Sharon, Dror; Blackshaw, Seth; Cepko, Constance L.; Dryja, Thaddeus P.
2002-01-01
We used the serial analysis of gene expression (SAGE) technique to catalogue and measure the relative levels of expression of the genes expressed in the human peripheral retina, macula, and retinal pigment epithelium (RPE) from one or both of two humans, aged 88 and 44 years. The cone photoreceptor contribution to all transcription in the retina was found to be similar in the macula versus the retinal periphery, whereas the rod contribution was greater in the periphery versus the macula. Genes encoding structural proteins for axons were found to be expressed at higher levels in the macula versus the retinal periphery, probably reflecting the large proportion of ganglion cells in the central retina. In comparison with the younger eye, the peripheral retina of the older eye had a substantially higher proportion of mRNAs from genes encoding proteins involved in iron metabolism or protection against oxidative damage and a substantially lower proportion of mRNAs from genes encoding proteins involved in rod phototransduction. These differences may reflect the difference in age between the two donors or merely interindividual variation. The RPE library had numerous previously unencountered tags, suggesting that this cell type has a large, idiosyncratic repertoire of expressed genes. Comparison of these libraries with 100 reported nonocular SAGE libraries revealed 89 retina-specific or enriched genes expressed at substantial levels, of which 14 are known to cause a retinal disease and 53 are RPE-specific genes. We expect that these libraries will serve as a resource for understanding the relative expression levels of genes in the retina and the RPE and for identifying additional disease genes. PMID:11756676
Maclaren, R.E.; Groppe, M.; Barnard, A.R.; Cottriall, C.L.; Tolmachova, T.; Seymour, L.; Clark, K.; During, M.J.; Cremers, F.P.M.; Black, G.C.M.; Lotery, A.J.; Downes, S.M.; Webster, A.R.; Seabra, M.C.
2014-01-01
BACKGROUND: Choroideremia is an X-linked recessive disease that leads to blindness due to mutations in the CHM gene, which encodes the Rab escort protein 1 (REP1). We assessed the effects of retinal gene therapy with an adeno-associated viral (AAV) vector encoding REP1 (AAV.REP1) in patients with
Renal-Retinal Ciliopathy Gene Sdccag8 Regulates DNA Damage Response Signaling
DEFF Research Database (Denmark)
Airik, Rannar; Slaats, Gisela G; Guo, Zhi
2014-01-01
Nephronophthisis-related ciliopathies (NPHP-RCs) are developmental and degenerative kidney diseases that are frequently associated with extrarenal pathologies such as retinal degeneration, obesity, and intellectual disability. We recently identified mutations in a gene encoding the centrosomal...... protein SDCCAG8 as causing NPHP type 10 in humans. To study the role of Sdccag8 in disease pathogenesis, we generated a Sdccag8 gene-trap mouse line. Homozygous Sdccag8(gt/gt) mice lacked the wild-type Sdccag8 transcript and protein, and recapitulated the human phenotypes of NPHP and retinal degeneration....... These mice exhibited early onset retinal degeneration that was associated with rhodopsin mislocalization in the photoreceptors and reduced cone cell numbers, and led to progressive loss of vision. By contrast, renal histologic changes occurred later, and no global ciliary defects were observed in the kidneys...
Recent Advancements in Gene Therapy for Hereditary Retinal Dystrophies
Directory of Open Access Journals (Sweden)
Ayşe Öner
2017-12-01
Full Text Available Hereditary retinal dystrophies (HRDs are degenerative diseases of the retina which have marked clinical and genetic heterogeneity. Common presentations among these disorders include night or colour blindness, tunnel vision, and subsequent progression to complete blindness. The known causative disease genes have a variety of developmental and functional roles, with mutations in more than 120 genes shown to be responsible for the phenotypes. In addition, mutations within the same gene have been shown to cause different disease phenotypes, even amongst affected individuals within the same family, highlighting further levels of complexity. The known disease genes encode proteins involved in retinal cellular structures, phototransduction, the visual cycle, and photoreceptor structure or gene regulation. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been proposed as potentially efficacious therapies. Because of its favorable anatomical and immunological characteristics, the eye has been at the forefront of translational gene therapy. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Dozens of promising proofs of concept have been obtained in animal models of HRDs and some of them have been relayed to the clinic. The results from the first clinical trials for a congenital form of blindness have generated great interest and have demonstrated the safety and efficacy of intraocular administrations of viral vectors in humans. This review summarizes the clinical development of retinal gene therapy.
Appleyard, Greg D; Forsyth, George W; Kiehlbauch, Laura M; Sigfrid, Kristen N; Hanik, Heather L J; Quon, Anita; Loewen, Matthew E; Grahn, Bruce H
2006-05-01
To investigate the molecular basis of inherited retinal dysplasia in miniature Schnauzers. Retina and retinal pigment epithelial tissues were collected from canine subjects at the age of 3 weeks. Total RNA isolated from these tissues was reverse transcribed to make representative cDNA pools that were compared for differences in gene expression by using a subtractive hybridization technique referred to as representational difference analysis (RDA). Expression differences identified by RDA were confirmed and quantified by real-time reverse-transcription PCR. Mitochondrial morphology from leukocytes and skeletal muscle of normal and affected miniature Schnauzers was examined by transmission electron microscopy. RDA screening of retinal pigment epithelial cDNA identified differences in mRNA transcript coding for two mitochondrial (mt) proteins--cytochrome oxidase subunit 1 and NADH dehydrogenase subunit 6--in affected dogs. Contrary to expectations, these identified sequences did not contain mutations. Based on the implication of mt-DNA-encoded proteins by the RDA experiments we used real-time PCR to compare the relative amounts of mt-DNA template in white blood cells from normal and affected dogs. White blood cells of affected dogs contained less than 30% of the normal amount of two specific mtDNA sequences, compared with the content of the nuclear-encoded glyceraldehyde-3-phosphate dehydrogenase (GA-3-PDH) reference gene. Retina and RPE tissue from affected dogs had reduced mRNA transcript levels for the two mitochondrial genes detected in the RDA experiment. Transcript levels for another mtDNA-encoded gene as well as the nuclear-encoded mitochondrial Tfam transcription factor were reduced in these tissues in affected dogs. Mitochondria from affected dogs were reduced in number and size and were unusually electron dense. Reduced levels of nuclear and mitochondrial transcripts in the retina and RPE of miniature Schnauzers affected with retinal dysplasia suggest that
A cascade model of information processing and encoding for retinal prosthesis.
Pei, Zhi-Jun; Gao, Guan-Xin; Hao, Bo; Qiao, Qing-Li; Ai, Hui-Jian
2016-04-01
Retinal prosthesis offers a potential treatment for individuals suffering from photoreceptor degeneration diseases. Establishing biological retinal models and simulating how the biological retina convert incoming light signal into spike trains that can be properly decoded by the brain is a key issue. Some retinal models have been presented, ranking from structural models inspired by the layered architecture to functional models originated from a set of specific physiological phenomena. However, Most of these focus on stimulus image compression, edge detection and reconstruction, but do not generate spike trains corresponding to visual image. In this study, based on state-of-the-art retinal physiological mechanism, including effective visual information extraction, static nonlinear rectification of biological systems and neurons Poisson coding, a cascade model of the retina including the out plexiform layer for information processing and the inner plexiform layer for information encoding was brought forward, which integrates both anatomic connections and functional computations of retina. Using MATLAB software, spike trains corresponding to stimulus image were numerically computed by four steps: linear spatiotemporal filtering, static nonlinear rectification, radial sampling and then Poisson spike generation. The simulated results suggested that such a cascade model could recreate visual information processing and encoding functionalities of the retina, which is helpful in developing artificial retina for the retinally blind.
A novel NR2E3 gene mutation in autosomal recessive retinitis pigmentosa with cystic maculopathy
Mahajan, D.; Votruba, Marcela
2017-01-01
NR2E3 is a gene that encodes for photoreceptor cell specific nuclear receptor, which is involved in cone proliferation. The splice site mutation 119-2A>C in NR2E3 (15q23) has been previously reported to underlie recessive enhanced cone S sensitivity syndrome, clumped pigmentary retinal degeneration, Goldman-Favre syndrome and also autosomal dominant and autosomal recessive retinitis pigmentosa (RP). However, the mutation c 571 + 2 T > C in NR2E3 has not been previously reported with retinal d...
Tschernutter, M; Schlichtenbrede, F C; Howe, S; Balaggan, K S; Munro, P M; Bainbridge, J W B; Thrasher, A J; Smith, A J; Ali, R R
2005-04-01
The Royal College of Surgeons (RCS) rat is a well-characterized model of autosomal recessive retinitis pigmentosa (RP) due to a defect in the retinal pigment epithelium (RPE). It is homozygous for a null mutation in the gene encoding , a receptor tyrosine kinase found in RPE cells, that is required for phagocytosis of shed photoreceptor outer segments. The absence of Mertk results in accumulation of outer segment debris. This subsequently leads to progressive loss of photoreceptor cells. In order to evaluate the efficacy of lentiviral-mediated gene replacement therapy in the RCS rat, we produced recombinant VSV-G pseudotyped HIV-1-based lentiviruses containing a murine Mertk cDNA driven by a spleen focus forming virus (SFFV) promoter. The vector was subretinally injected into the right eye of 10-day-old RCS rats; the left eye was left untreated as an internal control. Here, we present a detailed assessment of the duration and extent of the morphological rescue and the resulting functional benefits. We examined animals at various time points over a period of 7 months by light and electron microscopy, and electroretinography. We observed correction of the phagocytic defect, slowing of photoreceptor cell loss and preservation of retinal function for up to 7 months. This study demonstrates the potential of gene therapy approaches for the treatment of retinal degenerations caused by defects specific to the RPE and supports the use of lentiviral vectors for the treatment of such disorders.
Myosin7a deficiency results in reduced retinal activity which is improved by gene therapy.
Directory of Open Access Journals (Sweden)
Pasqualina Colella
Full Text Available Mutations in MYO7A cause autosomal recessive Usher syndrome type IB (USH1B, one of the most frequent conditions that combine severe congenital hearing impairment and retinitis pigmentosa. A promising therapeutic strategy for retinitis pigmentosa is gene therapy, however its pre-clinical development is limited by the mild retinal phenotype of the shaker1 (sh1(-/- murine model of USH1B which lacks both retinal functional abnormalities and degeneration. Here we report a significant, early-onset delay of sh1(-/- photoreceptor ability to recover from light desensitization as well as a progressive reduction of both b-wave electroretinogram amplitude and light sensitivity, in the absence of significant loss of photoreceptors up to 12 months of age. We additionally show that subretinal delivery to the sh1(-/- retina of AAV vectors encoding the large MYO7A protein results in significant improvement of sh1(-/- photoreceptor and retinal pigment epithelium ultrastructural anomalies which is associated with improvement of recovery from light desensitization. These findings provide new tools to evaluate the efficacy of experimental therapies for USH1B. In addition, although AAV vectors expressing large genes might have limited clinical applications due to their genome heterogeneity, our data show that AAV-mediated MYO7A gene transfer to the sh1(-/- retina is effective.
Genomic analysis of mouse retinal development.
Directory of Open Access Journals (Sweden)
Seth Blackshaw
2004-09-01
Full Text Available The vertebrate retina is comprised of seven major cell types that are generated in overlapping but well-defined intervals. To identify genes that might regulate retinal development, gene expression in the developing retina was profiled at multiple time points using serial analysis of gene expression (SAGE. The expression patterns of 1,051 genes that showed developmentally dynamic expression by SAGE were investigated using in situ hybridization. A molecular atlas of gene expression in the developing and mature retina was thereby constructed, along with a taxonomic classification of developmental gene expression patterns. Genes were identified that label both temporal and spatial subsets of mitotic progenitor cells. For each developing and mature major retinal cell type, genes selectively expressed in that cell type were identified. The gene expression profiles of retinal Müller glia and mitotic progenitor cells were found to be highly similar, suggesting that Müller glia might serve to produce multiple retinal cell types under the right conditions. In addition, multiple transcripts that were evolutionarily conserved that did not appear to encode open reading frames of more than 100 amino acids in length ("noncoding RNAs" were found to be dynamically and specifically expressed in developing and mature retinal cell types. Finally, many photoreceptor-enriched genes that mapped to chromosomal intervals containing retinal disease genes were identified. These data serve as a starting point for functional investigations of the roles of these genes in retinal development and physiology.
Correction of the retinal dystrophy phenotype of the RCS rat by viral gene transfer of Mertk.
Vollrath, D; Feng, W; Duncan, J L; Yasumura, D; D'Cruz, P M; Chappelow, A; Matthes, M T; Kay, M A; LaVail, M M
2001-10-23
The Royal College of Surgeons (RCS) rat is a widely studied animal model of retinal degeneration in which the inability of the retinal pigment epithelium (RPE) to phagocytize shed photoreceptor outer segments leads to a progressive loss of rod and cone photoreceptors. We recently used positional cloning to demonstrate that the gene Mertk likely corresponds to the retinal dystrophy (rdy) locus of the RCS rat. In the present study, we sought to determine whether gene transfer of Mertk to a RCS rat retina would result in correction of the RPE phagocytosis defect and preservation of photoreceptors. We used subretinal injection of a recombinant replication-deficient adenovirus encoding rat Mertk to deliver the gene to the eyes of young RCS rats. Electrophysiological assessment of animals 30 days after injection revealed an increased sensitivity of treated eyes to low-intensity light. Histologic and ultrastructural assessment demonstrated substantial sparing of photoreceptors, preservation of outer segment structure, and correction of the RPE phagocytosis defect in areas surrounding the injection site. Our results provide definitive evidence that mutation of Mertk underlies the RCS retinal dystrophy phenotype, and that the phenotype can be corrected by treatment of juvenile animals. To our knowledge, this is the first demonstration of complementation of both a functional cellular defect (phagocytosis) and a photoreceptor degeneration by gene transfer to the RPE. These results, together with the recent discovery of MERTK mutations in individuals with retinitis pigmentosa, emphasize the importance of the RCS rat as a model for gene therapy of diseases that arise from RPE dysfunction.
Arrestin gene mutations in autosomal recessive retinitis pigmentosa.
Nakazawa, M; Wada, Y; Tamai, M
1998-04-01
To assess the clinical and molecular genetic studies of patients with autosomal recessive retinitis pigmentosa associated with a mutation in the arrestin gene. Results of molecular genetic screening and case reports with DNA analysis and clinical features. University medical center. One hundred twenty anamnestically unrelated patients with autosomal recessive retinitis pigmentosa. DNA analysis was performed by single strand conformation polymorphism followed by nucleotide sequencing to search for a mutation in exon 11 of the arrestin gene. Clinical features were characterized by visual acuity slitlamp biomicroscopy, fundus examinations, fluorescein angiography, kinetic visual field testing, and electroretinography. We identified 3 unrelated patients with retinitis pigmentosa associated with a homozygous 1-base-pair deletion mutation in codon 309 of the arrestin gene designated as 1147delA. All 3 patients showed pigmentary retinal degeneration in the midperipheral area with or without macular involvement. Patient 1 had a sibling with Oguchi disease associated with the same mutation. Patient 2 demonstrated pigmentary retinal degeneration associated with a golden-yellow reflex in the peripheral fundus. Patients 1 and 3 showed features of retinitis pigmentosa without the golden-yellow fundus reflex. Although the arrestin 1147delA has been known as a frequent cause of Oguchi disease, this mutation also may be related to the pathogenesis of autosomal recessive retinitis pigmentosa. This phenomenon may provide evidence of variable expressivity of the mutation in the arrestin gene.
Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.
Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C
2001-01-01
Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.
Retinitis pigmentosa: genes and disease mechanisms.
Ferrari, Stefano; Di Iorio, Enzo; Barbaro, Vanessa; Ponzin, Diego; Sorrentino, Francesco S; Parmeggiani, Francesco
2011-06-01
Retinitis pigmentosa (RP) is a group of inherited disorders affecting 1 in 3000-7000 people and characterized by abnormalities of the photoreceptors (rods and cones) or the retinal pigment epithelium of the retina which lead to progressive visual loss. RP can be inherited in an autosomal dominant, autosomal recessive or X-linked manner. While usually limited to the eye, RP may also occur as part of a syndrome as in the Usher syndrome and Bardet-Biedl syndrome. Over 40 genes have been associated with RP so far, with the majority of them expressed in either the photoreceptors or the retinal pigment epithelium. The tremendous heterogeneity of the disease makes the genetics of RP complicated, thus rendering genotype-phenotype correlations not fully applicable yet. In addition to the multiplicity of mutations, in fact, different mutations in the same gene may cause different diseases. We will here review which genes are involved in the genesis of RP and how mutations can lead to retinal degeneration. In the future, a more thorough analysis of genetic and clinical data together with a better understanding of the genotype-phenotype correlation might allow to reveal important information with respect to the likelihood of disease development and choices of therapy.
Gene Therapy for the Retinal Degeneration of Usher Syndrome Caused by Mutations in MYO7A.
Lopes, Vanda S; Williams, David S
2015-01-20
Usher syndrome is a deaf-blindness disorder. One of the subtypes, Usher 1B, is caused by loss of function of the gene encoding the unconventional myosin, MYO7A. A variety of different viral-based delivery approaches have been tested for retinal gene therapy to prevent the blindness of Usher 1B, and a clinical trial based on one of these approaches has begun. This review evaluates the different approaches. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.
Gao, Zhiguang; Mao, Chai-An; Pan, Ping; Mu, Xiuqian; Klein, William H
2014-11-01
The bHLH transcription factor ATOH7 (Math5) is essential for establishing retinal ganglion cell (RGC) fate. However, Atoh7-expressing retinal progenitor cells (RPCs) can give rise to all retinal cell types, suggesting that other factors are involved in specifying RGCs. The basis by which a subpopulation of Atoh7-expressing RPCs commits to an RGC fate remains uncertain but is of critical importance to retinal development since RGCs are the earliest cell type to differentiate. To better understand the regulatory mechanisms leading to cell-fate specification, a binary genetic system was generated to specifically label Atoh7-expressing cells with green fluorescent protein (GFP). Fluorescence-activated cell sorting (FACS)-purified GFP(+) and GFP(-) cells were profiled by RNA-seq. Here, we identify 1497 transcripts that were differentially expressed between the two RPC populations. Pathway analysis revealed diminished growth factor signaling in Atoh7-expressing RPCs, indicating that these cells had exited the cell cycle. In contrast, axon guidance signals were enriched, suggesting that axons of Atoh7-expressing RPCs were already making synaptic connections. Notably, many genes enriched in Atoh7-expressing RPCs encoded transcriptional regulators, and several were direct targets of ATOH7, including, and unexpectedly, Ebf3 and Eya2. We present evidence for a Pax6-Atoh7-Eya2 pathway that acts downstream of Atoh7 but upstream of differentiation factor Pou4f2. EYA2 is a protein phosphatase involved in protein-protein interactions and posttranslational regulation. These properties, along with Eya2 as an early target gene of ATOH7, suggest that EYA2 functions in RGC specification. Our results expand current knowledge of the regulatory networks operating in Atoh7-expressing RPCs and offer new directions for exploring the earliest aspects of retinogenesis. © 2014 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Wen-Li Deng
2018-04-01
Full Text Available Summary: Retinitis pigmentosa (RP is an irreversible, inherited retinopathy in which early-onset nyctalopia is observed. Despite the genetic heterogeneity of RP, RPGR mutations are the most common causes of this disease. Here, we generated induced pluripotent stem cells (iPSCs from three RP patients with different frameshift mutations in the RPGR gene, which were then differentiated into retinal pigment epithelium (RPE cells and well-structured retinal organoids possessing electrophysiological properties. We observed significant defects in photoreceptor in terms of morphology, localization, transcriptional profiling, and electrophysiological activity. Furthermore, shorted cilium was found in patient iPSCs, RPE cells, and three-dimensional retinal organoids. CRISPR-Cas9-mediated correction of RPGR mutation rescued photoreceptor structure and electrophysiological property, reversed the observed ciliopathy, and restored gene expression to a level in accordance with that in the control using transcriptome-based analysis. This study recapitulated the pathogenesis of RPGR using patient-specific organoids and achieved targeted gene therapy of RPGR mutations in a dish as proof-of-concept evidence. : Jin and colleagues demonstrate that patient-specific iPSC-derived 3D retinae can recapitulate disease progress of retinitis pigmentosa through presenting defects in photoreceptor morphology, gene profile, and electrophysiology, as well as the defective ciliogenesis in iPSCs, iPSC-RPE, and 3D retinae. CRISPR/Cas9-mediated gene correction can rescue not only photoreceptor structure and electrophysiological property but also observed ciliopathy. Keywords: RPGR, photoreceptor, electrophysiology, retinitis pigmentosa, patient-derived iPSCs, retinal organoid, RPE cells, cilium, ciliopathy, disease modeling
[Progress in research on pathogenic genes and gene therapy for inherited retinal diseases].
Zhu, Ling; Cao, Cong; Sun, Jiji; Gao, Tao; Liang, Xiaoyang; Nie, Zhipeng; Ji, Yanchun; Jiang, Pingping; Guan, Minxin
2017-02-10
Inherited retinal diseases (IRDs), including retinitis pigmentosa, Usher syndrome, Cone-Rod degenerations, inherited macular dystrophy, Leber's congenital amaurosis, Leber's hereditary optic neuropathy are the most common and severe types of hereditary ocular diseases. So far more than 200 pathogenic genes have been identified. With the growing knowledge of the genetics and mechanisms of IRDs, a number of gene therapeutic strategies have been developed in the laboratory or even entered clinical trials. Here the progress of IRD research on the pathogenic genes and therapeutic strategies, particularly gene therapy, are reviewed.
Directory of Open Access Journals (Sweden)
Catherine Cukras
Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.
Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha
2012-01-01
Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Cideciyan, Artur V.; Jacobson, Samuel G.; Beltran, William A.; Sumaroka, Alexander; Swider, Malgorzata; Iwabe, Simone; Roman, Alejandro J.; Olivares, Melani B.; Schwartz, Sharon B.; Komáromy, András M.; Hauswirth, William W.; Aguirre, Gustavo D.
2013-01-01
The first retinal gene therapy in human blindness from RPE65 mutations has focused on safety and efficacy, as defined by improved vision. The disease component not studied, however, has been the fate of photoreceptors in this progressive retinal degeneration. We show that gene therapy improves vision for at least 3 y, but photoreceptor degeneration progresses unabated in humans. In the canine model, the same result occurs when treatment is at the disease stage equivalent to humans. The study ...
Directory of Open Access Journals (Sweden)
Xia Wang
Full Text Available When seeking a confirmed molecular diagnosis in the research setting, patients with one descriptive diagnosis of retinal disease could carry pathogenic variants in genes not specifically associated with that description. However, this event has not been evaluated systematically in clinical diagnostic laboratories that validate fully all target genes to minimize false negatives/positives.We performed targeted next-generation sequencing analysis on 207 ocular disease-related genes for 42 patients whose DNA had been tested negative for disease-specific panels of genes known to be associated with retinitis pigmentosa, Leber congenital amaurosis, or exudative vitreoretinopathy.Pathogenic variants, including single nucleotide variations and copy number variations, were identified in 9 patients, including 6 with variants in syndromic retinal disease genes and 3 whose molecular diagnosis could not be distinguished easily from their submitted clinical diagnosis, accounting for 21% (9/42 of the unsolved cases.Our study underscores the clinical and genetic heterogeneity of retinal disorders and provides valuable reference to estimate the fraction of clinical samples whose retinal disorders could be explained by genes not specifically associated with the corresponding clinical diagnosis. Our data suggest that sequencing a larger set of retinal disorder related genes can increase the molecular diagnostic yield, especially for clinically hard-to-distinguish cases.
Genes and Mutations Causing Autosomal Dominant Retinitis Pigmentosa
Daiger, Stephen P.; Bowne, Sara J.; Sullivan, Lori S.
2015-01-01
Retinitis pigmentosa (RP) has a prevalence of approximately one in 4000; 25%–30% of these cases are autosomal dominant retinitis pigmentosa (adRP). Like other forms of inherited retinal disease, adRP is exceptionally heterogeneous. Mutations in more than 25 genes are known to cause adRP, more than 1000 mutations have been reported in these genes, clinical findings are highly variable, and there is considerable overlap with other types of inherited disease. Currently, it is possible to detect disease-causing mutations in 50%–75% of adRP families in select populations. Genetic diagnosis of adRP has advantages over other forms of RP because segregation of disease in families is a useful tool for identifying and confirming potentially pathogenic variants, but there are disadvantages too. In addition to identifying the cause of disease in the remaining 25% of adRP families, a central challenge is reconciling clinical diagnosis, family history, and molecular findings in patients and families. PMID:25304133
[Gene Therapy for Inherited RETINAL AND OPTIC NERVE Disorders: Current Knowledge].
Ďuďáková, Ľ; Kousal, B; Kolářová, H; Hlavatá, L; Lišková, P
The aim of this review is to provide a comprehensive summary of current gene therapy clinical trials for monogenic and optic nerve disorders.The number of genes for which gene-based therapies are being developed is growing. At the time of writing this review gene-based clinical trials have been registered for Leber congenital amaurosis 2 (LCA2), retinitis pigmentosa 38, Usher syndrome 1B, Stargardt disease, choroideremia, achromatopsia, Leber hereditary optic neuropathy (LHON) and X-linked retinoschisis. Apart from RPE65 gene therapy for LCA2 and MT-ND4 for LHON which has reached phase III, all other trials are in investigation phase I and II, i.e. testing the efficacy and safety.Because of the relatively easy accessibility of the retina and its ease of visualization which allows monitoring of efficacy, gene-based therapies for inherited retinal disorders represent a very promising treatment option. With the development of novel therapeutic approaches, the importance of establishing not only clinical but also molecular genetic diagnosis is obvious.Key words: gene therapy, monogenic retinal diseases, optic nerve atrophy, mitochondrial disease.
Directory of Open Access Journals (Sweden)
Bryant L
2017-12-01
Full Text Available Laura Bryant,1 Olga Lozynska,1 Albert M Maguire,1–3 Tomas S Aleman,1–3 Jean Bennett1–3 1Center for Advanced Retinal and Ocular Therapeutics (CAROT, FM Kirby Center for Molecular Ophthalmology, Scheie Eye Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA; 2Department of Ophthalmology, The Children’s Hospital of Philadelphia, Philadelphia, PA, USA; 3Department of Ophthalmology, Scheie Eye Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA Background: Accurate clinical diagnosis and prognosis of retinal degeneration can be aided by the identification of the disease-causing genetic variant. It can confirm the clinical diagnosis as well as inform the clinician of the risk for potential involvement of other organs such as kidneys. It also aids in genetic counseling for affected individuals who want to have a child. Finally, knowledge of disease-causing variants informs laboratory investigators involved in translational research. With the advent of next-generation sequencing, identifying pathogenic mutations is becoming easier, especially the identification of novel pathogenic variants.Methods: We used whole exome sequencing on a cohort of 69 patients with various forms of retinal degeneration and in whom screens for previously identified disease-causing variants had been inconclusive. All potential pathogenic variants were verified by Sanger sequencing and, when possible, segregation analysis of immediate relatives. Potential variants were identified by using a semi-masked approach in which rare variants in candidate genes were identified without knowledge of the clinical diagnosis (beyond “retinal degeneration” or inheritance pattern. After the initial list of genes was prioritized, genetic diagnosis and inheritance pattern were taken into account.Results: We identified the likely pathogenic variants in 64% of the subjects. Seven percent had a single
Gene Therapy in a Large Animal Model of PDE6A-Retinitis Pigmentosa
Directory of Open Access Journals (Sweden)
Freya M. Mowat
2017-06-01
Full Text Available Despite mutations in the rod phosphodiesterase 6-alpha (PDE6A gene being well-recognized as a cause of human retinitis pigmentosa, no definitive treatments have been developed to treat this blinding disease. We performed a trial of retinal gene augmentation in the Pde6a mutant dog using Pde6a delivery by capsid-mutant adeno-associated virus serotype 8, previously shown to have a rapid onset of transgene expression in the canine retina. Subretinal injections were performed in 10 dogs at 29–44 days of age, and electroretinography and vision testing were performed to assess functional outcome. Retinal structure was assessed using color fundus photography, spectral domain optical coherence tomography, and histology. Immunohistochemistry was performed to examine transgene expression and expression of other retinal genes. Treatment resulted in improvement in dim light vision and evidence of rod function on electroretinographic examination. Photoreceptor layer thickness in the treated area was preserved compared with the contralateral control vector treated or uninjected eye. Improved rod and cone photoreceptor survival, rhodopsin localization, cyclic GMP levels and bipolar cell dendrite distribution was observed in treated areas. Some adverse effects including foci of retinal separation, foci of retinal degeneration and rosette formation were identified in both AAV-Pde6a and control vector injected regions. This is the first description of successful gene augmentation for Pde6a retinitis pigmentosa in a large animal model. Further studies will be necessary to optimize visual outcomes and minimize complications before translation to human studies.
A Comprehensive Review of Retinal Gene Therapy
Boye, Shannon E; Boye, Sanford L; Lewin, Alfred S; Hauswirth, William W
2013-01-01
Blindness, although not life threatening, is a debilitating disorder for which few, if any treatments exist. Ocular gene therapies have the potential to profoundly improve the quality of life in patients with inherited retinal disease. As such, tremendous focus has been given to develop such therapies. Several factors make the eye an ideal organ for gene-replacement therapy including its accessibility, immune privilege, small size, compartmentalization, and the existence of a contralateral co...
Booij, Judith C.; Bakker, Arne 1; Kulumbetova, Jamilia; Moutaoukil, Youssef; Smeets, Bert; Verheij, Joke; Kroes, Hester Y.; Klaver, Caroline C. W.; van Schooneveld, Mary; Bergen, Arthur A. B.; Florijn, Ralph J.
Purpose: To develop a high-throughput, cost-effective diagnostic strategy for the identification of known and new mutations in 90 retinal disease genes. Design: Evidence-based study. Participants: Sixty patients with a variety of retinal disorders, including Leber's congenital amaurosis, ocular
Chuang, Katherine; Fields, Mark A; Del Priore, Lucian V
2017-12-01
The advent of gene editing has introduced the ability to make changes to the genome of cells, thus allowing for correction of genetic mutations in patients with monogenic diseases. Retinal diseases are particularly suitable for the application of this new technology because many retinal diseases, such as Stargardt disease, retinitis pigmentosa (RP), and Leber congenital amaurosis (LCA), are monogenic. Moreover, gene delivery techniques such as the use of adeno-associated virus (AAV) vectors have been optimized for intraocular use, and phase III trials are well underway to treat LCA, a severe form of inherited retinal degeneration, with gene therapy. This review focuses on the use of gene editing techniques and another relatively recent advent, induced pluripotent stem cells (iPSCs), and their potential for the study and treatment of retinal disease. Investment in these technologies, including overcoming challenges such as off-target mutations and low transplanted cell integration, may allow for future treatment of many debilitating inherited retinal diseases.
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Directory of Open Access Journals (Sweden)
Jennifer Rodger
Full Text Available Recombinant adeno-associated viral (rAAV vectors can be used to introduce neurotrophic genes into injured CNS neurons, promoting survival and axonal regeneration. Gene therapy holds much promise for the treatment of neurotrauma and neurodegenerative diseases; however, neurotrophic factors are known to alter dendritic architecture, and thus we set out to determine whether such transgenes also change the morphology of transduced neurons. We compared changes in dendritic morphology of regenerating adult rat retinal ganglion cells (RGCs after long-term transduction with rAAV2 encoding: (i green fluorescent protein (GFP, or (ii bi-cistronic vectors encoding GFP and ciliary neurotrophic factor (CNTF, brain-derived neurotrophic factor (BDNF or growth-associated protein-43 (GAP43. To enhance regeneration, rats received an autologous peripheral nerve graft onto the cut optic nerve of each rAAV2 injected eye. After 5-8 months, RGCs with regenerated axons were retrogradely labeled with fluorogold (FG. Live retinal wholemounts were prepared and GFP positive (transduced or GFP negative (non-transduced RGCs injected iontophoretically with 2% lucifer yellow. Dendritic morphology was analyzed using Neurolucida software. Significant changes in dendritic architecture were found, in both transduced and non-transduced populations. Multivariate analysis revealed that transgenic BDNF increased dendritic field area whereas GAP43 increased dendritic complexity. CNTF decreased complexity but only in a subset of RGCs. Sholl analysis showed changes in dendritic branching in rAAV2-BDNF-GFP and rAAV2-CNTF-GFP groups and the proportion of FG positive RGCs with aberrant morphology tripled in these groups compared to controls. RGCs in all transgene groups displayed abnormal stratification. Thus in addition to promoting cell survival and axonal regeneration, vector-mediated expression of neurotrophic factors has measurable, gene-specific effects on the morphology of injured
Directory of Open Access Journals (Sweden)
Keith P. Johnson
2018-02-01
Full Text Available The spike trains of retinal ganglion cells (RGCs are the only source of visual information to the brain. Here, we genetically identify an RGC type in mice that functions as a pixel encoder and increases firing to light increments (PixON-RGC. PixON-RGCs have medium-sized dendritic arbors and non-canonical center-surround receptive fields. From their receptive field center, PixON-RGCs receive only excitatory input, which encodes contrast and spatial information linearly. From their receptive field surround, PixON-RGCs receive only inhibitory input, which is temporally matched to the excitatory center input. As a result, the firing rate of PixON-RGCs linearly encodes local image contrast. Spatially offset (i.e., truly lateral inhibition of PixON-RGCs arises from spiking GABAergic amacrine cells. The receptive field organization of PixON-RGCs is independent of stimulus wavelength (i.e., achromatic. PixON-RGCs project predominantly to the dorsal lateral geniculate nucleus (dLGN of the thalamus and likely contribute to visual perception.
Directory of Open Access Journals (Sweden)
Alihamze Fathinajafabadi
Full Text Available The function of CERKL (CERamide Kinase Like, a causative gene of retinitis pigmentosa and cone-rod dystrophy, still awaits characterization. To approach its cellular role we have investigated the subcellular localization and interaction partners of the full length CERKL isoform, CERKLa of 532 amino acids, in different cell lines, including a photoreceptor-derived cell line. We demonstrate that CERKLa is a main component of compact and untranslated mRNPs and that associates with other RNP complexes such as stress granules, P-bodies and polysomes. CERKLa is a protein that binds through its N-terminus to mRNAs and interacts with other mRNA-binding proteins like eIF3B, PABP, HSP70 and RPS3. Except for eIF3B, these interactions depend on the integrity of mRNAs but not of ribosomes. Interestingly, the C125W CERKLa pathological mutant does not interact with eIF3B and is absent from these complexes. Compact mRNPs containing CERKLa also associate with microtubules and are found in neurites of neural differentiated cells. These localizations had not been reported previously for any member of the retinal disorders gene family and should be considered when investigating the pathogenic mechanisms and therapeutical approaches in these diseases.
A novel homozygous truncating GNAT1 mutation implicated in retinal degeneration.
LENUS (Irish Health Repository)
Carrigan, Matthew
2016-04-01
The GNAT1 gene encodes the α subunit of the rod transducin protein, a key element in the rod phototransduction cascade. Variants in GNAT1 have been implicated in stationary night-blindness in the past, but unlike other proteins in the same pathway, it has not previously been implicated in retinitis pigmentosa.
A novel method for objective vision testing in canine models of inherited retinal disease.
Gearhart, Patricia M; Gearhart, Chris C; Petersen-Jones, Simon M
2008-08-01
The use of canine models of retinal disease in the development of therapeutic strategies for inherited retinal disorders is a growing area of research. To evaluate accurately the success of potential vision-enhancing treatments, reliable methods for objectively assessing visual function in canine models is necessary. A simple vision-testing device was constructed that consisted of a junction box with four exit tunnels. Dogs were placed in the junction box and given one vision-based choice for exit. The first-choice tunnel and time to exit were recorded and analyzed. Two canine models of retinal disease with distinct molecular defects, a null mutation in the gene encoding the alpha subunit of rod cyclic GMP phosphodiesterase (PDE6A), and a null mutation in the gene encoding a retinal pigment epithelium-specific protein (RPE65) were tested and compared to those in unaffected dogs. With the use of bright light versus dim red light, the test differentiated between unaffected dogs and dogs affected with either mutation with a high degree of certainty. The white-light intensity series showed a significantly different performance between the unaffected and affected dogs. A significant difference in performance was detected between the dogs with each mutation. The results indicate that this novel canine vision-testing method is an accurate and sensitive means of distinguishing between unaffected dogs and dogs affected with two different forms of inherited retinal disease and should be useful as a means of assessing response to therapy in future studies.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Martens, Thomas F.; Remaut, Katrien; Deschout, Hendrik; Engbersen, Johan F J; Hennink, Wim E.; Van Steenbergen, Mies J.; Demeester, Jo; De Smedt, Stefaan C.; Braeckmans, Kevin
2015-01-01
Retinal gene therapy could potentially affect the lives of millions of people suffering from blinding disorders. Yet, one of the major hurdles remains the delivery of therapeutic nucleic acids to the retinal target cells. Due to the different barriers that need to be overcome in case of topical or
Jang, G.F.; Hooser, J.P. van; Kuksa, V.; McBee, J.K.; He, Y.G.; Janssen, J.J.M.; Driessen, C.A.G.G.; Palczewski, K.
2001-01-01
In the vertebrate retina, the final step of visual chromophore production is the oxidation of 11-cis-retinol to 11-cis-retinal. This reaction is catalyzed by 11-cis-retinol dehydrogenases (11-cis-RDHs), prior to the chromophore rejoining with the visual pigment apo-proteins. The RDH5 gene encodes a
Li, Yao; Chan, Lawrence; Nguyen, Huy V; Tsang, Stephen H
2016-01-01
Interest in generating human induced pluripotent stem (iPS) cells for stem cell modeling of diseases has overtaken that of patient-specific human embryonic stem cells due to the ethical, technical, and political concerns associated with the latter. In ophthalmology, researchers are currently using iPS cells to explore various applications, including: (1) modeling of retinal diseases using patient-specific iPS cells; (2) autologous transplantation of differentiated retinal cells that undergo gene correction at the iPS cell stage via gene editing tools (e.g., CRISPR/Cas9, TALENs and ZFNs); and (3) autologous transplantation of patient-specific iPS-derived retinal cells treated with gene therapy. In this review, we will discuss the uses of patient-specific iPS cells for differentiating into retinal pigment epithelium (RPE) cells, uncovering disease pathophysiology, and developing new treatments such as gene therapy and cell replacement therapy via autologous transplantation.
A novel homozygous truncating GNAT1 mutation implicated in retinal degeneration
Carrigan, Matthew; Duignan, Emma; Humphries, Pete; Palfi, Arpad; Kenna, Paul F; Farrar, G Jane
2015-01-01
Background The GNAT1 gene encodes the ? subunit of the rod transducin protein, a key element in the rod phototransduction cascade. Variants in GNAT1 have been implicated in stationary night-blindness in the past, but unlike other proteins in the same pathway, it has not previously been implicated in retinitis pigmentosa. Methods A panel of 182 retinopathy-associated genes was sequenced to locate disease-causing mutations in patients with inherited retinopathies. Results Sequencing revealed a ...
Gene therapy in animal models of autosomal dominant retinitis pigmentosa
Rossmiller, Brian; Mao, Haoyu
2012-01-01
Gene therapy for dominantly inherited genetic disease is more difficult than gene-based therapy for recessive disorders, which can be treated with gene supplementation. Treatment of dominant disease may require gene supplementation partnered with suppression of the expression of the mutant gene either at the DNA level, by gene repair, or at the RNA level by RNA interference or transcriptional repression. In this review, we examine some of the gene delivery approaches used to treat animal models of autosomal dominant retinitis pigmentosa, focusing on those models associated with mutations in the gene for rhodopsin. We conclude that combinatorial approaches have the greatest promise for success. PMID:23077406
Gene therapy for inherited retinal and optic nerve degenerations.
Moore, Nicholas A; Morral, Nuria; Ciulla, Thomas A; Bracha, Peter
2018-01-01
The eye is a target for investigational gene therapy due to the monogenic nature of many inherited retinal and optic nerve degenerations (IRD), its accessibility, tight blood-ocular barrier, the ability to non-invasively monitor for functional and anatomic outcomes, as well as its relative immune privileged state.Vectors currently used in IRD clinical trials include adeno-associated virus (AAV), small single-stranded DNA viruses, and lentivirus, RNA viruses of the retrovirus family. Both can transduce non-dividing cells, but AAV are non-integrating, while lentivirus integrate into the host cell genome, and have a larger transgene capacity. Areas covered: This review covers Leber's congenital amaurosis, choroideremia, retinitis pigmentosa, Usher syndrome, Stargardt disease, Leber's hereditary optic neuropathy, Achromatopsia, and X-linked retinoschisis. Expert opinion: Despite great potential, gene therapy for IRD raises many questions, including the potential for less invasive intravitreal versus subretinal delivery, efficacy, safety, and longevity of response, as well as acceptance of novel study endpoints by regulatory bodies, patients, clinicians, and payers. Also, ultimate adoption of gene therapy for IRD will require widespread genetic screening to identify and diagnose patients based on genotype instead of phenotype.
Dai, Xufeng; Zhang, Hua; Han, Juanjuan; He, Ying; Zhang, Yangyang; Qi, Yan; Pang, Ji-Jing
2016-01-01
Lysophosphatidylcholine acyltransferase 1 (LPCAT1) is necessary for photoreceptors to generate an important lipid component of their membranes. The absence of LPCAT1 results in early and rapid rod and cone degeneration. Retinal degeneration 11 (rd11) mice carry a mutation in the Lpcat1 gene, and are an excellent model of early-onset rapid retinal degeneration (RD). To date, no reports have documented gene therapy administration in the rd11 mouse model at different ages. In this study, the AAV8 (Y733F)-smCBA-Lpcat1 vector was subretinally injected at postnatal day (P) 10, 14, 18, or 22. Four months after injection, immunohistochemistry and analysis of retinal morphology showed that treatment at P10 rescued about 82% of the wild-type retinal thickness. However, the diffusion of the vector and the resulting rescue were limited to an area around the injection site that was only 31% of the total retinal area. Injection at P14 resulted in vector diffusion that covered approximately 84% of the retina, and we found that gene therapy was more effective against RD when exposure to light was limited before and after treatment. We observed long-term preservation of electroretinogram (ERG) responses, and preservation of retinal structure, indicating that early treatment followed by limited light exposure can improve gene therapy effectiveness for the eyes of rd11 mice. Importantly, delayed treatment still partially preserved M-cones, but not S-cones, and M-cones in the rd11 retina appeared to have a longer window of opportunity for effective preservation with gene therapy. These results provide important information regarding the effects of subretinal gene therapy in the mouse model of LPCAT1-deficiency.
The Role of Gene Therapy in the Treatment of Retinal Diseases: A Review.
Campa, C; Gallenga, C E; Bolletta, E; Perri, P
2017-01-01
Gene therapy represents the therapeutic delivery of nucleic acid polymers into patient cells with the aim of treating an underlying disease. Over the past 2 decades this new therapy has made substantial progress owing to better understanding of the pathobiologic basis of various diseases coupled with growth of gene transfer biotechnologies. The eye, in particular, represents a suitable target for such therapy due to the immune privilege provided by the blood-ocular barrier, the ability to directly visualize, access and locally treat the cells and the minimal amount of vector needed given the size of this organ. It is not surprising therefore that several clinical trials are now ongoing in this field. The purpose of this review was to provide an update on gene therapy for retinal diseases, discussing differences in treatment strategies, vector designs and surgical techniques. Research was performed on PubMed, ClinicalTrials.gov, and Home Genetic Reference. We additionally utilized the internet database for genetics of retinal diseases, the portal for rare diseases and orphan drugs and the NCBI database Online Mendelian Inheritance in Man. No restriction was applied on the language of publications. We present the available results of current active clinical trials for inherited retinal disease such as Leber's congenital amaurosis type 2, choroideremia, Stargardt disease, achromatopsia and juvenile X-linked retinoschisis. We also illustrate a new approach of this therapy for the treatment of much more common ocular diseases such as age-related macular degeneration and diabetic retinopathy. Gene therapy represents an emerging and promising therapeutic approach for the treatment not only of rare inherited retinal diseases but also much more common retinal pathologies. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
Defining the Human Macula Transcriptome and Candidate Retinal Disease Genes UsingEyeSAGE
Rickman, Catherine Bowes; Ebright, Jessica N.; Zavodni, Zachary J.; Yu, Ling; Wang, Tianyuan; Daiger, Stephen P.; Wistow, Graeme; Boon, Kathy; Hauser, Michael A.
2009-01-01
Purpose To develop large-scale, high-throughput annotation of the human macula transcriptome and to identify and prioritize candidate genes for inherited retinal dystrophies, based on ocular-expression profiles using serial analysis of gene expression (SAGE). Methods Two human retina and two retinal pigment epithelium (RPE)/choroid SAGE libraries made from matched macula or midperipheral retina and adjacent RPE/choroid of morphologically normal 28- to 66-year-old donors and a human central retina longSAGE library made from 41- to 66-year-old donors were generated. Their transcription profiles were entered into a relational database, EyeSAGE, including microarray expression profiles of retina and publicly available normal human tissue SAGE libraries. EyeSAGE was used to identify retina- and RPE-specific and -associated genes, and candidate genes for retina and RPE disease loci. Differential and/or cell-type specific expression was validated by quantitative and single-cell RT-PCR. Results Cone photoreceptor-associated gene expression was elevated in the macula transcription profiles. Analysis of the longSAGE retina tags enhanced tag-to-gene mapping and revealed alternatively spliced genes. Analysis of candidate gene expression tables for the identified Bardet-Biedl syndrome disease gene (BBS5) in the BBS5 disease region table yielded BBS5 as the top candidate. Compelling candidates for inherited retina diseases were identified. Conclusions The EyeSAGE database, combining three different gene-profiling platforms including the authors’ multidonor-derived retina/RPE SAGE libraries and existing single-donor retina/RPE libraries, is a powerful resource for definition of the retina and RPE transcriptomes. It can be used to identify retina-specific genes, including alternatively spliced transcripts and to prioritize candidate genes within mapped retinal disease regions. PMID:16723438
Nagel-Wolfrum, Kerstin; Möller, Fabian; Penner, Inessa; Wolfrum, Uwe
2014-09-01
The eye has become an excellent target for gene therapy, and gene augmentation therapy of inherited retinal disorders has made major progress in recent years. Nevertheless, a recent study indicated that gene augmentation intervention might not stop the progression of retinal degeneration in patients. In addition, for many genes, viral-mediated gene augmentation is currently not feasible due to gene size and limited packaging capacity of viral vectors as well as expression of various heterogeneous isoforms of the target gene. Thus, alternative gene-based strategies to stop or delay the retinal degeneration are necessary. This review focuses on an alternative pharmacologic treatment strategy based on the usage of translational read-through inducing drugs (TRIDs) such as PTC124, aminoglycoside antibiotics, and designer aminoglycosides for overreading in-frame nonsense mutations. This strategy has emerged as an option for up to 30-50% of all cases of recessive hereditary retinal dystrophies. In-frame nonsense mutations are single-nucleotide alterations within the gene coding sequence resulting in a premature stop codon. Consequently, translation of such mutated genes leads to the synthesis of truncated proteins, which are unable to fulfill their physiologic functions. In this context, application of TRIDs facilitates the recoding of the premature termination codon into a sense codon, thus restoring syntheses of full-length proteins. So far, clinical trials for non-ocular diseases have been initiated for diverse TRIDs. Although the clinical outcome is not analyzed in detail, an excellent safety profile, namely for PTC124, was clearly demonstrated. Moreover, recent data demonstrated sustained read-through efficacies of nonsense mutations causing retinal degeneration, as manifested in the human Usher syndrome. In addition, a strong retinal biocompatibility for PTC124 and designer aminoglycosides has been demonstrated. In conclusion, recent progress emphasizes the
A novel homozygous truncating GNAT1 mutation implicated in retinal degeneration.
Carrigan, Matthew; Duignan, Emma; Humphries, Pete; Palfi, Arpad; Kenna, Paul F; Farrar, G Jane
2016-04-01
The GNAT1 gene encodes the α subunit of the rod transducin protein, a key element in the rod phototransduction cascade. Variants in GNAT1 have been implicated in stationary night-blindness in the past, but unlike other proteins in the same pathway, it has not previously been implicated in retinitis pigmentosa. A panel of 182 retinopathy-associated genes was sequenced to locate disease-causing mutations in patients with inherited retinopathies. Sequencing revealed a novel homozygous truncating mutation in the GNAT1 gene in a patient with significant pigmentary disturbance and constriction of visual fields, a presentation consistent with retinitis pigmentosa. This is the first report of a patient homozygous for a complete loss-of-function GNAT1 mutation. The clinical data from this patient provide definitive evidence of retinitis pigmentosa with late onset in addition to the lifelong night-blindness that would be expected from a lack of transducin function. These data suggest that some truncating GNAT1 variants can indeed cause a recessive, mild, late-onset retinal degeneration in human beings rather than just stationary night-blindness as reported previously, with notable similarities to the phenotype of the Gnat1 knockout mouse. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Presentation of Complex Homozygous Allele in ABCA4 Gene in a Patient with Retinitis Pigmentosa
Directory of Open Access Journals (Sweden)
Māreta Audere
2015-01-01
Full Text Available Retinitis pigmentosa is a degenerative retinal disease characterized by progressive photoreceptor damage, which causes loss of peripheral and night vision and the development of tunnel vision and may result in loss of central vision. This study describes a patient with retinitis pigmentosa caused by a mutation in the ABCA4 gene with complex allele c.1622T>C, p.L541P; c.3113C>T, p.A1038V in homozygous state.
Wu, Wei-Chi; Drenser, Kimberly; Trese, Michael; Capone, Antonio; Dailey, Wendy
2007-02-01
To correlate the ophthalmic findings of patients with pediatric vitreoretinopathies with mutations occurring in the Norrie disease gene (NDP). One hundred nine subjects with diverse pediatric vitreoretinopathies and 54 control subjects were enrolled in the study. Diagnoses were based on retinal findings at each patient's first examination. Samples of DNA from each patient underwent polymerase chain reaction amplification and direct sequencing of the NDP gene. Eleven male patients expressing mutations in the NDP gene were identified in the test group, whereas the controls demonstrated wild-type NDP. All patients diagnosed as having Norrie disease had mutations in the NDP gene. Four of the patients with Norrie disease had mutations involving a cysteine residue in the cysteine-knot motif. Four patients diagnosed as having familial exudative vitreoretinopathy were found to have noncysteine mutations. One patient with retinopathy of prematurity had a 14-base deletion in the 5' untranslated region (exon 1), and 1 patient with bilateral persistent fetal vasculature syndrome expressed a noncysteine mutation in the second exon. Mutations disrupting the cysteine-knot motif corresponded to severe retinal dysgenesis, whereas patients with noncysteine mutations had varying degrees of avascular peripheral retina, extraretinal vasculature, and subretinal exudate. Patients exhibiting severe retinal dysgenesis should be suspected of carrying a mutation that disrupts the cysteine-knot motif in the NDP gene.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Directory of Open Access Journals (Sweden)
Jeffery Glen
2008-05-01
Full Text Available Abstract Background The transcription factor Pax6 is expressed by many cell types in the developing eye. Eyes do not form in homozygous loss-of-function mouse mutants (Pax6Sey/Sey and are abnormally small in Pax6Sey/+ mutants. Eyes are also abnormally small in PAX77 mice expressing multiple copies of human PAX6 in addition to endogenous Pax6; protein sequences are identical in the two species. The developmental events that lead to microphthalmia in PAX77 mice are not well-characterised, so it is not clear whether over- and under-expression of Pax6/PAX6 cause microphthalmia through similar mechanisms. Here, we examined the consequences of over-expression for the eye and its axonal connections. Results Eyes form in PAX77+/+ embryos but subsequently degenerate. At E12.5, we found no abnormalities in ocular morphology, retinal cell cycle parameters and the incidence of retinal cell death. From E14.5 on, we observed malformations of the optic disc. From E16.5 into postnatal life there is progressively more severe retinal dysplasia and microphthalmia. Analyses of patterns of gene expression indicated that PAX77+/+ retinae produce a normal range of cell types, including retinal ganglion cells (RGCs. At E14.5 and E16.5, quantitative RT-PCR with probes for a range of molecules associated with retinal development showed only one significant change: a slight reduction in levels of mRNA encoding the secreted morphogen Shh at E16.5. At E16.5, tract-tracing with carbocyanine dyes in PAX77+/+ embryos revealed errors in intraretinal navigation by RGC axons, a decrease in the number of RGC axons reaching the thalamus and an increase in the proportion of ipsilateral projections among those RGC axons that do reach the thalamus. A survey of embryos with different Pax6/PAX6 gene dosage (Pax6Sey/+, Pax6+/+, PAX77+ and PAX77+/+ showed that (1 the total number of RGC axons projected by the retina and (2 the proportions that are sorted into the ipsilateral and
Directory of Open Access Journals (Sweden)
John Paul SanGiovanni
Full Text Available Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs and use of peroxisome proliferator activator receptor (PPAR-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG co-activator 1 alpha (PPARGC1A, a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR transcription complex, may influence neovascularization (NV in age-related macular degeneration (AMD.We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A.A DNA coding variant (rs3736265 and a 3'UTR-resident regulatory variant (rs3774923 in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs. SNP-SNP interactions existed for NV AMD (P<0.005 with rs3736265 and a AMD-associated variant in complement factor B (CFB, rs512559. PPARGC1A influences activation of the AMD-associated complement component 3 (C3 promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P ≤ 0.003 of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033, a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678 showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P ≤ 0.003. C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice
SanGiovanni, John Paul; Chen, Jing; Sapieha, Przemyslaw; Aderman, Christopher M; Stahl, Andreas; Clemons, Traci E; Chew, Emily Y; Smith, Lois E H
2013-01-01
Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs) and use of peroxisome proliferator activator receptor (PPAR)-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG) co-activator 1 alpha (PPARGC1A), a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR) transcription complex, may influence neovascularization (NV) in age-related macular degeneration (AMD). We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A. A DNA coding variant (rs3736265) and a 3'UTR-resident regulatory variant (rs3774923) in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs). SNP-SNP interactions existed for NV AMD (Pcomplement factor B (CFB, rs512559). PPARGC1A influences activation of the AMD-associated complement component 3 (C3) promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P ≤ 0.003) of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033), a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678) showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P ≤ 0.003). C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice - these animals also showed 70% reduction in retinal NV (P
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy
2017-01-01
Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular
Directory of Open Access Journals (Sweden)
Kosuke Fujita
2017-06-01
Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Retinal oscillations carry visual information to cortex
Directory of Open Access Journals (Sweden)
Kilian Koepsell
2009-04-01
Full Text Available Thalamic relay cells fire action potentials that transmit information from retina to cortex. The amount of information that spike trains encode is usually estimated from the precision of spike timing with respect to the stimulus. Sensory input, however, is only one factor that influences neural activity. For example, intrinsic dynamics, such as oscillations of networks of neurons, also modulate firing pattern. Here, we asked if retinal oscillations might help to convey information to neurons downstream. Specifically, we made whole-cell recordings from relay cells to reveal retinal inputs (EPSPs and thalamic outputs (spikes and then analyzed these events with information theory. Our results show that thalamic spike trains operate as two multiplexed channels. One channel, which occupies a low frequency band (<30 Hz, is encoded by average firing rate with respect to the stimulus and carries information about local changes in the visual field over time. The other operates in the gamma frequency band (40-80 Hz and is encoded by spike timing relative to retinal oscillations. At times, the second channel conveyed even more information than the first. Because retinal oscillations involve extensive networks of ganglion cells, it is likely that the second channel transmits information about global features of the visual scene.
DEFF Research Database (Denmark)
Riess, O; Noerremoelle, A; Weber, B
1992-01-01
The finding of a mutation in the beta subunit of the cyclic GMP (cGMP) phosphodiesterase gene causing retinal degeneration in mice (the Pdeb gene) prompted a search for disease-causing mutations in the human phosphodiesterase gene (PDEB gene) in patients with retinitis pigmentosa. All 22 exons...
The severity of retinal degeneration in Rp1h gene-targeted mice is dependent on genetic background.
Liu, Qin; Saveliev, Alexei; Pierce, Eric A
2009-04-01
The severity of disease in patients with retinitis pigmentosa (RP) can vary significantly, even among patients with the same primary mutations. It is hypothesized that modifier genes play important roles in determining the severity of RP, including the retinitis pigmentosa 1 (RP1) form of disease. To investigate the basis of variation in disease expression for RP1 disease, the authors generated congenic mice with a gene-targeted retinitis pigmentosa 1 homolog (Rp1h) allele (Rp1h(tm1Eap)) on several different genetic backgrounds and analyzed their retinal phenotypes. The Rp1h(tm1Eap) allele was placed onto the C57BL/6J, DBA1/J, and A/J backgrounds. Retinal function of the resultant congenic mice was evaluated using electroretinographic analyses. Retinal structure and ultrastructure were evaluated using light and electron microscopy. Rp1h protein location was determined with immunofluorescence microscopy. Analysis of the retinal phenotype of incipient congenic (N6) B6.129S-Rp1h(+/tm1Eap), DBA.129S(B6)-Rp1h(+/tm1Eap), and A.129S(B6)-Rp1h(+/tm1Eap) mice at 1 year of age showed retinal degeneration only in the A.129S(B6)-Rp1h(+/tm1Eap) mice. Further analyses revealed that the photoreceptors of the fully congenic A.129S(B6)-Rp1h(+/tm1Eap) mice show evidence of degeneration at 6 months of age and are almost completely lost by 18 months of age. In contrast, the photoreceptor cells in the fully congenic B6.129S-Rp1h(+/tm1Eap) mice remain healthy up to 18 months. The severity of the retinal degeneration caused by the Rp1h(tm1Eap) allele is notably dependent on genetic background. The development and characterization of the B6.129S-Rp1h(+/tm1Eap) and A.129S(B6)-Rp1h(+/tm1Eap) congenic mouse lines will facilitate identification of sequence alterations in genes that modify the severity of RP1 disease.
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
Directory of Open Access Journals (Sweden)
Daniel Boloc
Full Text Available Retinitis pigmentosa (RP is a highly heterogeneous genetic visual disorder with more than 70 known causative genes, some of them shared with other non-syndromic retinal dystrophies (e.g. Leber congenital amaurosis, LCA. The identification of RP genes has increased steadily during the last decade, and the 30% of the cases that still remain unassigned will soon decrease after the advent of exome/genome sequencing. A considerable amount of genetic and functional data on single RD genes and mutations has been gathered, but a comprehensive view of the RP genes and their interacting partners is still very fragmentary. This is the main gap that needs to be filled in order to understand how mutations relate to progressive blinding disorders and devise effective therapies.We have built an RP-specific network (RPGeNet by merging data from different sources: high-throughput data from BioGRID and STRING databases, manually curated data for interactions retrieved from iHOP, as well as interactions filtered out by syntactical parsing from up-to-date abstracts and full-text papers related to the RP research field. The paths emerging when known RP genes were used as baits over the whole interactome have been analysed, and the minimal number of connections among the RP genes and their close neighbors were distilled in order to simplify the search space.In contrast to the analysis of single isolated genes, finding the networks linking disease genes renders powerful etiopathological insights. We here provide an interactive interface, RPGeNet, for the molecular biologist to explore the network centered on the non-syndromic and syndromic RP and LCA causative genes. By integrating tissue-specific expression levels and phenotypic data on top of that network, a more comprehensive biological view will highlight key molecular players of retinal degeneration and unveil new RP disease candidates.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Leber’s congenital amaurosis and the role of gene therapy in congenital retinal disorders
Directory of Open Access Journals (Sweden)
Walid Sharif
2017-03-01
Full Text Available Leber’s congenital amaurosis (LCA and recent gene therapy advancement for treating inherited retinopathies were extensive literature reviewed using MEDLINE, PubMed and EMBASE. Adeno-associated viral vectors were the most utilised vectors for ocular gene therapy. Cone photoreceptor cells might use an alternate pathway which was not reliant of the retinal pigment epithelium (RPE derived retinoid isomerohydrolase (RPE65 to access the 11-cis retinal dehydechromophore. Research efforts dedicated on the progression of a gene-based therapy for the treatment of LCA2. Such gene therapy approaches were extremely successful in canine, porcine and rodent LCA2 models. The recombinant AAV2.hRPE65v2 adeno-associated vector contained the RPE65 cDNA and was replication deficient. Its in vitro injection in target cells induced RPE65 protein production. The gene therapy trials that were so far conducted for inherited retinopathies have generated promising results. Phase I clinical trials to cure LCA and choroideremia demonstrated that adeno-associated viral vectors containing RPE genes and photoreceptors respectively, could be successfully administered to inherited retinopathy patients. A phase III trial is presently ongoing and if successful, it will lead the way to additional gene therapy attempts to cure monogenic, inherited retinopathies.
Leber’s congenital amaurosis and the role of gene therapy in congenital retinal disorders
Institute of Scientific and Technical Information of China (English)
Walid; Sharif; Zuhair; Sharif
2017-01-01
Leber’s congenital amaurosis(LCA)and recent gene therapy advancement for treating inherited retinopathies were extensive literature reviewed using MEDLINE,Pub Med and EMBASE. Adeno-associated viral vectors were the most utilised vectors for ocular gene therapy. Cone photoreceptor cells might use an alternate pathway which was not reliant of the retinal pigment epithelium(RPE)derived retinoid isomerohydrolase(RPE65)to access the 11-cis retinal dehydechromophore. Research efforts dedicated on the progression of a gene-based therapy for the treatment of LCA2. Such gene therapy approaches were extremely successful in canine,porcine and rodent LCA2 models. The recombinant AAV2.h RPE65v2 adenoassociated vector contained the RPE65 cDNA and was replication deficient. Its in vitro injection in target cells induced RPE65 protein production. The gene therapy trials that were so far conducted for inherited retinopathies have generated promising results. Phase I clinical trials to cure LCA and choroideremia demonstrated that adeno-associated viral vectors containing RPE genes and photoreceptors respectively,could be successfully administered to inherited retinopathy patients. A phase III trial is presently ongoing and if successful,it will lead the way to additional gene therapy attempts to cure monogenic,inherited retinopathies.
Rosenbaum, James T.; Sibley, Cailin H.; Lin, Phoebe
2016-01-01
Purpose of review Ophthalmologists and rheumatologists frequently miscommunicate in consulting on patients with retinal vasculitis. This report seeks to establish a common understanding of the term, retinal vasculitis, and to review recent papers on this diagnosis. Recent findings 1) The genetic basis of some rare forms of retinal vascular disease have recently been described. Identified genes include CAPN5, TREX1, and TNFAIP3; 2) Behçet’s disease is a systemic illness that is very commonly associated with occlusive retinal vasculitis; 3) retinal imaging including fluorescein angiography and other newer imaging modalities has proven crucial to the identification and characterization of retinal vasculitis and its complications; 4) although monoclonal antibodies to IL-17A or IL-1 beta failed in trials for Behçet’s disease, antibodies to TNF alpha, either infliximab or adalimumab, have demonstrated consistent benefit in managing this disease. Interferon treatment and B cell depletion therapy via rituximab may be beneficial in certain types of retinal vasculitis. Summary Retinal vasculitis is an important entity for rheumatologists to understand. Retinal vasculitis associated with Behçet’s disease responds to monoclonal antibodies that neutralize TNF, but the many other forms of non-infectious retinal vasculitis may require alternate therapeutic management. PMID:26945335
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Usher syndrome: animal models, retinal function of Usher proteins, and prospects for gene therapy
Williams, David S.
2009-01-01
Usher syndrome is a deafness-blindness disorder. The blindness occurs from a progressive retinal degeneration that begins after deafness and after the retina has developed. Three clinical subtypes of Usher syndrome have been identified, with mutations in any one of six different genes giving rise to type 1, in any one of three different genes to type 2, and in one identified gene causing Usher type 3. Mutant mice for most of the genes have been studied; while they have clear inner ear defects, retinal phenotypes are relatively mild and have been difficult to characterize. The retinal functions of the Usher proteins are still largely unknown. Protein binding studies have suggested many interactions among the proteins, and a model of interaction among all the proteins in the photoreceptor synapse has been proposed. However this model is not supported by localization data from some laboratories, or the indication of any synaptic phenotype in mutant mice. An earlier suggestion, based on patient pathologies, of Usher protein function in the photoreceptor cilium continues to gain support from immunolocalization and mutant mouse studies, which are consistent with Usher protein interaction in the photoreceptor ciliary/periciliary region. So far, the most characterized Usher protein is myosin VIIa. It is present in the apical RPE and photoreceptor ciliary/periciliary region, where it is required for organelle transport and clearance of opsin from the connecting cilium, respectively. Usher syndrome is amenable to gene replacement therapy, but also has some specific challenges. Progress in this treatment approach has been achieved by correction of mutant phenotypes in Myo7a-null mouse retinas, following lentiviral delivery of MYO7A. PMID:17936325
Mutation K42E in dehydrodolichol diphosphate synthase (DHDDS) causes recessive retinitis pigmentosa.
Lam, Byron L; Züchner, Stephan L; Dallman, Julia; Wen, Rong; Alfonso, Eduardo C; Vance, Jeffery M; Peričak-Vance, Margaret A
2014-01-01
A single-nucleotide mutation in the gene that encodes DHDDS has been identified by whole exome sequencing as the cause of the non-syndromic recessive retinitis pigmentosa (RP) in a family of Ashkenazi Jewish origin in which three of the four siblings have early onset retinal degeneration. The peripheral retinal degeneration in the affected siblings was evident in the initial examination in 1992 and only one had detectable electroretinogram (ERG) that suggested cone-rod dysfunction. The pigmentary retinal degeneration subsequently progressed rapidly. The identified mutation changes the highly conserved residue Lys42 to Glu, resulting in lower catalytic efficiency. Patterns of plasma transferrin isoelectric focusing gel were normal in all family members, indicating no significant abnormality in protein glycosylation. Dolichols have been shown to influence the fluidity and of the membrane and promote vesicle fusion. Considering that photoreceptor outer segments contain stacks of membrane discs, we believe that the mutation may lead to low dolichol levels in photoreceptor outer segments, resulting in unstable membrane structure that leads to photoreceptor degeneration.
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
Cremers, F.P.M.; Maugeri, A.; Klevering, B.J.; Hoefsloot, L.H.; Hoyng, C.B.
2002-01-01
Autosomal recessive Stargardt disease is caused by mutations in the ABCA4 gene. Mutations in ABCA4 are also found in two-thirds of cases with autosomal recessive cone-rod dystrophy, and a small fraction of patients with autosomal recessive retinitis pigmentosa. Patients with autosomal recessive
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Terapia gênica em distrofias hereditárias de retina Gene therapy for inherited retinal dystrophies
Directory of Open Access Journals (Sweden)
Monique Côco
2009-08-01
Full Text Available As distrofias hereditárias de retina abrangem um amplo número de doenças caracterizadas por lenta e progressiva degeneração da retina. São o resultado de mutações em genes expressos em fotorreceptores e no epitélio pigmentado da retina. A herança pode ser autossômica dominante, autossômica recessiva, ligada ao X recessiva, digênica ou herança mitocondrial. Atualmente não há tratamento para essas doenças e os pacientes convivem com a perda progressiva da visão. O aconselhamento genético e o suporte para reabilitação têm indicação nestes casos. Pesquisas envolvendo a base molecular e genética dessas doenças está continuamente em expansão e ampliam as perspectivas para novas formas de tratamento. Dessa forma, a terapia gênica, que consiste na inserção de material genético exógeno em células de um indivíduo com finalidade terapêutica, tem sido a principal forma de tratamento para as distrofias hereditárias de retina. O olho é um órgão peculiar para a terapia gênica, pois é anatomicamente dividido em compartimentos, imunologicamente privilegiado e com meios transparentes. A maioria das doenças oculares tem defeitos em genes conhecidos. Além disso, há modelo animal bem caracterizado para algumas condições. Propostas para pesquisa clínica em terapia gênica nas degenerações retinianas hereditárias com defeito no gene RPE65, recentemente tiveram aprovação ética e os resultados preliminares obtidos trouxeram grandes expectativas na melhora da qualidade de vida dos pacientes.The inherited retinal dystrophies comprise a large number of disorders characterized by a slow and progressive retinal degeneration. They are the result of mutations in genes that express in either the photoreceptor cells or the retinal pigment epithelium. The mode of inheritance can be autosomal dominant, autosomal recessive, X linked recessive, digenic or mitochondrial DNA inherited. At the moment, there is no treatment for these
Mutations in REEP6 Cause Autosomal-Recessive Retinitis Pigmentosa.
Arno, Gavin; Agrawal, Smriti A; Eblimit, Aiden; Bellingham, James; Xu, Mingchu; Wang, Feng; Chakarova, Christina; Parfitt, David A; Lane, Amelia; Burgoyne, Thomas; Hull, Sarah; Carss, Keren J; Fiorentino, Alessia; Hayes, Matthew J; Munro, Peter M; Nicols, Ralph; Pontikos, Nikolas; Holder, Graham E; Asomugha, Chinwe; Raymond, F Lucy; Moore, Anthony T; Plagnol, Vincent; Michaelides, Michel; Hardcastle, Alison J; Li, Yumei; Cukras, Catherine; Webster, Andrew R; Cheetham, Michael E; Chen, Rui
2016-12-01
Retinitis pigmentosa (RP) is the most frequent form of inherited retinal dystrophy. RP is genetically heterogeneous and the genes identified to date encode proteins involved in a wide range of functional pathways, including photoreceptor development, phototransduction, the retinoid cycle, cilia, and outer segment development. Here we report the identification of biallelic mutations in Receptor Expression Enhancer Protein 6 (REEP6) in seven individuals with autosomal-recessive RP from five unrelated families. REEP6 is a member of the REEP/Yop1 family of proteins that influence the structure of the endoplasmic reticulum but is relatively unstudied. The six variants identified include three frameshift variants, two missense variants, and a genomic rearrangement that disrupts exon 1. Human 3D organoid optic cups were used to investigate REEP6 expression and confirmed the expression of a retina-specific isoform REEP6.1, which is specifically affected by one of the frameshift mutations. Expression of the two missense variants (c.383C>T [p.Pro128Leu] and c.404T>C [p.Leu135Pro]) and the REEP6.1 frameshift mutant in cultured cells suggest that these changes destabilize the protein. Furthermore, CRISPR-Cas9-mediated gene editing was used to produce Reep6 knock-in mice with the p.Leu135Pro RP-associated variant identified in one RP-affected individual. The homozygous knock-in mice mimic the clinical phenotypes of RP, including progressive photoreceptor degeneration and dysfunction of the rod photoreceptors. Therefore, our study implicates REEP6 in retinal homeostasis and highlights a pathway previously uncharacterized in retinal dystrophy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Usher syndrome: animal models, retinal function of Usher proteins, and prospects for gene therapy
Williams, David S.
2007-01-01
Usher syndrome is a deafness-blindness disorder. The blindness occurs from a progressive retinal degeneration that begins after deafness and after the retina has developed. Three clinical subtypes of Usher syndrome have been identified, with mutations in any one of six different genes giving rise to type 1, in any one of three different genes to type 2, and in one identified gene causing Usher type 3. Mutant mice for most of the genes have been studied; while they have clear inner ear defects...
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
Gene therapy for inherited retinal degenerations: initial successes and future challenges
Gupta, Priya R.; Huckfeldt, Rachel M.
2017-10-01
Inherited retinal degenerations are a clinically and genetically heterogeneous group of conditions that have historically shared an untreatable course. In recent years, however, a wide range of therapeutic strategies have demonstrated efficacy in preclinical studies and entered clinical trials with a common goal of improving visual function for patients affected with these conditions. Gene therapy offers a particularly elegant and precise opportunity to target the causative genetic mutations underlying these monogenic diseases. The present review will provide an overview of gene therapy with particular emphasis on key clinical results to date and challenges for the future.
Directory of Open Access Journals (Sweden)
Melissa L Williams
2006-06-01
Full Text Available Leber congenital amaurosis (LCA is a genetically heterogeneous group of retinal diseases that cause congenital blindness in infants and children. Mutations in the GUCY2D gene that encodes retinal guanylate cyclase-1 (retGC1 were the first to be linked to this disease group (LCA type 1 [LCA1] and account for 10%-20% of LCA cases. These mutations disrupt synthesis of cGMP in photoreceptor cells, a key second messenger required for function of these cells. The GUCY1*B chicken, which carries a null mutation in the retGC1 gene, is blind at hatching and serves as an animal model for the study of LCA1 pathology and potential treatments in humans.A lentivirus-based gene transfer vector carrying the GUCY2D gene was developed and injected into early-stage GUCY1*B embryos to determine if photoreceptor function and sight could be restored to these animals. Like human LCA1, the avian disease shows early-onset blindness, but there is a window of opportunity for intervention. In both diseases there is a period of photoreceptor cell dysfunction that precedes retinal degeneration. Of seven treated animals, six exhibited sight as evidenced by robust optokinetic and volitional visual behaviors. Electroretinographic responses, absent in untreated animals, were partially restored in treated animals. Morphological analyses indicated there was slowing of the retinal degeneration.Blindness associated with loss of function of retGC1 in the GUCY1*B avian model of LCA1 can be reversed using viral vector-mediated gene transfer. Furthermore, this reversal can be achieved by restoring function to a relatively low percentage of retinal photoreceptors. These results represent a first step toward development of gene therapies for one of the more common forms of childhood blindness.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Assessment of different virus-mediated approaches for retinal gene therapy of Usher 1B.
Lopes, Vanda S; Diemer, Tanja; Williams, David S
2014-01-01
Usher syndrome type 1B, which is characterized by congenital deafness and progressive retinal degeneration, is caused by the loss of the function of MYO7A. Prevention of the retinal degeneration should be possible by delivering functional MYO7A to retinal cells. Although this approach has been used successfully in clinical trials for Leber congenital amaurosis (LCA2), it remains a challenge for Usher 1B because of the large size of the MYO7A cDNA. Different viral vectors have been tested for use in MYO7A gene therapy. Here, we review approaches with lentiviruses, which can accommodate larger genes, as well as attempts to use adeno-associated virus (AAV), which has a smaller packaging capacity. In conclusion, both types of viral vector appear to be effective. Despite concerns about the ability of lentiviruses to access the photoreceptor cells, a phenotype of the photoreceptors of Myo7a-mutant mice can be corrected. And although MYO7A cDNA is significantly larger than the nominal carrying capacity of AAV, AAV-MYO7A in single vectors also corrected Myo7a-mutant phenotypes in photoreceptor and RPE cells. Interestingly, however, a dual AAV vector approach was found to be much less effective.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Directory of Open Access Journals (Sweden)
Bo Gong
2015-01-01
Full Text Available Retinitis pigmentosa (RP is the most important hereditary retinal disease caused by progressive degeneration of the photoreceptor cells. This study is to identify gene mutations responsible for autosomal recessive retinitis pigmentosa (arRP in a Chinese family using next-generation sequencing technology. A Chinese family with 7 members including two individuals affected with severe early-onset RP was studied. All patients underwent a complete ophthalmic examination. Exome sequencing was performed on a single RP patient (the proband of this family and direct Sanger sequencing on other family members and normal controls was followed to confirm the causal mutations. A homozygous mutation c.437Tgene, which encodes an NADPH-dependent retinal reductase, was identified as being related to the phenotype of this arRP family. This homozygous mutation was detected in the two affected patients, but not present in other family members and 600 normal controls. Another three normal members in the family were found to carry this heterozygous missense mutation. Our results emphasize the importance of c.437T
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Therapeutic avenues for hereditary forms of retinal blindness.
Kannabiran, Chitra; Mariappan, Indumathi
2018-03-01
Hereditary retinal diseases, known as retinal degenerations or dystrophies, are a large group of inherited eye disorders resulting in irreversible visual loss and blindness. They develop due to mutations in one or more genes that lead to the death of the retinal photoreceptor cells. Till date, mutations in over 200 genes are known to be associated with all different forms of retinal disorders. The enormous genetic heterogeneity of this group of diseases has posedmany challenges in understanding the mechanisms of disease and in developing suitable therapies. Therapeutic avenues that are being investigated for these disorders include gene therapy to replace the defective gene, treatment with neurotrophic factors to stimulate the growth of photoreceptors, cell replacement therapy, and prosthetic devices that can capture light and transmit electrical signals through retinal neurons to the brain. Several of these are in process of human trials in patients, and have shown safety and efficacy of the treatment. A combination of approaches that involve both gene replacement and cell replacement may be required for optimum benefit.
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Ebermann, Inga; Scholl, Hendrik P N; Charbel Issa, Peter; Becirovic, Elvir; Lamprecht, Jürgen; Jurklies, Bernhard; Millán, José M; Aller, Elena; Mitter, Diana; Bolz, Hanno
2007-04-01
Usher syndrome is an autosomal recessive condition characterized by sensorineural hearing loss, variable vestibular dysfunction, and visual impairment due to retinitis pigmentosa (RP). The seven proteins that have been identified for Usher syndrome type 1 (USH1) and type 2 (USH2) may interact in a large protein complex. In order to identify novel USH genes, we followed a candidate strategy, assuming that mutations in proteins interacting with this "USH network" may cause Usher syndrome as well. The DFNB31 gene encodes whirlin, a PDZ scaffold protein with expression in both hair cell stereocilia and retinal photoreceptor cells. Whirlin represents an excellent candidate for USH2 because it binds to Usherin (USH2A) and VLGR1b (USH2C). Genotyping of microsatellite markers specific for the DFNB31 gene locus on chromosome 9q32 was performed in a German USH2 family that had been excluded for all known USH loci. Patients showed common haplotypes. Sequence analysis of DFNB31 revealed compound heterozygosity for a nonsense mutation, p.Q103X, in exon 1, and a mutation in the splice donor site of exon 2, c.837+1G>A. DFNB31 mutations appear to be a rare cause of Usher syndrome, since no mutations were identified in an additional 96 USH2 patients. While mutations in the C-terminal half of whirlin have previously been reported in non-syndromic deafness (DFNB31), both alterations identified in our USH2 family affect the long protein isoform. We propose that mutations causing Usher syndrome are probably restricted to exons 1-6 that are specific for the long isoform and probably crucial for retinal function. We describe a novel genetic subtype for Usher syndrome, which we named USH2D and which is caused by mutations in whirlin. Moreover, this is the first case of USH2 that is allelic to non-syndromic deafness.
PlGF gene knockdown in human retinal pigment epithelial cells.
Akrami, Hassan; Soheili, Zahra-Soheila; Sadeghizadeh, Majid; Ahmadieh, Hamid; Rezaeikanavi, Mozhgan; Samiei, Shahram; Khalooghi, Keynoush
2011-04-01
To evaluate the knockdown of placental growth factor (PlGF) gene expression in human retinal pigment epithelium (RPE) cells and its effect on cell proliferation, apoptosis and angiogenic potential of RPE cells. Human RPE cells were isolated by dispase I solution and cultured in DMEM/F12 supplemented with 10% fetal calf serum (FCS). A small interfering RNA (siRNA) corresponding to PlGF mRNA and a scrambled siRNA (scRNA) were introduced into the cells. Cell proliferation and cell death were examined by ELISA. PlGF mRNA and protein were quantified by real-time polymerase chain reaction (PCR) and western blot. The levels of gene expression for human retinal pigment epithelium-specific protein 65 kDa (RPE65), cellular retinaldehyde-binding protein (CRALBP) and tyrosinase were examined by real-time PCR. The angiogenic activity of RPE cell-derived conditioned media was assayed by a tube formation assay using human umbilical vein endothelial cells (HUVECs). At a final siRNA concentration of 20 pmol/ml, the transfection efficiency was about 80%. The amount of PlGF transcripts was reduced to 10% after 36 h of incubation, and the amount of PlGF protein in culture supernatant was significantly decreased. Suppression of PlGF gene had no effect on RPE cell proliferation and survival, and there were no notable changes in the transcript levels of RPE65, CRALBP or tyrosinase for the cultures treated by siRNA cognate to PlGF. Vascular tube formation was efficiently reduced in HUVECs. Our findings present PlGF as a key modulator of angiogenic potential in RPE cells of the human retina.
Huang, Xiangjun; Yuan, Lamei; Xu, Hongbo; Zheng, Wen; Cao, Yanna; Yi, Junhui; Guo, Yi; Yang, Zhijian; Li, Yu; Deng, Hao
2018-02-05
Retinitis pigmentosa (RP) is a group of hereditary, degenerative retinal disorders characterized by progressive retinal dysfunction, outer retina cell loss, and retinal tissue atrophy. It eventually leads to tunnel vision and legal, or total blindness. Here we aimed to reveal the causal gene and mutation contributing to the development of autosomal recessive RP (arRP) in a consanguineous family. A novel homozygous mutation, c.4845delT (p.K1616Rfs*46), in the ATP-binding cassette subfamily A member 4gene ( ABCA4 ) was identified. It may reduce ABCA4 protein activity, leading to progressive degeneration of both rod and cone photoreceptors. The study extends the arRP genotypic spectrum and confirms a genotype-phenotype relationship. This study may also disclose some new clues for RP genetic causes and pathogenesis, as well as clinical and genetic diagnosis. The research findings may contribute to improvement in clinical care, therapy, genetic screening, and counseling. ©2018 The Author(s).
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Huet, R.A.C. van; Siemiatkowska, A.M.; Ozgul, R.K.; Yucel, D.; Hoyng, C.B.; Banin, E.; Blumenfeld, A.; Rotenstreich, Y.; Riemslag, F.C.; Hollander, A.I. den; Theelen, T.; Collin, R.W.J.; Born, L.I. van den; Klevering, B.J.
2015-01-01
PURPOSE: Defects in MAK, encoding a protein localized to the photoreceptor connecting cilium, have recently been associated with autosomal recessive retinitis pigmentosa (RP). The aim of this study is to describe our detailed clinical observations in patients with MAK-associated RP, including an
Mutation spectrum of the rhodopsin gene among patients with autosomal dominant retinitis pigmentosa
International Nuclear Information System (INIS)
Dryja, T.P.; Han, L.B.; Cowley, G.S.; McGee, T.L.; Berson, E.L.
1991-01-01
The authors searched for point mutations in every exon of the rhodopsin gene in 150 patients from separate families with autosomal dominant retinitis pigmentosa. Including the 4 mutations the authors reported previously, they found a total of 17 different mutations that correlate with the disease. Each of these mutations is a single-base substitution corresponding to a single amino acid substitution. Based on current models for the structure of rhodopsin, 3 of the 17 mutant amino acids are normally located on the cytoplasmic side of the protein, 6 in transmembrane domains, and 8 on the intradiscal side. Forty-three of the 150 patients (29%) carry 1 of these mutations, and no patient has more than 1 mutation. In every family with a mutation so far analyzed, the mutation cosegregates with the disease. They found one instance of a mutation in an affected patient that was absent in both unaffected parents (i.e., a new germ-line mutation), indicating that some isolate cases of retinitis pigmentosa carry a mutation of the rhodopsin gene
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Bauer, Bianca S; Forsyth, George W; Sandmeyer, Lynne S; Grahn, Bruce H
2011-04-01
Mitochondrial transcription factor A (Tfam) has been implicated in the pathogenesis of retinal dysplasia in miniature schnauzer dogs and it has been proposed that affected dogs have altered mitochondrial numbers, size, and morphology. To test these hypotheses the Tfam gene of affected and normal miniature schnauzer dogs with retinal dysplasia was sequenced and lymphocyte mitochondria were quantified, measured, and the morphology was compared in normal and affected dogs using transmission electron microscopy. For Tfam sequencing, retina, retinal pigment epithelium (RPE), and whole blood samples were collected. Total RNA was isolated from the retina and RPE and reverse transcribed to make cDNA. Genomic DNA was extracted from white blood cell pellets obtained from the whole blood samples. The Tfam coding sequence, 5' promoter region, intron1 and the 3' non-coding sequence of normal and affected dogs were amplified using polymerase chain reaction (PCR), cloned and sequenced. For electron microscopy, lymphocytes from affected and normal dogs were photographed and the mitochondria within each cross-section were identified, quantified, and the mitochondrial area (μm²) per lymphocyte cross-section was calculated. Lastly, using a masked technique, mitochondrial morphology was compared between the 2 groups. Sequencing of the miniature schnauzer Tfam gene revealed no functional sequence variation between affected and normal dogs. Lymphocyte and mitochondrial area, mitochondrial quantification, and morphology assessment also revealed no significant difference between the 2 groups. Further investigation into other candidate genes or factors causing retinal dysplasia in the miniature schnauzer is warranted.
Directory of Open Access Journals (Sweden)
Li eJiang
2014-04-01
Full Text Available RNA interference (RNAi knockdown is an efficacious therapeutic strategy for silencing genes causative for dominant retinal dystrophies. To test this, we used self-complementary (sc AAV2/8 vector to develop an RNAi-based therapy in two dominant retinal degeneration mouse models. The allele-specific model expresses transgenic bovine GCAP1(Y99C establishing a rapid RP-like phenotype, whereas the nonallele-specific model expresses mouse GCAP1(L151F producing a slowly progressing cone/rod dystrophy (CORD. The late onset GCAP1(L151F-CORD mimics the dystrophy observed in human GCAP1-CORD patients. Subretinal injection of scAAV2/8 carrying shRNA expression cassettes specific for bovine or mouse GCAP1 showed strong expression at one week post-injection. In both allele-specific (GCAP1(Y99C-RP and nonallele-specific (GCAP1(L151F-CORD models of dominant retinal dystrophy, RNAi-mediated gene silencing enhanced photoreceptor survival, delayed onset of degeneration and improved visual function. Such results provide a proof of concept toward effective RNAi-based gene therapy mediated by scAAV2/8 for dominant retinal disease based on GCAP1 mutation. Further, nonallele-specific RNAi knockdown of GCAP1 may prove generally applicable toward the rescue of any human GCAP1-based dominant cone-rod dystrophy.
Yang, Hyun-Jin; Ratnapriya, Rinki; Cogliati, Tiziana; Kim, Jung-Woong; Swaroop, Anand
2015-05-01
Genomics and genetics have invaded all aspects of biology and medicine, opening uncharted territory for scientific exploration. The definition of "gene" itself has become ambiguous, and the central dogma is continuously being revised and expanded. Computational biology and computational medicine are no longer intellectual domains of the chosen few. Next generation sequencing (NGS) technology, together with novel methods of pattern recognition and network analyses, has revolutionized the way we think about fundamental biological mechanisms and cellular pathways. In this review, we discuss NGS-based genome-wide approaches that can provide deeper insights into retinal development, aging and disease pathogenesis. We first focus on gene regulatory networks (GRNs) that govern the differentiation of retinal photoreceptors and modulate adaptive response during aging. Then, we discuss NGS technology in the context of retinal disease and develop a vision for therapies based on network biology. We should emphasize that basic strategies for network construction and analyses can be transported to any tissue or cell type. We believe that specific and uniform guidelines are required for generation of genome, transcriptome and epigenome data to facilitate comparative analysis and integration of multi-dimensional data sets, and for constructing networks underlying complex biological processes. As cellular homeostasis and organismal survival are dependent on gene-gene and gene-environment interactions, we believe that network-based biology will provide the foundation for deciphering disease mechanisms and discovering novel drug targets for retinal neurodegenerative diseases. Published by Elsevier Ltd.
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
van Soest, S.; te Nijenhuis, S.; van den Born, L. I.; Bleeker-Wagemakers, E. M.; Sharp, E.; Sandkuijl, L. A.; Westerveld, A.; Bergen, A. A.
1996-01-01
In a previous study on a large pedigree from a genetically isolated population in the Netherlands, we localized a gene for autosomal recessive retinitis pigmentosa with paraarteriolar preservation of the retinal pigment epithelium (PPRPE) on the long arm of chromosome 1. In this study, we present an
Progressive retinal atrophy in Shetland sheepdog is associated with a mutation in the CNGA1 gene.
Wiik, A C; Ropstad, E O; Ekesten, B; Karlstam, L; Wade, C M; Lingaas, F
2015-10-01
Progressive retinal atrophy (PRA) is the collective name of a class of hereditary retinal dystrophies in the dog and is often described as the equivalent of retinitis pigmentosa in humans. PRA is characterized by visual impairment due to degeneration of the photoreceptors in the retina, usually leading to blindness. PRA has been reported in dogs from more than 100 breeds and can be genetically heterogeneous both between and within breeds. The disease can be subdivided by age at onset and rate of progression. Using genome-wide association with 15 Shetland Sheepdog (Sheltie) cases and 14 controls, we identified a novel PRA locus on CFA13 (Praw = 8.55 × 10(-7) , Pgenome = 1.7 × 10(-4) ). CNGA1, which is known to be involved in human cases of retinitis pigmentosa, was located within the associated region and was considered a likely candidate gene. Sequencing of this gene identified a 4-bp deletion in exon 9 (c.1752_1755delAACT), leading to a frameshift and a premature stop codon. The study indicated genetic heterogeneity as the mutation was present in all PRA-affected individuals in one large family of Shelties, whereas some other cases in the studied Sheltie population were not associated with this CNGA1 mutation. To our knowledge, this is the first report of a mutation in CNGA1 causing PRA in dogs. © 2015 Stichting International Foundation for Animal Genetics.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Directory of Open Access Journals (Sweden)
Charles W Higdon
Full Text Available In order to facilitate understanding of pigment cell biology, we developed a method to concomitantly purify melanocytes, iridophores, and retinal pigmented epithelium from zebrafish, and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co-enrichment in melanocytes and retinal pigmented epithelium, as well as in melanocytes and iridophores. We found 214 genes co-enriched in melanocytes and retinal pigmented epithelium, indicating the shared functions of melanin-producing cells. We found 62 genes significantly co-enriched in melanocytes and iridophores, illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine-based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate-limiting substrate for purine synthesis, phosphoribosyl pyrophosphate, thus constituting a guanine cycle. The purification procedure and expression analysis described here, along with the accompanying transcriptome-wide expression data, provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types, and will be a useful resource for further studies of pigment cell biology.
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
[To cognize retinitis pigmentosa with scientific view].
Li, Gen-lin
2009-03-01
Retinitis pigmentosa (RP) is the most common inherited eye disease that usually leads into blind, and is high simplex and clinical heterogeneity. Recent years, some new hereditary forms have been found, such as digenic RP, mitochondrial RP, incomplete dominant inheritance RP. The phenotype of RP is multiplicity. Incompatible phenomenon between genotype and phenotypes was shown in some genes such as peripherin/RDS, RHO, RP2 and RP3. The complicated phenotype was shown in the rare RP forms, such as centricity RP, stemma RP, retinitis pigmentosa sine pigmento, and retinal degeneration slow. Retinal transplantation, retinal implantation, drug and neurotrophic factor therapy, and gene therapy have been well studied worldwide and presented some hopeful efficacy. Ophthalmologists and practitioners should cognize the new advance and new knowledge on RP therapy with a scientific view for better serving the RP patients.
Stem Cell-Based Therapeutic Applications in Retinal Degenerative Diseases.
Huang Yiming; Enzmann Volker; Ildstad Suzanne T
2011-01-01
Retinal degenerative diseases that target photoreceptors or the adjacent retinal pigment epithelium (RPE) affect millions of people worldwide. Retinal degeneration (RD) is found in many different forms of retinal diseases including retinitis pigmentosa (RP), age-related macular degeneration (AMD), diabetic retinopathy, cataracts, and glaucoma. Effective treatment for retinal degeneration has been widely investigated. Gene-replacement therapy has been shown to improve visual function in inheri...
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Sanie-Jahromi, Fatemeh; Ahmadieh, Hamid; Soheili, Zahra-Soheila; Davari, Maliheh; Ghaderi, Shima; Kanavi, Mozhgan Rezaei; Samiei, Shahram; Deezagi, Abdolkhalegh; Pakravesh, Jalil; Bagheri, Abouzar
2012-04-10
Retinal progenitor cells are a convenient source of cell replacement therapy in retinal degenerative disorders. The purpose of this study was to evaluate the expression patterns of the homeobox genes PAX6 and CHX10 (retinal progenitor markers) during treatment of human retinal pigment epithelium (RPE) cells with amniotic fluid (AF), RPE cells harvested from neonatal cadaver globes were cultured in a mixture of DMEM and Ham's F12 supplemented with 10% FBS. At different passages, cells were trypsinized and co-cultured with 30% AF obtained from normal fetuses of 1416 weeks gestational age. Compared to FBS-treated controls, AF-treated cultures exhibited special morphological changes in culture, including appearance of spheroid colonies, improved initial cell adhesion and ordered cell alignment. Cell proliferation assays indicated a remarkable increase in the proliferation rate of RPE cells cultivated in 30% AF-supplemented medium, compared with those grown in the absence of AF. Immunocytochemical analyses exhibited nuclear localization of retinal progenitor markers at a ratio of 33% and 27% for CHX10 and PAX6, respectively. This indicated a 3-fold increase in retinal progenitor markers in AF-treated cultures compared to FBS-treated controls. Real-time PCR data of retinal progenitor genes (PAX6, CHX10 and VSX-1) confirmed these results and demonstrated AF's capacity for promoting retinal progenitor cell generation. Taken together, the results suggest that AF significantly promotes the rate of retinal progenitor cell generation, indicating that AF can be used as an enriched supplement for serum-free media used for the in vitro propagation of human progenitor cells.
Neuman, Sarah D.; Bashirullah, Arash; Kumar, Justin P.
2016-01-01
The eyes absent (eya) gene of the fruit fly, Drosophila melanogaster, is a member of an evolutionarily conserved gene regulatory network that controls eye formation in all seeing animals. The loss of eya leads to the complete elimination of the compound eye while forced expression of eya in non-retinal tissues is sufficient to induce ectopic eye formation. Within the developing retina eya is expressed in a dynamic pattern and is involved in tissue specification/determination, cell proliferation, apoptosis, and cell fate choice. In this report we explore the mechanisms by which eya expression is spatially and temporally governed in the developing eye. We demonstrate that multiple cis-regulatory elements function cooperatively to control eya transcription and that spacing between a pair of enhancer elements is important for maintaining correct gene expression. Lastly, we show that the loss of eya expression in sine oculis (so) mutants is the result of massive cell death and a progressive homeotic transformation of retinal progenitor cells into head epidermis. PMID:27930646
Directory of Open Access Journals (Sweden)
Hamel Christian
2006-10-01
Full Text Available Abstract Retinitis pigmentosa (RP is an inherited retinal dystrophy caused by the loss of photoreceptors and characterized by retinal pigment deposits visible on fundus examination. Prevalence of non syndromic RP is approximately 1/4,000. The most common form of RP is a rod-cone dystrophy, in which the first symptom is night blindness, followed by the progressive loss in the peripheral visual field in daylight, and eventually leading to blindness after several decades. Some extreme cases may have a rapid evolution over two decades or a slow progression that never leads to blindness. In some cases, the clinical presentation is a cone-rod dystrophy, in which the decrease in visual acuity predominates over the visual field loss. RP is usually non syndromic but there are also many syndromic forms, the most frequent being Usher syndrome. To date, 45 causative genes/loci have been identified in non syndromic RP (for the autosomal dominant, autosomal recessive, X-linked, and digenic forms. Clinical diagnosis is based on the presence of night blindness and peripheral visual field defects, lesions in the fundus, hypovolted electroretinogram traces, and progressive worsening of these signs. Molecular diagnosis can be made for some genes, but is not usually performed due to the tremendous genetic heterogeneity of the disease. Genetic counseling is always advised. Currently, there is no therapy that stops the evolution of the disease or restores the vision, so the visual prognosis is poor. The therapeutic approach is restricted to slowing down the degenerative process by sunlight protection and vitaminotherapy, treating the complications (cataract and macular edema, and helping patients to cope with the social and psychological impact of blindness. However, new therapeutic strategies are emerging from intensive research (gene therapy, neuroprotection, retinal prosthesis.
A CTRP5 gene S163R mutation knock-in mouse model for late-onset retinal degeneration.
Chavali, Venkata R M; Khan, Naheed W; Cukras, Catherine A; Bartsch, Dirk-Uwe; Jablonski, Monica M; Ayyagari, Radha
2011-05-15
Late-onset retinal macular degeneration (L-ORD) is an autosomal dominant inherited disorder caused by a single missense mutation (S163R) in the CTRP5/C1QTNF5 protein. Early phenotypic features of L-ORD include: dark adaptation abnormalities, nyctalopia, and drusen deposits in the peripheral macular region. Apart from posterior segment abnormalities, these patients also develop abnormally long anterior lens zonules. In the sixth decade of life the rod and cone function declines, accompanied by electroretinogram (ERG) abnormalities. Some patients also develop choroidal neovascularization and glaucoma. In order to understand the disease pathology and mechanisms involved in retinal dystrophy, we generated a knock-in (Ctrp5(+/-)) mouse model carrying the disease-associated mutation in the mouse Ctrp5/C1QTNF5 gene. These mice develop slower rod-b wave recovery consistent with early dark adaptation abnormalities, accumulation of hyperautofluorescence spots, retinal pigment epithelium abnormalities, drusen, Bruch's membrane abnormalities, loss of photoreceptors, and retinal vascular leakage. The Ctrp5(+/-) mice, which have most of the pathological features of age-related macular degeneration, are unique and may serve as a valuable model both to understand the molecular pathology of late-onset retinal degeneration and to evaluate therapies.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
High Myopia Caused by a Mutation in LEPREL1, Encoding Prolyl 3-Hydroxylase 2
Mordechai, Shikma; Gradstein, Libe; Pasanen, Annika; Ofir, Rivka; El Amour, Khalil; Levy, Jaime; Belfair, Nadav; Lifshitz, Tova; Joshua, Sara; Narkis, Ginat; Elbedour, Khalil; Myllyharju, Johanna; Birk, Ohad S.
2011-01-01
Autosomal-recessive high-grade axial myopia was diagnosed in Bedouin Israeli consanguineous kindred. Some affected individuals also had variable expressivity of early-onset cataracts, peripheral vitreo-retinal degeneration, and secondary sight loss due to severe retinal detachments. Through genome-wide linkage analysis, the disease-associated gene was mapped to ∼1.7 Mb on chromosome 3q28 (the maximum LOD score was 11.5 at θ = 0 for marker D3S1314). Sequencing of the entire coding regions and intron-exon boundaries of the six genes within the defined locus identified a single mutation (c.1523G>T) in exon 10 of LEPREL1, encoding prolyl 3-hydroxylase 2 (P3H2), a 2-oxoglutarate-dependent dioxygenase that hydroxylates collagens. The mutation affects a glycine that is conserved within P3H isozymes. Analysis of wild-type and p.Gly508Val (c.1523G>T) mutant recombinant P3H2 polypeptides expressed in insect cells showed that the mutation led to complete inactivation of P3H2. PMID:21885030
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Directory of Open Access Journals (Sweden)
Sanie-Jahromi Fatemeh
2012-04-01
Full Text Available Abstract Background Retinal progenitor cells are a convenient source of cell replacement therapy in retinal degenerative disorders. The purpose of this study was to evaluate the expression patterns of the homeobox genes PAX6 and CHX10 (retinal progenitor markers during treatment of human retinal pigment epithelium (RPE cells with amniotic fluid (AF, RPE cells harvested from neonatal cadaver globes were cultured in a mixture of DMEM and Ham's F12 supplemented with 10% FBS. At different passages, cells were trypsinized and co-cultured with 30% AF obtained from normal fetuses of 1416 weeks gestational age. Results Compared to FBS-treated controls, AF-treated cultures exhibited special morphological changes in culture, including appearance of spheroid colonies, improved initial cell adhesion and ordered cell alignment. Cell proliferation assays indicated a remarkable increase in the proliferation rate of RPE cells cultivated in 30% AF-supplemented medium, compared with those grown in the absence of AF. Immunocytochemical analyses exhibited nuclear localization of retinal progenitor markers at a ratio of 33% and 27% for CHX10 and PAX6, respectively. This indicated a 3-fold increase in retinal progenitor markers in AF-treated cultures compared to FBS-treated controls. Real-time PCR data of retinal progenitor genes (PAX6, CHX10 and VSX-1 confirmed these results and demonstrated AF's capacity for promoting retinal progenitor cell generation. Conclusion Taken together, the results suggest that AF significantly promotes the rate of retinal progenitor cell generation, indicating that AF can be used as an enriched supplement for serum-free media used for the in vitro propagation of human progenitor cells.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
PDZD7 is a modifier of retinal disease and a contributor to digenic Usher syndrome
Ebermann, Inga; Phillips, Jennifer B.; Liebau, Max C.; Koenekoop, Robert K.; Schermer, Bernhard; Lopez, Irma; Schäfer, Ellen; Roux, Anne-Francoise; Dafinger, Claudia; Bernd, Antje; Zrenner, Eberhart; Claustres, Mireille; Blanco, Bernardo; Nürnberg, Gudrun; Nürnberg, Peter; Ruland, Rebecca; Westerfield, Monte; Benzing, Thomas; Bolz, Hanno J.
2010-01-01
Usher syndrome is a genetically heterogeneous recessive disease characterized by hearing loss and retinitis pigmentosa (RP). It frequently presents with unexplained, often intrafamilial, variability of the visual phenotype. Although 9 genes have been linked with Usher syndrome, many patients do not have mutations in any of these genes, suggesting that there are still unidentified genes involved in the syndrome. Here, we have determined that mutations in PDZ domain–containing 7 (PDZD7), which encodes a homolog of proteins mutated in Usher syndrome subtype 1C (USH1C) and USH2D, contribute to Usher syndrome. Mutations in PDZD7 were identified only in patients with mutations in other known Usher genes. In a set of sisters, each with a homozygous mutation in USH2A, a frame-shift mutation in PDZD7 was present in the sister with more severe RP and earlier disease onset. Further, heterozygous PDZD7 mutations were present in patients with truncating mutations in USH2A, G protein–coupled receptor 98 (GPR98; also known as USH2C), and an unidentified locus. We validated the human genotypes using zebrafish, and our findings were consistent with digenic inheritance of PDZD7 and GPR98, and with PDZD7 as a retinal disease modifier in patients with USH2A. Pdzd7 knockdown produced an Usher-like phenotype in zebrafish, exacerbated retinal cell death in combination with ush2a or gpr98, and reduced Gpr98 localization in the region of the photoreceptor connecting cilium. Our data challenge the view of Usher syndrome as a traditional Mendelian disorder and support the reclassification of Usher syndrome as an oligogenic disease. PMID:20440071
PDZD7 is a modifier of retinal disease and a contributor to digenic Usher syndrome.
Ebermann, Inga; Phillips, Jennifer B; Liebau, Max C; Koenekoop, Robert K; Schermer, Bernhard; Lopez, Irma; Schäfer, Ellen; Roux, Anne-Francoise; Dafinger, Claudia; Bernd, Antje; Zrenner, Eberhart; Claustres, Mireille; Blanco, Bernardo; Nürnberg, Gudrun; Nürnberg, Peter; Ruland, Rebecca; Westerfield, Monte; Benzing, Thomas; Bolz, Hanno J
2010-06-01
Usher syndrome is a genetically heterogeneous recessive disease characterized by hearing loss and retinitis pigmentosa (RP). It frequently presents with unexplained, often intrafamilial, variability of the visual phenotype. Although 9 genes have been linked with Usher syndrome, many patients do not have mutations in any of these genes, suggesting that there are still unidentified genes involved in the syndrome. Here, we have determined that mutations in PDZ domain-containing 7 (PDZD7), which encodes a homolog of proteins mutated in Usher syndrome subtype 1C (USH1C) and USH2D, contribute to Usher syndrome. Mutations in PDZD7 were identified only in patients with mutations in other known Usher genes. In a set of sisters, each with a homozygous mutation in USH2A, a frame-shift mutation in PDZD7 was present in the sister with more severe RP and earlier disease onset. Further, heterozygous PDZD7 mutations were present in patients with truncating mutations in USH2A, G protein-coupled receptor 98 (GPR98; also known as USH2C), and an unidentified locus. We validated the human genotypes using zebrafish, and our findings were consistent with digenic inheritance of PDZD7 and GPR98, and with PDZD7 as a retinal disease modifier in patients with USH2A. Pdzd7 knockdown produced an Usher-like phenotype in zebrafish, exacerbated retinal cell death in combination with ush2a or gpr98, and reduced Gpr98 localization in the region of the photoreceptor connecting cilium. Our data challenge the view of Usher syndrome as a traditional Mendelian disorder and support the reclassification of Usher syndrome as an oligogenic disease.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Macular xanthophylls, lipoprotein-related genes, and age-related macular degeneration.
Koo, Euna; Neuringer, Martha; SanGiovanni, John Paul
2014-07-01
Plant-based macular xanthophylls (MXs; lutein and zeaxanthin) and the lutein metabolite meso-zeaxanthin are the major constituents of macular pigment, a compound concentrated in retinal areas that are responsible for fine-feature visual sensation. There is an unmet need to examine the genetics of factors influencing regulatory mechanisms and metabolic fates of these 3 MXs because they are linked to processes implicated in the pathogenesis of age-related macular degeneration (AMD). In this work we provide an overview of evidence supporting a molecular basis for AMD-MX associations as they may relate to DNA sequence variation in AMD- and lipoprotein-related genes. We recognize a number of emerging research opportunities, barriers, knowledge gaps, and tools offering promise for meaningful investigation and inference in the field. Overviews on AMD- and high-density lipoprotein (HDL)-related genes encoding receptors, transporters, and enzymes affecting or affected by MXs are followed with information on localization of products from these genes to retinal cell types manifesting AMD-related pathophysiology. Evidence on the relation of each gene or gene product with retinal MX response to nutrient intake is discussed. This information is followed by a review of results from mechanistic studies testing gene-disease relations. We then present findings on relations of AMD with DNA sequence variants in MX-associated genes. Our conclusion is that AMD-associated DNA variants that influence the actions and metabolic fates of HDL system constituents should be examined further for concomitant influence on MX absorption, retinal tissue responses to MX intake, and the capacity to modify MX-associated factors and processes implicated in AMD pathogenesis. © 2014 American Society for Nutrition.
Biology and therapy of inherited retinal degenerative disease: insights from mouse models
Veleri, Shobi; Lazar, Csilla H.; Chang, Bo; Sieving, Paul A.; Banin, Eyal; Swaroop, Anand
2015-01-01
Retinal neurodegeneration associated with the dysfunction or death of photoreceptors is a major cause of incurable vision loss. Tremendous progress has been made over the last two decades in discovering genes and genetic defects that lead to retinal diseases. The primary focus has now shifted to uncovering disease mechanisms and designing treatment strategies, especially inspired by the successful application of gene therapy in some forms of congenital blindness in humans. Both spontaneous and laboratory-generated mouse mutants have been valuable for providing fundamental insights into normal retinal development and for deciphering disease pathology. Here, we provide a review of mouse models of human retinal degeneration, with a primary focus on diseases affecting photoreceptor function. We also describe models associated with retinal pigment epithelium dysfunction or synaptic abnormalities. Furthermore, we highlight the crucial role of mouse models in elucidating retinal and photoreceptor biology in health and disease, and in the assessment of novel therapeutic modalities, including gene- and stem-cell-based therapies, for retinal degenerative diseases. PMID:25650393
Vergara, M Natalia; Gutierrez, Christian; O'Brien, David R; Canto-Soler, M Valeria
2013-04-01
Primary retinal cultures constitute valuable tools not only for basic research on retinal cell development and physiology, but also for the identification of factors or drugs that promote cell survival and differentiation. In order to take full advantage of the benefits of this system it is imperative to develop efficient and reliable techniques for the manipulation of gene expression. However, achieving appropriate transfection efficiencies in these cultures has remained challenging. The purpose of this work was to develop and optimize a technique that would allow the transfection of chick retinal cells with high efficiency and reproducibility for multiple applications. We developed an ex vivo electroporation method applied to dissociated retinal cell cultures that offers a significant improvement over other currently available transfection techniques, increasing efficiency by five-fold. In this method, eyes were enucleated, devoid of RPE, and electroporated with GFP-encoding plasmids using custom-made electrodes. Electroporated retinas were then dissociated into single cells and plated in low density conditions, to be analyzed after 4 days of incubation. Parameters such as voltage and number of electric pulses, as well as plasmid concentration and developmental stage of the animal were optimized for efficiency. The characteristics of the cultures were assessed by morphology and immunocytochemistry, and cell viability was determined by ethidium homodimer staining. Cell imaging and counting was performed using an automated high-throughput system. This procedure resulted in transfection efficiencies in the order of 22-25% of cultured cells, encompassing both photoreceptors and non-photoreceptor neurons, and without affecting normal cell survival and differentiation. Finally, the feasibility of the technique for cell-autonomous studies of gene function in a biologically relevant context was tested by carrying out gain and loss-of-function experiments for the
Pharmacology of Myopia and Potential Role for Intrinsic Retinal Circadian Rhythms
Stone, Richard A.; Pardue, Machelle T.; Iuvone, P. Michael; Khurana, Tejvir S.
2013-01-01
; these rhythms shift in eyes developing experimental ametropia. Long-standing clinical ideas about myopia in particular have postulated a role for ambient lighting, although molecular or cellular mechanisms for these speculations have remained obscure. Experimental myopia induced by the wearing of a concave spectacle lens alters the retinal expression of a significant proportion of intrinsic circadian clock genes, as well as genes encoding a melatonin receptor and the photopigment melanopsin. Together this evidence suggests a hypothesis that the retinal clock and intrinsic retinal circadian rhythms may be fundamental to the mechanism(s) regulating refractive development, and that disruptions in circadian signals may produce refractive errors. Here we review the potential role of biological rhythms in refractive development. While much future research is needed, this hypothesis could unify many of the disparate clinical and laboratory observations addressing the pathogenesis of refractive errors. PMID:23313151
Autosomal recessive retinitis pigmentosa caused by mutations in the MAK gene.
Stone, Edwin M; Luo, Xunda; Héon, Elise; Lam, Byron L; Weleber, Richard G; Halder, Jennifer A; Affatigato, Louisa M; Goldberg, Jacqueline B; Sumaroka, Alexander; Schwartz, Sharon B; Cideciyan, Artur V; Jacobson, Samuel G
2011-12-28
To determine the disease expression in autosomal recessive (ar) retinitis pigmentosa (RP) caused by mutations in the MAK (male germ cell-associated kinase) gene. Patients with RP and MAK gene mutations (n = 24; age, 32-77 years at first visit) were studied by ocular examination, perimetry, and optical coherence tomography (OCT). All but one MAK patient were homozygous for an identical truncating mutation in exon 9 and had Ashkenazi Jewish heritage. The carrier frequency of this mutation among 1207 unrelated Ashkenazi control subjects was 1 in 55, making it the most common cause of heritable retinal disease in this population and MAK-associated RP the sixth most common Mendelian disease overall in this group. Visual acuities could be normal into the eighth decade of life. Kinetic fields showed early loss in the superior-temporal quadrant. With more advanced disease, superior and midperipheral function was lost, but the nasal field remained. Only a central island was present at late stages. Pigmentary retinopathy was less prominent in the superior nasal quadrant. Rod-mediated vision was abnormal but detectable in the residual field; all patients had rod>cone dysfunction. Photoreceptor layer thickness was normal centrally but decreased with eccentricity. At the stages studied, there was no evidence of photoreceptor ciliary elongation. The patterns of disease expression in the MAK form of arRP showed some resemblance to patterns described in autosomal dominant RP, especially the form caused by RP1 mutations. The similarity in phenotypes is of interest, considering that there is experimental evidence of interaction between Mak and RP1 in the photoreceptor cilium.
A characteristic phenotypic retinal appearance in Norrie disease.
Drenser, Kimberly A; Fecko, Alice; Dailey, Wendy; Trese, Michael T
2007-02-01
To describe a striking retinal finding that the authors have only seen in Norrie disease eyes and to determine if a particular genotype corresponds to this dramatic presentation. This is a retrospective, interventional case report of four patients seen in the clinic over a 1-year period. All patients had analysis of the Norrie gene by direct sequencing. All patients presented with a similar retinal appearance of dense stalk tissue, globular dystrophic retina, and peripheral avascular retina with pigmentary changes. Each patient was found to have a mutation in the Norrie gene affecting a cystine residue in the cystine knot domain. The mutations are predicted to disrupt the structure of the protein product, norrin, which is required for activation of the Wnt receptor:beta-catenin pathway. No other vitreoretinopathy that the authors have seen demonstrates this characteristic retinal presentation of severe retinal dysplasia. All four patients were found to have mutations in the Norrie gene which alter the cystine knot motif. Mutations affecting this domain appear to have devastating effects on retinal development and indicate phenotype correlates with mutations affecting the cystine knot domain.
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
Sharif, Ali Sakawa
Inherited retinal degenerative diseases (IRD) are a group of disorders that lead to progressive deterioration of mainly the photoreceptors. Retinitis pigmentosa (RP) and cone-rod dystrophy (CRD) are two forms of IRDs. RP is the most common form of IRD and is due to rod photoreceptor degeneration followed by cone photoreceptor loss. CRD, on the other hand, is characterized by the loss of cones or the concurrent degeneration of both cones and rods. Both RP and CRD are presently incurable. More than 200 genes have been identified to cause IRDs and the functions of many of these genes remain unclear. Mutations in a novel gene, C8ORF37, were identified to cause recessive, severe, and early-onset RP and CRD. I, therefore, pioneered in characterizing the role of C8ORF37 in the retina. This dissertation is comprised of four chapters that is organized as follows: (1) summary of an ocular disorder (2) a genetic model of a retinal disorder (3) biochemical/proteomic analysis of C8ORF37 (4) potential clinical applications. A summary of ocular disorders is discussed in Chapter 1, with an emphasis on CRD. Chapter 2 focuses on the generation and characterization of C8orf37 mutant mouse models that recapitulate the retinal pathologies observed in human patients. In C8orf37 knockout retinas, the outer segment (OS) was nonuniform, swollen, and wider in width when compared to the controls. Moreover, many OS membrane proteins were reduced in the retina of C8orf37 knockout, including CNGB1 and RDS, proteins essential for OS disc morphogenesis and alignment. Our findings shed new light on the pathogenesis underlying retinal dysfunction and degeneration in C8ORF37-deficient patients. To determine the function of a novel protein, a powerful approach is by identifying its binding partners. In Chapter 3, I discuss GST pull-down using bovine retinal lysates, yeast-two-hybrid, and immunoprecipitation with mouse retinal lysate in order to identify C8ORF37-interacting proteins. Our pull
Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa
García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J.; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M.
2014-01-01
Purpose The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. Methods The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was...
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
Booij, J. C.; Florijn, R. J.; ten Brink, J. B.; Loves, W.; Meire, F.; van Schooneveld, M. J.; de Jong, P. T. V. M.; Bergen, A. A. B.
2005-01-01
OBJECTIVE: To identify mutations in the AIPL1, CRB1, GUCY2D, RPE65, and RPGRIP1 genes in patients with juvenile retinitis pigmentosa. METHODS: Mutation analysis was carried out in a group of 35 unrelated patients with juvenile autosomal recessive retinitis pigmentosa (ARRP), Leber's congenital
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Macular xanthophylls, lipoprotein-related genes, and age-related macular degeneration1234
Koo, Euna; Neuringer, Martha; SanGiovanni, John Paul
2014-01-01
Plant-based macular xanthophylls (MXs; lutein and zeaxanthin) and the lutein metabolite meso-zeaxanthin are the major constituents of macular pigment, a compound concentrated in retinal areas that are responsible for fine-feature visual sensation. There is an unmet need to examine the genetics of factors influencing regulatory mechanisms and metabolic fates of these 3 MXs because they are linked to processes implicated in the pathogenesis of age-related macular degeneration (AMD). In this work we provide an overview of evidence supporting a molecular basis for AMD-MX associations as they may relate to DNA sequence variation in AMD- and lipoprotein-related genes. We recognize a number of emerging research opportunities, barriers, knowledge gaps, and tools offering promise for meaningful investigation and inference in the field. Overviews on AMD- and high-density lipoprotein (HDL)–related genes encoding receptors, transporters, and enzymes affecting or affected by MXs are followed with information on localization of products from these genes to retinal cell types manifesting AMD-related pathophysiology. Evidence on the relation of each gene or gene product with retinal MX response to nutrient intake is discussed. This information is followed by a review of results from mechanistic studies testing gene-disease relations. We then present findings on relations of AMD with DNA sequence variants in MX-associated genes. Our conclusion is that AMD-associated DNA variants that influence the actions and metabolic fates of HDL system constituents should be examined further for concomitant influence on MX absorption, retinal tissue responses to MX intake, and the capacity to modify MX-associated factors and processes implicated in AMD pathogenesis. PMID:24829491
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Biology and therapy of inherited retinal degenerative disease: insights from mouse models
Directory of Open Access Journals (Sweden)
Shobi Veleri
2015-02-01
Full Text Available Retinal neurodegeneration associated with the dysfunction or death of photoreceptors is a major cause of incurable vision loss. Tremendous progress has been made over the last two decades in discovering genes and genetic defects that lead to retinal diseases. The primary focus has now shifted to uncovering disease mechanisms and designing treatment strategies, especially inspired by the successful application of gene therapy in some forms of congenital blindness in humans. Both spontaneous and laboratory-generated mouse mutants have been valuable for providing fundamental insights into normal retinal development and for deciphering disease pathology. Here, we provide a review of mouse models of human retinal degeneration, with a primary focus on diseases affecting photoreceptor function. We also describe models associated with retinal pigment epithelium dysfunction or synaptic abnormalities. Furthermore, we highlight the crucial role of mouse models in elucidating retinal and photoreceptor biology in health and disease, and in the assessment of novel therapeutic modalities, including gene- and stem-cell-based therapies, for retinal degenerative diseases.
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
Ratbi, Ilham; Jaouad, Imane Cherkaoui; Elorch, Hamza; Al-Sheqaih, Nada; Elalloussi, Mustapha; Lyahyai, Jaber; Berraho, Amina; Newman, William G; Sefiani, Abdelaziz
2016-10-01
Heimler syndrome (HS) is a rare recessive disorder characterized by sensorineural hearing loss (SNHL), amelogenesis imperfecta, nail abnormalities, and occasional or late-onset retinal pigmentation. It is the mildest form known to date of peroxisome biogenesis disorder caused by hypomorphic mutations of PEX1 and PEX6 genes. We report on a second Moroccan family with Heimler syndrome with early onset, severe visual impairment and important phenotypic overlap with Usher syndrome. The patient carried a novel homozygous missense variant c.3140T > C (p.Leu1047Pro) of PEX1 gene. As standard biochemical screening of blood for evidence of a peroxisomal disorder did not provide a diagnosis in the individuals with HS, patients with SNHL and retinal pigmentation should have mutation analysis of PEX1 and PEX6 genes. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
el-Amraoui, A; Sahly, I; Picaud, S; Sahel, J; Abitbol, M; Petit, C
1996-08-01
Usher syndrome type 1 (USH1) associates severe congenital deafness, vestibular dysfunction and progressive retinitis pigmentosa leading to blindness. The gene encoding myosin VIIA is responsible for USH1B. Mutations in the murine orthologous gene lead to the shaker-1 phenotype, which manifests cochlear and vestibular dysfunction, without any retinal defect. To address this phenotypic discrepancy, the expression of myosin VIIA in retinal cells was analyzed in human and mouse during embryonic development and adult life. In the human embryo, myosin VIIA was present first in the pigment epithelium cells, and later in these cells as well as in the photoreceptor cells. In the adult human retina, myosin VIIA was present in both cell types. In contrast, in mouse, only pigment epithelium cells expressed the protein throughout development and adult life. Myosin VIIA was also found to be absent in the photoreceptor cells of other rodents (rat and guinea-pig), whereas these cells expressed the protein in amphibians, avians and primates. These observations suggest that retinitis pigmentosa of USH1B results from a primary rod and cone defect. The USH1B/shaker-1 paradigm illustrates a species-specific cell pattern of gene expression as a possible cause for the discrepancy between phenotypes involving defective orthologous genes in man and mouse. Interestingly, in the photoreceptor cells, myosin VIIA is mainly localized in the inner and base of outer segments as well as in the synaptic ending region where it is co-localized with the synaptic vesicles. Therefore, we suggest that myosin VIIA might play a role in the trafficking of ribbon-synaptic vesicle complexes and the renewal processes of the outer photoreceptor disks.
Zobor, Ditta; Balousha, Ghassan; Baumann, Britta; Wissinger, Bernd
2014-01-01
Retinitis pigmentosa (RP) is a heterogenous group of inherited retinal degenerations caused by mutations in at least 45 genes. Recently, the FAM161A gene was identified as the causative gene for RP28, an autosomal recessive form of RP. We performed a clinical and molecular genetic study of a consanguineous Palestinian family with two three siblings affected with retinitis pigmentosa. DNA samples were collected from the index patient, his father, his affected sister, and two non-affected brothers. DNA sample from the index was subjected to high resolution genome-wide SNP array. Assuming identity-by-descent in this consanguineous family we applied homozygosity mapping to identify disease causing genes. The index patient reported night blindness since the age of 20 years, followed by moderate disease progression with decrease of peripheral vision, the development of photophobia and later on reduced central vision. At the age of 40 his visual acuity was counting fingers (CF) for both eyes, color discrimination was not possible and his visual fields were severely constricted. Funduscopic examination revealed a typical appearance of advanced RP with optic disc pallor, narrowed retinal vessels, bone-spicule like pigmentary changes in the mid-periphery and atrophic changes in the macula. His younger affected brother (37 years) was reported with overall milder symptoms, while the youngest sister (21 years) reported problems only with night vision. Applying high-density SNP arrays we identified several homozygous genomic regions one of which included the recently identified FAM161A gene mutated in RP28-linked autosomal recessive RP. Sequencing analysis revealed the presence of a novel homozygous nonsense mutation, c.1003C>T/p.R335X in the index patient and the affected sister. We identified an RP28-linked RP family in the Palestinian population caused by a novel nonsense mutation in FAM161A. RP in this family shows a typical disease onset with moderate to rapid progression
Genetic characterization and disease mechanism of retinitis pigmentosa; current scenario.
Ali, Muhammad Umar; Rahman, Muhammad Saif Ur; Cao, Jiang; Yuan, Ping Xi
2017-08-01
Retinitis pigmentosa is a group of genetically transmitted disorders affecting 1 in 3000-8000 individual people worldwide ultimately affecting the quality of life. Retinitis pigmentosa is characterized as a heterogeneous genetic disorder which leads by progressive devolution of the retina leading to a progressive visual loss. It can occur in syndromic (with Usher syndrome and Bardet-Biedl syndrome) as well as non-syndromic nature. The mode of inheritance can be X-linked, autosomal dominant or autosomal recessive manner. To date 58 genes have been reported to associate with retinitis pigmentosa most of them are either expressed in photoreceptors or the retinal pigment epithelium. This review focuses on the disease mechanisms and genetics of retinitis pigmentosa. As retinitis pigmentosa is tremendously heterogeneous disorder expressing a multiplicity of mutations; different variations in the same gene might induce different disorders. In recent years, latest technologies including whole-exome sequencing contributing effectively to uncover the hidden genesis of retinitis pigmentosa by reporting new genetic mutations. In future, these advancements will help in better understanding the genotype-phenotype correlations of disease and likely to develop new therapies.
[A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].
Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming
2003-01-01
To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.
Rivolta, Carlo; Sweklo, Elizabeth A.; Berson, Eliot L.; Dryja, Thaddeus P.
2000-01-01
Microdeletions Glu767(1-bp del), Thr967(1-bp del), and Leu1446(2-bp del) in the human USH2A gene have been reported to cause Usher syndrome type II, a disorder characterized by retinitis pigmentosa (RP) and mild-to-severe hearing loss. Each of these three frameshift mutations is predicted to lead to an unstable mRNA transcript that, if translated, would result in a truncated protein lacking the carboxy terminus. Here, we report Cys759Phe, a novel missense mutation in this gene that changes an...
Functional annotation of the human retinal pigment epithelium transcriptome
Directory of Open Access Journals (Sweden)
Gorgels Theo GMF
2009-04-01
Full Text Available Abstract Background To determine level, variability and functional annotation of gene expression of the human retinal pigment epithelium (RPE, the key tissue involved in retinal diseases like age-related macular degeneration and retinitis pigmentosa. Macular RPE cells from six selected healthy human donor eyes (aged 63–78 years were laser dissected and used for 22k microarray studies (Agilent technologies. Data were analyzed with Rosetta Resolver, the web tool DAVID and Ingenuity software. Results In total, we identified 19,746 array entries with significant expression in the RPE. Gene expression was analyzed according to expression levels, interindividual variability and functionality. A group of highly (n = 2,194 expressed RPE genes showed an overrepresentation of genes of the oxidative phosphorylation, ATP synthesis and ribosome pathways. In the group of moderately expressed genes (n = 8,776 genes of the phosphatidylinositol signaling system and aminosugars metabolism were overrepresented. As expected, the top 10 percent (n = 2,194 of genes with the highest interindividual differences in expression showed functional overrepresentation of the complement cascade, essential in inflammation in age-related macular degeneration, and other signaling pathways. Surprisingly, this same category also includes the genes involved in Bruch's membrane (BM composition. Among the top 10 percent of genes with low interindividual differences, there was an overrepresentation of genes involved in local glycosaminoglycan turnover. Conclusion Our study expands current knowledge of the RPE transcriptome by assigning new genes, and adding data about expression level and interindividual variation. Functional annotation suggests that the RPE has high levels of protein synthesis, strong energy demands, and is exposed to high levels of oxidative stress and a variable degree of inflammation. Our data sheds new light on the molecular composition of BM, adjacent to the
Selected Predictors Of Apoptosis In Retinitis Pigmentosa | Mahmoud ...
African Journals Online (AJOL)
Selected Predictors Of Apoptosis In Retinitis Pigmentosa. AAG Mahmoud, AA Abdel Azeem, AH Galal, BMA Bayoumi. Abstract. The genetics of non syndromic retinitis pigmentosa (RP) is complex with numerous gene mutations. An attempt to overcome each individual mutation provides an overwhelming challenge.
Rezanejad, Habib; Soheili, Zahra-Soheila; Haddad, Farhang; Matin, Maryam M; Samiei, Shahram; Manafi, Ali; Ahmadieh, Hamid
2014-04-01
The neural retina is subjected to various degenerative conditions. Regenerative stem-cell-based therapy holds great promise for treating severe retinal degeneration diseases, although many drawbacks remain to be overcome. One important problem is to gain authentically differentiated cells for replacement. Paired box 6 protein (5a) (PAX6 (5a)) is a highly conserved master control gene that has an essential role in the development of the vertebrate visual system. Human adipose-tissue-derived stem cell (hADSC) isolation was performed by using fat tissues and was confirmed by the differentiation potential of the cells into adipocytes and osteocytes and by their surface marker profile. The coding region of the human PAX6 (5a) gene isoform was cloned and lentiviral particles were propagated in HEK293T. The differentiation of hADSCs into retinal cells was characterized by morphological characteristics, quantitative real-time reverse transcription plus the polymerase chain reaction (qPCR) and immunocytochemistry (ICC) for some retinal cell-specific and retinal pigmented epithelial (RPE) cell-specific markers. hADSCs were successfully isolated. Flow cytometric analysis of surface markers indicated the high purity (~97 %) of isolated hADSCs. After 30 h of post-transduction, cells gradually showed the characteristic morphology of neuronal cells and small axon-like processes emerged. qPCR and ICC confirmed the differentiation of some neural retinal cells and RPE cells. Thus, PAX6 (5a) transcription factor expression, together with medium supplemented with fibronectin, is able to induce the differentiation of hADSCs into retinal progenitors, RPE cells and photoreceptors.
Applications of CRISPR/Cas9 in retinal degenerative diseases
Peng, Ying-Qian; Tang, Luo-Sheng; Yoshida, Shigeo; Zhou, Ye-Di
2017-01-01
Gene therapy is a potentially effective treatment for retinal degenerative diseases. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system has been developed as a new genome-editing tool in ophthalmic studies. Recent advances in researches showed that CRISPR/Cas9 has been applied in generating animal models as well as gene therapy in vivo of retinitis pigmentosa (RP) and leber congenital amaurosis (LCA). It has also been shown as a potential attempt for clinic by combining with other technologies such as adeno-associated virus (AAV) and induced pluripotent stem cells (iPSCs). In this review, we highlight the main points of further prospect of using CRISPR/Cas9 in targeting retinal degeneration. We also emphasize the potential applications of this technique in treating retinal degenerative diseases. PMID:28503441
CERKL knockdown causes retinal degeneration in zebrafish.
Directory of Open Access Journals (Sweden)
Marina Riera
Full Text Available The human CERKL gene is responsible for common and severe forms of retinal dystrophies. Despite intense in vitro studies at the molecular and cellular level and in vivo analyses of the retina of murine knockout models, CERKL function remains unknown. In this study, we aimed to approach the developmental and functional features of cerkl in Danio rerio within an Evo-Devo framework. We show that gene expression increases from early developmental stages until the formation of the retina in the optic cup. Unlike the high mRNA-CERKL isoform multiplicity shown in mammals, the moderate transcriptional complexity in fish facilitates phenotypic studies derived from gene silencing. Moreover, of relevance to pathogenicity, teleost CERKL shares the two main human protein isoforms. Morpholino injection has been used to generate a cerkl knockdown zebrafish model. The morphant phenotype results in abnormal eye development with lamination defects, failure to develop photoreceptor outer segments, increased apoptosis of retinal cells and small eyes. Our data support that zebrafish Cerkl does not interfere with proliferation and neural differentiation during early developmental stages but is relevant for survival and protection of the retinal tissue. Overall, we propose that this zebrafish model is a powerful tool to unveil CERKL contribution to human retinal degeneration.
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Light and inherited retinal degeneration
Paskowitz, D M; LaVail, M M; Duncan, J L
2006-01-01
Light deprivation has long been considered a potential treatment for patients with inherited retinal degenerative diseases, but no therapeutic benefit has been demonstrated to date. In the few clinical studies that have addressed this issue, the underlying mutations were unknown. Our rapidly expanding knowledge of the genes and mechanisms involved in retinal degeneration have made it possible to reconsider the potential value of light restriction in specific genetic contexts. This review summ...
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Portelli, Geoffrey; Barrett, John M; Hilgen, Gerrit; Masquelier, Timothée; Maccione, Alessandro; Di Marco, Stefano; Berdondini, Luca; Kornprobst, Pierre; Sernagor, Evelyne
2016-01-01
How a population of retinal ganglion cells (RGCs) encodes the visual scene remains an open question. Going beyond individual RGC coding strategies, results in salamander suggest that the relative latencies of a RGC pair encode spatial information. Thus, a population code based on this concerted spiking could be a powerful mechanism to transmit visual information rapidly and efficiently. Here, we tested this hypothesis in mouse by recording simultaneous light-evoked responses from hundreds of RGCs, at pan-retinal level, using a new generation of large-scale, high-density multielectrode array consisting of 4096 electrodes. Interestingly, we did not find any RGCs exhibiting a clear latency tuning to the stimuli, suggesting that in mouse, individual RGC pairs may not provide sufficient information. We show that a significant amount of information is encoded synergistically in the concerted spiking of large RGC populations. Thus, the RGC population response described with relative activities, or ranks, provides more relevant information than classical independent spike count- or latency- based codes. In particular, we report for the first time that when considering the relative activities across the whole population, the wave of first stimulus-evoked spikes is an accurate indicator of stimulus content. We show that this coding strategy coexists with classical neural codes, and that it is more efficient and faster. Overall, these novel observations suggest that already at the level of the retina, concerted spiking provides a reliable and fast strategy to rapidly transmit new visual scenes.
Intravitreal Injection of Splice-switching Oligonucleotides to Manipulate Splicing in Retinal Cells
Directory of Open Access Journals (Sweden)
Xavier Gérard
2015-01-01
Full Text Available Leber congenital amaurosis is a severe hereditary retinal dystrophy responsible for neonatal blindness. The most common disease-causing mutation (c.2991+1655A>G; 10–15% creates a strong splice donor site that leads to insertion of a cryptic exon encoding a premature stop codon. Recently, we reported that splice-switching oligonucleotides (SSO allow skipping of the mutant cryptic exon and the restoration of ciliation in fibroblasts of affected patients, supporting the feasibility of a SSO-mediated exon skipping strategy to correct the aberrant splicing. Here, we present data in the wild-type mouse, which demonstrate that intravitreal administration of 2’-OMePS-SSO allows selective alteration of Cep290 splicing in retinal cells, including photoreceptors as shown by successful alteration of Abca4 splicing using the same approach. We show that both SSOs and Cep290 skipped mRNA were detectable for at least 1 month and that intravitreal administration of oligonucleotides did not provoke any serious adverse event. These data suggest that intravitreal injections of SSO should be considered to bypass protein truncation resulting from the c.2991+1655A>G mutation as well as other truncating mutations in genes which like CEP290 or ABCA4 have a mRNA size that exceed cargo capacities of US Food and Drug Administration (FDA-approved adeno-associated virus (AAV-vectors, thus hampering gene augmentation therapy.
The Contribution of L-Type Cav1.3 Channels to Retinal Light Responses
Directory of Open Access Journals (Sweden)
Liheng Shi
2017-12-01
Full Text Available L-type voltage-gated calcium channels (LTCCs regulate tonic neurotransmitter release from sensory neurons including retinal photoreceptors. There are three types of LTCCs (Cav1.2, Cav1.3, and Cav1.4 expressed in the retina. While Cav1.2 is expressed in all retinal cells including the Müller glia and neurons, Cav1.3 and Cav1.4 are expressed in the retinal neurons with Cav1.4 exclusively expressed in the photoreceptor synaptic terminals. Mutations in the gene encoding Cav1.4 cause incomplete X-linked congenital stationary night blindness in humans. Even though Cav1.3 is present in the photoreceptor inner segments and the synaptic terminals in various vertebrate species, its role in vision is unclear, since genetic alterations in Cav1.3 are not associated with severe vision impairment in humans or in Cav1.3-null (Cav1.3−/− mice. However, a failure to regulate Cav1.3 was found in a mouse model of Usher syndrome, the most common cause of combined deafness and blindness in humans, indicating that Cav1.3 may contribute to retinal function. In this report, we combined physiological and morphological data to demonstrate the role of Cav1.3 in retinal physiology and function that has been undervalued thus far. Through ex vivo and in vivo electroretinogram (ERG recordings and immunohistochemical staining, we found that Cav1.3 plays a role in retinal light responses and synaptic plasticity. Pharmacological inhibition of Cav1.3 decreased ex vivo ERG a- and b-wave amplitudes. In Cav1.3−/− mice, their dark-adapted ERG a-, b-wave, and oscillatory potential amplitudes were significantly dampened, and implicit times were delayed compared to the wild type (WT. Furthermore, the density of ribbon synapses was reduced in the outer plexiform layer of Cav1.3−/− mice retinas. Hence, Cav1.3 plays a more prominent role in retinal physiology and function than previously reported.
The Contribution of L-Type Cav1.3 Channels to Retinal Light Responses.
Shi, Liheng; Chang, Janet Ya-An; Yu, Fei; Ko, Michael L; Ko, Gladys Y-P
2017-01-01
L-type voltage-gated calcium channels (LTCCs) regulate tonic neurotransmitter release from sensory neurons including retinal photoreceptors. There are three types of LTCCs (Ca v 1.2, Ca v 1.3, and Ca v 1.4) expressed in the retina. While Ca v 1.2 is expressed in all retinal cells including the Müller glia and neurons, Ca v 1.3 and Ca v 1.4 are expressed in the retinal neurons with Ca v 1.4 exclusively expressed in the photoreceptor synaptic terminals. Mutations in the gene encoding Ca v 1.4 cause incomplete X-linked congenital stationary night blindness in humans. Even though Ca v 1.3 is present in the photoreceptor inner segments and the synaptic terminals in various vertebrate species, its role in vision is unclear, since genetic alterations in Ca v 1.3 are not associated with severe vision impairment in humans or in Ca v 1.3-null (Ca v 1.3 -/- ) mice. However, a failure to regulate Ca v 1.3 was found in a mouse model of Usher syndrome, the most common cause of combined deafness and blindness in humans, indicating that Ca v 1.3 may contribute to retinal function. In this report, we combined physiological and morphological data to demonstrate the role of Ca v 1.3 in retinal physiology and function that has been undervalued thus far. Through ex vivo and in vivo electroretinogram (ERG) recordings and immunohistochemical staining, we found that Ca v 1.3 plays a role in retinal light responses and synaptic plasticity. Pharmacological inhibition of Ca v 1.3 decreased ex vivo ERG a- and b-wave amplitudes. In Ca v 1.3 -/- mice, their dark-adapted ERG a-, b-wave, and oscillatory potential amplitudes were significantly dampened, and implicit times were delayed compared to the wild type (WT). Furthermore, the density of ribbon synapses was reduced in the outer plexiform layer of Ca v 1.3 -/- mice retinas. Hence, Ca v 1.3 plays a more prominent role in retinal physiology and function than previously reported.
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
Overexpression of Snail in retinal pigment epithelial triggered epithelial–mesenchymal transition
International Nuclear Information System (INIS)
Li, Hui; Li, Min; Xu, Ding; Zhao, Chun; Liu, Guodong; Wang, Fang
2014-01-01
Highlights: • First reported overexpression of Snail in RPE cells could directly trigger EMT. • Further confirmed the regulator role of Snail in RPE cells EMT in vitro. • Snail may be a potential therapeutic target to prevent the fibrosis of PVR. - Abstract: Snail transcription factor has been implicated as an important regulator in epithelial–mesenchymal transition (EMT) during tumourigenesis and fibrogenesis. Our previous work showed that Snail transcription factor was activated in transforming growth factor β1 (TGF-β1) induced EMT in retinal pigment epithelial (RPE) cells and may contribute to the development of retinal fibrotic disease such as proliferative vitreoretinopathy (PVR). However, whether Snail alone has a direct role on retinal pigment epithelial–mesenchymal transition has not been investigated. Here, we analyzed the capacity of Snail to drive EMT in human RPE cells. A vector encoding Snail gene or an empty vector were transfected into human RPE cell lines ARPE-19 respectively. Snail overexpression in ARPE-19 cells resulted in EMT, which was characterized by the expected phenotypic transition from a typical epithelial morphology to mesenchymal spindle-shaped. The expression of epithelial markers E-cadherin and Zona occludin-1 (ZO-1) were down-regulated, whereas mesenchymal markers a-smooth muscle actin (a-SMA) and fibronectin were up-regulated in Snail expression vector transfected cells. In addition, ectopic expression of Snail significantly enhanced ARPE-19 cell motility and migration. The present data suggest that overexpression of Snail in ARPE-19 cells could directly trigger EMT. These results may provide novel insight into understanding the regulator role of Snail in the development of retinal pigment epithelial–mesenchymal transition
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa.
García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M
2014-01-01
The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was identified. We detected six large deletions involving USH2A in six out of the 40 cases studied. Three of the patients were homozygous for the deletion, and the remaining three were compound heterozygous with a previously identified USH2A point mutation. In five of these cases, the patients displayed Usher type 2, and the remaining case displayed nonsyndromic retinitis pigmentosa. The exact breakpoint junctions of the deletions found in USH2A in four of these cases were characterized. Our study highlights the need to develop improved efficient strategies of mutation screening based upon next generation sequencing (NGS) that reduce cost, time, and complexity and allow simultaneous identification of all types of disease-causing mutations in diagnostic procedures.
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Retinal Detachment Vision Simulator
... Feb 20, 2018 Gene Therapy May Be a Game-Changer for People With Inherited Retinal Disease Dec 19, 2017 ... the Academy Jobs at the Academy Financial Relationships with Industry Medical Disclaimer Privacy Policy Terms of Service For ...
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Rong, Weining; Chen, Xuejuan; Li, Huiping; Liu, Yani; Sheng, Xunlun
2014-06-01
To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip. Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations. Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree. Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
Avascular Retinal Findings in a Child With Achondroplasia.
Hua, Hong-Uyen T; Tran, Kimberly D; Medina, Carlos A; Fallas, Brenda; Negron, Cathy; Berrocal, Audina M
2017-03-01
The authors present clinical and angiographic findings in a 12-year-old girl with achondroplasia who presented with bilateral retinal peripheral nonperfusion and unilateral rhegmatogenous retinal detachment, which has not been previously described in achondroplasia. This report contributes incremental knowledge regarding aberrant retinal vascular phenomena observed in pediatric disease states and implicates the possible role of mutations in the FGFR3 gene in peripheral vascular abnormalities. [Ophthalmic Surg Lasers Imaging Retina. 2017;48:272-274.]. Copyright 2017, SLACK Incorporated.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Tanito, Masaki; Brush, Richard S.; Elliott, Michael H.; Wicker, Lea D.; Henry, Kimberly R.; Anderson, Robert E.
2009-01-01
The fat-1 gene cloned from C. elegans encodes an n-3 fatty acid desaturase that converts n-6 to n-3 PUFA. Mice carrying the fat-1 transgene and wild-type controls were fed an n-3-deficient/n-6-enriched diet [fat-1- safflower oil (SFO) and wt-SFO, respectively]. Fatty acid profiles of rod outer segments (ROS), cerebellum, plasma, and liver demonstrated significantly lower n-6/n-3 ratios and higher docosahexaenoic acid (DHA) levels in fat-1-SFO compared with wt-SFO. When mice were exposed to light stress: 1) the outer nuclear layer (ONL) thickness was reduced; 2) amplitudes of the electroretinogram (ERG) were lower; 3) the number of apoptotic photoreceptor cells was greater; and 4) modification of retinal proteins by 4-hydroxyhexenal (4-HHE), an end-product of n-3 PUFA oxidation was increased in both fat-1-SFO and wt mice fed a regular lab chow diet compared with wt-SFO. The results indicate a positive correlation between the level of DHA, the degree of n-3 PUFA lipid peroxidation, and the vulnerability of the retina to photooxidative stress. In mice not exposed to intense light, the reduction in DHA resulted in reduced efficacy in phototransduction gain steps, while no differences in the retinal morphology or retinal biochemistry. These results highlight the dual roles of DHA in cellular physiology and pathology. PMID:19023138
Directory of Open Access Journals (Sweden)
Li Ma
2013-08-01
Full Text Available AIM: To screen mutations in the retinitis pigmentosa 1 (RP1 gene and the rhodopsin (RHO gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP and describe the genotype-phenotype relationship of the mutations.METHODS:Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations.RESULTS: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800 and one non-coding variant (rs56340615 were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.CONCLUSION: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.
Ma, Li; Sheng, Xun-Lun; Li, Hui-Ping; Zhang, Fang-Xia; Liu, Ya-Ni; Rong, Wei-Ning; Zhang, Jian-Ling
2013-01-01
To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.
Klevering, B.J.; Ijzer, S.; Rohrschneider, K.; Zonneveld-Vrieling, M.N.; Allikmets, R.; Born, L.I. van den; Maugeri, A.; Hoyng, C.B.; Cremers, F.P.M.
2004-01-01
Mutations in the ABCA4 gene have been associated with autosomal recessive Stargardt disease (STGD1), cone-rod dystrophy (CRD), and retinitis pigmentosa (RP). We employed a recently developed genotyping microarray, the ABCR400-chip, to search for known ABCA4 mutations in patients with isolated or
Ghaderi, Shima; Soheili, Zahra-Soheila; Ahmadieh, Hamid; Davari, Maliheh; Jahromi, Fatemeh Sanie; Samie, Shahram; Rezaie-Kanavi, Mozhgan; Pakravesh, Jalil; Deezagi, Abdolkhalegh
2011-09-01
To evaluate the effect of human amniotic fluid (HAF) on retinal pigmented epithelial cells growth and trans-differentiation into retinal neurons, retinal pigmented epithelium (RPE) cells were isolated from neonatal human cadaver eye globes and cultured in Dulbecco's modified Eagle's medium-F12 supplemented with 10% fetal bovine serum (FBS). Confluent monolayer cultures were trypsinized and passaged using FBS-containing or HAF-containing media. Amniotic fluid samples were received from pregnant women in the first trimester of gestation. Cell proliferation and death enzyme-linked immunosorbent assays were performed to assess the effect of HAF on RPE cell growth. Trans-differentiation into rod photoreceptors and retinal ganglion cells was also studied using immunocytochemistry and real-time polymerase chain reaction techniques. Primary cultures of RPE cells were successfully established under FBS-containing or HAF-containing media leading to rapid cell growth and proliferation. When RPE cells were moved to in vitro culture system, they began to lose their differentiation markers such as pigmentation and RPE65 marker and trans-differentiated neural-like cells followed by spheroid colonies pertaining to stem/progenitor cells were morphologically detected. Immunocytochemistry (ICC) analysis of HAF-treated cultures showed a considerable expression of Rhodopsin gene (30% Rhodopsin-positive cells) indicating trans-differentiation of RPE cells to rod photoreceptors. Real-time polymerase chain reaction revealed an HAF-dose-dependant expression of Thy-1 gene (RGC marker) and significant promoting effect of HAF on RGCs generation. The data presented here suggest that HAF possesses invaluable stimulatory effect on RPE cells growth and trans-differentiation into retinal neurons. It can be regarded as a newly introduced enriched supplement in serum-free kinds of media used in neuro-retinal regeneration studies.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Shifera, Amde Selassie; Kay, Christine Nichols
2015-01-01
To report a heterozygous female presenting with an early-onset and severe form of X-linked retinitis pigmentosa (XLRP). This is a case series presenting the clinical findings in a heterozygous female with XLRP and two of her family members. Fundus photography, fundus autofluorescence, ocular coherence tomography, and visual perimetry are presented. The proband reported here is a heterozygous female who presented at the age of 8 years with an early onset and aggressive form of XLRP. The patient belongs to a four-generation family with a total of three affected females and four affected males. The patient was initially diagnosed with retinitis pigmentosa (RP) at the age of 4 years. Genetic testing identified a heterozygous donor splice site mutation in intron 1 (IVS1 + 1G > A) of the retinitis pigmentosa GTPase regulator gene. The father of the proband was diagnosed with RP when he was a young child. The sister of the proband, evaluated at the age of 6 years, showed macular pigmentary changes. Although carriers of XLRP are usually asymptomatic or have a mild disease of late onset, the proband presented here exhibited an early-onset, aggressive form of the disease. It is not clear why some carrier females manifest a severe phenotype. A better understanding of the genetic processes involved in the penetrance and expressivity of XLRP in heterozygous females could assist in providing the appropriate counseling to affected families.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Fang Hu
2014-10-01
Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.
Diagnostic Challenges in Retinitis Pigmentosa: Genotypic Multiplicity and Phenotypic Variability
Chang, Susie; Vaccarella, Leah; Olatunji, Sunday; Cebulla, Colleen; Christoforidis, John
2011-01-01
Retinitis pigmentosa (RP) is a heterogeneous group of inherited retinal disorders. Diagnosis can be challenging as more than 40 genes are known to cause non-syndromic RP and phenotypic expression can differ significantly resulting in variations in disease severity, age of onset, rate of progression, and clinical findings. We describe the clinical manifestations of RP, the more commonly known causative gene mutations, and the genotypic-phenotypic correlation of RP. PMID:22131872
Quantitative genetic analysis of retinal degeneration in the blind cavefish Astyanax mexicanus.
Directory of Open Access Journals (Sweden)
Kelly E O'Quin
Full Text Available The retina is the light-sensitive tissue of the eye that facilitates vision. Mutations within genes affecting eye development and retinal function cause a host of degenerative visual diseases, including retinitis pigmentosa and anophthalmia/microphthalmia. The characin fish Astyanax mexicanus includes both eyed (surface fish and eyeless (cavefish morphs that initially develop eyes with normal retina; however, early in development, the eyes of cavefish degenerate. Since both surface and cave morphs are members of the same species, they serve as excellent evolutionary mutant models with which to identify genes causing retinal degeneration. In this study, we crossed the eyed and eyeless forms of A. mexicanus and quantified the thickness of individual retinal layers among 115 F(2 hybrid progeny. We used next generation sequencing (RAD-seq and microsatellite mapping to construct a dense genetic map of the Astyanax genome, scan for quantitative trait loci (QTL affecting retinal thickness, and identify candidate genes within these QTL regions. The map we constructed for Astyanax includes nearly 700 markers assembled into 25 linkage groups. Based on our scans with this map, we identified four QTL, one each associated with the thickness of the ganglion, inner nuclear, outer plexiform, and outer nuclear layers of the retina. For all but one QTL, cavefish alleles resulted in a clear reduction in the thickness of the affected layer. Comparative mapping of genetic markers within each QTL revealed that each QTL corresponds to an approximately 35 Mb region of the zebrafish genome. Within each region, we identified several candidate genes associated with the function of each affected retinal layer. Our study is the first to examine Astyanax retinal degeneration in the context of QTL mapping. The regions we identify serve as a starting point for future studies on the genetics of retinal degeneration and eye disease using the evolutionary mutant model Astyanax.
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Genetics Home Reference: retinitis pigmentosa
... A characteristic of X-linked inheritance is that fathers cannot pass X-linked traits to their sons. ... in known genes account for 58% of autosomal dominant retinitis pigmentosa (adRP). Adv Exp Med Biol. 2008; ...
Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.
Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E
2015-01-01
To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.
Enhancing the efficacy of AREDS antioxidants in light-induced retinal degeneration.
Wong, Paul; Markey, M; Rapp, C M; Darrow, R M; Ziesel, A; Organisciak, D T
2017-01-01
Light-induced photoreceptor cell degeneration and disease progression in age-related macular degeneration (AMD) involve oxidative stress and visual cell loss, which can be prevented, or slowed, by antioxidants. Our goal was to test the protective efficacy of a traditional Age-related Eye Disease Study antioxidant formulation (AREDS) and AREDS combined with non-traditional antioxidants in a preclinical animal model of photooxidative retinal damage. Male Sprague-Dawley rats were reared in a low-intensity (20 lux) or high-intensity (200 lux) cyclic light environment for 6 weeks. Some animals received a daily dietary supplement consisting of a small cracker infused with an AREDS antioxidant mineral mixture, AREDS antioxidants minus zinc, or zinc oxide alone. Other rats received AREDS combined with a detergent extract of the common herb rosemary, AREDS plus carnosic acid, zinc oxide plus rosemary, or rosemary alone. Antioxidant efficacy was determined by measuring retinal DNA levels 2 weeks after 6 h of intense exposure to white light (9,000 lux). Western blotting was used to determine visual cell opsin and arrestin levels following intense light treatment. Rhodopsin regeneration was determined after 1 h of exposure to light. Gene array analysis was used to determine changes in the expression of retinal genes resulting from light rearing environment or from antioxidant supplementation. Chronic high-intensity cyclic light rearing resulted in lower levels of rod and cone opsins, retinal S-antigen (S-ag), and medium wavelength cone arrestin (mCAR) than found for rats maintained in low cyclic light. However, as determined by retinal DNA, and by residual opsin and arrestin levels, 2 weeks after acute photooxidative damage, visual cell loss was greater in rats reared in low cyclic light. Retinal damage decreased with AREDS plus rosemary, or with zinc oxide plus rosemary whereas AREDS alone and zinc oxide alone (at their daily recommended levels) were both ineffective. One
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Jones, Melissa K; Lu, Bin; Saghizadeh, Mehrnoosh; Wang, Shaomei
2016-01-01
Retinal degenerative diseases (RDDs) affect millions of people and are the leading cause of vision loss. Although treatment options for RDDs are limited, stem and progenitor cell-based therapies have great potential to halt or slow the progression of vision loss. Our previous studies have shown that a single subretinal injection of human forebrain derived neural progenitor cells (hNPCs) into the Royal College of Surgeons (RCS) retinal degenerate rat offers long-term preservation of photoreceptors and visual function. Furthermore, neural progenitor cells are currently in clinical trials for treating age-related macular degeneration; however, the molecular mechanisms of stem cell-based therapies are largely unknown. This is the first study to analyze gene expression changes in the retina of RCS rats following subretinal injection of hNPCs using high-throughput sequencing. RNA-seq data of retinas from RCS rats injected with hNPCs (RCS(hNPCs)) were compared to sham surgery in RCS (RCS(sham)) and wild-type Long Evans (LE(sham)) rats. Differential gene expression patterns were determined with in silico analysis and confirmed with qRT-PCR. Function, biologic, cellular component, and pathway analyses were performed on differentially expressed genes and investigated with immunofluorescent staining experiments. Analysis of the gene expression data sets identified 1,215 genes that were differentially expressed between RCS(sham) and LE(sham) samples. Additionally, 283 genes were differentially expressed between the RCS(hNPCs) and RCS(sham) samples. Comparison of these two gene sets identified 68 genes with inverse expression (termed rescue genes), including Pdc, Rp1, and Cdc42ep5. Functional, biologic, and cellular component analyses indicate that the immune response is enhanced in RCS(sham). Pathway analysis of the differential expression gene sets identified three affected pathways in RCS(hNPCs), which all play roles in phagocytosis signaling. Immunofluorescent staining
Retinal detachment and retinal holes in retinitis pigmentosa sine pigmento.
Csaky, K; Olk, R J; Mahl, C F; Bloom, S M
1991-01-01
Retinal detachment and retinal holes in two family members with retinitis pigmentosa sine pigmento are reported. We believe these are the first such cases reported in the literature. We describe the presenting symptoms and management, including cryotherapy, scleral buckling procedure, and sulfur hexafluoride injection (SF6), resulting in stable visual acuity in one case and retinal reattachment and improved visual acuity in the other case.
Identification of Inherited Retinal Disease-Associated Genetic Variants in 11 Candidate Genes.
Astuti, Galuh D N; van den Born, L Ingeborgh; Khan, M Imran; Hamel, Christian P; Bocquet, Béatrice; Manes, Gaël; Quinodoz, Mathieu; Ali, Manir; Toomes, Carmel; McKibbin, Martin; El-Asrag, Mohammed E; Haer-Wigman, Lonneke; Inglehearn, Chris F; Black, Graeme C M; Hoyng, Carel B; Cremers, Frans P M; Roosing, Susanne
2018-01-10
Inherited retinal diseases (IRDs) display an enormous genetic heterogeneity. Whole exome sequencing (WES) recently identified genes that were mutated in a small proportion of IRD cases. Consequently, finding a second case or family carrying pathogenic variants in the same candidate gene often is challenging. In this study, we searched for novel candidate IRD gene-associated variants in isolated IRD families, assessed their causality, and searched for novel genotype-phenotype correlations. Whole exome sequencing was performed in 11 probands affected with IRDs. Homozygosity mapping data was available for five cases. Variants with minor allele frequencies ≤ 0.5% in public databases were selected as candidate disease-causing variants. These variants were ranked based on their: (a) presence in a gene that was previously implicated in IRD; (b) minor allele frequency in the Exome Aggregation Consortium database (ExAC); (c) in silico pathogenicity assessment using the combined annotation dependent depletion (CADD) score; and (d) interaction of the corresponding protein with known IRD-associated proteins. Twelve unique variants were found in 11 different genes in 11 IRD probands. Novel autosomal recessive and dominant inheritance patterns were found for variants in Small Nuclear Ribonucleoprotein U5 Subunit 200 ( SNRNP200 ) and Zinc Finger Protein 513 ( ZNF513 ), respectively. Using our pathogenicity assessment, a variant in DEAH-Box Helicase 32 ( DHX32 ) was the top ranked novel candidate gene to be associated with IRDs, followed by eight medium and lower ranked candidate genes. The identification of candidate disease-associated sequence variants in 11 single families underscores the notion that the previously identified IRD-associated genes collectively carry > 90% of the defects implicated in IRDs. To identify multiple patients or families with variants in the same gene and thereby provide extra proof for pathogenicity, worldwide data sharing is needed.
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Retinal oximetry in patients with ischaemic retinal diseases
DEFF Research Database (Denmark)
Rilvén, Sandra; Torp, Thomas Lee; Grauslund, Jakob
2017-01-01
The retinal oximeter is a new tool for non-invasive measurement of retinal oxygen saturation in humans. Several studies have investigated the associations between retinal oxygen saturation and retinal diseases. In the present systematic review, we examine whether there are associations between...... retinal oxygen saturation and retinal ischaemic diseases. We used PubMed and Embase to search for retinal oxygen saturation and retinal ischaemic diseases. Three separate searches identified a total of 79 publications. After two levels of manual screening, 10 studies were included: six about diabetic...... retinopathy (DR) and four about retinal vein occlusion. No studies about retinal artery occlusion were included. In diabetes, all studies found that increases in retinal venous oxygen saturation (rvSatO2 ) were associated with present as well as increasing levels of DR. Four of six studies also found...
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Missed retinal breaks in rhegmatogenous retinal detachment
Directory of Open Access Journals (Sweden)
Brijesh Takkar
2016-12-01
Full Text Available AIM: To evaluate the causes and associations of missed retinal breaks (MRBs and posterior vitreous detachment (PVD in patients with rhegmatogenous retinal detachment (RRD. METHODS: Case sheets of patients undergoing vitreo retinal surgery for RRD at a tertiary eye care centre were evaluated retrospectively. Out of the 378 records screened, 253 were included for analysis of MRBs and 191 patients were included for analysis of PVD, depending on the inclusion criteria. Features of RRD and retinal breaks noted on examination were compared to the status of MRBs and PVD detected during surgery for possible associations. RESULTS: Overall, 27% patients had MRBs. Retinal holes were commonly missed in patients with lattice degeneration while missed retinal tears were associated with presence of complete PVD. Patients operated for cataract surgery were significantly associated with MRBs (P=0.033 with the odds of missing a retinal break being 1.91 as compared to patients with natural lens. Advanced proliferative vitreo retinopathy (PVR and retinal bullae were the most common reasons for missing a retinal break during examination. PVD was present in 52% of the cases and was wrongly assessed in 16%. Retinal bullae, pseudophakia/aphakia, myopia, and horse shoe retinal tears were strongly associated with presence of PVD. Traumatic RRDs were rarely associated with PVD. CONCLUSION: Pseudophakic patients, and patients with retinal bullae or advanced PVR should be carefully screened for MRBs. Though Weiss ring is a good indicator of PVD, it may still be over diagnosed in some cases. PVD is associated with retinal bullae and pseudophakia, and inversely with traumatic RRD.
Optimal Achievable Encoding for Brain Machine Interface
2017-12-22
dictionary-based encoding approach to translate a visual image into sequential patterns of electrical stimulation in real time , in a manner that...including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and completing and...networks, and by applying linear decoding to complete recorded populations of retinal ganglion cells for the first time . Third, we developed a greedy
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
[Spinocerebellar ataxia type 2 associated to pigmentary retinitis].
Jiménez-Caballero, Pedro Enrique; Serviá, Mónica
2010-07-01
Ocular disorders are useful in the characterisation of the different types of spinocerebellar ataxias (SCA); pigmentary retinitis is an alteration that is specifically associated to SCA type 7 and is characterised by night blindness, sensitivity to glare and progressive narrowing of the visual field. A 34-year-old woman with clinical symptoms of progressive ataxia and visual impairment secondary to pigmentary retinitis. The patient had a personal history with an autosomal dominant pattern of a similar disorder in her father and paternal grandmother. In the genetic study she presented a triplet expansion in the SCA type 2 gene. CONCLUSIONS; Although pigmentary retinitis belongs to the SCA type 7 phenotype, our patient presented this retinal disorder, as in other cases of SCA type 2. A genetic study for SCA type 2 must therefore be conducted in patients with a degenerative ataxic clinical picture and who present evidence of pigmentary retinitis.
Rivolta, C; Sweklo, E A; Berson, E L; Dryja, T P
2000-06-01
Microdeletions Glu767(1-bp del), Thr967(1-bp del), and Leu1446(2-bp del) in the human USH2A gene have been reported to cause Usher syndrome type II, a disorder characterized by retinitis pigmentosa (RP) and mild-to-severe hearing loss. Each of these three frameshift mutations is predicted to lead to an unstable mRNA transcript that, if translated, would result in a truncated protein lacking the carboxy terminus. Here, we report Cys759Phe, a novel missense mutation in this gene that changes an amino-acid residue within the fifth laminin-epidermal growth factor-like domain of the USH2A gene and that is associated with recessive RP without hearing loss. This single mutation was found in 4.5% of 224 patients with recessive RP, suggesting that USH2A could cause more cases of nonsyndromic recessive RP than does any other gene identified to date.
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
CRALBP supports the mammalian retinal visual cycle and cone vision.
Xue, Yunlu; Shen, Susan Q; Jui, Jonathan; Rupp, Alan C; Byrne, Leah C; Hattar, Samer; Flannery, John G; Corbo, Joseph C; Kefalov, Vladimir J
2015-02-01
Mutations in the cellular retinaldehyde-binding protein (CRALBP, encoded by RLBP1) can lead to severe cone photoreceptor-mediated vision loss in patients. It is not known how CRALBP supports cone function or how altered CRALBP leads to cone dysfunction. Here, we determined that deletion of Rlbp1 in mice impairs the retinal visual cycle. Mice lacking CRALBP exhibited M-opsin mislocalization, M-cone loss, and impaired cone-driven visual behavior and light responses. Additionally, M-cone dark adaptation was largely suppressed in CRALBP-deficient animals. While rearing CRALBP-deficient mice in the dark prevented the deterioration of cone function, it did not rescue cone dark adaptation. Adeno-associated virus-mediated restoration of CRALBP expression specifically in Müller cells, but not retinal pigment epithelial (RPE) cells, rescued the retinal visual cycle and M-cone sensitivity in knockout mice. Our results identify Müller cell CRALBP as a key component of the retinal visual cycle and demonstrate that this pathway is important for maintaining normal cone-driven vision and accelerating cone dark adaptation.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells
Energy Technology Data Exchange (ETDEWEB)
Jiang, Meisheng; Tran, V.T.; Fong, H.K.W. (Univ. of Southern California, Los Angeles (United States)); Pandey, S. (Doheny Eye Inst., Los Angeles, CA (United States))
1991-05-01
The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha} protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.
Wavre-Shapton, Silène T; Tolmachova, Tanya; Lopes da Silva, Mafalda; da Silva, Mafalda Lopes; Futter, Clare E; Seabra, Miguel C
2013-01-01
The retinal pigment epithelium (RPE) is a pigmented monolayer of cells lying between the photoreceptors and a layer of fenestrated capillaries, the choriocapillaris. Choroideremia (CHM) is an X-linked progressive degeneration of these three layers caused by the loss of function of Rab Escort protein-1 (REP1). REP1 is involved in the prenylation of Rab proteins, key regulators of membrane trafficking. To study the pathological consequences of chronic disruption of membrane traffic in the RPE we used a cell type-specific knock-out mouse model of the disease, where the Chm/Rep1 gene is deleted only in pigmented cells (Chm(Flox), Tyr-Cre+). Transmission electron microscopy (TEM) was used to quantitate the melanosome distribution in the RPE and immunofluorescent staining of rhodopsin was used to quantitate phagocytosed rod outer segments in retinal sections. The ultrastructure of the RPE and Bruch's membrane at different ages was characterised by TEM to analyse age-related changes occurring as a result of defects in membrane traffic pathways. Chm/Rep1 gene knockout in RPE cells resulted in reduced numbers of melanosomes in the apical processes and delayed phagosome degradation. In addition, the RPE accumulated pathological changes at 5-6 months of age similar to those observed in 2-year old controls. These included the intracellular accumulation of lipofuscin-containing deposits, disorganised basal infoldings and the extracellular accumulation of basal laminar and basal linear deposits. The phenotype of the Chm(Flox), Tyr-Cre+ mice suggests that loss of the Chm/Rep1 gene causes premature accumulation of features of aging in the RPE. Furthermore, the striking similarities between the present observations and some of the phenotypes reported in age-related macular degeneration (AMD) suggest that membrane traffic defects may contribute to the pathogenesis of AMD.
Directory of Open Access Journals (Sweden)
Silène T Wavre-Shapton
Full Text Available The retinal pigment epithelium (RPE is a pigmented monolayer of cells lying between the photoreceptors and a layer of fenestrated capillaries, the choriocapillaris. Choroideremia (CHM is an X-linked progressive degeneration of these three layers caused by the loss of function of Rab Escort protein-1 (REP1. REP1 is involved in the prenylation of Rab proteins, key regulators of membrane trafficking. To study the pathological consequences of chronic disruption of membrane traffic in the RPE we used a cell type-specific knock-out mouse model of the disease, where the Chm/Rep1 gene is deleted only in pigmented cells (Chm(Flox, Tyr-Cre+. Transmission electron microscopy (TEM was used to quantitate the melanosome distribution in the RPE and immunofluorescent staining of rhodopsin was used to quantitate phagocytosed rod outer segments in retinal sections. The ultrastructure of the RPE and Bruch's membrane at different ages was characterised by TEM to analyse age-related changes occurring as a result of defects in membrane traffic pathways. Chm/Rep1 gene knockout in RPE cells resulted in reduced numbers of melanosomes in the apical processes and delayed phagosome degradation. In addition, the RPE accumulated pathological changes at 5-6 months of age similar to those observed in 2-year old controls. These included the intracellular accumulation of lipofuscin-containing deposits, disorganised basal infoldings and the extracellular accumulation of basal laminar and basal linear deposits. The phenotype of the Chm(Flox, Tyr-Cre+ mice suggests that loss of the Chm/Rep1 gene causes premature accumulation of features of aging in the RPE. Furthermore, the striking similarities between the present observations and some of the phenotypes reported in age-related macular degeneration (AMD suggest that membrane traffic defects may contribute to the pathogenesis of AMD.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Directory of Open Access Journals (Sweden)
Xiao-Fei Ma
2017-05-01
Full Text Available Objective: To study the effect of lycium barbarum polysaccharides (LBP on high glucoseinduced retinal ganglion cell apoptosis, gene expression and delayed rectifier potassium current. Methods: RGC-5 retinal ganglion cell lines were cultured and divided into control group, high glucose group and LBP group that were treated with normal DMEM, highglucose DMEM as well as high-glucose DMEM containing 500 ng/mL LBP respectively. After treatment, the Annexin V-FITC/PI kits were used to measure the number of apoptotic cells, fluorescence quantitative PCR kits were used to determine the expression of apoptosis genes and antioxidant genes, and patch clamp was used to test delayed rectifier potassium current. Results: 12, 24, 36 and 48 h after intervention, the number of apoptotic cells of high glucose group was significantly higher than that of control group, and the number of apoptotic cells of LBP group was significantly lower than that of high glucose group (P<0.05; 24 and 48 h after intervention, c-fos, c-jun, caspase-3, caspase-9, Nrf-2, NQO1 and HO-1 mRNA expression as well as potassium current amplitude (IK and maximum conductance (Gmax of high glucose group were significantly higher than those of control group while half maximum activation voltage (V1/2 was significantly lower than that of control group (P<0.05; c-fos, c-jun, caspase-3 and caspase-9 mRNA expression as well as IK and Gmax of LBP group were significantly lower than those of high glucose group, while Nrf-2, NQO1 and HO-1 mRNA expression as well as V1/2 of LBP group were significantly higher than those of high glucose group (P<0.05. Conclusions: LBP can reduce the high glucose-induced retinal ganglion cell apoptosis and inhibit the delayed rectifier potassium current amplitude.
Shroyer, N F; Lewis, R A; Lupski, J R
2001-06-01
To determine if mutations in ABCR (ABCA4) are associated with chloroquine/hydroxychloroquine retinopathy. DNA from eight patients with chloroquine or hydroxychloroquine retinopathy was studied. Controls were 80 individuals over age 65 years with normal retinal examinations. Ophthalmoscopy, color vision testing, visual fields, retinal photography, and fluorescein angiography were performed on the eight patients. Direct DNA sequencing of the exons and flanking intronic regions of the ABCR gene was completed for all patients. Clinical evaluation confirmed the diagnosis of chloroquine/hydroxychloroquine retinopathy and excluded Stargardt disease in each patient. Two patients had heterozygous ABCR missense mutations previously associated with Stargardt disease. None of the controls had these missense mutations. Three other patients had other missense polymorphisms. Some individuals who have ABCR mutations may be predisposed to develop retinal toxicity when exposed to chloroquine/hydroxychloroquine. We urge further study of a larger cohort of patients with chloroquine/hydroxychloroquine retinopathy.
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Age- and Gene-Dosage–Dependent Cre-Induced Abnormalities in the Retinal Pigment Epithelium
He, Lizhi; Marioutina, Mariya; Dunaief, Joshua L.; Marneros, Alexander G.
2015-01-01
To conditionally inactivate genes in the retinal pigment epithelium (RPE) transgenic mouse strains have been developed, in which Cre recombinase (Cre) expression is driven by an RPE-specific gene promoter. The RPE is a quiescent epithelium, and continuous expression of Cre could affect its function. Here, we tested the hypothesis that continuous postnatal Cre expression in the RPE may lead to cellular abnormalities, which may depend on both age and Cre gene dosage. We therefore examined the eyes of homozygous and heterozygous VMD2-Cre mice at various ages. In VMD2-Cre heterozygous mice variable progressive age-dependent RPE abnormalities were noticed, including attenuation of phalloidin and cytoplasmic active β-catenin staining, reduced cell size, and loss of the typical honeycomb pattern of RPE morphology in those RPE cells that stained for Cre. These morphological RPE abnormalities were not noticed in Cre-negative RPE cells in VMD2-Cre or age-matched control mice. In addition, an abnormal number and morphology of cell nuclei were noticed in a subset of Cre-expressing RPE cells in aged heterozygous VMD2-Cre mice, whereas more severe nuclear abnormalities were observed already in young homozygous VMD2-Cre mice. Thus, continuous postnatal expression of Cre causes abnormalities in the RPE in an age- and Cre gene dosage-dependent manner, which needs to be considered in the interpretation of gene targeting studies in the RPE. PMID:24854863
Progress toward the maintenance and repair of degenerating retinal circuitry.
Vugler, Anthony A
2010-01-01
Retinal diseases such as age-related macular degeneration and retinitis pigmentosa remain major causes of severe vision loss in humans. Clinical trials for treatment of retinal degenerations are underway and advancements in our understanding of retinal biology in health/disease have implications for novel therapies. A review of retinal biology is used to inform a discussion of current strategies to maintain/repair neural circuitry in age-related macular degeneration, retinitis pigmentosa, and Type 2 Leber congenital amaurosis. In age-related macular degeneration/retinitis pigmentosa, a progressive loss of rods/cones results in corruption of bipolar cell circuitry, although retinal output neurons/photoreceptive melanopsin cells survive. Visual function can be stabilized/enhanced after treatment in age-related macular degeneration, but in advanced degenerations, reorganization of retinal circuitry may preclude attempts to restore cone function. In Type 2 Leber congenital amaurosis, useful vision can be restored by gene therapy where central cones survive. Remarkable progress has been made in restoring vision to rodents using light-responsive ion channels inserted into bipolar cells/retinal ganglion cells. Advances in genetic, cellular, and prosthetic therapies show varying degrees of promise for treating retinal degenerations. While functional benefits can be obtained after early therapeutic interventions, efforts should be made to minimize circuitry changes as soon as possible after rod/cone loss. Advances in retinal anatomy/physiology and genetic technologies should allow refinement of future reparative strategies.
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
Complex genetics of familial exudative vitreoretinopathy and related pediatric retinal detachments
Kondo, Hiroyuki
2015-01-01
Familial exudative vitreoretinopathy (FEVR) is a hereditary vitreoretinal disorder that can cause various types of retinal detachments. The abnormalities in eyes with FEVR are caused by poor vascularization in the peripheral retina. The genetics of FEVR is highly heterogeneous, and mutations in the genes for Wnt signaling and a transcription factor have been reported to be responsible for FEVR. These factors have been shown to be the regulators of the pathophysiological pathways of retinal vascular development. Studies conducted to identify the causative genes of FEVR have uncovered a diverse and complex relationship between FEVR and other diseases; for example, Norrie disease, a Mendelian-inherited disease; retinopathy of prematurity, a multifactorial genetic disease; and Coats disease, a nongenetic disease, associated with pediatric retinal detachments. PMID:29018668
Directory of Open Access Journals (Sweden)
Goetz Thomas
2004-07-01
Full Text Available Abstract Background The mammalian retina is a valuable model system to study neuronal biology in health and disease. To obtain insight into intrinsic processes of the retina, great efforts are directed towards the identification and characterization of transcripts with functional relevance to this tissue. Results With the goal to assemble a first genome-wide reference transcriptome of the adult mammalian retina, referred to as the retinome, we have extracted 13,037 non-redundant annotated genes from nearly 500,000 published datasets on redundant retina/retinal pigment epithelium (RPE transcripts. The data were generated from 27 independent studies employing a wide range of molecular and biocomputational approaches. Comparison to known retina-/RPE-specific pathways and established retinal gene networks suggest that the reference retinome may represent up to 90% of the retinal transcripts. We show that the distribution of retinal genes along the chromosomes is not random but exhibits a higher order organization closely following the previously observed clustering of genes with increased expression. Conclusion The genome wide retinome map offers a rational basis for selecting suggestive candidate genes for hereditary as well as complex retinal diseases facilitating elaborate studies into normal and pathological pathways. To make this unique resource freely available we have built a database providing a query interface to the reference retinome 1.
Optical modulation of transgene expression in retinal pigment epithelium
Palanker, D.; Lavinsky, D.; Chalberg, T.; Mandel, Y.; Huie, P.; Dalal, R.; Marmor, M.
2013-03-01
Over a million people in US alone are visually impaired due to the neovascular form of age-related macular degeneration (AMD). The current treatment is monthly intravitreal injections of a protein which inhibits Vascular Endothelial Growth Factor, thereby slowing progression of the disease. The immense financial and logistical burden of millions of intravitreal injections signifies an urgent need to develop more long-lasting and cost-effective treatments for this and other retinal diseases. Viral transfection of ocular cells allows creation of a "biofactory" that secretes therapeutic proteins. This technique has been proven successful in non-human primates, and is now being evaluated in clinical trials for wet AMD. However, there is a critical need to down-regulate gene expression in the case of total resolution of retinal condition, or if patient has adverse reaction to the trans-gene products. The site for genetic therapy of AMD and many other retinal diseases is the retinal pigment epithelium (RPE). We developed and tested in pigmented rabbits, an optical method to down-regulate transgene expression in RPE following vector delivery, without retinal damage. Microsecond exposures produced by a rapidly scanning laser vaporize melanosomes and destroy a predetermined fraction of the RPE cells selectively. RPE continuity is restored within days by migration and proliferation of adjacent RPE, but since the transgene is not integrated into the nucleus it is not replicated. Thus, the decrease in transgene expression can be precisely determined by the laser pattern density and further reduced by repeated treatment without affecting retinal structure and function.
The molecular genetics of Usher syndrome.
Ahmed, Z M; Riazuddin, S; Riazuddin, S; Wilcox, E R
2003-06-01
Association of sensorineural deafness and progressive retinitis pigmentosa with and without a vestibular abnormality is the hallmark of Usher syndrome and involves at least 12 loci among three different clinical subtypes. Genes identified for the more commonly inherited loci are USH2A (encoding usherin), MYO7A (encoding myosin VIIa), CDH23 (encoding cadherin 23), PCDH15 (encoding protocadherin 15), USH1C (encoding harmonin), USH3A (encoding clarin 1), and USH1G (encoding SANS). Transcripts from all these genes are found in many tissues/cell types other than the inner ear and retina, but all are uniquely critical for retinal and cochlear cell function. Many of these protein products have been demonstrated to have direct interactions with each other and perform an essential role in stereocilia homeostasis.
Genetic testing for retinal dystrophies and dysfunctions: benefits, dilemmas and solutions.
Koenekoop, Robert K; Lopez, Irma; den Hollander, Anneke I; Allikmets, Rando; Cremers, Frans P M
2007-07-01
Human retinal dystrophies have unparalleled genetic and clinical diversity and are currently linked to more than 185 genetic loci. Genotyping is a crucial exercise, as human gene-specific clinical trials to study photoreceptor rescue are on their way. Testing confirms the diagnosis at the molecular level and allows for a more precise prognosis of the possible future clinical evolution. As treatments are gene-specific and the 'window of opportunity' is time-sensitive; accurate, rapid and cost-effective genetic testing will play an ever-increasing crucial role. The gold standard is sequencing but is fraught with excessive costs, time, manpower issues and finding non-pathogenic variants. Therefore, no centre offers testing of all currently 132 known genes. Several new micro-array technologies have emerged recently, that offer rapid, cost-effective and accurate genotyping. The new disease chips from Asper Ophthalmics (for Stargardt dystrophy, Leber congenital amaurosis [LCA], Usher syndromes and retinitis pigmentosa) offer an excellent first pass opportunity. All known mutations are placed on the chip and in 4 h a patient's DNA is screened. Identification rates (identifying at least one disease-associated mutation) are currently approximately 70% (Stargardt), approximately 60-70% (LCA) and approximately 45% (Usher syndrome subtype 1). This may be combined with genotype-phenotype correlations that suggest the causal gene from the clinical appearance (e.g. preserved para-arteriolar retinal pigment epithelium suggests the involvement of the CRB1 gene in LCA). As approximately 50% of the retinal dystrophy genes still await discovery, these technologies will improve dramatically as additional novel mutations are added. Genetic testing will then become standard practice to complement the ophthalmic evaluation.
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
RNCR3 knockdown inhibits diabetes mellitus-induced retinal reactive gliosis
International Nuclear Information System (INIS)
Liu, Chang; Li, Chao-peng; Wang, Jia-Jian; Shan, Kun; Liu, Xin; Yan, Biao
2016-01-01
Retinal reactive gliosis is an important pathological feature of diabetic retinopathy. Identifying the underlying mechanisms causing reactive gliosis will be important for developing new therapeutic strategies for treating diabetic retinopathy. Herein, we show that long noncoding RNA-RNCR3 knockdown significantly inhibits retinal reactive gliosis. RNCR3 knockdown leads to a marked reduction in the release of several cytokines. RNCR3 knockdown alleviates diabetes mellitus-induced retinal neurodegeneration, as shown by less apoptotic retinal cells and ameliorative visual function. RNCR3 knockdown could also decrease Müller glial cell viability and proliferation, and reduce the expression of glial reactivity-related genes including GFAP and vimentin in vitro. Collectively, this study shows that RNCR3 knockdown may be a promising strategy for the prevention of diabetes mellitus-induced retinal neurodegeneration. - Highlights: • RNCR3 knockdown inhibits retinal reactive gliosis. • RNCR3 knockdown causes a significant change in cytokine profile. • RNCR3 knockdown alleviates diabetes mellitus-induced retinal neurodegeneration. • RNCR3 knockdown affects Müller glial cell function in vitro.
Wiley, Luke A; Burnight, Erin R; Drack, Arlene V; Banach, Bailey B; Ochoa, Dalyz; Cranston, Cathryn M; Madumba, Robert A; East, Jade S; Mullins, Robert F; Stone, Edwin M; Tucker, Budd A
2016-10-01
Juvenile neuronal ceroid lipofuscinosis (JNCL) is a childhood neurodegenerative disease with early-onset, severe central vision loss. Affected children develop seizures and CNS degeneration accompanied by severe motor and cognitive deficits. There is no cure for JNCL, and patients usually die during the second or third decade of life. In this study, independent lines of induced pluripotent stem cells (iPSCs) were generated from two patients with molecularly confirmed mutations in CLN3, the gene mutated in JNCL. Clinical-grade adeno-associated adenovirus serotype 2 (AAV2) carrying the full-length coding sequence of human CLN3 was generated in a U.S. Food and Drug Administration-registered cGMP facility. AAV2-CLN3 was efficacious in restoring full-length CLN3 transcript and protein in patient-specific fibroblasts and iPSC-derived retinal neurons. When injected into the subretinal space of wild-type mice, purified AAV2-CLN3 did not show any evidence of retinal toxicity. This study provides proof-of-principle for initiation of a clinical trial using AAV-mediated gene augmentation for the treatment of children with CLN3-associated retinal degeneration.
Lo, David; Weng, Jingning; Liu, xiaohong; Yang, Juhua; He, Fen; Wang, Yun; Liu, Xuyang
2016-01-01
PURPOSE To detect the disease-causing gene in a Chinese pedigree with autosomal-recessive retinitis pigmentosa (ARRP). METHODS All subjects in this family underwent a complete ophthalmic examination. Targeted-capture next generation sequencing (NGS) was performed on the proband to detect variants. All variants were verified in the remaining family members by PCR amplification and Sanger sequencing. RESULTS All the affected subjects in this pedigree were diagnosed with retinitis pigmentosa (RP). The compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations in the Crumbs homolog 1 (CRB1) gene were identified in all the affected patients but not in the unaffected individuals in this family. These mutations were inherited from their parents, respectively. CONCLUSION The novel compound heterozygous mutations in CRB1 were identified in a Chinese pedigree with ARRP using targeted-capture next generation sequencing. After evaluating the significant heredity and impaired protein function, the compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations are the causal genes of early onset ARRP in this pedigree. To the best of our knowledge, there is no previous report regarding the compound mutations. PMID:27806333
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Progressive outer retinal necrosis-like retinitis in immunocompetent hosts.
Chawla, Rohan; Tripathy, Koushik; Gogia, Varun; Venkatesh, Pradeep
2016-08-10
We describe two young immunocompetent women presenting with bilateral retinitis with outer retinal necrosis involving posterior pole with centrifugal spread and multifocal lesions simulating progressive outer retinal necrosis (PORN) like retinitis. Serology was negative for HIV and CD4 counts were normal; however, both women were on oral steroids at presentation for suspected autoimmune chorioretinitis. The retinitis in both eyes responded well to oral valaciclovir therapy. However, the eye with the more fulminant involvement developed retinal detachment with a loss of vision. Retinal atrophy was seen in the less involved eye with preservation of vision. Through these cases, we aim to describe a unique evolution of PORN-like retinitis in immunocompetent women, which was probably aggravated by a short-term immunosuppression secondary to oral steroids. 2016 BMJ Publishing Group Ltd.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
Inherited Retinal Degenerative Disease Clinical Trial Network. Addendum
2010-10-01
Stargardt disease, and Usher syndrome represent the predominant forms of inherited orphan retinal degenerative diseases and are estimated to affect...working with Oxford Biomedica and a separate project with academic investigators on gene therapy for Usher lb syndrome (deaf-blindness due to a gene...s. The NEER Network will also develop standard protocols for data collection, mainta i n and expand patient databases, classified by genotype and
LONGITUDINAL STRUCTURAL CHANGES IN LATE-ONSET RETINAL DEGENERATION.
Cukras, Catherine; Flamendorf, Jason; Wong, Wai T; Ayyagari, Radha; Cunningham, Denise; Sieving, Paul A
2016-12-01
To characterize longitudinal structural changes in early stages of late-onset retinal degeneration to investigate pathogenic mechanisms. Two affected siblings, both with a S163R missense mutation in the causative gene C1QTNF5, were followed for 8+ years. Color fundus photos, fundus autofluorescence images, near-infrared reflectance fundus images, and spectral domain optical coherence tomography scans were acquired during follow-up. Both patients, aged 45 and 50 years, had good visual acuities (>20/20) in the context of prolonged dark adaptation. Baseline color fundus photography demonstrated yellow-white, punctate lesions in the temporal macula that correlated with a reticular pattern on fundus autofluorescence and near-infrared reflectance imaging. Baseline spectral domain optical coherence tomography imaging revealed subretinal deposits that resemble reticular pseudodrusen described in age-related macular degeneration. During follow-up, these affected areas developed confluent thickening of the retinal pigment epithelial layer and disruption of the ellipsoid zone of photoreceptors before progressing to overt retinal pigment epithelium and outer retinal atrophy. Structural changes in early stages of late-onset retinal degeneration, revealed by multimodal imaging, resemble those of reticular pseudodrusen observed in age-related macular degeneration and other retinal diseases. Longitudinal follow-up of these lesions helps elucidate their progression to frank atrophy and may lend insight into the pathogenic mechanisms underlying diverse retinal degenerations.
Mef2d is essential for the maturation and integrity of retinal photoreceptor and bipolar cells.
Omori, Yoshihiro; Kitamura, Tamiki; Yoshida, Satoyo; Kuwahara, Ryusuke; Chaya, Taro; Irie, Shoichi; Furukawa, Takahisa
2015-05-01
Mef2 transcription factors play a crucial role in cardiac and skeletal muscle differentiation. We found that Mef2d is highly expressed in the mouse retina and its loss causes photoreceptor degeneration similar to that observed in human retinitis pigmentosa patients. Electroretinograms (ERGs) were severely impaired in Mef2d-/- mice. Immunohistochemistry showed that photoreceptor and bipolar cell synapse protein levels severely decreased in the Mef2d-/- retina. Expression profiling by microarray analysis showed that Mef2d is required for the expression of various genes in photoreceptor and bipolar cells, including cone arrestin, Guca1b, Pde6h and Cacna1s, which encode outer segment and synapse proteins. We also observed that Mef2d synergistically activates the cone arrestin (Arr3) promoter with Crx, suggesting that functional cooperation between Mef2d and Crx is important for photoreceptor cell gene regulation. Taken together, our results show that Mef2d is essential for photoreceptor and bipolar cell gene expression, either independently or cooperatively with Crx. © 2015 Institution for Protein Research. Genes to Cells published by Wiley Publishing Asia Pty Ltd and the Molecular Biology Society of Japan.
Aag-initiated base excision repair drives alkylation-induced retinal degeneration in mice.
Meira, Lisiane B; Moroski-Erkul, Catherine A; Green, Stephanie L; Calvo, Jennifer A; Bronson, Roderick T; Shah, Dharini; Samson, Leona D
2009-01-20
Vision loss affects >3 million Americans and many more people worldwide. Although predisposing genes have been identified their link to known environmental factors is unclear. In wild-type animals DNA alkylating agents induce photoreceptor apoptosis and severe retinal degeneration. Alkylation-induced retinal degeneration is totally suppressed in the absence of the DNA repair protein alkyladenine DNA glycosylase (Aag) in both differentiating and postmitotic retinas. Moreover, transgenic expression of Aag activity restores the alkylation sensitivity of photoreceptors in Aag null animals. Aag heterozygotes display an intermediate level of retinal degeneration, demonstrating haploinsufficiency and underscoring that Aag expression confers a dominant retinal degeneration phenotype.
Targeted ablation of Crb2 in photoreceptor cells induces retinitis pigmentosa
Alves, Celso Henrique; Pellissier, Lucie P; Vos, Rogier M; Garcia Garrido, Marina; Sothilingam, Vithiyanjali; Seide, Christina; Beck, Susanne C; Klooster, J.; Furukawa, Takahisa; Flannery, John G; Verhaagen, J.; Seeliger, Mathias W; Wijnholds, J.
2014-01-01
In humans, the Crumbs homolog-1 (CRB1) gene is mutated in autosomal recessive Leber congenital amaurosis and early-onset retinitis pigmentosa. In mammals, the Crumbs family is composed of: CRB1, CRB2, CRB3A and CRB3B. Recently, we showed that removal of mouse Crb2 from retinal progenitor cells, and
Dryja, Thaddeus P.; McGee, Terri L.; Berson, Eliot L.; Fishman, Gerald A.; Sandberg, Michael A.; Alexander, Kenneth R.; Derlacki, Deborah J.; Rajagopalan, Aruna S.
2005-01-01
We report three unrelated patients with mutations in the GRM6 gene that normally encodes the glutamate receptor mGluR6. This neurotransmitter receptor has been shown previously to be present only in the synapses of the ON bipolar cell dendrites, and it mediates synaptic transmission from rod and cone photoreceptors to this type of second-order neuron. Despite the synaptic defect, best visual acuities were normal or only moderately reduced (20/15 to 20/40). The patients were night blind from an early age, and when maximally dark-adapted, they could perceive lights only with an intensity equal to or slightly dimmer than that normally detected by the cone system (i.e., 2-3 log units above normal). Electroretinograms (ERGs) in response to single brief flashes of light had clearly detectable a-waves, which are derived from photoreceptors, and greatly reduced b-waves, which are derived from the second-order inner retinal neurons. ERGs in response to sawtooth flickering light indicated a markedly reduced ON response and a nearly normal OFF response. There was no subjective delay in the perception of suddenly appearing white vs. black objects on a gray background. These patients exemplify a previously unrecognized, autosomal recessive form of congenital night blindness associated with a negative ERG waveform. PMID:15781871
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
Retinal Detachment: Torn or Detached Retina Diagnosis
... Feb 20, 2018 Gene Therapy May Be a Game-Changer for People With Inherited Retinal Disease Dec 19, 2017 ... the Academy Jobs at the Academy Financial Relationships with Industry Medical Disclaimer Privacy Policy Terms of Service For ...
Retinal Detachment: Torn or Detached Retina Treatment
... Feb 20, 2018 Gene Therapy May Be a Game-Changer for People With Inherited Retinal Disease Dec 19, 2017 ... the Academy Jobs at the Academy Financial Relationships with Industry Medical Disclaimer Privacy Policy Terms of Service For ...
Retinal Detachment: Torn or Detached Retina Symptoms
... Feb 20, 2018 Gene Therapy May Be a Game-Changer for People With Inherited Retinal Disease Dec 19, 2017 ... the Academy Jobs at the Academy Financial Relationships with Industry Medical Disclaimer Privacy Policy Terms of Service For ...
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Trezza, Alfonso; Bernini, Andrea; Langella, Andrea; Ascher, David B; Pires, Douglas E V; Sodi, Andrea; Passerini, Ilaria; Pelo, Elisabetta; Rizzo, Stanislao; Niccolai, Neri; Spiga, Ottavia
2017-10-01
The aim of this article is to report the investigation of the structural features of ABCA4, a protein associated with a genetic retinal disease. A new database collecting knowledge of ABCA4 structure may facilitate predictions about the possible functional consequences of gene mutations observed in clinical practice. In order to correlate structural and functional effects of the observed mutations, the structure of mouse P-glycoprotein was used as a template for homology modeling. The obtained structural information and genetic data are the basis of our relational database (ABCA4Database). Sequence variability among all ABCA4-deposited entries was calculated and reported as Shannon entropy score at the residue level. The three-dimensional model of ABCA4 structure was used to locate the spatial distribution of the observed variable regions. Our predictions from structural in silico tools were able to accurately link the functional effects of mutations to phenotype. The development of the ABCA4Database gathers all the available genetic and structural information, yielding a global view of the molecular basis of some retinal diseases. ABCA4 modeled structure provides a molecular basis on which to analyze protein sequence mutations related to genetic retinal disease in order to predict the risk of retinal disease across all possible ABCA4 mutations. Additionally, our ABCA4 predicted structure is a good starting point for the creation of a new data analysis model, appropriate for precision medicine, in order to develop a deeper knowledge network of the disease and to improve the management of patients.
Luhmann, Ulrich F O; Lin, Jihong; Acar, Niyazi; Lammel, Stefanie; Feil, Silke; Grimm, Christian; Seeliger, Mathias W; Hammes, Hans-Peter; Berger, Wolfgang
2005-09-01
To characterize developmental defects and the time course of Norrie disease in retinal and hyaloid vasculature during retinal development and to identify underlying molecular angiogenic pathways that may be affected in Norrie disease, exudative vitreoretinopathy, retinopathy of prematurity, and Coats' disease. Norrie disease pseudoglioma homologue (Ndph)-knockout mice were studied during retinal development at early postnatal (p) stages (p5, p10, p15, and p21). Histologic techniques, quantitative RT-PCR, ELISA, and Western blot analyses provided molecular data, and scanning laser ophthalmoscopy (SLO) angiography and electroretinography (ERG) were used to obtain in vivo data. The data showed that regression of the hyaloid vasculature of Ndph-knockout mice occurred but was drastically delayed. The development of the superficial retinal vasculature was strongly delayed, whereas the deep retinal vasculature did not form because of the blockage of vessel outgrowth into the deep retinal layers. Subsequently, microaneurysm-like lesions formed. Several angiogenic factors were differentially transcribed during retinal development. Increased levels of hypoxia inducible factor-1alpha (HIF1alpha) and VEGFA, as well as a characteristic ERG pattern, confirmed hypoxic conditions in the inner retina of the Ndph-knockout mouse. These data provide evidence for a crucial role of Norrin in hyaloid vessel regression and in sprouting angiogenesis during retinal vascular development, especially in the development of the deep retinal capillary networks. They also suggest an early and a late phase of Norrie disease and may provide an explanation for similar phenotypic features of allelic retinal diseases in mice and patients as secondary consequences of pathologic hypoxia.
Genetic determinants of hyaloid and retinal vasculature in zebrafish
Directory of Open Access Journals (Sweden)
Hyde David R
2007-10-01
Full Text Available Abstract Background The retinal vasculature is a capillary network of blood vessels that nourishes the inner retina of most mammals. Developmental abnormalities or microvascular complications in the retinal vasculature result in severe human eye diseases that lead to blindness. To exploit the advantages of zebrafish for genetic, developmental and pharmacological studies of retinal vasculature, we characterised the intraocular vasculature in zebrafish. Results We show a detailed morphological and developmental analysis of the retinal blood supply in zebrafish. Similar to the transient hyaloid vasculature in mammalian embryos, vessels are first found attached to the zebrafish lens at 2.5 days post fertilisation. These vessels progressively lose contact with the lens and by 30 days post fertilisation adhere to the inner limiting membrane of the juvenile retina. Ultrastructure analysis shows these vessels to exhibit distinctive hallmarks of mammalian retinal vasculature. For example, smooth muscle actin-expressing pericytes are ensheathed by the basal lamina of the blood vessel, and vesicle vacuolar organelles (VVO, subcellular mediators of vessel-retinal nourishment, are present. Finally, we identify 9 genes with cell membrane, extracellular matrix and unknown identity that are necessary for zebrafish hyaloid and retinal vasculature development. Conclusion Zebrafish have a retinal blood supply with a characteristic developmental and adult morphology. Abnormalities of these intraocular vessels are easily observed, enabling application of genetic and chemical approaches in zebrafish to identify molecular regulators of hyaloid and retinal vasculature in development and disease.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
Booij, J C; Florijn, R J; ten Brink, J B; Loves, W; Meire, F; van Schooneveld, M J; de Jong, P T V M; Bergen, A A B
2005-11-01
To identify mutations in the AIPL1, CRB1, GUCY2D, RPE65, and RPGRIP1 genes in patients with juvenile retinitis pigmentosa. Mutation analysis was carried out in a group of 35 unrelated patients with juvenile autosomal recessive retinitis pigmentosa (ARRP), Leber's congenital amaurosis (LCA), or juvenile isolated retinitis pigmentosa (IRP), by denaturing high performance liquid chromatography followed by direct sequencing. All three groups of patients showed typical combinations of eye signs associated with retinitis pigmentosa: pale optic discs, narrow arterioles, pigmentary changes, and nystagmus. Mutations were found in 34% of in CRB1 (11%), GUCY2D (11%), RPE65 (6%), and RPGRIP1 (6%). Nine mutations are reported, including a new combination of two mutations in CRB1, and new mutations in GUCY2D and RPGRIP1. The new GUCY2D mutation (c.3283delC, p.Pro1069ArgfsX37) is the first pathological sequence change reported in the intracellular C-terminal domain of GUCY2D, and did not lead to the commonly associated LCA, but to a juvenile retinitis pigmentosa phenotype. The polymorphic nature of three previously described (pathological) sequence changes in AIPL1, CRB1, and RPGRIP1 was established. Seven new polymorphic changes, useful for further association studies, were found. New and previously described sequence changes were detected in retinitis pigmentosa in CRB1, GUCY2D, and RPGRIP1; and in LCA patients in CRB1, GUCY2D, and RPE65. These data, combined with previous reports, suggest that LCA and juvenile ARRP are closely related and belong to a continuous spectrum of juvenile retinitis pigmentosa.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Shaibani, Aziz; Wong, Lee-Jun; Wei Zhang, Victor; Lewis, Richard Alan; Shinawi, Marwan
2015-01-01
Posterior column ataxia with retinitis pigmentosa (PCARP) is an autosomal recessive disorder characterized by severe sensory ataxia, muscle weakness and atrophy, and progressive pigmentary retinopathy. Recently, mutations in the FLVCR1 gene were described in four families with this condition. We investigated the molecular basis and studied the phenotype of PCARP in a new family. The proband is a 33-year-old woman presented with sensory polyneuropathy and retinitis pigmentosa (RP). The constellation of clinical findings with normal metabolic and genetic evaluation, including mitochondrial DNA (mtDNA) analysis and normal levels of phytanic acid and vitamin E, prompted us to seek other causes of our patient's condition. Sequencing of FLVCR1 in the proband and targeted mutation testing in her two affected siblings revealed two novel variants, c.1547G > A (p.R516Q) and c.1593+5_+8delGTAA predicted, respectively, to be highly conserved throughout evolution and affecting the normal splicing, therefore, deleterious. This study supports the pathogenic role of FLVCR1 in PCARP and expands the molecular and clinical spectra of PCARP. We show for the first time that nontransmembrane domain (TMD) mutations in the FLVCR1 can cause PCARP, suggesting different mechanisms for pathogenicity. Our clinical data reveal that impaired sensation can be part of the phenotypic spectrum of PCARP. This study along with previously reported cases suggests that targeted sequencing of the FLVCR1 gene should be considered in patients with severe sensory ataxia, RP, and peripheral sensory neuropathy.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Ashtari, Manzar; Zhang, Hui; Cook, Philip A.; Cyckowski, Laura L.; Shindler, Kenneth S.; Marshall, Kathleen A.; Aravand, Puya; Vossough, Arastoo; Gee, James C.; Maguire, Albert M.; Baker, Chris I.; Bennett, Jean
2015-01-01
Much of our knowledge of the mechanisms underlying plasticity in the visual cortex in response to visual impairment, vision restoration, and environmental interactions comes from animal studies. We evaluated human brain plasticity in a group of patients with Leber’s congenital amaurosis (LCA), who regained vision through gene therapy. Using non-invasive multimodal neuroimaging methods, we demonstrated that reversing blindness with gene therapy promoted long-term structural plasticity in the visual pathways emanating from the treated retina of LCA patients. The data revealed improvements and normalization along the visual fibers corresponding to the site of retinal injection of the gene therapy vector carrying the therapeutic gene in the treated eye compared to the visual pathway for the untreated eye of LCA patients. After gene therapy, the primary visual pathways (for example, geniculostriate fibers) in the treated retina were similar to those of sighted control subjects, whereas the primary visual pathways of the untreated retina continued to deteriorate. Our results suggest that visual experience, enhanced by gene therapy, may be responsible for the reorganization and maturation of synaptic connectivity in the visual pathways of the treated eye in LCA patients. The interactions between the eye and the brain enabled improved and sustained long-term visual function in patients with LCA after gene therapy. PMID:26180100
Qu, Zepeng; Guan, Yuan; Cui, Lu; Song, Jian; Gu, Junjie; Zhao, Hanzhi; Xu, Lei; Lu, Lixia; Jin, Ying; Xu, Guo-Tong
2015-11-09
Degenerative retinal diseases like age-related macular degeneration (AMD) are the leading cause of blindness. Cell transplantation showed promising therapeutic effect for such diseases, and embryonic stem cell (ESC) is one of the sources of such donor cells. Here, we aimed to generate retinal progenitor cells (RPCs) from rat ESCs (rESCs) and to test their therapeutic effects in rat model. The rESCs (DA8-16) were cultured in N2B27 medium with 2i, and differentiated to two types of RPCs following the SFEBq method with modifications. For rESC-RPC1, the cells were switched to adherent culture at D10, while for rESC-RPC2, the suspension culture was maintained to D14. Both RPCs were harvested at D16. Primary RPCs were obtained from P1 SD rats, and some of them were labeled with EGFP by infection with lentivirus. To generate Rax::EGFP knock-in rESC lines, TALENs were engineered to facilitate homologous recombination in rESCs, which were cotransfected with the targeting vector and TALEN vectors. The differentiated cells were analyzed with live image, immunofluorescence staining, flow cytometric analysis, gene expression microarray, etc. RCS rats were used to mimic the degeneration of retina and test the therapeutic effects of subretinally transplanted donor cells. The structure and function of retina were examined. We established two protocols through which two types of rESC-derived RPCs were obtained and both contained committed retina lineage cells and some neural progenitor cells (NPCs). These rESC-derived RPCs survived in the host retinas of RCS rats and protected the retinal structure and function in early stage following the transplantation. However, the glia enriched rESC-RPC1 obtained through early and longer adherent culture only increased the b-wave amplitude at 4 weeks, while the longer suspension culture gave rise to evidently neuronal differentiation in rESC-RPC2 which significantly improved the visual function of RCS rats. We have successfully differentiated
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Directory of Open Access Journals (Sweden)
Marie-Noëlle Delyfer
Full Text Available BACKGROUND: Retinal detachment often leads to a severe and permanent loss of vision and its therapeutic management remains to this day exclusively surgical. We have used surgical specimens to perform a differential analysis of the transcriptome of human retinal tissues following detachment in order to identify new potential pharmacological targets that could be used in combination with surgery to further improve final outcome. METHODOLOGY/PRINCIPAL FINDINGS: Statistical analysis reveals major involvement of the immune response in the disease. Interestingly, using a novel approach relying on coordinated expression, the interindividual variation was monitored to unravel a second crucial aspect of the pathological process: the death of photoreceptor cells. Within the genes identified, the expression of the major histocompatibility complex I gene HLA-C enables diagnosis of the disease, while PKD2L1 and SLCO4A1 -which are both down-regulated- act synergistically to provide an estimate of the duration of the retinal detachment process. Our analysis thus reveals the two complementary cellular and molecular aspects linked to retinal detachment: an immune response and the degeneration of photoreceptor cells. We also reveal that the human specimens have a higher clinical value as compared to artificial models that point to IL6 and oxidative stress, not implicated in the surgical specimens studied here. CONCLUSIONS/SIGNIFICANCE: This systematic analysis confirmed the occurrence of both neurodegeneration and inflammation during retinal detachment, and further identifies precisely the modification of expression of the different genes implicated in these two phenomena. Our data henceforth give a new insight into the disease process and provide a rationale for therapeutic strategies aimed at limiting inflammation and photoreceptor damage associated with retinal detachment and, in turn, improving visual prognosis after retinal surgery.
Circadian perinatal photoperiod has enduring effects on retinal dopamine and visual function.
Jackson, Chad R; Capozzi, Megan; Dai, Heng; McMahon, Douglas G
2014-03-26
Visual system development depends on neural activity, driven by intrinsic and light-sensitive mechanisms. Here, we examined the effects on retinal function due to exposure to summer- and winter-like circadian light cycles during development and adulthood. Retinal light responses, visual behaviors, dopamine content, retinal morphology, and gene expression were assessed in mice reared in seasonal photoperiods consisting of light/dark cycles of 8:16, 16:8, and 12:12 h, respectively. Mice exposed to short, winter-like, light cycles showed enduring deficits in photopic retinal light responses and visual contrast sensitivity, but only transient changes were observed for scotopic measures. Dopamine levels were significantly lower in short photoperiod mice, and dopaminergic agonist treatment rescued the photopic light response deficits. Tyrosine hydroxylase and Early Growth Response factor-1 mRNA expression were reduced in short photoperiod retinas. Therefore, seasonal light cycles experienced during retinal development and maturation have lasting influence on retinal and visual function, likely through developmental programming of retinal dopamine.
Arai, Yuuki; Maeda, Akiko; Hirami, Yasuhiko; Ishigami, Chie; Kosugi, Shinji; Mandai, Michiko; Kurimoto, Yasuo; Takahashi, Masayo
2015-01-01
The aim of this study was to gain information about disease prevalence and to identify the responsible genes for inherited retinal dystrophies (IRD) in Japanese populations. Clinical and molecular evaluations were performed on 349 patients with IRD. For segregation analyses, 63 of their family members were employed. Bioinformatics data from 1,208 Japanese individuals were used as controls. Molecular diagnosis was obtained by direct sequencing in a stepwise fashion utilizing one or two panels of 15 and 27 genes for retinitis pigmentosa patients. If a specific clinical diagnosis was suspected, direct sequencing of disease-specific genes, that is, ABCA4 for Stargardt disease, was conducted. Limited availability of intrafamily information and decreasing family size hampered identifying inherited patterns. Differential disease profiles with lower prevalence of Stargardt disease from European and North American populations were obtained. We found 205 sequence variants in 159 of 349 probands with an identification rate of 45.6%. This study found 43 novel sequence variants. In silico analysis suggests that 20 of 25 novel missense variants are pathogenic. EYS mutations had the highest prevalence at 23.5%. c.4957_4958insA and c.8868C>A were the two major EYS mutations identified in this cohort. EYS mutations are the most prevalent among Japanese patients with IRD.
Directory of Open Access Journals (Sweden)
Yuuki Arai
2015-01-01
Full Text Available The aim of this study was to gain information about disease prevalence and to identify the responsible genes for inherited retinal dystrophies (IRD in Japanese populations. Clinical and molecular evaluations were performed on 349 patients with IRD. For segregation analyses, 63 of their family members were employed. Bioinformatics data from 1,208 Japanese individuals were used as controls. Molecular diagnosis was obtained by direct sequencing in a stepwise fashion utilizing one or two panels of 15 and 27 genes for retinitis pigmentosa patients. If a specific clinical diagnosis was suspected, direct sequencing of disease-specific genes, that is, ABCA4 for Stargardt disease, was conducted. Limited availability of intrafamily information and decreasing family size hampered identifying inherited patterns. Differential disease profiles with lower prevalence of Stargardt disease from European and North American populations were obtained. We found 205 sequence variants in 159 of 349 probands with an identification rate of 45.6%. This study found 43 novel sequence variants. In silico analysis suggests that 20 of 25 novel missense variants are pathogenic. EYS mutations had the highest prevalence at 23.5%. c.4957_4958insA and c.8868C>A were the two major EYS mutations identified in this cohort. EYS mutations are the most prevalent among Japanese patients with IRD.
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Directory of Open Access Journals (Sweden)
Qi Zhou
2015-01-01
Full Text Available Background. Retinitis pigmentosa (RP is an inherited retinal degenerative disease, which is clinically and genetically heterogeneous, and the inheritance pattern is complex. In this study, we have intended to study the possible association of certain genes with X-linked RP (XLRP in a Chinese family. Methods. A Chinese family with RP was recruited, and a total of seven individuals were enrolled in this genetic study. Genomic DNA was isolated from peripheral leukocytes, and used for the next generation sequencing (NGS. Results. The affected individual presented the clinical signs of XLRP. A heterozygous missense mutation (c.1555C>T, p.R519W was identified by NGS in exon 13 of the CACNA1F gene on X chromosome, and was confirmed by Sanger sequencing. It showed perfect cosegregation with the disease in the family. The mutation at this position in the CACNA1F gene of RP was found novel by database searching. Conclusion. By using NGS, we have found a novel heterozygous missense mutation (c.1555C>T, p.R519W in CACNA1F gene, which is probably associated with XLRP. The findings might provide new insights into the cause and diagnosis of RP, and have implications for genetic counseling and clinical management in this family.
CLRN1 mutations cause nonsyndromic retinitis pigmentosa
Khan, M.I.; Kersten, F.F.J.; Azam, M.; Collin, R.W.J.; Hussain, A.; Shah, S.T.; Keunen, J.E.E.; Kremer, J.M.J.; Cremers, F.P.M.; Qamar, R.; Hollander, A.I. den
2011-01-01
OBJECTIVE: To describe the mutations in the CLRN1 gene in patients from 2 consanguineous Pakistani families diagnosed with autosomal recessive retinitis pigmentosa (arRP). DESIGN: Case-series study. PARTICIPANTS: Affected and unaffected individuals of 2 consanguineous Pakistani families and 90
Hypoxia-ischemia and retinal ganglion cell damage
Directory of Open Access Journals (Sweden)
Charanjit Kaur
2008-08-01
Full Text Available Charanjit Kaur1, Wallace S Foulds2, Eng-Ang Ling11Department of Anatomy, Yong Loo Lin School of Medicine, National University of Singapore, Singapore; 2Singapore Eye Research Institute, SingaporeAbstract: Retinal hypoxia is the potentially blinding mechanism underlying a number of sight-threatening disorders including central retinal artery occlusion, ischemic central retinal vein thrombosis, complications of diabetic eye disease and some types of glaucoma. Hypoxia is implicated in loss of retinal ganglion cells (RGCs occurring in such conditions. RGC death occurs by apoptosis or necrosis. Hypoxia-ischemia induces the expression of hypoxia inducible factor-1α and its target genes such as vascular endothelial growth factor (VEGF and nitric oxide synthase (NOS. Increased production of VEGF results in disruption of the blood retinal barrier leading to retinal edema. Enhanced expression of NOS results in increased production of nitric oxide which may be toxic to the cells resulting in their death. Excess glutamate release in hypoxic-ischemic conditions causes excitotoxic damage to the RGCs through activation of ionotropic and metabotropic glutamate receptors. Activation of glutamate receptors is thought to initiate damage in the retina by a cascade of biochemical effects such as neuronal NOS activation and increase in intracellular Ca2+ which has been described as a major contributing factor to RGC loss. Excess production of proinflammatory cytokines also mediates cell damage. Besides the above, free-radicals generated in hypoxic-ischemic conditions result in RGC loss because of an imbalance between antioxidant- and oxidant-generating systems. Although many advances have been made in understanding the mediators and mechanisms of injury, strategies to improve the damage are lacking. Measures to prevent neuronal injury have to be developed.Keywords: retinal hypoxia, retinal ganglion cells, glutamate receptors, neuronal injury, retina
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
Mechanisms of Retinal Damage after Ocular Alkali Burns.
Paschalis, Eleftherios I; Zhou, Chengxin; Lei, Fengyang; Scott, Nathan; Kapoulea, Vassiliki; Robert, Marie-Claude; Vavvas, Demetrios; Dana, Reza; Chodosh, James; Dohlman, Claes H
2017-06-01
Alkali burns to the eye constitute a leading cause of worldwide blindness. In recent case series, corneal transplantation revealed unexpected damage to the retina and optic nerve in chemically burned eyes. We investigated the physical, biochemical, and immunological components of retinal injury after alkali burn and explored a novel neuroprotective regimen suitable for prompt administration in emergency departments. Thus, in vivo pH, oxygen, and oxidation reduction measurements were performed in the anterior and posterior segment of mouse and rabbit eyes using implantable microsensors. Tissue inflammation was assessed by immunohistochemistry and flow cytometry. The experiments confirmed that the retinal damage is not mediated by direct effect of the alkali, which is effectively buffered by the anterior segment. Rather, pH, oxygen, and oxidation reduction changes were restricted to the cornea and the anterior chamber, where they caused profound uveal inflammation and release of proinflammatory cytokines. The latter rapidly diffuse to the posterior segment, triggering retinal damage. Tumor necrosis factor-α was identified as a key proinflammatory mediator of retinal ganglion cell death. Blockade, by either monoclonal antibody or tumor necrosis factor receptor gene knockout, reduced inflammation and retinal ganglion cell loss. Intraocular pressure elevation was not observed in experimental alkali burns. These findings illuminate the mechanism by which alkali burns cause retinal damage and may have importance in designing therapies for retinal protection. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Hoang, Quan V; Freund, K Bailey; Klancnik, James M; Sorenson, John A; Cunningham, Emmett T; Yannuzzi, Lawrence A
2012-01-01
To report three cases of solitary, focal retinal phlebitis. An observational case series. Three eyes in three patients were noted to have unilateral decreased vision, macular edema, and a focal retinal phlebitis, which was not at an arteriovenous crossing. All three patients developed a branch retinal vein occlusion at the site of inflammation. These patients had no other evidence of intraocular inflammation, including vitritis, retinitis, retinal vasculitis, or choroiditis, nor was there any systemic disorder associated with inflammation, infection, or coagulation identified. Focal retinal phlebitis appears to be an uncommon and unique entity that produces macular edema and ultimately branch retinal vein occlusion. In our patients, the focal phlebitis and venous occlusion did not occur at an arteriovenous crossing, which is the typical site for branch retinal venous occlusive disease. This suggests that our cases represent a distinct clinical entity, which starts with a focal abnormality in the wall of a retinal venule, resulting in surrounding exudation and, ultimately, ends with branch retinal vein occlusion.
An animal model for Norrie disease (ND): gene targeting of the mouse ND gene.
Berger, W; van de Pol, D; Bächner, D; Oerlemans, F; Winkens, H; Hameister, H; Wieringa, B; Hendriks, W; Ropers, H H
1996-01-01
In order to elucidate the cellular and molecular processes which are involved in Norrie disease (ND), we have used gene targeting technology to generate ND mutant mice. The murine homologue of the ND gene was cloned and shown to encode a polypeptide that shares 94% of the amino acid sequence with its human counterpart. RNA in situ hybridization revealed expression in retina, brain and the olfactory bulb and epithelium of 2 week old mice. Hemizygous mice carrying a replacement mutation in exon 2 of the ND gene developed retrolental structures in the vitreous body and showed an overall disorganization of the retinal ganglion cell layer. The outer plexiform layer disappears occasionally, resulting in a juxtaposed inner and outer nuclear layer. At the same regions, the outer segments of the photoreceptor cell layer are no longer present. These ocular findings are consistent with observations in ND patients and the generated mouse line provides a faithful model for study of early pathogenic events in this severe X-linked recessive neurological disorder.
Mitochondrial Protection by Exogenous Otx2 in Mouse Retinal Neurons
Directory of Open Access Journals (Sweden)
Hyoung-Tai Kim
2015-11-01
Full Text Available OTX2 (orthodenticle homeobox 2 haplodeficiency causes diverse defects in mammalian visual systems ranging from retinal dysfunction to anophthalmia. We find that the retinal dystrophy of Otx2+/GFP heterozygous knockin mice is mainly due to the loss of bipolar cells and consequent deficits in retinal activity. Among bipolar cell types, OFF-cone bipolar subsets, which lack autonomous Otx2 gene expression but receive Otx2 proteins from photoreceptors, degenerate most rapidly in Otx2+/GFP mouse retinas, suggesting a neuroprotective effect of the imported Otx2 protein. In support of this hypothesis, retinal dystrophy in Otx2+/GFP mice is prevented by intraocular injection of Otx2 protein, which localizes to the mitochondria of bipolar cells and facilitates ATP synthesis as a part of mitochondrial ATP synthase complex. Taken together, our findings demonstrate a mitochondrial function for Otx2 and suggest a potential therapeutic application of OTX2 protein delivery in human retinal dystrophy.
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Whiting, Rebecca E H; Jensen, Cheryl A; Pearce, Jacqueline W; Gillespie, Lauren E; Bristow, Daniel E; Katz, Martin L
2016-05-01
CLN2 disease is one of a group of lysosomal storage disorders called the neuronal ceroid lipofuscinoses (NCLs). The disease results from mutations in the TPP1 gene that cause an insufficiency or complete lack of the soluble lysosomal enzyme tripeptidyl peptidase-1 (TPP1). TPP1 is involved in lysosomal protein degradation, and lack of this enzyme results in the accumulation of protein-rich autofluorescent lysosomal storage bodies in numerous cell types including neurons throughout the central nervous system and the retina. CLN2 disease is characterized primarily by progressive loss of neurological functions and vision as well as generalized neurodegeneration and retinal degeneration. In children the progressive loss of neurological functions typically results in death by the early teenage years. A Dachshund model of CLN2 disease with a null mutation in TPP1 closely recapitulates the human disorder with a progression from disease onset at approximately 4 months of age to end-stage at 10-11 months. Delivery of functional TPP1 to the cerebrospinal fluid (CSF), either by periodic infusion of the recombinant protein or by a single administration of a TPP1 gene therapy vector to the CSF, significantly delays the onset and progression of neurological signs and prolongs life span but does not prevent the loss of vision or modest retinal degeneration that occurs by 11 months of age. In this study we found that in dogs that received the CSF gene therapy treatment, the degeneration of the retina and loss of retinal function continued to progress during the prolonged life spans of the treated dogs. Eventually the normal cell layers of the retina almost completely disappeared. An exception was the ganglion cell layer. In affected dogs that received TPP1 gene therapy to the CSF and survived an average of 80 weeks, ganglion cell axons were present in numbers comparable to those of normal Dachshunds of similar age. The selective preservation of the retinal ganglion cells suggests
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
Yoshida, S; Honda, M; Yoshida, A; Nakao, S; Goto, Y; Nakamura, T; Fujisawa, K; Ishibashi, T
2005-02-01
To report a novel mutation of the ABCC6 gene in a Japanese family that had a case of pseudoxanthoma elasticum (PXE) another with PXE and retinitis pigmentosa. Ophthalmologic examinations were performed, and the ABCC6 gene was analysed by direct genomic sequencing. Fundus examinations of the 48-year-old proband disclosed angioid streaks and a peud'orange appearance of the retina of the both eyes, whereas both of his 25- and 20-year-old daughters had pigmentary degeneration and angioid streaks. In the sibilings, the mixed cone-rod ERG was almost nondetectable, whereas that of the proband was well-preserved. Molecular genetic analysis revealed that the proband has a homozygous nonsense mutation at the 595 bp in the ABCC6, and the siblings were heterozygous for the same mutation. This mutation was not detected in Japanese subjects in the JSNP database (http://snp.ims.u-tokyo.ac.jp/). Our results demonstrated an association between a novel mutation in the ABCC6 gene and PXE in a Japanese family.
Nishiyama, Shoko; Slack, Olga A L; Lokugamage, Nandadeva; Hill, Terence E; Juelich, Terry L; Zhang, Lihong; Smith, Jennifer K; Perez, David; Gong, Bin; Freiberg, Alexander N; Ikegami, Tetsuro
2016-11-16
Rift Valley fever is a mosquito-borne zoonotic disease affecting ruminants and humans. Rift Valley fever virus (RVFV: family Bunyaviridae, genus Phlebovirus) causes abortions and fetal malformations in ruminants, and hemorrhagic fever, encephalitis, or retinitis in humans. The live-attenuated MP-12 vaccine is conditionally licensed for veterinary use in the US. However, this vaccine lacks a marker for the differentiation of vaccinated from infected animals (DIVA). NSs gene is dispensable for RVFV replication, and thus, rMP-12 strains lacking NSs gene is applicable to monitor vaccinated animals. However, the immunogenicity of MP-12 lacking NSs was not as high as parental MP-12. Thus, chimeric MP-12 strains encoding NSs from either Toscana virus (TOSV), sandfly fever Sicilian virus (SFSV) or Punta Toro virus Adames strain (PTA) were characterized previously. Although chimeric MP-12 strains are highly immunogenic, the attenuation through the S-segment remains unknown. Using pathogenic ZH501 strain, we aimed to demonstrate the attenuation of ZH501 strain through chimeric S-segment encoding either the NSs of TOSV, SFSV, PTA, or Punta Toro virus Balliet strain (PTB). In addition, we characterized rZH501 encoding a human dominant-negative PKR (PKRΔE7), which also enhances the immunogenicity of MP-12. Study done on mice revealed that attenuation of rZH501 occurred through the S-segment encoding either PKRΔE7 or SFSV NSs. However, rZH501 encoding either TOSV, PTA, or PTB NSs in the S-segment uniformly caused lethal encephalitis. Our results indicated that the S-segments encoding PKRΔE7 or SFSV NSs are attenuated and thus applicable toward next generation MP-12 vaccine candidates that encode a DIVA marker.
Directory of Open Access Journals (Sweden)
Daniel Ardeljan
Full Text Available Age-related macular degeneration (AMD is a common yet complex retinal degeneration that causes irreversible central blindness in the elderly. Pathology is widely believed to follow loss of retinal pigment epithelium (RPE and photoreceptor degeneration. Here we report aberrant expression of interleukin-17A (IL17A and the receptor IL17RC in the macula of AMD patients. In vitro, IL17A induces RPE cell death characterized by the accumulation of cytoplasmic lipids and autophagosomes with subsequent activation of pro-apoptotic Caspase-3 and Caspase-9. This pathology is reduced by siRNA knockdown of IL17RC. IL17-dependent retinal degeneration in a mouse model of focal retinal degeneration can be prevented by gene therapy with adeno-associated virus vector encoding soluble IL17 receptor. This intervention rescues RPE and photoreceptors in a MAPK-dependent process. The IL17 pathway plays a key role in RPE and photoreceptor degeneration and could hold therapeutic potential in AMD.
Directory of Open Access Journals (Sweden)
Clérin Emmanuelle
2011-12-01
Full Text Available Abstract Background Retinitis pigmentosa is characterized by the sequential loss of rod and cone photoreceptors. The preservation of cones would prevent blindness due to their essential role in human vision. Rod-derived Cone Viability Factor is a thioredoxin-like protein that is secreted by rods and is involved in cone survival. To validate the activity of Rod-derived Cone Viability Factors (RdCVFs as therapeutic agents for treating retinitis Pigmentosa, we have developed e-conome, an automated cell counting platform for retinal flat mounts of rodent models of cone degeneration. This automated quantification method allows for faster data analysis thereby accelerating translational research. Methods An inverted fluorescent microscope, motorized and coupled to a CCD camera records images of cones labeled with fluorescent peanut agglutinin lectin on flat-mounted retinas. In an average of 300 fields per retina, nine Z-planes at magnification X40 are acquired after two-stage autofocus individually for each field. The projection of the stack of 9 images is subject to a threshold, filtered to exclude aberrant images based on preset variables. The cones are identified by treating the resulting image using 13 variables empirically determined. The cone density is calculated over the 300 fields. Results The method was validated by comparison to the conventional stereological counting. The decrease in cone density in rd1 mouse was found to be equivalent to the decrease determined by stereological counting. We also studied the spatiotemporal pattern of the degeneration of cones in the rd1 mouse and show that while the reduction in cone density starts in the central part of the retina, cone degeneration progresses at the same speed over the whole retinal surface. We finally show that for mice with an inactivation of the Nucleoredoxin-like genes Nxnl1 or Nxnl2 encoding RdCVFs, the loss of cones is more pronounced in the ventral retina. Conclusion The automated
Clérin, Emmanuelle; Wicker, Nicolas; Mohand-Saïd, Saddek; Poch, Olivier; Sahel, José-Alain; Léveillard, Thierry
2011-12-20
Retinitis pigmentosa is characterized by the sequential loss of rod and cone photoreceptors. The preservation of cones would prevent blindness due to their essential role in human vision. Rod-derived Cone Viability Factor is a thioredoxin-like protein that is secreted by rods and is involved in cone survival. To validate the activity of Rod-derived Cone Viability Factors (RdCVFs) as therapeutic agents for treating retinitis Pigmentosa, we have developed e-conome, an automated cell counting platform for retinal flat mounts of rodent models of cone degeneration. This automated quantification method allows for faster data analysis thereby accelerating translational research. An inverted fluorescent microscope, motorized and coupled to a CCD camera records images of cones labeled with fluorescent peanut agglutinin lectin on flat-mounted retinas. In an average of 300 fields per retina, nine Z-planes at magnification X40 are acquired after two-stage autofocus individually for each field. The projection of the stack of 9 images is subject to a threshold, filtered to exclude aberrant images based on preset variables. The cones are identified by treating the resulting image using 13 variables empirically determined. The cone density is calculated over the 300 fields. The method was validated by comparison to the conventional stereological counting. The decrease in cone density in rd1 mouse was found to be equivalent to the decrease determined by stereological counting. We also studied the spatiotemporal pattern of the degeneration of cones in the rd1 mouse and show that while the reduction in cone density starts in the central part of the retina, cone degeneration progresses at the same speed over the whole retinal surface. We finally show that for mice with an inactivation of the Nucleoredoxin-like genes Nxnl1 or Nxnl2 encoding RdCVFs, the loss of cones is more pronounced in the ventral retina. The automated platform ℮-conome used here for retinal disease is a tool that
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
Directory of Open Access Journals (Sweden)
Thomas Riedel
Full Text Available Proteorhodopsin (PR photoheterotrophy in the marine flavobacterium Dokdonia sp. PRO95 has previously been investigated, showing no growth stimulation in the light at intermediate carbon concentrations. Here we report the genome sequence of strain PRO95 and compare it to two other PR encoding Dokdonia genomes: that of strain 4H-3-7-5 which shows the most similar genome, and that of strain MED134 which grows better in the light under oligotrophic conditions. Our genome analysis revealed that the PRO95 genome as well as the 4H-3-7-5 genome encode a protein related to xanthorhodopsins. The genomic environment and phylogenetic distribution of this gene suggest that it may have frequently been recruited by lateral gene transfer. Expression analyses by RT-PCR and direct mRNA-sequencing showed that both rhodopsins and the complete β-carotene pathway necessary for retinal production are transcribed in PRO95. Proton translocation measurements showed enhanced proton pump activity in response to light, supporting that one or both rhodopsins are functional. Genomic information and carbon source respiration data were used to develop a defined cultivation medium for PRO95, but reproducible growth always required small amounts of yeast extract. Although PRO95 contains and expresses two rhodopsin genes, light did not stimulate its growth as determined by cell numbers in a nutrient poor seawater medium that mimics its natural environment, confirming previous experiments at intermediate carbon concentrations. Starvation or stress conditions might be needed to observe the physiological effect of light induced energy acquisition.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Directory of Open Access Journals (Sweden)
Mathieu Marella
2010-07-01
Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally inherited disorder with point mutations in mitochondrial DNA which result in loss of vision in young adults. The majority of mutations reported to date are within the genes encoding the subunits of the mitochondrial NADH-quinone oxidoreductase, complex I. Establishment of animal models of LHON should help elucidate mechanism of the disease and could be utilized for possible development of therapeutic strategies.We established a rat model which involves injection of rotenone-loaded microspheres into the optic layer of the rat superior colliculus. The animals exhibited the most common features of LHON. Visual loss was observed within 2 weeks of rotenone administration with no apparent effect on retinal ganglion cells. Death of retinal ganglion cells occurred at a later stage. Using our rat model, we investigated the effect of the yeast alternative NADH dehydrogenase, Ndi1. We were able to achieve efficient expression of the Ndi1 protein in the mitochondria of all regions of retinal ganglion cells and axons by delivering the NDI1 gene into the optical layer of the superior colliculus. Remarkably, even after the vision of the rats was severely impaired, treatment of the animals with the NDI1 gene led to a complete restoration of the vision to the normal level. Control groups that received either empty vector or the GFP gene had no effects.The present study reports successful manifestation of LHON-like symptoms in rats and demonstrates the potential of the NDI1 gene therapy on mitochondrial optic neuropathies. Our results indicate a window of opportunity for the gene therapy to be applied successfully after the onset of the disease symptoms.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Johnen, Sandra; Meißner, Frank; Krug, Mario; Baltz, Thomas; Endler, Ingolf; Mokwa, Wilfried; Walter, Peter
2016-01-01
Background. To analyze the biocompatibility of vertically aligned multiwalled carbon nanotubes (MWCNT), used as nanomodification to optimize the properties of prostheses-embedded microelectrodes that induce electrical stimulation of surviving retinal cells. Methods. MWCNT were synthesized on silicon wafers. Their growth was achieved by iron particles (Fe) or mixtures of iron-platinum (Fe-Pt) and iron-titanium (Fe-Ti) acting as catalysts. Viability, growth, adhesion, and gene expression of L-929 and retinal precursor (R28) cells were analyzed after nondirect and direct contact. Results. Nondirect contact had almost no influence on cell growth, as measured in comparison to reference materials with defined levels of cytotoxicity. Both cell types exhibited good proliferation properties on each MWCNT-coated wafer. Viability ranged from 95.9 to 99.8%, in which better survival was observed for nonfunctionalized MWCNT generated with the Fe-Pt and Fe-Ti catalyst mixtures. R28 cells grown on the MWCNT-coated wafers showed a decreased gene expression associated with neural and glial properties. Expression of the cell cycle-related genes CCNC, MYC, and TP53 was slightly downregulated. Cultivation on plasma-treated MWCNT did not lead to additional changes. Conclusions. All tested MWCNT-covered slices showed good biocompatibility profiles, confirming that this nanotechnology is a promising tool to improve prostheses bearing electrodes which connect with retinal tissue.
Directory of Open Access Journals (Sweden)
Sandra Johnen
2016-01-01
Full Text Available Background. To analyze the biocompatibility of vertically aligned multiwalled carbon nanotubes (MWCNT, used as nanomodification to optimize the properties of prostheses-embedded microelectrodes that induce electrical stimulation of surviving retinal cells. Methods. MWCNT were synthesized on silicon wafers. Their growth was achieved by iron particles (Fe or mixtures of iron-platinum (Fe-Pt and iron-titanium (Fe-Ti acting as catalysts. Viability, growth, adhesion, and gene expression of L-929 and retinal precursor (R28 cells were analyzed after nondirect and direct contact. Results. Nondirect contact had almost no influence on cell growth, as measured in comparison to reference materials with defined levels of cytotoxicity. Both cell types exhibited good proliferation properties on each MWCNT-coated wafer. Viability ranged from 95.9 to 99.8%, in which better survival was observed for nonfunctionalized MWCNT generated with the Fe-Pt and Fe-Ti catalyst mixtures. R28 cells grown on the MWCNT-coated wafers showed a decreased gene expression associated with neural and glial properties. Expression of the cell cycle-related genes CCNC, MYC, and TP53 was slightly downregulated. Cultivation on plasma-treated MWCNT did not lead to additional changes. Conclusions. All tested MWCNT-covered slices showed good biocompatibility profiles, confirming that this nanotechnology is a promising tool to improve prostheses bearing electrodes which connect with retinal tissue.
Large-scale imaging of retinal output activity
Litke, A M; Dabrowski, W; Grillo, A A; Grybos, P; Kachiguine, S; Rahman, M; Taylor, G
2003-01-01
A system is being developed to study how the retina processes, encodes and communicates information about the visual world to the brain. It will image the activity of retinal output neurons over a region of live retina approaching that used for significant neural computation in the visual cortex. A prototype system consisting of 61 microelectrodes, covering an area of 0.17 mm**2, is described, including some first results with monkey retina. The plans and status for a system with 512 microelectrodes, covering an area of 1.7 mm**2, are also given.
Directory of Open Access Journals (Sweden)
Thing-Fong Tzeng
2015-09-01
Full Text Available The present study investigates the amelioration of diabetic retinopathy (DR by Zingiber zerumbet rhizome ethanol extracts (ZZRext in streptozotocin-induced diabetic rats (STZ-diabetic rats. ZZRext contains high phenolic and flavonoid contents. STZ-diabetic rats were treated orally with ZZRext (200, 300 mg/kg per day for three months. Blood-retinal barrier (BRB breakdown and increased vascular permeability were found in diabetic rats, with downregulation of occludin, and claudin-5. ZZRext treatment effectively preserved the expression of occludin, and claudin-5, leading to less BRB breakdown and less vascular permeability. Retinal histopathological observation showed that the disarrangement and reduction in thickness of retinal layers were reversed in ZZRext-treated diabetic rats. Retinal gene expression of tumor necrosis factor-α, interleukin (IL-1β, IL-6, vascular endothelial growth factor, intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 were all decreased in ZZRext-treated diabetic rats. Moreover, ZZRext treatment not only inhibited the nuclear factor κB (NF-κB activation, but also downregulated the protein expression of p38 mitogen-activated protein kinase (MAPK in diabetic retina. In conclusion, the results suggest that the retinal protective effects of ZZRext occur through improved retinal structural change and inhibiting retinal inflammation. The antiretinopathy property of ZZRext might be related to the downregulation of p38 MAPK and NF-κB signal transduction induced by diabetes.
Mixing of Chromatic and Luminance Retinal Signals in Primate Area V1.
Li, Xiaobing; Chen, Yao; Lashgari, Reza; Bereshpolova, Yulia; Swadlow, Harvey A; Lee, Barry B; Alonso, Jose Manuel
2015-07-01
Vision emerges from activation of chromatic and achromatic retinal channels whose interaction in visual cortex is still poorly understood. To investigate this interaction, we recorded neuronal activity from retinal ganglion cells and V1 cortical cells in macaques and measured their visual responses to grating stimuli that had either luminance contrast (luminance grating), chromatic contrast (chromatic grating), or a combination of the two (compound grating). As with parvocellular or koniocellular retinal ganglion cells, some V1 cells responded mostly to the chromatic contrast of the compound grating. As with magnocellular retinal ganglion cells, other V1 cells responded mostly to the luminance contrast and generated a frequency-doubled response to equiluminant chromatic gratings. Unlike magnocellular and parvocellular retinal ganglion cells, V1 cells formed a unimodal distribution for luminance/color preference with a 2- to 4-fold bias toward luminance. V1 cells associated with positive local field potentials in deep layers showed the strongest combined responses to color and luminance and, as a population, V1 cells encoded a diverse combination of luminance/color edges that matched edge distributions of natural scenes. Taken together, these results suggest that the primary visual cortex combines magnocellular and parvocellular retinal inputs to increase cortical receptive field diversity and to optimize visual processing of our natural environment. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Schnetkamp, Paul P M
2013-01-01
Members of the SLC24 gene family encode K(+)-dependent Na(+)/Ca(2+) exchangers (NCKX) that utilize both the inward Na(+) and outward K(+) gradients to extrude Ca(2+) from cells. There are five human SLC24 genes that play a role in biological process as diverse as vision in retinal rod and cone photoreceptors, olfaction, skin pigmentation and at least three of the five genes are also widely expressed in the brain. Here I review the functional, physiological and structural features of NCKX proteins that have emerged in the past few years. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Timing the Generation of Distinct Retinal Cells by Homeobox Proteins
Decembrini, Sarah; Andreazzoli, Massimiliano; Vignali, Robert; Barsacchi, Giuseppina; Cremisi, Federico
2006-01-01
The reason why different types of vertebrate nerve cells are generated in a particular sequence is still poorly understood. In the vertebrate retina, homeobox genes play a crucial role in establishing different cell identities. Here we provide evidence of a cellular clock that sequentially activates distinct homeobox genes in embryonic retinal cells, linking the identity of a retinal cell to its time of generation. By in situ expression analysis, we found that the three Xenopus homeobox genes Xotx5b, Xvsx1, and Xotx2 are initially transcribed but not translated in early retinal progenitors. Their translation requires cell cycle progression and is sequentially activated in photoreceptors (Xotx5b) and bipolar cells (Xvsx1 and Xotx2). Furthermore, by in vivo lipofection of “sensors” in which green fluorescent protein translation is under control of the 3′ untranslated region (UTR), we found that the 3′ UTRs of Xotx5b, Xvsx1, and Xotx2 are sufficient to drive a spatiotemporal pattern of translation matching that of the corresponding proteins and consistent with the time of generation of photoreceptors (Xotx5b) and bipolar cells (Xvsx1 and Xotx2). The block of cell cycle progression of single early retinal progenitors impairs their differentiation as photoreceptors and bipolar cells, but is rescued by the lipofection of Xotx5b and Xvsx1 coding sequences, respectively. This is the first evidence to our knowledge that vertebrate homeobox proteins can work as effectors of a cellular clock to establish distinct cell identities. PMID:16903786
Timing the generation of distinct retinal cells by homeobox proteins.
Directory of Open Access Journals (Sweden)
Sarah Decembrini
2006-09-01
Full Text Available The reason why different types of vertebrate nerve cells are generated in a particular sequence is still poorly understood. In the vertebrate retina, homeobox genes play a crucial role in establishing different cell identities. Here we provide evidence of a cellular clock that sequentially activates distinct homeobox genes in embryonic retinal cells, linking the identity of a retinal cell to its time of generation. By in situ expression analysis, we found that the three Xenopus homeobox genes Xotx5b, Xvsx1, and Xotx2 are initially transcribed but not translated in early retinal progenitors. Their translation requires cell cycle progression and is sequentially activated in photoreceptors (Xotx5b and bipolar cells (Xvsx1 and Xotx2. Furthermore, by in vivo lipofection of "sensors" in which green fluorescent protein translation is under control of the 3' untranslated region (UTR, we found that the 3' UTRs of Xotx5b, Xvsx1, and Xotx2 are sufficient to drive a spatiotemporal pattern of translation matching that of the corresponding proteins and consistent with the time of generation of photoreceptors (Xotx5b and bipolar cells (Xvsx1 and Xotx2. The block of cell cycle progression of single early retinal progenitors impairs their differentiation as photoreceptors and bipolar cells, but is rescued by the lipofection of Xotx5b and Xvsx1 coding sequences, respectively. This is the first evidence to our knowledge that vertebrate homeobox proteins can work as effectors of a cellular clock to establish distinct cell identities.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Requirement of Smad4 from Ocular Surface Ectoderm for Retinal Development.
Li, Jing; Wang, Shusheng; Anderson, Chastain; Zhao, Fangkun; Qin, Yu; Wu, Di; Wu, Xinwei; Liu, Jia; He, Xuefei; Zhao, Jiangyue; Zhang, Jinsong
2016-01-01
Microphthalmia is characterized by abnormally small eyes and usually retinal dysplasia, accounting for up to 11% of the blindness in children. Right now there is no effective treatment for the disease, and the underlying mechanisms, especially how retinal dysplasia develops from microphthalmia and whether it depends on the signals from lens ectoderm are still unclear. Mutations in genes of the TGF-β superfamily have been noted in patients with microphthalmia. Using conditional knockout mice, here we address the question that whether ocular surface ectoderm-derived Smad4 modulates retinal development. We found that loss of Smad4 specifically on surface lens ectoderm leads to microphthalmia and dysplasia of retina. Retinal dysplasia in the knockout mice is caused by the delayed or failed differentiation and apoptosis of retinal cells. Microarray analyses revealed that members of Hedgehog and Wnt signaling pathways are affected in the knockout retinas, suggesting that ocular surface ectoderm-derived Smad4 can regulate Hedgehog and Wnt signaling in the retina. Our studies suggest that defective of ocular surface ectoderm may affect retinal development.
Dorzolamide increases retinal oxygen tension after branch retinal vein occlusion
DEFF Research Database (Denmark)
Noergaard, Michael Hove; Bach-Holm, Daniella; Scherfig, Erik
2008-01-01
To study the effect of dorzolamide on the preretinal oxygen tension (RPO(2)) in retinal areas affected by experimental branch retinal vein occlusion (BRVO) in pigs.......To study the effect of dorzolamide on the preretinal oxygen tension (RPO(2)) in retinal areas affected by experimental branch retinal vein occlusion (BRVO) in pigs....
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Peripheral retinal degenerations and the risk of retinal detachment.
Lewis, Hilel
2003-07-01
To review the degenerative diseases of the peripheral retina in relationship with the risk to develop a rhegmatogenous retinal detachment and to present recommendations for use in eyes at increased risk of developing a retinal detachment. Focused literature review and author's clinical experience. Retinal degenerations are common lesions involving the peripheral retina, and most of them are clinically insignificant. Lattice degeneration, degenerative retinoschisis, cystic retinal tufts, and, rarely, zonular traction tufts, can result in a rhegmatogenous retinal detachment. Therefore, these lesions have been considered for prophylactic therapy; however, adequate studies have not been performed to date. Well-designed, prospective, randomized clinical studies are necessary to determine the benefit-risk ratio of prophylactic treatment. In the meantime, the evidence available suggests that most of the peripheral retinal degenerations should not be treated except in rare, high-risk situations.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa
Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying
2014-01-01
Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
International Nuclear Information System (INIS)
Maita, Hiroshi; Kitaura, Hirotake; Keen, T. Jeffrey; Inglehearn, Chris F.; Ariga, Hiroyoshi; Iguchi-Ariga, Sanae M.M.
2004-01-01
PAP-1 is an in vitro phosphorylation target of the Pim-1 oncogene. Although PAP-1 binds to Pim-1, it is not a substrate for phosphorylation by Pim-1 in vivo. PAP-1 has recently been implicated as the defective gene in RP9, one type of autosomal dominant retinitis pigmentosa (adRP). However, RP9 is a rare disease and only two missense mutations have been described, so the report of a link between PAP-1 and RP9 was tentative. The precise cellular role of PAP-1 was also unknown at that time. We now report that PAP-1 localizes in nuclear speckles containing the splicing factor SC35 and interacts directly with another splicing factor, U2AF35. Furthermore, we used in vitro and in vivo splicing assays to show that PAP-1 has an activity, which alters the pattern of pre-mRNA splicing and that this activity is dependent on the phosphorylation state of PAP-1. We used the same splicing assay to examine the activities of two mutant forms of PAP-1 found in RP9 patients. The results showed that while one of the mutations, H137L, had no effect on splicing activity compared with that of wild-type PAP-1, the other, D170G, resulted in both a defect in splicing activity and a decreased proportion of phosphorylated PAP-1. The D170G mutation may therefore cause RP by altering splicing of retinal genes through a decrease in PAP-1 phosphorylation. These results demonstrate that PAP-1 has a role in pre-mRNA splicing and, given that three other splicing factors have been implicated in adRP, this finding provides compelling further evidence that PAP-1 is indeed the RP9 gene
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Retinal vascular oximetry during ranibizumab treatment of central retinal vein occlusion
DEFF Research Database (Denmark)
Traustason, Sindri; la Cour, Morten; Larsen, Michael
2014-01-01
PURPOSE: To investigate the effect of intravitreal injections of the vascular endothelial growth factor inhibitor ranibizumab on retinal oxygenation in patients with central retinal vein occlusion (CRVO). METHODS: Retinal oxygen saturation in patients with CRVO was analysed using the Oxymap Retin...
The gene therapy revolution in ophthalmology.
Al-Saikhan, Fahad I
2013-04-01
The advances in gene therapy hold significant promise for the treatment of ophthalmic conditions. Several studies using animal models have been published. Animal models on retinitis pigmentosa, Leber's Congenital Amaurosis (LCA), and Stargardt disease have involved the use of adeno-associated virus (AAV) to deliver functional genes into mice and canines. Mice models have been used to show that a mutation in cGMP phosphodiesterase that results in retinitis pigmentosa can be corrected using rAAV vectors. Additionally, rAAV vectors have been successfully used to deliver ribozyme into mice with a subsequent improvement in autosomal dominant retinitis pigmentosa. By using dog models, researchers have made progress in studying X-linked retinitis pigmentosa which results from a RPGR gene mutation. Mouse and canine models have also been used in the study of LCA. The widely studied form of LCA is LCA2, resulting from a mutation in the gene RPE65. Mice and canines that were injected with normal copies of RPE65 gene showed signs such as improved retinal pigment epithelium transduction, visual acuity, and functional recovery. Studies on Stargardt disease have shown that mutations in the ABCA4 gene can be corrected with AAV vectors, or nanoparticles. Gene therapy for the treatment of red-green color blindness was successful in squirrel monkeys. Plans are at an advanced stage to begin clinical trials. Researchers have also proved that CD59 can be used with AMD. Gene therapy is also able to treat primary open angle glaucoma (POAG) in animal models, and studies show it is economically viable.
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Ivette M Sandoval
Full Text Available For sensitive detection of rare gene repair events in terminally differentiated photoreceptors, we generated a knockin mouse model by replacing one mouse rhodopsin allele with a form of the human rhodopsin gene that causes a severe, early-onset form of retinitis pigmentosa. The human gene contains a premature stop codon at position 344 (Q344X, cDNA encoding the enhanced green fluorescent protein (EGFP at its 3' end, and a modified 5' untranslated region to reduce translation rate so that the mutant protein does not induce retinal degeneration. Mutations that eliminate the stop codon express a human rhodopsin-EGFP fusion protein (hRho-GFP, which can be readily detected by fluorescence microscopy. Spontaneous mutations were observed at a frequency of about one per retina; in every case, they gave rise to single fluorescent rod cells, indicating that each mutation occurred during or after the last mitotic division. Additionally, the number of fluorescent rods did not increase with age, suggesting that the rhodopsin gene in mature rod cells is less sensitive to mutation than it is in developing rods. Thus, there is a brief developmental window, coinciding with the transcriptional activation of the rhodopsin locus, in which somatic mutations of the rhodopsin gene abruptly begin to appear.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
CRB2 acts as a modifying factor of CRB1-related retinal dystrophies in mice
Pellissier, L.P.; Lundvig, D.M.S.; Tanimoto, N.; Klooster, J.; Vos, R.M.; Richard, F.; Sothilingam, V.; Garrido, M. Garcia; Bivic, A. le; Seeliger, M.W.; Wijnholds, J.
2014-01-01
Mutations in the CRB1 gene lead to retinal dystrophies ranging from Leber congenital amaurosis (LCA) to early-onset retinitis pigmentosa (RP), due to developmental defects or loss of adhesion between photoreceptors and Muller glia cells, respectively. Whereas over 150 mutations have been found, no
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Vitamin A Derivatives as Treatment Options for Retinal Degenerative Diseases
Directory of Open Access Journals (Sweden)
Tadao Maeda
2013-07-01
Full Text Available The visual cycle is a sequential enzymatic reaction for vitamin A, all-trans-retinol, occurring in the outer layer of the human retina and is essential for the maintenance of vision. The central source of retinol is derived from dietary intake of both retinol and pro-vitamin A carotenoids. A series of enzymatic reactions, located in both the photoreceptor outer segment and the retinal pigment epithelium, transform retinol into the visual chromophore 11-cis-retinal, regenerating visual pigments. Retina specific proteins carry out the majority of the visual cycle, and any significant interruption in this sequence of reactions is capable of causing varying degrees of blindness. Among these important proteins are Lecithin:retinol acyltransferase (LRAT and retinal pigment epithelium-specific 65-kDa protein (RPE65 known to be responsible for esterification of retinol to all-trans-retinyl esters and isomerization of these esters to 11-cis-retinal, respectively. Deleterious mutations in these genes are identified in human retinal diseases that cause blindness, such as Leber congenital amaurosis (LCA and retinitis pigmentosa (RP. Herein, we discuss the pathology of 11-cis-retinal deficiency caused by these mutations in both animal disease models and human patients. We also review novel therapeutic strategies employing artificial visual chromophore 9-cis-retinoids which have been employed in clinical trials involving LCA patients.
Retinal Thickening and Photoreceptor Loss in HIV Eyes without Retinitis.
Directory of Open Access Journals (Sweden)
Cheryl A Arcinue
Full Text Available To determine the presence of structural changes in HIV retinae (i.e., photoreceptor density and retinal thickness in the macula compared with age-matched HIV-negative controls.Cohort of patients with known HIV under CART (combination Antiretroviral Therapy treatment were examined with a flood-illuminated retinal AO camera to assess the cone photoreceptor mosaic and spectral-domain optical coherence tomography (SD-OCT to assess retinal layers and retinal thickness.Twenty-four eyes of 12 patients (n = 6 HIV-positive and 6 HIV-negative were imaged with the adaptive optics camera. In each of the regions of interest studied (nasal, temporal, superior, inferior, the HIV group had significantly less mean cone photoreceptor density compared with age-matched controls (difference range, 4,308-6,872 cones/mm2. A different subset of forty eyes of 20 patients (n = 10 HIV-positive and 10 HIV-negative was included in the retinal thickness measurements and retinal layer segmentation with the SD-OCT. We observed significant thickening in HIV positive eyes in the total retinal thickness at the foveal center, and in each of the three horizontal B-scans (through the macular center, superior, and inferior to the fovea. We also noted that the inner retina (combined thickness from ILM through RNFL to GCL layer was also significantly thickened in all the different locations scanned compared with HIV-negative controls.Our present study shows that the cone photoreceptor density is significantly reduced in HIV retinae compared with age-matched controls. HIV retinae also have increased macular retinal thickness that may be caused by inner retinal edema secondary to retinovascular disease in HIV. The interaction of photoreceptors with the aging RPE, as well as possible low-grade ocular inflammation causing diffuse inner retinal edema, may be the key to the progressive vision changes in HIV-positive patients without overt retinitis.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
CRB2 acts as a modifying factor of CRB1-related retinal dystrophies in mice
Pellissier, Lucie P; Lundvig, Ditte M S; Tanimoto, Naoyuki; Klooster, J.; Vos, Rogier M; Richard, Fabrice; Sothilingam, Vithiyanjali; Garcia Garrido, Marina; Le Bivic, André; Seeliger, Mathias W; Wijnholds, J.
2014-01-01
Mutations in the CRB1 gene lead to retinal dystrophies ranging from Leber congenital amaurosis (LCA) to early-onset retinitis pigmentosa (RP), due to developmental defects or loss of adhesion between photoreceptors and Müller glia cells, respectively. Whereas over 150 mutations have been found, no
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Myeloid differentiation protein 2-dependent mechanisms in retinal ischemia-reperfusion injury
Energy Technology Data Exchange (ETDEWEB)
Ren, Luqing [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Tao, Jianjian; Chen, Huaicheng; Bian, Yang; Yang, Xi [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); The Eye Hospital of Wenzhou Medical University, Wenzhou, Zhejiang (China); Chen, Gaozhi; Zhang, Xin; Liang, Guang [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Wu, Wencan, E-mail: wuwencan118@163.com [The Eye Hospital of Wenzhou Medical University, Wenzhou, Zhejiang (China); Song, Zongming, E-mail: szmeyes@126.com [The Eye Hospital of Wenzhou Medical University, Wenzhou, Zhejiang (China); Wang, Yi, E-mail: yi.wang1122@wmu.edu.cn [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China)
2017-02-15
Retinal ischemia-reperfusion (I/R) injury is a common pathological process in many eye disorders. Oxidative stress and inflammation play a role in retinal I/R injury. Recent studies show that toll-like receptor 4 (TLR4) is involved in initiating sterile inflammatory response in retinal I/R. However, the molecular mechanism by which TLR4 is activated is not known. In this study, we show that retinal I/R injury involves a co-receptor of TLR4, myeloid differentiation 2 (MD2). Inhibition of MD2 prevented cell death and preserved retinal function following retinal I/R injury. We confirmed these findings using MD2 knockout mice. Furthermore, we utilized human retinal pigment epithelial cells (ARPE-19 cells) to show that oxidative stress-induced cell death as well as inflammatory response are mediated through MD2. Inhibition of MD2 through a chemical inhibitor or knockdown prevented oxidative stress-induced cell death and expression of inflammatory cytokines. Oxidative stress was found to activate TLR4 in a MD2-dependent manner via increasing the expression of high mobility group box 1. In summary, our study shows that oxidative stress in retinal I/R injury can activate TLR4 signaling via MD2, resulting in induction of inflammatory genes and retinal damage. MD2 may represent an attractive therapeutic target for retinal I/R injury. - Highlights: • MD2 inhibition reduced retinal damage after I/R induction in mice. • TBHP induced TLR4/MD2 binding via increasing HMGB-1 expression. • TLR4/MD2 initiated inflammatory response via activation of MAPKs and NF-κB. • MD2 could be the therapeutic target for the treatment of retinal I/R.
Myeloid differentiation protein 2-dependent mechanisms in retinal ischemia-reperfusion injury
International Nuclear Information System (INIS)
Ren, Luqing; Tao, Jianjian; Chen, Huaicheng; Bian, Yang; Yang, Xi; Chen, Gaozhi; Zhang, Xin; Liang, Guang; Wu, Wencan; Song, Zongming; Wang, Yi
2017-01-01
Retinal ischemia-reperfusion (I/R) injury is a common pathological process in many eye disorders. Oxidative stress and inflammation play a role in retinal I/R injury. Recent studies show that toll-like receptor 4 (TLR4) is involved in initiating sterile inflammatory response in retinal I/R. However, the molecular mechanism by which TLR4 is activated is not known. In this study, we show that retinal I/R injury involves a co-receptor of TLR4, myeloid differentiation 2 (MD2). Inhibition of MD2 prevented cell death and preserved retinal function following retinal I/R injury. We confirmed these findings using MD2 knockout mice. Furthermore, we utilized human retinal pigment epithelial cells (ARPE-19 cells) to show that oxidative stress-induced cell death as well as inflammatory response are mediated through MD2. Inhibition of MD2 through a chemical inhibitor or knockdown prevented oxidative stress-induced cell death and expression of inflammatory cytokines. Oxidative stress was found to activate TLR4 in a MD2-dependent manner via increasing the expression of high mobility group box 1. In summary, our study shows that oxidative stress in retinal I/R injury can activate TLR4 signaling via MD2, resulting in induction of inflammatory genes and retinal damage. MD2 may represent an attractive therapeutic target for retinal I/R injury. - Highlights: • MD2 inhibition reduced retinal damage after I/R induction in mice. • TBHP induced TLR4/MD2 binding via increasing HMGB-1 expression. • TLR4/MD2 initiated inflammatory response via activation of MAPKs and NF-κB. • MD2 could be the therapeutic target for the treatment of retinal I/R.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Retinal bipolar cells: elementary building blocks of vision.
Euler, Thomas; Haverkamp, Silke; Schubert, Timm; Baden, Tom
2014-08-01
Retinal bipolar cells are the first ‘projection neurons’ of the vertebrate visual system—all of the information needed for vision is relayed by this intraretinal connection. Each of the at least 13 distinct types of bipolar cells systematically transforms the photoreceptor input in a different way, thereby generating specific channels that encode stimulus properties, such as polarity, contrast, temporal profile and chromatic composition. As a result, bipolar cell output signals represent elementary ‘building blocks’ from which the microcircuits of the inner retina derive a feature-oriented description of the visual world.
National Research Council Canada - National Science Library
Obringer, John
2004-01-01
.... We assessed the sublethal insult to human retinal pigment epithelial cells using a cadaver organ donor explant system for genes differentially expressed 12 and 24 hours post- exposure using gene...
Sridhar, Akshayalakshmi; Ohlemacher, Sarah K; Langer, Kirstin B; Meyer, Jason S
2016-04-01
The derivation of human induced pluripotent stem cells (hiPSCs) from patient-specific sources has allowed for the development of novel approaches to studies of human development and disease. However, traditional methods of generating hiPSCs involve the risks of genomic integration and potential constitutive expression of pluripotency factors and often exhibit low reprogramming efficiencies. The recent description of cellular reprogramming using synthetic mRNA molecules might eliminate these shortcomings; however, the ability of mRNA-reprogrammed hiPSCs to effectively give rise to retinal cell lineages has yet to be demonstrated. Thus, efforts were undertaken to test the ability and efficiency of mRNA-reprogrammed hiPSCs to yield retinal cell types in a directed, stepwise manner. hiPSCs were generated from human fibroblasts via mRNA reprogramming, with parallel cultures of isogenic human fibroblasts reprogrammed via retroviral delivery of reprogramming factors. New lines of mRNA-reprogrammed hiPSCs were established and were subsequently differentiated into a retinal fate using established protocols in a directed, stepwise fashion. The efficiency of retinal differentiation from these lines was compared with retroviral-derived cell lines at various stages of development. On differentiation, mRNA-reprogrammed hiPSCs were capable of robust differentiation to a retinal fate, including the derivation of photoreceptors and retinal ganglion cells, at efficiencies often equal to or greater than their retroviral-derived hiPSC counterparts. Thus, given that hiPSCs derived through mRNA-based reprogramming strategies offer numerous advantages owing to the lack of genomic integration or constitutive expression of pluripotency genes, such methods likely represent a promising new approach for retinal stem cell research, in particular, those for translational applications. In the current report, the ability to derive mRNA-reprogrammed human induced pluripotent stem cells (hi
Directory of Open Access Journals (Sweden)
Simpson David
2006-03-01
Full Text Available Abstract Background Retinal photoreceptors are highly specialised cells, which detect light and are central to mammalian vision. Many retinal diseases occur as a result of inherited dysfunction of the rod and cone photoreceptor cells. Development and maintenance of photoreceptors requires appropriate regulation of the many genes specifically or highly expressed in these cells. Over the last decades, different experimental approaches have been developed to identify photoreceptor enriched genes. Recent progress in RNA analysis technology has generated large amounts of gene expression data relevant to retinal development. This paper assesses a machine learning methodology for supporting the identification of photoreceptor enriched genes based on expression data. Results Based on the analysis of publicly-available gene expression data from the developing mouse retina generated by serial analysis of gene expression (SAGE, this paper presents a predictive methodology comprising several in silico models for detecting key complex features and relationships encoded in the data, which may be useful to distinguish genes in terms of their functional roles. In order to understand temporal patterns of photoreceptor gene expression during retinal development, a two-way cluster analysis was firstly performed. By clustering SAGE libraries, a hierarchical tree reflecting relationships between developmental stages was obtained. By clustering SAGE tags, a more comprehensive expression profile for photoreceptor cells was revealed. To demonstrate the usefulness of machine learning-based models in predicting functional associations from the SAGE data, three supervised classification models were compared. The results indicated that a relatively simple instance-based model (KStar model performed significantly better than relatively more complex algorithms, e.g. neural networks. To deal with the problem of functional class imbalance occurring in the dataset, two data re
Burnight, Erin R; Gupta, Manav; Wiley, Luke A; Anfinson, Kristin R; Tran, Audrey; Triboulet, Robinson; Hoffmann, Jeremy M; Klaahsen, Darcey L; Andorf, Jeaneen L; Jiao, Chunhua; Sohn, Elliott H; Adur, Malavika K; Ross, Jason W; Mullins, Robert F; Daley, George Q; Schlaeger, Thorsten M; Stone, Edwin M; Tucker, Budd A
2017-09-06
Patient-derived induced pluripotent stem cells (iPSCs) hold great promise for autologous cell replacement. However, for many inherited diseases, treatment will likely require genetic repair pre-transplantation. Genome editing technologies are useful for this application. The purpose of this study was to develop CRISPR-Cas9-mediated genome editing strategies to target and correct the three most common types of disease-causing variants in patient-derived iPSCs: (1) exonic, (2) deep intronic, and (3) dominant gain of function. We developed a homology-directed repair strategy targeting a homozygous Alu insertion in exon 9 of male germ cell-associated kinase (MAK) and demonstrated restoration of the retinal transcript and protein in patient cells. We generated a CRISPR-Cas9-mediated non-homologous end joining (NHEJ) approach to excise a major contributor to Leber congenital amaurosis, the IVS26 cryptic-splice mutation in CEP290, and demonstrated correction of the transcript and protein in patient iPSCs. Lastly, we designed allele-specific CRISPR guides that selectively target the mutant Pro23His rhodopsin (RHO) allele, which, following delivery to both patient iPSCs in vitro and pig retina in vivo, created a frameshift and premature stop that would prevent transcription of the disease-causing variant. The strategies developed in this study will prove useful for correcting a wide range of genetic variants in genes that cause inherited retinal degeneration. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Evaluating Efficiencies of Dual AAV Approaches for Retinal Targeting
Directory of Open Access Journals (Sweden)
Livia S. Carvalho
2017-09-01
Full Text Available Retinal gene therapy has come a long way in the last few decades and the development and improvement of new gene delivery technologies has been exponential. The recent promising results from the first clinical trials for inherited retinal degeneration due to mutations in RPE65 have provided a major breakthrough in the field and have helped cement the use of recombinant adeno-associated viruses (AAV as the major tool for retinal gene supplementation. One of the key problems of AAV however, is its limited capacity for packaging genomic information to a maximum of around 4.8 kb. Previous studies have demonstrated that homologous recombination and/or inverted terminal repeat (ITR mediated concatemerization of two overlapping AAV vectors can partially overcome the size limitation and help deliver larger transgenes. The aim of this study was to investigate and compare the use of different AAV dual-vector approaches in the mouse retina using a systematic approach comparing efficiencies in vitro and in vivo using a unique oversized reporter construct. We show that the hybrid approach relying on vector genome concatemerization by highly recombinogenic sequences and ITRs sequence overlap offers the best levels of reconstitution both in vitro and in vivo compared to trans-splicing and overlap strategies. Our data also demonstrate that dose and vector serotype do not affect reconstitution efficiency but a discrepancy between mRNA and protein expression data suggests a bottleneck affecting translation.
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
CRALBP supports the mammalian retinal visual cycle and cone vision
Xue, Yunlu; Shen, Susan Q.; Jui, Jonathan; Rupp, Alan C.; Byrne, Leah C.; Hattar, Samer; Flannery, John G.; Corbo, Joseph C.; Kefalov, Vladimir J.
2015-01-01
Mutations in the cellular retinaldehyde-binding protein (CRALBP, encoded by RLBP1) can lead to severe cone photoreceptor-mediated vision loss in patients. It is not known how CRALBP supports cone function or how altered CRALBP leads to cone dysfunction. Here, we determined that deletion of Rlbp1 in mice impairs the retinal visual cycle. Mice lacking CRALBP exhibited M-opsin mislocalization, M-cone loss, and impaired cone-driven visual behavior and light responses. Additionally, M-cone dark ad...
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Grover, Sandeep; Fishman, Gerald A; Stone, Edwin M
2004-10-01
To define ophthalmic findings in a family with autosomal dominant retinitis pigmentosa and a novel IMPDH1 gene mutation. Genetic and observational family study. Sixteen affected members of a family with autosomal dominant retinitis pigmentosa. Ophthalmic examination, including best-corrected visual acuity (VA), slit-lamp biomicroscopy, direct and indirect ophthalmoscopy, Goldmann kinetic perimetry, and electroretinography were performed. Deoxyribonucleic acid single-strand conformation polymorphism (SSCP) analysis was done. Abnormal polymerase chain reaction products identified by SSCP analysis were sequenced bidirectionally. All affected patients had the onset of night blindness within the first decade of life. Ocular findings were characterized by diffuse retinal pigmentary degenerative changes, marked restriction of peripheral visual fields, severe loss of VA, nondetectable electroretinography amplitudes, and a high frequency of posterior subcapsular lens opacities. Affected members were observed to harbor a novel IMPDH1 gene mutation. A novel IMPDH1 gene mutation (Arg231Pro) was associated with a severe form of autosomal dominant retinitis pigmentosa. Families affected with a severe form of this genetic subtype should be investigated for a mutation in the IMPDH1 gene.
Digoxin-induced retinal degeneration depends on rhodopsin.
Landfried, Britta; Samardzija, Marijana; Barben, Maya; Schori, Christian; Klee, Katrin; Storti, Federica; Grimm, Christian
2017-03-16
Na,K-ATPases are energy consuming ion pumps that are required for maintaining ion homeostasis in most cells. In the retina, Na,K-ATPases are especially important to sustain the dark current in photoreceptor cells needed for rapid hyperpolarization of rods and cones in light. Cardiac glycosides like digoxin inhibit the activity of Na,K-ATPases by targeting their catalytic alpha subunits. This leads to a disturbed ion balance, which can affect cellular function and survival. Here we show that the treatment of wild-type mice with digoxin leads to severe retinal degeneration and loss of vision. Digoxin induced cell death specifically in photoreceptor cells with no or only minor effects in other retinal cell types. Photoreceptor-specific cytotoxicity depended on the presence of bleachable rhodopsin. Photoreceptors of Rpe65 knockouts, which have no measurable rhodopsin and photoreceptors of Rpe65 R91W mice that have treatment. Similarly, cones in the all-cone retina of Nrl knockout mice were also not affected. Digoxin induced expression of several genes involved in stress signaling and inflammation. It also activated proteins such as ERK1/2, AKT, STAT1, STAT3 and CASP1 during a period of up to 10 days after treatment. Activation of signaling genes and proteins, as well as the dependency on bleachable rhodopsin resembles mechanisms of light-induced photoreceptor degeneration. Digoxin-mediated photoreceptor cell death may thus be used as an inducible model system to study molecular mechanisms of retinal degeneration.
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Abu El-Asrar, Ahmed M; Herbort, Carl P; Tabbara, Khalid F
2005-12-01
Retinal vasculitis is a sight-threatening intraocular inflammation affecting the retinal vessels. It may occur as an isolated ocular condition, as a manifestation of infectious or neoplastic disorders, or in association with a systemic inflammatory disease. The search for an underlying etiology should be approached in a multidisciplinary fashion based on a thorough history, review of systems, physical examination, and laboratory evaluation. Discrimination between infectious and noninfectious etiologies of retinal vasculitis is important because their treatment is different. This review is based on recently published articles on retinal vasculitis and deals with its clinical diagnosis, its link with systemic diseases, and its laboratory investigation.
Lipofection strategy for the study of Xenopus retinal development.
Ohnuma, Shin-ichi; Mann, Fanny; Boy, Sébastien; Perron, Muriel; Harris, William A
2002-12-01
The analysis of gene function during retinal development can be addressed by perturbing gene expression either by inhibition or by overexpression in desired regions and at defined stages of development. An in vivo lipofection strategy has been applied for stage-specific and region-specific expression of genes in Xenopus retina. Due to colipofection efficiency, this strategy enables us to study functional interaction of genes by lipofecting multiple expression constructs. This lipofection technique also allows us to transfect morpholino oligonucleotides into retinoblasts to block gene function. We present here various aspects of this technique, including recent improvements and modifications.
Wilkinson, Charles P
2014-09-05
Asymptomatic retinal breaks and lattice degeneration are visible lesions that are risk factors for later retinal detachment. Retinal detachments occur when fluid in the vitreous cavity passes through tears or holes in the retina and separates the retina from the underlying retinal pigment epithelium. Creation of an adhesion surrounding retinal breaks and lattice degeneration, with laser photocoagulation or cryotherapy, has been recommended as an effective means of preventing retinal detachment. This therapy is of value in the management of retinal tears associated with the symptoms of flashes and floaters and persistent vitreous traction upon the retina in the region of the retinal break, because such symptomatic retinal tears are associated with a high rate of progression to retinal detachment. Retinal tears and holes unassociated with acute symptoms and lattice degeneration are significantly less likely to be the sites of retinal breaks that are responsible for later retinal detachment. Nevertheless, treatment of these lesions frequently is recommended, in spite of the fact that the effectiveness of this therapy is unproven. The objective of this review was to assess the effectiveness and safety of techniques used to treat asymptomatic retinal breaks and lattice degeneration for the prevention of retinal detachment. We searched CENTRAL (which contains the Cochrane Eyes and Vision Group Trials Register) (2014, Issue 2), Ovid MEDLINE, Ovid MEDLINE In-Process and Other Non-Indexed Citations, Ovid MEDLINE Daily, Ovid OLDMEDLINE (January 1946 to February 2014), EMBASE (January 1980 to February 2014), PubMed (January 1948 to February 2014), the metaRegister of Controlled Trials (mRCT) (www.controlled-trials.com), ClinicalTrials.gov (www.clinicaltrials.gov) and the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) (www.who.int/ictrp/search/en). We did not use any date or language restrictions in the electronic searches for trials
Richards, Anna; van den Maagdenberg, Arn M. J. M.; Jen, Joanna C.; Kavanagh, David; Bertram, Paula; Spitzer, Dirk; Liszewski, M. Kathryn; Barilla-LaBarca, Maria-Louise; Terwindt, Gisela M.; Kasai, Yumi; McLellan, Mike; Grand, Mark Gilbert; Vanmolkot, Kaate R. J.; de Vries, Boukje; Wan, Jijun; Kane, Michael J.; Mamsa, Hafsa; Schäfer, Ruth; Stam, Anine H.; Haan, Joost; de Jong, Paulus T. V. M.; Storimans, Caroline W.; van Schooneveld, Mary J.; Oosterhuis, Jendo A.; Gschwendter, Andreas; Dichgans, Martin; Kotschet, Katya E.; Hodgkinson, Suzanne; Hardy, Todd A.; Delatycki, Martin B.; Hajj-Ali, Rula A.; Kothari, Parul H.; Nelson, Stanley F.; Frants, Rune R.; Baloh, Robert W.; Ferrari, Michel D.; Atkinson, John P.
2007-01-01
Autosomal dominant retinal vasculopathy with cerebral leukodystrophy is a microvascular endotheliopathy with middle-age onset. In nine families, we identified heterozygous C-terminal frameshift mutations in TREX1, which encodes a 3'-5' exonuclease. These truncated proteins retain exonuclease
Richards, Anna; van den Maagdenberg, Arn M. J. M.; Jen, Joanna C.; Kavanagh, David; Bertram, Paula; Spitzer, Dirk; Liszewski, M. Kathryn; Barilla-LaBarca, Maria-Louise; Terwindt, Gisela M.; Kasai, Yumi; McLellan, Mike; Grand, Mark Gilbert; Vanmolkot, Kaate R. J.; de Vries, Boukje; Wan, Jijun; Kane, Michael J.; Mamsa, Hafsa; Schaefer, Ruth; Stam, Anine H.; Haan, Joost; Paulus, T. V. M. de Jong; Storimans, Caroline W.; van Schooneveld, Mary J.; Oosterhuis, Jendo A.; Gschwendter, Andreas; Dichgans, Martin; Kotschet, Katya E.; Hodgkinson, Suzanne; Hardy, Todd A.; Delatycki, Martin B.; Hajj-Ali, Rula A.; Kothari, Parul H.; Nelson, Stanley F.; Frants, Rune R.; Baloh, Robert W.; Ferrari, Michel D.; Atkinson, John P.
Autosomal dominant retinal vasculopathy with cerebral leukodystrophy is a microvascular endotheliopathy with middle- age onset. In nine families, we identified heterozygous C- terminal frameshift mutations in TREX1, which encodes a 3'-5' exonuclease. These truncated proteins retain exonuclease
Treatment of Retinal Separation in HIV-infected Patients with Cytomegalovirus Retinitis
Directory of Open Access Journals (Sweden)
A. L. Onischenko
2017-01-01
Full Text Available HIV infection — is a socially significant problem for many countries, as the infected die in an average of 10-11 years due to the immunodeficiency virus. Up to 20% of patients with AIDS lose their sight because of cytomegalovirus retinitis (CMV retinitis, which occurs in 70% of HIV-infected people. In some patients with HIV infection blindness occurs because of acute retinal necrosis of CMV etiology. The algorithm of CMV retinitis treatment in HIV-infected patients is described in modern manuals (ganciclovir, valganciclovir, foscarnet and others on the background of antiretroviral therapy, but the tactics of treatment of retinal separation in these patients is not clearly defined. It may be “wait and see”, providing conservative treatment with antiviral drugs, and the active tactics — vitreoretinal surgery. In this article the authors present their personal clinical observations of three HIV-infected patients with CMV retinitis at the age of 8 to 36 years with a detailed analysis of the clinical data and the results of the laboratory tests. In particular, the authors give their own results of intravitreal introduction of ganciclovir in patients with CMV retinitis. Given the poor prognosis for the life of these patients, the authors put a deontological question of justification of active treatment of retinal separation in AIDS patients with CMV retinitis.
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
2013-01-01
Inherited retinal degenerative diseases (RDDs) display wide variation in their mode of inheritance, underlying genetic defects, age of onset, and phenotypic severity. Molecular mechanisms have not been delineated for many retinal diseases, and treatment options are limited. In most instances, genotype-phenotype correlations have not been elucidated because of extensive clinical and genetic heterogeneity. Next-generation sequencing (NGS) methods, including exome, genome, transcriptome and epigenome sequencing, provide novel avenues towards achieving comprehensive understanding of the genetic architecture of RDDs. Whole-exome sequencing (WES) has already revealed several new RDD genes, whereas RNA-Seq and ChIP-Seq analyses are expected to uncover novel aspects of gene regulation and biological networks that are involved in retinal development, aging and disease. In this review, we focus on the genetic characterization of retinal and macular degeneration using NGS technology and discuss the basic framework for further investigations. We also examine the challenges of NGS application in clinical diagnosis and management. PMID:24112618
Fernandez-San Jose, Patricia; Liu, Yichuan; March, Michael; Pellegrino, Renata; Golhar, Ryan; Corton, Marta; Blanco-Kelly, Fiona; López-Molina, Maria Isabel; García-Sandoval, Blanca; Guo, Yiran; Tian, Lifeng; Liu, Xuanzhu; Guan, Liping; Zhang, Jianguo; Keating, Brendan; Xu, Xun
2015-01-01
This study aimed to identify the genetics underlying dominant forms of inherited retinal dystrophies using whole exome sequencing (WES) in six families extensively screened for known mutations or genes. Thirty-eight individuals were subjected to WES. Causative variants were searched among single nucleotide variants (SNVs) and insertion/deletion variants (indels) and whenever no potential candidate emerged, copy number variant (CNV) analysis was performed. Variants or regions harboring a candidate variant were prioritized and segregation of the variant with the disease was further assessed using Sanger sequencing in case of SNVs and indels, and quantitative PCR (qPCR) for CNVs. SNV and indel analysis led to the identification of a previously reported mutation in PRPH2. Two additional mutations linked to different forms of retinal dystrophies were identified in two families: a known frameshift deletion in RPGR, a gene responsible for X-linked retinitis pigmentosa and p.Ser163Arg in C1QTNF5 associated with Late-Onset Retinal Degeneration. A novel heterozygous deletion spanning the entire region of PRPF31 was also identified in the affected members of a fourth family, which was confirmed with qPCR. This study allowed the identification of the genetic cause of the retinal dystrophy and the establishment of a correct diagnosis in four families, including a large heterozygous deletion in PRPF31, typically considered one of the pitfalls of this method. Since all findings in this study are restricted to known genes, we propose that targeted sequencing using gene-panel is an optimal first approach for the genetic screening and that once known genetic causes are ruled out, WES might be used to uncover new genes involved in inherited retinal dystrophies. PMID:26197217
[Early therapeutic trials for retinitis pigmentosa].
Dufier, Jean-Louis
2003-01-01
Non syndromic forms of Retinitis Pigmentosa (RP) constitute a collection of clinically and genetically heterogeneous inherited retinal degenerative diseases. They are characterized by a bilateral progressive visual loss susceptible to cause blindness. These diseases are transmitted through pedigrees according to all known modes of inheritance. They are bilateral and usually start during infancy. However, very early clinical presentations exist, such as those observed in children affected by Leber Congenital Amaurosis, as well as late onset autosomal dominant forms of retinitis pigmentosa. The characteristic clinical aspect of the rod-cone RP dystrophies is marked by alterations of the peripheral retina associated with a night blindness and a progressive narrowing of the visual field. The ophthalmoscopic examination of RP patients commonly reveals thin retinal arteries and scattered pigmentary accumulations. In contrast, there are cone rod retinal dystrophies whose onset is marked by a decreased visual acuity before the appearance of any visual field alteration. Some forms of RPs display an ocular fundus devoid of any pigmentary alteration. Syndromic forms of RPs are not uncommon. The association of deafness with RP is detected in nearly 30% of the patients. Other associations with RP can include mental deficiency, facial dysmorphy, microcephaly, obesity, kidney deficiency, immune deficiencies, metabolic disorders. The existence of such syndromic forms of RP localizes RPs at the crossroad of several medical specialties. A long lasting collaboration between our department of ophthalmology and the department of medical genetics of the Necker-Sick Children Hospital has allowed us to establish numerous genotype-phenotype correlations, especially in LCA and Stargardt's disease. ABCR gene mutations cause Stargardt disease. ABCR mutations may also cause some types of Ages Related Macular Degenerations (AMD). Nowadays, there is no known efficient therapy available for
Gene therapy for ocular diseases.
Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao
2011-05-01
The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.
Genetic loci for retinal arteriolar microcirculation.
Directory of Open Access Journals (Sweden)
Xueling Sim
Full Text Available Narrow arterioles in the retina have been shown to predict hypertension as well as other vascular diseases, likely through an increase in the peripheral resistance of the microcirculatory flow. In this study, we performed a genome-wide association study in 18,722 unrelated individuals of European ancestry from the Cohorts for Heart and Aging Research in Genomic Epidemiology consortium and the Blue Mountain Eye Study, to identify genetic determinants associated with variations in retinal arteriolar caliber. Retinal vascular calibers were measured on digitized retinal photographs using a standardized protocol. One variant (rs2194025 on chromosome 5q14 near the myocyte enhancer factor 2C MEF2C gene was associated with retinal arteriolar caliber in the meta-analysis of the discovery cohorts at genome-wide significance of P-value <5×10(-8. This variant was replicated in an additional 3,939 individuals of European ancestry from the Australian Twins Study and Multi-Ethnic Study of Atherosclerosis (rs2194025, P-value = 2.11×10(-12 in combined meta-analysis of discovery and replication cohorts. In independent studies of modest sample sizes, no significant association was found between this variant and clinical outcomes including coronary artery disease, stroke, myocardial infarction or hypertension. In conclusion, we found one novel loci which underlie genetic variation in microvasculature which may be relevant to vascular disease. The relevance of these findings to clinical outcomes remains to be determined.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Zhang, Yan; Raychaudhuri, Suravi; Wildsoet, Christine F.
2016-01-01
Purpose This study investigated the gene expression of TGFβ isoforms and their receptors in chick retina, retinal pigment epithelium (RPE), and choroid and the effects of short-term imposed optical defocus. Methods The expression of TGFβ isoforms (TGF-β1, 2, 3) and TGFβ receptors (TGFBR1, 2, 3) was examined in the retina, RPE, and choroid of young White-Leghorn untreated chicks (19 days-old). The effects on the expression of the same genes of monocular +10 and -10 D defocusing lenses, worn for either 2 or 48 h by age-matched chicks, were also examined by comparing expression in treated and untreated fellow eyes. RNA was purified, characterized and then reverse transcribed to cDNA. Differential gene expression was quantified using real-time PCR. Results All 3 isoforms of TGFβ and all 3 receptor subtypes were found to be expressed in all 3 ocular tissues, with apparent tissue-dependent differences in expression profiles. Data are reported as mean normalized expression relative to GAPDH. Sign-dependent optical defocus effects were also observed. Optical defocus did not affect retinal gene expression but in the RPE, TGF-β2 expression was significantly up-regulated with +10 D lenses, worn for either 2 h (349% increase ± 88%, p < 0.01) or 48 h (752% increase ± 166%, p < 0.001), and in the choroid, the expression of TGF-β3 was up-regulated with -10 D lenses, worn for 48 h (147% increase ± 9%, p < 0.01). Conclusions The effects of short term exposure to optical defocus on TGFβ gene expression in the RPE and choroid, which were sign-dependent and isoform specific, provide further supporting evidence for important roles of members of the TGFβ family and these two tissues in local signal cascades regulating ocular growth. PMID:27214233
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Tabbara, Khalid F; Wedin, Keith; Al Haddab, Saad
2010-01-01
To report a case of Chaetomium atrobrunneum retinitis in a patient with Hodgkin lymphoma. We studied the ocular manifestations of an 11-year-old boy with retinitis. Biomicroscopy, ophthalmoscopy, and fundus photography were done. Magnetic resonance imaging of the brain was performed. A vitreous biopsy was subjected to viral, bacterial, and fungal cultures. Vitreous culture grew C. atrobrunneum. Magnetic resonance imaging showed multiple cerebral lesions consistent with an infectious process. The patient was given intravenous voriconazole and showed improvement of the ocular and central nervous system lesions. We report a case of central nervous system and ocular lesions by C. atrobrunneum. The retinitis was initially misdiagnosed as cytomegaloviral retinitis. Vitreous biopsy helped in the early diagnosis and prompt treatment of a life- and vision-threatening infection.
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
Single cell transcriptome profiling of developing chick retinal cells.
Laboissonniere, Lauren A; Martin, Gregory M; Goetz, Jillian J; Bi, Ran; Pope, Brock; Weinand, Kallie; Ellson, Laura; Fru, Diane; Lee, Miranda; Wester, Andrea K; Liu, Peng; Trimarchi, Jeffrey M
2017-08-15
The vertebrate retina is a specialized photosensitive tissue comprised of six neuronal and one glial cell types, each of which develops in prescribed proportions at overlapping timepoints from a common progenitor pool. While each of these cells has a specific function contributing to proper vision in the mature animal, their differential representation in the retina as well as the presence of distinctive cellular subtypes makes identifying the transcriptomic signatures that lead to each retinal cell's fate determination and development challenging. We have analyzed transcriptomes from individual cells isolated from the chick retina throughout retinogenesis. While we focused our efforts on the retinal ganglion cells, our transcriptomes of developing chick cells also contained representation from multiple retinal cell types, including photoreceptors and interneurons at different stages of development. Most interesting was the identification of transcriptomes from individual mixed lineage progenitor cells in the chick as these cells offer a window into the cell fate decision-making process. Taken together, these data sets will enable us to uncover the most critical genes acting in the steps of cell fate determination and early differentiation of various retinal cell types. © 2017 Wiley Periodicals, Inc.
Unilateral retinitis pigmentosa occurring in an individual with a mutation in the CLRN1 gene.
Sim, Peng Yong; Jeganathan, V Swetha E; Wright, Alan F; Cackett, Peter
2018-03-15
This case report depicts the clinical course of a female patient with unilateral retinitis pigmentosa, who first presented at the age of 12 years. Fundus photography at the time revealed unilateral pigmentary retinopathy, which was associated with extinguished electroretinogram (ERG) signal. At 35 years of age, fundus examination revealed deterioration of pre-existing unilateral pigmentary retinopathy with progressive visual field defect detected on Goldmann visual field testing. ERG findings remained unchanged and multifocal ERG showed unilateral decrease in amplitude in the affected eye. The patient was referred for genetic counselling. Next-generation sequencing identified a deleterious heterozygous c.118T>G (p.Cys40Gly) mutation in the CLRN1 gene. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Carr, Ronald E.
1979-01-01
The author describes the etiology of retinitis pigmentosa, a visual dysfunction which results from progressive loss of the retinal photoreceptors. Sections address signs and symptoms, ancillary findings, heredity, clinical diagnosis, therapy, and research. (SBH)
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
A CNGB1 frameshift mutation in Papillon and Phalene dogs with progressive retinal atrophy.
Directory of Open Access Journals (Sweden)
Saija J Ahonen
Full Text Available Progressive retinal degenerations are the most common causes of complete blindness both in human and in dogs. Canine progressive retinal atrophy (PRA or degeneration resembles human retinitis pigmentosa (RP and is characterized by a progressive loss of rod photoreceptor cells followed by a loss of cone function. The primary clinical signs are detected as vision impairment in a dim light. Although several genes have been associated with PRAs, there are still PRAs of unknown genetic cause in many breeds, including Papillons and Phalènes. We have performed a genome wide association and linkage studies in cohort of 6 affected Papillons and Phalènes and 14 healthy control dogs to map a novel PRA locus on canine chromosome 2, with a 1.9 Mb shared homozygous region in the affected dogs. Parallel exome sequencing of a trio identified an indel mutation, including a 1-bp deletion, followed by a 6-bp insertion in the CNGB1 gene. This mutation causes a frameshift and premature stop codon leading to probable nonsense mediated decay (NMD of the CNGB1 mRNA. The mutation segregated with the disease and was confirmed in a larger cohort of 145 Papillons and Phalènes (PFisher = 1.4×10(-8 with a carrier frequency of 17.2 %. This breed specific mutation was not present in 334 healthy dogs from 10 other breeds or 121 PRA affected dogs from 44 other breeds. CNGB1 is important for the photoreceptor cell function its defects have been previously associated with retinal degeneration in both human and mouse. Our study indicates that a frameshift mutation in CNGB1 is a cause of PRA in Papillons and Phalènes and establishes the breed as a large functional animal model for further characterization of retinal CNGB1 biology and possible retinal gene therapy trials. This study enables also the development of a genetic test for breeding purposes.
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Hossein-Javaheri, Nima
2010-01-01
Visualization of the internal structures of the retina is critical for clinical diagnosis and monitoring of pathology as well as for medical research investigating the root causes of retinal degeneration. The aim of this thesis is to develop multi-modal non-invasive imaging technology for studying retinal degeneration and gene therapy in mice. We have constructed a FD-OCT prototype and combined it with a Scanning Laser Ophthalmoscope (SLO) to permit real time alignment of the retinal field of...
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
... Linked Retinoschisis (XLRS) X-Linked Retinitis Pigmentosa (XLRP) Usher Syndrome Other Retinal Diseases Glossary News & Research News & Research ... degenerate. Forms of RP and related diseases include Usher syndrome, Leber congenital amaurosis, and Bardet-Biedl syndrome, among ...
... Linked Retinoschisis (XLRS) X-Linked Retinitis Pigmentosa (XLRP) Usher Syndrome Other Retinal Diseases Glossary News & Research News & Research ... central portion of the retina called the macula. Usher Syndrome Usher syndrome is an inherited condition characterized by ...
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Gao, Zaifeng; Bentin, Shlomo
2011-01-01
Face perception studies investigated how spatial frequencies (SF) are extracted from retinal display while forming a perceptual representation, or their selective use during task-imposed categorization. Here we focused on the order of encoding low-spatial frequencies (LSF) and high-spatial frequencies (HSF) from perceptual representations into…
Directory of Open Access Journals (Sweden)
Anna Machalińska
2015-01-01
Full Text Available We investigated effects of bone marrow-derived, lineage-negative cell (Lin−BMC transplantation in acute retinal injury. Lin−BMCs were intravitreally injected into murine eyes at 24 h after NaIO3-induced injury. Morphology, function, and expression of apoptosis-related genes, including brain-derived neurotrophic factor (BDNF and its receptor, were assessed in retinas at 7 days, 28 days, and 3 months after transplantation. Moreover, global gene expression at day 7 was analyzed by RNA arrays. We observed that Lin−BMCs integrated into outer retinal layers improving morphological retinal structure and induced molecular changes such as downregulation of proapoptotic caspase-3 gene, a decrease in BAX/BCL-2 gene ratio, and significant elevation of BDNF expression. Furthermore, transplanted Lin−BMCs differentiated locally into cells with a macrophage-like phenotype. Finally, Lin−BMCs treatment was associated with generation of two distinct transcriptomic patterns. The first relates to downregulated genes associated with regulation of neuron cell death and apoptosis, response to oxidative stress/hypoxia and external stimuli, and negative regulation of cell proliferation. The second relates to upregulated genes associated with neurological system processes and sensory perception. Collectively, our data demonstrate that transplanted Lin−BMCs exert neuroprotective function against acute retinal injury and this effect may be associated with their antiapoptotic properties and ability to express neurotrophic factors.
Young, Douglas; Mayer, Franziska; Vidotto, Nella; Schweizer, Tatjana; Berth, Ramon; Abramowski, Dorothee; Shimshek, Derya R.; van der Putten, P. Herman; Schmid, Peter
2013-01-01
Huntington's disease (HD) is an autosomal dominant, progressive and fatal neurological disorder caused by an expansion of CAG repeats in exon-1 of the huntingtin gene. The encoded poly-glutamine stretch renders mutant huntingtin prone to aggregation. HdhQ150 mice genocopy a pathogenic repeat (∼150 CAGs) in the endogenous mouse huntingtin gene and model predominantly pre-manifest HD. Treating early is likely important to prevent or delay HD, and HdhQ150 mice may be useful to assess therapeutic strategies targeting pre-manifest HD. This requires appropriate markers and here we demonstrate, that pre-symptomatic HdhQ150 mice show several dramatic mutant huntingtin gene-dose dependent pathological changes including: (i) an increase of neuronal intra-nuclear inclusions (NIIs) in brain, (ii) an increase of extra-nuclear aggregates in dentate gyrus, (iii) a decrease of DARPP32 protein and (iv) an increase in glial markers of neuroinflammation, which curiously did not correlate with local neuronal mutant huntingtin inclusion-burden. HdhQ150 mice developed NIIs also in all retinal neuron cell-types, demonstrating that retinal NIIs are not specific to human exon-1 R6 HD mouse models. Taken together, the striking and robust mutant huntingtin gene-dose related changes in aggregate-load, DARPP32 levels and glial activation markers should greatly facilitate future testing of therapeutic strategies in the HdhQ150 HD mouse model. PMID:24086450
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Directory of Open Access Journals (Sweden)
Antiñolo Guillermo
2006-04-01
Full Text Available Abstract Background Retinitis pigmentosa (RP, a clinically and genetically heterogeneous group of retinal degeneration disorders affecting the photoreceptor cells, is one of the leading causes of genetic blindness. Mutations in the photoreceptor-specific gene RP1 account for 3–10% of cases of autosomal dominant RP (adRP. Most of these mutations are clustered in a 500 bp region of exon 4 of RP1. Methods Denaturing gradient gel electrophoresis (DGGE analysis and direct genomic sequencing were used to evaluate the 5' coding region of exon 4 of the RP1 gene for mutations in 150 unrelated index adRP patients. Ophthalmic and electrophysiological examination of RP patients and relatives according to pre-existing protocols were carried out. Results Three novel disease-causing mutations in RP1 were detected: Q686X, K705fsX712 and K722fsX737, predicting truncated proteins. One novel missense mutation, Thr752Met, was detected in one family but the mutation does not co-segregate in the family, thereby excluding this amino acid variation in the protein as a cause of the disease. We found the Arg677Ter mutation, previously reported in other populations, in two independent families, confirming that this mutation is also present in a Spanish population. Conclusion Most of the mutations reported in the RP1 gene associated with adRP are expected to encode mutant truncated proteins that are approximately one third or half of the size of wild type protein. Patients with mutations in RP1 showed mild RP with variability in phenotype severity. We also observed several cases of non-penetrant mutations.
Park, Susanna S
2016-04-01
Retinal vascular conditions, such as diabetic retinopathy and retinal vein occlusion, remain leading causes of vision loss. No therapy exists to restore vision loss resulting from retinal ischemia and associated retinal degeneration. Tissue regeneration is possible with cell therapy. The goal would be to restore or replace the damaged retinal vasculature and the retinal neurons that are damaged and/or degenerating from the hypoxic insult. Currently, various adult cell therapies have been explored as potential treatment. They include mesenchymal stem cells, vascular precursor cells (i.e., CD34+ cells, hematopoietic cells or endothelial progenitor cells), and adipose stromal cells. Preclinical studies show that all these cells have a paracrine trophic effect on damaged ischemic tissue, leading to tissue preservation. Endothelial progenitor cells and adipose stromal cells integrate into the damaged retinal vascular wall in preclinical models of diabetic retinopathy and ischemia-reperfusion injury. Mesenchymal stem cells do not integrate as readily but appear to have a primary paracrine trophic effect. Early phase clinical trials have been initiated and ongoing using mesenchymal stem cells or autologous bone marrow CD34+ cells injected intravitreally as potential therapy for diabetic retinopathy or retinal vein occlusion. Adipose stromal cells or pluripotent stem cells differentiated into endothelial colony-forming cells have been explored in preclinical studies and show promise as possible therapies for retinal vascular disorders. The relative safety or efficacy of these various cell therapies for treating retinal vascular disorders have yet to be determined.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Ma, Hongwei; Yang, Fan; Butler, Michael R; Belcher, Joshua; Redmond, T Michael; Placzek, Andrew T; Scanlan, Thomas S; Ding, Xi-Qin
2017-08-01
Thyroid hormone (TH) signaling regulates cell proliferation, differentiation, and metabolism. Recent studies have implicated TH signaling in cone photoreceptor viability. Using mouse models of retinal degeneration, we demonstrated that antithyroid drug treatment and targeting iodothyronine deiodinases (DIOs) to suppress cellular tri-iodothyronine (T3) production or increase T3 degradation preserves cones. In this work, we investigated the effectiveness of inhibition of the TH receptor (TR). Two genes, THRA and THRB , encode TRs; THRB 2 has been associated with cone viability. Using TR antagonists and Thrb2 deletion, we examined the effects of TR inhibition. Systemic and ocular treatment with the TR antagonists NH-3 and 1-850 increased cone density by 30-40% in the Rpe65 -/- mouse model of Leber congenital amaurosis and reduced the number of TUNEL + cells. Cone survival was significantly improved in Rpe65 -/- and Cpfl1 (a model of achromatopsia with Pde6c defect) mice with Thrb2 deletion. Ventral cone density in Cpfl1/Thrb2 -/- and Rpe65 -/- / Thrb2 -/- mice was increased by 1- to 4-fold, compared with age-matched controls. Moreover, the expression levels of TR were significantly higher in the cone-degeneration retinas, suggesting locally elevated TR signaling. This work shows that the effects of antithyroid treatment or targeting DIOs were likely mediated by TRs and that suppressing TR protects cones. Our findings support the view that inhibition of TR locally in the retina is a therapeutic strategy for retinal degeneration management.-Ma, H., Yang, F., Butler, M. R., Belcher, J., Redmond, T. M., Placzek, A. T., Scanlan, T. S., Ding, X.-Q. Inhibition of thyroid hormone receptor locally in the retina is a therapeutic strategy for retinal degeneration. © FASEB.
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Nanda, A; Salvetti, A P; Martinez-Fernandez de la Camara, C; MacLaren, R E
2018-06-01
Inherited retinal diseases are thought to be the leading cause of sight loss in the working age population. Mutations found in the RPGR and CHM genes cause retinitis pigmentosa (RP) and choroideremia, respectively. In the first instance, an X-linked family history of visual field loss commonly raises the suspicion of one of these two genes. In choroideremia, the classic description of a white fundal reflex secondary to the widespread chorioretinal degeneration was made over a hundred years ago in Caucasians. But, it is not so obvious in heavily pigmented fundi. Hence, the clinical diagnosis of CHM in non-Caucasian patients may be challenging in the first stages of the disease. Here we report a case of a Southeast Asian gentleman who has a family history of X-linked retinal degeneration and was found to have a confirmed in-frame deletion of 12 DNA nucleotides in exon 15 of the RPGR gene. Later in life, however, his fundal appearance showed unusual areas of circular pigment hypertrophy and clumping. He was therefore tested for carrying a disease-causing mutation in the CHM gene and a null mutation was found. Since gene therapy trials are ongoing for both of these conditions, it has now become critically important to establish the correct genetic diagnosis in order to recruit suitable candidates. Moreover, this case demonstrates the necessity to remain vigilant in the interpretation of genetic results which are inconsistent with clinical features.
Therapeutic Approaches to Histone Reprogramming in Retinal Degeneration.
Berner, Andre K; Kleinman, Mark E
2016-01-01
Recent data have revealed epigenetic derangements and subsequent chromatin remodeling as a potent biologic switch for chronic inflammation and cell survival which are important therapeutic targets in the pathogenesis of several retinal degenerations. Histone deacetylases (HDACs) are a major component of this system and serve as a unique control of the chromatin remodeling process. With a multitude of targeted HDAC inhibitors now available, their use in both basic science and clinical studies has widened substantially. In the field of ocular biology, there are data to suggest that HDAC inhibition may suppress neovascularization and may be a possible treatment for retinitis pigmentosa and dry age-related macular degeneration (AMD). However, the effects of these inhibitors on cell survival and chemokine expression in the chorioretinal tissues remain very unclear. Here, we review the multifaceted biology of HDAC activity and pharmacologic inhibition while offering further insight into the importance of this epigenetic pathway in retinal degenerations. Our laboratory investigations aim to open translational avenues to advance dry AMD therapeutics while exploring the role of acetylation on inflammatory gene expression in the aging and degenerating retina.
The retinal clock in mammals: role in health and disease
Directory of Open Access Journals (Sweden)
Felder-Schmittbuhl MP
2017-05-01
fundamental processes, the coherence from cell to tissue is critical for circadian functions, and disruption of retinal clock organization or its response to light can potentially have a major impact on retinal pathophysiology and vision. Keywords: retina, clock gene, circadian, ipRGC, photoreceptor, light
Directory of Open Access Journals (Sweden)
Bojie Hu
2014-01-01
Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Gene therapy and genome surgery in the retina.
DiCarlo, James E; Mahajan, Vinit B; Tsang, Stephen H
2018-06-01
Precision medicine seeks to treat disease with molecular specificity. Advances in genome sequence analysis, gene delivery, and genome surgery have allowed clinician-scientists to treat genetic conditions at the level of their pathology. As a result, progress in treating retinal disease using genetic tools has advanced tremendously over the past several decades. Breakthroughs in gene delivery vectors, both viral and nonviral, have allowed the delivery of genetic payloads in preclinical models of retinal disorders and have paved the way for numerous successful clinical trials. Moreover, the adaptation of CRISPR-Cas systems for genome engineering have enabled the correction of both recessive and dominant pathogenic alleles, expanding the disease-modifying power of gene therapies. Here, we highlight the translational progress of gene therapy and genome editing of several retinal disorders, including RPE65-, CEP290-, and GUY2D-associated Leber congenital amaurosis, as well as choroideremia, achromatopsia, Mer tyrosine kinase- (MERTK-) and RPGR X-linked retinitis pigmentosa, Usher syndrome, neovascular age-related macular degeneration, X-linked retinoschisis, Stargardt disease, and Leber hereditary optic neuropathy.
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Tasharrofi, Nooshin; Kouhkan, Fatemeh; Soleimani, Masoud; Soheili, Zahra-Soheila; Atyabi, Fatemeh; Akbari Javar, Hamid; Abedin Dorkoosh, Farid
2017-02-25
The purpose of this study is designing non-viral gene delivery vectors for transfection of the primary human retinal pigment epithelial cells (RPE). In the design process of gene delivery vectors, considering physicochemical properties of vectors alone does not seem to be enough since they interact with constituents of the surrounding environment and hence gain new characteristics. Moreover, due to these interactions, their cargo can be released untimely or undergo degradation before reaching to the target cells. Further, the characteristics of cells itself can also influence the transfection efficacy. For example, the non-dividing property of RPE cells can impede the transfection efficiency which in most studies was ignored by using immortal cell lines. In this study, vectors with different characteristics differing in mixing orders of pDNA, PEI polymer, and PLGA/PEI or PLGA nanoparticles were prepared and characterized. Then, their characteristics and efficacy in gene delivery to RPE cells in the presence of vitreous or fetal bovine serum (FBS) were evaluated. All formulations showed no cytotoxicity and were able to protect pDNA from premature release and degradation in extracellular media. Also, the adsorption of vitreous or serum proteins onto the surface of vectors changed their properties and hence cellular uptake and transfection efficacy. Copyright © 2016 Elsevier B.V. All rights reserved.
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Bitner-Glindzicz, M; Lindley, K J; Rutland, P; Blaydon, D; Smith, V V; Milla, P J; Hussain, K; Furth-Lavi, J; Cosgrove, K E; Shepherd, R M; Barnes, P D; O'Brien, R E; Farndon, P A; Sowden, J; Liu, X Z; Scanlan, M J; Malcolm, S; Dunne, M J; Aynsley-Green, A; Glaser, B
2000-09-01
Usher syndrome type 1 describes the association of profound, congenital sensorineural deafness, vestibular hypofunction and childhood onset retinitis pigmentosa. It is an autosomal recessive condition and is subdivided on the basis of linkage analysis into types 1A through 1E. Usher type 1C maps to the region containing the genes ABCC8 and KCNJ11 (encoding components of ATP-sensitive K + (KATP) channels), which may be mutated in patients with hyperinsulinism. We identified three individuals from two consanguineous families with severe hyperinsulinism, profound congenital sensorineural deafness, enteropathy and renal tubular dysfunction. The molecular basis of the disorder is a homozygous 122-kb deletion of 11p14-15, which includes part of ABCC8 and overlaps with the locus for Usher syndrome type 1C and DFNB18. The centromeric boundary of this deletion includes part of a gene shown to be mutated in families with type 1C Usher syndrome, and is hence assigned the name USH1C. The pattern of expression of the USH1C protein is consistent with the clinical features exhibited by individuals with the contiguous gene deletion and with isolated Usher type 1C.
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
Directory of Open Access Journals (Sweden)
Yuta Takata
2018-06-01
Full Text Available Purpose: To report 2 cases of central retinal artery occlusion (CRAO who underwent retinal endovascular surgery with injection of tissue plasminogen activator (tPA into the retinal artery and showed a remarkable improvement in visual acuity and retinal circulation. Methods: Standard 25-G vitrectomy was performed under local anesthesia. Simultaneously, tPA (80,000 units/mL solution was injected into the retinal artery of the optic disc for 2–3 min using a microneedle. Changes in visual acuity, fundus photography, optical coherence tomography (OCT, fluorescein angiography, and laser speckle flowgraphy (LSFG results were examined. Results: Both cases could be treated within 12 h after the onset of CRAO. Case 1 was a 47-year-old woman. Her visual acuity improved from counting fingers before operation to 0.08 logMAR 1 month after the surgery. However, thinning of the retina at the macula was observed by OCT. Case 2 was a 70-year-old man. His visual acuity improved from counting fingers to 0.1 logMAR 2 months after the surgery. Both fluorescein angiography and LSFG showed improvement in retinal circulation after the surgery in case 2. Conclusions: Retinal endovascular surgery with injection of tPA into the retinal artery was feasible and may be a way to improve visual acuity and retinal circulation when performed in the acute phase of CRAO.
Directory of Open Access Journals (Sweden)
Geoffrey K Aguirre
2007-06-01
Full Text Available RPE65 is an essential molecule in the retinoid-visual cycle, and RPE65 gene mutations cause the congenital human blindness known as Leber congenital amaurosis (LCA. Somatic gene therapy delivered to the retina of blind dogs with an RPE65 mutation dramatically restores retinal physiology and has sparked international interest in human treatment trials for this incurable disease. An unanswered question is how the visual cortex responds after prolonged sensory deprivation from retinal dysfunction. We therefore studied the cortex of RPE65-mutant dogs before and after retinal gene therapy. Then, we inquired whether there is visual pathway integrity and responsivity in adult humans with LCA due to RPE65 mutations (RPE65-LCA.RPE65-mutant dogs were studied with fMRI. Prior to therapy, retinal and subcortical responses to light were markedly diminished, and there were minimal cortical responses within the primary visual areas of the lateral gyrus (activation amplitude mean +/- standard deviation [SD] = 0.07% +/- 0.06% and volume = 1.3 +/- 0.6 cm(3. Following therapy, retinal and subcortical response restoration was accompanied by increased amplitude (0.18% +/- 0.06% and volume (8.2 +/- 0.8 cm(3 of activation within the lateral gyrus (p < 0.005 for both. Cortical recovery occurred rapidly (within a month of treatment and was persistent (as long as 2.5 y after treatment. Recovery was present even when treatment was provided as late as 1-4 y of age. Human RPE65-LCA patients (ages 18-23 y were studied with structural magnetic resonance imaging. Optic nerve diameter (3.2 +/- 0.5 mm was within the normal range (3.2 +/- 0.3 mm, and occipital cortical white matter density as judged by voxel-based morphometry was slightly but significantly altered (1.3 SD below control average, p = 0.005. Functional magnetic resonance imaging in human RPE65-LCA patients revealed cortical responses with a markedly diminished activation volume (8.8 +/- 1.2 cm(3 compared to controls
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
Directory of Open Access Journals (Sweden)
Tracy Chew
2017-07-01
Full Text Available Progressive retinal atrophy is a common cause of blindness in the dog and affects >100 breeds. It is characterized by gradual vision loss that occurs due to the degeneration of photoreceptor cells in the retina. Similar to the human counterpart retinitis pigmentosa, the canine disorder is clinically and genetically heterogeneous and the underlying cause remains unknown for many cases. We use a positional candidate gene approach to identify putative variants in the Hungarian Puli breed using genotyping data of 14 family-based samples (CanineHD BeadChip array, Illumina and whole-genome sequencing data of two proband and two parental samples (Illumina HiSeq 2000. A single nonsense SNP in exon 2 of BBS4 (c.58A > T, p.Lys20* was identified following filtering of high quality variants. This allele is highly associated (PCHISQ = 3.425e−14, n = 103 and segregates perfectly with progressive retinal atrophy in the Hungarian Puli. In humans, BBS4 is known to cause Bardet–Biedl syndrome which includes a retinitis pigmentosa phenotype. From the observed coding change we expect that no functional BBS4 can be produced in the affected dogs. We identified canine phenotypes comparable with Bbs4-null mice including obesity and spermatozoa flagella defects. Knockout mice fail to form spermatozoa flagella. In the affected Hungarian Puli spermatozoa flagella are present, however a large proportion of sperm are morphologically abnormal and <5% are motile. This suggests that BBS4 contributes to flagella motility but not formation in the dog. Our results suggest a promising opportunity for studying Bardet–Biedl syndrome in a large animal model.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
X-linked recessive primary retinal dysplasia is linked to the Norrie disease locus.
Ravia, Y; Braier-Goldstein, O; Bat-Miriam, K M; Erlich, S; Barkai, G; Goldman, B
1993-08-01
X-linked primary retinal dysplasia (PRD) refers to an abnormal proliferation of retinal tissue causing either its neural elements or its glial tissue to form folds, giving rise to gliosis. A Jewish family of oriental origin was previously reported by Godel and Goodman, in which a total of five males suffer from different degrees of blindness. The authors postulated that the described findings are distinguished from Norrie disease, since in this case no clinical findings, other than those associated with the eyes, were noticed in the affected males. In addition, two of the carrier females exhibit minimal eye changes. We have performed linkage analysis of the family using the L1.28, p58-1 and m27 beta probes, and DXS426 and MAOB associated microsatellites. Our results map the gene responsible for the disorder between the MAOB and DXS426, m27 beta and p58-1 loci, on the short arm of the X chromosome at Xp11.3, which suggest the possibility that the same gene is responsible for both primary retinal dysplasia and Norrie disease.
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Pharmacotherapy of retinal disease with visual cycle modulators.
Hussain, Rehan M; Gregori, Ninel Z; Ciulla, Thomas A; Lam, Byron L
2018-04-01
Pharmacotherapy with visual cycle modulators (VCMs) is under investigation for retinitis pigmentosa (RP), Leber congenital amaurosis (LCA), Stargardt macular dystrophy (SMD) and nonexudative age-related macular degeneration (AMD), all blinding diseases that lack effective treatment options. Areas covered: The authors review investigational VCMs, including oral retinoids, 9-cis-retinyl-acetate (zuretinol) and 9-cis-β-carotene, which restore 11-cis-retinal levels in RP and LCA caused by LRAT and RPE65 gene mutations, and may improve visual acuity and visual fields. Therapies for SMD aiming to decrease accumulation of toxic Vitamin A dimers and lipofuscin in the retina and retinal pigment epithelium (RPE) include C20-D3-vitamin A (ALK-001), isotretinoin, VM200, emixustat, and A1120. Mouse models of SMD show promising data for these treatments, though proof of efficacy in humans is currently lacking. Fenretinide and emixustat are investigational VCMs for dry AMD, though neither has been shown to reduce geographic atrophy or improve vision in human trials. A1120 prevents retinol transport into the RPE and may spare the side effects typically seen in VCMs (nyctalopia and chromatopsia) per mouse studies. Expert opinion: Oral VCMs may be feasible treatment options for degenerative retinal diseases based on pre-clinical and some early clinical studies. Further trials are warranted to assess their efficacy and safety in humans.
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Abdulridha-Aboud, Wissam; Kjellström, Ulrika; Andréasson, Sten
2016-01-01
Purpose To study the phenotype in two families with genetically identified autosomal dominant retinitis pigmentosa (adRP) focusing on macular structure and function. Methods Clinical data were collected at the Department of Ophthalmology, Lund University, Sweden, for affected and unaffected family members from two pedigrees with adRP. Examinations included optical coherence tomography (OCT), full-field electroretinography (ffERG), and multifocal electroretinography (mfERG). Molecular genetic screening was performed for known mutations associated with adRP. Results The mode of inheritance was autosomal dominant in both families. The members of the family with a mutation in the PRPF31 (p.IVS6+1G>T) gene had clinical features characteristic of RP, with severely reduced retinal rod and cone function. The degree of deterioration correlated well with increasing age. The mfERG showed only centrally preserved macular function that correlated well with retinal thinning on OCT. The family with a mutation in the RHO (p.R135W) gene had an extreme intrafamilial variability of the phenotype, with more severe disease in the younger generations. OCT showed pathology, but the degree of morphological changes was not correlated with age or with the mfERG results. The mother, with a de novo mutation in the RHO (p.R135W) gene, had a normal ffERG, and her retinal degeneration was detected merely with the reduced mfERG. Conclusions These two families demonstrate the extreme inter- and intrafamilial variability in the clinical phenotype of adRP. This is the first Swedish report of the clinical phenotype associated with a mutation in the PRPF31 (p.IVS6+1G>T) gene. Our results indicate that methods for assessment of the central retinal structure and function may improve the detection and characterization of the RP phenotype. PMID:27212874
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Directory of Open Access Journals (Sweden)
David B. McGuigan
2017-07-01
Full Text Available Mutations in the EYS (eyes shut homolog gene are a common cause of autosomal recessive (ar retinitis pigmentosa (RP. Without a mammalian model of human EYS disease, there is limited understanding of details of disease expression and rates of progression of the retinal degeneration. We studied clinically and with chromatic static perimetry, spectral-domain optical coherence tomography (OCT, and en face autofluoresence imaging, a cohort of 15 patients (ages 12–51 at first visit, some of whom had longitudinal data of function and structure. Rod sensitivity was able to be measured by chromatic perimetry in most patients at their earliest visits and some patients retained patchy rod function into the fifth decade of life. As expected from RP, cone sensitivity persisted after rod function was no longer measurable. The photoreceptor nuclear layer of the central retina was abnormal except at the fovea in most patients at first visit. Perifoveal disease measured over a period of years indicated that photoreceptor structural loss was followed by dysmorphology of the inner retina and loss of retinal pigment epithelial integrity. Although there could be variability in severity, preliminary analyses of the rates of vision loss suggested that EYS is a more rapidly progressive disease than other ciliopathies causing arRP, such as USH2A and MAK.
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Republished review: Gene therapy for ocular diseases.
Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao
2011-07-01
The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Investigating the role of retinal Müller cells with approaches in genetics and cell biology.
Fu, Suhua; Zhu, Meili; Ash, John D; Wang, Yunchang; Le, Yun-Zheng
2014-01-01
Müller cells are major macroglia and play many essential roles as a supporting cell in the retina. As Müller cells only constitute a small portion of retinal cells, investigating the role of Müller glia in retinal biology and diseases is particularly challenging. To overcome this problem, we first generated a Cre/lox-based conditional gene targeting system that permits the genetic manipulation and functional dissection of gene of interests in Müller cells. To investigate diabetes-induced alteration of Müller cells, we recently adopted methods to analyze Müller cells survival/death in vitro and in vivo. We also used normal and genetically altered primary cell cultures to reveal the mechanistic insights for Müller cells in biological and disease processes. In this article, we will discuss the applications and limitations of these methodologies, which may be useful for research in retinal Müller cell biology and pathophysiology.
Differential diagnosis of retinal vasculitis.
Abu El-Asrar, Ahmed M; Herbort, Carl P; Tabbara, Khalid F
2009-10-01
Retinal vaculitis is a sight-threatening inflammatory eye condition that involves the retinal vessels. Detection of retinal vasculitis is made clinically, and confirmed with the help of fundus fluorescein angiography. Active vascular disease is characterized by exudates around retinal vessels resulting in white sheathing or cuffing of the affected vessels. In this review, a practical approach to the diagnosis of retinal vasculitis is discussed based on ophthalmoscopic and fundus fluorescein angiographic findings.
Retinal pigmentary changes in chronic uveitis mimicking retinitis pigmentosa.
Sevgi, D Damla; Davoudi, Samaneh; Comander, Jason; Sobrin, Lucia
2017-09-01
To present retinal pigmentary changes mimicking retinitis pigmentosa (RP) as a finding of advanced uveitis. We retrospectively reviewed charts of patients without a family history of inherited retinal degenerations who presented with retinal pigment changes and signs of past or present intraocular inflammation. Comprehensive eye examination including best-corrected visual acuity, slit-lamp examination and dilated fundus examination was performed on all patients in addition to color fundus photography, optical coherence tomography, fluorescein angiography (FA), and full-field electroretinogram testing. We identified five patients with ages ranging from 33 to 66 years, who presented with RP-like retinal pigmentary changes which were eventually attributed to longstanding uveitis. The changes were bilateral in three cases and unilateral in two cases. Four of five cases presented with active inflammation, and the remaining case showed evidence of active intraocular inflammation during follow-up. This study highlights the overlapping features of advanced uveitis and RP including the extensive pigmentary changes. Careful review of possible past uveitis history, detailed examination of signs of past or present inflammation and ancillary testing, with FA often being most helpful, are required for the correct diagnosis. This is important, because intervention can prevent further damage if the cause of the pigmentary changes is destructive inflammation.
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
CHEN, ROYCE W. S.; GREENBERG, JONATHAN P.; LAZOW, MARGOT A.; RAMACHANDRAN, RITHU; LIMA, LUIZ H.; HWANG, JOHN C.; SCHUBERT, CARL; BRAUNSTEIN, ALEXANDRA; ALLIKMETS, RANDO; TSANG, STEPHEN H.
2015-01-01
CSNB2 had a mutation, p.R614X, in the gene encoding calcium channel, α 1F subunit. CONCLUSIONS CSNB2 patients (X-linked recessive and autosomal recessive) had significantly thinner retinas than myopic controls. However, they demonstrated qualitatively normal SD OCT and FAF images, and therefore can be differentiated from RP patients with these techniques. Although ERG testing remains the gold standard for the diagnosis of these conditions, FAF and SD OCT systems are more widely available to community ophthalmologists, offer shorter acquisition times, and, unlike ERG, can be performed on the same day as the initial clinic visit. Therefore, as a supplement to ERG and genetic testing, we advocate the use of FAF and SD OCT in the examination of patients with CSNB2 and RP. PMID:21920492
Lambertus, S.; Bax, N.M.; Fakin, A.; Groenewoud, J.M.M.; Klevering, B.J.; Moore, A.T.; Michaelides, M.; Webster, A.R.; Wilt, G.J. van der; Hoyng, C.B.
2017-01-01
BACKGROUND: Each inherited retinal disorder is rare, but together, they affect millions of people worldwide. No treatment is currently available for these blinding diseases, but promising new options-including gene therapy-are emerging. Arguably, the most prevalent retinal dystrophy is Stargardt
Repetitive magnetic stimulation improves retinal function in a rat model of retinal dystrophy
Rotenstreich, Ygal; Tzameret, Adi; Levi, Nir; Kalish, Sapir; Sher, Ifat; Zangen, Avraham; Belkin, Michael
2014-02-01
Vision incapacitation and blindness associated with retinal dystrophies affect millions of people worldwide. Retinal degeneration is characterized by photoreceptor cell death and concomitant remodeling of remaining retinal cells. Repetitive Magnetic Stimulation (RMS) is a non-invasive technique that creates alternating magnetic fields by brief electric currents transmitted through an insulated coil. These magnetic field generate action potentials in neurons, and modulate the expression of neurotransmitter receptors, growth factors and transcription factors which mediate plasticity. This technology has been proven effective and safe in various psychiatric disorders. Here we determined the effect of RMS on retinal function in Royal College of Surgeons (RCS) rats, a model for retinal dystrophy. Four week-old RCS and control Spargue Dawley (SD) rats received sham or RMS treatment over the right eye (12 sessions on 4 weeks). RMS treatment at intensity of at 40% of the maximal output of a Rapid2 stimulator significantly increased the electroretinogram (ERG) b-wave responses by up to 6- or 10-fold in the left and right eye respectively, 3-5 weeks following end of treatment. RMS treatment at intensity of 25% of the maximal output did not significant effect b-wave responses following end of treatment with no adverse effect on ERG response or retinal structure of SD rats. Our findings suggest that RMS treatment induces delayed improvement of retinal functions and may induce plasticity in the retinal tissue. Furthermore, this non-invasive treatment may possibly be used in the future as a primary or adjuvant treatment for retinal dystrophy.
de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap
2002-04-15
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.
Unravelling the genetic basis of simplex Retinitis Pigmentosa cases
Bravo-Gil, Nereida; González-del Pozo, María; Martín-Sánchez, Marta; Méndez-Vidal, Cristina; Rodríguez-de la Rúa, Enrique; Borrego, Salud; Antiñolo, Guillermo
2017-01-01
Retinitis Pigmentosa (RP) is the most common form of inherited retinal dystrophy (IRD) characterized ultimately by photoreceptors degeneration. Exhibiting great clinical and genetic heterogeneity, RP can be inherited as an autosomal dominant (ad), autosomal recessive (ar) and X-linked (xl) disorder. Although the relative prevalence of each form varies somewhat between populations, a major proportion (41% in Spain) of patients represent simplex cases (sRP) in which the mode of inheritance is unknown. Molecular genetic diagnostic is crucial, but also challenging, for sRP patients because any of the 81 RP genes identified to date may be causative. Herein, we report the use of a customized targeted gene panel consisting of 68 IRD genes for the molecular characterization of 106 sRP cases. The diagnostic rate was 62.26% (66 of 106) with a proportion of clinical refinements of 30.3%, demonstrating the high efficiency of this genomic approach even for clinically ambiguous cases. The high number of patients diagnosed here has allowed us to study in detail the genetic basis of the sRP. The solved sRP cohort is composed of 62.1% of arRP cases, 24.2% of adRP and 13.6% of xlRP, which implies consequences for counselling of patients and families. PMID:28157192
Directory of Open Access Journals (Sweden)
Hongle Xu
Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
Bilateral patching in retinal detachment: fluid mechanics and retinal "settling".
Foster, William J
2011-07-20
When a patient suffers a retinal detachment and surgery is delayed, it is known clinically that bilaterally patching the patient may allow the retina to partially reattach or "settle." Although this procedure has been performed since the 1860s, there is still debate as to how such a maneuver facilitates the reattachment of the retina. Finite element calculations using commercially available analysis software are used to elucidate the influence of reduction in eye movement caused by bilateral patching on the flow of subretinal fluid in a physical model of retinal detachment. It was found that by coupling fluid mechanics with structural mechanics, a physically consistent explanation of increased retinal detachment with eye movements can be found in the case of traction on the retinal hole. Large eye movements increase vitreous traction and detachment forces on the edge of the retinal hole, creating a subretinal vacuum and facilitating increased subretinal fluid. Alternative models, in which intraocular fluid flow is redirected into the subretinal space, are not consistent with these simulations. The results of these simulations explain the physical principles behind bilateral patching and provide insight that can be used clinically. In particular, as is known clinically, bilateral patching may facilitate a decrease in the height of a retinal detachment. The results described here provide a description of a physical mechanism underlying this technique. The findings of this study may aid in deciding whether to bilaterally patch patients and in counseling patients on pre- and postoperative care.
Identification and functional analysis of endothelial tip cell-enriched genes.
del Toro, Raquel; Prahst, Claudia; Mathivet, Thomas; Siegfried, Geraldine; Kaminker, Joshua S; Larrivee, Bruno; Breant, Christiane; Duarte, Antonio; Takakura, Nobuyuki; Fukamizu, Akiyoshi; Penninger, Josef; Eichmann, Anne
2010-11-11
Sprouting of developing blood vessels is mediated by specialized motile endothelial cells localized at the tips of growing capillaries. Following behind the tip cells, endothelial stalk cells form the capillary lumen and proliferate. Expression of the Notch ligand Delta-like-4 (Dll4) in tip cells suppresses tip cell fate in neighboring stalk cells via Notch signaling. In DLL4(+/-) mouse mutants, most retinal endothelial cells display morphologic features of tip cells. We hypothesized that these mouse mutants could be used to isolate tip cells and so to determine their genetic repertoire. Using transcriptome analysis of retinal endothelial cells isolated from DLL4(+/-) and wild-type mice, we identified 3 clusters of tip cell-enriched genes, encoding extracellular matrix degrading enzymes, basement membrane components, and secreted molecules. Secreted molecules endothelial-specific molecule 1, angiopoietin 2, and apelin bind to cognate receptors on endothelial stalk cells. Knockout mice and zebrafish morpholino knockdown of apelin showed delayed angiogenesis and reduced proliferation of stalk cells expressing the apelin receptor APJ. Thus, tip cells may regulate angiogenesis via matrix remodeling, production of basement membrane, and release of secreted molecules, some of which regulate stalk cell behavior.
The molecular genetics of Usher syndrome: Genetics of Usher syndrome
Ahmed, Zm; Riazuddin, S.; Riazuddin, S.; Wilcox, Er
2003-01-01
Association of sensorineural deafness and progressive retinitis pigmentosa with and without a vestibular abnormality is the hallmark of Usher syndrome and involves at least 12 loci among three different clinical subtypes. Genes identified for the more commonly inherited loci are USH2A (encoding usherin), MYO7A (encoding myosin VIIa), CDH23 (encoding cadherin 23), PCDH15 (encoding protocadherin 15), USH1C (encoding harmonin), USH3A (encoding clarin 1), and USH1G (encoding SANS). Transcripts fr...
DEFF Research Database (Denmark)
Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H
2012-01-01
OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.