedical research. However, various kinds of biological and technological factors result in a large degree of variation in blood gene expression profiles. METHODOLOGY/PRINCIPAL FINDINGS: Human peripheral blood samples were drawn from healthy volunteers and analysed using the Human Genome U133Plus2 Microarray. We applied a novel approach using the Principle Component Analysis and Eigen-R(2 methods to dissect the overall variation of blood gene expression profiles with respect to the interested biological and technological factors. The results indicated that the predominating sources of the variation could be traced to the individual heterogeneity of the relative proportions of different blood cell types (leukocyte subsets and erythrocytes. The physiological factors like age, gender and BMI were demonstrated to be associated with 5.3% to 9.2% of the total variation in the blood gene expression profiles. We investigated the gene expression profiles of samples from the same donors but with different levels of RNA quality. Although the proportion of variation associated to the RNA Integrity Number was mild (2.1%, the significant impact of RNA quality on the expression of individual genes was observed. CONCLUSIONS: By characterizing the major sources of variation in blood gene expression profiles, such variability can be minimized by modifications to study designs. Increasing sample size, balancing confounding factors between study groups, using rigorous selection criteria for sample quality, and well controlled experimental processes will significantly improve the accuracy and reproducibility of blood transcriptome study.

  3. Individual variation of adipose gene expression and identification of covariated genes by cDNA microarrays

    NARCIS (Netherlands)

    Boeuf, S.; Keijer, J.; Franssen-Hal, van N.L.W.; Klaus, S.

    2002-01-01

    Gene expression profiling through the application of microarrays provides comprehensive assessment of gene expression levels in a given tissue or cell population, as well as information on changes of gene expression in altered physiological or pathological situations. Microarrays are particularly su

  4. NMDA receptor gene variations as modifiers in Huntington disease: a replication study

    OpenAIRE

    2011-01-01

    Several candidate modifier genes which, in addition to the pathogenic CAG repeat expansion, influence the age at onset (AO) in Huntington disease (HD) have already been described. The aim of this study was to replicate association of variations in the N-methyl D-aspartate receptor subtype genes GRIN2A and GRIN2B in the “REGISTRY” cohort from the European Huntington Disease Network (EHDN). The analyses did replicate the association reported between the GRIN2A rs2650427 variation and AO in the ...

  5. Genetic variation in telomere maintenance genes in relation to ovarian cancer survival.

    Science.gov (United States)

    Harris, Holly R; Vivo, Immaculata De; Titus, Linda J; Vitonis, Allison F; Wong, Jason Y Y; Cramer, Daniel W; Terry, Kathryn L

    2012-01-01

    Telomeres are repetitive non-coding DNA sequences at the ends of chromosomes that provide protection against chromosomal instability. Telomere length and stability are influenced by proteins, including telomerase which is partially encoded by the TERT gene. Genetic variation in the TERT gene is associated with ovarian cancer risk, and predicts survival in lung cancer and glioma. We investigated whether genetic variation in five telomere maintenance genes was associated with survival among 1480 cases of invasive epithelial ovarian cancer in the population-based New England Case-Control Study. Cox proportional hazard models were used to calculate hazard ratios and 95% confidence intervals. Overall we observed no significant associations between SNPs in telomere maintenance genes and mortality using a significance threshold of p=0.001. However, we observed some suggestive associations in subgroup analyses. Future studies with larger populations may further our understanding of what role telomeres play in ovarian cancer survival.

  6. Variations in the Solution of Linear First-Order Differential Equations. Classroom Notes

    Science.gov (United States)

    Seaman, Brian; Osler, Thomas J.

    2004-01-01

    A special project which can be given to students of ordinary differential equations is described in detail. Students create new differential equations by changing the dependent variable in the familiar linear first-order equation (dv/dx)+p(x)v=q(x) by means of a substitution v=f(y). The student then creates a table of the new equations and…

  7. Temperature variation of higher-order elastic constants of MgO

    Indian Academy of Sciences (India)

    K M Raju; R K Srivastava; Kailash

    2007-09-01

    An effort has been made for obtaining higher-order elastic constants for MgO starting from basic parameters, viz. nearest-neighbor distance and hardness parameter using Coulomb and Börn–Mayer potentials. These are calculated in a wide temperature range (100–1000 K) and compared with available theoretical and experimental results.

  8. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Directory of Open Access Journals (Sweden)

    Laercio R Porto-Neto

    2014-04-01

    Full Text Available We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2,112 and Tropical Composite (n = 2,550. We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases and 99 (chromatin remodelling factors genes. A total of 3,091 SNP mapped to positions within 3,000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2,738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10-5. A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84. To further characterise the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05 enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterise the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes.

  9. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Science.gov (United States)

    Porto-Neto, Laercio R.; Fortes, Marina R. S.; McWilliam, Sean M.; Lehnert, Sigrid A.; Reverter, Antonio

    2014-01-01

    We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2112) and Tropical Composite (n = 2550). We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases) and 99 (chromatin remodeling factors) genes. A total of 3091 SNP mapped to positions within 3000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10−5). A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84). To further characterize the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05) enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterize the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes. PMID:24795751

  10. Variation.

    Science.gov (United States)

    Hamilton City Board of Education (Ontario).

    Suggestions for studying the topic of variation of individuals and objects (balls) to help develop elementary school students' measurement, comparison, classification, evaluation, and data collection and recording skills are made. General suggestions of variables that can be investigated are made for the study of human variation. Twelve specific…

  11. Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

    Directory of Open Access Journals (Sweden)

    Michelle N. Arbeitman

    2016-07-01

    Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

  12. Exploiting natural variation in Saccharomyces cerevisiae to identify genes for increased ethanol resistance.

    Science.gov (United States)

    Lewis, Jeffrey A; Elkon, Isaac M; McGee, Mick A; Higbee, Alan J; Gasch, Audrey P

    2010-12-01

    Ethanol production from lignocellulosic biomass holds promise as an alternative fuel. However, industrial stresses, including ethanol stress, limit microbial fermentation and thus prevent cost competitiveness with fossil fuels. To identify novel engineering targets for increased ethanol tolerance, we took advantage of natural diversity in wild Saccharomyces cerevisiae strains. We previously showed that an S288c-derived lab strain cannot acquire higher ethanol tolerance after a mild ethanol pretreatment, which is distinct from other stresses. Here, we measured acquired ethanol tolerance in a large panel of wild strains and show that most strains can acquire higher tolerance after pretreatment. We exploited this major phenotypic difference to address the mechanism of acquired ethanol tolerance, by comparing the global gene expression response to 5% ethanol in S288c and two wild strains. Hundreds of genes showed variation in ethanol-dependent gene expression across strains. Computational analysis identified several transcription factor modules and known coregulated genes as differentially expressed, implicating genetic variation in the ethanol signaling pathway. We used this information to identify genes required for acquisition of ethanol tolerance in wild strains, including new genes and processes not previously linked to ethanol tolerance, and four genes that increase ethanol tolerance when overexpressed. Our approach shows that comparative genomics across natural isolates can quickly identify genes for industrial engineering while expanding our understanding of natural diversity.

  13. Estimating the robustness of composite CBA & MCA assessments by variation of criteria importance order

    DEFF Research Database (Denmark)

    Jensen, Anders Vestergaard; Barfod, Michael Bruhn; Leleur, Steen

    , the proposed method uses surrogate weights based on rankings of the criteria, by the use of Rank Order Distribution (ROD) weights [3]. This reduces the problem to assigning a rank order value for each criterion. A method for combining the MCA with the cost-benefit analysis (CBA) is applied as described...... by Salling et al. in [4]. This methodology, COSIMA, uses a calibration indicator which expresses the trade-off between the CBA and MCA part resulting in a total rate expressing the attractiveness of each alternative. However, it should be mentioned that the proposed procedure for estimating the importance...... that the outcome of the method is a subset of the total solution space. The paper finishes up with a discussion and considerations about how to present the results. The question whether to present a single decision criterion, such as the benefit-cost rate or the net present value, or instead to present graphs...

  14. A Variational Approach to an Inhomogeneous Second-Order Ordinary Differential System

    Directory of Open Access Journals (Sweden)

    B. Muatjetjeja

    2013-01-01

    Full Text Available This paper studies the coupled inhomogeneous Lane-Emden system from the Lagrangian formulation point of view. The existence of multiple positive solutions has been discussed in the literature. Here we aim to classify the system with respect to a first-order Lagrangian according to the Noether point symmetries it admits. We then obtain first integrals of the various cases which admit Noether point symmetries.

  15. Four-order stiffness variation of laser-fabricated photopolymer biodegradable scaffolds by laser parameter modulation

    Energy Technology Data Exchange (ETDEWEB)

    Farkas, Balázs; Romano, Ilaria; Ceseracciu, Luca; Diaspro, Alberto [Department of Nanophysics, Istituto Italiano di Tecnologia (IIT), Via Morego 30, 16163 Genova (Italy); Brandi, Fernando [Department of Nanophysics, Istituto Italiano di Tecnologia (IIT), Via Morego 30, 16163 Genova (Italy); Istituto Nazionale di Ottica, Via Moruzzi 1, 56124 Pisa (Italy); Beke, Szabolcs, E-mail: szabolcs.beke@iit.it [Department of Nanophysics, Istituto Italiano di Tecnologia (IIT), Via Morego 30, 16163 Genova (Italy)

    2015-10-01

    The effects of various fabrication parameters of our Mask Projection Excimer Laser StereoLithography (MPExSL) system were investigated. We demonstrate that laser parameters directly change the physical properties (stiffness, thermal degradation, and height/thickness) of the poly(propylene fumarate) (PFF) scaffold structures. The tested parameters were the number of pulses, fluence per pulse and laser repetition rate. We present a four-order tuning capability of MPExSL-fabricated structures' stiffness without altering the resin composition or using cumbersome post-treatment procedures. Thermogravimetric analysis and differential scanning calorimetry confirmed this tuning capability. Prototype-segmented scaffold designs are presented and analyzed to further expand the concept and exploit this in situ stiffness tuning capability of the scaffolds for tissue engineering and regenerative medicine applications. - Highlights: • Facile stiffness control of scaffolds is beneficial in tissue engineering. • Four-order tuning capability of structures' stiffness is presented. • Scaffold's stiffness can be tuned in four orders (4 MPa–4 GPa). • All scaffolds have been fabricated from the same polymer resin in a broad stiffness range.

  16. Inherited Variation in Vitamin D Genes and Type 1 Diabetes Predisposition

    Science.gov (United States)

    Penna-Martinez, Marissa; Badenhoop, Klaus

    2017-01-01

    The etiology and pathophysiology of type 1 diabetes remain largely elusive with no established concepts for a causal therapy. Efforts to clarify genetic susceptibility and screening for environmental factors have identified the vitamin D system as a contributory pathway that is potentially correctable. This review aims at compiling all genetic studies addressing the vitamin D system in type 1 diabetes. Herein, association studies with case control cohorts are presented as well as family investigations with transmission tests, meta-analyses and intervention trials. Additionally, rare examples of inborn errors of vitamin D metabolism manifesting with type 1 diabetes and their immune status are discussed. We find a majority of association studies confirming a predisposing role for vitamin D receptor (VDR) polymorphisms and those of the vitamin D metabolism, particularly the CYP27B1 gene encoding the main enzyme for vitamin D activation. Associations, however, are tenuous in relation to the ethnic background of the studied populations. Intervention trials identify the specific requirements of adequate vitamin D doses to achieve vitamin D sufficiency. Preliminary evidence suggests that doses may need to be individualized in order to achieve target effects due to pharmacogenomic variation. PMID:28425954

  17. Granger Causality in Multi-variate Time Series using a Time Ordered Restricted Vector Autoregressive Model

    CERN Document Server

    Siggiridou, Elsa

    2015-01-01

    Granger causality has been used for the investigation of the inter-dependence structure of the underlying systems of multi-variate time series. In particular, the direct causal effects are commonly estimated by the conditional Granger causality index (CGCI). In the presence of many observed variables and relatively short time series, CGCI may fail because it is based on vector autoregressive models (VAR) involving a large number of coefficients to be estimated. In this work, the VAR is restricted by a scheme that modifies the recently developed method of backward-in-time selection (BTS) of the lagged variables and the CGCI is combined with BTS. Further, the proposed approach is compared favorably to other restricted VAR representations, such as the top-down strategy, the bottom-up strategy, and the least absolute shrinkage and selection operator (LASSO), in terms of sensitivity and specificity of CGCI. This is shown by using simulations of linear and nonlinear, low and high-dimensional systems and different t...

  18. Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens

    Directory of Open Access Journals (Sweden)

    Nätt Daniel

    2012-02-01

    Full Text Available Abstract Background Variations in gene expression, mediated by epigenetic mechanisms, may cause broad phenotypic effects in animals. However, it has been debated to what extent expression variation and epigenetic modifications, such as patterns of DNA methylation, are transferred across generations, and therefore it is uncertain what role epigenetic variation may play in adaptation. Results In Red Junglefowl, ancestor of domestic chickens, gene expression and methylation profiles in thalamus/hypothalamus differed substantially from that of a domesticated egg laying breed. Expression as well as methylation differences were largely maintained in the offspring, demonstrating reliable inheritance of epigenetic variation. Some of the inherited methylation differences were tissue-specific, and the differential methylation at specific loci were little changed after eight generations of intercrossing between Red Junglefowl and domesticated laying hens. There was an over-representation of differentially expressed and methylated genes in selective sweep regions associated with chicken domestication. Conclusions Our results show that epigenetic variation is inherited in chickens, and we suggest that selection of favourable epigenomes, either by selection of genotypes affecting epigenetic states, or by selection of methylation states which are inherited independently of sequence differences, may have been an important aspect of chicken domestication.

  19. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Directory of Open Access Journals (Sweden)

    Kaas Rolf S

    2012-10-01

    Full Text Available Abstract Background Escherichia coli exists in commensal and pathogenic forms. By measuring the variation of individual genes across more than a hundred sequenced genomes, gene variation can be studied in detail, including the number of mutations found for any given gene. This knowledge will be useful for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness of the 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good resolution phylogenies can be inferred from the core-genome. The results further suggest that the resolution at the isolate level may, subsequently be improved by targeting more variable genes. The use of whole genome sequencing will make it possible to eliminate, or at least reduce, the need for several typing steps used in traditional epidemiology.

  20. Effects of common germ-line genetic variation in cell cycle genes on ovarian cancer survival

    DEFF Research Database (Denmark)

    Song, H.; Hogdall, E.; Ramus, S.J.

    2008-01-01

    PURPOSE: Somatic alterations have been shown to correlate with ovarian cancer prognosis and survival, but less is known about the effects on survival of common inherited genetic variation. Of particular interest are genes involved in cell cycle pathways, which regulate cell division and could pla...

  1. Geographic variation in advertisement calls in a tree frog species: gene flow and selection hypotheses.

    Directory of Open Access Journals (Sweden)

    Yikweon Jang

    Full Text Available BACKGROUND: In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. METHODOLOGY: We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR, note duration (ND, and dominant frequency (DF, along with snout-to-vent length. RESULTS: The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. CONCLUSIONS: Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japonica. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with

  2. Geographic Variation in Advertisement Calls in a Tree Frog Species: Gene Flow and Selection Hypotheses

    Science.gov (United States)

    Jang, Yikweon; Hahm, Eun Hye; Lee, Hyun-Jung; Park, Soyeon; Won, Yong-Jin; Choe, Jae C.

    2011-01-01

    Background In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD) or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. Methodology We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR), note duration (ND), and dominant frequency (DF), along with snout-to-vent length. Results The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. Conclusions Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japoinca. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with restricted gene

  3. Natural variation in CBF gene sequence, gene expression and freezing tolerance in the Versailles core collection of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Brunel Dominique

    2008-10-01

    Full Text Available Abstract Background Plants from temperate regions are able to withstand freezing temperatures due to a process known as cold acclimation, which is a prior exposure to low, but non-freezing temperatures. During acclimation, a large number of genes are induced, bringing about biochemical changes in the plant, thought to be responsible for the subsequent increase in freezing tolerance. Key regulatory proteins in this process are the CBF1, 2 and 3 transcription factors which control the expression of a set of target genes referred to as the "CBF regulon". Results To assess the role of the CBF genes in cold acclimation and freezing tolerance of Arabidopsis thaliana, the CBF genes and their promoters were sequenced in the Versailles core collection, a set of 48 accessions that maximizes the naturally-occurring genetic diversity, as well as in the commonly used accessions Col-0 and WS. Extensive polymorphism was found in all three genes. Freezing tolerance was measured in all accessions to assess the variability in acclimated freezing tolerance. The effect of sequence polymorphism was investigated by evaluating the kinetics of CBF gene expression, as well as that of a subset of the target COR genes, in a set of eight accessions with contrasting freezing tolerance. Our data indicate that CBF genes as well as the selected COR genes are cold induced in all accessions, irrespective of their freezing tolerance. Although we observed different levels of expression in different accessions, CBF or COR gene expression was not closely correlated with freezing tolerance. Conclusion Our results indicate that the Versailles core collection contains significant natural variation with respect to freezing tolerance, polymorphism in the CBF genes and CBF and COR gene expression. Although there tends to be more CBF and COR gene expression in tolerant accessions, there are exceptions, reinforcing the idea that a complex network of genes is involved in freezing tolerance

  4. Gene expression profiles deciphering leaf senescence variation between early- and late-senescence cotton lines.

    Directory of Open Access Journals (Sweden)

    Xiangqiang Kong

    Full Text Available Leaf senescence varies greatly among genotypes of cotton (Gossypium hirsutium L, possibly due to the different expression of senescence-related genes. To determine genes involved in leaf senescence, we performed genome-wide transcriptional profiling of the main-stem leaves of an early- (K1 and a late-senescence (K2 cotton line at 110 day after planting (DAP using the Solexa technology. The profiling analysis indicated that 1132 genes were up-regulated and 455 genes down-regulated in K1 compared with K2 at 110 DAP. The Solexa data were highly consistent with, and thus were validated by those from real-time quantitative PCR (RT-PCR. Most of the genes related to photosynthesis, anabolism of carbohydrates and other biomolecules were down-regulated, but those for catabolism of proteins, nucleic acids, lipids and nutrient recycling were mostly up-regulated in K1 compared with K2. Fifty-one differently expressed hormone-related genes were identified, of which 5 ethylene, 3 brassinosteroid (BR, 5 JA, 18 auxin, 8 GA and 1 ABA related genes were up-regulated in K1 compared with K2, indicating that these hormone-related genes might play crucial roles in early senescence of K1 leaves. Many differently expressed transcription factor (TF genes were identified and 11 NAC and 8 WRKY TF genes were up-regulated in K1 compared with K2, suggesting that TF genes, especially NAC and WRKY genes were involved in early senescence of K1 leaves. Genotypic variation in leaf senescence was attributed to differently expressed genes, particularly hormone-related and TF genes.

  5. Bright and photostable push-pull pyrene dye visualizes lipid order variation between plasma and intracellular membranes

    Science.gov (United States)

    Niko, Yosuke; Didier, Pascal; Mely, Yves; Konishi, Gen-Ichi; Klymchenko, Andrey S.

    2016-01-01

    Imaging lipid organization in cell membranes requires advanced fluorescent probes. Here, we show that a recently synthesized push-pull pyrene (PA), similarly to popular probe Laurdan, changes the emission maximum as a function of lipid order, but outperforms it by spectroscopic properties. In addition to red-shifted absorption compatible with common 405 nm diode laser, PA shows higher brightness and much higher photostability than Laurdan in apolar membrane environments. Moreover, PA is compatible with two-photon excitation at wavelengths >800 nm, which was successfully used for ratiometric imaging of coexisting liquid ordered and disordered phases in giant unilamellar vesicles. Fluorescence confocal microscopy in Hela cells revealed that PA efficiently stains the plasma membrane and the intracellular membranes at >20-fold lower concentrations, as compared to Laurdan. Finally, ratiometric imaging using PA reveals variation of lipid order within different cellular compartments: plasma membranes are close to liquid ordered phase of model membranes composed of sphingomyelin and cholesterol, while intracellular membranes are much less ordered, matching well membranes composed of unsaturated phospholipids without cholesterol. These differences in the lipid order were confirmed by fluorescence lifetime imaging (FLIM) at the blue edge of PA emission band. PA probe constitutes thus a new powerful tool for biomembrane research.

  6. Lagrange-type modeling of continuous dielectric permittivity variation in double-higher-order volume integral equation method

    Science.gov (United States)

    Chobanyan, E.; Ilić, M. M.; Notaroš, B. M.

    2015-05-01

    A novel double-higher-order entire-domain volume integral equation (VIE) technique for efficient analysis of electromagnetic structures with continuously inhomogeneous dielectric materials is presented. The technique takes advantage of large curved hexahedral discretization elements—enabled by double-higher-order modeling (higher-order modeling of both the geometry and the current)—in applications involving highly inhomogeneous dielectric bodies. Lagrange-type modeling of an arbitrary continuous variation of the equivalent complex permittivity of the dielectric throughout each VIE geometrical element is implemented, in place of piecewise homogeneous approximate models of the inhomogeneous structures. The technique combines the features of the previous double-higher-order piecewise homogeneous VIE method and continuously inhomogeneous finite element method (FEM). This appears to be the first implementation and demonstration of a VIE method with double-higher-order discretization elements and conformal modeling of inhomogeneous dielectric materials embedded within elements that are also higher (arbitrary) order (with arbitrary material-representation orders within each curved and large VIE element). The new technique is validated and evaluated by comparisons with a continuously inhomogeneous double-higher-order FEM technique, a piecewise homogeneous version of the double-higher-order VIE technique, and a commercial piecewise homogeneous FEM code. The examples include two real-world applications involving continuously inhomogeneous permittivity profiles: scattering from an egg-shaped melting hailstone and near-field analysis of a Luneburg lens, illuminated by a corrugated horn antenna. The results show that the new technique is more efficient and ensures considerable reductions in the number of unknowns and computational time when compared to the three alternative approaches.

  7. Tumor Classification Using High-Order Gene Expression Profiles Based on Multilinear ICA

    Directory of Open Access Journals (Sweden)

    Ming-gang Du

    2009-01-01

    Full Text Available Motivation. Independent Components Analysis (ICA maximizes the statistical independence of the representational components of a training gene expression profiles (GEP ensemble, but it cannot distinguish relations between the different factors, or different modes, and it is not available to high-order GEP Data Mining. In order to generalize ICA, we introduce Multilinear-ICA and apply it to tumor classification using high order GEP. Firstly, we introduce the basis conceptions and operations of tensor and recommend Support Vector Machine (SVM classifier and Multilinear-ICA. Secondly, the higher score genes of original high order GEP are selected by using t-statistics and tabulate tensors. Thirdly, the tensors are performed by Multilinear-ICA. Finally, the SVM is used to classify the tumor subtypes. Results. To show the validity of the proposed method, we apply it to tumor classification using high order GEP. Though we only use three datasets, the experimental results show that the method is effective and feasible. Through this survey, we hope to gain some insight into the problem of high order GEP tumor classification, in aid of further developing more effective tumor classification algorithms.

  8. Trends in genome dynamics among major orders of insects revealed through variations in protein families.

    Science.gov (United States)

    Rappoport, Nadav; Linial, Michal

    2015-08-07

    Insects belong to a class that accounts for the majority of animals on earth. With over one million identified species, insects display a huge diversity and occupy extreme environments. At present, there are dozens of fully sequenced insect genomes that cover a range of habitats, social behavior and morphologies. In view of such diverse collection of genomes, revealing evolutionary trends and charting functional relationships of proteins remain challenging. We analyzed the relatedness of 17 complete proteomes representative of proteomes from insects including louse, bee, beetle, ants, flies and mosquitoes, as well as an out-group from the crustaceans. The analyzed proteomes mostly represented the orders of Hymenoptera and Diptera. The 287,405 protein sequences from the 18 proteomes were automatically clustered into 20,933 families, including 799 singletons. A comprehensive analysis based on statistical considerations identified the families that were significantly expanded or reduced in any of the studied organisms. Among all the tested species, ants are characterized by an exceptionally high rate of family gain and loss. By assigning annotations to hundreds of species-specific families, the functional diversity among species and between the major clades (Diptera and Hymenoptera) is revealed. We found that many species-specific families are associated with receptor signaling, stress-related functions and proteases. The highest variability among insects associates with the function of transposition and nucleic acids processes (collectively coined TNAP). Specifically, the wasp and ants have an order of magnitude more TNAP families and proteins relative to species that belong to Diptera (mosquitoes and flies). An unsupervised clustering methodology combined with a comparative functional analysis unveiled proteomic signatures in the major clades of winged insects. We propose that the expansion of TNAP families in Hymenoptera potentially contributes to the accelerated

  9. Variation in gene expression patterns in effusions and primary tumors from serous ovarian cancer patients

    Directory of Open Access Journals (Sweden)

    Tropè Claes G

    2005-07-01

    Full Text Available Abstract Background While numerous studies have characterized primary ovarian tumors, little information is available regarding expression patterns of metastatic sites of this cancer. To define sets of genes that distinguish primary and metastatic ovarian tumors, we used cDNA microarrays to characterize global gene expression patterns in 38 effusions (28 peritoneal, 10 pleural and 8 corresponding primary ovarian tumors, and searched for associations between expression patterns and clinical parameters. Results We observed multidimensional variation in expression patterns among the cancers. Coordinate variation in expression of genes from two chromosomal regions, 8q and 19q, was seen in subsets of the cancers indicating possible amplifications in these regions. A set of 112 unique genes of known function was differentially expressed between primary tumors and effusions using supervised analysis. Relatively few differences were seen between effusions isolated from the pleural and peritoneal cavities or between effusions from patients diagnosed with stage III and stage IV cancers. A set of 84 unique genes was identified that distinguished high from lower grade ovarian cancers. The results were corroborated using immunocytochemistry, mRNA in situ hybridization, and immunoblotting. Conclusion The extensive variation in expression patterns observed underscores the molecular heterogeneity of ovarian cancer, but suggests a similar molecular profile for ovarian carcinoma cells in serosal cavities.

  10. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  11. Association between low density lipoprotein receptor-related protein 2 gene polymorphisms and bone mineral density variation in Chinese population.

    Directory of Open Access Journals (Sweden)

    Chun Wang

    Full Text Available Low density lipoprotein receptor-related protein 2 gene (LRP2 is located next to the genomic region showing suggestive linkage with both hip and wrist bone mineral density (BMD phenotypes. LRP2 knockout mice showed severe vitamin D deficiency and bone disease, indicating the involvement of LRP2 in the preservation of vitamin D metabolites and delivery of the precursor to the kidney for the generation of 1α,25(OH(2D(3. In order to investigate the contribution of LRP2 gene polymorphisms to the variation of BMD in Chinese population, a total of 330 Chinese female-offspring nuclear families with 1088 individuals and 400 Chinese male-offspring nuclear families with 1215 individuals were genotyped at six tagSNPs of the LRP2 gene (rs2389557, rs2544381, rs7600336, rs10210408, rs2075252 and rs4667591. BMD values at the lumbar spine 1-4 (L1-4 and hip sites were measured by DXA. The association between LRP2 polymorphisms and BMD phenotypes was assessed by quantitative transmission disequilibrium tests (QTDTs in female- and male-offspring nuclear families separately. In the female-offspring nuclear families, rs2075252 and haplotype GA of rs4667591 and rs2075252 were identified in the nominally significant total association with peak BMD at L1-4; however, no significant within-family association was found between peak BMD at the L1-4 and hip sites and six tagSNPs or haplotypes. In male-offspring nuclear families, neither the six tagSNPs nor the haplotypes was in total association or within-family association with the peak BMD variation at the L1-4 and hip sites by QTDT analysis. Our findings suggested that the polymorphisms of LRP2 gene is not a major factor that contributes to the peak BMD variation in Chinese population.

  12. Poly(T) variation within mitochondrial protein-coding genes in Globodera (Nematoda: Heteroderidae).

    Science.gov (United States)

    Riepsamen, Angelique H; Blok, Vivian C; Phillips, Mark; Gibson, Tracey; Dowton, Mark

    2008-03-01

    We sequenced a mitochondrial subgenome from the nematode Globodera rostochiensis, in two overlapping pieces. The subgenome was 9210 bp and contained four protein-coding genes (ND4, COIII, ND3, Cytb) and two tRNA genes (tRNA(Thr), tRNA(Gln)). Genome organization was similar to that of Globodera pallida, which is multipartite. Together with the small number of genes on this subgenome, this suggests that the mitochondrial genome of G. rostochiensis is also multipartite. In the initial clones sequenced, COIII and ND3 were full-length, while ND4 and Cytb were interrupted by premature stop codons and contained point indels that disrupted the reading frame. However, sequencing of multiple clones, from DNA extracted both from multiple individuals and from single cysts, revealed a predominant source of variation-in the length of polythymidine tracts. Comparison of our genomic sequences with ESTs similarly revealed variation in the length of polythymidine tracts. We subsequently sequenced both genomic DNA and mRNA from populations of G. pallida. In each case, variation in the length of polythymidine tracts was observed. The levels of expression of mitochondrial genes in G. pallida were representative of the subgenomes present: little evidence of differential expression was observed. These observations are consistent with the operation of posttranscriptional editing in Globodera mitochondria, although this is difficult to show conclusively in the presence of intraindividual gene sequence variation. Further, alternative explanations cannot be discounted; these include the operation of slippage during translation or that genomic copies of most genes are pseudogenes with a small proportion of full-length sequences able to maintain mitochondrial function.

  13. Systematic prioritization and integrative analysis of copy number variations in schizophrenia reveal key schizophrenia susceptibility genes.

    Science.gov (United States)

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-11-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  14. Patterns of variation among distinct alleles of the Flag silk gene from Nephila clavipes.

    Science.gov (United States)

    Higgins, Linden E; White, Sheryl; Nuñez-Farfán, Juan; Vargas, Jesus

    2007-02-20

    Spider silk proteins and their genes are very attractive to researchers in a wide range of disciplines because they permit linking many levels of organization. However, hypotheses of silk gene evolution have been built primarily upon single sequences of each gene each species, and little is known about allelic variation within a species. Silk genes are known for their repeat structure with high levels of homogenization of nucleotide and amino acid sequence among repeated units. One common explanation for this homogeneity is gene convergence. To test this model, we sequenced multiple alleles of one intron-exon segment from the Flag gene from four populations of the spider Nephila clavipes and compared the new sequences to a published sequence. Our analysis revealed very high levels of heterozygosity in this gene, with no pattern of population differentiation. There was no evidence of gene convergence within any of these alleles, with high levels of nucleotide and amino acid substitution among the repeating motifs. Our data suggest that minimally, there is relaxed selection on mutations in this gene and that there may actually be positive selection for heterozygosity.

  15. Gene expression and variation in social aggression by queens of the harvester ant Pogonomyrmex californicus.

    Science.gov (United States)

    Helmkampf, Martin; Mikheyev, Alexander S; Kang, Yun; Fewell, Jennifer; Gadau, Jürgen

    2016-08-01

    A key requirement for social cooperation is the mitigation and/or social regulation of aggression towards other group members. Populations of the harvester ant Pogonomyrmex californicus show the alternate social phenotypes of queens founding nests alone (haplometrosis) or in groups of unrelated yet cooperative individuals (pleometrosis). Pleometrotic queens display an associated reduction in aggression. To understand the proximate drivers behind this variation, we placed foundresses of the two populations into social environments with queens from the same or the alternate population, and measured their behaviour and head gene expression profiles. A proportion of queens from both populations behaved aggressively, but haplometrotic queens were significantly more likely to perform aggressive acts, and conflict escalated more frequently in pairs of haplometrotic queens. Whole-head RNA sequencing revealed variation in gene expression patterns, with the two populations showing moderate differentiation in overall transcriptional profile, suggesting that genetic differences underlie the two founding strategies. The largest detected difference, however, was associated with aggression, regardless of queen founding type. Several modules of coregulated genes, involved in metabolism, immune system and neuronal function, were found to be upregulated in highly aggressive queens. Conversely, nonaggressive queens exhibited a striking pattern of upregulation in chemosensory genes. Our results highlight that the social phenotypes of cooperative vs. solitary nest founding tap into a set of gene regulatory networks that seem to govern aggression level. We also present a number of highly connected hub genes associated with aggression, providing opportunity to further study the genetic underpinnings of social conflict and tolerance.

  16. Identifying the genetic variation of gene expression using gene sets: application of novel gene Set eQTL approach to PharmGKB and KEGG.

    Directory of Open Access Journals (Sweden)

    Ryan Abo

    Full Text Available Genetic variation underlying the regulation of mRNA gene expression in humans may provide key insights into the molecular mechanisms of human traits and complex diseases. Current statistical methods to map genetic variation associated with mRNA gene expression have typically applied standard linkage and/or association methods; however, when genome-wide SNP and mRNA expression data are available performing all pair wise comparisons is computationally burdensome and may not provide optimal power to detect associations. Consideration of different approaches to account for the high dimensionality and multiple testing issues may provide increased efficiency and statistical power. Here we present a novel approach to model and test the association between genetic variation and mRNA gene expression levels in the context of gene sets (GSs and pathways, referred to as gene set - expression quantitative trait loci analysis (GS-eQTL. The method uses GSs to initially group SNPs and mRNA expression, followed by the application of principal components analysis (PCA to collapse the variation and reduce the dimensionality within the GSs. We applied GS-eQTL to assess the association between SNP and mRNA expression level data collected from a cell-based model system using PharmGKB and KEGG defined GSs. We observed a large number of significant GS-eQTL associations, in which the most significant associations arose between genetic variation and mRNA expression from the same GS. However, a number of associations involving genetic variation and mRNA expression from different GSs were also identified. Our proposed GS-eQTL method effectively addresses the multiple testing limitations in eQTL studies and provides biological context for SNP-expression associations.

  17. Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

    Science.gov (United States)

    Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K

    2013-01-01

    Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, ppopulation. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

  18. Physical mapping of the elephant X chromosome: conservation of gene order over 105 million years.

    Science.gov (United States)

    Delgado, Claudia Leticia Rodríguez; Waters, Paul D; Gilbert, Clément; Robinson, Terence J; Graves, Jennifer A Marshall

    2009-01-01

    All therian mammals (eutherians and marsupials) have an XX female/XY male sex chromosome system or some variant of it. The X and Y evolved from a homologous pair of autosomes over the 166 million years since therian mammals diverged from monotremes. Comparing the sex chromosomes of eutherians and marsupials defined an ancient X conserved region that is shared between species of these mammalian clades. However, the eutherian X (and the Y) was augmented by a recent addition (XAR) that is autosomal in marsupials. XAR is part of the X in primates, rodents, and artiodactyls (which belong to the eutherian clade Boreoeutheria), but it is uncertain whether XAR is part of the X chromosome in more distantly related eutherian mammals. Here we report on the gene content and order on the X of the elephant (Loxodonta africana)-a representative of Afrotheria, a basal endemic clade of African mammals-and compare these findings to those of other documented eutherian species. A total of 17 genes were mapped to the elephant X chromosome. Our results support the hypothesis that the eutherian X and Y chromosomes were augmented by the addition of autosomal material prior to eutherian radiation. Not only does the elephant X bear the same suite of genes as other eutherian X chromosomes, but gene order appears to have been maintained across 105 million years of evolution, perhaps reflecting strong constraints posed by the eutherian X inactivation system.

  19. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Science.gov (United States)

    Mayer, Melanie G; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J

    2015-06-01

    Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for

  20. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Directory of Open Access Journals (Sweden)

    Melanie G Mayer

    2015-06-01

    Full Text Available Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as

  1. Mitochondrial tRNALeu/Lys and ATPase 6/8 gene variations in spinocerebellar ataxias.

    Science.gov (United States)

    Safaei, Sepideh; Houshmand, Massoud; Banoei, Mohammad Mehdi; Panahi, Mehdi Shafa Shariat; Nafisi, Shahriar; Parivar, Kazem; Rostami, Maryam; Shariati, Parvin

    2009-01-01

    The spinocerebellar ataxias (SCA) comprise a heterogeneous group of severe late-onset neurodegenerative diseases that are promoted by the expansion of a tandem-arrayed DNA sequence that modifies the primary structure of the protein. Genomic DNA of 20 patients affected with SCAs was extracted from peripheral blood and screened for deletions in mitochondrial DNA (mtDNA). Sequencing of tRNA(Leu), tRNA(Lys), cytochrome oxidase II, ATPase 6/8 and NADH dehydrogenase I (NDI) genes belonging to mtDNA from patients with SCAs was also carried out to detect the presence of variations. We identified cytosine-adenine-guanine (CAG) trinucleotide repeat expansions in 20 patients. Seven of these patients had at least one nucleotide change in mtDNA. In such cases, 5 nucleotide variations resulted in amino acid changes with two novel variations T8256G and G9010A. SCA patients showed high levels of mtDNA variations in lymphocytes. It can be proposed that the SCA gene proteins (Ataxins) are involved in the complicated intracellular mechanisms that affect cellular organelles and their components, such as the mitochondrial genome. The instability of CAG repeats in polyglutamine diseases such as SCAs and Huntington's disease might be a causative factor in mtDNA variation or possible damage. Copyright 2008 S. Karger AG, Basel.

  2. Conceptual Variation in the Depiction of Gene Function in Upper Secondary School Textbooks

    Science.gov (United States)

    Gericke, Niklas Markus; Hagberg, Mariana

    2010-10-01

    This paper explores conceptual variation in the depiction of gene function in upper secondary school textbooks. Historically, concepts in genetics have developed in various scientific frameworks, which has led to a level of incommensurability as concepts have changed over time within their respective frameworks. Since students may have difficulties in understanding concepts where there is implicit variation in descriptions of the same phenomena, we have developed a concept mapping instrument and applied it to study the gene function concepts in biology and chemistry textbooks that are widely used in Sweden, and others used in a selection of English speaking countries. The data were then further examined using content analysis. In the present paper we describe the conceptual variation of gene function as it is presented in the textbooks, and analyze the ways in which students’ understanding may be influenced. We conclude that it may be difficult for students to gain a modern, process-oriented understanding of gene function if textbooks are used as foundations for the planning and execution of lessons.

  3. Copy Number Variation of UGT 2B Genes in Indian Families Using Whole Genome Scans

    Directory of Open Access Journals (Sweden)

    Avinash M. Veerappa

    2016-01-01

    Full Text Available Background and Objectives. Uridine diphospho-glucuronosyltransferase 2B (UGT2B is a family of genes involved in metabolizing steroid hormones and several other xenobiotics. These UGT2B genes are highly polymorphic in nature and have distinct polymorphisms associated with specific regions around the globe. Copy number variations (CNVs status of UGT2B17 in Indian population is not known and their disease associations have been inconclusive. It was therefore of interest to investigate the CNV profile of UGT2B genes. Methods. We investigated the presence of CNVs in UGT2B genes in 31 members from eight Indian families using Affymetrix Genome-Wide Human SNP Array 6.0 chip. Results. Our data revealed >50% of the study members carried CNVs in UGT2B genes, of which 76% showed deletion polymorphism. CNVs were observed more in UGT2B17 (76.4% than in UGT2B15 (17.6%. Molecular network and pathway analysis found enrichment related to steroid metabolic process, carboxylesterase activity, and sequence specific DNA binding. Interpretation and Conclusion. We report the presence of UGT2B gene deletion and duplication polymorphisms in Indian families. Network analysis indicates the substitutive role of other possible genes in the UGT activity. The CNVs of UGT2B genes are very common in individuals indicating that the effect is neutral in causing any suspected diseases.

  4. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  5. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    DEFF Research Database (Denmark)

    Campa, Daniele; McKay, James; Sinilnikova, Olga

    2009-01-01

    -binding protein), which is induced by glucose, and SREBP-1 (sterol response element-binding protein-1), which is stimulated by insulin through the PI3K/Akt signal transduction pathway. We investigated whether the genetic variability of the genes encoding for ChREBP, SREBP and FAS (respectively, MLXIPL, SREBF1...... and FASN) is related to breast cancer risk and body-mass index (BMI) by studying 1,294 breast cancer cases and 2,452 controls from the European Prospective Investigation on Cancer (EPIC). We resequenced the FAS gene and combined information of SNPs found by resequencing and SNPs from public databases....... Using a tagging approach and selecting 20 SNPs, we covered all the common genetic variation of these genes. In this study we were not able to find any statistically significant association between the SNPs in the FAS, ChREBP and SREPB-1 genes and an increased risk of breast cancer overall...

  6. High Order Gene-Gene Interactions in Eight Single Nucleotide Polymorphisms of Renin-Angiotensin System Genes for Hypertension Association Study

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    2015-01-01

    Full Text Available Several single nucleotide polymorphisms (SNPs of renin-angiotensin system (RAS genes are associated with hypertension (HT but most of them are focusing on single locus effects. Here, we introduce an unbalanced function based on multifactor dimensionality reduction (MDR for multiloci genotypes to detect high order gene-gene (SNP-SNP interaction in unbalanced cases and controls of HT data. Eight SNPs of three RAS genes (angiotensinogen, AGT; angiotensin-converting enzyme, ACE; angiotensin II type 1 receptor, AT1R in HT and non-HT subjects were included that showed no significant genotype differences. In 2- to 6-locus models of the SNP-SNP interaction, the SNPs of AGT and ACE genes were associated with hypertension (bootstrapping odds ratio [Boot-OR] = 1.972~3.785; 95%, confidence interval (CI 1.26~6.21; P<0.005. In 7- and 8-locus model, SNP A1166C of AT1R gene is joined to improve the maximum Boot-OR values of 4.050 to 4.483; CI = 2.49 to 7.29; P<1.63E−08. In conclusion, the epistasis networks are identified by eight SNP-SNP interaction models. AGT, ACE, and AT1R genes have overall effects with susceptibility to hypertension, where the SNPs of ACE have a mainly hypertension-associated effect and show an interacting effect to SNPs of AGT and AT1R genes.

  7. High-order full-discretization method using Lagrange interpolation for stability analysis of turning processes with stiffness variation

    Science.gov (United States)

    Sun, Yuxin; Xiong, Zhenhua

    2017-01-01

    In turning processes, chatter is an unstable vibration which adversely affects surface finish and machine tool components. Stiffness variation (SV) is an effective strategy for chatter suppression by periodically modulating the stiffness around a nominal value. The dynamics of SV turning is governed by a time periodic delay differential equation (DDE) where the time-period/time-delay ratio (TPTDR) can be arbitrary. Recently, first-, second- and higher-order full-discretization methods (FDMs) have been reported as a popular class of methods for milling stability prediction. However, these FDMs can only deal with time periodic DDE where the TPTDR equals one. In this paper, two high-order FDMs using Lagrange interpolation (HLFDMs) are proposed for stability analysis of SV turning. On each discrete time interval, the time delay term is interpolated by the second-degree Lagrange polynomial, and the time periodic term is linearly interpolated. The state term is approximated using linear interpolation and second-degree Lagrange polynomial interpolation, achieving the first- and second-order HLFDM, respectively. Finally, the transition matrix over a single period is deduced for stability analysis via the Floquet theory. Benchmark examples of damped delay Mathieu equations are used to verify the proposed algorithm, which demonstrates that HLFDMs are highly efficient and accurate. In addition, the second-order HLFDM is used to investigate the effects of SV amplitude and frequency parameters. These results provide theoretical insights for the selection of SV parameters.

  8. Threshold-dominated regulation hides genetic variation in gene expression networks

    Directory of Open Access Journals (Sweden)

    Plahte Erik

    2007-12-01

    Full Text Available Abstract Background In dynamical models with feedback and sigmoidal response functions, some or all variables have thresholds around which they regulate themselves or other variables. A mathematical analysis has shown that when the dose-response functions approach binary or on/off responses, any variable with an equilibrium value close to one of its thresholds is very robust to parameter perturbations of a homeostatic state. We denote this threshold robustness. To check the empirical relevance of this phenomenon with response function steepnesses ranging from a near on/off response down to Michaelis-Menten conditions, we have performed a simulation study to investigate the degree of threshold robustness in models for a three-gene system with one downstream gene, using several logical input gates, but excluding models with positive feedback to avoid multistationarity. Varying parameter values representing functional genetic variation, we have analysed the coefficient of variation (CV of the gene product concentrations in the stable state for the regulating genes in absolute terms and compared to the CV for the unregulating downstream gene. The sigmoidal or binary dose-response functions in these models can be considered as phenomenological models of the aggregated effects on protein or mRNA expression rates of all cellular reactions involved in gene expression. Results For all the models, threshold robustness increases with increasing response steepness. The CVs of the regulating genes are significantly smaller than for the unregulating gene, in particular for steep responses. The effect becomes less prominent as steepnesses approach Michaelis-Menten conditions. If the parameter perturbation shifts the equilibrium value too far away from threshold, the gene product is no longer an effective regulator and robustness is lost. Threshold robustness arises when a variable is an active regulator around its threshold, and this function is maintained by

  9. Understanding gene sequence variation in the context of transcription regulation in yeast.

    Directory of Open Access Journals (Sweden)

    Irit Gat-Viks

    2010-01-01

    Full Text Available DNA sequence polymorphism in a regulatory protein can have a widespread transcriptional effect. Here we present a computational approach for analyzing modules of genes with a common regulation that are affected by specific DNA polymorphisms. We identify such regulatory-linkage modules by integrating genotypic and expression data for individuals in a segregating population with complementary expression data of strains mutated in a variety of regulatory proteins. Our procedure searches simultaneously for groups of co-expressed genes, for their common underlying linkage interval, and for their shared regulatory proteins. We applied the method to a cross between laboratory and wild strains of S. cerevisiae, demonstrating its ability to correctly suggest modules and to outperform extant approaches. Our results suggest that middle sporulation genes are under the control of polymorphism in the sporulation-specific tertiary complex Sum1p/Rfm1p/Hst1p. In another example, our analysis reveals novel inter-relations between Swi3 and two mitochondrial inner membrane proteins underlying variation in a module of aerobic cellular respiration genes. Overall, our findings demonstrate that this approach provides a useful framework for the systematic mapping of quantitative trait loci and their role in gene expression variation.

  10. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    OpenAIRE

    DWINITA WIKAN UTAMI; KALIA BARNITA; SITI YURIAH; IDA HANARIDA

    2011-01-01

    Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufip...

  11. The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity.

    Directory of Open Access Journals (Sweden)

    Slavé Petrovski

    2015-09-01

    Full Text Available Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene's proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS, termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene's regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1 genes that are known to cause disease through haploinsufficiency, 2 genes curated as dosage sensitive in ClinGen's Genome Dosage Map, 3 genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4 genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding

  12. The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity.

    Science.gov (United States)

    Petrovski, Slavé; Gussow, Ayal B; Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H; Allen, Andrew S; Goldstein, David B

    2015-09-01

    Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene's proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene's regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen's Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance, nc

  13. Variations in genes regulating neuronal migration predict reduced prefrontal cognition in schizophrenia and bipolar subjects from mediterranean Spain: a preliminary study.

    Science.gov (United States)

    Tabarés-Seisdedos, R; Escámez, T; Martínez-Giménez, J A; Balanzá, V; Salazar, J; Selva, G; Rubio, C; Vieta, E; Geijó-Barrientos, E; Martínez-Arán, A; Reiner, O; Martínez, S

    2006-01-01

    Both neural development and prefrontal cortex function are known to be abnormal in schizophrenia and bipolar disorder. In order to test the hypothesis that these features may be related with genes that regulate neuronal migration, we analyzed two genomic regions: the lissencephaly critical region (chromosome 17p) encompassing the LIS1 gene and which is involved in human lissencephaly; and the genes related to the platelet-activating-factor, functionally related to LIS1, in 52 schizophrenic patients, 36 bipolar I patients and 65 normal control subjects. In addition, all patients and the 25 control subjects completed a neuropsychological battery. Thirteen (14.8%) patients showed genetic variations in either two markers related with lissencephaly or in the platelet-activating-factor receptor gene. These patients performed significantly worse in the Wisconsin Card Sorting Test-Perseverative Errors in comparison with patients with no lissencephaly critical region/platelet-activating-factor receptor variations. The presence of lissencephaly critical region/platelet-activating-factor receptor variations was parametrically related to perseverative errors, and this accounted for 17% of the variance (P = 0.0001). Finally, logistic regression showed that poor Wisconsin Card Sorting Test-Perseverative Errors performance was the only predictor of belonging to the positive lissencephaly critical region/platelet-activating-factor receptor group. These preliminary findings suggest that the variations in genes involved in neuronal migration predict the severity of the prefrontal cognitive deficits in both disorders.

  14. Molecular phylogenetic and sequence variation analysis of dimeric α-amylase inhibitor genes in wheat and its wild relative species

    Directory of Open Access Journals (Sweden)

    Bharati Pandey

    2016-06-01

    Full Text Available Dimeric alpha-amylase inhibitors serve protection against insects that are highly dependent on starch for their energy. In order to study the molecular evolution and sequence variation, we have sequenced dimeric α-amylase inhibitors gene from different genomes in Triticeae including Indian bread and durum wheat genotypes. Using BLAST, obtained sequences show very high homology with other inhibitors available at GenBank database and had common conserved 10 cysteine residues. Investigated frequency of significant SNPs in the α-amylase inhibitor gene was 1 out of 60 bases. The phylogenetic analysis based on deduced amino acid sequences revealed that the genes encoding dimeric α-amylase inhibitors formed three groups and genes isolated from Indian bread wheat clustered with 0.19 inhibitors. In addition, we predicted that dimeric α-amylase inhibitors co-localized into chloroplast and mitochondria expect for the sequences isolated from Aegilops tauschii. Fingerprinting analysis done with ScanProsite confirmed biologically meaningful signatures. Multiple sequence alignment of dimeric α-amylase proteins from different plant species revealed a conserved secondary structure region, indicating homology at the sequence and structural levels. Analysis of the protein sequences obtained from wheat and its wild related species are very similar, indicates a highest conservation of these proteins.

  15. A relative variation-based method to unraveling gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Yali Wang

    Full Text Available Gene regulatory network (GRN reconstruction is essential in understanding the functioning and pathology of a biological system. Extensive models and algorithms have been developed to unravel a GRN. The DREAM project aims to clarify both advantages and disadvantages of these methods from an application viewpoint. An interesting yet surprising observation is that compared with complicated methods like those based on nonlinear differential equations, etc., methods based on a simple statistics, such as the so-called Z-score, usually perform better. A fundamental problem with the Z-score, however, is that direct and indirect regulations can not be easily distinguished. To overcome this drawback, a relative expression level variation (RELV based GRN inference algorithm is suggested in this paper, which consists of three major steps. Firstly, on the basis of wild type and single gene knockout/knockdown experimental data, the magnitude of RELV of a gene is estimated. Secondly, probability for the existence of a direct regulation from a perturbed gene to a measured gene is estimated, which is further utilized to estimate whether a gene can be regulated by other genes. Finally, the normalized RELVs are modified to make genes with an estimated zero in-degree have smaller RELVs in magnitude than the other genes, which is used afterwards in queuing possibilities of the existence of direct regulations among genes and therefore leads to an estimate on the GRN topology. This method can in principle avoid the so-called cascade errors under certain situations. Computational results with the Size 100 sub-challenges of DREAM3 and DREAM4 show that, compared with the Z-score based method, prediction performances can be substantially improved, especially the AUPR specification. Moreover, it can even outperform the best team of both DREAM3 and DREAM4. Furthermore, the high precision of the obtained most reliable predictions shows that the suggested algorithm may be

  16. Gene order data from a model amphibian (Ambystoma: new perspectives on vertebrate genome structure and evolution

    Directory of Open Access Journals (Sweden)

    Voss S Randal

    2006-08-01

    Full Text Available Abstract Background Because amphibians arise from a branch of the vertebrate evolutionary tree that is juxtaposed between fishes and amniotes, they provide important comparative perspective for reconstructing character changes that have occurred during vertebrate evolution. Here, we report the first comparative study of vertebrate genome structure that includes a representative amphibian. We used 491 transcribed sequences from a salamander (Ambystoma genetic map and whole genome assemblies for human, mouse, rat, dog, chicken, zebrafish, and the freshwater pufferfish Tetraodon nigroviridis to compare gene orders and rearrangement rates. Results Ambystoma has experienced a rate of genome rearrangement that is substantially lower than mammalian species but similar to that of chicken and fish. Overall, we found greater conservation of genome structure between Ambystoma and tetrapod vertebrates, nevertheless, 57% of Ambystoma-fish orthologs are found in conserved syntenies of four or more genes. Comparisons between Ambystoma and amniotes reveal extensive conservation of segmental homology for 57% of the presumptive Ambystoma-amniote orthologs. Conclusion Our analyses suggest relatively constant interchromosomal rearrangement rates from the euteleost ancestor to the origin of mammals and illustrate the utility of amphibian mapping data in establishing ancestral amniote and tetrapod gene orders. Comparisons between Ambystoma and amniotes reveal some of the key events that have structured the human genome since diversification of the ancestral amniote lineage.

  17. Regulation of flowering in rice: two florigen genes, a complex gene network, and natural variation.

    Science.gov (United States)

    Tsuji, Hiroyuki; Taoka, Ken-ichiro; Shimamoto, Ko

    2011-02-01

    Photoperiodic control of flowering time consists of a complicated network that converges into the generation of a mobile flowering signal called florigen. Recent advances identifying the protein FT/Hd3a as the molecular nature responsible for florigen activity have focused current research on florigen genes as the important output of this complex signaling network. Rice is a model system for short-day plants and recent progress in elucidating the flowering network from rice and Arabidopsis, a long-day plant, provides an evolutionarily comparative view of the photoperiodic flowering pathway. This review summarizes photoperiodic flowering control in rice, including the interaction of complex layers of gene networks contributed from evolutionarily unique factors and the regulatory adaptation of conserved factors.

  18. Genetic variations of glycinin subunit genes among cultivated and wild type soybean species

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Glycinin is a predominant storage protein in most soybean accessions. It is a hexamer constituted by five major subunits, which can be classified into two groups. Group Ⅰ contains Gl, G2 and G3, and Group Ⅱ contains G4 and G5. The genes encoding these subunits have been designated from Gyl to Gy5, respectively. In the present study, Gyl genomic fragments were cloned from wild accessions of subgenera Glycine glycine, Glycine soja and a cultivar of Glycine max. Their sequences and the deduced amino acid sequences were compared. The residues critical for assembling of G1 subunits from the wild perennial accession were conservative. The Gy4 fragments were cloned from two wild perennial accessions and compared with that from subgenus Soja. The intron 3 of Gy4 had abundant variations between the subgenera G. Soja and G. Glycine as well as within the subgenus G. Glycine. Abundant variations existed in the disordered regions 3 and 4 of G4 subunits from two wild perennial accessions. The genomic organization of glycinin genes was analyzed in 19 accessions from subgenera Soja and Glycine. The hybridization patterns were identical among the accessions of subgenus Soja. On the contrary, abundant polymorphisms existed between the accessions from subgenus Glycine. These results indicated that glycinin genes have high degree of conservation within subgenus Soja but more variations within subgenus Glycine.

  19. Novel rare variations of the oxytocin receptor (OXTR) gene in autism spectrum disorder individuals.

    Science.gov (United States)

    Liu, Xiaoxi; Kawashima, Minae; Miyagawa, Taku; Otowa, Takeshi; Latt, Khun Zaw; Thiri, Myo; Nishida, Hisami; Sugiyama, Toshiro; Tsurusaki, Yoshinori; Matsumoto, Naomichi; Mabuchi, Akihiko; Tokunaga, Katsushi; Sasaki, Tsukasa

    2015-01-01

    The oxytocin receptor (OXTR) gene has been implicated as a risk gene for autism spectrum disorder (ASD)-a neurodevelopmental disorder with essential features of impairments in social communication and reciprocal interaction. The genetic associations between common variations in OXTR and ASD have been reported in multiple ethnic populations. However, little is known about the distribution of rare variations within OXTR in ASD patients. In this study, we resequenced the full length of OXTR in 105 ASD individuals using an approach that combined the power of next-generation sequencing technology, long-range PCR and DNA pooling. We demonstrated that rare variants with minor allele frequency as low as 0.05% could be reliably detected by our method. We identified 28 novel variants including potential functional variants in the intron region and one rare missense variant (R150S). We subsequently performed Sanger sequencing and validated five novel variants located in previously suggested candidate regions in ASD individuals. Further sequencing of 312 healthy subjects showed that the burden of rare variants is significantly higher in ASDs compared with healthy individuals. Our results support that the rare variation in OXTR gene might be involved in ASD.

  20. Effects of abhydrolase domain containing 5 gene (ABHD5) expression and variations on chicken fat metabolism.

    Science.gov (United States)

    Ouyang, Hongjia; Liu, Qing; Xu, Jiguo; Zeng, Fang; Pang, Xiaolin; Jebessa, Endashaw; Liang, Shaodong; Nie, Qinghua; Zhang, Xiquan

    2016-01-01

    Abhydrolase domain containing 5 gene (ABHD5), also known as comparative gene identification 58 (CGI-58), is a member of the α/β-hydrolase family as a protein cofactor of ATGL stimulating its triacylglycerol hydrolase activity. In this study, we aim to characterize the expression and variations of ABHD5 and to study their functions in chicken fat metabolism. We compared the ABHD5 expression level in various tissues and under different nutrition conditions, identified the variations of ABHD5, and associated them with production traits in an F2 resource population of chickens. Overexpression analysis with two different genotypes and siRNA interfering analysis of ABHD5 were performed in chicken preadipocytes. Chicken ABDH5 was expressed widely and most predominantly in adipose tissue. Five SNPs of the ABHD5 gene were identified and genotyped in the F2 resource population. The c.490C > T SNP was associated with subcutaneous fat thickness (P  C SNP was also associated with chicken body weight (P chicken preadipocytes, overexpression of wild type ABDH5 did not affect the mRNA level of ATGL (adipose triglyceride lipase) but markedly decreased (P chickens with a high fat diet. These results suggest that expression and variations of ABHD5 may affect fat metabolism through regulating the activity of ATGL in chickens.

  1. Contribution of haplotypes across the fibrinogen gene cluster to variation in risk of myocardial infarction.

    Science.gov (United States)

    Mannila, Maria Nastase; Eriksson, Per; Lundman, Pia; Samnegård, Ann; Boquist, Susanna; Ericsson, Carl-Göran; Tornvall, Per; Hamsten, Anders; Silveira, Angela

    2005-03-01

    Fibrinogen has consistently been recognized as an independent predictor of myocardial infarction (MI). Multiple mechanisms link fibrinogen to MI; therefore disentangling the factors underlying variation in plasma fibrinogen concentration is essential. Candidate regions in the fibrinogen gamma (FGG), alpha (FGA) and beta (FGB) genes were screened for single nucleotide polymorphisms (SNPs). Several novel SNPs were detected in the FGG and FGA genes in addition to the previously known SNPs in the fibrinogen genes. Tight linkage disequilibrium extending over various physical distances was observed between most SNPs. Consequently, eight SNPs were chosen and determined in 377 postinfarction patients and 387 healthy individuals. None of the SNPs were associated with plasma fibrinogen concentration or MI. Haplotype analyses revealed a consistent pattern of haplotypes associated with variation in risk of MI. Of the four haplotypes inferred using the FGA -58G>A and FGG 1299 +79T>C SNPs, the most frequent haplotype, FGG-FGA*1 (prevalence 46.6%), was associated with increased risk of MI (OR 1.51; 95%CI 1.18, 1.93), whereas the least frequent haplotype, FGG-FGA*4 (11.8%), was associated with lower risk of MI (OR 0.79 95%CI 0.64, 0.98). In conclusion, fibrinogen haplotypes, but not SNPs in isolation, are associated with variation in risk of MI.

  2. Associations between dopamine D4 receptor gene variation with both infidelity and sexual promiscuity.

    Directory of Open Access Journals (Sweden)

    Justin R Garcia

    Full Text Available BACKGROUND: Human sexual behavior is highly variable both within and between populations. While sex-related characteristics and sexual behavior are central to evolutionary theory (sexual selection, little is known about the genetic bases of individual variation in sexual behavior. The variable number tandem repeats (VNTR polymorphism in exon III of the human dopamine D4 receptor gene (DRD4 has been correlated with an array of behavioral phenotypes and may be predicatively responsible for variation in motivating some sexual behaviors, particularly promiscuity and infidelity. METHODOLOGY/PRINCIPAL FINDINGS: We administered an anonymous survey on personal history of sexual behavior and intimate relationships to 181 young adults. We also collected buccal wash samples and genotyped the DRD4 VNTR. Here we show that individuals with at least one 7-repeat allele (7R+ report a greater categorical rate of promiscuous sexual behavior (i.e., having ever had a "one-night stand" and report a more than 50% increase in instances of sexual infidelity. CONCLUSIONS/SIGNIFICANCE: DRD4 VNTR genotype varies considerably within and among populations and has been subject to relatively recent, local selective pressures. Individual differences in sexual behavior are likely partially mediated by individual genetic variation in genes coding for motivation and reward in the brain. Conceptualizing these findings in terms of r/K selection theory suggests a mechanism for selective pressure for and against the 7R+ genotype that may explain the considerable global allelic variation for this polymorphism.

  3. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  4. Association of variation in Fc gamma receptor 3B gene copy number with rheumatoid arthritis in Caucasian samples

    NARCIS (Netherlands)

    McKinney, Cushla; Fanciulli, Manuela; Merriman, Marilyn E.; Phipps-Green, Amanda; Alizadeh, Behrooz Z.; Koeleman, Bobby P. C.; Dalbeth, Nicola; Gow, Peter J.; Harrison, Andrew A.; Highton, John; Jones, Peter B.; Stamp, Lisa K.; Steer, Sophia; Barrera, Pilar; Coenen, Marieke J. H.; Franke, Barbara; van Riel, Piet L. C. M.; Vyse, Tim J.; Aitman, Tim J.; Radstake, Timothy R. D. J.; Merriman, Tony R.

    2010-01-01

    Objective There is increasing evidence that variation in gene copy number (CN) influences clinical phenotype. The low-affinity Fc gamma receptor 3B (FCGR3B) located in the FCGR gene cluster is a CN polymorphic gene involved in the recruitment to sites of inflammation and activation of polymorphonucl

  5. Development of EMS-induced mutation population for amylose and resistant starch variation in bread wheat (Triticum aestivum) and identification of candidate genes responsible for amylose variation.

    Science.gov (United States)

    Mishra, Ankita; Singh, Anuradha; Sharma, Monica; Kumar, Pankaj; Roy, Joy

    2016-10-06

    Starch is a major part of cereal grain. It comprises two glucose polymer fractions, amylose (AM) and amylopectin (AP), that make up about 25 and 75 % of total starch, respectively. The ratio of the two affects processing quality and digestibility of starch-based food products. Digestibility determines nutritional quality, as high amylose starch is considered a resistant or healthy starch (RS type 2) and is highly preferred for preventive measures against obesity and related health conditions. The topic of nutrition security is currently receiving much attention and consumer demand for food products with improved nutritional qualities has increased. In bread wheat (Triticum aestivum L.), variation in amylose content is narrow, hence its limited improvement. Therefore, it is necessary to produce wheat lines or populations showing wide variation in amylose/resistant starch content. In this study, a set of EMS-induced M4 mutant lines showing dynamic variation in amylose/resistant starch content were produced. Furthermore, two diverse mutant lines for amylose content were used to study quantitative expression patterns of 20 starch metabolic pathway genes and to identify candidate genes for amylose biosynthesis. A population comprising 101 EMS-induced mutation lines (M4 generation) was produced in a bread wheat (Triticum aestivum) variety. Two methods of amylose measurement in grain starch showed variation in amylose content ranging from ~3 to 76 % in the population. The method of in vitro digestion showed variation in resistant starch content from 1 to 41 %. One-way ANOVA analysis showed significant variation (p wheat. It is also useful for the study of the genetic and molecular basis of amylose/resistant starch variation in wheat. Furthermore, gene expression analysis of 20 starch metabolic genes in the two diverse mutant lines (low and high amylose mutants) indicates that in addition to key genes, several other genes (such as phosphorylases, isoamylases, and

  6. Sweet taste receptor gene variation and aspartame taste in primates and other species.

    Science.gov (United States)

    Li, Xia; Bachmanov, Alexander A; Maehashi, Kenji; Li, Weihua; Lim, Raymond; Brand, Joseph G; Beauchamp, Gary K; Reed, Danielle R; Thai, Chloe; Floriano, Wely B

    2011-06-01

    Aspartame is a sweetener added to foods and beverages as a low-calorie sugar replacement. Unlike sugars, which are apparently perceived as sweet and desirable by a range of mammals, the ability to taste aspartame varies, with humans, apes, and Old World monkeys perceiving aspartame as sweet but not other primate species. To investigate whether the ability to perceive the sweetness of aspartame correlates with variations in the DNA sequence of the genes encoding sweet taste receptor proteins, T1R2 and T1R3, we sequenced these genes in 9 aspartame taster and nontaster primate species. We then compared these sequences with sequences of their orthologs in 4 other nontasters species. We identified 9 variant sites in the gene encoding T1R2 and 32 variant sites in the gene encoding T1R3 that distinguish aspartame tasters and nontasters. Molecular docking of aspartame to computer-generated models of the T1R2 + T1R3 receptor dimer suggests that species variation at a secondary, allosteric binding site in the T1R2 protein is the most likely origin of differences in perception of the sweetness of aspartame. These results identified a previously unknown site of aspartame interaction with the sweet receptor and suggest that the ability to taste aspartame might have developed during evolution to exploit a specialized food niche.

  7. Excited State Studies of Polyacenes Using the All-Order Constricted Variational Density Functional Theory with Orbital Relaxation.

    Science.gov (United States)

    Senn, Florian; Krykunov, Mykhaylo

    2015-10-22

    For the polyacenes series from naphthalene to hexacene, we present the vertical singlet excitation energies 1 (1)La and 1 (1)Lb, as well as the first triplet excitation energies obtained by the all-order constricted variational density functional theory with orbital relaxation (R-CV(∞)-DFT). R-CV(∞)-DFT is a further development of variational density functional theory (CV(∞)-DFT), which has already been successfully applied for the calculation of the vertical singlet excitation energies (1)La and (1)Lb for polyacenes,15 and we show that one obtains consistent excitation energies using the local density approximation as a functional for singlet as well as for triplet excitations when going beyond the linear response theory. Furthermore, we apply self-consistent field density functional theory (ΔSCF-DFT) and compare the obtained excitation energies for the first triplet excitations T1, where, due to the character of the transition, ΔSCF-DFT and R-CV(∞)-DFT become numerically equivalent, and for the singlet excitations 1 (1)La and 1 (1)Lb, where the two methods differ.

  8. Variational study of the antiferromagnetic insulating phase of V2O3 based on Nth order muffin-tin-orbitals

    Science.gov (United States)

    Perkins, N. B.; Di Matteo, S.; Natoli, C. R.

    2009-10-01

    Motivated by recent results of Nth order muffin-tin-orbital (NMTO) implementation of density-functional theory, we re-examine low-temperature ground-state properties of the antiferromagnetic insulating phase of vanadium sesquioxide V2O3 . In fact, the hopping matrix elements within the nearest-neighbor vanadium pair, obtained by the NMTO-downfolding procedure, are strongly reduced compared to those previously obtained using the downfolding procedure of Castellani [Phys. Rev. B18, 4945 (1978); 18, 4967 (1978);18, 5001 (1978)]. This could imply a breakdown of the molecular picture. We use the NMTO hopping matrix elements as input and perform a variational study of the ground state. We find that the formation of stable molecules throughout the crystal is not favorable in this case, though the experimentally observed magnetic structure can still be obtained in the atomic variational regime. However, the resulting ground state (two t2g electrons occupying the degenerate eg doublet) is in contrast with many well-established experimental observations. We discuss the implications of this finding in the light of the importance of nonlocal electronic correlations in V2O3 .

  9. Genetic variation in the immunosuppression pathway genes and breast cancer susceptibility

    DEFF Research Database (Denmark)

    Lei, Jieping; Rudolph, Anja; Moysich, Kirsten B

    2016-01-01

    Immunosuppression plays a pivotal role in assisting tumors to evade immune destruction and promoting tumor development. We hypothesized that genetic variation in the immunosuppression pathway genes may be implicated in breast cancer tumorigenesis. We included 42,510 female breast cancer cases.......5 × 10(-4) and 0.63, respectively). Our data provide evidence that the immunosuppression pathway genes STAT3, IL5, and GM-CSF may be novel susceptibility loci for breast cancer in women of European ancestry....... and 40,577 controls of European ancestry from 37 studies in the Breast Cancer Association Consortium (2015) with available genotype data for 3595 single nucleotide polymorphisms (SNPs) in 133 candidate genes. Associations between genotyped SNPs and overall breast cancer risk, and secondarily according...

  10. Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

    Science.gov (United States)

    Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

    2016-01-01

    In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. © 2015 John Wiley & Sons Ltd.

  11. Clinal variation at phenology-related genes in spruce: parallel evolution in FTL2 and Gigantea?

    Science.gov (United States)

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L; Vendramin, Giovanni G; Lascoux, Martin

    2014-07-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Quaternary history. We sequenced nine candidate genes and 27 control loci and genotyped 14 SSR loci in six populations of P. obovata located along the Yenisei river from latitude 56°N to latitude 67°N. In contrast to Scandinavian Norway spruce that both departs from the standard neutral model (SNM) and shows a clear population structure, Siberian spruce populations along the Yenisei do not depart from the SNM and are genetically unstructured. Nonetheless, as in Norway spruce, growth cessation is significantly clinal. Polymorphisms in photoperiodic (FTL2) and circadian clock (Gigantea, GI, PRR3) genes also show significant clinal variation and/or evidence of local selection. In GI, one of the variants is the same as in Norway spruce. Finally, a strong cline in gene expression is observed for FTL2, but not for GI. These results, together with recent physiological studies, confirm the key role played by FTL2 and circadian clock genes in the control of growth cessation in spruce species and suggest the presence of parallel adaptation in these two species.

  12. Candidate Gene Approach for Parasite Resistance in Sheep – Variation in Immune Pathway Genes and Association with Fecal Egg Count

    Science.gov (United States)

    Periasamy, Kathiravan; Pichler, Rudolf; Poli, Mario; Cristel, Silvina; Cetrá, Bibiana; Medus, Daniel; Basar, Muladno; A. K., Thiruvenkadan; Ramasamy, Saravanan; Ellahi, Masroor Babbar; Mohammed, Faruque; Teneva, Atanaska; Shamsuddin, Mohammed; Podesta, Mario Garcia; Diallo, Adama

    2014-01-01

    Sheep chromosome 3 (Oar3) has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs) within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF) did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05) in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have potential for

  13. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  14. Variation in Telangiectasia Predisposing Genes Is Associated With Overall Radiation Toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Tanteles, George A. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Murray, Robert J.S. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Mills, Jamie [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Barwell, Julian [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Chakraborti, Prabir [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Chan, Steve [Department of Clinical Oncology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom); Cheung, Kwok-Leung [Division of Breast Surgery, University of Nottingham, Nottingham (United Kingdom); Ennis, Dawn [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Khurshid, Nazish [Department of Genetics, University of Leicester, Leicester (United Kingdom); Lambert, Kelly [Department of Breast Surgery, University Hospitals of Leicester, Glenfield Hospital, Leicester (United Kingdom); Machhar, Rohan; Meisuria, Mitul [Department of Genetics, University of Leicester, Leicester (United Kingdom); Osman, Ahmed; Peat, Irene [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Sahota, Harjinder [Department of Genetics, University of Leicester, Leicester (United Kingdom); Woodings, Pamela [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Talbot, Christopher J., E-mail: cjt14@le.ac.uk [Department of Genetics, University of Leicester, Leicester (United Kingdom); and others

    2012-11-15

    Purpose: In patients receiving radiotherapy for breast cancer where the heart is within the radiation field, cutaneous telangiectasiae could be a marker of potential radiation-induced heart disease. We hypothesized that single nucleotide polymorphisms (SNPs) in genes known to cause heritable telangiectasia-associated disorders could predispose to such late, normal tissue vascular damage. Methods and Materials: The relationship between cutaneous telangiectasia as a late normal tissue radiation injury phenotype in 633 breast cancer patients treated with radiotherapy was examined. Patients were clinically assessed for the presence of cutaneous telangiectasia and genotyped at nine SNPs in three candidate genes. Candidate SNPs were within the endoglin (ENG) and activin A receptor, type II-like 1 (ACVRL1) genes, mutations in which cause hereditary hemorrhagic telangiectasia and the ataxia-telangiectasia mutated (ATM) gene associated with ataxia-telangiectasia. Results: A total of 121 (19.1%) patients exhibited a degree of cutaneous telangiectasiae on clinical examination. Regression was used to examine the associations between the presence of telangiectasiae in patients who underwent breast-conserving surgery, controlling for the effects of boost and known brassiere size (n=388), and individual geno- or haplotypes. Inheritance of ACVRL1 SNPs marginally contributed to the risk of cutaneous telangiectasiae. Haplotypic analysis revealed a stronger association between inheritance of a ATM haplotype and the presence of cutaneous telangiectasiae, fibrosis and overall toxicity. No significant association was observed between telangiectasiae and the coinheritance of the candidate ENG SNPs. Conclusions: Genetic variation in the ATM gene influences reaction to radiotherapy through both vascular damage and increased fibrosis. The predisposing variation in the ATM gene will need to be better defined to optimize it as a predictive marker for assessing radiotherapy late effects.

  15. Copy number variation of age-related macular degeneration relevant genes in the Korean population.

    Directory of Open Access Journals (Sweden)

    Jung Hyun Park

    Full Text Available PURPOSE: Studies that analyzed single nucleotide polymorphisms (SNP in various genes have shown that genetic factors are strongly associated with age-related macular degeneration (AMD susceptibility. Copy number variation (CNV may be an additional type of genetic variation that contributes to AMD pathogenesis. This study investigated CNV in 4 AMD-relevant genes in Korean AMD patients and control subjects. METHODS: Four CNV candidate regions located in AMD-relevant genes (VEGFA, ARMS2/HTRA1, CFH and VLDLR, were selected based on the outcomes of our previous study which elucidated common CNVs in the Asian populations. Real-time PCR based TaqMan Copy Number Assays were performed on CNV candidates in 273 AMD patients and 257 control subjects. RESULTS: The predicted copy number (PCN, 0, 1, 2 or 3+ of each region was called using the CopyCaller program. All candidate genes except ARMS2/HTRA1 showed CNV in at least one individual, in which losses of VEGFA and VLDLR represent novel findings in the Asian population. When the frequencies of PCN were compared, only the gain in VLDLR showed significant differences between AMD patients and control subjects (p = 0.025. Comparisons of the raw copy values (RCV revealed that 3 of 4 candidate genes showed significant differences (2.03 vs. 1.92 for VEGFA, p<0.01; 2.01 vs. 1.97 for CFH, p<0.01; 1.97 vs. 2.01, p<0.01 for ARMS2/HTRA1. CONCLUSION: CNVs located in AMD-relevant genes may be associated with AMD susceptibility. Further investigations encompassing larger patient cohorts are needed to elucidate the role of CNV in AMD pathogenesis.

  16. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    Science.gov (United States)

    Purrington, Kristen S.; Slettedahl, Seth; Bolla, Manjeet K.; Michailidou, Kyriaki; Czene, Kamila; Nevanlinna, Heli; Bojesen, Stig E.; Andrulis, Irene L.; Cox, Angela; Hall, Per; Carpenter, Jane; Yannoukakos, Drakoulis; Haiman, Christopher A.; Fasching, Peter A.; Mannermaa, Arto; Winqvist, Robert; Brenner, Hermann; Lindblom, Annika; Chenevix-Trench, Georgia; Benitez, Javier; Swerdlow, Anthony; Kristensen, Vessela; Guénel, Pascal; Meindl, Alfons; Darabi, Hatef; Eriksson, Mikael; Fagerholm, Rainer; Aittomäki, Kristiina; Blomqvist, Carl; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Wang, Xianshu; Olswold, Curtis; Olson, Janet E.; Mulligan, Anna Marie; Knight, Julia A.; Tchatchou, Sandrine; Reed, Malcolm W.R.; Cross, Simon S.; Liu, Jianjun; Li, Jingmei; Humphreys, Keith; Clarke, Christine; Scott, Rodney; Fostira, Florentia; Fountzilas, George; Konstantopoulou, Irene; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Ekici, Arif B.; Hartmann, Arndt; Beckmann, Matthias W.; Hartikainen, Jaana M.; Kosma, Veli-Matti; Kataja, Vesa; Jukkola-Vuorinen, Arja; Pylkäs, Katri; Kauppila, Saila; Dieffenbach, Aida Karina; Stegmaier, Christa; Arndt, Volker; Margolin, Sara; Balleine, Rosemary; Arias Perez, Jose Ignacio; Pilar Zamora, M.; Menéndez, Primitiva; Ashworth, Alan; Jones, Michael; Orr, Nick; Arveux, Patrick; Kerbrat, Pierre; Truong, Thérèse; Bugert, Peter; Toland, Amanda E.; Ambrosone, Christine B.; Labrèche, France; Goldberg, Mark S.; Dumont, Martine; Ziogas, Argyrios; Lee, Eunjung; Dite, Gillian S.; Apicella, Carmel; Southey, Melissa C.; Long, Jirong; Shrubsole, Martha; Deming-Halverson, Sandra; Ficarazzi, Filomena; Barile, Monica; Peterlongo, Paolo; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Tollenaar, Robert A.E.M.; Seynaeve, Caroline; Brüning, Thomas; Ko, Yon-Dschun; Van Deurzen, Carolien H.M.; Martens, John W.M.; Kriege, Mieke; Figueroa, Jonine D.; Chanock, Stephen J.; Lissowska, Jolanta; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Schneeweiss, Andreas; Tapper, William J.; Gerty, Susan M.; Durcan, Lorraine; Mclean, Catriona; Milne, Roger L.; Baglietto, Laura; dos Santos Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Van'T Veer, Laura J.; Cornelissen, Sten; Försti, Asta; Torres, Diana; Rüdiger, Thomas; Rudolph, Anja; Flesch-Janys, Dieter; Nickels, Stefan; Weltens, Caroline; Floris, Giuseppe; Moisse, Matthieu; Dennis, Joe; Wang, Qin; Dunning, Alison M.; Shah, Mitul; Brown, Judith; Simard, Jacques; Anton-Culver, Hoda; Neuhausen, Susan L.; Hopper, John L.; Bogdanova, Natalia; Dörk, Thilo; Zheng, Wei; Radice, Paolo; Jakubowska, Anna; Lubinski, Jan; Devillee, Peter; Brauch, Hiltrud; Hooning, Maartje; García-Closas, Montserrat; Sawyer, Elinor; Burwinkel, Barbara; Marmee, Frederick; Eccles, Diana M.; Giles, Graham G.; Peto, Julian; Schmidt, Marjanka; Broeks, Annegien; Hamann, Ute; Chang-Claude, Jenny; Lambrechts, Diether; Pharoah, Paul D.P.; Easton, Douglas; Pankratz, V. Shane; Slager, Susan; Vachon, Celine M.; Couch, Fergus J.

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymorphisms (SNPs) from 194 mitotic genes and breast cancer risk, overall and by histologic grade, in the Breast Cancer Association Consortium (BCAC) iCOGS study (n = 39 067 cases; n = 42 106 controls). SNPs in TACC2 [rs17550038: odds ratio (OR) = 1.24, 95% confidence interval (CI) 1.16–1.33, P = 4.2 × 10−10) and EIF3H (rs799890: OR = 1.07, 95% CI 1.04–1.11, P = 8.7 × 10−6) were significantly associated with risk of low-grade breast cancer. The TACC2 signal was retained (rs17550038: OR = 1.15, 95% CI 1.07–1.23, P = 7.9 × 10−5) after adjustment for breast cancer risk SNPs in the nearby FGFR2 gene, suggesting that TACC2 is a novel, independent genome-wide significant genetic risk locus for low-grade breast cancer. While no SNPs were individually associated with high-grade disease, a pathway-level gene set analysis showed that variation across the 194 mitotic genes was associated with high-grade breast cancer risk (P = 2.1 × 10−3). These observations will provide insight into the contribution of mitotic defects to histological grade and the etiology of breast cancer. PMID:24927736

  17. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  18. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Directory of Open Access Journals (Sweden)

    Mark T Anderson

    Full Text Available Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae

  19. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Science.gov (United States)

    Anderson, Mark T; Seifert, H Steven

    2013-01-01

    Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae when investigating

  20. CNTNAP2 gene dosage variation is associated with schizophrenia and epilepsy

    NARCIS (Netherlands)

    Friedman, J. I.; Vrijenhoek, T.; Markx, S.; Janssen, I. M.; Van der Vliet, W. A.; Faas, B. H. W.; Knoers, N. V.; Cahn, W.; Kahn, R. S.; Edelmann, L.; Davis, K. L.; Silverman, J. M.; Brunner, H. G.; Van Kessel, A. Geurts; Wijmenga, C.; Ophoff, R. A.; Veltman, J. A.

    2008-01-01

    A homozygous mutation of the CNTNAP2 gene has been associated with a syndrome of focal epilepsy, mental retardation, language regression and other neuropsychiatric problems in children of the Old Order Amish community. Here we report genomic rearrangements resulting in haploinsufficiency of the CNTN

  1. Antigen-presenting genes and genomic copy number variations in the Tasmanian devil MHC

    Directory of Open Access Journals (Sweden)

    Cheng Yuanyuan

    2012-03-01

    Full Text Available Abstract Background The Tasmanian devil (Sarcophilus harrisii is currently under threat of extinction due to an unusual fatal contagious cancer called Devil Facial Tumour Disease (DFTD. DFTD is caused by a clonal tumour cell line that is transmitted between unrelated individuals as an allograft without triggering immune rejection due to low levels of Major Histocompatibility Complex (MHC diversity in Tasmanian devils. Results Here we report the characterization of the genomic regions encompassing MHC Class I and Class II genes in the Tasmanian devil. Four genomic regions approximately 960 kb in length were assembled and annotated using BAC contigs and physically mapped to devil Chromosome 4q. 34 genes and pseudogenes were identified, including five Class I and four Class II loci. Interestingly, when two haplotypes from two individuals were compared, three genomic copy number variants with sizes ranging from 1.6 to 17 kb were observed within the classical Class I gene region. One deletion is particularly important as it turns a Class Ia gene into a pseudogene in one of the haplotypes. This deletion explains the previously observed variation in the Class I allelic number between individuals. The frequency of this deletion is highest in the northwestern devil population and lowest in southeastern areas. Conclusions The third sequenced marsupial MHC provides insights into the evolution of this dynamic genomic region among the diverse marsupial species. The two sequenced devil MHC haplotypes revealed three copy number variations that are likely to significantly affect immune response and suggest that future work should focus on the role of copy number variations in disease susceptibility in this species.

  2. Joint statistics of partial sums of ordered exponential variates and performance of GSC RAKE receivers over rayleigh fading channel

    KAUST Repository

    Nam, Sungsik

    2011-08-01

    Spread spectrum receivers with generalized selection combining (GSC) RAKE reception were proposed and have been studied as alternatives to the classical two fundamental schemes: maximal ratio combining and selection combining because the number of diversity paths increases with the transmission bandwidth. Previous work on performance analyses of GSC RAKE receivers based on the signal to noise ratio focused on the development of methodologies to derive exact closed-form expressions for various performance measures. However, some open problems related to the performance evaluation of GSC RAKE receivers still remain to be solved such as the exact performance analysis of the capture probability and an exact assessment of the impact of self-interference on GSC RAKE receivers. The major difficulty in these problems is to derive some joint statistics of ordered exponential variates. With this motivation in mind, we capitalize in this paper on some new order statistics results to derive exact closed-form expressions for the capture probability and outage probability of GSC RAKE receivers subject to self-interference over independent and identically distributed Rayleigh fading channels, and compare it to that of partial RAKE receivers. © 2011 IEEE.

  3. A general scenario of Hox gene inventory variation among major sarcopterygian lineages

    Directory of Open Access Journals (Sweden)

    Wang Chaolin

    2011-01-01

    Full Text Available Abstract Background Hox genes are known to play a key role in shaping the body plan of metazoans. Evolutionary dynamics of these genes is therefore essential in explaining patterns of evolutionary diversity. Among extant sarcopterygians comprising both lobe-finned fishes and tetrapods, our knowledge of the Hox genes and clusters has largely been restricted in several model organisms such as frogs, birds and mammals. Some evolutionary gaps still exist, especially for those groups with derived body morphology or occupying key positions on the tree of life, hindering our understanding of how Hox gene inventory varied along the sarcopterygian lineage. Results We determined the Hox gene inventory for six sarcopterygian groups: lungfishes, caecilians, salamanders, snakes, turtles and crocodiles by comprehensive PCR survey and genome walking. Variable Hox genes in each of the six sarcopterygian group representatives, compared to the human Hox gene inventory, were further validated for their presence/absence by PCR survey in a number of related species representing a broad evolutionary coverage of the group. Turtles, crocodiles, birds and placental mammals possess the same 39 Hox genes. HoxD12 is absent in snakes, amphibians and probably lungfishes. HoxB13 is lost in frogs and caecilians. Lobe-finned fishes, amphibians and squamate reptiles possess HoxC3. HoxC1 is only present in caecilians and lobe-finned fishes. Similar to coelacanths, lungfishes also possess HoxA14, which is only found in lobe-finned fishes to date. Our Hox gene variation data favor the lungfish-tetrapod, turtle-archosaur and frog-salamander relationships and imply that the loss of HoxD12 is not directly related to digit reduction. Conclusions Our newly determined Hox inventory data provide a more complete scenario for evolutionary dynamics of Hox genes along the sarcopterygian lineage. Limbless, worm-like caecilians and snakes possess similar Hox gene inventories to animals with

  4. Gene regulatory network modeling via global optimization of high-order dynamic Bayesian network

    Directory of Open Access Journals (Sweden)

    Xuan Nguyen

    2012-06-01

    Full Text Available Abstract Background Dynamic Bayesian network (DBN is among the mainstream approaches for modeling various biological networks, including the gene regulatory network (GRN. Most current methods for learning DBN employ either local search such as hill-climbing, or a meta stochastic global optimization framework such as genetic algorithm or simulated annealing, which are only able to locate sub-optimal solutions. Further, current DBN applications have essentially been limited to small sized networks. Results To overcome the above difficulties, we introduce here a deterministic global optimization based DBN approach for reverse engineering genetic networks from time course gene expression data. For such DBN models that consist only of inter time slice arcs, we show that there exists a polynomial time algorithm for learning the globally optimal network structure. The proposed approach, named GlobalMIT+, employs the recently proposed information theoretic scoring metric named mutual information test (MIT. GlobalMIT+ is able to learn high-order time delayed genetic interactions, which are common to most biological systems. Evaluation of the approach using both synthetic and real data sets, including a 733 cyanobacterial gene expression data set, shows significantly improved performance over other techniques. Conclusions Our studies demonstrate that deterministic global optimization approaches can infer large scale genetic networks.

  5. [Genetic variation analysis of canine parvovirus VP2 gene in China].

    Science.gov (United States)

    Yi, Li; Cheng, Shi-Peng; Yan, Xi-Jun; Wang, Jian-Ke; Luo, Bin

    2009-11-01

    To recognize the molecular biology character, phylogenetic relationship and the state quo prevalent of Canine parvovirus (CPV), Faecal samnples from pet dogs with acute enteritis in the cities of Beijing, Wuhan, and Nanjing were collected and tested for CPV by PCR and other assay between 2006 and 2008. There was no CPV to FPV (MEV) variation by PCR-RFLP analysis in all samples. The complete ORFs of VP2 genes were obtained by PCR from 15 clinical CPVs and 2 CPV vaccine strains. All amplicons were cloned and sequenced. Analysis of the VP2 sequences showed that clinical CPVs both belong to CPV-2a subtype, and could be classified into a new cluster by amino acids contrasting which contains Tyr-->Ile (324) mutation. Besides the 2 CPV vaccine strains belong to CPV-2 subtype, and both of them have scattered variation in amino acids residues of VP2 protein. Construction of the phylogenetic tree based on CPV VP2 sequence showed these 15 CPV clinical strains were in close relationship with Korea strain K001 than CPV-2a isolates in other countries at early time, It is indicated that the canine parvovirus genetic variation was associated with location and time in some degree. The survey of CPV capsid protein VP2 gene provided the useful information for the identification of CPV types and understanding of their genetic relationship.

  6. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Science.gov (United States)

    Reiter, Taylor; Jagoda, Evelyn; Capellini, Terence D

    2016-01-01

    Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR), phytanol-CoA 2-hydroxylase (PHYH), and pancreatic α-amylase 2B (AMY2B). These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  7. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Directory of Open Access Journals (Sweden)

    Taylor Reiter

    Full Text Available Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR, phytanol-CoA 2-hydroxylase (PHYH, and pancreatic α-amylase 2B (AMY2B. These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  8. Selection of genes associated with variations in the Circle of Willis in gerbils using suppression subtractive hybridization.

    Science.gov (United States)

    Li, Zhenkun; Huo, Xueyun; Zhang, Shuangyue; Lu, Jing; Li, Changlong; Guo, Meng; Fu, Rui; He, Zhengming; Du, Xiaoyan; Chen, Zhenwen

    2015-01-01

    Deformities in the Circle of Willis (CoW) can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil is an ideal experimental model for studying variations in the CoW. To study the mechanisms underlying these variations, we selected genes associated with different types of the CoW using suppression subtractive hybridization (SSH). After evaluating the efficiency of SSH using quantitative real-time polymerase chain reaction (qPCR) on subtracted and unsubtracted cDNA and Southern blotting on SSH PCR products, 12 SSH libraries were established. We identified 4 genes (CST3, GNAS, GPx4 and PFN2) associated with variations in the CoW. These genes were identified with qPCR and Western blotting using 70 expressed sequence tags from the SSH libraries. Cloning and sequencing allowed us to demonstrate that the 4 genes were closely related to mouse genes. We may assume that these 4 genes play an important role in the development of variations in the CoW. This study provides a foundation for further research of genes related to development of variations in the CoW and the mechanisms of dysmorphosis of cerebral vessels.

  9. Selection of genes associated with variations in the Circle of Willis in gerbils using suppression subtractive hybridization.

    Directory of Open Access Journals (Sweden)

    Zhenkun Li

    Full Text Available Deformities in the Circle of Willis (CoW can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil is an ideal experimental model for studying variations in the CoW. To study the mechanisms underlying these variations, we selected genes associated with different types of the CoW using suppression subtractive hybridization (SSH. After evaluating the efficiency of SSH using quantitative real-time polymerase chain reaction (qPCR on subtracted and unsubtracted cDNA and Southern blotting on SSH PCR products, 12 SSH libraries were established. We identified 4 genes (CST3, GNAS, GPx4 and PFN2 associated with variations in the CoW. These genes were identified with qPCR and Western blotting using 70 expressed sequence tags from the SSH libraries. Cloning and sequencing allowed us to demonstrate that the 4 genes were closely related to mouse genes. We may assume that these 4 genes play an important role in the development of variations in the CoW. This study provides a foundation for further research of genes related to development of variations in the CoW and the mechanisms of dysmorphosis of cerebral vessels.

  10. Genetic variation in the oxytocin receptor (OXTR) gene is associated with Asperger Syndrome.

    Science.gov (United States)

    Di Napoli, Agnese; Warrier, Varun; Baron-Cohen, Simon; Chakrabarti, Bhismadev

    2014-01-01

    Autism Spectrum Conditions (ASC) are a group of neurodevelopmental conditions characterized by impairments in communication and social interaction, alongside unusually repetitive behaviors and narrow interests. ASC are highly heritable and have complex patterns of inheritance where multiple genes are involved, alongside environmental and epigenetic factors. Asperger Syndrome (AS) is a subgroup of these conditions, where there is no history of language or cognitive delay. Animal models suggest a role for oxytocin (OXT) and oxytocin receptor (OXTR) genes in social-emotional behaviors, and several studies indicate that the oxytocin/oxytocin receptor system is altered in individuals with ASC. Previous studies have reported associations between genetic variations in the OXTR gene and ASC. The present study tested for an association between nine single nucleotide polymorphisms (SNPs) in the OXTR gene and AS in 530 individuals of Caucasian origin, using SNP association test and haplotype analysis. There was a significant association between rs2268493 in OXTR and AS. Multiple haplotypes that include this SNP (rs2268493-rs2254298, rs2268490-rs2268493-rs2254298, rs2268493-rs2254298-rs53576, rs237885-rs2268490-rs2268493-rs2254298, rs2268490-rs2268493-rs2254298-rs53576) were also associated with AS. rs2268493 has been previously associated with ASC and putatively alters several transcription factor-binding sites and regulates chromatin states, either directly or through other variants in linkage disequilibrium (LD). This study reports a significant association of the sequence variant rs2268493 in the OXTR gene and associated haplotypes with AS.

  11. Recombination in pe/ppe genes contributes to genetic variation in Mycobacterium tuberculosis lineages

    KAUST Repository

    Phelan, Jody E.

    2016-02-29

    Background Approximately 10 % of the Mycobacterium tuberculosis genome is made up of two families of genes that are poorly characterized due to their high GC content and highly repetitive nature. The PE and PPE families are typified by their highly conserved N-terminal domains that incorporate proline-glutamate (PE) and proline-proline-glutamate (PPE) signature motifs. They are hypothesised to be important virulence factors involved with host-pathogen interactions, but their high genetic variability and complexity of analysis means they are typically disregarded in genome studies. Results To elucidate the structure of these genes, 518 genomes from a diverse international collection of clinical isolates were de novo assembled. A further 21 reference M. tuberculosis complex genomes and long read sequence data were used to validate the approach. SNP analysis revealed that variation in the majority of the 168 pe/ppe genes studied was consistent with lineage. Several recombination hotspots were identified, notably pe_pgrs3 and pe_pgrs17. Evidence of positive selection was revealed in 65 pe/ppe genes, including epitopes potentially binding to major histocompatibility complex molecules. Conclusions This, the first comprehensive study of the pe and ppe genes, provides important insight into M. tuberculosis diversity and has significant implications for vaccine development.

  12. Systematic variation in gene expression patterns in human cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Ross, Douglas T.; Scherf, Uwe; Eisen, Michael B.; Perou, Charles M.; Rees, Christian; Spellman, Paul; Iyer, Vishwanath; Jeffrey, Stefanie S.; Van de Rijn, Matt; Waltham, Mark; Pergamenschikov, Alexander; Lee, Jeffrey C.F.; Lashkari, Deval; Shalon, Dari; Myers, Timothy G.; Weinstein, John N.; Botstein, David; Brown, Patrick O.

    2000-01-01

    We used cDNA micro arrays to explore the variation in expression of approximately 8,000 unique genes among the 60 cell lines used in the National Cancer Institute s screen for anti-cancer drugs. Classification of the cell lines based solely on the observed patterns of gene expression revealed a correspondence to the ostensible origins of the tumors from which the cell lines were derived. The consistent relationship between the gene expression patterns and the tissue of origin allowed us to recognize outliers whose previous classification appeared incorrect. Specific features of the gene expression patterns appeared to be related to physiological properties of the cell lines, such as their doubling time in culture, drug metabolism or the interferon response. Comparison of gene expression patterns in the cell lines to those observed in normal breast tissue or in breast tumor specimens revealed features of the expression patterns in the tumors that had recognizable counterparts in specific cell lines, reflecting the tumor, stromal and inflammatory components of the tumor tissue. These results provided a novel molecular characterization of this important group of human cell lines and their relationships to tumors in vivo.

  13. Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits

    Directory of Open Access Journals (Sweden)

    Amanda K Lindholm-Perry

    2012-03-01

    Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across

  14. Genetic variation in telomere maintenance genes, telomere length, and lung cancer susceptibility.

    Science.gov (United States)

    Hosgood, H Dean; Cawthon, Richard; He, Xingzhou; Chanock, Stephen; Lan, Qing

    2009-11-01

    Telomeres are responsible for the protection of the chromosome ends and shortened telomere length has been associated with risk of multiple cancers. Genetic variation in telomere-related genes may alter cancer risk associated with telomere length. Using lung cancer cases (n=120) and population-based controls (n=110) from Xuanwei, China, we analyzed telomere length separately and in conjunction with single nucleotide polymorphisms in the telomere maintenance genes POT1, TERT, and TERF2, which we have previously reported were associated with risk of lung cancer in this study. POT1 rs10244817, TERT rs2075786, and TERF2 rs251796 were significantly associated with lung cancer (p(trend)telomere length was not significantly associated with risk of lung cancer (OR=1.58; 95% CI=0.79-3.18) when compared to the longest tertile of telomere length. When stratified by genotype, there was a suggestion of a dose-response relationship between tertiles of telomere length and risk of lung cancer among the POT1 rs10244817 common variant carriers (OR (95% CI)=1.33 (0.47-3.75), 3.30 (1.14-9.56), respectively) but not among variant genotype carriers (p(interaction)=0.05). Our findings provide evidence that telomere length and genetic variation in telomere maintenance genes may be associated with risk of lung cancer susceptibility and warrant replication in larger studies.

  15. Melanopsin Gene Variations Interact With Season to Predict Sleep Onset and Chronotype

    Science.gov (United States)

    Roecklein, Kathryn A.; Wong, Patricia M.; Franzen, Peter L.; Hasler, Brant P.; Wood-Vasey, W. Michael; Nimgaonkar, Vishwajit L.; Miller, Megan A.; Kepreos, Kyle M.; Ferrell, Robert E.; Manuck, Stephen B.

    2013-01-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are associated with differences in sleep-wake behavior among those not suffering from a mood disorder, the authors tested associations between melanopsin gene polymorphisms and self-reported sleep timing (sleep onset and wake time) in a community sample (N = 234) of non-Hispanic Caucasian participants (age 30–54 yrs) with no history of psychological, neurological, or sleep disorders. The authors also tested the effect of melanopsin variations on differences in preferred sleep and activity timing (i.e., chronotype), which may reflect differences in circadian phase, sleep homeostasis, or both. Daylength on the day of assessment was measured and included in analyses. DNA samples were genotyped for melanopsin gene polymorphisms using fluorescence polarization. P10L genotype interacted with daylength to predict self-reported sleep onset (interaction p seasonal patterns of recurrence or exacerbation. PMID:22881342

  16. Genetic variations of the dihydrofolate reductase gene of Plasmodium vivax in Mandalay Division, Myanmar.

    Science.gov (United States)

    Na, Byoung-Kuk; Lee, Hyeong-Woo; Moon, Sung-Ung; In, Tae-Suk; Lin, Khin; Maung, Maung; Chung, Gyung-Tae; Lee, Jong-Koo; Kim, Tong-Soo; Kong, Yoon

    2005-07-01

    Dihydrofolate reductase (DHFR; EC1.5.1.3) is a known target enzyme for antifolate agents, which are used as alternative chemotherapeutics for chloroquine-resistant malaria. Mutations in the dhfr gene of Plasmodium vivax are thought to be associated with resistance to the antifolate drugs. In this study, we have analyzed genetic variations in the dhfr genes of clinical isolates of P. vivax (n=21) in Myanmar, to monitor antifolate resistance in this country. Sequence variations within the entire dhfr gene were highly restricted to codons from 57 to 117, and the GGDN tandem repeat region. Double (S58R and S117N/T) or quadruple mutations (F57L/I, S58R, T61M, and S117N/T), which may be closely related to the drug resistance, were recognized in most of the isolates (20/21 cases). Our results suggest that antifolate-resistant P. vivax is becoming widespread in Myanmar, as it also is in the neighboring countries in Southeast Asia. It appears that the drug resistance situation may be worsening in the country.

  17. Genetic variation of Taenia pisiformis collected from Sichuan, China, based on the mitochondrial cytochrome B gene.

    Science.gov (United States)

    Yang, Deying; Ren, Yongjun; Fu, Yan; Xie, Yue; Nie, Huaming; Nong, Xiang; Gu, Xiaobin; Wang, Shuxian; Peng, Xuerong; Yang, Guangyou

    2013-08-01

    Taenia pisiformis is one of the most important parasites of canines and rabbits. T. pisiformis cysticercus (the larval stage) causes severe damage to rabbit breeding, which results in huge economic losses. In this study, the genetic variation of T. pisiformis was determined in Sichuan Province, China. Fragments of the mitochondrial cytochrome b (cytb) (922 bp) gene were amplified in 53 isolates from 8 regions of T. pisiformis. Overall, 12 haplotypes were found in these 53 cytb sequences. Molecular genetic variations showed 98.4% genetic variation derived from intra-region. FST and Nm values suggested that 53 isolates were not genetically differentiated and had low levels of genetic diversity. Neutrality indices of the cytb sequences showed the evolution of T. pisiformis followed a neutral mode. Phylogenetic analysis revealed no correlation between phylogeny and geographic distribution. These findings indicate that 53 isolates of T. pisiformis keep a low genetic variation, which provide useful knowledge for monitoring changes in parasite populations for future control strategies.

  18. Selective Landscapes in newt Immune Genes Inferred from Patterns of Nucleotide Variation.

    Science.gov (United States)

    Fijarczyk, Anna; Dudek, Katarzyna; Babik, Wieslaw

    2016-12-31

    Host-pathogen interactions may result in either directional selection or in pressure for the maintenance of polymorphism at the molecular level. Hence signatures of both positive and balancing selection are expected in immune genes. Because both overall selective pressure and specific targets may differ between species, large-scale population genomic studies are useful in detecting functionally important immune genes and comparing selective landscapes between taxa. Such studies are of particular interest in amphibians, a group threatened worldwide by emerging infectious diseases. Here, we present an analysis of polymorphism and divergence of 634 immune genes in two lineages of Lissotriton newts: L. montandoni and L. vulgaris graecus Variation in newt immune genes has been shaped predominantly by widespread purifying selection and strong evolutionary constraint, implying long-term importance of these genes for functioning of the immune system. The two evolutionary lineages differ in the overall strength of purifying selection which can partially be explained by demographic history but may also signal differences in long-term pathogen pressure. The prevalent constraint notwithstanding, 23 putative targets of positive selection and 11 putative targets of balancing selection were identified. The latter were detected by composite tests involving the demographic model and further validated in independent population samples. Putative targets of balancing selection encode proteins which may interact closely with pathogens but include also regulators of immune response. The identified candidates will be useful for testing whether genes affected by balancing selection are more prone to interspecific introgression than other genes in the genome. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Common genetic variations in the CYP2R1 and GC genes are determinants of vitamin D status in Danes

    DEFF Research Database (Denmark)

    Nissen, Ioanna

    ), after 6 months intake of vitamin D3-fortified bread and milk (paper II) and in 92 participants in the VitDgen study after artificial UVB irradiation during winter (paper III). Common genetic variations in the CYP2R1 and GC genes were found to be important determinants of vitamin D status in three out...... by genetic variation in vitamin D modulating genes. Twin and family-based studies indicate that genetic variation may have an appreciable influence on vitamin D status. Moreover, several candidate gene studies including two genome-wide association studies (GWAS) have found single nucleotide polymorphisms...... (SNPs) in CYP2R1, CYP24A1, CYP27B1, C10orf88, DHCR7/NADSYN1, GC and VDR genes to be associated with vitamin D status. The main hypothesis of this work was that genetically determined variation in vitamin D metabolism would influence the effect of vitamin D sources (vitamin D...

  20. FTO gene variation and measures of body mass in an African population

    Directory of Open Access Journals (Sweden)

    Hattersley Andrew T

    2009-03-01

    Full Text Available Abstract Background Variation in the fat mass and obesity associated (FTO gene has been reproducibly associated with body mass index (BMI and obesity in populations of White European origin. Data from Asians and African-Americans is less conclusive. Methods We assessed the effect of 16 FTO polymorphisms on body mass in a large population of predominantly lean Gambians (Nmax 2208 participating in a long-term surveillance program providing contemporary and early-life anthropometric measurements. Results Sixteen FTO tagSNPs screened here, including several associated with BMI in Europeans, were not associated with birth weight (BWT, early weight gain in 1–2 year olds, BMI in adults (≥ 18 y, or weight-for-height (WFH z-score across all ages. No association was seen between genotype and WFH z-score or other measures of body mass. The confidence limits indicate that the effect size for WFH z-score never exceeded 0.17 units per allele copy for any SNP (excluding the three SNPs with allele Conclusion To our knowledge this is the first study of FTO gene variation in a well-characterised African population. Our results suggest that FTO gene variation does not influence measures of body mass in Gambians living a traditional lifestyle, or has a smaller effect than that detected in Europeans. These findings are not directly comparable to results from previous studies in African-Americans due to differences in study design and analysis. It is also possible that any effect of FTO genotype on body mass is of limited relevance in a lean population where little excess food is available, compared to similar ethnic populations where food supply is plentiful.

  1. Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces

    Directory of Open Access Journals (Sweden)

    Chakrabarti Bhismadev

    2011-06-01

    Full Text Available Abstract Background From an early age, humans look longer at preferred stimuli and also typically look longer at facial expressions of emotion, particularly happy faces. Atypical gaze patterns towards social stimuli are common in autism spectrum conditions (ASC. However, it is unknown whether gaze fixation patterns have any genetic basis. In this study, we tested whether variations in the cannabinoid receptor 1 (CNR1 gene are associated with gaze duration towards happy faces. This gene was selected because CNR1 is a key component of the endocannabinoid system, which is involved in processing reward, and in our previous functional magnetic resonance imaging (fMRI study, we found that variations in CNR1 modulate the striatal response to happy (but not disgust faces. The striatum is involved in guiding gaze to rewarding aspects of a visual scene. We aimed to validate and extend this result in another sample using a different technique (gaze tracking. Methods A total of 30 volunteers (13 males and 17 females from the general population observed dynamic emotional expressions on a screen while their eye movements were recorded. They were genotyped for the identical four single-nucleotide polymorphisms (SNPs in the CNR1 gene tested in our earlier fMRI study. Results Two SNPs (rs806377 and rs806380 were associated with differential gaze duration for happy (but not disgust faces. Importantly, the allelic groups associated with a greater striatal response to happy faces in the fMRI study were associated with longer gaze duration at happy faces. Conclusions These results suggest that CNR1 variations modulate the striatal function that underlies the perception of signals of social reward, such as happy faces. This suggests that CNR1 is a key element in the molecular architecture of perception of certain basic emotions. This may have implications for understanding neurodevelopmental conditions marked by atypical eye contact and facial emotion processing

  2. From Structural Variation of Gene Molecules to Chromatin Dynamics and Transcriptional Bursting

    Directory of Open Access Journals (Sweden)

    Hinrich Boeger

    2015-06-01

    Full Text Available Transcriptional activation of eukaryotic genes is accompanied, in general, by a change in the sensitivity of promoter chromatin to endonucleases. The structural basis of this alteration has remained elusive for decades; but the change has been viewed as a transformation of one structure into another, from “closed” to “open” chromatin. In contradistinction to this static and deterministic view of the problem, a dynamical and probabilistic theory of promoter chromatin has emerged as its solution. This theory, which we review here, explains observed variation in promoter chromatin structure at the level of single gene molecules and provides a molecular basis for random bursting in transcription—the conjecture that promoters stochastically transition between transcriptionally conducive and inconducive states. The mechanism of transcriptional regulation may be understood only in probabilistic terms.

  3. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2......,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant...... where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine...

  4. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2016-01-01

    single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2......,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant...... where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine...

  5. Variation in the sequence and modification state of the human insulin gene flanking regions.

    Science.gov (United States)

    Ullrich, A; Dull, T J; Gray, A; Philips, J A; Peter, S

    1982-04-10

    The nucleotide sequence of a highly repetitive sequence region upstream from the human insulin gene is reported. The length of this region varies between alleles in the population, and appears to be stably transmitted to the next generation in a Mendelian fashion. There is no significant correlation between the length of this sequence and two types of diabetes mellitus. We observe variation in the cleavability of a BglI recognition site downstream from the human insulin gene, which is probably due to variable nucleotide modification. This presumed modification state appears not to be inherited, and varies between tissues within an individual and between individuals for a given tissue. Both alleles in a given tissue DNA sample are modified to the same extent.

  6. Anatomically weighted second-order total variation reconstruction of 23Na MRI using prior information from 1H MRI.

    Science.gov (United States)

    Gnahm, Christine; Nagel, Armin M

    2015-01-15

    Sodium ((23)Na) MRI is a noninvasive tool to assess cell viability, which is linked to the total tissue sodium concentration (TSC). However, due to low in vivo concentrations, (23)Na MRI suffers from low signal-to-noise ratio (SNR) and limited spatial resolution. As a result, image quality is compromised by Gibbs ringing artifacts and partial volume effects. An iterative reconstruction algorithm that incorporates prior information from (1)H MRI is developed to reduce partial volume effects and to increase the SNR in non-proton MRI. Anatomically weighted second-order total variation (AnaWeTV) is proposed as a constraint for compressed sensing reconstruction of 3D projection reconstruction (3DPR) data. The method is evaluated in simulations and a MR measurement of a multiple sclerosis (MS) patient by comparing it to gridding and other reconstruction techniques. AnaWeTV increases resolution of known structures and reduces partial volume effects. In simulated MR brain data (nominal resolution Δx(3) = 3 × 3 × 3 mm(3)), the intensity error of four small MS lesions was reduced from (6.9 ± 3.8)% (gridding) to (2.8 ± 1.4)% (AnaWeTV with T2-weighted reference images). Compared to gridding, a substantial SNR increase of 130% was found in the white matter of the MS patient. The algorithm is robust against misalignment of the prior information on the order of the (23)Na image resolution. Features without prior information are still reconstructed with high contrast. AnaWeTV allows a more precise quantification of TSC in structures with prior knowledge. Thus, the AnaWeTV algorithm is in particular beneficial for the assessment of tissue structures that are visible in both (23)Na and (1)H MRI.

  7. Genetic variation in the serotonin transporter gene influences ERP old/new effects during recognition memory.

    Science.gov (United States)

    Ross, Robert S; Medrano, Paolo; Boyle, Kaitlin; Smolen, Andrew; Curran, Tim; Nyhus, Erika

    2015-11-01

    Recognition memory is defined as the ability to recognize a previously encountered stimulus and has been associated with spatially and temporally distinct event-related potentials (ERPs). Allelic variations of the serotonin transporter gene (SLC6A4) have recently been shown to impact memory performance. Common variants of the serotonin transporter-linked polymorphic region (5HTTLPR) of the SLC6A4 gene result in long (l) and short (s) allelic variants with carriers of the s allele having lowered transcriptional efficiency. Thus, the current study examines the effects polymorphisms of the SLC6A4 gene have on performance and ERP amplitudes commonly associated with recognition memory. Electroencephalogram (EEG), genetic, and behavioral data were collected from sixty participants as they performed an item and source memory recognition task. In both tasks, participants studied and encoded 200 words, which were then mixed with 200 new words during retrieval. Participants were monitored with EEG during the retrieval portion of each memory task. EEG electrodes were grouped into four ROIs, left anterior superior, right anterior superior, left posterior superior, and right posterior superior. ERP mean amplitudes during hits in the item and source memory task were compared to correctly recognizing new items (correct rejections). Results show that s-carriers have decreased mean hit amplitudes in both the right anterior superior ROI 1000-1500ms post stimulus during the source memory task and the left anterior superior ROI 300-500ms post stimulus during the item memory task. These results suggest that individual differences due to genetic variation of the serotonin transporter gene influences recognition memory.

  8. Diversity and population-genetic properties of copy number variations and multicopy genes in cattle.

    Science.gov (United States)

    Bickhart, Derek M; Xu, Lingyang; Hutchison, Jana L; Cole, John B; Null, Daniel J; Schroeder, Steven G; Song, Jiuzhou; Garcia, Jose Fernando; Sonstegard, Tad S; Van Tassell, Curtis P; Schnabel, Robert D; Taylor, Jeremy F; Lewin, Harris A; Liu, George E

    2016-06-01

    The diversity and population genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analysed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, and Romagnola), sequenced to 11-fold coverage to identify 1,853 non-redundant CNV regions. Supported by high validation rates in array comparative genomic hybridization (CGH) and qPCR experiments, these CNV regions accounted for 3.1% (87.5 Mb) of the cattle reference genome, representing a significant increase over previous estimates of the area of the genome that is copy number variable (∼2%). Further population genetics and evolutionary genomics analyses based on these CNVs revealed the population structures of the cattle taurine and indicine breeds and uncovered potential diversely selected CNVs near important functional genes, including AOX1, ASZ1, GAT, GLYAT, and KRTAP9-1 Additionally, 121 CNV gene regions were found to be either breed specific or differentially variable across breeds, such as RICTOR in dairy breeds and PNPLA3 in beef breeds. In contrast, clusters of the PRP and PAG genes were found to be duplicated in all sequenced animals, suggesting that subfunctionalization, neofunctionalization, or overdominance play roles in diversifying those fertility-related genes. These CNV results provide a new glimpse into the diverse selection histories of cattle breeds and a basis for correlating structural variation with complex traits in the future. Published by Oxford University Press on behalf of Kazusa DNA Research Institute 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  9. Drd4 gene polymorphisms are associated with personality variation in a passerine bird.

    Science.gov (United States)

    Fidler, Andrew E; van Oers, Kees; Drent, Piet J; Kuhn, Sylvia; Mueller, Jakob C; Kempenaers, Bart

    2007-07-22

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, genotype-environment interactions and confounding environmental factors all act to obscure genotype-personality relationships. Such problems can be addressed by measuring personality under standardized conditions and by selection experiments, with both approaches only feasible with non-human animals. Looking for similar Drd4 genotype-personality associations in a free-living bird, the great tit (Parus major), we detected 73 polymorphisms (66 SNPs, 7 indels) in the P. major Drd4 orthologue. Two of the P. major Drd4 gene polymorphisms were investigated for evidence of association with novelty-seeking behaviour: a coding region synonymous single nucleotide polymorphism (SNP830) and a 15bp indel (ID15) located 5' to the putative transcription initiation site. Frequencies of the three Drd4 SNP830 genotypes, but not the ID15 genotypes, differed significantly between two P. major lines selected over four generations for divergent levels of 'early exploratory behaviour' (EEB). Strong corroborating evidence for the significance of this finding comes from the analysis of free-living, unselected birds where we found a significant association between SNP830 genotypes and differing mean EEB levels. These findings suggest that an association between Drd4 gene polymorphisms and animal personality variation predates the divergence of the avian and mammalian lineages. Furthermore, this work heralds the possibility of following microevolutionary changes in frequencies of behaviourally relevant Drd4 polymorphisms within populations where natural selection acts differentially on different personality types.

  10. Genetic Variation in Osteopontin Gene Is Associated with Susceptibility to Sarcoidosis in Slovenian Population

    Directory of Open Access Journals (Sweden)

    A. Maver

    2009-01-01

    Full Text Available Sarcoidosis is a systemic inflammatory disease characterised by appearance of granulomas. Precise etiology has not been elucidated. Osteopontin (Opn is a Th1 cytokine whose levels have been found increased in granulomas and serum samples from patients with sarcoidosis. We investigated whether genetic variation in Osteopontin gene (OPN gene contributes to susceptibility to sarcoidosis. Haplotype-block structure in the OPN gene region was investigated using data from HapMap project. Three representative SNPs have been selected from each block of SNPs in linkage disequilibrium (rs11730582-C/T, rs11728697-C/T and rs4754-C/T. Genotyping was performed using TaqMan SNP Genotyping Assays on a sample of 165 patients and 284 controls. Statistical analyses of association were performed using Chi-Square test and algorithms implemented in the haplo.stats and PHASE packages. Genotyping analysis revealed a significant difference in genotype frequencies at rs4754 polymorphism in groups of patients and controls under recessive genetic model (p=0.036, OR=1.99, 95%CI=1.04-3.82, CC homozygotes being significantly over-represented in the patients group. However these results failed to reach significance after correction for multiple testing (p=0.25. The frequencies of predicted haplotypes differed between patient and control groups, frequency of TTT haplotype was found to be significantly decreased in the group of patients with sarcoidosis (p=0.014, OR=0.40, 95%CI=0.20-0.79. Our results suggest that variation in the OPN gene might be significantly associated with sarcoidosis and that the TTT haplotype in OPN may act as a protective factor in sarcoidosis.

  11. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    DEFF Research Database (Denmark)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. ...... imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). CONCLUSION: These results, generated on a large cohort of women, revealed associations between inherited cellular transport gene variants and risk of EOC histologic subtypes.......BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes....... As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. METHODS: In total, DNA samples were obtained from 14,525 case subjects with invasive EOC...

  12. Molecular cloning and daily variations of the Period gene in a reef fish Siganus guttatus.

    Science.gov (United States)

    Park, Ji-Gweon; Park, Yong-Ju; Sugama, Nozomi; Kim, Se-Jae; Takemura, Akihiro

    2007-04-01

    As the first step in understanding the molecular oscillation of the circa rhythms in the golden rabbitfish Siganus guttatus--a reef fish with a definite lunar-related rhythmicity--we cloned and sequenced a Period gene (rfPer). The rfPer gene contained an open reading frame that encodes a protein consisting of 1,452 amino acids; this protein is highly homologous to PER proteins of vertebrates including zebrafish. Phylogenetic analyses indicated that the rfPER protein is related to the zebrafish PER1 and PER4. The expression of rfPer mRNA in the whole brain, retina, and liver under light/dark (LD) conditions increased at 06:00 h and decreased at 18:00 h, suggesting that its robust circadian rhythm occurs in neural and peripheral tissues. When daily variation in the expression in rfPer mRNA in the whole brain and cultured pineal gland were examined under LD conditions, similar expression patterns of the gene were observed with an increase around dawn. Under constant light condition, the increased expression of rfPer mRNA in the whole brain disappeared around dawn. The present results demonstrate that rfPer is related to zPer4 and possibly zPer1. The present study is the first report on the Period gene from a marine fish.

  13. TIR-NBS-LRR genes are rare in monocots: evidence from diverse monocot orders

    Directory of Open Access Journals (Sweden)

    Tarr D Ellen K

    2009-09-01

    Full Text Available Abstract Background Plant resistance (R gene products recognize pathogen effector molecules. Many R genes code for proteins containing nucleotide binding site (NBS and C-terminal leucine-rich repeat (LRR domains. NBS-LRR proteins can be divided into two groups, TIR-NBS-LRR and non-TIR-NBS-LRR, based on the structure of the N-terminal domain. Although both classes are clearly present in gymnosperms and eudicots, only non-TIR sequences have been found consistently in monocots. Since most studies in monocots have been limited to agriculturally important grasses, it is difficult to draw conclusions. The purpose of our study was to look for evidence of these sequences in additional monocot orders. Findings Using degenerate PCR, we amplified NBS sequences from four monocot species (C. blanda, D. marginata, S. trifasciata, and Spathiphyllum sp., a gymnosperm (C. revoluta and a eudicot (C. canephora. We successfully amplified TIR-NBS-LRR sequences from dicot and gymnosperm DNA, but not from monocot DNA. Using databases, we obtained NBS sequences from additional monocots, magnoliids and basal angiosperms. TIR-type sequences were not present in monocot or magnoliid sequences, but were present in the basal angiosperms. Phylogenetic analysis supported a single TIR clade and multiple non-TIR clades. Conclusion We were unable to find monocot TIR-NBS-LRR sequences by PCR amplification or database searches. In contrast to previous studies, our results represent five monocot orders (Poales, Zingiberales, Arecales, Asparagales, and Alismatales. Our results establish the presence of TIR-NBS-LRR sequences in basal angiosperms and suggest that although these sequences were present in early land plants, they have been reduced significantly in monocots and magnoliids.

  14. RUNX1 contributes to higher-order chromatin organization and gene regulation in breast cancer cells.

    Science.gov (United States)

    Barutcu, A Rasim; Hong, Deli; Lajoie, Bryan R; McCord, Rachel Patton; van Wijnen, Andre J; Lian, Jane B; Stein, Janet L; Dekker, Job; Imbalzano, Anthony N; Stein, Gary S

    2016-11-01

    RUNX1 is a transcription factor functioning both as an oncogene and a tumor suppressor in breast cancer. RUNX1 alters chromatin structure in cooperation with chromatin modifier and remodeling enzymes. In this study, we examined the relationship between RUNX1-mediated transcription and genome organization. We characterized genome-wide RUNX1 localization and performed RNA-seq and Hi-C in RUNX1-depleted and control MCF-7 breast cancer cells. RNA-seq analysis showed that RUNX1 depletion led to up-regulation of genes associated with chromatin structure and down-regulation of genes related to extracellular matrix biology, as well as NEAT1 and MALAT1 lncRNAs. Our ChIP-Seq analysis supports a prominent role for RUNX1 in transcriptional activation. About 30% of all RUNX1 binding sites were intergenic, indicating diverse roles in promoter and enhancer regulation and suggesting additional functions for RUNX1. Hi-C analysis of RUNX1-depleted cells demonstrated that overall three-dimensional genome organization is largely intact, but indicated enhanced association of RUNX1 near Topologically Associating Domain (TAD) boundaries and alterations in long-range interactions. These results suggest an architectural role for RUNX1 in fine-tuning local interactions rather than in global organization. Our results provide novel insight into RUNX1-mediated perturbations of higher-order genome organization that are functionally linked with RUNX1-dependent compromised gene expression in breast cancer cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. A comprehensive characterization of the caspase gene family in insects from the order Lepidoptera

    Directory of Open Access Journals (Sweden)

    Vogel Heiko

    2011-07-01

    Full Text Available Abstract Background The cell suicide pathway of apoptosis is a necessary event in the life of multicellular organisms. It is involved in many biological processes ranging from development to the immune response. Evolutionarily conserved proteases, called caspases, play a central role in regulating apoptosis. Reception of death stimuli triggers the activation of initiator caspases, which in turn activate the effector caspases. In Lepidoptera, apoptosis is crucial in processes such as metamorphosis or defending against baculovirus infection. The discovery of p35, a baculovirus protein inhibiting caspase activity, has led to the characterization of the first lepidopteran caspase, Sf-Caspase-1. Studies on Sf-Caspase-1 mode of activation suggested that apoptosis in Lepidoptera requires a cascade of caspase activation, as demonstrated in many other species. Results In order to get insights into this gene family in Lepidoptera, we performed an extensive survey of lepidopteran-derived EST datasets. We identified 66 sequences distributed among 27 species encoding putative caspases. Phylogenetic analyses showed that Lepidoptera possess at least 5 caspases, for which we propose a unified nomenclature. According to homology to their Drosophila counterparts and their primary structure, we determined that Lep-Caspase-1, -2 and -3 are putative effector caspases, whereas Lep-Caspase-5 and -6 are putative initiators. The likely function of Lep-Caspase-4 remains unclear. Lep-Caspase-2 is absent from the silkworm genome and appears to be noctuid-specific, and to have arisen from a tandem duplication of the Caspase-1 gene. In the tobacco hawkmoth, 3 distinct transcripts encoding putative Caspase-4 were identified, suggesting at least 2 duplication events in this species. Conclusions The basic repertoire of five major types of caspases shared among Lepidoptera seems to be smaller than for most other groups studied to date, but gene duplication still plays a role in

  16. Mitochondrial genome sequence and gene order of Sipunculus nudus give additional support for an inclusion of Sipuncula into Annelida

    Directory of Open Access Journals (Sweden)

    Bartolomaeus Thomas

    2009-01-01

    Full Text Available Abstract Background Mitochondrial genomes are a valuable source of data for analysing phylogenetic relationships. Besides sequence information, mitochondrial gene order may add phylogenetically useful information, too. Sipuncula are unsegmented marine worms, traditionally placed in their own phylum. Recent molecular and morphological findings suggest a close affinity to the segmented Annelida. Results The first complete mitochondrial genome of a member of Sipuncula, Sipunculus nudus, is presented. All 37 genes characteristic for metazoan mtDNA were detected and are encoded on the same strand. The mitochondrial gene order (protein-coding and ribosomal RNA genes resembles that of annelids, but shows several derivations so far found only in Sipuncula. Sequence based phylogenetic analysis of mitochondrial protein-coding genes results in significant bootstrap support for Annelida sensu lato, combining Annelida together with Sipuncula, Echiura, Pogonophora and Myzostomida. Conclusion The mitochondrial sequence data support a close relationship of Annelida and Sipuncula. Also the most parsimonious explanation of changes in gene order favours a derivation from the annelid gene order. These results complement findings from recent phylogenetic analyses of nuclear encoded genes as well as a report of a segmental neural patterning in Sipuncula.

  17. Allelic variation of bile salt hydrolase genes in Lactobacillus salivarius does not determine bile resistance levels.

    LENUS (Irish Health Repository)

    Fang, Fang

    2009-09-01

    Commensal lactobacilli frequently produce bile salt hydrolase (Bsh) enzymes whose roles in intestinal survival are unclear. Twenty-six Lactobacillus salivarius strains from different sources all harbored a bsh1 allele on their respective megaplasmids. This allele was related to the plasmid-borne bsh1 gene of the probiotic strain UCC118. A second locus (bsh2) was found in the chromosomes of two strains that had higher bile resistance levels. Four Bsh1-encoding allele groups were identified, defined by truncations or deletions involving a conserved residue. In vitro analyses showed that this allelic variation was correlated with widely varying bile deconjugation phenotypes. Despite very low activity of the UCC118 Bsh1 enzyme, a mutant lacking this protein had significantly lower bile resistance, both in vitro and during intestinal transit in mice. However, the overall bile resistance phenotype of this and other strains was independent of the bsh1 allele type. Analysis of the L. salivarius transcriptome upon exposure to bile and cholate identified a multiplicity of stress response proteins and putative efflux proteins that appear to broadly compensate for, or mask, the effects of allelic variation of bsh genes. Bsh enzymes with different bile-degrading kinetics, though apparently not the primary determinants of bile resistance in L. salivarius, may have additional biological importance because of varying effects upon bile as a signaling molecule in the host.

  18. Genetic variation and population structure of interleukin genes among seven ethnic populations from Karnataka, India

    Indian Academy of Sciences (India)

    Srilakshmi M. Raj; Diddahally R. Govindaraju; Ranajit Chakraborty

    2007-12-01

    The extent of genetic variation and the degree of genetic differentiation among seven ethnic populations from Karnataka, India (Bunt, Havyak, Iyengar, Lingayath, Smartha, Vaishya, Vokkaliga), was investigated using four single nucleotide polymorphisms (SNPs: IL-1A 4845, IL-1B 3954, IL-1B 511 and IL-1RA 2018) of the interleukin gene cluster. Allele frequencies varied by threefold among these populations, which also differed for gene diversity and heterozygosity levels. The average degree of population subdivision among these castes was low ($F_{ST} = 0.02$). However, pair-wise interpopulation differentiation ranged from 0–7%, indicating no detectable differentiation to moderate differentiation between specific populations. The results of phylogenetic analysis based on genetic distances between populations agreed with known social and cultural data on these ethnic groups. Variation in the allele frequencies, as well as differentiation, may be attributed to differential selection and demographic factors including consanguinity among the ethnic groups. Information on the distribution of functionally relevant polymorphisms among ethnic populations may be important towards developing community medicine and public health policies.

  19. The impact of osteopontin gene variations on multiple sclerosis development and progression.

    Science.gov (United States)

    Comi, Cristoforo; Cappellano, Giuseppe; Chiocchetti, Annalisa; Orilieri, Elisabetta; Buttini, Sara; Ghezzi, Laura; Galimberti, Daniela; Guerini, Franca; Barizzone, Nadia; Perla, Franco; Leone, Maurizio; D'Alfonso, Sandra; Caputo, Domenico; Scarpini, Elio; Cantello, Roberto; Dianzani, Umberto

    2012-01-01

    Osteopontin is a proinflammatory molecule, modulating TH1 and TH17 responses. Several reports suggest its involvement in multiple sclerosis (MS) pathogenesis. We previously reported that OPN gene variations at the 3' end are a predisposing factor for MS development and evolution. In this paper, we extended our analysis to a gene variation at the 5' end on the -156G > GG single nucleotide polymorphism (SNP) and replicated our previous findings at the 3' end on the +1239A > C SNP. We found that only +1239A > C SNP displayed a statistically significant association with MS development, but both +1239A > C and -156G > GG had an influence on MS progression, since patients homozygous for both +1239A and -156GG alleles displayed slower progression of disability and slower switch to secondary progression than those carrying +1239C and/or -156G and those homozygous for +1239A only. Moreover, patients homozygous for +1239A also displayed a significantly lower relapse rate than those carrying +1239C, which is in line with the established role of OPN in MS relapses.

  20. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy

    Directory of Open Access Journals (Sweden)

    Helle Ruff Laursen

    2014-12-01

    Full Text Available The neuromodulators oxytocin and serotonin have been implicated in regulating affective processes underlying empathy. Understanding this dependency, however, has been limited by a lack of objective metrics for measuring empathic performance. Here we employ a novel psychophysical method for measuring empathic performance that quantitatively measures the ability of subjects to decode the experience of another person’s pain. In 50 female subjects, we acquired functional magnetic resonance imaging data as they were exposed to a target subject experiencing variable degrees of pain, whilst performing an irrelevant attention-demanding task. We investigated the effect of variation in the oxytocin receptor gene (OXTR and the serotonin transporter gene (SLC6A4 on the psychophysical and neurometric variability associated with empathic performance. The OXTR rs2268498 and rs53576 polymorphisms, but not the SLC6A4 5-HTTLPR, were associated with significant differences in empathic accuracy, with CC- and AA-carriers, respectively, displaying higher empathic accuracy. For OXTR rs2268498 there was also a genotype difference in the correlation between empathic accuracy and activity in the superior temporal sulcus (STS. In OXTR rs2268498 CC-carriers, high empathic accuracy was associated with stronger responsiveness of the right STS to the observed pain. Together, the results show that genetic variation in the OXTR has significant influence on empathic accuracy and that this may be linked to variable responsivity of the STS.

  1. Nucleotide variation at the dopa decarboxylase (Ddc) gene in natural populations of Drosophila melanogaster

    Indian Academy of Sciences (India)

    Andrey Tatarenkov; Francisco J. Ayala

    2007-08-01

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald–Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the -test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.

  2. Genomic Copy Number Variations of the Complement Component C4B Gene Are Associated With Chronic Central Serous Chorioretinopathy

    NARCIS (Netherlands)

    Breukink, M.B.; Schellevis, R.L.; Boon, C.J.F.; Fauser, S.; Hoyng, C.B.; Hollander, A.I. den; Jong, E.K.

    2015-01-01

    PURPOSE: Chronic central serous chorioretinopathy (cCSC) has recently been associated to variants in the complement factor H gene. To further investigate the role of the complement system in cCSC, the genomic copy number variations in the complement component 4 gene (C4) were studied. METHODS: C4A

  3. MHC class II genes in the European badger (Meles meles) : Characterization, patterns of variation, and transcription analysis

    NARCIS (Netherlands)

    Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry

    The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the

  4. Genomic Copy Number Variations of the Complement Component C4B Gene Are Associated With Chronic Central Serous Chorioretinopathy

    NARCIS (Netherlands)

    Breukink, M.B.; Schellevis, R.L.; Boon, C.J.F.; Fauser, S.; Hoyng, C.B.; Hollander, A.I. den; Jong, E.K.

    2015-01-01

    PURPOSE: Chronic central serous chorioretinopathy (cCSC) has recently been associated to variants in the complement factor H gene. To further investigate the role of the complement system in cCSC, the genomic copy number variations in the complement component 4 gene (C4) were studied. METHODS: C4A a

  5. MHC class II genes in the European badger (Meles meles) : Characterization, patterns of variation, and transcription analysis

    NARCIS (Netherlands)

    Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry

    2012-01-01

    The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the pre

  6. Identifying regulational alterations in gene regulatory networks by state space representation of vector autoregressive models and variational annealing.

    Science.gov (United States)

    Kojima, Kaname; Imoto, Seiya; Yamaguchi, Rui; Fujita, André; Yamauchi, Mai; Gotoh, Noriko; Miyano, Satoru

    2012-01-01

    In the analysis of effects by cell treatment such as drug dosing, identifying changes on gene network structures between normal and treated cells is a key task. A possible way for identifying the changes is to compare structures of networks estimated from data on normal and treated cells separately. However, this approach usually fails to estimate accurate gene networks due to the limited length of time series data and measurement noise. Thus, approaches that identify changes on regulations by using time series data on both conditions in an efficient manner are demanded. We propose a new statistical approach that is based on the state space representation of the vector autoregressive model and estimates gene networks on two different conditions in order to identify changes on regulations between the conditions. In the mathematical model of our approach, hidden binary variables are newly introduced to indicate the presence of regulations on each condition. The use of the hidden binary variables enables an efficient data usage; data on both conditions are used for commonly existing regulations, while for condition specific regulations corresponding data are only applied. Also, the similarity of networks on two conditions is automatically considered from the design of the potential function for the hidden binary variables. For the estimation of the hidden binary variables, we derive a new variational annealing method that searches the configuration of the binary variables maximizing the marginal likelihood. For the performance evaluation, we use time series data from two topologically similar synthetic networks, and confirm that our proposed approach estimates commonly existing regulations as well as changes on regulations with higher coverage and precision than other existing approaches in almost all the experimental settings. For a real data application, our proposed approach is applied to time series data from normal Human lung cells and Human lung cells treated by

  7. ASSESSMENT OF GENETIC VARIATION OF PEARL OYSTER, Pinctada maxima, BASED ON THE ANALYSIS OF MITOCHONDRIAL CYTOCHROME OXIDASE SUBUNIT I GENE

    Directory of Open Access Journals (Sweden)

    Achmad Sudradjat

    2009-06-01

    Full Text Available Pearl oyster, Pinctada maxima is one of economical ly important species in aquaculture, particularly in pearl industry. Information on genetic variation of pearl oyster is required in order to be able to make a sound management of it’s natural populations and to utilize it to improve the quality of pearl culture. Five populations from different geographic locations of pearl oyster, Pinctada maxima, (Sumbawa, Bali, Selat Sunda, Belitung, and South Sulawesi were analyzed for genetic variation within a 750-base pair region of the Mitochondrial Cytochrome Oxidase subunit I (MtCOI gene using Restriction Fragment Length Polymorphism (RFLP technique. The analysis of 25 pearl oyster samples, their haplotype diversity ranged from 0.0970 to 0.1939 and the number of haplotype in each population ranged from three to five haplotypes. Clustering of populations based on Nei’s genetic distances and constructed using unweighted pair-group method with Arithmetic mean (UPGMA showed that the populations were clustered into two groups: Belitung, Selat Sunda, Bali and Sumbawa in one group, while South Sulawesi in the second group.

  8. Polymorphic genes of major effect: consequences for variation, selection and evolution in Arabidopsis thaliana.

    Science.gov (United States)

    Stinchcombe, John R; Weinig, Cynthia; Heath, Katy D; Brock, Marcus T; Schmitt, Johanna

    2009-07-01

    The importance of genes of major effect for evolutionary trajectories within and among natural populations has long been the subject of intense debate. For example, if allelic variation at a major-effect locus fundamentally alters the structure of quantitative trait variation, then fixation of a single locus can have rapid and profound effects on the rate or direction of subsequent evolutionary change. Using an Arabidopsis thaliana RIL mapping population, we compare G-matrix structure between lines possessing different alleles at ERECTA, a locus known to affect ecologically relevant variation in plant architecture. We find that the allele present at ERECTA significantly alters G-matrix structure-in particular the genetic correlations between branch number and flowering time traits-and may also modulate the strength of natural selection on these traits. Despite these differences, however, when we extend our analysis to determine how evolution might differ depending on the ERECTA allele, we find that predicted responses to selection are similar. To compare responses to selection between allele classes, we developed a resampling strategy that incorporates uncertainty in estimates of selection that can also be used for statistical comparisons of G matrices.

  9. Patterns of nucleotide sequence variation in ICAM1 and TNF genes in twelve ethnic groups of India: roles of demographic history and natural selection

    Indian Academy of Sciences (India)

    Sanghamitra Sengupta; Shabana Farheen; Neelanjana Mukherjee; Partha P. Majumder

    2007-12-01

    We have studied DNA sequence variation in and around the genes ICAM1 and TNF, which play functional and correlated roles in inflammatory processes and immune cell responses, in 12 diverse ethnic groups of India, with a view to investigating the relative roles of demographic history and natural selection in shaping the observed patterns of variation. The total numbers of single nucleotide polymorphisms (SNPs) detected at the ICAM1 and TNF loci were 29 and 12, respectively. Haplotype and allele frequencies differed significantly across populations. The site frequency spectra at these loci were significantly different from those expected under neutrality, and showed an excess of intermediate-frequency variants consistent with balancing selection. However, as expected under balancing selection, there was no significant reduction of $F_{ST}$ values compared to neutral autosomal loci. Mismatch distributions were consistent with population expansion for both loci. On the other hand, the phylogenetic network among haplotypes for the TNF locus was similar to expectations under population expansion, while that for the ICAM1 was as expected under balancing selection. Nucleotide diversity at the ICAM1 locus was an order of magnitude lower in the promoter region, compared to the introns or exons, but no such difference was noted for the TNF gene. Thus, we conclude that the pattern of nucleotide variation in these genes has been modulated by both demographic history and selection. This is not surprising in view of the known allelic associations of several polymorphisms in these genes with various diseases, both infectious and noninfectious.

  10. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.

    Directory of Open Access Journals (Sweden)

    Ganna Chornokur

    Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular

  11. Genetic variations in the CLU and PICALM genes are associated with cognitive function in the oldest old

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Christensen, Kaare; McGue, Matt

    2011-01-01

    Recently, two large, and independent genome wide association studies of late-onset Alzheimer's disease (AD) established association with the same rs11136000 variation in the clusterin (CLU) gene. In addition, one variation, rs3851179, in the phosphatidylinositol binding clathrin assembly protein...... (PICALM) gene and one variation, rs6656401, in the complement component (3b/4b) receptor 1 (CR) gene were associated with AD. Here, we replicate these associations with cognitive functioning in 1380 individuals from the Danish (1905) birth cohort study of the oldest old (92-93 years at intake) using...... measures of Mini Mental State Examination (MMSE) and a cognitive composite score. We found a significant association between the highly frequent CLU rs11136000 T allele (38%) and better performance on the cognitive composite score (p = 0.016) explaining 0.5% of the mean variation in cognitive composite...

  12. Allelic diversity in an NLR gene BPH9 enables rice to combat planthopper variation.

    Science.gov (United States)

    Zhao, Yan; Huang, Jin; Wang, Zhizheng; Jing, Shengli; Wang, Yang; Ouyang, Yidan; Cai, Baodong; Xin, Xiu-Fang; Liu, Xin; Zhang, Chunxiao; Pan, Yufang; Ma, Rui; Li, Qiaofeng; Jiang, Weihua; Zeng, Ya; Shangguan, Xinxin; Wang, Huiying; Du, Bo; Zhu, Lili; Xu, Xun; Feng, Yu-Qi; He, Sheng Yang; Chen, Rongzhi; Zhang, Qifa; He, Guangcun

    2016-10-24

    Brown planthopper (BPH), Nilaparvata lugens Stål, is one of the most devastating insect pests of rice (Oryza sativa L.). Currently, 30 BPH-resistance genes have been genetically defined, most of which are clustered on specific chromosome regions. Here, we describe molecular cloning and characterization of a BPH-resistance gene, BPH9, mapped on the long arm of rice chromosome 12 (12L). BPH9 encodes a rare type of nucleotide-binding and leucine-rich repeat (NLR)-containing protein that localizes to the endomembrane system and causes a cell death phenotype. BPH9 activates salicylic acid- and jasmonic acid-signaling pathways in rice plants and confers both antixenosis and antibiosis to BPH. We further demonstrated that the eight BPH-resistance genes that are clustered on chromosome 12L, including the widely used BPH1, are allelic with each other. To honor the priority in the literature, we thus designated this locus as BPH1/9 These eight genes can be classified into four allelotypes, BPH1/9-1, -2, -7, and -9 These allelotypes confer varying levels of resistance to different biotypes of BPH. The coding region of BPH1/9 shows a high level of diversity in rice germplasm. Homologous fragments of the nucleotide-binding (NB) and leucine-rich repeat (LRR) domains exist, which might have served as a repository for generating allele diversity. Our findings reveal a rice plant strategy for modifying the genetic information to gain the upper hand in the struggle against insect herbivores. Further exploration of natural allelic variation and artificial shuffling within this gene may allow breeding to be tailored to control emerging biotypes of BPH.

  13. Genetic variation in exon 5 of troponin - I gene in hypertrophic cardiomyopathy cases

    Directory of Open Access Journals (Sweden)

    Annapurna S

    2007-01-01

    Full Text Available Background: Cardiomyopathies are a heterogeneous group of heart muscle disorders and are classified as 1 Hypertrophic Cardiomyopathy (HCM 2 Dilated cardiomyopathy (DCM 3 Restrictive cardiomyopathy (RCM and 4 Arrhythmogenic right ventricular dysplasia (ARVD as per WHO classification, of which HCM and DCM are common. HCM is a complex but relatively common form of inherited heart muscle disease with prevalence of 1 in 500 individuals and is commonly associated with sarcomeric gene mutations. Cardiac muscle troponin I (TNNI-3 is one such sarcomeric protein and is a subunit of the thin filament-associated troponin-tropomyosin complex involved in calcium regulation of skeletal and cardiac muscle contraction. Mutations in this gene were found to be associated with a history of sudden cardiac death in HCM patients. Aim: Therefore the present study aims to identify for mutations associated with troponin I gene in a set of HCM patients from Indian population. Materials and Methods: Mutational analyses of 92 HCM cases were carried out following PCR based SSCP analysis. Results: The study revealed band pattern variation in 3 cases from a group of 92 HCM patients. This band pattern variation, on sequencing revealed base changes, one at nt 2560 with G>T transversion in exon-5 region with a wobble and others at nt 2479 and nt 2478 with G>C and C>G transversions in the intronic region upstream of the exon 5 on sequencing. Further analysis showed that one of the probands showed apical form of hypertrophy, two others showing asymmetric septal hypertrophy. Two of these probands showed family history of the condition. Conclusions: Hence, the study supports earlier reports of involvement of TNNI-3 in the causation of apical and asymmetrical forms of hypertrophy.

  14. Genomic imprinting variations in the mouse type 3 deiodinase gene between tissues and brain regions.

    Science.gov (United States)

    Martinez, M Elena; Charalambous, Marika; Saferali, Aabida; Fiering, Steven; Naumova, Anna K; St Germain, Donald; Ferguson-Smith, Anne C; Hernandez, Arturo

    2014-11-01

    The Dio3 gene, which encodes for the type 3 deiodinase (D3), controls thyroid hormone (TH) availability. The lack of D3 in mice results in tissue overexposure to TH and a broad neuroendocrine phenotype. Dio3 is an imprinted gene, preferentially expressed from the paternally inherited allele in the mouse fetus. However, heterozygous mice with paternal inheritance of the inactivating Dio3 mutation exhibit an attenuated phenotype when compared with that of Dio3 null mice. To investigate this milder phenotype, the allelic expression of Dio3 was evaluated in different mouse tissues. Preferential allelic expression of Dio3 from the paternal allele was observed in fetal tissues and neonatal brain regions, whereas the biallelic Dio3 expression occurred in the developing eye, testes, and cerebellum and in the postnatal brain neocortex, which expresses a larger Dio3 mRNA transcript. The newborn hypothalamus manifests the highest degree of Dio3 expression from the paternal allele, compared with other brain regions, and preferential allelic expression of Dio3 in the brain relaxed in late neonatal life. A methylation analysis of two regulatory regions of the Dio3 imprinted domain revealed modest but significant differences between tissues, but these did not consistently correlate with the observed patterns of Dio3 allelic expression. Deletion of the Dio3 gene and promoter did not result in significant changes in the tissue-specific patterns of Dio3 allelic expression. These results suggest the existence of unidentified epigenetic determinants of tissue-specific Dio3 imprinting. The resulting variation in the Dio3 allelic expression between tissues likely explains the phenotypic variation that results from paternal Dio3 haploinsufficiency.

  15. Gene expression variation to predict 10-year survival in lymph-node-negative breast cancer

    Directory of Open Access Journals (Sweden)

    Karlsson Per

    2008-09-01

    Full Text Available Abstract Background It is of great significance to find better markers to correctly distinguish between high-risk and low-risk breast cancer patients since the majority of breast cancer cases are at present being overtreated. Methods 46 tumours from node-negative breast cancer patients were studied with gene expression microarrays. A t-test was carried out in order to find a set of genes where the expression might predict clinical outcome. Two classifiers were used for evaluation of the gene lists, a correlation-based classifier and a Voting Features Interval (VFI classifier. We then evaluated the predictive accuracy of this expression signature on tumour sets from two similar studies on lymph-node negative patients. They had both developed gene expression signatures superior to current methods in classifying node-negative breast tumours. These two signatures were also tested on our material. Results A list of 51 genes whose expression profiles could predict clinical outcome with high accuracy in our material (96% or 89% accuracy in cross-validation, depending on type of classifier was developed. When tested on two independent data sets, the expression signature based on the 51 identified genes had good predictive qualities in one of the data sets (74% accuracy, whereas their predictive value on the other data set were poor, presumably due to the fact that only 23 of the 51 genes were found in that material. We also found that previously developed expression signatures could predict clinical outcome well to moderately well in our material (72% and 61%, respectively. Conclusion The list of 51 genes derived in this study might have potential for clinical utility as a prognostic gene set, and may include candidate genes of potential relevance for clinical outcome in breast cancer. According to the predictions by this expression signature, 30 of the 46 patients may have benefited from different adjuvant treatment than they recieved. Trial

  16. Average correlation clustering algorithm (ACCA) for grouping of co-regulated genes with similar pattern of variation in their expression values.

    Science.gov (United States)

    Bhattacharya, Anindya; De, Rajat K

    2010-08-01

    Distance based clustering algorithms can group genes that show similar expression values under multiple experimental conditions. They are unable to identify a group of genes that have similar pattern of variation in their expression values. Previously we developed an algorithm called divisive correlation clustering algorithm (DCCA) to tackle this situation, which is based on the concept of correlation clustering. But this algorithm may also fail for certain cases. In order to overcome these situations, we propose a new clustering algorithm, called average correlation clustering algorithm (ACCA), which is able to produce better clustering solution than that produced by some others. ACCA is able to find groups of genes having more common transcription factors and similar pattern of variation in their expression values. Moreover, ACCA is more efficient than DCCA with respect to the time of execution. Like DCCA, we use the concept of correlation clustering concept introduced by Bansal et al. ACCA uses the correlation matrix in such a way that all genes in a cluster have the highest average correlation values with the genes in that cluster. We have applied ACCA and some well-known conventional methods including DCCA to two artificial and nine gene expression datasets, and compared the performance of the algorithms. The clustering results of ACCA are found to be more significantly relevant to the biological annotations than those of the other methods. Analysis of the results show the superiority of ACCA over some others in determining a group of genes having more common transcription factors and with similar pattern of variation in their expression profiles. Availability of the software: The software has been developed using C and Visual Basic languages, and can be executed on the Microsoft Windows platforms. The software may be downloaded as a zip file from http://www.isical.ac.in/~rajat. Then it needs to be installed. Two word files (included in the zip file) need to

  17. Copy number variations of the ATP-binding cassette transporter ABCC6 gene and its pseudogenes

    Directory of Open Access Journals (Sweden)

    Kringen Marianne K

    2012-08-01

    Full Text Available Abstract Background The ATP-binding cassette transporter ABCC6 gene is located on chromosome 16 between its two pseudogenes (ABCC6P1 and ABCC6P2. Previously, we have shown that ABCC6P1 is transcribed and affects ABCC6 at the transcriptional level. In this study we aimed to determine copy number variations of ABCC6, ABCC6P1 and ABCC6P2 in different populations. Moreover, we sought to study the transcription pattern of ABCC6 and ABCC6 pseudogenes in 39 different human tissues. Findings Genomic DNA from healthy individuals from five populations, Chinese (n = 24, Middle East (n = 20, Mexicans (n = 24, Caucasians (n = 50 and Africans (n = 24, were examined for copy number variations of ABCC6 and its pseudogenes by pyrosequencing and quantitative PCR. Copy number variation of ABCC6 was very rare (2/142; 1.4%. However, one or three copies of ABCC6P1 were relatively common (3% and 8%, respectively. Only one person had a single copy of ABCC6P2 while none had three copies. In Chinese, deletions or duplications of ABCC6P1 were more frequent than in any other population (9/24; 37.5%. The transcription pattern of ABCC6P2 was highly similar to ABCC6 and ABCC6P1, with highest transcription in liver and kidney. Interestingly, the total transcription level of pseudogenes, ABCC6P1 + ABCC6P2, was higher than ABCC6 in most tissues, including liver and kidney. Conclusions Copy number variations of the ABCC6 pseudogenes are quite common, especially in populations of Chinese ancestry. The expression pattern of ABCC6P2 in 39 human tissues was highly similar to that of ABCC6 and ABCC6P1 suggesting similar regulatory mechanisms for ABCC6 and its pseudogenes.

  18. Genes and quantitative genetic variation involved with senescence in cells, organs and the whole plant

    Directory of Open Access Journals (Sweden)

    Benoit ePujol

    2015-02-01

    Full Text Available Senescence, the deterioration of morphological, physiological and reproductive functions with age that ends with the death of the organism, was widely studied in plants. Genes were identified that are linked to the deterioration of cells, organs and the whole plant. It is however unclear whether those genes are the source of age dependent deterioration or get activated to regulate such deterioration. Furthermore, it is also unclear whether such genes are active as a direct consequence of age or because they are specifically involved in some developmental stages. At the individual level, it is the relationship between quantitative genetic variation and age that can be used to detect the genetic signature of senescence. Surprisingly, the latter approach was only scarcely applied to plants. This may be the consequence of the demanding requirements for such approaches and/or the fact that most research interest was directed towards plants that avoid senescence. Here, I review those aspects in turn and call for an integrative genetic theory of senescence in plants. Such conceptual development would have implications for the management of plant genetic resources and generate progress on fundamental questions raised by ageing research.

  19. A Molecular Epidemiology Analysis of HIV in Shenzhen and HIV Env Gene Variation Replication Analysis

    Institute of Scientific and Technical Information of China (English)

    CHEN Lin(陈琳); FENG Tiejian(冯铁建); LI Liangcheng(李良成); HE Jianfan(何建凡)

    2002-01-01

    Objective: To analyze molecular trends of the HIV epidemic in Shenzhen.Methods: Serum collected from Shenzhen AIDS patientsbetween 1992-1999 was analyzed using molecular techniques.DNA fragments of the HIV-1 Env gene were amplified bynested PCR from uncultured peripheral blood mononuclearcells (PBMCs) from these serum samples. The C2-C3 region ofthe Env gene was sequenced and analyzed. Specific high-riskbehaviors were also analyzed.Results: We found that the transmission of HIV in the citywas mainly through sexual behaviors (46.0%). There werefour HIV-1 subtypes: B', B, C and E with 6.31%, 7.95%,3.09% and 8.92% gene divergence inside each subtype inShenzhen. These results suggested that epidemic times were 6,8, 3 and 9 respectively. The main epidemic subtypes were Eand B strains. AIDS patient's antigenic variation was slightlyhigher than that of HIV infected individuals.Conclusion: Surveillance data reflect trends and theepidemic time of HIV, which will be useful for policy makersto formulate effective strategies of HIV/AIDS prevention andcontrol in Shenzhen.

  20. Two complete mitochondrial genomes from Praticolella mexicana Perez, 2011 (Polygyridae) and gene order evolution in Helicoidea (Mollusca, Gastropoda)

    Science.gov (United States)

    Minton, Russell L.; Cruz, Marco A. Martinez; Farman, Mark L.; Perez, Kathryn E.

    2016-01-01

    Abstract Helicoidea is a diverse group of land snails with a global distribution. While much is known regarding the relationships of helicoid taxa, comparatively little is known about the evolution of the mitochondrial genome in the superfamily. We sequenced two complete mitochondrial genomes from Praticolella mexicana Perez, 2011 representing the first such data from the helicoid family Polygyridae, and used them in an evolutionary analysis of mitogenomic gene order. We found the mitochondrial genome of Praticolella mexicana to be 14,008 bp in size, possessing the typical 37 metazoan genes. Multiple alternate stop codons are used, as are incomplete stop codons. Mitogenome size and nucleotide content is consistent with other helicoid species. Our analysis of gene order suggested that Helicoidea has undergone four mitochondrial rearrangements in the past. Two rearrangements were limited to tRNA genes only, and two involved protein coding genes. PMID:27833437

  1. Molecular variation at a candidate gene implicated in the regulation of fire ant social behavior.

    Directory of Open Access Journals (Sweden)

    Dietrich Gotzek

    Full Text Available The fire ant Solenopsis invicta and its close relatives display an important social polymorphism involving differences in colony queen number. Colonies are headed by either a single reproductive queen (monogyne form or multiple queens (polygyne form. This variation in social organization is associated with variation at the gene Gp-9, with monogyne colonies harboring only B-like allelic variants and polygyne colonies always containing b-like variants as well. We describe naturally occurring variation at Gp-9 in fire ants based on 185 full-length sequences, 136 of which were obtained from S. invicta collected over much of its native range. While there is little overall differentiation between most of the numerous alleles observed, a surprising amount is found in the coding regions of the gene, with such substitutions usually causing amino acid replacements. This elevated coding-region variation may result from a lack of negative selection acting to constrain amino acid replacements over much of the protein, different mutation rates or biases in coding and non-coding sequences, negative selection acting with greater strength on non-coding than coding regions, and/or positive selection acting on the protein. Formal selection analyses provide evidence that the latter force played an important role in the basal b-like lineages coincident with the emergence of polygyny. While our data set reveals considerable paraphyly and polyphyly of S. invicta sequences with respect to those of other fire ant species, the b-like alleles of the socially polymorphic species are monophyletic. An expanded analysis of colonies containing alleles of this clade confirmed the invariant link between their presence and expression of polygyny. Finally, our discovery of several unique alleles bearing various combinations of b-like and B-like codons allows us to conclude that no single b-like residue is completely predictive of polygyne behavior and, thus, potentially causally

  2. Telomere length and variation in telomere biology genes in individuals with osteosarcoma.

    Science.gov (United States)

    Mirabello, Lisa; Richards, Elliott G; Duong, Linh M; Yu, Kai; Wang, Zhaoming; Cawthon, Richard; Berndt, Sonja I; Burdett, Laurie; Chowdhury, Salma; Teshome, Kedest; Douglass, Chester; Savage, Sharon A

    2011-01-01

    Osteosarcoma, the most common primary bone tumor, occurs most frequently in adolescents. Chromosomal aneuploidy is common in osteosarcoma cells, suggesting underlying chromosomal instability. Telomeres, located at chromosome ends, are essential for genomic stability; several studies have suggested that germline telomere length (TL) is associated with cancer risk. We hypothesized that TL and/or common genetic variation in telomere biology genes may be associated with risk of osteosarcoma. We investigated TL in peripheral blood DNA and 713 single nucleotide polymorphisms (SNPs) from 39 telomere biology genes in 98 osteosarcoma cases and 69 orthopedic controls. For the genotyping component, we added 1363 controls from the Prostate, Lung, Colorectal, and Ovarian Cancer ScreeningTrial. Short TL was not associated with osteosarcoma risk overall (OR 1.39, P=0.67), although there was a statistically significant association in females (OR 4.35, 95% Cl 1.20-15.74, P=0.03). Genotype analyses identified seven SNPs in TERF1 significantly associated with osteosarcoma risk after Bonferroni correction by gene. These SNPs were highly linked and associated with a reduced risk of osteosarcoma (OR 0.48-0.53, P=0.0001-0.0006). We also investigated associations between TL and telomere gene SNPs in osteosarcoma cases and orthopedic controls. Several SNPs were associated with TL prior to Bonferroni correction; one SNP in NOLA2 and one in MEN1 were marginally non-significant after correction (P(adj)=0.057 and 0.066, respectively). This pilot-study suggests that females with short telomeres may be at increased risk of osteosarcoma, and that SNPs in TERF1 are inversely associated with osteosarcoma risk.

  3. Genetic variation in the epidermal transglutaminase genes is not associated with atopic dermatitis.

    Directory of Open Access Journals (Sweden)

    Agne Liedén

    Full Text Available BACKGROUND: Atopic dermatitis (AD is a common chronic inflammatory skin disorder where epidermal barrier dysfunction is a major factor in the pathogenesis. The identification of AD susceptibility genes related to barrier dysfunction is therefore of importance. The epidermal transglutaminases (TGM1, TGM3 and TGM5 encodes essential cross-linking enzymes in the epidermis. OBJECTIVE: To determine whether genetic variability in the epidermal transglutaminases contributes to AD susceptibility. METHODS: Forty-seven single nucleotide polymorphisms (SNPs in the TGM1, TGM3 and TGM5 gene region were tested for genetic association with AD, independently and in relation to FLG genotype, using a pedigree disequilibrium test (PDT in a Swedish material consisting of 1753 individuals from 539 families. In addition, a German case-control material, consisting of 533 AD cases and 1996 controls, was used for in silico analysis of the epidermal TGM regions. Gene expression of the TGM1, TGM3 and TGM5 gene was investigated by relative quantification with Real Time PCR (qRT-PCR. Immunohistochemical (IHC analysis was performed to detect TG1, TG3 and TG5 protein expression in the skin of patients and healthy controls. RESULTS: PDT analysis identified a significant association between the TGM1 SNP rs941505 and AD with allergen-specific IgE in the Swedish AD family material. However, the association was not replicated in the German case-control material. No significant association was detected for analyzed SNPs in relation to FLG genotype. TG1, TG3 and TG5 protein expression was detected in AD skin and a significantly increased TGM3 mRNA expression was observed in lesional skin by qRT-PCR. CONCLUSION: Although TGM1 and TGM3 may be differentially expressed in AD skin, the results from the genetic analysis suggest that genetic variation in the epidermal transglutaminases is not an important factor in AD susceptibility.

  4. Genomic variation in the vomeronasal receptor gene repertoires of inbred mice

    Directory of Open Access Journals (Sweden)

    Wynn Elizabeth H

    2012-08-01

    Full Text Available Abstract Background Vomeronasal receptors (VRs, expressed in sensory neurons of the vomeronasal organ, are thought to bind pheromones and mediate innate behaviours. The mouse reference genome has over 360 functional VRs arranged in highly homologous clusters, but the vast majority are of unknown function. Differences in these receptors within and between closely related species of mice are likely to underpin a range of behavioural responses. To investigate these differences, we interrogated the VR gene repertoire from 17 inbred strains of mice using massively parallel sequencing. Results Approximately half of the 6222 VR genes that we investigated could be successfully resolved, and those that were unambiguously mapped resulted in an extremely accurate dataset. Collectively VRs have over twice the coding sequence variation of the genome average; but we identify striking non-random distribution of these variants within and between genes, clusters, clades and functional classes of VRs. We show that functional VR gene repertoires differ considerably between different Mus subspecies and species, suggesting these receptors may play a role in mediating behavioural adaptations. Finally, we provide evidence that widely-used, highly inbred laboratory-derived strains have a greatly reduced, but not entirely redundant capacity for differential pheromone-mediated behaviours. Conclusions Together our results suggest that the unusually variable VR repertoires of mice have a significant role in encoding differences in olfactory-mediated responses and behaviours. Our dataset has expanded over nine fold the known number of mouse VR alleles, and will enable mechanistic analyses into the genetics of innate behavioural differences in mice.

  5. Variation in fibrinogen FGG and FGA genes and risk of stroke: the Rotterdam Study.

    Science.gov (United States)

    Cheung, Elim Y L; Bos, Michiel J; Leebeek, Frank W G; Koudstaal, Peter J; Hofman, Albert; de Maat, Moniek P M; Breteler, Monique M B

    2008-08-01

    Haplotypes of the fibrinogen gamma and alpha (FGG and FGA) genes are associated with the structure of the fibrin network and may therefore influence the risk of stroke. We investigated the relationship between common variation in these genes with ischemic and haemorrhagic stroke. The study was based on 6,275 participants of the prospective population-based Rotterdam Study who at baseline (1990-1993) were aged 55 years or over, free from stroke, and had successful assessment of at least one FGG or FGA single nucleotide polymorphisms (SNP). Common haplotypes were estimated using seven tagging SNPs across a 30 kb region containing the FGG and FGA genes. Follow-up for incident stroke was complete until January 1, 2005. Associations between constructed haplotypes and risk of stroke were estimated with an age- and sex-adjusted logistic regression model. We observed 668 strokes, of which 393 were ischemic and 62 haemorrhagic, during a median follow-up time of 10.1 years. FGG + FGA haplotype 3 (H3) was associated with an increased risk of ischemic stroke (odds ratio [OR] 1.36, 95% confidence interval [CI] 1.09-1.69) and the risk estimate for hemorrhagic stroke was 0.71 (95% CI 0.46-1.09) compared to the most frequent H1. The FGG and FGA genes were not associated with stroke or its subtypes when analyzed separately. In conclusion, risk of ischemic stroke was higher in FGG + FGA H3 than in H1. The results suggested that an opposite association may exist for haemorrhagic stroke.

  6. Genetic variation at hair length candidate genes in elephants and the extinct woolly mammoth

    Directory of Open Access Journals (Sweden)

    Tisdale Michele

    2009-09-01

    Full Text Available Abstract Background Like humans, the living elephants are unusual among mammals in being sparsely covered with hair. Relative to extant elephants, the extinct woolly mammoth, Mammuthus primigenius, had a dense hair cover and extremely long hair, which likely were adaptations to its subarctic habitat. The fibroblast growth factor 5 (FGF5 gene affects hair length in a diverse set of mammalian species. Mutations in FGF5 lead to recessive long hair phenotypes in mice, dogs, and cats; and the gene has been implicated in hair length variation in rabbits. Thus, FGF5 represents a leading candidate gene for the phenotypic differences in hair length notable between extant elephants and the woolly mammoth. We therefore sequenced the three exons (except for the 3' UTR and a portion of the promoter of FGF5 from the living elephantid species (Asian, African savanna and African forest elephants and, using protocols for ancient DNA, from a woolly mammoth. Results Between the extant elephants and the mammoth, two single base substitutions were observed in FGF5, neither of which alters the amino acid sequence. Modeling of the protein structure suggests that the elephantid proteins fold similarly to the human FGF5 protein. Bioinformatics analyses and DNA sequencing of another locus that has been implicated in hair cover in humans, type I hair keratin pseudogene (KRTHAP1, also yielded negative results. Interestingly, KRTHAP1 is a pseudogene in elephantids as in humans (although fully functional in non-human primates. Conclusion The data suggest that the coding sequence of the FGF5 gene is not the critical determinant of hair length differences among elephantids. The results are discussed in the context of hairlessness among mammals and in terms of the potential impact of large body size, subarctic conditions, and an aquatic ancestor on hair cover in the Proboscidea.

  7. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Directory of Open Access Journals (Sweden)

    Olfa Siala

    2010-01-01

    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  8. Circadian variations of clock gene Per2 and cell cycle genes in different stages of carcinogenesis in golden hamster buccal mucosa.

    Science.gov (United States)

    Tan, Xue-Mei; Ye, Hua; Yang, Kai; Chen, Dan; Wang, Qing-Qing; Tang, Hong; Zhao, Ning-Bo

    2015-05-07

    Previous studies have suggested that the expression of clock genes have circadian rhythms, and many cell cycle genes are regulated by clock genes. The disruption of circadian rhythms appears to be associated with the acceleration of cancer development. To investigate the circadian patterns of the clock gene Per2 and of cell cycle genes p53, Cyclin D1, CDK1 and Cyclin B1 in different stages of carcinogenesis, the daily mRNA profiles of these genes were detected by real-time RT-PCR in dimethylbenzanthracene-induced cancer, in precancerous lesions and in normal tissues. Per2, p53, Cyclin D1 and CDK1 showed circadian rhythms in the 3 different stages of carcinogenesis, whereas the circadian rhythm of Cyclin B1 was absent in the precancerous lesions. The mesors and amplitudes of Per2 and p53 were decreased (P circadian pattern variations of these genes in different stages of carcinogenesis.

  9. Association between common variation in 120 candidate genes and breast cancer risk.

    Directory of Open Access Journals (Sweden)

    Paul D P Pharoah

    2007-03-01

    Full Text Available Association studies in candidate genes have been widely used to search for common low penetrance susceptibility alleles, but few definite associations have been established. We have conducted association studies in breast cancer using an empirical single nucleotide polymorphism (SNP tagging approach to capture common genetic variation in genes that are candidates for breast cancer based on their known function. We genotyped 710 SNPs in 120 candidate genes in up to 4,400 breast cancer cases and 4,400 controls using a staged design. Correction for population stratification was done using the genomic control method, on the basis of data from 280 genomic control SNPs. Evidence for association with each SNP was assessed using a Cochran-Armitage trend test (p-trend and a two-degrees of freedom chi(2 test for heterogeneity (p-het. The most significant single SNP (p-trend = 8 x 10(-5 was not significant at a nominal 5% level after adjusting for population stratification and multiple testing. To evaluate the overall evidence for an excess of positive associations over the proportion expected by chance, we applied two global tests: the admixture maximum likelihood (AML test and the rank truncated product (RTP test corrected for population stratification. The admixture maximum likelihood experiment-wise test for association was significant for both the heterogeneity test (p = 0.0031 and the trend test (p = 0.017, but no association was observed using the rank truncated product method for either the heterogeneity test or the trend test (p = 0.12 and p = 0.24, respectively. Genes in the cell-cycle control pathway and genes involved in steroid hormone metabolism and signalling were the main contributors to the association. These results suggest that a proportion of SNPs in these candidate genes are associated with breast cancer risk, but that the effects of individual SNPs is likely to be small. Large sample sizes from multicentre collaboration will be needed

  10. Genetic variation of Aflatoxin B(1) aldehyde reductase genes (AFAR) in human tumour cells

    DEFF Research Database (Denmark)

    Praml, Christian; Schulz, Wolfgang; Claas, Andreas

    2008-01-01

    . Furthermore, human AFAR1 catalyses the rate limiting step in the synthesis of the neuromodulator gamma-hydroxybutyrate (GHB) and was found elevated in neurodegenerative diseases such as Alzheimer's and dementia with Lewy bodies (DLB). The human AFAR gene family maps to a genomic region in 1p36 of frequent...... samples, we identified nine different amino acid changes; two were in AFAR1 and seven in AFAR2. In AFAR1, we found genetic variation in the proposed substrate-binding amino acid 113, encoding Ala(113) or Thr(113). An AFAR2 variant had a Glu(55) substituted by Lys(55) at a position that is conserved among...... many aldo-keto reductases. This polarity change may have an effect on the proposed substrate binding amino acids nearby (Met(47), Tyr(48), Asp(50)). Further population analyses and functional studies of the nine variants detected may show if these variants are disease-related....

  11. Plasma Fetuin-A concentration, genetic variation in the AHSG gene and risk of colorectal cancer

    DEFF Research Database (Denmark)

    Nimptsch, Katharina; Aleksandrova, Krasimira; Boeing, Heiner

    2015-01-01

    .93-1.22) in women, 1.13 (1.00-1.27) for colon cancer and 1.12 (0.94-1.32) for rectal cancer. To improve causal inference in a Mendelian Randomization approach, five tagging single nucleotide polymorphisms of the AHSG gene were genotyped in a subset of 456 case-control pairs. The AHSG allele-score explained 21......% of the interindividual variation in plasma fetuin-A concentrations. In instrumental variable analysis, genetically raised fetuin-A was not associated with colorectal cancer risk (relative risk per 40 µg/mL genetically determined higher fetuin-A was 0.98, 95% confidence interval: 0.73-1.33). The findings of our study...

  12. Variation in genes related to hepatic lipid metabolism and changes in waist circumference and body weight

    DEFF Research Database (Denmark)

    Meidtner, Karina; Fisher, Eva; Angquist, Lars

    2014-01-01

    ) and changes in weight and waist circumference. We also investigated effect modification by sex and dietary intake. Data of 6,287 individuals participating in the European prospective investigation into cancer and nutrition were included in the analyses. Data on weight and waist circumference were followed up...... for 6.9 ± 2.5 years. Association of 69 tagSNPs with baseline BMI and annual changes in weight as well as waist circumference were investigated using linear regression analysis. Interactions with sex, GI and intake of carbohydrates, fat as well as saturated, monounsaturated and polyunsaturated fatty...... acids were examined by including multiplicative SNP-covariate terms into the regression model. Neither baseline BMI nor annual weight or waist circumference changes were significantly associated with variation in the selected genes in the entire study population after correction for multiple testing...

  13. Genetic Variations in Inflammatory Response Genes and Their Association with the Risk of Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Xin Cui

    2015-01-01

    Full Text Available Prostate cancer is a common cancer in men. Genetic variations in inflammatory response genes can potentially influence the risk of prostate cancer. We aimed to examine the association between PPARG Pro12Ala, NFKB1 -94 ins/del, NFKBIA -826C/T, COX-1 (50C>T, and COX-2 (-1195G>A polymorphisms on prostate cancer risk. The genotypes of the polymorphisms were ascertained in 543 prostate cancer patients and 753 controls through PCR-RFLP and the risk association was evaluated statistically using logistic regression analysis. The NFKB1 -94 polymorphism was shown to decrease prostate cancer risk in both heterozygous and homozygous comparison models (odds ratios of 0.74 (95% CI = 0.58–0.96 (P=0.02 and 0.57 (95% CI = 0.42–0.78 (PA polymorphisms may be, respectively, associated with decreased and increased prostate cancer risk in the Chinese population.

  14. The architecture of gene regulatory variation across multiple human tissues: the MuTHER study.

    Directory of Open Access Journals (Sweden)

    Alexandra C Nica

    Full Text Available While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL, skin, and fat. The samples (156 LCL, 160 skin, 166 fat were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes. In addition, we apply factor analysis (FA to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes. The unique study design (Matched Co-Twin Analysis--MCTA permits immediate replication of eQTLs using co-twins (93%-98% and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%-20% have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits.

  15. The Architecture of Gene Regulatory Variation across Multiple Human Tissues: The MuTHER Study

    Science.gov (United States)

    Nica, Alexandra C.; Parts, Leopold; Glass, Daniel; Nisbet, James; Barrett, Amy; Sekowska, Magdalena; Travers, Mary; Potter, Simon; Grundberg, Elin; Small, Kerrin; Hedman, Åsa K.; Bataille, Veronique; Tzenova Bell, Jordana; Surdulescu, Gabriela; Dimas, Antigone S.; Ingle, Catherine; Nestle, Frank O.; di Meglio, Paola; Min, Josine L.; Wilk, Alicja; Hammond, Christopher J.; Hassanali, Neelam; Yang, Tsun-Po; Montgomery, Stephen B.; O'Rahilly, Steve; Lindgren, Cecilia M.; Zondervan, Krina T.; Soranzo, Nicole; Barroso, Inês; Durbin, Richard; Ahmadi, Kourosh; Deloukas, Panos; McCarthy, Mark I.; Dermitzakis, Emmanouil T.; Spector, Timothy D.

    2011-01-01

    While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL), skin, and fat. The samples (156 LCL, 160 skin, 166 fat) were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes). In addition, we apply factor analysis (FA) to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes). The unique study design (Matched Co-Twin Analysis—MCTA) permits immediate replication of eQTLs using co-twins (93%–98%) and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%–20%) have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits. PMID:21304890

  16. New stacking variations of the charge and orbital ordering in the metal-ordered manganite YBaMn{sub 2}O{sub 6}

    Energy Technology Data Exchange (ETDEWEB)

    Kageyama, H.; Nakajima, T.; Ichihara, M.; Ueda, Y.; Yoshizawa, H. [Tokyo Univ., Institute for Solid State Physics, Kashiwa, Chiba (Japan); Ohoyama, K. [Tohoku Univ., Institute for Materials Research, Sendai, Miyagi (Japan)

    2003-02-01

    We performed transmission electron microscopy (TEM) and powder neutron diffraction experiments on an A-site ordered manganese perovskite YBaMn{sub 2}O{sub 6} which undergoes unusual and multiple phase transitions. In the paramagnetic insulating phase, the so-called CE type of charge and orbital ordering was observed in the monoclinic a-b plane, which has been frequently observed for the ordinary solid solution of A{sub 1-x}{sup 3+}A{sub x}'{sup 2+}MnO{sub 3} around x=0.5. TEM revealed, however, a fourfold periodicity along the c axis, suggesting a new stacking pattern, in which planes of the CE type are built up according to the sequence [{alpha}{alpha}{beta}{beta}...]. Interestingly, when the system entered the antiferromagnetic state below 195 K, this stacking pattern changed into [{alpha}{alpha}{alpha}{alpha}...] or [{alpha}{beta}{alpha}{beta}...], suggesting a close interplay between spins and orbitals. The obtained stacking patterns were strongly correlated to the inherent structural alternation, i.e., the Y/Ba order along the c axis. (author)

  17. Variation in oxytocin receptor gene (OXTR) polymorphisms is associated with emotional and behavioral reactions to betrayal.

    Science.gov (United States)

    Tabak, Benjamin A; McCullough, Michael E; Carver, Charles S; Pedersen, Eric J; Cuccaro, Michael L

    2014-06-01

    Variations in the gene that encodes the oxytocin receptor (OXTR) have been associated with many aspects of social cognition as well as several prosocial behaviors. However, potential associations of OXTR variants with reactions to betrayals of trust while cooperating for mutual benefit have not yet been explored. We examined how variations in 10 single-nucleotide polymorphisms on OXTR were associated with behavior and emotional reactions after a betrayal of trust in an iterated Prisoner's Dilemma Game. After correction for multiple testing, one haplotype (C-rs9840864, T-rs2268494) was significantly associated with faster retaliation post-betrayal-an association that appeared to be due to this haplotype's intermediate effect of exacerbating people's anger after they had been betrayed. Furthermore, a second haplotype (A-rs237887, C-rs2268490) was associated with higher levels of post-betrayal satisfaction, and a third haplotype (G-rs237887, C-rs2268490) was associated with lower levels of post-betrayal satisfaction.

  18. Variation at genes influencing facial morphology are not associated with developmental imprecision in human faces.

    Directory of Open Access Journals (Sweden)

    Sonja Windhager

    Full Text Available Facial asymmetries are commonly used as a proxy for human developmental imprecision resulting from inbreeding, and thus reduced genetic heterozygosity. Several environmental factors influence human facial asymmetry (e.g., health care, parasites, but the generalizability of findings on genetic stressors has been limited in humans by sample characteristics (island populations, endogamy and indirect genetic assessment (inference from pedigrees. In a sample of 3215 adult humans from the Rotterdam Study, we therefore studied the relationship of facial asymmetry, estimated from nine mid-facial landmarks, with genetic variation at 102 single nucleotide polymorphism (SNP loci recently associated with facial shape variation. We further tested whether the degree of individual heterozygosity is negatively correlated with facial asymmetry. An ANOVA tree regression did not identify any SNP relating to either fluctuating asymmetry or total asymmetry. In a general linear model, only age and sex--but neither heterozygosity nor any SNP previously reported to covary with facial shape--was significantly related to total or fluctuating asymmetry of the midface. Our study does not corroborate the common assumption in evolutionary and behavioral biology that morphological asymmetries reflect heterozygosity. Our results, however, may be affected by a relatively small degree of inbreeding, a relatively stable environment, and an advanced age in the Rotterdam sample. Further large-scale genetic studies, including gene expression studies, are necessary to validate the genetic and developmental origin of morphological asymmetries.

  19. Post-polyploidisation morphotype diversification associates with gene copy number variation

    Science.gov (United States)

    Schiessl, Sarah; Huettel, Bruno; Kuehn, Diana; Reinhardt, Richard; Snowdon, Rod

    2017-01-01

    Genetic models for polyploid crop adaptation provide important information relevant for future breeding prospects. A well-suited model is Brassica napus, a recent allopolyploid closely related to Arabidopsis thaliana. Flowering time is a major adaptation trait determining life cycle synchronization with the environment. Here we unravel natural genetic variation in B. napus flowering time regulators and investigate associations with evolutionary diversification into different life cycle morphotypes. Deep sequencing of 35 flowering regulators was performed in 280 diverse B. napus genotypes. High sequencing depth enabled high-quality calling of single-nucleotide polymorphisms (SNPs), insertion-deletions (InDels) and copy number variants (CNVs). By combining these data with genotyping data from the Brassica 60 K Illumina® Infinium SNP array, we performed a genome-wide marker distribution analysis across the 4 ecogeographical morphotypes. Twelve haplotypes, including Bna.FLC.A10, Bna.VIN3.A02 and the Bna.FT promoter on C02_random, were diagnostic for the diversification of winter and spring types. The subspecies split between oilseed/kale (B. napus ssp. napus) and swedes/rutabagas (B. napus ssp. napobrassica) was defined by 13 haplotypes, including genomic rearrangements encompassing copies of Bna.FLC, Bna.PHYA and Bna.GA3ox1. De novo variation in copies of important flowering-time genes in B. napus arose during allopolyploidisation, enabling sub-functionalisation that allowed different morphotypes to appropriately fine-tune their lifecycle. PMID:28165502

  20. Intra-retinal variation of opsin gene expression in the guppy (Poecilia reticulata).

    Science.gov (United States)

    Rennison, Diana J; Owens, Gregory L; Allison, W Ted; Taylor, John S

    2011-10-01

    Although behavioural experiments demonstrate that colouration influences mate choice in many species, a complete understanding of this form of signalling requires information about colour vision in the species under investigation. The guppy (Poecilia reticulata) has become a model species for the study of colour-based sexual selection. To investigate the role of opsin gene duplication and divergence in the evolution of colour-based mate choice, we used in situ hybridization to determine where the guppy's nine cone opsins are expressed in the retina. Long wavelength-sensitive (LWS) opsins were more abundant in the dorsal retina than in the ventral retina. One of the middle wavelength-sensitive opsins (RH2-1) exhibited the opposite pattern, while the other middle wavelength-sensitive opsin (RH2-2) and the short wavelength-sensitive opsins (SWS1, SWS2A and SWS2B) were expressed throughout the retina. We also found variation in LWS opsin expression among individuals. These observations suggest that regions of the guppy retina are specialized with respect to wavelength discrimination and/or sensitivity. Intra-retinal variability in opsin expression, which has been observed in several fish species, might be an adaptation to variation in the strength and spectral composition of light entering the eye from above and below. The discovery that opsin expression varies in the guppy retina may motivate new behavioural experiments designed to study its role in mate choice.

  1. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  2. The association between ace gene variation and aerobic capacity in winter endurance disciplines.

    Science.gov (United States)

    Orysiak, J; Zmijewski, P; Klusiewicz, A; Kaliszewski, P; Malczewska-Lenczowska, J; Gajewski, J; Pokrywka, A

    2013-12-01

    The aim of the study was to examine the possible relationship between I/D polymorphism of ACE gene and selected indices of aerobic capacity among male and female athletes practising winter endurance sports. Sixty-six well-trained athletes (female n = 26, male n = 40), aged 18.4 ± 2.8 years, representing winter endurance sports (cross-country skiing, n = 48; biathlon, n = 8; Nordic combined, n = 10) participated in the study. Genotyping for ACE I/D polymorphism was performed using polymerase chain reaction. Maximal oxygen consumption (VO2max), maximal running velocity (Vmax) and running velocity at anaerobic threshold (VAT4) were determined in an incremental test to volitional exhaustion on a motorized treadmill. The ACE genotype had no significant effect on absolute VO2max, relative VO2max (divided by body mass or fat free body mass), VAT4 or Vmax. No interaction effect of gender x ACE genotype was found for each of the examined aerobic capacity indices. ACE gene variation was not found to be a determinant of aerobic capacity in either female or male Polish, well-trained endurance athletes participating in winter sports.

  3. Variation in the Oxytocin Receptor Gene Is Associated with Face Recognition and its Neural Correlates

    Science.gov (United States)

    Westberg, Lars; Henningsson, Susanne; Zettergren, Anna; Svärd, Joakim; Hovey, Daniel; Lin, Tian; Ebner, Natalie C.; Fischer, Håkan

    2016-01-01

    The ability to recognize faces is crucial for daily social interactions. Recent studies suggest that intranasal oxytocin administration improves social recognition in humans. Oxytocin signaling in the amygdala plays an essential role for social recognition in mice, and oxytocin administration has been shown to influence amygdala activity in humans. It is therefore possible that the effects of oxytocin on human social recognition depend on mechanisms that take place in the amygdala—a central region for memory processing also in humans. Variation in the gene encoding the oxytocin receptor (OXTR) has been associated with several aspects of social behavior. The present study examined the potential associations between nine OXTR polymorphisms, distributed across the gene, and the ability to recognize faces, as well as face-elicited amygdala activity measured by functional magnetic resonance imaging (fMRI) during incidental encoding of faces. The OXTR 3′ polymorphism rs7632287, previously related to social bonding behavior and autism risk, was associated with participants’ ability to recognize faces. Carriers of the GA genotype, associated with enhanced memory, displayed higher amygdala activity during face encoding compared to carriers of the GG genotype. In line with work in rodents, these findings suggest that, in humans, naturally occurring endogenous modulation of OXTR function affects social recognition through an amygdala-dependent mechanism. These findings contribute to the understanding of how oxytocin regulates human social behaviors. PMID:27713694

  4. Variation in the Oxytocin Receptor Gene is associated with Face Recognition and its neural correlates

    Directory of Open Access Journals (Sweden)

    Lars Westberg

    2016-09-01

    Full Text Available The ability to recognize faces is crucial for daily social interactions. Recent studies suggest that intranasal oxytocin administration improves social recognition in humans. Oxytocin signaling in the amygdala plays an essential role for social recognition in mice, and oxytocin administration has been shown to influence amygdala activity in humans. It is therefore possible that the effects of oxytocin on human social recognition depend on mechanisms that take place in the amygdala – a central region for memory processing also in humans. Variation in the gene encoding the oxytocin receptor (OXTR has been associated with several aspects of social behavior. The present study examined the potential associations between nine OXTR polymorphisms, distributed across the gene, and the ability to recognize faces, as well as face-elicited amygdala activity measured by functional magnetic resonance imaging during incidental encoding of faces. The OXTR 3’ polymorphism rs7632287, previously related to social bonding behavior and autism risk, was associated with participants’ ability to recognize faces. Carriers of the GA genotype, associated with enhanced memory, displayed higher amygdala activity during face encoding compared to carriers of the GG genotype. In line with work in rodents, these findings suggest that, in humans, naturally occurring endogenous modulation of OXTR function affects social recognition through an amygdala-dependent mechanism. These findings contribute to the understanding of how oxytocin regulates human social behaviors.

  5. Chromosomal localisation and genetic variation of the SLC11A1 gene in goats (Capra hircus).

    Science.gov (United States)

    Vacca, G M; Pazzola, M; Pisano, C; Carcangiu, V; Diaz, M L; Nieddu, M; Robledo, R; Mezzanotte, R; Dettori, M L

    2011-10-01

    The solute carrier family 11 member A1 (SLC11A1) gene is associated with resistance to infectious diseases. Chromosomal localisation, genomic regions corresponding to functional domains and the genetic variability of microsatellites in the 3' untranslated region (3'-UTR) of this gene were investigated in 427 goats (Capra hircus) of six breeds. Using dual colour fluorescence in situ hybridisation, SLC11A1 was localised to goat chromosome 2. Single strand conformation polymorphism was used to screen for polymorphisms in SLC11A1 exons 2, 10 and 15. There was no variation among goat breeds in the sarcoma homology 3 (SH3) binding motif, the protein kinase C phosphorylation site or the two N-linked glycosylation sites. Exon 15 exhibited variability due to the presence of two polymorphic microsatellites. Genotyping of the upstream guanine-thymine repeat (GTn) at 3'-UTR revealed eight alleles (GT11, GT12, GT14-GT19) in goats, whereas GT13 (present in cattle) was absent. Most goats carried the GT16 allele and no allele was found to be exclusive to only one breed. The coefficient of genetic differentiation value (G(ST)) was 0.084. This microsatellite appears to be an informative DNA marker for genetic linkage analysis in goats.

  6. Evolutionary variation in neural gene expression in the developing sense organs of the crustacean Daphnia magna.

    Science.gov (United States)

    Klann, Marleen; Stollewerk, Angelika

    2017-02-24

    Arthropods have numerous sense organs, which are adapted to their habitat. While some sense organs are similar in structure and function in all arthropod groups, structural differences in functionally related sense organs have been described, as well as the absence of particular sense organ subtypes in individual arthropod groups. Here we address the question of how the diverse structures of arthropod sense organs have evolved by analysing the underlying molecular developmental processes in a crustacean, an arthropod group that has been neglected so far. We have investigated the development of four types of chemo- and mechanosensory sense organs in the branchiopod Daphnia magna (Cladocera) that either cannot be found in arthropods other than crustaceans or represent adaptations to an aquatic environment. The formation of the sensory organ precursors shows greater similarity to the arthropod taxa Chelicerata and Myriapoda than to the more closely related insects. All analysed sense organ types co-express the proneural genes ASH and atonal regardless of their structure and function. In contrast, in Drosophila melanogaster, ASH and atonal expression does not overlap and the genes confer different sense organ subtype identities. We performed experimental co-expression studies in D. melanogaster and found that the combinatorial expression of ato and ASH can change the external structure of sense organs. Our results indicate a central role for ASH and Atonal family members in the emergence of structural variations in arthropod sense organs.

  7. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    Directory of Open Access Journals (Sweden)

    DWINITA WIKAN UTAMI

    2011-09-01

    Full Text Available Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufipogon and CT13432 crossing. DNA of five rice lines were amplified using the spesific primer for Pi33, G1010. Amplification results purified through Exonuclease 1 and Shrimp Alkaline Phosphatase protocols. Labelling using fluorescent dyes done before sequencing nucleotide base using CEQ8000 instrument. The results showed that lines number 28 showed introgesion of the three control parent genome (subspecies of Indica, subspecies of Japonica, and O. rufipogon while the Lines number 79, 136, and 143 were identical to Indica genome. Strain number 195 was identical to Japonica genome. These broad genetic background lines promise as durable performance to attack the expansion of the dynamic nature of the pathogen to blast. The result of ortholog sequence analysis found conserved nucleotide base sequence (CAGCAGCC which involved in heterotrimeric G-protein group. This protein has role as plant receptor for recognizing pathogen elicitor in interaction of rice and blast pathogen.

  8. Clinical associations of host genetic variations in the genes of cytokines in critically ill patients.

    Science.gov (United States)

    Belopolskaya, O B; Smelaya, T V; Moroz, V V; Golubev, A M; Salnikova, L E

    2015-06-01

    Host genetic variations may influence a changing profile of biochemical markers and outcome in patients with trauma/injury. The objective of this study was to assess clinical associations of single nucleotide polymorphisms (SNPs) in the genes of cytokines in critically ill patients. A total of 430 patients were genotyped for SNPs in the genes of pro- (IL1B, IL6, IL8) and anti-inflammatory (IL4, IL10, IL13) cytokines. The main end-points were sepsis, mortality and adult respiratory distress syndrome (ARDS). We evaluated the dynamic levels of bilirubin, blood urea nitrogen, creatine kinase, creatinine and lactate dehydrogenase in five points of measurements (between 1 and 14 days after admission) and correlated them with SNPs. High-producing alleles of proinflammatory cytokines protected patients against sepsis (IL1B -511A and IL8 -251A) and mortality (IL1B -511A). High-producing alleles of anti-inflammatory cytokines IL4 -589T and IL13 431A (144Gln) were less frequent in ARDS patients. The carriers of IL6 -174C/C genotypes were prone to the increased levels of biochemical markers and acute kidney and liver insufficiency. Genotype-dependent differences in the levels of biochemical indicators gradually increased to a maximal value on the 14th day after admission. These findings suggest that genetic variability in pro- and anti-inflammatory cytokines may contribute to different clinical phenotypes in patients at high risk of critical illness.

  9. Genetic variations in the KIR gene family may contribute to susceptibility to ankylosing spondylitis: a meta-analysis.

    Science.gov (United States)

    Zuo, Hai-Ning; Wang, Zhi-Long; Cui, Dao-Ran; Xin, Da-Jiang

    2014-08-01

    The present meta-analysis of relevant case-control studies was conducted to investigate the possible relationships between genetic variations in the killer cell immunoglobulin-like receptor (KIR) gene clusters of the human KIR gene family and susceptibility to ankylosing spondylitis (AS). The following electronic databases were searched for relevant articles without language restrictions: the Web of Science, the Cochrane Library Database, PubMed, EMBASE, CINAHL, the Chinese Biomedical Database (CBM) and Chinese National Knowledge Infrastructure (CNKI) databases, covering all papers published until 2013. STATA statistical software was adopted in this meta-analysis as well. We also calculated the crude odds ratios (OR) and its 95% confidence intervals (95 % CI). Seven case-control studies with 1,004 patients diagnosed with AS and 2,138 healthy cases were implicated in our meta-analysis, and 15 genes in the KIR gene family were also evaluated. The results of our meta-analysis show statistical significance between the genetic variations in the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes and an increased susceptibility to AS (KIR2DL1: OR 7.82, 95% CI 3.87-15.81, P0.05). The current meta-analysis provides reliable evidence that genetic variations in the KIR gene family may contribute to susceptibility to AS, especially for the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes.

  10. Evidence that Natural Selection is the Primary Cause of the Guanine-cytosine Content Variation in Rice Genes

    Institute of Scientific and Technical Information of China (English)

    Xiaoli Shi; Xiyin Wang; Zhe Li; Qihui Zhu; Ji Yang; Song Ge; Jingchu Luo

    2007-01-01

    Cereal genes are classified into two distinct classes according to the guanine-cytosine (GC) content at the third codon sites (GC3). Natural selection and mutation bias have been proposed to affect the GC content. However, there has been controversy about the cause of GC variation. Here, we characterized the GC content of 1 092 paralogs and other single-copy genes in the duplicated chromosomal regions of the rice genome (ssp. indica) and classified the paralogs into GC3-rich and GC3-poor groups. By referring to out-group sequences from Arabidopsis and maize, we confirmed that the average synonymous substitution rate of the GC3-rich genes is significantly lower than that of the GC3-poor genes. Furthermore,we explored the other possible factors corresponding to the GC variation including the length of coding sequences, the number of exons in each gene, the number of genes in each family, the location of genes on chromosomes and the protein functions. Consequently, we propose that natural selection rather than mutation bias was the primary cause of the GC variation.

  11. Conservation of gene order and content in the circular chromosomes of 'Candidatus Liberibacter asiaticus' and other Rhizobiales.

    Directory of Open Access Journals (Sweden)

    L David Kuykendall

    Full Text Available 'Ca. Liberibacter asiaticus,' an insect-vectored, obligate intracellular bacterium associated with citrus-greening disease, also called "HLB," is a member of the Rhizobiales along with nitrogen-fixing microsymbionts Sinorhizobium meliloti and Bradyrhizobium japonicum, plant pathogen Agrobacterium tumefaciens and facultative intracellular mammalian pathogen Bartonella henselae. Comparative analyses of their circular chromosomes identified 514 orthologous genes shared among all five species. Shared among all five species are 50 identical blocks of microsyntenous orthologous genes (MOGs, containing a total of 283 genes. While retaining highly conserved genomic blocks of microsynteny, divergent evolution, horizontal gene transfer and niche specialization have disrupted macrosynteny among the five circular chromosomes compared. Highly conserved microsyntenous gene clusters help define the Rhizobiales, an order previously defined by 16S RNA gene similarity and herein represented by the three families: Bartonellaceae, Bradyrhizobiaceae and Rhizobiaceae. Genes without orthologs in the other four species help define individual species. The circular chromosomes of each of the five Rhizobiales species examined had genes lacking orthologs in the other four species. For example, 63 proteins are encoded by genes of 'Ca. Liberibacter asiaticus' not shared with other members of the Rhizobiales. Of these 63 proteins, 17 have predicted functions related to DNA replication or RNA transcription, and some of these may have roles related to low genomic GC content. An additional 17 proteins have predicted functions relevant to cellular processes, particularly modifications of the cell surface. Seventeen unshared proteins have specific metabolic functions including a pathway to synthesize cholesterol encoded by a seven-gene operon. The remaining 12 proteins encoded by 'Ca. Liberibacter asiaticus' genes not shared with other Rhizobiales are of bacteriophage origin. 'Ca

  12. Capturing sequence variation among flowering-time regulatory gene homologues in the allopolyploid crop species Brassica napus

    Directory of Open Access Journals (Sweden)

    Sarah eSchiessl

    2014-08-01

    Full Text Available Flowering, the transition from the vegetative to the generative phase, is a decisive time point in the lifecycle of a plant. Flowering is controlled by a complex network of transcription factors, photoreceptors, enzymes and miRNAs. In recent years, several studies gave rise to the hypothesis that this network is also strongly involved in the regulation of other important lifecycle processes ranging from germination and seed development through to fundamental developmental and yield-related traits. In the allopolyploid crop species Brassica napus, (genome AACC, homoeologous copies of flowering time regulatory genes are implicated in major phenological variation within the species, however the extent and control of intraspecific and intergenomic variation among flowering-time regulators is still unclear. To investigate differences among B. napus morphotypes in relation to flowering-time gene variation, we performed targeted deep sequencing of 29 regulatory flowering-time genes in four genetically and phenologically diverse B. napus accessions. The genotype panel included a winter-type oilseed rape, a winter fodder rape, a spring-type oilseed rape (all B. napus ssp. napus and a swede (B. napus ssp. napobrassica, which show extreme differences in winter-hardiness, vernalization requirement and flowering behaviour. A broad range of genetic variation was detected in the targeted genes for the different morphotypes, including non-synonymous SNPs, copy number variation and presence-absence variation. The results suggest that this broad variation in vernalisation, clock and signaling genes could be a key driver of morphological differentiation for flowering-related traits in this recent allopolyploid crop species.

  13. Genetic variation of the Fc gamma receptor 3B gene and association with rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Rute B Marques

    Full Text Available BACKGROUND: Fc gamma receptors (FcγRs play a crucial role in immunity by linking IgG antibody-mediated responses with cellular effector and regulatory functions. Genetic variants in these receptors have been previously identified as risk factors for several chronic inflammatory conditions. The present study aimed to investigate the presence of copy number variations (CNVs in the FCGR3B gene and its potential association with the autoimmune disease rheumatoid arthritis (RA. METHODOLOGY/PRINCIPAL FINDINGS: CNV of the FCGR3B gene was studied using Multiplex Ligation Dependent Probe Amplification (MLPA in 518 Dutch RA patients and 304 healthy controls. Surprisingly, three independent MLPA probes targeting the FCGR3B promoter measured different CNV frequencies, with probe#1 and #2 measuring 0 to 5 gene copies and probe#3 showing little evidence of CNV. Quantitative-PCR correlated with the copy number results from MLPA probe#2, which detected low copy number (1 copy in 6.7% and high copy number (≥3 copies in 9.4% of the control population. No significant difference was observed between RA patients and the healthy controls, neither in the low copy nor the high copy number groups (p-values = 0.36 and 0.71, respectively. Sequencing of the FCGR3B promoter region revealed an insertion/deletion (indel that explained the disparate CNV results of MLPA probe#1. Finally, a non-significant trend was found between the novel -256A>TG indel and RA (40.7% in healthy controls versus 35.9% in RA patients; P = 0.08. CONCLUSIONS/SIGNIFICANCE: The current study highlights the complexity and poor characterization of the FCGR3B gene sequence, indicating that the design and interpretation of genotyping assays based on specific probe sequences must be performed with caution. Nonetheless, we confirmed the presence of CNV and identified novel polymorphisms in the FCGR3B gene in the Dutch population. Although no association was found between RA and FCGR3B CNV, the

  14. Genetic and epigenetic variation in the DNMT3B and MTHFR genes and colorectal adenoma risk.

    Science.gov (United States)

    Ho, Vikki; Ashbury, Janet E; Taylor, Sherryl; Vanner, Stephen; King, Will D

    2016-05-01

    Polymorphisms in DNMT3B and MTHFR have been implicated in cancer etiology; however, it is increasingly clear that gene-specific DNA methylation also affects gene expression. A cross-sectional study (N = 272) investigated the main and joint effects of polymorphisms and DNA methylation in DNMT3B and MTHFR on colorectal adenoma risk. Polymorphisms examined included DNMT3B c.-6-1045G > T, and MTHFR c.665C > T and c.1286A > C. DNA methylation of 66 and 28 CpG sites in DNMT3B and MTHFR, respectively, was quantified in blood leukocytes using Sequenom EpiTYPER®. DNA methylation was conceptualized using two approaches: (1) average methylation and (2) unsupervised principal component analysis to identify variables that represented methylation around the transcription start site and the gene coding area of both genes. Logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs) associated with the main and joint effects of polymorphisms and DNA methylation. DNA methyltransferase 3B (DNMT3B) TT versus GG/GT genotypes was associated with increased colorectal adenoma risk (OR = 2.12; 95% CI: 1.03-4.34). In addition, increasing DNA methylation in the gene-coding area of DNMT3B was associated with higher risk of colorectal adenomas (OR = 1.34; 95% CI: 1.01-1.79 per SD). In joint effect analyses, synergistic effects were observed among those with both the DNMT3B TT genotype and higher DNMT3B methylation levels compared to those with GT/GG genotypes and lower methylation levels (OR = 4.19; 95% CI: 1.45-12.13 for average methylation; OR = 4.26; 95%CI: 1.31-13.87 for methylation in the transcription start site). This research provides novel evidence that genetic and epigenetic variations contribute to colorectal adenoma risk, precursor to the majority of colorectal cancer (CRC).

  15. The gene Sex-lethal of the Sciaridae family (order Diptera, suborder Nematocera) and its phylogeny in dipteran insects.

    Science.gov (United States)

    Serna, Esther; Gorab, Eduardo; Ruiz, M Fernanda; Goday, Clara; Eirín-López, José M; Sánchez, Lucas

    2004-10-01

    This article reports the cloning and characterization of the gene homologous to Sex-lethal (Sxl) of Drosophila melanogaster from Sciara coprophila, Rhynchosciara americana, and Trichosia pubescens. This gene plays the key role in controlling sex determination and dosage compensation in D. melanogaster. The Sxl gene of the three species studied produces a single transcript encoding a single protein in both males and females. Comparison of the Sxl proteins of these Nematocera insects with those of the Brachycera showed their two RNA-binding domains (RBD) to be highly conserved, whereas significant variation was observed in both the N- and C-terminal domains. The great majority of nucleotide changes in the RBDs were synonymous, indicating that purifying selection is acting on them. In both sexes of the three Nematocera insects, the Sxl protein colocalized with transcription-active regions dependent on RNA polymerase II but not on RNA polymerase I. Together, these results indicate that Sxl does not appear to play a discriminatory role in the control of sex determination and dosage compensation in nematocerans. Thus, in the phylogenetic lineage that gave rise to the drosophilids, evolution coopted for the Sxl gene, modified it, and converted it into the key gene controlling sex determination and dosage compensation. At the same time, however, certain properties of the recruited ancestral Sxl gene were beneficial, and these are maintained in the evolved Sxl gene, allowing it to exert its sex-determining and dose compensation functions in Drosophila.

  16. Melanopsin gene variations interact with season to predict sleep onset and chronotype.

    Science.gov (United States)

    Roecklein, Kathryn A; Wong, Patricia M; Franzen, Peter L; Hasler, Brant P; Wood-Vasey, W Michael; Nimgaonkar, Vishwajit L; Miller, Megan A; Kepreos, Kyle M; Ferrell, Robert E; Manuck, Stephen B

    2012-10-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are associated with differences in sleep-wake behavior among those not suffering from a mood disorder, the authors tested associations between melanopsin gene polymorphisms and self-reported sleep timing (sleep onset and wake time) in a community sample (N = 234) of non-Hispanic Caucasian participants (age 30-54 yrs) with no history of psychological, neurological, or sleep disorders. The authors also tested the effect of melanopsin variations on differences in preferred sleep and activity timing (i.e., chronotype), which may reflect differences in circadian phase, sleep homeostasis, or both. Daylength on the day of assessment was measured and included in analyses. DNA samples were genotyped for melanopsin gene polymorphisms using fluorescence polarization. P10L genotype interacted with daylength to predict self-reported sleep onset (interaction p sleep onset among those with the TT genotype was later in the day when individuals were assessed on longer days and earlier in the day on shorter days, whereas individuals in the other genotype groups (i.e., CC and CT) did not show this interaction effect. P10L genotype also interacted in an analogous way with daylength to predict self-reported morningness (interaction p sleep onset and chronotype as a function of daylength, whereas other genotypes at P10L do not seem to have effects that vary by daylength. A better understanding of how melanopsin confers heightened responsivity to daylength may improve our understanding of a broad range of

  17. Genetic variations of the porcine PRKAG3 gene in Chinese indigenous pig breeds

    Directory of Open Access Journals (Sweden)

    Zhou Li-Hua

    2004-07-01

    Full Text Available Abstract Four missense substitutions (T30N, G52S, V199I and R200Q in the porcine PRKAG3 gene were considered as the likely candidate loci affecting meat quality. In this study, the R200Q substitution was investigated in a sample of 62 individuals from Hampshire, Chinese Min and Erhualian pigs, and the genetic variations of T30N, G52S and V199I substitutions were detected in 1505 individuals from 21 Chinese indigenous breeds, 5 Western commercial pig breeds, and the wild pig. Allele 200R was fixed in Chinese Min and Erhualian pigs. Haplotypes II-QQ and IV-QQ were not observed in the Hampshire population, supporting the hypothesis that allele 200Q is tightly linked with allele 199V. Significant differences in allele frequencies of the three substitutions (T30N, G52S and V199I between Chinese indigenous pigs and Western commercial pigs were observed. Obvious high frequencies of the "favorable" alleles 30T and 52G in terms of meat quality were detected in Chinese indigenous pigs, which are well known for high meat quality. However, the frequency of the "favorable" allele 199I, which was reported to have a greater effect on meat quality in comparison with 30T and 52G, was very low in all of the Chinese indigenous pigs except for the Min pig. The reasons accounting for this discrepancy remain to be addressed. The presence of the three substitutions in purebred Chinese Tibetan pigs indicates that the three substitutions were ancestral mutations. A novel A/G substitution at position 51 in exon 1 was identified. The results suggest that further studies are required to investigate the associations of these substitutions in the PRKAG3 gene with meat quality of Chinese indigenous pigs, and to uncover other polymorphisms in the PRKAG3 gene with potential effects on meat quality in Chinese indigenous pigs.

  18. The influence of genetic variations in HHEX gene on insulin metabolism in the German MESYBEPO cohort.

    Science.gov (United States)

    Pivovarova, Olga; Nikiforova, Victoria J; Pfeiffer, Andreas F H; Rudovich, Natalia

    2009-02-01

    In the present study, we aimed to validate the type 2 diabetes (T2DM) susceptibility alleles identified in the first genome-wide association study in the hematopoietically expressed homeobox protein (HHEX) gene region (rs1111875 and rs7923837). Furthermore, we investigated quantitative metabolic risk phenotypes of these two variants for association with three key components of the insulin metabolism: insulin secretion, insulin sensitivity and insulin degradation. Two HHEX polymorphisms were genotyped in 1026 subjects from the German MESYBEPO cohort. Complete OGTT data were available for a subset of 420 with normal glucose tolerance (NGT), 282 with impaired glucose tolerance/impaired fasting glucose (IGT/IFG) and 146 diabetic subjects. We validated association of both HHEX polymorphisms with T2DM. In the non-diabetic subcohort including NGT and IFG/IGT subjects, the risk alleles of rs7923837 and rs1111875 were significantly associated with decreased first and second phases of insulin secretion and lower insulinogenic index after oral glucose loading. In healthy, normal glucose-tolerant subjects, the same association of HHEX SNP rs1111875 with OGTT-derived phases of insulin secretion were detectable, however, rs7923837 was only weakly associated with reduced insulinogenic index. For both polymorphisms, no significant correlations with insulin sensitivity were obtained. Reduced insulin clearance was also observed in heterozygous carriers of rs1111875. We validated the association of polymorphisms of the HHEX gene with T2DM in the MESYBEPO cohort. Importantly, variations within the HHEX gene conferred the impaired insulin secretion and changes of insulin degradation but no alteration in insulin sensitivity in carriers of risk alleles. Copyright (c) 2008 John Wiley & Sons, Ltd.

  19. Variations of the angiotensin II type 1 receptor gene are associated with extreme human longevity.

    Science.gov (United States)

    Benigni, Ariela; Orisio, Silvia; Noris, Marina; Iatropoulos, Paraskevas; Castaldi, Davide; Kamide, Kei; Rakugi, Hiromi; Arai, Yasumichi; Todeschini, Marta; Ogliari, Giulia; Imai, Enyu; Gondo, Yasuyuki; Hirose, Nobuyoshi; Mari, Daniela; Remuzzi, Giuseppe

    2013-06-01

    Longevity phenotype in humans results from the influence of environmental and genetic factors. Few gene polymorphisms have been identified so far with a modest effect on lifespan leaving room for the search of other players in the longevity game. It has been recently demonstrated that targeted disruption of the mouse homolog of the human angiotensin II type 1 receptor (AT1R) gene (AGTR1) translates into marked prolongation of animal lifespan (Benigni et al., J Clin Invest 119(3):524-530, 2009). Based on the above study in mice, here we sought to search for AGTR1 variations associated to reduced AT1 receptor protein levels and to prolonged lifespan in humans. AGTR1 was sequenced in 173 Italian centenarians and 376 younger controls. A novel non-synonymous mutation was detected in a centenarian. Two polymorphisms in AGTR1 promoter, rs422858 and rs275653, in complete linkage disequilibrium, were significantly associated with the ability to attain extreme old age. We then replicated the study of rs275653 in a large independent cohort of Japanese origin (598 centenarians and semi-supercentenarians, 422 younger controls) and indeed confirmed its association with exceptional old age. In combined analyses, rs275653 was associated to extreme longevity either at recessive model (P = 0.007, odds ratio (OR) 3.57) or at genotype level (P = 0.015). Significance was maintained after correcting for confounding factors. Fluorescence activated cell sorting analysis revealed that subjects homozygous for the minor allele of rs275653 had less AT1R-positive peripheral blood polymorphonuclear cells. Moreover, rs275653 was associated to lower blood pressure in centenarians. These findings highlight the role of AGTR1 as a possible candidate among longevity-enabling genes.

  20. Polymorphisms in the WNK1 gene are associated with blood pressure variation and urinary potassium excretion.

    Directory of Open Access Journals (Sweden)

    Stephen Newhouse

    Full Text Available WNK1--a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP control--is an excellent candidate gene for essential hypertension (EH. We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT study case-control resource (1700 hypertensive cases and 1700 normotensive controls. We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005, diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002 and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004. Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively. The major allele (A of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23-4.9, DBP 1.9 mmHg (95%CI:0.7-3.2 and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0-1.7].We genotyped this variant in six independent populations (n = 14,451 and replicated the association between rs765250 and SBP in a meta-analysis (p = 7 x 10(-3, combined with BRIGHT data-set p = 2 x 10(-4, n = 17,851. The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction and risk for hypertension (OR<0.60. Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH.

  1. Natural variation in the Pto pathogen resistance gene within species of wild tomato (Lycopersicon). I. Functional analysis of Pto alleles.

    Science.gov (United States)

    Rose, Laura E; Langley, Charles H; Bernal, Adriana J; Michelmore, Richard W

    2005-09-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the cultivated tomato, Lycopersicon esculentum, and the closely related L. pimpinellifolium is triggered by the physical interaction between plant disease resistance protein, Pto, and the pathogen avirulence protein, AvrPto. To investigate the extent to which variation in the Pto gene is responsible for naturally occurring variation in resistance to Pst, we determined the resistance phenotype of 51 accessions from seven species of Lycopersicon to isogenic strains of Pst differing in the presence of avrPto. One-third of the plants displayed resistance specifically when the pathogen expressed AvrPto, consistent with a gene-for-gene interaction. To test whether this resistance in these species was conferred specifically by the Pto gene, alleles of Pto were amplified and sequenced from 49 individuals and a subset (16) of these alleles was tested in planta using Agrobacterium-mediated transient assays. Eleven alleles conferred a hypersensitive resistance response (HR) in the presence of AvrPto, while 5 did not. Ten amino acid substitutions associated with the absence of AvrPto recognition and HR were identified, none of which had been identified in previous structure-function studies. Additionally, 3 alleles encoding putative pseudogenes of Pto were isolated from two species of Lycopersicon. Therefore, a large proportion, but not all, of the natural variation in the reaction to strains of Pst expressing AvrPto can be attributed to sequence variation in the Pto gene.

  2. An approximation to the temporal order in endogenous circadian rhythms of genes implicated in human adipose tissue metabolism.

    Science.gov (United States)

    Garaulet, Marta; Ordovás, José M; Gómez-Abellán, Purificación; Martínez, Jose A; Madrid, Juan A

    2011-08-01

    Although it is well established that human adipose tissue (AT) shows circadian rhythmicity, published studies have been discussed as if tissues or systems showed only one or few circadian rhythms at a time. To provide an overall view of the internal temporal order of circadian rhythms in human AT including genes implicated in metabolic processes such as energy intake and expenditure, insulin resistance, adipocyte differentiation, dyslipidemia, and body fat distribution. Visceral and subcutaneous abdominal AT biopsies (n=6) were obtained from morbid obese women (BMI≥40 kg/m(2) ). To investigate rhythmic expression pattern, AT explants were cultured during 24-h and gene expression was analyzed at the following times: 08:00, 14:00, 20:00, 02:00 h using quantitative real-time PCR. Clock genes, glucocorticoid metabolism-related genes, leptin, adiponectin and their receptors were studied. Significant differences were found both in achrophases and relative-amplitude among genes (P30%). When interpreting the phase map of gene expression in both depots, data indicated that circadian rhythmicity of the genes studied followed a predictable physiological pattern, particularly for subcutaneous AT. Interesting are the relationships between adiponectin, leptin, and glucocorticoid metabolism-related genes circadian profiles. Their metabolic significance is discussed. Visceral AT behaved in a different way than subcutaneous for most of the genes studied. For every gene, protein mRNA levels fluctuated during the day in synchrony with its receptors. We have provided an overall view of the internal temporal order of circadian rhythms in human adipose tissue.

  3. RNA splicing regulates the temporal order of TNF-induced gene expression.

    Science.gov (United States)

    Hao, Shengli; Baltimore, David

    2013-07-16

    When cells are induced to express inflammatory genes by treatment with TNF, the mRNAs for the induced genes appear in three distinct waves, defining gene groups I, II, and III, or early, intermediate, and late genes. To examine the basis for these different kinetic classes, we have developed a PCR-based procedure to distinguish pre-mRNAs from mRNAs. It shows that the three groups initiate transcription virtually simultaneously but that delays in splicing characterize groups II and III. We also examined the elongation times, concluding that pre-mRNA synthesis is coordinate but splicing differences directly regulate the timing of mRNA production.

  4. The complete mitochondrial genome of the cyclopoid copepod Paracyclopina nana: a highly divergent genome with novel gene order and atypical gene numbers.

    Science.gov (United States)

    Ki, Jang-Seu; Park, Heum Gi; Lee, Jae-Seong

    2009-04-15

    In this paper, we describe the complete mitogenome of the cyclopoid copepod Paracyclopina nana with emphasis on the highly rearranged gene order and high divergence against published copepod mitogenomes. The P. nana mtDNA is 15,981 bp in length (70.9% AT) and consists of 37 genes (12 protein-coding genes, 2 rRNAs, 23 tRNAs) that are atypical for metazoan mitogenomes. Unusually, it contains an extra tRNA (tRNA-Ala) but it does not contain the ATPase 8 gene. The P. nana mitogenome has a long putative control region with high AT content (1351 bp, 77.0% AT). The Cyt b was considerably short in length, compared to other crustaceans. Compared to typical mitogenomes of arthropods and copepods, the gene order of the P. nana mitogenome is highly rearranged with a novel gene structure. In addition, P. nana has highly divergent mt genes (mostly less than 50%), judged by amino acid substitution. We present the first complete mitogenome sequence from a cyclopoid copepod, thereby increasing our understanding of copepod and crustacean evolution from the mitochondrial point of view.

  5. Patterns of human genetic variation inferred from comparative analysis of allelic mutations in blood group antigen genes.

    Science.gov (United States)

    Patnaik, Santosh Kumar; Blumenfeld, Olga O

    2011-03-01

    Comparative analysis of allelic variation of a gene sheds light on the pattern and process of its diversification at the population level. Gene families for which a large number of allelic forms have been verified by sequencing provide a useful resource for such studies. In this regard, human blood group-encoding genes are unique in that differences of cell surface traits among individuals and populations can be readily detected by serological screening, and correlation between the variant cell surface phenotype and the genotype is, in most cases, unequivocal. Here, we perform a comprehensive analysis of allelic forms, compiled in the Blood Group Antigen Gene Mutation database, of ABO, RHD/CE, GYPA/B/E and FUT1/2 gene families that encode the ABO, RH, MNS, and H/h blood group system antigens, respectively. These genes are excellent illustrative examples showing distinct mutational patterns among the alleles, and leading to speculation on how their origin may have been driven by recurrent but different molecular mechanisms. We illustrate how alignment of alleles of a gene may provide an additional insight into the DNA variation process and its pathways, and how this approach may serve to catalog alleles of a gene, simplifying the task and content of mutation databases.

  6. Association between a variation in the phosphodiesterase 4D gene and bone mineral density

    Directory of Open Access Journals (Sweden)

    Sambrook Philip N

    2005-03-01

    Full Text Available Abstract Background Fragility fractures caused by osteoporosis are a major cause of morbidity and mortality in aging populations. Bone mineral density (BMD is a useful surrogate marker for risk of fracture and is a highly heritable trait. The genetic variants underlying this genetic contribution are largely unknown. Methods We performed a large-scale association study investigating more than 25,000 single nucleotide polymorphisms (SNPs located within 16,000 genes. Allele frequencies were estimated in contrasting DNA pools from white females selected for low (2, n = 319 and high (> 1.11 g/cm2, n = 321 BMD at the lumbar spine. Significant findings were verified in two additional sample collections. Results Based on allele frequency differences between DNA pools and subsequent individual genotyping, one of the candidate loci indicated was the phosphodiesterase 4D (PDE4D gene region on chromosome 5q12. We subsequently tested the marker SNP, rs1498608, in a second sample of 138 white females with low (2 and 138 females with high (>1.04 g/cm2 lumbar spine BMD. Odds ratios were 1.5 (P = 0.035 in the original sample and 2.1 (P = 0.018 in the replication sample. Association fine mapping with 80 SNPs located within 50 kilobases of the marker SNP identified a 20 kilobase region of association containing exon 6 of PDE4D. In a second, family-based replication sample with a preponderance of females with low BMD, rs1498608 showed an opposite relationship with BMD at different sites (p = 0.00044-0.09. We also replicated the previously reported association of the Ser37Ala polymorphism in BMP2, known to interact biologically with PDE4D, with BMD. Conclusion This study indicates that variants in the gene encoding PDE4D account for some of the genetic contribution to bone mineral density variation in humans. The contrasting results from different samples indicate that the effect may be context-dependent. PDE4 inhibitors have been shown to increase bone mass in

  7. Genetic variation of the IL-28B promoter affecting gene expression.

    Directory of Open Access Journals (Sweden)

    Masaya Sugiyama

    Full Text Available The current standard of care for the treatment of chronic hepatitis C is pegylated interferon-α (PEG-IFNα and ribavirin (RBV. The treatment achieves a sustained viral clearance in only approximately 50% of patients. Recent whole genome association studies revealed that single nucleotide polymorphisms (SNPs around IL-28B have been associated with response to the standard therapy and could predict treatment responses at approximately 80%. However, it is not clear which SNP is most informative because the genomic region containing significant SNPs shows strong linkage disequilibrium. We focused on SNPs in close proximity to the IL-28B gene to evaluate the function of each and identify the SNP affecting the IL-28B expression level most. The structures of IL-28A/B from 5' to 3'-UTR were determined by complete cDNA cloning. Both IL-28A and 28B genes consisted of 6 exons, differing from the CCDS data of NCBI. Two intron SNPs and a nonsynonymous SNP did not affect IL-28B gene function and expression levels but a SNP located in the proximal promoter region influenced gene expression. A (TA dinucleotide repeat, rs72258881, located in the promoter region was discovered by our functional studies of the proximal SNPs upstream of IL-28B; the transcriptional activity of the promoter increased gradually in a (TA(n length-dependent manner following IFN-α and lipopolysaccharide stimulation. Healthy Japanese donors exhibited a broad range of (TA dinucleotide repeat numbers from 10 to 18 and the most prevalent genotype was 12/12 (75%, differing from the database (13/13. However, genetic variation of IL-28A corresponding to that of IL-28B was not detected in these Japanese donors. These findings suggest that the dinucleotide repeat could be associated with the transcriptional activity of IL-28B as well as being a marker to improve the prediction of the response to interferon-based hepatitis C virus treatment.

  8. Identification of genes related to the phenotypic variations of a synthesized Paulownia (Paulownia tomentosa×Paulownia fortunei) autotetraploid.

    Science.gov (United States)

    Li, Yongsheng; Fan, Guoqiang; Dong, Yanpeng; Zhao, Zhenli; Deng, Minjie; Cao, Xibing; Xu, Enkai; Niu, Suyan

    2014-12-15

    Paulownia is a fast-growing deciduous tree native to China. It has great economic importance for the pulp and paper industries, as well as ecological prominence in forest ecosystems. Paulownia is of much interest to plant breeder keen to explore new plant varieties by selecting on the basis of phenotype. A newly synthesized autotetraploid Paulownia exhibited advanced characteristics, such as greater yield, and higher resistance than the diploid tree. However, tissue-specific transcriptome and genomic data in public databases are not sufficient to understand the molecular mechanisms associated with genome duplication. To evaluate the effects of genome duplication on the phenotypic variations in Paulownia tomentosa×Paulownia fortunei, the transcriptomes of the autotetraploid and diploid Paulownia were compared. Using Illumina sequencing technology, a total of 82,934 All-unigenes with a mean length of 1109 bp were assembled. The data revealed numerous differences in gene expression between the two transcriptomes, including 718 up-regulated and 667 down-regulated differentially expressed genes between the two Paulownia trees. An analysis of the pathway and gene annotations revealed that genes involved in nucleotide sugar metabolism in plant cell walls were down-regulated, and genes involved in the light signal pathway and the biosynthesis of structural polymers were up-regulated in autotetraploid Paulownia. The differentially expressed genes may contribute to the observed phenotypic variations between diploid and autotetraploid Paulownia. These results provide a significant resource for understanding the variations in Paulownia polyploidization and will benefit future breeding work.

  9. Association of genetic variations of the prostasin gene with essential hypertension in the Xinjiang Kazakh population

    Institute of Scientific and Technical Information of China (English)

    LI Nan-fang; ZHANG Ju-hong; CHANG Jian-hang; YANG Jin; WANG Hong-mei; ZHOU Ling; LUO Wen-li

    2011-01-01

    Background Transgenic overexpression of human prostasin in rats disturbs salt balance and causes hypertension. We investigated whether genetic variations in prostasin were implicated in hypertension or related phenotypes in the Xinjiang Kazakh population.Methods We sequenced all exons and the promoter regions of the prostasin gene in 94 hypertensive individuals, and the genotype identification was performed by the TaqMan polymerase chain reaction method. Case-control studies were conducted in 938 Kazakh subjects.Results E342K and 2827G>A, which are novel variants, were successfully genotyped in the general Xinjiang Kazakh population with a sample size of 938 individuals (406 men and 532 women). Only one hypertensive patient was identified with the E342K mutation. No significant association was observed between 2827G>A and hypertension. However,quantitative traits of hypertensive intermediate phenotypes were significantly associated with the A allele; P=-0.041 and 0.034 for body mass index (BMI) in the additive and recessive models, P=0.042 and 0.018 for OGTT-2h glucose in the additive and recessive models, P=0.031 for IRT-3h insulin in the recessive model, and P=0.038 for serum potassium in the dominant model.Conclusions This study does not provide evidence of a major role of prostasin variation in blood pressure modulation.However, association of prostasin polymorphisms with hypertension and metabolic effects can be observed in our population. Further investigation is warranted to clarify the relevance of prostasin polymorphisms to blood pressure regulation.

  10. Comparison of Affymetrix Gene Array with the Exon Array shows potential application for detection of transcript isoform variation

    Directory of Open Access Journals (Sweden)

    Coulombe-Huntington Jasmin

    2009-11-01

    Full Text Available Abstract Background The emergence of isoform-sensitive microarrays has helped fuel in-depth studies of the human transcriptome. The Affymetrix GeneChip Human Exon 1.0 ST Array (Exon Array has been previously shown to be effective in profiling gene expression at the isoform level. More recently, the Affymetrix GeneChip Human Gene 1.0 ST Array (Gene Array has been released for measuring gene expression and interestingly contains a large subset of probes from the Exon Array. Here, we explore the potential of using Gene Array probes to assess expression variation at the sub-transcript level. Utilizing datasets of the high quality Microarray Quality Control (MAQC RNA samples previously assayed on the Exon Array and Gene Array, we compare the expression measurements of the two platforms to determine the performance of the Gene Array in detecting isoform variations. Results Overall, we show that the Gene Array is comparable to the Exon Array in making gene expression calls. Moreover, to examine expression of different isoforms, we modify the Gene Array probe set definition file to enable summarization of probe intensity values at the exon level and show that the expression profiles between the two platforms are also highly correlated. Next, expression calls of previously known differentially spliced genes were compared and also show concordant results. Splicing index analysis, representing estimates of exon inclusion levels, shows a lower but good correlation between platforms. As the Gene Array contains a significant subset of probes from the Exon Array, we note that, in comparison, the Gene Array overlaps with fewer but still a high proportion of splicing events annotated in the Known Alt Events UCSC track, with abundant coverage of cassette exons. We discuss the ability of the Gene Array to detect alternative splicing and isoform variation and address its limitations. Conclusion The Gene Array is an effective expression profiling tool at gene and

  11. Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene

    KAUST Repository

    Julkowska, Magdalena M.

    2016-02-11

    Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.

  12. Rapid pair-wise synteny analysis of large bacterial genomes using web-based GeneOrder4.0

    Directory of Open Access Journals (Sweden)

    Mahadevan Padmanabhan

    2010-02-01

    Full Text Available Abstract Background The growing whole genome sequence databases necessitate the development of user-friendly software tools to mine these data. Web-based tools are particularly useful to wet-bench biologists as they enable platform-independent analysis of sequence data, without having to perform complex programming tasks and software compiling. Findings GeneOrder4.0 is a web-based "on-the-fly" synteny and gene order analysis tool for comparative bacterial genomics (ca. 8 Mb. It enables the visualization of synteny by plotting protein similarity scores between two genomes and it also provides visual annotation of "hypothetical" proteins from older archived genomes based on more recent annotations. Conclusions The web-based software tool GeneOrder4.0 is a user-friendly application that has been updated to allow the rapid analysis of synteny and gene order in large bacterial genomes. It is developed with the wet-bench researcher in mind.

  13. The association between common genetic variation in the FTO gene and metabolic syndrome in Han Chinese

    Institute of Scientific and Technical Information of China (English)

    WANG Tong; ZHANG Li-li; ZHANG Yun; SUN Xiao-fang; ZHANG Qian; HUANG Yi; XIAO Xin-hua; WANG Duen-mei; DIAO Cheng-ming; ZHANG Feng; XU Ling-ling; ZHANG Yong-biao; LI Wen-hui

    2010-01-01

    Background Genome-wide association studies for type 2 diabetes mellitus (T2DM) identified FTO gene as a locus conferring increased risk for common obesity in many populations with European ancestry. However, the involvement of FTO gene in obesity or T2DM related metabolic traits has not been consistently established in Chinese populations. The objective of this study was to investigate the association of FTO genetic polymorphisms with metabolic syndrome (MetS) in Han Chinese.Methods We tested 41 FTO single nucleotide polymorphisms (SNPs) for association between FTO and MetS-related traits. There were a total of 236 unrelated subjects (108 cases and 128 controls), grouped according to the International Diabetes Federation (IDF) criteria.Results Of the 41 SNPs examined, only SNP rs8047395 exhibited statistical significance (P=0.026) under a recessive model, after Bonferroni adjustment for multiple testing (OR 1.64, 95% CI 1.11-2.42; P=0.014). The common distributions of this polymorphism among Chinese-with a minor allele frequency (MAF) of 36% in the control group versus 48% in the MetS group-greatly improved our test power in a relatively small sample size for an association study. Previously identified obesity-(or T2DM-) associated FTO SNPs were less common in Han Chinese and were not associated with MetS in this study. No significant associations were found between our FTO SNPs and any endophenotypes of MetS.Conclusions A more common risk-conferring variant of FTO for MetS was identified in Han Chinese. Our study substantiated that genetic variations in FTO locus are involved in the pathogenesis of MetS.

  14. The Order Bacillales Hosts Functional Homologs of the Worrisome cfr Antibiotic Resistance Gene

    DEFF Research Database (Denmark)

    Hansen, Lykke H.; Planellas, Mercè H.; Long, Katherine S.

    2012-01-01

    The cfr gene encodes the Cfr methyltransferase that methylates a single adenine in the peptidyl transferase region of bacterial ribosomes. The methylation provides resistance to several classes of antibiotics that include drugs of clinical and veterinary importance. This paper describes a first...... coli, and MICs for selected antibiotics indicate that the cfr-like genes confer resistance to PhLOPSa (phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A) antibiotics in the same way as the cfr gene. In addition, modification at A2503 on 23S rRNA was confirmed by primer extension...

  15. Case Study of Somaclonal Variation in Resistance Genes Mlo and Pme3 in Flaxseed (Linum usitatissimum L.) Induced by Nanoparticles

    Science.gov (United States)

    Kokina, Inese; Jermaļonoka, Marija; Bankovska, Linda; Gerbreders, Vjačeslavs; Ogurcovs, Andrejs; Jahundoviča, Inese

    2017-01-01

    Nanoparticles influence on genome is investigated worldwide. The appearance of somaclonal variation is a cause of great concern for any micropropagation system. Somaclonal variation describes the tissue-culture-induced phenotypic and genotypic variations. This paper shows the results of somaclonal variation in two resistance genes pectin methylesterase and Mlo-like protein in all tissue culture development stages, as donor plant, calluses, and regenerants of Linum usitatissimum induced by gold and silver nanoparticles. In this paper, it was essential to obtain DNA material from all tissue culture development stages from one donor plant to record changes in each nucleotide sequence. Gene region specific primers were developed for resistance genes such as Mlo and Pme3 to define the genetic variability in tissue culture of L. usitatissimum. In recent years, utilization of gold and silver nanoparticles in tissue culture is increased and the mechanisms of changes in genome induced by nanoparticles still remain unclear. Obtained data show the somaclonal variation increase in calluses obtained from one donor plant and grown on medium supplemented by gold nanoparticles (Mlo 14.68 ± 0.98; Pme3 2.07 ± 0.87) or silver nanoparticles (Mlo 12.01 ± 0.43; Pme3 10.04 ± 0.46) and decrease in regenerants. Morphological parameters of calluses showed a number of differences between each investigated culture group. PMID:28326314

  16. Common Variation in the NOS1AP Gene Is Associated With Drug-Induced QT Prolongation and Ventricular Arrhythmia

    NARCIS (Netherlands)

    Jamshidi, Yalda; Nolte, Ilja M.; Dalageorgou, Chrysoula; Zheng, Dongling; Johnson, Toby; Bastiaenen, Rachel; Ruddy, Suzanne; Talbott, Daniel; Norris, Kris J.; Snieder, Harold; George, Alfred L.; Marshall, Vanessa; Shakir, Saad; Kannankeril, Prince J.; Munroe, Patricia B.; Camm, A. John; Jeffery, Steve; Roden, Dan M.; Behr, Elijah R.

    2012-01-01

    Objectives This study sought to determine whether variations in NOS1AP affect drug-induced long QT syndrome (LQTS). Background Use of antiarrhythmic drugs is limited by the high incidence of serious adverse events including QT prolongation and torsades de pointes. NOS1AP gene variants play a role in

  17. Genetic Variation and the Risk of Haloperidol-Related Parkinsonism in Elderly Patients A Candidate Gene Approach

    NARCIS (Netherlands)

    Knol, Wilma; van Marum, Rob J.; Jansen, Paul A. F.; Strengman, Eric; Al Hadithy, Asmar F. Y.; Wilffert, Bob; Schobben, Alfred F. A. M.; Ophoff, Roel A.; Egberts, Toine C. G.

    2013-01-01

    Factors that influence the variation in occurrence of antipsychotic-related parkinsonism in elderly have not been well elucidated. The aim of this study was to investigate whether previous identified and studied genetic polymorphisms at DRD2, ANKK1, DRD3, HTR2A, HTR2C, RGS2, COMT, and BDNF genes are

  18. Common variation in oxidative phosphorylation genes is not a major cause of insulin resistance or type 2 diabetes

    DEFF Research Database (Denmark)

    Snogdal, L S; Wod, M; Grarup, Niels;

    2012-01-01

    There is substantial evidence that mitochondrial dysfunction is linked to insulin resistance and is present in several tissues relevant to the pathogenesis of type 2 diabetes. Here, we examined whether common variation in genes involved in oxidative phosphorylation (OxPhos) contributes to type 2...... diabetes susceptibility or influences diabetes-related metabolic traits....

  19. D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

    DEFF Research Database (Denmark)

    Andreou, Dimitrios; Saetre, Peter; Werge, Thomas;

    2012-01-01

    3918342 and rs1421292, were significantly associated with CSF HVA concentrations. Rs3918342 was found to be nominally associated with CSF 5-HIAA concentrations. None of the polymorphisms were significantly associated with MHPG concentrations. Our results indicate that DAOA gene variation affects dopamine...

  20. Common genetic variation in the Estrogen Receptor Beta (ESR2) gene and osteoarthritis: Results of a meta-analysis

    NARCIS (Netherlands)

    J.M. Kerkhof (Hanneke); I. Meulenbelt (Ingrid); A. Gonzalez (Antonio); D.J. Hart (Deborah); A. Hofman (Albert); M. Kloppenburg (Margreet); N.E. Lane; J. Loughlin (John); M.C. Nevitt (Michael); H.A.P. Pols (Huib); F. Rivadeneira Ramirez (Fernando); E. Slagboom (Eline); T.D. Spector (Tim); L. Stolk (Lisette); A. Tsezou (Aspasia); A.G. Uitterlinden (André); A.M. Valdes (Ana Maria); J.B.J. van Meurs (Joyce); A.J. Carr (Andrew Jonathan)

    2010-01-01

    textabstractBackground: The objective of this study was to examine the relationship between common genetic variation of the ESR2 gene and osteoarthritis.Methods: In the discovery study, the Rotterdam Study-I, 7 single nucleotide polymorphisms (SNPs) were genotyped and tested for association with hip

  1. Variations in potassium channel genes are associated with breast pain in women prior to breast cancer surgery.

    Science.gov (United States)

    Langford, Dale J; West, Claudia; Elboim, Charles; Cooper, Bruce A; Abrams, Gary; Paul, Steven M; Schmidt, Brian L; Levine, Jon D; Merriman, John D; Dhruva, Anand; Neuhaus, John; Leutwyler, Heather; Baggott, Christina; Sullivan, Carmen Ward; Aouizerat, Bradley E; Miaskowski, Christine

    2014-01-01

    Preoperative breast pain in women with breast cancer may result from a number of causes. Previous work from our team found that breast pain occurred in 28.2% of women (n = 398) who were about to undergo breast cancer surgery. The occurrence of preoperative breast pain was associated with a number of demographic and clinical characteristics, as well as variation in two cytokine genes. Given that ion channels regulate excitability of sensory neurons, we hypothesized that variations in potassium channel genes would be associated with preoperative breast pain in these patients. Therefore, in this study, we evaluated for associations between single-nucleotide polymorphisms and inferred haplotypes among 10 potassium channel genes and the occurrence of preoperative breast pain in patients scheduled to undergo breast cancer surgery. Multivariable logistic regression analyses were used to identify those genetic variations that were associated with the occurrence of preoperative breast pain while controlling for age and genomic estimates of and self-reported race/ethnicity. Variations in four potassium channel genes: (1) potassium voltage-gated channel, delayed rectifier, subfamily S, member 1 (KCNS1); (2) potassium inwardly rectifying channel, subfamily J, member 3 (KCNJ3); (3) KCNJ6; and (4) potassium channel, subfamily K, member 9 (KCNK9) were associated with the occurrence of breast pain. Findings from this study warrant replication in an independent sample of women who report breast pain following one or more breast biopsies.

  2. Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent

    Science.gov (United States)

    Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...

  3. Gene variations of nitric oxide synthase regulate the effects of a saturated fat rich meal on endothelial function

    Science.gov (United States)

    Objective: Endothelial nitric oxide synthase gene variations have been linked to a higher risk for cardiovascular diseases by unknown mechanisms. Our aim was to determine if two SNPs located in NOS3 (E298D and i19342) interfere with microvascular endothelial function (MEF) and/or oxidative stress du...

  4. An LTR Retrotransposon-Derived Gene Displays Lineage-Specific Structural and Putative Species-Specific Functional Variations in Eutherians

    Science.gov (United States)

    Irie, Masahito; Koga, Akihiko; Kaneko-Ishino, Tomoko; Ishino, Fumitoshi

    2016-01-01

    Amongst the 11 eutherian-specific genes acquired from a sushi-ichi retrotransposon is the CCHC type zinc-finger protein-encoding gene SIRH11/ZCCHC16. Its contribution to eutherian brain evolution is implied because of its involvement in cognitive function in mice, possibly via the noradrenergic system. Although, the possibility that Sirh11/Zcchc16 functions as a non-coding RNA still remains, dN/dS ratios in pairwise comparisons between its orthologs have provided supportive evidence that it acts as a protein. It became a pseudogene in armadillos (Cingulata) and sloths (Pilosa), the only two extant orders of xenarthra, which prompted us to examine the lineage-specific variations of SIRH11/ZCCHC16 in eutherians. We examined the predicted SIRH11/ZCCHC16 open reading frame (ORF) in 95 eutherian species based on the genomic DNA information in GenBank. A large variation in the SIRH11/ZCCHC16 ORF was detected in several lineages. These include a lack of a CCHC RNA-binding domain in its C-terminus, observed in gibbons (Hylobatidae: Primates) and megabats (Megachiroptera: Chiroptera). A lack of the N-terminal half, on the other hand, was observed in New World monkeys (Platyrrhini: Primates) and species belonging to New World and African Hystricognaths (Caviomorpha and Bathyergidae: Rodents) along with Cetacea and Ruminantia (Cetartiodactyla). Among the hominoids, interestingly, three out of four genera of gibbons have lost normal SIRH11/ZCCHC16 function by deletion or the lack of the CCHC RNA-binding domain. Our extensive dN/dS analysis suggests that such truncated SIRH11/ZCCHC16 ORFs are functionally diversified even within lineages. Combined, our results show that SIRH11/ZCCHC16 may contribute to the diversification of eutherians by lineage-specific structural changes after its domestication in the common eutherian ancestor, followed by putative species-specific functional changes that enhanced fitness and occurred as a consequence of complex natural selection events

  5. The impact of heat shock protein 70 gene variations on clinical presentation and outcome in schizophrenic inpatients.

    Science.gov (United States)

    Pae, Chi-Un; Drago, Antonio; Kim, Jung-Jin; Mandelli, Laura; De Ronchi, Diana; Serretti, Alessandro

    2009-01-01

    We previously investigated a group of single-nucleotide polymorphisms of a set of genes coding for heat shock proteins (HSPA1A, HSPA1B and HSPA1L) and found a significant association between one HSPA1B variation and schizophrenia (SZ). We now report an association between a set of variations (rs2227956, rs2075799, rs1043618, rs562047 and rs539689) within the same genes and a larger sample of schizophrenic inpatients. A single variation, rs539689 (HSPA1B), was found to be marginally associated with Positive and Negative Syndrome Scale (PANSS) positive scores at discharge, and haplotype analysis revealed a significant association between improvement in PANSS scores with both A-C-G-G and A-C-G-G haplotypes. These findings further support a role of heat shock proteins in the pathophysiology of SZ.

  6. Assessment of PD-1 gene variation in patients with multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Shadmehri AA

    2010-05-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Multiple sclerosis (MS is a chronic inflammatory demyelinating disease of the central nervous system with presumed autoimmune origin. T cells are considered to play a pivotal role in orchestrating the self-reactive immune responses in multiple sclerosis (MS. This study was performed to investigate the role of polymorphisms of the programmed cell death 1 (PD-1 gene on susceptibility to ankylosing spondylitis. This gene codes an immunoreceptor named PD-1, which has a cytoplasmic domain containing two tyrosine residues located within immunoreceptor tyrosine-based inhibitory and switch motifs (ITIM and ITSM, suggesting that PD-1 is predominantly inhibitory which responsible for the negative regulation in T cell activation and peripheral tolerance. We investigated whether PD-1 gene polymorphism is a genetic modifier for risk and progression of MS."n"n Methods: Blood samples from 150 Iranian Relapsing-Remitting MS patients (mean age, 34.98 years and 202 healthy controls (mean age, 30 years were enrolled in this study. The PD-1.3 (7146 G/A Intron 4 and PD-1.9 (7625 C/T Exon 5 polymorphisms were detected by Polymerase Chain Reaction and Restriction Enzyme digestion or Restriction Fragment Length Polymorphism (PCR

  7. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Directory of Open Access Journals (Sweden)

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  8. Genetic variation in selenoprotein genes, lifestyle, and risk of colon and rectal cancer.

    Directory of Open Access Journals (Sweden)

    Martha L Slattery

    Full Text Available BACKGROUND: Associations between selenium and cancer have directed attention to role of selenoproteins in the carcinogenic process. METHODS: We used data from two population-based case-control studies of colon (n = 1555 cases, 1956 controls and rectal (n = 754 cases, 959 controls cancer. We evaluated the association between genetic variation in TXNRD1, TXNRD2, TXNRD3, C11orf31 (SelH, SelW, SelN1, SelS, SepX, and SeP15 with colorectal cancer risk. RESULTS: After adjustment for multiple comparisons, several associations were observed. Two SNPs in TXNRD3 were associated with rectal cancer (rs11718498 dominant OR 1.42 95% CI 1.16,1.74 pACT 0.0036 and rs9637365 recessive 0.70 95% CI 0.55,0.90 pACT 0.0208. Four SNPs in SepN1 were associated with rectal cancer (rs11247735 recessive OR 1.30 95% CI 1.04,1.63 pACT 0.0410; rs2072749 GGvsAA OR 0.53 95% CI 0.36,0.80 pACT 0.0159; rs4659382 recessive OR 0.58 95% CI 0.39,0.86 pACT 0.0247; rs718391 dominant OR 0.76 95% CI 0.62,0.94 pACT 0.0300. Interaction between these genes and exposures that could influence these genes showed numerous significant associations after adjustment for multiple comparisons. Two SNPs in TXNRD1 and four SNPs in TXNRD2 interacted with aspirin/NSAID to influence colon cancer; one SNP in TXNRD1, two SNPs in TXNRD2, and one SNP in TXNRD3 interacted with aspirin/NSAIDs to influence rectal cancer. Five SNPs in TXNRD2 and one in SelS, SeP15, and SelW1 interacted with estrogen to modify colon cancer risk; one SNP in SelW1 interacted with estrogen to alter rectal cancer risk. Several SNPs in this candidate pathway influenced survival after diagnosis with colon cancer (SeP15 and SepX1 increased HRR and rectal cancer (SepX1 increased HRR. CONCLUSIONS: Findings support an association between selenoprotein genes and colon and rectal cancer development and survival after diagnosis. Given the interactions observed, it is likely that the impact of cancer susceptibility from genotype is

  9. Common Variation in the LRRK2 Gene is a Risk Factor for Parkinson’s Disease

    Science.gov (United States)

    Mata, Ignacio F.; Checkoway, Harvey; Hutter, Carolyn M.; Samii, Ali; Roberts, John W.; Kim, Hojoong M.; Agarwal, Pinky; Alvarez, Victoria; Ribacoba, Renee; Pastor, Pau; Lorenzo-Betancor, Oswaldo; Infante, Jon; Sierra, María; Gómez-Garre, Pilar; Mir, Pablo; Ritz, Beate; Rhodes, Shannon L; Colcher, Amy; Van Deerlin, Vivianna; Chung, Kathryn A.; Quinn, Joseph F.; Yearout, Dora; Martinez, Erica; Farin, Federico M.; Wan, Jia Y.; Edwards, Karen L.; Zabetian, Cyrus P.

    2012-01-01

    Background Common variants in the LRRK2 gene influence risk of Parkinson’s disease (PD) in Asians, but whether the same is true in European-derived populations is less clear. Methods We genotyped 66 LRRK2 tagging single nucleotide polymorphisms (SNPs) in 575 PD patients and 689 controls from the Northwestern U.S. (Tier 1). PD-associated SNPs (p<0.05) were then genotyped in an independent sample of 3617 cases and 2512 controls from the U.S. and Spain (Tier 2). Logistic regression was used to model additive SNP genotype effects adjusted for age and sex among white individuals. Results Two regions showed independent association with PD in Tier 1, and SNPs in both regions were successfully replicated in Tier 2 (rs10878226, combined odds ratio [OR], 1.20; 95% confidence interval [CI], 1.08-1.33; p=6.3×10−4; rs11176013, OR, 0.89; CI, 0.83-0.95; p=4.6×10−4). Conclusions Our data suggest that common variation within LRRK2 conveys susceptibility for PD in individuals of European ancestry. PMID:23115130

  10. Haplotype variation of Green Revolution gene Rht-D1 during wheat domestication and improvement

    Institute of Scientific and Technical Information of China (English)

    Chihong Zhang; Lifeng Gao; Jiaqiang Sun; Jizeng Jia; Zhenglong Ren

    2014-01-01

    Green Revolution made a substantial contribution to wheat yields worldwide in the 1960s and 1970s. It is of great importance to analyze the haplotype variation of Rht-D1, the Green Revolution gene, during wheat (Triticum aestivum L.) domestication and breeding to understand its evolution and function in wheat breeding history. In this study, the Rht-D1 and its flanking regions were sequenced and single nucleotide polymorphisms were detected based on a panel of 45 accessions of Aegilops tauschi , 51 accessions of landraces and 80 accessions of commercial varieties. Genetic diversity in the wild accessions was much higher than that in the varieties and higher than that reported previously. Seven haplotypes (Hapl I to Hapl VII) of Rht-D1 were identified and their evolutionary relationships were proposed. In addition to the wel-known Green Revolution al ele Rht-D1b, Hapl VII (an al ele Rht-D1k) was identified in early breeding varieties, which reduced plant height by 16%. The results suggested that Rht-D1k had been used in breeding before the Green Revolution and made a great contribution to wheat production worldwide. Based on the breeding history and molecular evidence, we proposed that the wheat Green Revolution in China and International Maize and Wheat Improvement Center (CIMMYT) occurred independently.

  11. Heritable variation in heat shock gene expression: a potential mechanism for adaptation to thermal stress in embryos of sea turtles.

    Science.gov (United States)

    Tedeschi, J N; Kennington, W J; Tomkins, J L; Berry, O; Whiting, S; Meekan, M G; Mitchell, N J

    2016-01-13

    The capacity of species to respond adaptively to warming temperatures will be key to their survival in the Anthropocene. The embryos of egg-laying species such as sea turtles have limited behavioural means for avoiding high nest temperatures, and responses at the physiological level may be critical to coping with predicted global temperature increases. Using the loggerhead sea turtle (Caretta caretta) as a model, we used quantitative PCR to characterise variation in the expression response of heat-shock genes (hsp60, hsp70 and hsp90; molecular chaperones involved in cellular stress response) to an acute non-lethal heat shock. We show significant variation in gene expression at the clutch and population levels for some, but not all hsp genes. Using pedigree information, we estimated heritabilities of the expression response of hsp genes to heat shock and demonstrated both maternal and additive genetic effects. This is the first evidence that the heat-shock response is heritable in sea turtles and operates at the embryonic stage in any reptile. The presence of heritable variation in the expression of key thermotolerance genes is necessary for sea turtles to adapt at a molecular level to warming incubation environments.

  12. Single-gene negative binomial regression models for RNA-Seq data with higher-order asymptotic inference.

    Science.gov (United States)

    Di, Yanming

    2015-01-01

    We consider negative binomial (NB) regression models for RNA-Seq read counts and investigate an approach where such NB regression models are fitted to individual genes separately and, in particular, the NB dispersion parameter is estimated from each gene separately without assuming commonalities between genes. This single-gene approach contrasts with the more widely-used dispersion-modeling approach where the NB dispersion is modeled as a simple function of the mean or other measures of read abundance, and then estimated from a large number of genes combined. We show that through the use of higher-order asymptotic techniques, inferences with correct type I errors can be made about the regression coefficients in a single-gene NB regression model even when the dispersion is unknown and the sample size is small. The motivations for studying single-gene models include: 1) they provide a basis of reference for understanding and quantifying the power-robustness trade-offs of the dispersion-modeling approach; 2) they can also be potentially useful in practice if moderate sample sizes become available and diagnostic tools indicate potential problems with simple models of dispersion.

  13. Rapid screening of an ordered fosmid library to clone multiple polyketide synthase genes of the phytopathogenic fungus Cladosporium phlei.

    Science.gov (United States)

    So, Kum-Kang; Kim, Jung-Mi; Nguyen, Ngoc-Luong; Park, Jin-Ah; Kim, Beom-Tae; Park, Seung-Moon; Hwang, Ki-Jun; Kim, Dae-Hyuk

    2012-12-01

    In previous studies, the biological characteristics of the fungus Cladosporium phlei and its genetic manipulation by transformation were assessed to improve production of the fungal pigment, phleichrome, which is a fungal perylenequinone that plays an important role in the production of a photodynamic therapeutic agent. However, the low production of this metabolite by the wild-type strain has limited its application. Thus, we attempted to clone and characterize the genes that encode polyketide synthases (PKS), which are responsible for the synthesis of fungal pigments such as perylenequinones including phleichrome, elsinochrome and cercosporin. Thus, we performed genomic DNA PCR using 11 different combinations of degenerate primers targeting conserved domains including β-ketoacyl synthase and acyltransferase domains. Sequence comparison of the PCR amplicons revealed a high homology to known PKSs, and four different PKS genes showing a high similarity to three representative types of PKS genes were amplified. To obtain full-length PKS genes, an ordered gene library of a phleichrome-producing C. phlei strain (ATCC 36193) was constructed in a fosmid vector and 4800 clones were analyzed using a simple pyramidal arrangement system. This hierarchical clustering method combines the efficiency of PCR with enhanced specificity. Among the three representative types of PKSs, two reducing, one partially reducing, and one non-reducing PKS were identified. These genes were subsequently cloned, sequenced, and characterized. Biological characterization of these genes to determine their roles in phleichrome production is underway, with the ultimate aim of engineering this pathway to overproduce the desired substance.

  14. The ordering of expression among a few genes can provide simple cancer biomarkers and signal BRCA1 mutations

    Directory of Open Access Journals (Sweden)

    Parmigiani Giovanni

    2009-08-01

    Full Text Available Abstract Background A major challenge in computational biology is to extract knowledge about the genetic nature of disease from high-throughput data. However, an important obstacle to both biological understanding and clinical applications is the "black box" nature of the decision rules provided by most machine learning approaches, which usually involve many genes combined in a highly complex fashion. Achieving biologically relevant results argues for a different strategy. A promising alternative is to base prediction entirely upon the relative expression ordering of a small number of genes. Results We present a three-gene version of "relative expression analysis" (RXA, a rigorous and systematic comparison with earlier approaches in a variety of cancer studies, a clinically relevant application to predicting germline BRCA1 mutations in breast cancer and a cross-study validation for predicting ER status. In the BRCA1 study, RXA yields high accuracy with a simple decision rule: in tumors carrying mutations, the expression of a "reference gene" falls between the expression of two differentially expressed genes, PPP1CB and RNF14. An analysis of the protein-protein interactions among the triplet of genes and BRCA1 suggests that the classifier has a biological foundation. Conclusion RXA has the potential to identify genomic "marker interactions" with plausible biological interpretation and direct clinical applicability. It provides a general framework for understanding the roles of the genes involved in decision rules, as illustrated for the difficult and clinically relevant problem of identifying BRCA1 mutation carriers.

  15. The first complete mitochondrial genome sequences of Amblypygi (Chelicerata: Arachnida) reveal conservation of the ancestral arthropod gene order.

    Science.gov (United States)

    Fahrein, Kathrin; Masta, Susan E; Podsiadlowski, Lars

    2009-05-01

    Amblypygi (whip spiders) are terrestrial chelicerates inhabiting the subtropics and tropics. In morphological and rRNA-based phylogenetic analyses, Amblypygi cluster with Uropygi (whip scorpions) and Araneae (spiders) to form the taxon Tetrapulmonata, but there is controversy regarding the interrelationship of these three taxa. Mitochondrial genomes provide an additional large data set of phylogenetic information (sequences, gene order, RNA secondary structure), but in arachnids, mitochondrial genome data are missing for some of the major orders. In the course of an ongoing project concerning arachnid mitochondrial genomics, we present the first two complete mitochondrial genomes from Amblypygi. Both genomes were found to be typical circular duplex DNA molecules with all 37 genes usually present in bilaterian mitochondrial genomes. In both species, gene order is identical to that of Limulus polyphemus (Xiphosura), which is assumed to reflect the putative arthropod ground pattern. All tRNA gene sequences have the potential to fold into structures that are typical of metazoan mitochondrial tRNAs, except for tRNA-Ala, which lacks the D arm in both amblypygids, suggesting the loss of this feature early in amblypygid evolution. Phylogenetic analysis resulted in weak support for Uropygi being the sister group of Amblypygi.

  16. Multicolor in situ hybridization and linkage analysis order Charcot-Marie-Tooth type I (CMTIA) gene-region markers

    Energy Technology Data Exchange (ETDEWEB)

    Lebo, R.V.; Lynch, E.D.; Golbus, M.S. (Univ. of California, San Francisco (United States)); Bird, T.D. (Univ. of Washington, Seattle (United States)); Barker, D.F.; O' Connell, P.; Chance, P.F. (Univ. of Utah, Salt Lake City (United States))

    1992-01-01

    This study demonstrates a clear and current role for multicolor in situ hybridization in expediting positional cloning studies of unknown disease genes. Nine polymorphic DNA cosmids have been mapped to eight ordered locations spanning the Charcot-Marie-Tooth type 1 (CMT1A) disease gene region in distal band 17p11.2, by multicolor in situ hybridization. When used with linkage analysis, these methods have generated a fine physical map and have firmly assigned the CMT1A gene to distal band 17p11.2. Linkage analysis with four CMT1A pedigrees mapped the CMT1A gene with respect to two flanking markers. Additional loci were physically mapped and ordered by in situ hybridization and analysis of phase-known recombinants in CMT1A pedigrees. These data demonstrate the ability of in situ hybridization to resolve loci within 0.5 Mb on early-metaphase chromosomes. Multicolor in situ hybridization also excluded the possibility of pericentric inversions in two unrelated patients with CMT1 and neurofibromatosis type 1. When used with pulsed-field gel electrophoresis, multicolor in situ hybridization can establish physical location, order, and distance in closely spaced chromosome loci.

  17. Independent losses of visual perception genes Gja10 and Rbp3 in echolocating bats (Order: Chiroptera).

    Science.gov (United States)

    Shen, Bin; Fang, Tao; Dai, Mengyao; Jones, Gareth; Zhang, Shuyi

    2013-01-01

    A trade-off between the sensory modalities of vision and hearing is likely to have occurred in echolocating bats as the sophisticated mechanism of laryngeal echolocation requires considerable neural processing and has reduced the reliance of echolocating bats on vision for perceiving the environment. If such a trade-off exists, it is reasonable to hypothesize that some genes involved in visual function may have undergone relaxed selection or even functional loss in echolocating bats. The Gap junction protein, alpha 10 (Gja10, encoded by Gja10 gene) is expressed abundantly in mammal retinal horizontal cells and plays an important role in horizontal cell coupling. The interphotoreceptor retinoid-binding protein (Irbp, encoded by the Rbp3 gene) is mainly expressed in interphotoreceptor matrix and is known to be critical for normal functioning of the visual cycle. We sequenced Gja10 and Rbp3 genes in a taxonomically wide range of bats with divergent auditory characteristics (35 and 18 species for Gja10 and Rbp3, respectively). Both genes have became pseudogenes in species from the families Hipposideridae and Rhinolophidae that emit constant frequency echolocation calls with Doppler shift compensation at high-duty-cycles (the most sophisticated form of biosonar known), and in some bat species that emit echolocation calls at low-duty-cycles. Our study thus provides further evidence for the hypothesis that a trade-off occurs at the genetic level between vision and echolocation in bats.

  18. Tissue Specificity and Sex-Specific Regulatory Variation Permit the Evolution of Sex-Biased Gene Expression.

    Science.gov (United States)

    Dean, Rebecca; Mank, Judith E

    2016-09-01

    Genetic correlations between males and females are often thought to constrain the evolution of sexual dimorphism. However, sexually dimorphic traits and the underlying sexually dimorphic gene expression patterns are often rapidly evolving. We explore this apparent paradox by measuring the genetic correlation in gene expression between males and females (Cmf) across broad evolutionary timescales, using two RNA-sequencing data sets spanning multiple populations and multiple species. We find that unbiased genes have higher Cmf than sex-biased genes, consistent with intersexual genetic correlations constraining the evolution of sexual dimorphism. However, we found that highly sex-biased genes (both male and female biased) also had higher tissue specificity, and unbiased genes had greater expression breadth, suggesting that pleiotropy may constrain the breakdown of intersexual genetic correlations. Finally, we show that genes with high Cmf showed some degree of sex-specific changes in gene expression in males and females. Together, our results suggest that genetic correlations between males and females may be less important in constraining the evolution of sex-biased gene expression than pleiotropy. Sex-specific regulatory variation and tissue specificity may resolve the paradox of widespread sex bias within a largely shared genome.

  19. Conservation laws of high-order nonlinear PDEs and the variational conservation laws in the class with mixed derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Narain, R; Kara, A H, E-mail: Abdul.Kara@wits.ac.z [School of Mathematics, University of the Witwatersrand, Wits 2050, Johannesburg (South Africa)

    2010-02-26

    The construction of conserved vectors using Noether's theorem via a knowledge of a Lagrangian (or via the recently developed concept of partial Lagrangians) is well known. The formulas to determine these for higher order flows are somewhat cumbersome but peculiar and become more so as the order increases. We carry out these for a class of high-order partial differential equations from mathematical physics and then consider some specific ones with mixed derivatives. In the latter set of examples, our main focus is that the resultant conserved flows display some previously unknown interesting 'divergence properties' owing to the presence of the mixed derivatives. Overall, we consider a large class of equations of interest and construct some new conservation laws.

  20. Aire controls gene expression in the thymic epithelium with ordered stochasticity

    Science.gov (United States)

    Meredith, Matthew; Zemmour, David; Mathis, Diane; Benoist, Christophe

    2015-01-01

    Aire controls immunologic tolerance by inducing the ectopic thymic expression of many tissue-specific genes, acting broadly by removing stops on the transcriptional machinery. To better understand Aire’s specificity, we performed single-cell RNAseq and DNA methylation analysis in Aire-sufficient and -deficient medullary epithelial cells (mTECs). Each of Aire’s target genes was induced in only a minority of mTECs, independently of DNA methylation patterns, as small inter-chromosomal gene clusters activated in concert in a proportion of mTECs. These microclusters differed between individual mice, and thus suggest an organization of the DNA or of the epigenome that results from stochastic determinism, but is bookmarked and stable through mTEC divisions, ensuring more effective presentation of self-antigens, and favoring diversity of self-tolerance between individuals. PMID:26237550

  1. Analysis of an ordered, comprehensive STM mutant library in infectious Borrelia burgdorferi: insights into the genes required for mouse infectivity.

    Directory of Open Access Journals (Sweden)

    Tao Lin

    Full Text Available The identification of genes important in the pathogenesis of Lyme disease Borrelia has been hampered by exceedingly low transformation rates in low-passage, infectious organisms. Using the infectious, moderately transformable B. burgdorferi derivative 5A18NP1 and signature-tagged versions of the Himar1 transposon vector pGKT, we have constructed a defined transposon library for the efficient genome-wide investigation of genes required for wild-type pathogenesis, in vitro growth, physiology, morphology, and plasmid replication. To facilitate analysis, the insertion sites of 4,479 transposon mutants were determined by sequencing. The transposon insertions were widely distributed across the entire B. burgdorferi genome, with an average of 2.68 unique insertion sites per kb DNA. The 10 linear plasmids and 9 circular plasmids had insertions in 33 to 100 percent of their predicted genes. In contrast, only 35% of genes in the 910 kb linear chromosome had incapacitating insertions; therefore, the remaining 601 chromosomal genes may represent essential gene candidates. In initial signature-tagged mutagenesis (STM analyses, 434 mutants were examined at multiple tissue sites for infectivity in mice using a semi-quantitative, Luminex-based DNA detection method. Examples of genes found to be important in mouse infectivity included those involved in motility, chemotaxis, the phosphoenolpyruvate phosphotransferase system, and other transporters, as well as putative plasmid maintenance genes. Availability of this ordered STM library and a high-throughput screening method is expected to lead to efficient assessment of the roles of B. burgdorferi genes in the infectious cycle and pathogenesis of Lyme disease.

  2. Analysis of the relationship between longitudinal gene expressions and ordered categorical event data

    OpenAIRE

    Rajicic, Natasa; Finkelstein, Dianne M; Schoenfeld, David A.

    2009-01-01

    The NIH project ”Inflammatory and Host Response to Injury” (Glue) is being conducted to study the changes in the body over time in response to trauma and burn. Patients are monitored for changes in their clinical status, such as the onset of and recovery from organ failure. Blood samples are drawn over the first days and weeks after the injury to obtain gene expression levels over time. Our goal was to develop a method of selecting genes that differentially expressed in pati...

  3. Variation in the MC4R gene is associated with bone phenotypes in elderly Swedish women.

    Directory of Open Access Journals (Sweden)

    Gaurav Garg

    Full Text Available Osteoporosis is characterized by reduced bone mineral density (BMD and increased fracture risk. Fat mass is a determinant of bone strength and both phenotypes have a strong genetic component. In this study, we examined the association between obesity associated polymorphisms (SNPs with body composition, BMD, Ultrasound (QUS, fracture and biomarkers (Homocysteine (Hcy, folate, Vitamin D and Vitamin B12 for obesity and osteoporosis. Five common variants: rs17782313 and rs1770633 (melanocortin 4 receptor (MC4R; rs7566605 (insulin induced gene 2 (INSIG2; rs9939609 and rs1121980 (fat mass and obesity associated (FTO were genotyped in 2 cohorts of Swedish women: PEAK-25 (age 25, n = 1061 and OPRA (age 75, n = 1044. Body mass index (BMI, total body fat and lean mass were strongly positively correlated with QUS and BMD in both cohorts (r(2 = 0.2-0.6. MC4R rs17782313 was associated with QUS in the OPRA cohort and individuals with the minor C-allele had higher values compared to T-allele homozygotes (TT vs. CT vs.100 vs. 103 vs. 103; p = 0.002; (SOS: 1521 vs. 1526 vs. 1524; p = 0.008; (Stiffness index: 69 vs. 73 vs. 74; p = 0.0006 after adjustment for confounders. They also had low folate (18 vs. 17 vs. 16; p = 0.03 and vitamin D (93 vs. 91 vs. 90; p = 0.03 and high Hcy levels (13.7 vs 14.4 vs. 14.5; p = 0.06. Fracture incidence was lower among women with the C-allele, (52% vs. 58%; p = 0.067. Variation in MC4R was not associated with BMD or body composition in either OPRA or PEAK-25. SNPs close to FTO and INSIG2 were not associated with any bone phenotypes in either cohort and FTO SNPs were only associated with body composition in PEAK-25 (p≤0.001. Our results suggest that genetic variation close to MC4R is associated with quantitative ultrasound and risk of fracture.

  4. A molecular footprint of limb loss: sequence variation of the autopodial identity gene Hoxa-13.

    Science.gov (United States)

    Kohlsdorf, Tiana; Cummings, Michael P; Lynch, Vincent J; Stopper, Geffrey F; Takahashi, Kazuhiko; Wagner, Günter P

    2008-12-01

    The homeobox gene Hoxa-13 codes for a transcription factor involved in multiple functions, including body axis and hand/foot development in tetrapods. In this study we investigate whether the loss of one function (e.g., limb loss in snakes) left a molecular footprint in exon 1 of Hoxa-13 that could be associated with the release of functional constraints caused by limb loss. Fragments of the Hoxa-13 exon 1 were sequenced from 13 species and analyzed, with additional published sequences of the same region, using relative rates and likelihood-ratio tests. Five amino acid sites in exon 1 of Hoxa-13 were detected as evolving under positive selection in the stem lineage of snakes. To further investigate whether there is an association between limb loss and sequence variation in Hoxa-13, we used the random forest method on an alignment that included shark, basal fish lineages, and "eu-tetrapods" such as mammals, turtle, alligator, and birds. The random forest method approaches the problem as one of classification, where we seek to predict the presence or absence of autopodium based on amino acid variation in Hoxa-13 sequences. Different alignments tested were associated with similar error rates (18.42%). The random forest method suggested that phenotypic states (autopodium present and absent) can often be correctly predicted based on Hoxa-13 sequences. Basal, nontetrapod gnat-hostomes that never had an autopodium were consistently classified as limbless together with the snakes, while eu-tetrapods without any history of limb loss in their phylogeny were also consistently classified as having a limb. Misclassifications affected mostly lizards, which, as a group, have a history of limb loss and limb re-evolution, and the urodele and caecilian in our sample. We conclude that a molecular footprint can be detected in Hoxa-13 that is associated with the lack of an autopodium; groups with classification ambiguity (lizards) are characterized by a history of repeated limb loss

  5. Genetic Variation in the HSD17B1 Gene and Risk of Prostate Cancer

    Science.gov (United States)

    Kraft, Peter; Pharoah, Paul; Chanock, Stephen J; Albanes, Demetrius; Kolonel, Laurence N; Hayes, Richard B; Altshuler, David; Andriole, Gerald; Berg, Christine; Boeing, Heiner; Burtt, Noel P; Bueno-de-Mesquita, Bas; Calle, Eugenia E; Cann, Howard; Canzian, Federico; Chen, Yen-Ching; Crawford, David E; Dunning, Alison M; Feigelson, Heather S; Freedman, Matthew L; Gaziano, John M; Giovannucci, Ed; Gonzalez, Carlos Alberto; Haiman, Christopher A; Hallmans, Goran; Henderson, Brian E; Hirschhorn, Joel N; Hunter, David J; Kaaks, Rudolf; Key, Timothy; Marchand, Loic Le; Ma, Jing; Overvad, Kim; Palli, Domenico; Pike, Malcolm C; Riboli, Elio; Rodriguez, Carmen; Setiawan, Wendy V; Stampfer, Meir J; Stram, Daniel O; Thomas, Gilles; Thun, Michael J; Travis, Ruth; Trichopoulou, Antonia; Virtamo, Jarmo; Wacholder, Sholom

    2005-01-01

    Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17β-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Δ5-androsterone-3β,17β-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs) that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G) or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002) inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes these subgroup analyses

  6. Genetic variation in the HSD17B1 gene and risk of prostate cancer.

    Directory of Open Access Journals (Sweden)

    Peter Kraft

    2005-11-01

    Full Text Available Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17beta-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Delta5-androsterone-3beta,17beta-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002 inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes

  7. Immune gene expression in Bombus terrestris: signatures of infection despite strong variation among populations, colonies, and sister workers.

    Directory of Open Access Journals (Sweden)

    Franziska S Brunner

    Full Text Available Ecological immunology relies on variation in resistance to parasites. Colonies of the bumblebee Bombus terrestris vary in their susceptibility to the trypanosome gut parasite Crithidia bombi, which reduces colony fitness. To understand the possible origin of this variation in resistance we assayed the expression of 28 immunologically important genes in foraging workers. We deliberately included natural variation of the host "environment" by using bees from colonies collected in two locations and sampling active foraging workers that were not age controlled. Immune gene expression patterns in response to C. bombi showed remarkable variability even among genetically similar sisters. Nevertheless, expression varied with parasite exposure, among colonies and, perhaps surprisingly, strongly among populations (collection sites. While only the antimicrobial peptide abaecin is universally up regulated upon exposure, linear discriminant analysis suggests that the overall exposure effect is driven by a combination of several immune pathways and further immune functions such as ROS regulation. Also, the differences among colonies in their immune gene expression profiles provide clues to the mechanistic basis of well-known inter-colony variation in susceptibility to this parasite. Our results show that transcriptional responses to parasite exposure can be detected in ecologically heterogeneous groups despite strong background noise.

  8. Colony-level behavioral variation correlates with differences in expression of the foraging gene in red imported fire ants.

    Science.gov (United States)

    Bockoven, Alison A; Coates, Craig J; Eubanks, Micky D

    2017-09-13

    Among social insects, colony-level variation is likely to be widespread and have significant ecological consequences. Very few studies, however, have documented how genetic factors relate to behavior at the colony level. Differences in expression of the foraging gene have been associated with differences in foraging and activity of a wide variety of organisms. We quantified expression of the red imported fire ant foraging gene (sifor) in workers from 21 colonies collected across the natural range of Texas fire ant populations, but maintained under standardized, environmentally controlled conditions. Colonies varied significantly in their behavior. The most active colonies had up to 10 times more active foragers than the least active colony and more than 16 times as many workers outside the nest. Expression differences among colonies correlated with this colony-level behavioral variation. Colonies with higher sifor expression in foragers had, on average, significantly higher foraging activity, exploratory activity, and recruitment to nectar than colonies with lower expression. Expression of sifor was also strongly correlated with worker task (foraging versus working in the interior of the nest). These results provide insight into the genetic and physiological processes underlying collective differences in social behavior. Quantifying variation in expression of the foraging gene may provide an important tool for understanding and predicting the ecological consequences of colony-level behavioral variation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  9. Variations and classification of toxic epitopes related to celiac disease among α-gliadin genes from four Aegilops genomes.

    Science.gov (United States)

    Li, Jie; Wang, Shunli; Li, Shanshan; Ge, Pei; Li, Xiaohui; Ma, Wujun; Zeller, F J; Hsam, Sai L K; Yan, Yueming

    2012-07-01

    The α-gliadins are associated with human celiac disease. A total of 23 noninterrupted full open reading frame α-gliadin genes and 19 pseudogenes were cloned and sequenced from C, M, N, and U genomes of four diploid Aegilops species. Sequence comparison of α-gliadin genes from Aegilops and Triticum species demonstrated an existence of extensive allelic variations in Gli-2 loci of the four Aegilops genomes. Specific structural features were found including the compositions and variations of two polyglutamine domains (QI and QII) and four T cell stimulatory toxic epitopes. The mean numbers of glutamine residues in the QI domain in C and N genomes and the QII domain in C, N, and U genomes were much higher than those in Triticum genomes, and the QI domain in C and N genomes and the QII domain in C, M, N, and U genomes displayed greater length variations. Interestingly, the types and numbers of four T cell stimulatory toxic epitopes in α-gliadins from the four Aegilops genomes were significantly less than those from Triticum A, B, D, and their progenitor genomes. Relationships between the structural variations of the two polyglutamine domains and the distributions of four T cell stimulatory toxic epitopes were found, resulting in the α-gliadin genes from the Aegilops and Triticum genomes to be classified into three groups.

  10. Accurately assessing the risk of schizophrenia conferred by rare copy-number variation affecting genes with brain function.

    Science.gov (United States)

    Raychaudhuri, Soumya; Korn, Joshua M; McCarroll, Steven A; Altshuler, David; Sklar, Pamela; Purcell, Shaun; Daly, Mark J

    2010-09-09

    Investigators have linked rare copy number variation (CNVs) to neuropsychiatric diseases, such as schizophrenia. One hypothesis is that CNV events cause disease by affecting genes with specific brain functions. Under these circumstances, we expect that CNV events in cases should impact brain-function genes more frequently than those events in controls. Previous publications have applied "pathway" analyses to genes within neuropsychiatric case CNVs to show enrichment for brain-functions. While such analyses have been suggestive, they often have not rigorously compared the rates of CNVs impacting genes with brain function in cases to controls, and therefore do not address important confounders such as the large size of brain genes and overall differences in rates and sizes of CNVs. To demonstrate the potential impact of confounders, we genotyped rare CNV events in 2,415 unaffected controls with Affymetrix 6.0; we then applied standard pathway analyses using four sets of brain-function genes and observed an apparently highly significant enrichment for each set. The enrichment is simply driven by the large size of brain-function genes. Instead, we propose a case-control statistical test, cnv-enrichment-test, to compare the rate of CNVs impacting specific gene sets in cases versus controls. With simulations, we demonstrate that cnv-enrichment-test is robust to case-control differences in CNV size, CNV rate, and systematic differences in gene size. Finally, we apply cnv-enrichment-test to rare CNV events published by the International Schizophrenia Consortium (ISC). This approach reveals nominal evidence of case-association in neuronal-activity and the learning gene sets, but not the other two examined gene sets. The neuronal-activity genes have been associated in a separate set of schizophrenia cases and controls; however, testing in independent samples is necessary to definitively confirm this association. Our method is implemented in the PLINK software package.

  11. Accurately Assessing the Risk of Schizophrenia Conferred by Rare Copy-Number Variation Affecting Genes with Brain Function

    Science.gov (United States)

    Raychaudhuri, Soumya; Korn, Joshua M.; McCarroll, Steven A.; Altshuler, David; Sklar, Pamela; Purcell, Shaun; Daly, Mark J.

    2010-01-01

    Investigators have linked rare copy number variation (CNVs) to neuropsychiatric diseases, such as schizophrenia. One hypothesis is that CNV events cause disease by affecting genes with specific brain functions. Under these circumstances, we expect that CNV events in cases should impact brain-function genes more frequently than those events in controls. Previous publications have applied “pathway” analyses to genes within neuropsychiatric case CNVs to show enrichment for brain-functions. While such analyses have been suggestive, they often have not rigorously compared the rates of CNVs impacting genes with brain function in cases to controls, and therefore do not address important confounders such as the large size of brain genes and overall differences in rates and sizes of CNVs. To demonstrate the potential impact of confounders, we genotyped rare CNV events in 2,415 unaffected controls with Affymetrix 6.0; we then applied standard pathway analyses using four sets of brain-function genes and observed an apparently highly significant enrichment for each set. The enrichment is simply driven by the large size of brain-function genes. Instead, we propose a case-control statistical test, cnv-enrichment-test, to compare the rate of CNVs impacting specific gene sets in cases versus controls. With simulations, we demonstrate that cnv-enrichment-test is robust to case-control differences in CNV size, CNV rate, and systematic differences in gene size. Finally, we apply cnv-enrichment-test to rare CNV events published by the International Schizophrenia Consortium (ISC). This approach reveals nominal evidence of case-association in neuronal-activity and the learning gene sets, but not the other two examined gene sets. The neuronal-activity genes have been associated in a separate set of schizophrenia cases and controls; however, testing in independent samples is necessary to definitively confirm this association. Our method is implemented in the PLINK software package

  12. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    NARCIS (Netherlands)

    Bross, Peter; Li, Zhijie; Hansen, Jakob; Hansen, Jens Jacob; Nielsen, Marit Nyholm; Corydon, Thomas Juhl; Georgopoulos, Costa; Ang, Debbie; Lundemose, Jytte Banner; Niezen-Koning, Klary; Eiberg, Hans; Yang, Huanming; Kolvraa, Steen; Bolund, Lars; Gregersen, Niels

    2007-01-01

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups for v

  13. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    NARCIS (Netherlands)

    Bross, Peter; Li, Zhijie; Hansen, Jakob; Hansen, Jens Jacob; Nielsen, Marit Nyholm; Corydon, Thomas Juhl; Georgopoulos, Costa; Ang, Debbie; Lundemose, Jytte Banner; Niezen-Koning, Klary; Eiberg, Hans; Yang, Huanming; Kolvraa, Steen; Bolund, Lars; Gregersen, Niels

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups for

  14. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    DEFF Research Database (Denmark)

    Bross, Peter; Li, Zhijie; Hansen, Jakob;

    2007-01-01

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups fo...

  15. Coexistence of trichome variation in a natural plant population: a combined study using ecological and candidate gene approaches.

    Directory of Open Access Journals (Sweden)

    Tetsuhiro Kawagoe

    Full Text Available The coexistence of distinct phenotypes within populations has long been investigated in evolutionary ecology. Recent studies have identified the genetic basis of distinct phenotypes, but it is poorly understood how the variation in candidate loci is maintained in natural environments. In this study, we examined fitness consequences and genetic basis of variation in trichome production in a natural population of Arabidopsis halleri subsp. gemmifera. Half of the individuals in the study population produced trichomes while the other half were glabrous, and the leaf beetle Phaedon brassicae imposed intensive damage to both phenotypes. The fitness of hairy and glabrous plants showed no significant differences in the field during two years. A similar result was obtained when sibling hairy and glabrous plants were transplanted at the same field site, whereas a fitness cost of trichome production was detected under a weak herbivory condition. Thus, equivalent fitness of hairy and glabrous plants under natural herbivory allows their coexistence in the contemporary population. The pattern of polymorphism of the candidate trichome gene GLABROUS1 (GL1 showed no evidence of long-term maintenance of trichome variation within the population. Although balancing selection under fluctuating biotic environments is often proposed to explain the maintenance of defense variation, the lack of clear evidence of balancing selection in the study population suggests that other factors such as gene flow and neutral process may have played relatively large roles in shaping trichome variation at least for the single population level.

  16. Quantitative variation in obesity-related traits and insulin precursors linked to the OB gene region on human chromosome 7

    Energy Technology Data Exchange (ETDEWEB)

    Duggirala, R.; Stern, M.P.; Reinhart, L.J. [Univ. of Texas Health Science Center, San Antonio, TX (United States)] [and others

    1996-09-01

    Despite the evidence that human obesity has strong genetic determinants, efforts at identifying specific genes that influence human obesity have largely been unsuccessful. Using the sibship data obtained from 32 low-income Mexican American pedigrees ascertained on a type II diabetic proband and a multipoint variance-components method, we tested for linkage between various obesity-related traits plus associated metabolic traits and 15 markers on human chromosome 7. We found evidence for linkage between markers in the OB gene region and various traits, as follows: D7S514 and extremity skinfolds (LOD = 3.1), human carboxypeptidase A1 (HCPA1) and 32,33-split proinsulin level (LOD = 4.2), and HCPA1 and proinsulin level (LOD = 3.2). A putative susceptibility locus linked to the marker D7S514 explained 56% of the total phenotypic variation in extremity skinfolds. Variation at the HCPA1 locus explained 64% of phenotypic variation in proinsulin level and {approximately}73% of phenotypic variation in split proinsulin concentration, respectively. Weaker evidence for linkage to several other obesity-related traits (e.g., waist circumference, body-mass index, fat mass by bioimpedance, etc.) was observed for a genetic location, which is {approximately}15 cM telomeric to OB. In conclusion, our study reveals that the OB region plays a significant role in determining the phenotypic variation of both insulin precursors and obesity-related traits, at least in Mexican Americans. 66 refs., 3 figs., 4 tabs.

  17. Natural variations in expression of regulatory and detoxification related genes under limiting phosphate and arsenate stress in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Tapsi eShukla

    2015-10-01

    Full Text Available Abiotic stress including nutrient deficiency and heavy metal toxicity severely affects plant growth, development, and productivity. Genetic variations within and in between species are one of the important factors in establishing interactions and responses of plants with the environment. In the recent past, natural variations in Arabidopsis thaliana have been used to understand plant development and response towards different stresses at genetic level. Phosphorus (Pi deficiency negatively affects plant growth and metabolism and modulates expression of the genes involved in Pi homeostasis. Arsenate, As(V, a chemical analogue of Pi, is taken up by the plants via phosphate transport system. Studies suggest that during Pi deficiency, enhanced As(V uptake leads to increased toxicity in plants. Here, the natural variations in Arabidopsis have been utilized to study the As(V stress response under limiting Pi condition. The primary root length was compared to identify differential response of three Arabidopsis accessions (Col-0, Sij-1 and Slavi-1 under limiting Pi and As(V stress. To study the molecular mechanisms responsible for the differential response, comprehensive expression profiling of the genes involved in uptake, detoxification and regulatory mechanisms was carried out. Analysis suggests genetic variation-dependent regulatory mechanisms may affect differential response of Arabidopsis natural variants towards As(V stress under limiting Pi condition. Therefore, it is hypothesized that detailed analysis of the natural variations under multiple stress conditions might help in the better understanding of the biological processes involved in stress tolerance and adaptation.

  18. Variation in Maturity-Onset Diabetes of the Young Genes Influence Response to Interventions for Diabetes Prevention.

    Science.gov (United States)

    Billings, Liana K; Jablonski, Kathleen A; Warner, A Sofia; Cheng, Yu-Chien; McAteer, Jarred B; Tipton, Laura; Shuldiner, Alan R; Ehrmann, David A; Manning, Alisa K; Dabelea, Dana; Franks, Paul W; Kahn, Steven E; Pollin, Toni I; Knowler, William C; Altshuler, David; Florez, Jose C

    2017-08-01

    Variation in genes that cause maturity-onset diabetes of the young (MODY) has been associated with diabetes incidence and glycemic traits. This study aimed to determine whether genetic variation in MODY genes leads to differential responses to insulin-sensitizing interventions. This was a secondary analysis of a multicenter, randomized clinical trial, the Diabetes Prevention Program (DPP), involving 27 US academic institutions. We genotyped 22 missense and 221 common variants in the MODY-causing genes in the participants in the DPP. The study included 2806 genotyped DPP participants randomized to receive intensive lifestyle intervention (n = 935), metformin (n = 927), or placebo (n = 944). Association of MODY genetic variants with diabetes incidence at a median of 3 years and measures of 1-year β-cell function, insulinogenic index, and oral disposition index. Analyses were stratified by treatment group for significant single-nucleotide polymorphism × treatment interaction (Pint < 0.05). Sequence kernel association tests examined the association between an aggregate of rare missense variants and insulinogenic traits. After 1 year, the minor allele of rs3212185 (HNF4A) was associated with improved β-cell function in the metformin and lifestyle groups but not the placebo group; the minor allele of rs6719578 (NEUROD1) was associated with an increase in insulin secretion in the metformin group but not in the placebo and lifestyle groups. These results provide evidence that genetic variation among MODY genes may influence response to insulin-sensitizing interventions.

  19. Variation in the X-linked EFHC2 gene is associated with social cognitive abilities in males.

    Science.gov (United States)

    Startin, Carla M; Fiorentini, Chiara; de Haan, Michelle; Skuse, David H

    2015-01-01

    Females outperform males on many social cognitive tasks. X-linked genes may contribute to this sex difference. Males possess one X chromosome, while females possess two X chromosomes. Functional variations in X-linked genes are therefore likely to impact more on males than females. Previous studies of X-monosomic women with Turner syndrome suggest a genetic association with facial fear recognition abilities at Xp11.3, specifically at a single nucleotide polymorphism (SNP rs7055196) within the EFHC2 gene. Based on a strong hypothesis, we investigated an association between variation at SNP rs7055196 and facial fear recognition and theory of mind abilities in males. As predicted, males possessing the G allele had significantly poorer facial fear detection accuracy and theory of mind abilities than males possessing the A allele (with SNP variant accounting for up to 4.6% of variance). Variation in the X-linked EFHC2 gene at SNP rs7055196 is therefore associated with social cognitive abilities in males.

  20. BGMUT: NCBI dbRBC database of allelic variations of genes encoding antigens of blood group systems.

    Science.gov (United States)

    Patnaik, Santosh Kumar; Helmberg, Wolfgang; Blumenfeld, Olga O

    2012-01-01

    Analogous to human leukocyte antigens, blood group antigens are surface markers on the erythrocyte cell membrane whose structures differ among individuals and which can be serologically identified. The Blood Group Antigen Gene Mutation Database (BGMUT) is an online repository of allelic variations in genes that determine the antigens of various human blood group systems. The database is manually curated with allelic information collated from scientific literature and from direct submissions from research laboratories. Currently, the database documents sequence variations of a total of 1251 alleles of all 40 gene loci that together are known to affect antigens of 30 human blood group systems. When available, information on the geographic or ethnic prevalence of an allele is also provided. The BGMUT website also has general information on the human blood group systems and the genes responsible for them. BGMUT is a part of the dbRBC resource of the National Center for Biotechnology Information, USA, and is available online at http://www.ncbi.nlm.nih.gov/projects/gv/rbc/xslcgi.fcgi?cmd=bgmut. The database should be of use to members of the transfusion medicine community, those interested in studies of genetic variation and related topics such as human migrations, and students as well as members of the general public.

  1. Genetic variation within the interleukin-1 gene cluster and ischemic stroke.

    Science.gov (United States)

    Olsson, Sandra; Holmegaard, Lukas; Jood, Katarina; Sjögren, Marketa; Engström, Gunnar; Lövkvist, Håkan; Blomstrand, Christian; Norrving, Bo; Melander, Olle; Lindgren, Arne; Jern, Christina

    2012-09-01

    Evidence is emerging that inflammation plays a key role in the pathophysiology of ischemic stroke (IS). The aim of this study was to investigate whether genetic variation in the interleukin-1α, interleukin-1β, and interleukin-1 receptor antagonist genes (IL1A, IL1B, and IL1RN) is associated with IS and/or any etiologic subtype of IS. Twelve tagSNPs were analyzed in the Sahlgrenska Academy Study on Ischemic Stroke (SAHLSIS), which comprises 844 patients with IS and 668 control subjects. IS subtypes were defined according to the Trial of Org 10172 in Acute Stroke Treatment criteria in SAHLSIS. The Lund Stroke Register and the Malmö Diet and Cancer study were used as a replication sample for overall IS (in total 3145 patients and 1793 control subjects). The single nucleotide polymorphism rs380092 in IL1RN showed an association with overall IS in SAHLSIS (OR, 1.21; 95% CI, 1.02-1.43; P=0.03), which was replicated in the Lund Stroke Register and the Malmö Diet and Cancer study sample. An association was also detected in all samples combined (OR, 1.12; 95% CI, 1.04-1.21; P=0.03). Three single nucleotide polymorphisms in IL1RN (including rs380092) were nominally associated with the subtype of cryptogenic stroke in SAHLSIS, but the statistical significance did not remain after correction for multiple testing. Furthermore, increased plasma levels of interleukin-1 receptor antagonist were observed in the subtype of cryptogenic stroke compared with controls. This comprehensive study, based on a tagSNP approach and replication, presents support for the role of IL1RN in overall IS.

  2. Mutations in MAPT gene cause chromosome instability and introduce copy number variations widely in the genome.

    Science.gov (United States)

    Rossi, Giacomina; Conconi, Donatella; Panzeri, Elena; Redaelli, Serena; Piccoli, Elena; Paoletta, Laura; Dalprà, Leda; Tagliavini, Fabrizio

    2013-01-01

    In addition to the main function of promoting polymerization and stabilization of microtubules, other roles are being attributed to tau, now considered a multifunctional protein. In particular, previous studies suggest that tau is involved in chromosome stability and genome protection. We performed cytogenetic analysis, including molecular karyotyping, on lymphocytes and fibroblasts from patients affected by frontotemporal lobar degeneration carrying different mutations in the microtubule-associated protein tau gene, to investigate the effects of these mutations on genome stability. Furthermore, we analyzed the response of mutated lymphoblastoid cell lines to genotoxic agents to evaluate the participation of tau to DNA repair systems. We found a significantly higher level of chromosome aberrations in mutated than in control cells. Mutated lymphocytes showed higher percentages of stable lesions, clonal and total aneuploidy (medians: 2 versus 0, p $\\ll$ 0.01; 1.5 versus 0, p $\\ll$ 0.01; 16.5 versus 0, p $\\ll$ 0.01, respectively). Fibroblasts of patients showed higher percentages of stable lesions, structural aberrations and total aneuploidy (medians: 0 versus 0, p = 0.03; 5.8 versus 0, p = 0.02; 26.5 versus 12.6, p $\\ll$ 0.01, respectively). In addition, the in depth analysis of DNA copy number variations showed a higher tendency to non-allelic homologous recombination in mutated cells. Finally, while our analysis did not support an involvement of tau in DNA repair systems, it revealed its role in stabilization of chromatin. In summary, our findings indicate a role of tau in genome and chromosome stability that can be ascribed to its function as a microtubule-associated protein as well as a protein protecting chromatin integrity through interaction with DNA.

  3. Genetic variation of maturity groups and four E genes in the Chinese soybean mini core collection

    Science.gov (United States)

    Huang, Xinyang; Zhou, Jing; Zeng, Haiyan; Sun, Shi; Jia, Hongchang; Li, Wenbin; Zhou, Xinan; Li, Suzhen; Chen, Pengyin; Wu, Cunxiang; Guo, Yong; Han, Tianfu; Qiu, Lijuan

    2017-01-01

    The mini core collection (MCC) has been established by streamlining core collection (CC) chosen from China National Genebank including 23,587 soybean (Glycine max) accessions by morphological traits and simple sequence repeat (SSR) markers. Few studies have been focused on the maturity that has been considered as one of the most critical traits for the determination of the adaptation-growing region of the soybean. In the current study, two hundred and ninty-nine accessions of MCC planted for two years at four locations namely in Heihe, Harbin, Jining and Wuhan cities in China were used to assess the variation of maturity in MCC and identify the integrated effect of 4 E loci on flowering and maturity time in soybean. Forty-two North American varieties served as references of maturity groups (MG). Each accession in MCC was classified by comparing with the MG references in the days from VE (emergence) and physiological maturity (R7). The results showed that MCC covered a large range of MGs from MG000 to MGIX/X. Original locations and sowing types were revealed as the major affecting factors for maturity groups of the MCC accessions. The ratio of the reproductive period to the vegetative period (R/V) varied among MCC accessions. Genotyping of 4 maturity genes (i.e. E1, E2, E3 and E4) in 228 accessions indicated that recessive alleles e1, e2, e3 and e4 promoted earlier flowering and shortened the maturity time with different effects, while the dominate alleles were always detected in accessions with longer maturity. The allelic combinations determined the diversification of soybean maturity groups and adaptation to different regions. Our results indicated that the maturity of Chinese soybean MCC showed genetic diversities in phenotype and genotype, which provided information for further MG classification, geographic adaptation analysis of Chinese soybean cultivars, as well as developing new soybean varieties with adaptation to specific regions. PMID:28207889

  4. Differential stress responses among newly received calves: variations in reductant capacity and Hsp gene expression.

    Science.gov (United States)

    Eitam, Harel; Vaya, Jacob; Brosh, Arieh; Orlov, Ala; Khatib, Soliman; Izhaki, Ido; Shabtay, Ariel

    2010-11-01

    Bovine respiratory disease complex (BRD), a major economic concern to the beef cattle industry all over the world, is triggered by physical, biological and psychological stresses. It is becoming noticeable that the key to reducing BRD appears to be centered at reducing the response to stress. The aims of the present study were to detect individual variations in the stress response of newly received young calves through their leukocyte heat shock protein (Hsp) response, selected neutrophil-related gene expression and oxidative stress, and relate them to pulmonary adhesions at slaughter, an indicative sign of clinical and subclinical episodes of BRD at an early age. Differential expression patterns of Hsp60 and Hsp70A1A were revealed in newly received calves 1 h, 5 h and 1 day after arrival, distinguishing between stress-responsive and non-stress-responsive individuals. Plasma cortisol was also indicative of stress-responsive and non-stress-responsive individuals, 1 h and 5 h after arrival. At the longer term, β-glycan levels were highest 7 days after arrival and significantly correlated with an adhesion-free phenotype at slaughter. Oxidative stress responses, measured through the oxidation products of the exogenous linoleoyl tyrosine (LT) marker, revealed that hydroperoxidation and epoxidation of membranes may readily occur. Based on the LT oxidation products and levels of β-glycan, we present a discriminant analysis model, according to which vulnerable individuals may be predicted at near 100% probability 7 days after arrival. Since clinical signs of BRD may often go undetected in feedlot calves, such a model, after its examination in large-scale experiments, may be a reliable tool for an early prediction of subclinical signs of BRD.

  5. Transcription factor ATF-3 regulates allele variation phenotypes of the human SLC11A1 gene.

    Science.gov (United States)

    Taka, Styliani; Gazouli, Maria; Politis, Panagotis K; Pappa, Kalliopi I; Anagnou, Nicholas P

    2013-03-01

    Genetic polymorphisms in the human solute carrier family 11 member 1 (SLC11A1) gene predispose to susceptibility to infectious/inflammatory diseases and cancer. Human susceptibility to these diseases exhibits allelic association with a polymorphic regulatory Z-DNA-forming microsatellite of a (GT/AC)n repeat. The carriage of different alleles may influence chromatin remodeling and accessibility by transcription factors. Of particular importance is the binding site for the Activating Protein 1 (AP-1) elements, (ATF-3 and c-Jun), adjacent to the 5' sequence of the Z-DNA-forming polymorphism. The aim of the study was to characterize the transcriptional mechanisms controlling different alleles of SLC11A1 expression by ATF-3 and c-Jun. Allele 2, [T(GT)5AC(GT)5AC(GT)10GGCAGA(G)6], and Allele 3, [T(GT)5AC(GT)5AC(GT)9GGCAGA(G)6], were subcloned into the PGL2Basic vector. Transient transfections of THP-1 cells with the constructs, in the presence or absence of pATF-3 were preformed. Luciferase expression was determined. To document the recruitment of ATF-3 and c-Jun, to the polymorphic promoter alleles in vivo, we performed ChIP assays with transient transfected THP-1 cells treated with or without lipopolyssacharides. Our data documented that ATF-3 suppresses the transcriptional activation of Allele-3, and this suppression is enhanced in the presence of lipopolyssacharides. Our findings suggest that ATF-3 and c-Jun may influence heritable variation in SLC11A1-dependent innate resistance to infection and inflammation both within and between populations.

  6. Detailed analysis of the effects of stencil spatial variations with arbitrary high-order finite-difference Maxwell solver

    CERN Document Server

    Vincenti, H

    2015-01-01

    Due to discretization effects and truncation to finite domains, many electromagnetic simulations present non-physical modifications of Maxwell's equations in space that may generate spurious signals affecting the overall accuracy of the result. Such modifications for instance occur when Perfectly Matched Layers (PMLs) are used at simulation domain boundaries to simulate open media. Another example is the use of arbitrary order Maxwell solver with domain decomposition technique that may under some condition involve stencil truncations at subdomain boundaries, resulting in small spurious errors that do eventually build up. In each case, a careful evaluation of the characteristics and magnitude of the errors resulting from these approximations, and their impact at any frequency and angle, requires detailed analytical and numerical studies. To this end, we present a general analytical approach that enables the evaluation of numerical discretization errors of fully three-dimensional arbitrary order finite-differen...

  7. Molecular variation and evolution of the tyrosine kinase domains of insulin receptor IRa and IRb genes in Cyprinidae.

    Science.gov (United States)

    Kong, XiangHui; Wang, XuZhen; He, ShunPing

    2011-07-01

    The insulin receptor (IR) gene plays an important role in regulating cell growth, differentiation and development. In the present study, DNA sequences of insulin receptor genes, IRa and IRb, were amplified and sequenced from 37 representative species of the Cyprinidae and from five outgroup species from non-cyprinid Cypriniformes. Based on coding sequences (CDS) of tyrosine kinase regions of IRa and IRb, molecular evolution and phylogenetic relationships were analyzed to better understand the characteristics of IR gene divergence in the family Cyprinidae. IRa and IRb were clustered into one lineage in the gene tree of the IR gene family, reconstructed using the unweighted pair group method with arithmetic mean (UPGMA). IRa and IRb have evolved into distinct genes after IR gene duplication in Cyprinidae. For each gene, molecular evolution analyses showed that there was no significant difference among different groups in the reconstructed maximum parsimony (MP) tree of Cyprinidae; IRa and IRb have been subjected to similar evolutionary pressure among different lineages. Although the amino acid sequences of IRa and IRb tyrosine kinase regions were highly conserved, our analyses showed that there were clear sequence variations between the tyrosine kinase regions of IRa and IRb proteins. This indicates that IRa and IRb proteins might play different roles in the insulin signaling pathway.

  8. Variational Multiscale Stabilization and p-adaptivity of High-Order Spectral Elements for the Convection-Diffusion Equation (Preprint)

    Science.gov (United States)

    2011-07-26

    Cottrell, and Bazilevs in [21], where NURBS were used as high-order basis functions, un- expected convergence to monotone results were obtained...methods by Canuto and coworkers in [17, 18, 19, 52], and later by Hughes and coworkers in [21] using non-uniform rational B-splines ( NURBS ). In this...Hughes, J. A. Cottrell, Y. Bazilevs, Isogeometric analysis: CAD, finite elements, NURBS , exact geometry and mesh refinement, Comput. Methods Appl

  9. Mos1-mediated transgenesis to probe consequences of single gene mutations in variation-rich isolates of Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Maja Tarailo-Graovac

    Full Text Available Caenorhabditis elegans, especially the N2 isolate, is an invaluable biological model system. Numerous additional natural C. elegans isolates have been shown to have unexpected genotypic and phenotypic variations which has encouraged researchers to use next generation sequencing methodology to develop a more complete picture of genotypic variations among the isolates. To understand the phenotypic effects of a genomic variation (GV on a single gene, in a variation-rich genetic background, one should analyze that particular GV in a well understood genetic background. In C. elegans, the analysis is usually done in N2, which requires extensive crossing to bring in the GV. This can be a very time consuming procedure thus it is important to establish a fast and efficient approach to test the effect of GVs from different isolates in N2. Here we use a Mos1-mediated single-copy insertion (MosSCI method for phenotypic assessments of GVs from the variation-rich Hawaiian strain CB4856 in N2. Specifically, we investigate effects of variations identified in the CB4856 strain on tac-1 which is an essential gene that is necessary for mitotic spindle elongation and pronuclear migration. We show the usefulness of the MosSCI method by using EU1004 tac-1(or402 as a control. or402 is a temperature sensitive lethal allele within a well-conserved TACC domain (transforming acidic coiled-coil that results in a leucine to phenylalanine change at amino acid 229. CB4856 contains a variation that affects the second exon of tac-1 causing a cysteine to tryptophan change at amino acid 94 also within the TACC domain. Using the MosSCI method, we analyze tac-1 from CB4856 in the N2 background and demonstrate that the C94W change, albeit significant, does not cause any obvious decrease in viability. This MosSCI method has proven to be a rapid and efficient way to analyze GVs.

  10. An ordered EST catalogue and gene expression profiles of cassava (Manihot esculenta) at key growth stages.

    Science.gov (United States)

    Li, You-Zhi; Pan, Ying-Hua; Sun, Chang-Bin; Dong, Hai-Tao; Luo, Xing-Lu; Wang, Zhi-Qiang; Tang, Ji-Liang; Chen, Baoshan

    2010-12-01

    A cDNA library was constructed from the root tissues of cassava variety Huanan 124 at the root bulking stage. A total of 9,600 cDNA clones from the library were sequenced with single-pass from the 5'-terminus to establish a catalogue of expressed sequence tags (ESTs). Assembly of the resulting EST sequences resulted in 2,878 putative unigenes. Blastn analysis showed that 62.6% of the unigenes matched with known cassava ESTs and the rest had no 'hits' against the cassava database in the integrative PlantGDB database. Blastx analysis showed that 1,715 (59.59%) of the unigenes matched with one or more GenBank protein entries and 1,163 (40.41%) had no 'hits'. A cDNA microarray with 2,878 unigenes was developed and used to analyze gene expression profiling of Huanan 124 at key growth stages including seedling, formation of root system, root bulking, and starch maturity. Array data analysis revealed that (1) the higher ratio of up-regulated ribosome-related genes was accompanied by a high ratio of up-regulated ubiquitin, proteasome-related and protease genes in cassava roots; (2) starch formation and degradation simultaneously occur at the early stages of root development but starch degradation is declined partially due to decrease in UDP-glucose dehydrogenase activity with root maturity; (3) starch may also be synthesized in situ in roots; (4) starch synthesis, translocation, and accumulation are also associated probably with signaling pathways that parallel Wnt, LAM, TCS and ErbB signaling pathways in animals; (5) constitutive expression of stress-responsive genes may be due to the adaptation of cassava to harsh environments during long-term evolution.

  11. Salt stress induced variation in DNA methylation pattern and its influence on gene expression in contrasting rice genotypes.

    Directory of Open Access Journals (Sweden)

    Ratna Karan

    Full Text Available BACKGROUND: Salinity is a major environmental factor limiting productivity of crop plants including rice in which wide range of natural variability exists. Although recent evidences implicate epigenetic mechanisms for modulating the gene expression in plants under environmental stresses, epigenetic changes and their functional consequences under salinity stress in rice are underexplored. DNA methylation is one of the epigenetic mechanisms regulating gene expression in plant's responses to environmental stresses. Better understanding of epigenetic regulation of plant growth and response to environmental stresses may create novel heritable variation for crop improvement. METHODOLOGY/PRINCIPAL FINDINGS: Methylation sensitive amplification polymorphism (MSAP technique was used to assess the effect of salt stress on extent and patterns of DNA methylation in four genotypes of rice differing in the degree of salinity tolerance. Overall, the amount of DNA methylation was more in shoot compared to root and the contribution of fully methylated loci was always more than hemi-methylated loci. Sequencing of ten randomly selected MSAP fragments indicated gene-body specific DNA methylation of retrotransposons, stress responsive genes, and chromatin modification genes, distributed on different rice chromosomes. Bisulphite sequencing and quantitative RT-PCR analysis of selected MSAP loci showed that cytosine methylation changes under salinity as well as gene expression varied with genotypes and tissue types irrespective of the level of salinity tolerance of rice genotypes. CONCLUSIONS/SIGNIFICANCE: The gene body methylation may have an important role in regulating gene expression in organ and genotype specific manner under salinity stress. Association between salt tolerance and methylation changes observed in some cases suggested that many methylation changes are not "directed". The natural genetic variation for salt tolerance observed in rice germplasm may be

  12. Preliminary Application of Precision Genomic Medicine Detecting Gene Variation in Patients with Multifocal Osteosarcoma.

    Science.gov (United States)

    Zhang, Hao-Qiang; Li, Ming-Hui; Gao, Peng; Lan, Ping-Heng; Fan, Bo; Xiao, Xin; Lu, Ya-Jie; Chen, Guo-Jing; Wang, Zhen

    2016-05-01

    The purpose of this study was to present our clinical experience of treating multifocal osteosarcoma (MFOS) in our center and gain more insight into the biology of this rare condition; in particular, to address with the help of precision genomic medicine the issue of whether the multiple osteosarcoma (OS) lesions in such patients are multi-centric or originate from one primary lesion and metastasize to other sites. Finally, we aimed to identify particular gene phenotypes and mutations that differentiate MFOS from OS with only one tumor. Clinical data of patients with MFOS treated at our center between June 2007 and October 2014 were collected and analyzed retrospectively. High throughput sequencing of the whole exome of normal tissue and multiple lesions had been performed on samples from two patients (HJF and JZ) diagnosed in 2014. To explore the particular gene phenotype and clinical significance of MFOS, these sequencing results were analyzed and compared with those from patients with osteosarcoma in a single site. Seven patients with MFOS (three male and four female; average age 19.71 ± 3.35 years were enrolled in this study. Two of these patients declined treatment and died after 4 and 6 months, respectively. The remaining patients received standard treatment comprising neoadjuvant chemotherapy, surgery and chemotherapy. The chemotherapy regimen was lobaplatin (45 mg/m(2) ), doxorubicin (60 mg/m(2) ) and ifosfamide (12 g/m(2) ). Patients were followed up every 3 months after completing treatment and evaluated by the Enneking and Response Evaluation Criteria in Solid Tumors scoring systems. Up to the last follow-up on 1 December 2015, three patients were still alive. The event-free survival ranged from 4 to 144 weeks (median, 50.14 weeks), the mean (±SD) being 55.45 ± 45.47 weeks. Overall survival ranged from 16 to 388 weeks (median, 89 weeks; mean ± SD, 118.7 ± 147.7 weeks). The rates of mutation of the targeted drug-related genes were 133.5% ± 3.0% in

  13. Vascular endothelial growth factor (VEGFA gene variation in polycystic ovary syndrome in a Tunisian women population

    Directory of Open Access Journals (Sweden)

    Assila Ben Salem

    2016-10-01

    Full Text Available Abstract Background Polycystic ovary syndrome (PCOS is characterized by the growth of a number of small cysts on the ovaries which leads to sex hormonal imbalance. Women who are affected by this syndrome suffer from irregular menstrual cycles, decline in their fertility, excessive hair growth, obesity, acne and most importantly cardiac function problems. The vascular endothelial growth factor (VEGF plays a pivotal role in tissue vascularization in general and in the pathogenesis of many diseases. The PCOS was found to be associated with high expression levels of VEGF. In women who undergo assisted reproductive procedures (ART, VEGF was found to be a key mediator of other factors to control ovary angiogenesis. Here, we set out to examine the association of VEGFA gene polymorphism with PCOS and its components in a population of Tunisia women to enhance our understanding of the genetic background leading angiogenesis and vascularization abnormalities in PCOS. Methods The association of VEGFA gene with PCOS and its components was examined in a cohort of 268 women from Tunisia involving 118 PCOS patients and 150 controls. VEGFA gene variations were assessed through the analysis of the following SNPs rs699947 (A/C, rs833061 (C/T, rs1570360 (G/A, rs833068 (G/A, rs3025020 (C/T, and rs3025039 (C/T. The linkage disequilibrium between SNPs was assessed using HAPLOVIEW software while combination of SNPs into haplotypes in the population and the reconstruction of the cladogram were carried-out by PHASE and ARLEQUIN programs, respectively. Genetic association and genotype-phenotype correlations were calculated by logistic regression and non-parametric tests (Kruskall-Wallis and Mann–Whitney tests, respectively, using StatView program. Results We observed 10 haplotypes in our studied cohort whereH1 (ACGG, H2 (ACAG, H7 (CTGG and H8 (CTGA were the most frequent. We observed the association of the genotype CT of the SNP rs30225039 with PCOS phenotype (P = 0

  14. An Improved LCL Filter Design in Order to Ensure Stability without Damping and Despite Large Grid Impedance Variations

    Directory of Open Access Journals (Sweden)

    Marwa Ben Said-Romdhane

    2017-03-01

    Full Text Available With the smart grid revolution, there is a growing interest in the use of power converters associated to LCL filters to interface between the main utility grid and loads or renewable energy sources. LCL filters are commonly used mainly due to their low cost and high filtering performances. To achieve these performances, it is necessary to meticulously pick out the LCL filter parameters, taking into account grid code requirements and grid configuration and/or conditions. Several methodologies for LCL filter design have been presented and discussed in the literature. The main goal of this paper is to propose a simple, robust and systematic design methodology for LCL filter parameter tuning. The considered design methodology is aimed to overcome the shortcomings of classical design methodologies, namely, stable operation under different grid configurations and conditions. Compared to previous works, the proposed design methodology allows the achievement of robust LCL filter design with regard to large grid impedance variations without the use of any damping method. Also, it takes into account accuracy of capacitor standard values and proposes a simple design method for the converter side inductor that avoids saturation problems. An example of LCL filter design is presented and discussed. The obtained filter parameters were firstly tested using a Matlab-Simulink software tool. After that, they were tested through the development of an experimental set-up. The obtained simulation and experimental results show the reliability and efficiency of the proposed design methodology.

  15. Variations in gene organization and DNA uptake signal sequence in the folP region between commensal and pathogenic Neisseria species

    Directory of Open Access Journals (Sweden)

    Qvarnstrom Yvonne

    2006-02-01

    Full Text Available Abstract Background Horizontal gene transfer is an important source of genetic variation among Neisseria species and has contributed to the spread of resistance to penicillin and sulfonamide drugs in the pathogen Neisseria meningitidis. Sulfonamide resistance in Neisseria meningitidis is mediated by altered chromosomal folP genes. At least some folP alleles conferring resistance have been horizontally acquired from other species, presumably from commensal Neisseriae. In this work, the DNA sequence surrounding folP in commensal Neisseria species was determined and compared to corresponding regions in pathogenic Neisseriae, in order to elucidate the potential for inter-species DNA transfer within this region. Results The upstream region of folP displayed differences in gene order between species, including an insertion of a complete Correia element in Neisseria lactamica and an inversion of a larger genomic segment in Neisseria sicca, Neisseria subflava and Neisseria mucosa. The latter species also had DNA uptake signal sequences (DUS in this region that were one base different from the DUS in pathogenic Neisseriae. Another interesting finding was evidence of a horizontal transfer event from Neisseria lactamica or Neisseria cinerea that introduced a novel folP allele to the meningococcal population. Conclusion Genetic recombination events immediately upstream of folP and horizontal transfer have resulted in sequence differences in the folP region between the Neisseria species. This variability could be a consequence of the selective pressure on this region exerted by the use of sulfonamide drugs.

  16. Natural variation in the Pto disease resistance gene within species of wild tomato (Lycopersicon). II. Population genetics of Pto.

    Science.gov (United States)

    Rose, Laura E; Michelmore, Richard W; Langley, Charles H

    2007-03-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the host species Lycopersicon esculentum, the cultivated tomato, and the closely related L. pimpinellifolium is triggered by the physical interaction between the protein products of the host resistance (R) gene Pto and the pathogen avirulence genes AvrPto and AvrPtoB. Sequence variation at the Pto locus was surveyed in natural populations of seven species of Lycopersicon to test hypotheses of host-parasite coevolution and functional adaptation of the Pto gene. Pto shows significantly higher nonsynonymous polymorphism than 14 other non-R-gene loci in the same samples of Lycopersicon species, while showing no difference in synonymous polymorphism, suggesting that the maintenance of amino acid polymorphism at this locus is mediated by pathogen selection. Also, a larger proportion of ancestral variation is maintained at Pto as compared to these non-R-gene loci. The frequency spectrum of amino acid polymorphisms known to negatively affect Pto function is skewed toward low frequency compared to amino acid polymorphisms that do not affect function or silent polymorphisms. Therefore, the evolution of Pto appears to be influenced by a mixture of both purifying and balancing selection.

  17. Tissue-restricted expression of Nrf2 and its target genes in zebrafish with gene-specific variations in the induction profiles.

    Directory of Open Access Journals (Sweden)

    Hitomi Nakajima

    Full Text Available The Keap1-Nrf2 system serves as a defense mechanism against oxidative stress and electrophilic toxicants by inducing more than one hundred cytoprotective proteins, including antioxidants and phase 2 detoxifying enzymes. Since induction profiles of Nrf2 target genes have been studied exclusively in cultured cells, and not in animal models, their tissue-specificity has not been well characterized. In this paper, we examined and compared the tissue-specific expression of several Nrf2 target genes in zebrafish larvae by whole-mount in situ hybridization (WISH. Seven zebrafish genes (gstp1, mgst3b, prdx1, frrs1c, fthl, gclc and hmox1a suitable for WISH analysis were selected from candidates for Nrf2 targets identified by microarray analysis. Tissue-restricted induction was observed in the nose, gill, and/or liver for all seven genes in response to Nrf2-activating compounds, diethylmaleate (DEM and sulforaphane. The Nrf2 gene itself was dominantly expressed in these three tissues, implying that tissue-restricted induction of Nrf2 target genes is defined by tissue-specific expression of Nrf2. Interestingly, the induction of frrs1c and gclc in liver and nose, respectively, was quite low and that of hmox1a was restricted in the liver. These results indicate the existence of gene-specific variations in the tissue specificity, which can be controlled by factors other than Nrf2.

  18. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  19. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    DEFF Research Database (Denmark)

    Kaas, Rolf Sommer; Rundsten, Carsten Friis; Ussery, David

    2012-01-01

    more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness...

  20. Leveraging long sequencing reads to investigate R-gene clustering and variation in sugar beet

    Science.gov (United States)

    Host-pathogen interactions are of prime importance to modern agriculture. Plants utilize various types of resistance genes to mitigate pathogen damage. Identification of the specific gene responsible for a specific resistance can be difficult due to duplication and clustering within R-gene families....

  1. Variations in the β-Globin genes of Sickle Cell Anaemia Patients in ...

    African Journals Online (AJOL)

    ... this article online. Quick Response Code: ... Genbank Reference β-globin gene (NC_000011.9) using Basic Local Alignment. Search Tool ... of Chromosome 11 constituting 1.6kb of the β-globin ... natural selection, population genetics, gene expression, ... The molecular structure of the beta globin gene has a bearing on ...

  2. Natural variation of rice blast resistant gene Pi-ta in Oryza species

    Science.gov (United States)

    The Pi-ta gene in rice is a putative NBS type cytoplasmic receptor conferring resistance to races of Magnaporthe oryzae in a gene-for-gene manner. A Functional Nucleotide Polymorphism (FNP) change resulting in an amino acid substitution of Alanine to Serine at position 918 (nucleotide G to T at posi...

  3. Association between variations in the fat mass and obesity-associated gene and pancreatic cancer risk: a case–control study in Japan

    OpenAIRE

    Lin, Yingsong; Ueda, Junko; Yagyu, Kiyoko; Ishii, Hiroshi; Ueno, Makoto; Egawa, Naoto; Nakao, Haruhisa; MORI, MITSURU; Matsuo, Keitaro; Kikuchi, Shogo

    2013-01-01

    Background It is clear that genetic variations in the fat mass and obesity-associated (FTO) gene affect body mass index and the risk of obesity. Given the mounting evidence showing a positive association between obesity and pancreatic cancer, this study aimed to investigate the relation between variants in the FTO gene, obesity and pancreatic cancer risk. Methods We conducted a hospital-based case–control study in Japan to investigate whether genetic variations in the FTO gene were associated...

  4. DNA sequence and haplotype variation in two candidate genes for dilated cardiomyopathy in the turkey Meleagris gallopavo.

    Science.gov (United States)

    Lin, Kuan-chin; Xu, Jun; Kamara, Davida; Geng, Tuoyu; Gyenai, Kwaku; Reed, Kent M; Smith, Edward J

    2007-05-01

    Determining variation in genes is fundamental to understanding their function in the disease state. Cardiac troponin T (cTnT) and phospholamban (PLN) genes have been implicated in dilated cardiomyopathy (DCM) in human and model species. To investigate the role of these 2 candidate genes in DCM in the turkey Meleagris gallopavo, understanding sequence variants and map position distribution is necessary. To this end, a total of 1854 and 1771 bp of cTnT and PLN gene sequences, respectively, were scanned for single nucleotide polymorphisms (SNPs) in a randomly bred population. A total of 15 SNPs was identified in the cTnT and PLN genomic sequences. Nine haplotypes, 5 in cTnT and 4 in PLN, were identified. Observed heterozygosities (0.02-0.39) in the turkey population were low for both genes. Within each gene, 1 SNP corresponding to a restriction enzyme site was identified and used to develop a PCR-restriction fragment length polymorphism (RFLP) genotyping assay. The PLN gene was genetically mapped to turkey chromosome 2, equivalent to Gallus gallus chromosome 3, and cTnT mapped to a turkey microchromosome. Although limited because of the relatively small sample size of 55 birds, the data from this SNP analysis of PLN and cTnT provide a foundation from which to evaluate the function of cTnT and PLN in the turkey. Information about the distribution of the SNPs and haplotypes will facilitate future association and linkage studies.

  5. Y-linked variation for autosomal immune gene regulation has the potential to shape sexually dimorphic immunity.

    Science.gov (United States)

    Kutch, Ian C; Fedorka, Kenneth M

    2015-12-01

    Sexually dimorphic phenotypes arise from the differential expression of male and female shared genes throughout the genome. Unfortunately, the underlying molecular mechanisms by which dimorphic regulation manifests and evolves are unclear. Recent work suggests that Y-chromosomes may play an important role, given that Drosophila melanogaster Ys were shown to influence the regulation of hundreds of X and autosomal genes. For Y-linked regulatory variation (YRV) to facilitate sexually dimorphic evolution, however, it must exist within populations (where selection operates) and influence male fitness. These criteria have seldom been investigated, leaving the potential for dimorphic evolution via YRV unclear. Interestingly, male and female D. melanogaster differ in immune gene regulation. Furthermore, immune gene regulation appears to be influenced by the Y-chromosome, suggesting it may contribute to dimorphic immune evolution. We address this possibility by introgressing Y-chromosomes from a single wild population into an isogenic background (to create Y-lines) and assessing immune gene regulation and bacterial defence. We found that Y-line males differed in their immune gene regulation and their ability to defend against Serratia marcescens. Moreover, gene expression and bacterial defence were positively genetically correlated. These data indicate that the Y-chromosome has the potential to shape the evolution of sexually dimorphic immunity in this system.

  6. Genetic Variation and Divergence of Genes Involved in Leaf Adaxial-abaxial Polarity Establishment in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Jianli eLiang

    2016-02-01

    Full Text Available Alterations in leaf adaxial–abaxial (ad-ab polarity are one of the main factors that are responsible for leaf curvature. In Chinese cabbage, to form a leafy head, leaf incurvature is an essential prerequisite. Identifying ad-ab patterning genes and investigating its genetic variations will facilitate in elucidating the mechanism underlying leaf incurvature during head formation. In the present study we conducted comparative genomic analysis of the identification of 45 leaf ad-ab patterning genes in Brassica rapa based on 26 homologs in Arabidopsis thaliana, indicating that these genes underwent expansion and were retained after whole genome triplication (WGT. We also assessed the nucleotide diversity and selection footprints of these 45 genes in a collection of 94 Brassica rapa accessions that were composed of heading and non-heading morphotypes. Six of the 45 genes showed significant negative Tajima’s D indices and nucleotide diversity reduction in heading accessions compared to that in non-heading accessions, indicating that these underwent purifying selection. Further testing of the BrARF3.1 gene, which was one of the selection signals from a larger collection, confirmed that purifying selection did occur. Our results provide genetic evidence that ad-ab patterning genes are involved in leaf incurvature that is associated in the formation of a leafy head, as well as promote an understanding of the genetic mechanism underlying leafy head formation in Chinese cabbage.

  7. Robust assignment of cancer subtypes from expression data using a uni-variate gene expression average as classifier

    Directory of Open Access Journals (Sweden)

    Ryden Tobias

    2010-10-01

    Full Text Available Abstract Background Genome wide gene expression data is a rich source for the identification of gene signatures suitable for clinical purposes and a number of statistical algorithms have been described for both identification and evaluation of such signatures. Some employed algorithms are fairly complex and hence sensitive to over-fitting whereas others are more simple and straight forward. Here we present a new type of simple algorithm based on ROC analysis and the use of metagenes that we believe will be a good complement to existing algorithms. Results The basis for the proposed approach is the use of metagenes, instead of collections of individual genes, and a feature selection using AUC values obtained by ROC analysis. Each gene in a data set is assigned an AUC value relative to the tumor class under investigation and the genes are ranked according to these values. Metagenes are then formed by calculating the mean expression level for an increasing number of ranked genes, and the metagene expression value that optimally discriminates tumor classes in the training set is used for classification of new samples. The performance of the metagene is then evaluated using LOOCV and balanced accuracies. Conclusions We show that the simple uni-variate gene expression average algorithm performs as well as several alternative algorithms such as discriminant analysis and the more complex approaches such as SVM and neural networks. The R package rocc is freely available at http://cran.r-project.org/web/packages/rocc/index.html.

  8. Oxytocin and vasopressin receptor gene variation as a proximate base for inter- and intraspecific behavioral differences in bonobos and chimpanzees.

    Directory of Open Access Journals (Sweden)

    Nicky Staes

    Full Text Available Recent literature has revealed the importance of variation in neuropeptide receptor gene sequences in the regulation of behavioral phenotypic variation. Here we focus on polymorphisms in the oxytocin receptor gene (OXTR and vasopressin receptor gene 1a (Avpr1a in chimpanzees and bonobos. In humans, a single nucleotide polymorphism (SNP in the third intron of OXTR (rs53576 SNP (A/G is linked with social behavior, with the risk allele (A carriers showing reduced levels of empathy and prosociality. Bonobos and chimpanzees differ in these same traits, therefore we hypothesized that these differences might be reflected in variation at the rs53576 position. We sequenced a 320 bp region surrounding rs53576 but found no indications of this SNP in the genus Pan. However, we identified previously unreported SNP variation in the chimpanzee OXTR sequence that differs from both humans and bonobos. Humans and bonobos have previously been shown to have a more similar 5' promoter region of Avpr1a when compared to chimpanzees, who are polymorphic for the deletion of ∼ 360 bp in this region (+/- DupB which includes a microsatellite (RS3. RS3 has been linked with variation in levels of social bonding, potentially explaining part of the interspecies behavioral differences found in bonobos, chimpanzees and humans. To date, results for bonobos have been based on small sample sizes. Our results confirmed that there is no DupB deletion in bonobos with a sample size comprising approximately 90% of the captive founder population, whereas in chimpanzees the deletion of DupB had the highest frequency. Because of the higher frequency of DupB alleles in our bonobo population, we suggest that the presence of this microsatellite may partly reflect documented differences in levels of sociability found in bonobos and chimpanzees.

  9. Genome-wide association implicates numerous genes and pleiotropy underlying ecological trait variation in natural populations of Populus trichocarpa

    Energy Technology Data Exchange (ETDEWEB)

    McKown, Athena [University of British Columbia, Vancouver; Klapste, Jaroslav [University of British Columbia, Vancouver; Guy, Robert [University of British Columbia, Vancouver; Geraldes, Armando [University of British Columbia, Vancouver; Porth, Ilga [University of British Columbia, Vancouver; Hannemann, Jan [University of Victoria, Canada; Friedmann, Michael [University of British Columbia, Vancouver; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; Ehlting, Juergen [University of Victoria, Canada; Cronk, Quentin [University of British Columbia, Vancouver; El-Kassaby, Yousry [University of British Columbia, Vancouver; Mansfield, Shawn [University of British Columbia, Vancouver; Douglas, Carl [University of British Columbia, Vancouver

    2014-01-01

    To uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa Torr. & Gray) from natural populations throughout western North America. Extensive information from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34K Populus SNP array) of all accessions were used for gene discovery in a genome-wide association study (GWAS).

  10. Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

    Directory of Open Access Journals (Sweden)

    David Jean-Philippe

    2009-11-01

    Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

  11. Copy number variation analysis implicates the cell polarity gene glypican 5 as a human spina bifida candidate gene

    Science.gov (United States)

    Bassuk, Alexander G.; Muthuswamy, Lakshmi B.; Boland, Riley; Smith, Tiffany L.; Hulstrand, Alissa M.; Northrup, Hope; Hakeman, Matthew; Dierdorff, Jason M.; Yung, Christina K.; Long, Abby; Brouillette, Rachel B.; Au, Kit Sing; Gurnett, Christina; Houston, Douglas W.; Cornell, Robert A.; Manak, J. Robert

    2013-01-01

    Neural tube defects (NTDs) are common birth defects of complex etiology. Family and population-based studies have confirmed a genetic component to NTDs. However, despite more than three decades of research, the genes involved in human NTDs remain largely unknown. We tested the hypothesis that rare copy number variants (CNVs), especially de novo germline CNVs, are a significant risk factor for NTDs. We used array-based comparative genomic hybridization (aCGH) to identify rare CNVs in 128 Caucasian and 61 Hispanic patients with non-syndromic lumbar-sacral myelomeningocele. We also performed aCGH analysis on the parents of affected individuals with rare CNVs where parental DNA was available (42 sets). Among the eight de novo CNVs that we identified, three generated copy number changes of entire genes. One large heterozygous deletion removed 27 genes, including PAX3, a known spina bifida-associated gene. A second CNV altered genes (PGPD8, ZC3H6) for which little is known regarding function or expression. A third heterozygous deletion removed GPC5 and part of GPC6, genes encoding glypicans. Glypicans are proteoglycans that modulate the activity of morphogens such as Sonic Hedgehog (SHH) and bone morphogenetic proteins (BMPs), both of which have been implicated in NTDs. Additionally, glypicans function in the planar cell polarity (PCP) pathway, and several PCP genes have been associated with NTDs. Here, we show that GPC5 orthologs are expressed in the neural tube, and that inhibiting their expression in frog and fish embryos results in NTDs. These results implicate GPC5 as a gene required for normal neural tube development. PMID:23223018

  12. Gene expression variation resolves species and individual strains among coral-associated dinoflagellates within the genus Symbiodinium

    KAUST Repository

    Parkinson, John Everett

    2016-02-11

    Reef-building corals depend on symbiotic mutualisms with photosynthetic dinoflagellates in the genus Symbiodinium. This large microalgal group comprises many highly divergent lineages (“Clades A-I”) and hundreds of undescribed species. Given their ecological importance, efforts have turned to genomic approaches to characterize the functional ecology of Symbiodinium. To date, investigators have only compared gene expression between representatives from separate clades—the equivalent of contrasting genera or families in other dinoflagellate groups—making it impossible to distinguish between clade-level and species-level functional differences. Here, we examined the transcriptomes of four species within one Symbiodinium clade (Clade B) at ~20,000 orthologous genes, as well as multiple isoclonal cell lines within species (i.e. cultured strains). These species span two major adaptive radiations within Clade B, each encompassing both host-specialized and ecologically cryptic taxa. Species-specific expression differences were consistently enriched for photosynthesis-related genes, likely reflecting selection pressures driving niche diversification. Transcriptional variation among strains involved fatty acid metabolism and biosynthesis pathways. Such differences among individuals are potentially a major source of physiological variation, contributing to the functional diversity of coral holobionts composed of unique host-symbiont genotype pairings. Our findings expand the genomic resources available for this important symbiont group and emphasize the power of comparative transcriptomics as a method for studying speciation processes and inter-individual variation in non-model organisms.

  13. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    Science.gov (United States)

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  14. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  15. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Science.gov (United States)

    Knoll, Nadja; Jarick, Ivonne; Volckmar, Anna-Lena; Klingenspor, Martin; Illig, Thomas; Grallert, Harald; Gieger, Christian; Wichmann, Heinz-Erich; Peters, Annette; Hebebrand, Johannes; Scherag, André; Hinney, Anke

    2013-01-01

    There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1) 16 nuclear regulators of mitochondrial genes, (2) 91 genes for oxidative phosphorylation and (3) 966 nuclear-encoded mitochondrial genes). Gene set enrichment analysis (GSEA) showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS) data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents) and a population-based GWAS sample (KORA F4, n = 1,743). A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th) and 95(th) percentile of the set of all gene-wise corrected p-values) as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th) percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50) = 0.0103). This finding was not confirmed in the trios (p(GSEA,50) = 0.5991), but in KORA (p(GSEA,50) = 0.0398). The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50) = 0.1052, p(MAGENTA,75) = 0.0251). The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  16. Differentially expressed genes linked to natural variation in long-term memory formation in Cotesia parasitic wasps

    Directory of Open Access Journals (Sweden)

    Joke J. F. A. Van Vugt

    2015-09-01

    Full Text Available Even though learning and memory are universal traits in the Animal Kingdom, closely related species reveal substantial variation in learning rate and memory dynamics. To determine the genetic background of this natural variation, we studied two congeneric parasitic wasp species, Cotesia glomerata and C. rubecula, which lay their eggs in caterpillars of the large and small cabbage white butterfly. A successful egg laying event serves as an unconditioned stimulus in a classical conditioning paradigm, where plant odors become associated to the encounter of a suitable host caterpillar. Depending on the host species, the number of conditioning trials and the parasitic wasp species, three different types of transcription-dependent long-term memory (LTM and one type of transcription-independent, anesthesia-resistant memory (ARM can be distinguished. To identify transcripts underlying these differences in memory formation, we isolated mRNA from parasitic wasp heads at three different time points between induction and consolidation of each of the four memory types, and for each sample three biological replicates, where after strand-specific paired-end 100 bp deep sequencing. Transcriptomes were assembled de novo and differential expression was determined for each memory type and time point after conditioning, compared to unconditioned wasps. Most differentially expressed (DE genes and antisense transcripts were only DE in one of the LTM types. Among the DE genes that were DE in two or more LTM types, were many protein kinases and phosphatases, small GTPases, receptors and ion channels. Some genes were DE in opposing directions between any of the LTM memory types and ARM, suggesting that ARM in Cotesia requires the transcription of genes inhibiting LTM or vice versa. We discuss our findings in the context of neuronal functioning, including RNA splicing and transport, epigenetic regulation, neurotransmitter/peptide synthesis and antisense transcription. In

  17. Adaptive evolution of interleukin-3 (IL3), a gene associated with brain volume variation in general human populations.

    Science.gov (United States)

    Li, Ming; Huang, Liang; Li, Kaiqin; Huo, Yongxia; Chen, Chunhui; Wang, Jinkai; Liu, Jiewei; Luo, Zhenwu; Chen, Chuansheng; Dong, Qi; Yao, Yong-gang; Su, Bing; Luo, Xiong-jian

    2016-04-01

    Greatly expanded brain volume is one of the most characteristic traits that distinguish humans from other primates. Recent studies have revealed genes responsible for the dramatically enlarged human brain size (i.e., the microcephaly genes), and it has been well documented that many microcephaly genes have undergone accelerated evolution along the human lineage. In addition to being far larger than other primates, human brain volume is also highly variable in general populations. However, the genetic basis underlying human brain volume variation remains elusive and it is not known whether genes regulating human brain volume variation also have experienced positive selection. We have previously shown that genetic variants (near the IL3 gene) on 5q33 were significantly associated with brain volume in Chinese population. Here, we provide further evidence that support the significant association of genetic variants on 5q33 with brain volume. Bioinformatic analyses suggested that rs31480 is likely to be the causal variant among the studied SNPs. Molecular evolutionary analyses suggested that IL3 might have undergone positive selection in primates and humans. Neutrality tests further revealed signatures of positive selection of IL3 in Han Chinese and Europeans. Finally, extended haplotype homozygosity (EHH) and relative EHH analyses showed that the C allele of SNP rs31480 might have experienced recent positive selection in Han Chinese. Our results suggest that IL3 is an important genetic regulator for human brain volume variation and implied that IL3 might have experienced weak or modest positive selection in the evolutionary history of humans, which may be due to its contribution to human brain volume.

  18. SDF1 gene variation is associated with circulating SDF1alpha level and endothelial progenitor cell number: the Bruneck Study.

    Directory of Open Access Journals (Sweden)

    Qingzhong Xiao

    Full Text Available BACKGROUND: Stromal cell-derived factor-1 (SDF1 and its receptor CXC chemokine receptor 4 (CXCR4 play a critical role in progenitor cell homing, mobilization and differentiation. It would be interesting to assess the predictive value of SDF-1alpha level for EPC number, and to ascertain whether there is a relationship between SDF1 gene variation, plasma SDF-1alpha level, and the number and function of circulating EPCs. We also tested whether EPC number and function was related to CXCR4 gene variation. METHODOLOGY AND PRINCIPAL FINDINGS: We genotyped a cohort of individuals who participated in the Bruneck Study for single nucleotide polymorphisms (SNPs in the SDF1 and CXCR4 genes, and measured blood SDF1alpha level as well as EPC number and function. SDF1alpha levels were correlated with age, gender, alcohol consumption, circulating reticulocyte numbers, and concentrations of matrix metalloproteinase-9, C-reactive protein, cystatin C, fibrinogen and homocytein. In blood samples taken in 2005, EPC number was inversely associated with SDF1alpha level (p<0.001. EPC number in 2005 was also inversely associated with SDF1alpha level in 2000 (p = 0.009, suggesting a predictive value of plasma SDF1alpha level for EPC number. There was an association between the SDF1 gene rs2297630 SNP A/A genotype, increased SDF1alpha level (p = 0.002 and lower EPC number (p = 0.006. CONCLUSIONS: Our data indicate that a SDF1 gene variation (rs2297630 has an influence on SDF1alpha level and circulating EPC number, and that plasma SDF1alpha level is a predictor of EPC number.

  19. Social context-induced song variation affects female behavior and gene expression.

    Directory of Open Access Journals (Sweden)

    Sarah C Woolley

    2008-03-01

    Full Text Available Social cues modulate the performance of communicative behaviors in a range of species, including humans, and such changes can make the communication signal more salient. In songbirds, males use song to attract females, and song organization can differ depending on the audience to which a male sings. For example, male zebra finches (Taeniopygia guttata change their songs in subtle ways when singing to a female (directed song compared with when they sing in isolation (undirected song, and some of these changes depend on altered neural activity from a specialized forebrain-basal ganglia circuit, the anterior forebrain pathway (AFP. In particular, variable activity in the AFP during undirected song is thought to actively enable syllable variability, whereas the lower and less-variable AFP firing during directed singing is associated with more stereotyped song. Consequently, directed song has been suggested to reflect a "performance" state, and undirected song a form of vocal motor "exploration." However, this hypothesis predicts that directed-undirected song differences, despite their subtlety, should matter to female zebra finches, which is a question that has not been investigated. We tested female preferences for this natural variation in song in a behavioral approach assay, and we found that both mated and socially naive females could discriminate between directed and undirected song-and strongly preferred directed song. These preferences, which appeared to reflect attention especially to aspects of song variability controlled by the AFP, were enhanced by experience, as they were strongest for mated females responding to their mate's directed songs. We then measured neural activity using expression of the immediate early gene product ZENK, and found that social context and song familiarity differentially modulated the number of ZENK-expressing cells in telencephalic auditory areas. Specifically, the number of ZENK-expressing cells in the

  20. No Association between Variation in Longevity Candidate Genes and Aging-related Phenotypes in Oldest-old Danes.

    Science.gov (United States)

    Soerensen, Mette; Nygaard, Marianne; Debrabant, Birgit; Mengel-From, Jonas; Dato, Serena; Thinggaard, Mikael; Christensen, Kaare; Christiansen, Lene

    2016-06-01

    In this study we explored the association between aging-related phenotypes previously reported to predict survival in old age and variation in 77 genes from the DNA repair pathway, 32 genes from the growth hormone 1/ insulin-like growth factor 1/insulin (GH/IGF-1/INS) signalling pathway and 16 additional genes repeatedly considered as candidates for human longevity: APOE, APOA4, APOC3, ACE, CETP, HFE, IL6, IL6R, MTHFR, TGFB1, SIRTs 1, 3, 6; and HSPAs 1A, 1L, 14. Altogether, 1,049 single nucleotide polymorphisms (SNPs) were genotyped in 1,088 oldest-old (age 92-93 years) Danes and analysed with phenotype data on physical functioning (hand grip strength), cognitive functioning (mini mental state examination and a cognitive composite score), activity of daily living and self-rated health. Five SNPs showed association to one of the phenotypes; however, none of these SNPs were associated with a change in the relevant phenotype over time (7 years of follow-up) and none of the SNPs could be confirmed in a replicatio