Vaginal Gene Expression During Treatment With Aromatase Inhibitors.
Kallak, Theodora Kunovac; Baumgart, Juliane; Nilsson, Kerstin; Åkerud, Helena; Poromaa, Inger Sundström; Stavreus-Evers, Anneli
2015-12-01
Aromatase inhibitor (AI) treatment suppresses estrogen biosynthesis and causes genitourinary symptoms of menopause such as vaginal symptoms, ultimately affecting the quality of life for many postmenopausal women with breast cancer. Thus, the aim of this study was to examine vaginal gene expression in women during treatment with AIs compared with estrogen-treated women. The secondary aim was to study the presence and localization of vaginal aromatase. Vaginal biopsies were collected from postmenopausal women treated with AIs and from age-matched control women treated with vaginal estrogen therapy. Differential gene expression was studied with the Affymetrix Gene Chip Gene 1.0 ST Array (Affymetrix Inc, Santa Clara, CA) system, Ingenuity pathway analysis, quantitative real-time polymerase chain reaction, and immunohistochemistry. The expression of 279 genes differed between the 2 groups; AI-treated women had low expression of genes involved in cell differentiation, proliferation, and cell adhesion. Some differentially expressed genes were found to interact indirectly with the estrogen receptor alpha. In addition, aromatase protein staining was evident in the basal and the intermediate vaginal epithelium layers, and also in stromal cells with a slightly stronger staining intensity found in AI-treated women. In this study, we demonstrated that genes involved in cell differentiation, proliferation, and cell adhesion are differentially expressed in AI-treated women. The expression of vaginal aromatase suggests that this could be the result of local and systemic inhibition of aromatase. Our results emphasize the role of estrogen for vaginal cell differentiation and proliferation and future drug candidates should be aimed at improving cell differentiation and proliferation. Copyright © 2015 Elsevier Inc. All rights reserved.
Aromatase inhibitors in pediatrics.
Wit, Jan M; Hero, Matti; Nunez, Susan B
2011-10-25
Aromatase, an enzyme located in the endoplasmic reticulum of estrogen-producing cells, catalyzes the rate-limiting step in the conversion of androgens to estrogens in many tissues. The clinical features of patients with defects in CYP19A1, the gene encoding aromatase, have revealed a major role for this enzyme in epiphyseal plate closure, which has promoted interest in the use of inhibitors of aromatase to improve adult height. The availability of the selective aromatase inhibitors letrozole and anastrozole--currently approved as adjuvant therapy for breast cancer--have stimulated off-label use of aromatase inhibitors in pediatrics for the following conditions: hyperestrogenism, such as aromatase excess syndrome, Peutz-Jeghers syndrome, McCune-Albright syndrome and functional follicular ovarian cysts; hyperandrogenism, for example, testotoxicosis (also known as familial male-limited precocious puberty) and congenital adrenal hyperplasia; pubertal gynecomastia; and short stature and/or pubertal delay in boys. Current data suggest that aromatase inhibitors are probably effective in the treatment of patients with aromatase excess syndrome or testotoxicosis, partially effective in Peutz-Jeghers and McCune-Albright syndrome, but probably ineffective in gynecomastia. Insufficient data are available in patients with congenital adrenal hyperplasia or functional ovarian cysts. Although aromatase inhibitors appear effective in increasing adult height of boys with short stature and/or pubertal delay, safety concerns, including vertebral deformities, a decrease in serum HDL cholesterol levels and increase of erythrocytosis, are reasons for caution.
Lee, Young-Mi; Seo, Jung Soo; Kim, Il-Chan; Yoon, Yong-Dal; Lee, Jae-Seong
2006-06-30
To understand the effect of endocrine-disrupting chemicals (EDCs) on cytochrome P450 aromatase (rm-cyp19) gene expression between gender types in the hermaphroditic fish Rivulus marmoratus, we cloned two distinct rm-cyp19 genes using RT-PCR with degenerative primers, obtained full-length cDNAs using 5'- and 3'-RACE-PCR methods, and completely sequenced them. The brain aromatase (rm-cyp19b) cDNA consisted of 2,124 bp including the open reading frame (ORF), which encoded a putative protein of 505 amino acids. The ovarian aromatase (rm-cyp19a) cDNA consisted of 2,075 bp, including the ORF encoding a putative protein of 516 amino acids. Expression patterns of rm-cyp19b and rm-cyp19a mRNAs were investigated in embryos of different developmental stages and in seven different tissues of adult fish. The rm-cyp19b gene in hermaphrodite and secondary male R. marmoratus was predominantly expressed in the brain, while the rm-cyp19a gene was expressed gender-specifically in the gonad. The expression of rm-cyp19b mRNA increased from stage 1 (2 d post fertilization) to stage 4 (12 d post fertilization) in a developmental stage-dependent manner but steeply decreased in the hatching stage. Compared to the rm-cyp19b gene, the abundance of ovarian aromatase rm-cyp19a transcripts was very low, and its expression was first detected at stage 3 and then decreased gradually to the hatching stage. Alteration of rm-cyp19b and rm-cyp19a gene expression was further analyzed in the brain and gonad by real-time RT-PCR 96 h after EDC exposure in hermaphrodites and secondary males. The brain aromatase rm-cyp19b gene was up-regulated in the brain after 4-nonylphenol (4-NP)-exposure, while the ovarian aromatase rm-cyp19a gene was significantly down-regulated in the gonad. In 300 microg/L 4-tert octylphenol (4-tert-OP), or 600 microg/L bisphenol A-exposed brain and gonad, both rm-cyp19b and rm-cyp19a genes were up-regulated. In the case of secondary males, the rm-cyp19b gene was highly expressed in
Le Page, Yann; Menuet, Arnaud; Kah, Olivier; Pakdel, Farzad
2008-10-01
The cytochrome P450 Aromatase is the key enzyme catalyzing the conversion of androgens into estrogens. In zebrafish, the brain aromatase is encoded by cyp19b. Expression of cyp19b is restricted to radial glial cells bordering forebrain ventricles and is strongly stimulated by estrogens during development. At the promoter level, we have previously shown that an estrogen responsive element (ERE) is required for induction by estrogens. Here, we investigated the role of ERE flanking regions in the control of cell-specific expression. First, we show that a 20 bp length motif, named G x RE (glial x responsive element), acts in synergy with the ERE to mediate the estrogenic induction specifically in glial cells. Second, we demonstrate that, in vitro, this sequence binds factors exclusively present in glial or neuro-glial cells and is able to confer a glial specificity to an artificial estrogen-dependent gene. Taken together, these results contribute to the understanding of the molecular mechanisms allowing cyp19b regulation by estrogens and allowed to identify a promoter sequence involved in the strong estrogen inducibility of cyp19b which is specific for glial cells. The exceptional aromatase activity measured in the brain of teleost fish could rely on such mechanisms.
Molecular Bases and Phenotypic Determinants of Aromatase Excess Syndrome
Directory of Open Access Journals (Sweden)
Maki Fukami
2012-01-01
Full Text Available Aromatase excess syndrome (AEXS is a rare autosomal dominant disorder characterized by gynecomastia. This condition is caused by overexpression of CYP19A1 encoding aromatase, and three types of cryptic genomic rearrangement around CYP19A1, that is, duplications, deletions, and inversions, have been identified in AEXS. Duplications appear to have caused CYP19A1 overexpression because of an increased number of physiological promoters, whereas deletions and inversions would have induced wide CYP19A1 expression due to the formation of chimeric genes consisting of a noncoding exon(s of a neighboring gene and CYP19A1 coding exons. Genotype-phenotype analysis implies that phenotypic severity of AEXS is primarily determined by the expression pattern of CYP19A1 and the chimeric genes and by the structural property of the fused exons with a promoter function (i.e., the presence or the absence of a natural translation start codon. These results provide novel information about molecular mechanisms of human genetic disorders and biological function of estrogens.
Tang, Haipei; Chen, Yu; Liu, Yun; Yin, Yike; Li, Gaofei; Guo, Yin; Liu, Xiaochun; Lin, Haoran
2017-09-01
It has been demonstrated that estrogens are indispensable for male fertility in mammals. Aromatase (encoded by CYP19) catalyzes the final step of estradiol biosynthesis. However, less is known about the role of aromatase in male fertility in nonmammalian species. Fish aromatase is encoded by two separate genes: the gonad-specific cyp19a1a and the brain-specific cyp19a1b. In a recent study, we used transcription activatorlike effector nucleases to systematically generate cyp19a1a and cyp19a1b mutant lines and a cyp19a1a;cyp19a1b double-mutant line in zebrafish and demonstrated that cyp19a1a was indispensable for sex differentiation. In this study, we focused on male fertility in these aromatase-deficient zebrafish. Our results showed that all aromatase-deficient male fish had normal fertility even at 1 year after fertilization. Interestingly, we observed more spermatozoa in the cyp19a1a and double-mutant males than in the wild-type and cyp19a1b mutant males. The whole-body androgen levels, follicle-stimulating hormone β and luteinizing hormone β protein levels in the pituitary, and transcript levels of genes known to be involved in spermatogenesis and steroidogenesis in the testes were significantly higher in the cyp19a1a mutant and aromatase double-mutant males than in the wild-type and cyp19a1b mutant males. These results might explain why more spermatozoa were observed in these fish. Collectively, our findings indicate that estrogens are not needed to achieve and maintain normal fertility in male zebrafish. This finding challenges the traditional view that estrogens are indispensable for male fertility. Copyright © 2017 Endocrine Society.
Molecular cloning of P450 aromatase from the leopard gecko and its expression in the ovary.
Endo, Daisuke; Park, Min Kyun
2005-07-01
In this study, we identified the cDNA of P450 aromatase in the leopard gecko, a lizard with temperature-dependent sex determination. The cDNA encodes a putative protein of 505 amino acids. The deduced amino acid sequence of leopard gecko aromatase cDNA showed 80% identity with that of turtles, 70% with humans and 77% with chickens. This is the first report of the identification of P450 aromatase cDNA in squamata species. It has been reported that this gene is expressed in different layers of cells in the ovary of mammalian species and avian species. Thus, we also investigated cells expressing the mRNA of this gene in the ovary of the leopard gecko by RT-PCR and in situ hybridization. The mRNA expression of leopard gecko P450 aromatase was localized in both the thecal and granulosa cell layers in the ovary. The expression in thecal and granulosa cell layers was examined in the largest follicle, second largest follicle and third largest follicle by RT-PCR. A higher level of mRNA expression was observed in the granulosa cell layer of the second largest follicle than in other cell layers. This result may reflect the characteristics of follicles in species with automonochronic ovulation.
Aromatase expression is increased in BRCA1 mutation carriers
International Nuclear Information System (INIS)
Chand, Ashwini L; KConFab; Simpson, Evan R; Clyne, Colin D
2009-01-01
Until recently, the molecular mechanisms explaining increased incidence of ovarian and breast cancers in carriers of BRCA1 gene mutations had not been clearly understood. Of significance is the finding that BRCA1 negatively regulates aromatase expression in vitro. Our objective was to characterise aromatase gene (CYP19A1) and its promoter expression in breast adipose and ovarian tissue in BRCA1 mutation carriers and unaffected controls. We measured aromatase transcripts, total and promoter-specific (PII, PI.3, PI.4) in prophylactic oophorectomy or mastectomy, therapeutic mastectomy, ovarian and breast tissue from unaffected women. We demonstrate that the lack of functional BRCA1 protein correlates to higher aromatase levels in 85% of BRCA1 mutation carriers. This increase is mediated by aberrant transcriptional regulation of aromatase; in breast adipose by increases in promoter II/I.3 and I.4-specific transcripts; and in the ovary with elevation in promoter I.3 and II-specific transcripts. Understanding the link between BRCA1 and aromatase is significant in terms of understanding why carcinogenesis is restricted to estrogen-producing tissues in BRCA1 mutation carriers
Developmental regulation of aromatase activity in the rat hypothalamus
International Nuclear Information System (INIS)
Lephart, E.D.
1989-01-01
The brain of all mammalian species studied thus far contain an enzymatic activity (aromatase) that catalyzes the conversion of androgens to estrogens. The activity is highest during prenatal development and contributes to the establishment of sex differences which determine adult gonadotropin secretion patterns and reproductive behavior. The studies presented in this dissertation represent a systematic effort to elucidate the mechanism(s) that control the initiation of and contribute to maintaining rat hypothalamic aromatase activity during pre- and postnatal development. Aromatase enzyme activity was measured by the 3 H 2 O release assay or by traditional estrogen product isolation. Brain aromatase mRNA was detected by hybridization to a cDNA encoding rat aromatase cytochrome P-450. In both males and females the time of puberty was associated with a decline in hypothalamic aromatase activity. This decline may represent a factor underlying the peri-pubertal decrease in the sensitivity to gonadal steroid feedback that accompanies completion of puberty. The results also indicate that androgens regulate brain aromatase levels during both the prepubertal and peri-pubertal stages of sexual development and that this regulation is transiently lost in young adults. Utilizing a hypothalamic organotypic culture system, aromatase activity in vitro was maintained for as long as two days. The results of studies of a variety of hormonal and metabolic regulators suggest that prenatal aromatase activity is regulated by factor(s) that function independently from the classical cyclic AMP and protein kinase C trans-membrane signaling pathways
Zhou, Yan; Zeng, Cheng; Li, Xin; Wu, Pei-Li; Yin, Ling; Yu, Xiao-Lan; Zhou, Ying-Fang; Xue, Qing
2016-08-01
Estrogen receptor beta (ERβ, encoded by ESR2 gene) and cytochrome P450 aromatase (encoded by CYP19A1 gene) play critical roles in endometriosis, and the levels of insulin-like growth factor-I (IGF-I) in the peritoneal fluid are significantly higher in patients with endometriosis compared with those in normal women. However, the effects and mechanisms of IGF-I on ERβ and aromatase expression remain to be fully elucidated. In this study, human endometriotic stromal cells (ESCs) and endometrial cells (EMs) derived from ovarian endometriomas and eutopic endometrial tissues. ESCs were cultured with IGF-I, signal pathway inhibitors, and siRNAs. ERβ and aromatase expression were measured by real-time PCR and Western, respectively. The binding of c-Jun and CREB to the ESR2 and CYP19A1 promoters was assessed by chromatin immunoprecipitation assay. Animal experiments were performed in a xenograft mouse model. Levels of IGF-I mRNA in ESCs were markedly higher than those in EMs. IGF-I upregulated ERβ and aromatase expression in ESCs after stimulation of the IGF1R/PI3K/AKT pathway. Following IGF-I treatment, a marked increase in c-Jun and CREB phosphorylation occurred, enhancing binding to the ESR2 and CYP19A1 promoters. An IGF1R inhibitor in vivo reduced IGF-I-induced endometriosis graft growth and ERβ and aromatase expression. In conclusion, this is the first report to describe a mechanistic analysis of ERβ and aromatase expression regulated by IGF-I in ESCs. Moreover, an IGF1R inhibitor impeded ectopic lesion growth in nude mice. These findings suggest that an inhibitor of IGF1R might have therapeutic potential as an antiendometriotic drug. Level of IGF-I mRNA in ESCs is markedly higher than that in EMs. IGF-I up-regulates ERβ and aromatase expression via IGF1R/PI3K/AKT pathway. C-Jun and CREB are recruited to ESR2 or CYP19A1 promoter by IGF-I stimulation. IGF-1R inhibitors in vivo impede the growth of ectopic lesions in nude mice.
Sex change strategy and the aromatase genes.
Gardner, L; Anderson, T; Place, A R; Dixon, B; Elizur, A
2005-04-01
Sequential hermaphroditism is a common reproductive strategy in many teleosts. Steroid production is known to mediate both the natural and induced sex change, yet beyond this the physiology directing this process has received little attention. Cytochrome P450 aromatase is a key enzyme in the hormonal pathway catalysing the conversion of sex steroids, androgens to oestrogens, and thus is highly relevant to the process of sex change. This study reports the isolation of cDNA sequences for aromatase isoforms CYP19A1 and CYP19A2 from teleost species representing three forms of sexual hermaphroditism: Lates calcarifer (protandry), Cromileptes altivelis (protogyny), and Gobiodon histrio (bi-directional). Deduced amino acid analysis of these isoforms with other reported isoforms from gonochoristic (single sex) teleosts revealed 56-95% identity within the same isoform while only 48-65% identity between isoforms irrespective of species and sexual strategy. Phylogenetic analysis supported this result separating sequences into isoform exclusive clades in spite of species apparent evolutionary distance. Furthermore, this study isolates 5' flanking regions of all above genes and describes putative cis-acting elements therein. Elements identified include steroidogenic factor 1 binding site (SF-1), oestrogen response element (ERE), progesterone response element (PRE), androgen response element (ARE), glucocorticoid response elements (GRE), peroxisome proliferator-activated receptor alpha/retinoid X receptor alpha heterodimer responsive element (PPARalpha/RXRalpha), nuclear factor kappabeta (NF-kappabeta), SOX 5, SOX 9, and Wilms tumor suppressor (WTI). A hypothetical in vivo model was constructed for both isoforms highlighting potential roles of these putative cis-acting elements with reference to normal function and sexual hermaphroditism.
Medway, Christopher; Combarros, Onofre; Cortina-Borja, Mario; Butler, Helen T; Ibrahim-Verbaas, Carla A; de Bruijn, Renée F A G; Koudstaal, Peter J; van Duijn, Cornelia M; Ikram, M Arfan; Mateo, Ignacio; Sánchez-Juan, Pascual; Lehmann, Michael G; Heun, Reinhard; Kölsch, Heike; Deloukas, Panos; Hammond, Naomi; Coto, Eliecer; Alvarez, Victoria; Kehoe, Patrick G; Barber, Rachel; Wilcock, Gordon K; Brown, Kristelle; Belbin, Olivia; Warden, Donald R; Smith, A David; Morgan, Kevin; Lehmann, Donald J
2014-02-01
Epistasis between interleukin-10 (IL10) and aromatase gene polymorphisms has previously been reported to modify the risk of Alzheimer's disease (AD). However, although the main effects of aromatase variants suggest a sex-specific effect in AD, there has been insufficient power to detect sex-specific epistasis between these genes to date. Here we used the cohort of 1757 AD patients and 6294 controls in the Epistasis Project. We replicated the previously reported main effects of aromatase polymorphisms in AD risk in women, for example, adjusted odds ratio of disease for rs1065778 GG=1.22 (95% confidence interval: 1.01-1.48, P=0.03). We also confirmed a reported epistatic interaction between IL10 rs1800896 and aromatase (CYP19A1) rs1062033, again only in women: adjusted synergy factor=1.94 (1.16-3.25, 0.01). Aromatase, a rate-limiting enzyme in the synthesis of estrogens, is expressed in AD-relevant brain regions ,and is downregulated during the disease. IL-10 is an anti-inflammatory cytokine. Given that estrogens have neuroprotective and anti-inflammatory activities and regulate microglial cytokine production, epistasis is biologically plausible. Diminishing serum estrogen in postmenopausal women, coupled with suboptimal brain estrogen synthesis, may contribute to the inflammatory state, that is a pathological hallmark of AD.
Romo-Mendoza, Daniel; Campos-Ramos, Rafael; Vázquez-Islas, Grecia; Burgos-Aceves, Mario A; Esquivel-Gutiérrez, Edgar R; Guerrero-Tortolero, Danitzia A
2018-01-25
Social factors and aromatase gene expression in the leopard grouper Mycteroperca rosacea was studied when captive fish were separated by sex during the reproductive (April-June) and post-reproductive (July-September) seasons. Monosex females, monosex males, and mixed-sex, held in social sextet units were analyzed for sex steroids throughout confinement. At the end of the experiment, the gonad-sex was defined by histology, and gonad and brain aromatase gene expressions were quantified. Only males held in the monosex social units changed sex. Histology showed one male remained unchanged, six were found in a transitional sexual stage, in which two had intersex-predominantly-testes, and four had a more defined intersex ovo-testes pattern, and 11 were immature de novo females (neofemales). Neofemales and most intersex fish did not survive. In spring, 11-ketosterone showed a specific male profile, which suggests that male-to-female sex change was not triggered during the reproductive season. The low steroid levels in summer made it impossible to associate the sex change to a gonad hormonal shift; in September, gonad aromatase gene expression was not significantly different among groups. However, brain aromatase expression in intersex fish was significantly higher than monosex females, mixed-sex females, and neofemale groups. These results suggest that in the absence of female hormonal compounds, and at a time when male gonad steroidogenesis was diminished, the brain mediated male-to-male social-behavioral interactions, including stress, by increasing aromatization, resulting in derived intersex-male, which triggered more aromatization, followed by a sex change. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Akio Takeuchi
Full Text Available Aromatase, the key enzyme responsible for estrogen biosynthesis, is present in the brain of all vertebrates. Much evidence has accumulated that aromatase is highly and exclusively expressed in proliferating mature radial glial cells in the brain of teleost fish even in adulthood, unlike in other vertebrates. However, the physiological significance of this expression remains unknown. We recently found that aromatase is female-specifically expressed in the optic tectum of adult medaka fish. In the present study, we demonstrated that, contrary to the accepted view of the teleost brain, female-specific aromatase-expressing cells in the medaka optic tectum represent a transient subset of post-proliferative immature radial glial cells in the neural stem cell lineage. This finding led us to hypothesize that female-specific aromatase expression and consequent estrogen production causes some sex difference in the life cycle of tectal cells. As expected, the female tectum exhibited higher expression of genes indicative of cell proliferation and radial glial maturation and lower expression of an anti-apoptotic gene than did the male tectum, suggesting a female-biased acceleration of the cell life cycle. Complicating the interpretation of this result, however, is the additional observation that estrogen administration masculinized the expression of these genes in the optic tectum, while simultaneously stimulating aromatase expression. Taken together, these results provide evidence that a unique subpopulation of neural stem cells female-specifically express aromatase in the optic tectum and suggest that this aromatase expression and resultant estrogen synthesis have an impact on the life cycle of tectal cells, whether stimulatory or inhibitory.
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Directory of Open Access Journals (Sweden)
Irene Moy
Full Text Available Aromatase inhibitors (AIs are the most effective class of drugs in the endocrine treatment of breast cancer, with an approximate 50% treatment response rate. Our objective was to determine whether intratumoral expression levels of estrogen-related genes are predictive of AI responsiveness in postmenopausal women with breast cancer. Primary breast carcinomas were obtained from 112 women who received AI therapy after failing adjuvant tamoxifen therapy and developing recurrent breast cancer. Tumor ERα and PR protein expression were analyzed by immunohistochemistry (IHC. Messenger RNA (mRNA levels of 5 estrogen-related genes-AKR1C3, aromatase, ERα, and 2 estradiol/ERα target genes, BRCA1 and PR-were measured by real-time PCR. Tumor protein and mRNA levels were compared with breast cancer progression rates to determine predictive accuracy. Responsiveness to AI therapy-defined as the combined complete response, partial response, and stable disease rates for at least 6 months-was 51%; rates were 56% in ERα-IHC-positive and 14% in ERα-IHC-negative tumors. Levels of ERα, PR, or BRCA1 mRNA were independently predictive for responsiveness to AI. In cross-validated analyses, a combined measurement of tumor ERα and PR mRNA levels yielded a more superior specificity (36% and identical sensitivity (96% to the current clinical practice (ERα/PR-IHC. In patients with ERα/PR-IHC-negative tumors, analysis of mRNA expression revealed either non-significant trends or statistically significant positive predictive values for AI responsiveness. In conclusion, expression levels of estrogen-related mRNAs are predictive for AI responsiveness in postmenopausal women with breast cancer, and mRNA expression analysis may improve patient selection.
Directory of Open Access Journals (Sweden)
Luke S Lambeth
Full Text Available Estrogens play a key role in sexual differentiation of both the gonads and external traits in birds. The production of estrogen occurs via a well-characterised steroidogenic pathway, which is a multi-step process involving several enzymes, including cytochrome P450 aromatase. In chicken embryos, the aromatase gene (CYP19A1 is expressed female-specifically from the time of gonadal sex differentiation. To further explore the role of aromatase in sex determination, we ectopically delivered this enzyme using the retroviral vector RCASBP in ovo. Aromatase overexpression in male chicken embryos induced gonadal sex-reversal characterised by an enlargement of the left gonad and development of ovarian structures such as a thickened outer cortex and medulla with lacunae. In addition, the expression of key male gonad developmental genes (DMRT1, SOX9 and Anti-Müllerian hormone (AMH was suppressed, and the distribution of germ cells in sex-reversed males followed the female pattern. The detection of SCP3 protein in late stage sex-reversed male embryonic gonads indicated that these genetically male germ cells had entered meiosis, a process that normally only occurs in female embryonic germ cells. This work shows for the first time that the addition of aromatase into a developing male embryo is sufficient to direct ovarian development, suggesting that male gonads have the complete capacity to develop as ovaries if provided with aromatase.
Ekspresi Gen CYP19 Aromatase, Estrogen, Androgen pada penderita Periodontitis Agresif
Directory of Open Access Journals (Sweden)
Dahlia Herawati
2016-11-01
Full Text Available Kepadatan tulang tubuh ditentukan oleh gen CYP19 aromatase, hormon estrogen dan androgen. Pada periodontitis agresif terjadi perkembangan cepat kerusakan tulang alveolar, dan kerusakan tulang alveoler tersebut tidak diimbangioleh regenerasi tulang. Tujuan penelitian ini adalah menunjukkan ekspresi gen CYP19 aromatase, estrogen, androgen pada penderita periodontitis agresif agar dapat untuk menjadi pertimbangan pada saat melakukan perawatan periodontal. Metode penelitian, pemeriksaan ekspresi gen aromatse CYP19 berasal dari spesimen tulang alveolar menggunakan imunohistokimia, pengukuran hormon estrogen dan androgen dari serum menggunakan Vidas: Elfa. Hasil penelitian ekspresi gene CYP19 aromatase pada periodontitis agresif menunjukkan gambaran lebih rendah densitasnya dibandingkan pada nonperiodontitis. Estrogen dan androgen pad aperiodontitis agresif ada kecenderungan lebih rendah dibandingkan pada nonperiodontitis. Kesimpulan regenerasi tulang alveoler pad a periodontitis agresif terhambat karena sedikitnya gen CYP19 aromatase dan hormon estrogen dan androgen yang berperan pada pembentukan tulang alveoler kurang memadai.
Saïd, Lamia; Delalande, Christelle; Britton-Davidian, Janice; Saïd, Khaled; Saad, Ali; Carreau, Serge
2007-07-01
House mice (Mus musculus domesticus) in Tunisia consists of two races, one carries the 40-acrocentric standard karyotypes and the other one is a robertsonian race (2n=22) homozygous for nine centric fusions (Rb). The F1 hybrids between the two chromosomal races showed a significant decrease in reproductive success and litter size. Such results can be related to the formation of meiotic trivalent in the hybrids leading to the production of viable aneuploid gametes and post-zygotic elimination of embryos due to chromosomal non disjunction events at meiosis. Moreover, testicular histology of F1 and backcross males showed in some cases a breakdown in spermatogenesis. In both females and males, androgens but also estrogens play an important role in gametogenesis. In this study, we have studied aromatase and estrogen receptor alpha (ERalpha) gene expression in the gonads of the two parental races and their chromosomal hybrids. The results showed that aromatase and ERalpha mRNAs are expressed in hybrid males of inter-racial crosses (female22Rb x male40Std and female40Std x male22Rb) and in hybrid females of inter-racial crosses (female22Rb x male40Std) as in the two parental races. However, in hybrid females of inter-racial crosses (female40Std x male22Rb) the amount of aromatase transcripts decreased sharply suggesting that this gene is involved in the breakdown of hybrid fertility in females, but not in males. However, in hybrid males, a putative post-translational modification of this enzyme, in terms of activity, should be verified.
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Cocciadiferro, Letizia; Miceli, Vitale; Granata, Orazia M; Carruba, Giuseppe
2017-09-01
The product of neurofibromatosis type 2 (NF2) gene, also known as Merlin/neurofibromin 2, homeostatically regulates liver stem cells by controlling abundance and signaling of epidermal growth factor receptor (EGFR), with a mechanism independent of the Hippo pathway. We have reported that locally elevated estrogen formation, driven by abnormally high expression and function of aromatase, may be implicated in development and progression of human hepatocellular carcinoma (HCC) through activation of a rapid signaling pathway mediated by amphiregulin (AREG) and EGFR. We have recently presented a model by which the aromatase-estrogen-amphiregulin-EGFR axis is activated in response to tissue injury and/or inflammatory disease, with its alteration eventually leading to development of major human tumors (liver, breast, prostate) and other chronic diseases (diabetes, obesity, Alzheimer's and heart disease). In this study, we investigated NF2 expression in liver cancer cells and tissues in relation to aromatase expression/function, estrogen receptor (ER) status and amphiregulin. Our data indicate that NF2 expression is associated with aromatase and AREG expression, being elevated in HCC tissues and HepG2 cells, intermediate in cirrhotic tissues and Huh7 cells, and lower in nontumoral liver and HA22T cells. In addition, NF2 expression is inversely related to wild type hERα66 and proportional to the expression of the membrane-associated hERα36 splice variant, as measured by exon-specific RT-PCR analysis, both in vivo and in vitro. Furthermore, incubation with estradiol induced a significant decrease of NF2 expression in both HA22T and Huh7 cells (over 54% and 22%, respectively), while no change could be observed in HepG2 cells, this effect being inversely related to aromatase expression and activity in HCC cell lines. Based on the above combined evidence, we hypothesize that NF2 behaves as a protein sensing tissue damage and aromatase-driven local estrogen formation
Regulation of brain aromatase activity in rats
International Nuclear Information System (INIS)
Roselli, C.E.; Ellinwood, W.E.; Resko, J.A.
1984-01-01
The distribution and regulation of aromatase activity in the adult rat brain with a sensitive in vitro assay that measures the amount of 3 H 2 O formed during the conversion of [1 beta- 3 H]androstenedione to estrone. The rate of aromatase activity in the hypothalamus-preoptic area (HPOA) was linear with time up to 1 h, and with tissue concentrations up to 5 mgeq/200 microliters incubation mixture. The enzyme demonstrated a pH optimum of 7.4 and an apparent Michaelis-Menten constant (Km) of 0.04 microns. The greatest amount of aromatase activity was found in amygdala and HPOA from intact male rats. The hippocampus, midbrain tegmentum, cerebral cortex, cerebellum, and anterior pituitary all contained negligible enzymatic activity. Castration produced a significant decrease in aromatase activity in the HPOA, but not in the amygdala or cerebral cortex. The HPOAs of male rats contained significantly greater aromatase activity than the HPOAs of female rats. In females, this enzyme activity did not change during the estrous cycle or after ovariectomy. Administration of testosterone to gonadectomized male and female rats significantly enhanced HPOA aromatase activities to levels approximating those found in HPOA from intact males. Therefore, the results suggest that testosterone, or one of its metabolites, is a major steroidal regulator of HPOA aromatase activity in rats
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Aromatase inhibitors and breast cancer prevention.
Litton, Jennifer Keating; Arun, Banu K; Brown, Powel H; Hortobagyi, Gabriel N
2012-02-01
Endocrine therapy with selective estrogen receptor modulators (SERMs) has been the mainstay of breast cancer prevention trials to date. The aromatase inhibitors, which inhibit the final chemical conversion of androgens to estrogens, have shown increased disease-free survival benefit over tamoxifen in patients with primary hormone receptor-positive breast cancer, as well as reducing the risk of developing contralateral breast cancers. The aromatase inhibitors are being actively evaluated as prevention agents for women with a history of ductal carcinoma in situ as well as for women who are considered to be at high risk for developing primary invasive breast cancer. This review evaluates the available prevention data, as evidenced by the decrease in contralateral breast cancers, when aromatase inhibitors are used in the adjuvant setting, as well as the emerging data of the aromatase inhibitors specifically tested in the prevention setting for women at high risk. Exemestane is a viable option for breast cancer prevention. We continue to await further follow-up on exemestane as well as other aromatase inhibitors in the prevention setting for women at high risk of developing breast cancer or with a history of ductal carcinoma in situ.
Rapid Modulation of Aromatase Activity in the Vertebrate Brain
Directory of Open Access Journals (Sweden)
Thierry D. Charlier
2013-01-01
Full Text Available Numerous steroid hormones, including 17β-estradiol (E2, activate rapid and transient cellular, physiological, and behavioral changes in addition to their well-described genomic effects. Aromatase is the key-limiting enzyme in the production of estrogens, and the rapid modulation of this enzymatic activity could produce rapid changes in local E2 concentrations. The mechanisms that might mediate such rapid enzymatic changes are not fully understood but are currently under intense scrutiny. Recent studies in our laboratory indicate that brain aromatase activity is rapidly inhibited by an increase in intracellular calcium concentration resulting from potassium-induced depolarization or from the activation of glutamatergic receptors. Phosphorylating conditions also reduce aromatase activity within minutes, and this inhibition is blocked by the addition of multiple protein kinase inhibitors. This rapid modulation of aromatase activity by phosphorylating conditions is a general mechanism observed in different cell types and tissues derived from a variety of species, including human aromatase expressed in various cell lines. Phosphorylation processes affect aromatase itself and do not involve changes in aromatase protein concentration. The control of aromatase activity by multiple kinases suggests that several amino acids must be concomitantly phosphorylated to modify enzymatic activity but site-directed mutagenesis of several amino acids alone or in combination has not to date revealed the identity of the targeted residue(s. Altogether, the phosphorylation processes affecting aromatase activity provide a new general mechanism by which the concentration of estrogens can be rapidly altered in the brain.
Eriksen, Mette Brandt; Glintborg, Dorte; Nielsen, Michael Friberg Bruun; Jakobsen, Marianne Antonius; Brusgaard, Klaus; Tan, Qihua; Gaster, Michael
2014-09-05
Polycystic ovary syndrome (PCOS) is associated with insulin resistance and increased risk of type 2 diabetes. Skeletal muscle is the major site of insulin mediated glucose disposal and the skeletal muscle tissue is capable to synthesize, convert and degrade androgens. Insulin sensitivity is conserved in cultured myotubes (in vitro) from patients with PCOS, but the effect of testosterone on this insulin sensitivity is unknown. We investigated the effect of 7days testosterone treatment (100nmol/l) on glucose transport and gene expression levels of hormone receptors and enzymes involved in the synthesis and conversion of testosterone (HSD17B1, HSD17B2, CYP19A1, SRD5A1-2, AR, ER-α, HSD17B6 and AKR1-3) in myotubes from ten patients with PCOS and ten matched controls. Testosterone treatment significantly increased aromatase and androgen receptor gene expression levels in patients and controls. Glucose transport in myotubes was comparable in patients with PCOS vs. controls and was unchanged by testosterone treatment (p=0.21 PCOS vs. controls). These results suggest that testosterone treatment of myotubes increases the aromatase and androgen receptor gene expression without affecting insulin sensitivity and if testosterone is implicated in muscular insulin resistance in PCOS, this is by and indirect mechanism. Copyright © 2014 Elsevier Inc. All rights reserved.
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
Brain aromatase: roles in reproduction and neuroprotection.
Roselli, Charles F
2007-01-01
It is well established that aromatization constitutes an essential part of testosterone's signaling pathway in brain and that estrogen metabolites, often together with testosterone, organize and activate masculine neural circuits. This paper summarizes the current understanding regarding the distribution, regulation and function of brain aromatase in mammals. Data from our laboratory are presented that highlight the important function of aromatase in the regulation of androgen feedback sensitivity in non-human primates and the possible role that aromatase plays in determining the brain structure and sexual partner preferences of rams. In addition, new data is presented indicating that the capacity for aromatization in cortical astrocytes is associated with cell survival and may be important for neuroprotection. It is anticipated that a better appreciation of the physiological and pathophysiological functions of aromatase will lead to important clinical insights.
Aromatase inhibitors in men: effects and therapeutic options
Directory of Open Access Journals (Sweden)
de Jong Frank H
2011-06-01
Full Text Available Abstract Aromatase inhibitors effectively delay epiphysial maturation in boys and improve testosterone levels in adult men Therefore, aromatase inhibitors may be used to increase adult height in boys with gonadotropin-independent precocious puberty, idiopathic short stature and constitutional delay of puberty. Long-term efficacy and safety of the use of aromatase inhibitors has not yet been established in males, however, and their routine use is therefore not yet recommended.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Ramallo, Martín R; Honji, Renato M; Birba, Agustina; Morandini, Leonel; Varela, María L; Genovese, Griselda; Moreira, Renata G; Somoza, Gustavo M; Pandolfi, Matías
2017-10-01
For many species parental behavior is essential for the survival of the offspring. While the ultimate causes of teleost parental behavior have been widely studied, comparatively little is known about its proximate causes. The aim of this study was to analyze the yet unexplored, potential dual role of brain and gonadal aromatases, the enzymes responsible for the conversion of androgens to estrogens in the brains and gonads of teleosts, respectively, on the different stages of the maternal care period of the biparental cichlid Cichlasoma dimerus, locally known as chanchita. By immunohistochemistry we analyzed the neural distribution of brain aromatase and observed it exclusively within the forebrain, including areas involved in the regulation of parental behavior. We next analyzed the gene expression of brain aromatase in the brain, and gonadal aromatase in the ovary, of female chanchitas through the parental care period. To further characterize the physiological environment associated to maternal care, we also evaluated sex steroid levels (17β-estradiol, testosterone and 11-ketotestoterone) and ovarian follicle percentage. The onset of parental behavior specifically downregulated sex steroids synthesis and the rate of ovarian maturation, as denoted by a more than 10-fold decrease in steroid levels and delayed detection of mature follicles in females with offspring, compared to females which eggs were removed. Gene expression levels of both aromatases were independent of maternal care at the evaluated time points, even though they varied during the parental care period. Copyright © 2017 Elsevier Inc. All rights reserved.
Aromatase inhibitor (anastrozole) affects growth of endometrioma cells in culture.
Badawy, Shawky Z A; Brown, Shereene; Kaufman, Lydia; Wojtowycz, Martha A
2015-05-01
To study the effects of aromatase inhibitor (anastrozole) on the growth and estradiol secretion of endometrioma cells in culture. Endometrioma cells are grown in vitro until maximum growth before used in this study. This was done in the research laboratory for tissue culture, in an academic hospital. Testosterone at a concentration of 10 μg/mL was added as a substrate for the intracellular aromatase. In addition, aromatase inhibitor was added at a concentration of 200 and 300 μg/mL. The effect on cell growth and estradiol secretion is evaluated using Student's t-test. The use of testosterone increased estradiol secretion by endometrioma cells in culture. The use of aromatase inhibitor significantly inhibited the growth of endometrioma cells, and estradiol secretion. Aromatase inhibitor (anastrozole) may be an effective treatment for endometriosis due to inhibition of cellular aromatase. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Expression study of CYP19A1 gene in a cohort of Iranian leiomyoma patients
Directory of Open Access Journals (Sweden)
Leila Emrahi
2018-07-01
Full Text Available Background: CYP19A1 gene encodes aromatase, a microsomal key enzyme that catalyzes the synthesis of estrogens from androgens. Accumulating evidence has revealed that aromatase plays an important role in the pathogenesis of leiomyoma through increasing local concentration of estrogens. In this study, we examined the levels of CYP19A1 mRNA to determine the impact of aromatase overexpression in uterine leiomyoma growth. Subjects and methods: Tissues were obtained via myomectomy or hysterectomy from 30 patients. Total RNA was extracted and cDNA was synthesized from each frozen sample. Using SYBR Green dye, Real-time PCR assay was performed by sequence-specific primers. Relative mRNA expression was normalized to the mean of the Ct values determined for HPRT1. Gene expression ratio in each sample was determined relative to the mean ΔCt value of tumor-free margin samples. Results: PCR efficiencies for amplification reactions of HPRT1, and CYP19A genes were calculated as 0.93 and 0.96, respectively. Regression coefficients (R for standard curves were above 0.90. The obtained data revealed that the mean fold increase of CYP19A1 gene expression in leiomyoma samples relative to normal samples was 3.551 (95% CI: 0.04–6.64, S.E., 0.29–5.35. Conclusions: Our results were in accordance with previous studies and imply that up-regulation of CYP19A1 is correlated with the pathogenesis of leiomyoma tumors. We also observed that expression level of CYP19A1 was not linked to the tumor size or localization. It can be concluded that; up-regulation of aromatase is a key factor in the initiation of tumor development as well as tumor growth. Keywords: Leiomyoma, CYP19A1, Real-time PCR, Gene expression study
Neuroinflammation induces glial aromatase expression in the uninjured songbird brain
Directory of Open Access Journals (Sweden)
Saldanha Colin J
2011-07-01
Full Text Available Abstract Background Estrogens from peripheral sources as well as central aromatization are neuroprotective in the vertebrate brain. Under normal conditions, aromatase is only expressed in neurons, however following anoxic/ischemic or mechanical brain injury; aromatase is also found in astroglia. This increased glial aromatization and the consequent estrogen synthesis is neuroprotective and may promote neuronal survival and repair. While the effects of estradiol on neuroprotection are well studied, what induces glial aromatase expression remains unknown. Methods Adult male zebra finches (Taeniopygia guttata were given a penetrating injury to the entopallium. At several timepoints later, expression of aromatase, IL-1β-like, and IL-6-like were examined using immunohisotchemistry. A second set of zebra birds were exposed to phytohemagglutinin (PHA, an inflammatory agent, directly on the dorsal surface of the telencephalon without creating a penetrating injury. Expression of aromatase, IL-1β-like, and IL-6-like were examined using both quantitative real-time polymerase chain reaction to examine mRNA expression and immunohistochemistry to determine cellular expression. Statistical significance was determined using t-test or one-way analysis of variance followed by the Tukey Kramers post hoc test. Results Following injury in the zebra finch brain, cytokine expression occurs prior to aromatase expression. This temporal pattern suggests that cytokines may induce aromatase expression in the damaged zebra finch brain. Furthermore, evoking a neuroinflammatory response characterized by an increase in cytokine expression in the uninjured brain is sufficient to induce glial aromatase expression. Conclusions These studies are among the first to examine a neuroinflammatory response in the songbird brain following mechanical brain injury and to describe a novel neuroimmune signal to initiate aromatase expression in glia.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Computational drug designing of fungal pigments as potential aromatase inhibitors
Directory of Open Access Journals (Sweden)
Nighat Fatima
2014-12-01
Full Text Available The existing aromatase inhibitors produced unwelcome effects impose the discovery of novel drugs with privileged selectivity, a reduced amount of toxicity and humanizing potency. In this study, we illuminate the binding mode of polyketide azaphilanoid pigments monascin, ankaflavin, monascorubrin and monascorubramine isolated from Monascus fungus to the aromatase by molecular docking. The 3-dimensional structure of aromatase enzyme (PDB: 4KQ8 was obtained from the Protein Data Bank. PatchDock docking software was used to analyze structural complexes of the aromatase with monascus pigments. Comparatively, the AutoGrid model presented the most briskly constructive binding mode of monascin to aromatase. Docked energies in kcal/mol are: monascin;-13.2; monascorubramine:-12.8, monascorubrin:-12.3; ankaflavin: -10.5. These outcomes exposed these ligands could be potential drugs to treat hormone dependent breast cancer.
Belgorosky, Alicia; Pepe, Carolina; Marino, Roxana; Guercio, Gabriela; Saraco, Nora; Vaiani, Elisa; Rivarola, Marco A
2003-11-01
A loss of function mutation of the CYP19 aromatase gene leads to excess circulating androgens in the fetus and in the mother, resulting in ambiguous genitalia in the female fetus. Later on, lack of aromatase is responsible for sexual infantilism, primary amenorrhea, tall stature, and multicystic ovaries, even in preadolescent girls. Up to now, 11 CYP19 aromatase point mutations and 10 well-documented cases have been reported. In the present case, we are reporting the clinical and hormonal follow-up, from birth to 7 yr of age, of an affected girl with ambiguous genitalia. Gene analysis showed that she was a compound heterozygote for two new CYP19 aromatase point mutations. In the father's allele, there was a consensus 5' splice donor sequence mutation, GAA-AAA at cDNA position bp 655 in exon 5, which probably results in a cryptic donor site. In the mother's allele, there was a base A deletion in exon 9 (Delta A GLU 412X), causing a frame shift mutation, and a stop codon after 98 bp (33 codons) downstream, altering the critical heme-binding region. Basal serum LH and FSH levels were high at 8 d of age (42.9 and 51.3 U/liter), 26 d of age (76.2 and 119 U/liter), and 60 d of age (58.7 and 150 U/liter, respectively). Both gonadotropins dropped dramatically between the second and fifth months of age (to 1.79 and 14.9 U/liter) but remained higher than in normal control girls (0.64 and 8.5 U/liter, respectively). Serum testosterone (T) and androstenedione (Delta(4)A) levels were high during the first month, but Delta(4)A was normal at 2 months of age. However, at 5 months of age, along with significant decrements of serum LH and FSH levels and increments in serum Delta(4)A and T levels, a large ovarian cyst was removed from each gonad. Relatively high levels of T [27.3 ng/ml (94.6 nmol/liter); control, 34.9 ng/ml (121 nmol/liter)], but not of estradiol [1.8 ng/ml (6.6 nmol/liter); control 62.9 ng/ml (231 nmol/liter)], and a high T/estradiol ratio [15.2; control < 1] were
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Placental Aromatase Is Deficient in Placental Ischemia and Preeclampsia.
Directory of Open Access Journals (Sweden)
Alejandra Perez-Sepulveda
Full Text Available Preeclampsia is a maternal hypertensive disorder with uncertain etiology and a leading cause of maternal and fetal mortality worldwide, causing nearly 40% of premature births delivered before 35 weeks of gestation. The first stage of preeclampsia is characterized by reduction of utero-placental blood flow which is reflected in high blood pressure and proteinuria during the second half of pregnancy. In human placenta androgens derived from the maternal and fetal adrenal glands are converted into estrogens by the enzymatic action of placental aromatase. This implies that alterations in placental steroidogenesis and, subsequently, in the functionality or bioavailability of placental aromatase may be mechanistically involved in the pathophysiology of PE.Serum samples were collected at 32-36 weeks of gestation and placenta biopsies were collected at time of delivery from PE patients (n = 16 and pregnant controls (n = 32. The effect of oxygen tension on placental cells was assessed by incubation JEG-3 cells under 1% and 8% O2 for different time periods, Timed-mated, pregnant New Zealand white rabbits (n = 6 were used to establish an in vivo model of placental ischemia (achieved by ligature of uteroplacental vessels. Aromatase content and estrogens and androgens concentrations were measured.The protein and mRNA content of placental aromatase significantly diminished in placentae obtained from preeclamptic patients compared to controls. Similarly, the circulating concentrations of 17-β-estradiol/testosterone and estrone/androstenedione were reduced in preeclamptic patients vs. controls. These data are consistent with a concomitant decrease in aromatase activity. Aromatase content was reduced in response to low oxygen tension in the choriocarcinoma JEG-3 cell line and in rabbit placentae in response to partial ligation of uterine spiral arteries, suggesting that reduced placental aromatase activity in preeclamptic patients may be associated with chronic
Aromatase and estrogen receptors in male reproduction.
Carreau, Serge; Delalande, Christelle; Silandre, Dorothée; Bourguiba, Sonia; Lambard, Sophie
2006-02-26
Aromatase is a terminal enzyme which transforms irreversibly androgens into estrogens and it is present in the endoplasmic reticulum of numerous tissues. We have demonstrated that mature rat germ cells express a functional aromatase with a production of estrogens equivalent to that of Leydig cells. In humans in addition to Leydig cells, we have shown the presence of aromatase in ejaculated spermatozoa and in immature germ cells. In most tissues, high affinity estrogen receptors, ERalpha and/or ERbeta, mediate the role of estrogens. Indeed, in human spermatozoa, we have successfully amplified ERbeta mRNA but the protein was not detectable. Using ERalpha antibody we have detected two proteins in human immature germ cells: one at the expected size 66 kDa and another at 46 kDa likely corresponding to the ERalpha isoform lacking exon 1. In spermatozoa only the 46 kDa isoform was present, and we suggest that it may be located on the membrane. In addition, in men genetically deficient in aromatase, it is reported that alterations of spermatogenesis occur both in terms of the number and motility of spermatozoa. All together, these observations suggest that endogenous estrogens are important in male reproduction.
Aromatase in the brain: not just for reproduction anymore.
Garcia-Segura, L M
2008-06-01
Aromatase, the enzyme that synthesises oestrogens from androgen precursors, is expressed in the brain, where it has been classically associated with the regulation of neuroendocrine events and behaviours linked with reproduction. Recent findings, however, have revealed new unexpected roles for brain aromatase, indicating that the enzyme regulates synaptic activity, synaptic plasticity, neurogenesis and the response of neural tissue to injury, and may contribute to control nonreproductive behaviours, mood and cognition. Therefore, the function of brain aromatase is not restricted to the regulation of reproduction as previously thought.
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Directory of Open Access Journals (Sweden)
Anat eBiegon
2012-11-01
Full Text Available Cigarette smoking continues to be a major public health problem, and while smoking rates in men have shown some decrease over the last few decades, smoking rates among girls and young women are increasing. Practically all of the important aspects of cigarette smoking are sexually dimorphic. Women become addicted more easily than men, while finding it harder to quit. Nicotine replacement appears to be less effective in women. This may be linked to the observation that women are more sensitive than men to non-nicotine cues or ingredients in cigarettes. The reasons for these sex differences are mostly unknown. Several lines of evidence suggest that many of the reported sex differences related to cigarette smoking may stem from the inhibitory effects of nicotine and other tobacco alkaloids on estrogen synthesis via the enzyme aromatase (cyp19a gene product. Aromatase is the last enzyme in estrogen biosynthesis, catalyzing the conversion of androgens to estrogens. This review provides a summary of experimental evidence supporting brain aromatase as a potential mediator and/or modulator of nicotine actions in the brain, contributing to sex differences in smoking behavior. Additional research on the interaction between tobacco smoke, nicotine and aromatase may help devise new, sex specific methods for prevention and treatment of smoking addiction.
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Aromatase Expression in the Hippocampus of AD Patients and 5xFAD Mice
Directory of Open Access Journals (Sweden)
Janine Prange-Kiel
2016-01-01
Full Text Available Numerous studies show that 17β-estradiol (E2 protects against Alzheimer’s disease (AD induced neurodegeneration. The E2-synthesizing enzyme aromatase is expressed in healthy hippocampi, but although the hippocampus is severely affected in AD, little is known about the expression of hippocampal aromatase in AD. To better understand the role of hippocampal aromatase in AD, we studied its expression in postmortem material from patients with AD and in a mouse model for AD (5xFAD mice. In human hippocampi, aromatase-immunoreactivity was observed in the vast majority of principal neurons and signal quantification revealed higher expression of aromatase protein in AD patients compared to age- and sex-matched controls. The tissue-specific first exons of aromatase I.f, PII, I.3, and I.6 were detected in hippocampi of controls and AD patients by RT-PCR. In contrast, 3-month-old, female 5xFAD mice showed lower expression of aromatase mRNA and protein (measured by qRT-PCR and semiquantitative immunohistochemistry than WT controls; no such differences were observed in male mice. Our findings stress the importance of hippocampal aromatase expression in neurodegenerative diseases.
Gupta, Akash; Mehta, Rajeshwari; Alimirah, Fatouma; Peng, Xinjian; Murillo, Genoveva; Wiehle, Ronald; Mehta, Rajendra G
2013-01-01
Aromatase inhibitors (AI) are considered as a first line therapy for ER+PR+ breast cancers. However, many patients acquire resistance to AI. In this study, we determined the response of antiprogestin CDB-4124 (Proellex) on the aromatase overexpressing and Letrozole resistant cell lines and also studies its mechanism of action in inhibition of breast cancer cell proliferation. For these studies we generated aromatase overexpressing T47D (T47Darom) and respective control (T47Dcon) breast cancer cell lines by stable transfection with plasmid containing CYP19A1 gene, or empty vector respectively. Letrozole resistant cell line (T47DaromLR) was generated by incubating T47Darom for 75 weeks in the presence of 10 μM Letrozole. Cell proliferation was determined by MTT or crystal violet assays. Gene expressions were quantified by QRT-PCR whereas proteins were identified by western blot analyses, flow cytometry and immunofluorescence staining. Aromatase activity was determined by estradiol ELISA. The effects of Proellex on the anchorage independent growth were measured by soft agar colony formation. Statistical differences between the various groups were determined by Student's 't' test or ANOVA followed by Bonferroni's post hoc test. Results showed that T47Darom and T47DaromLR cell lines had significantly higher aromatase expression (mRNA; 80-90 fold and protein) and as a result exhibited increased aromatization of testosterone to estradiol as compared to T47Dcon. Both these cell lines showed enhanced growth in the presence of Testosterone (50-60%). In T47DaromLR cells increased PR-B and EGFR expression as compared to T47Dcon cells was observed. Proellex and other known aromatase inhibitors (Letrozole, Anastrozole, and Exemestane) inhibited testosterone induced cell proliferation and anchorage independent growth of T47Darom cells. Cell growth inhibition was significantly greater when cells were treated with Proellex alone or in combination with other AIs as compared to AIs
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Energy Technology Data Exchange (ETDEWEB)
Kjeldsen, Lisbeth Stigaard; Ghisari, Mandana; Bonefeld-Jørgensen, Eva Cecilie, E-mail: ebj@mil.au.dk
2013-10-15
The endocrine-disrupting potential of pesticides is of health concern, since they are found ubiquitously in the environment and in food items. We investigated in vitro effects on estrogen receptor (ER) and androgen receptor (AR) transactivity, and aromatase enzyme activity, of the following pesticides: 2-methyl-4-chlorophenoxyacetic acid (MCPA), terbuthylazine, iodosulfuron-methyl-sodium, mesosulfuron-methyl, metsulfuron-methyl, chlormequat chloride, bitertanol, propiconazole, prothioconazole, mancozeb, cypermethrin, tau fluvalinate, malathion and the metabolite ethylene thiourea (ETU). The pesticides were analyzed alone and in selected mixtures. Effects of the pesticides on ER and AR function were assessed in human breast carcinoma MVLN cells and hamster ovary CHO-K1 cells, respectively, using luciferase reporter gene assays. Effects on aromatase enzyme activity were analyzed in human choriocarcinoma JEG-3 cells, employing the classical [{sup 3}H]{sub 2}O method. Five pesticides (terbuthylazine, propiconazole, prothioconazole, cypermethrin and malathion) weakly induced the ER transactivity, and three pesticides (bitertanol, propiconazole and mancozeb) antagonized the AR activity in a concentration-dependent manner. Three pesticides (terbuthylazine, propiconazole and prothioconazole) weakly induced the aromatase activity. In addition, two mixtures, consisting of three pesticides (bitertanol, propiconazole, cypermethrin) and five pesticides (terbuthylazine, bitertanol, propiconazole, cypermethrin, malathion), respectively, induced the ER transactivity and aromatase activity, and additively antagonized the AR transactivity. In conclusion, our data suggest that currently used pesticides possess endocrine-disrupting potential in vitro which can be mediated via ER, AR and aromatase activities. The observed mixture effects emphasize the importance of considering the combined action of pesticides in order to assure proper estimations of related health effect risks
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Energy Technology Data Exchange (ETDEWEB)
Berg, M. van den; Heneweer, M.; Geest, M. de; Sanderson, T. [Inst. for Risk Assessment Sciences and Utrecht Univ. (Netherlands); Jong, P. de [St. Antonius Hospital, Nieuwegein (Netherlands); Bergman, A. [Stockholm Univ., Stockholm (Sweden)
2004-09-15
Methyl sulfonyl PCB metabolites (MeSO2-PCBs) are persistent contaminants and are ubiquitously present in humans and the environment. Lipophilicity of MeSO2- PCB metabolites is similar to the parent compounds and they have been detected in human milk, adipose, liver and lung tissue. 4- MeSO2-PCB-149 is the most abundant PCB metabolite in human adipose tissue and milk at a level of 1.5 ng/g lipids. Human blood concentration of 4-MeSO2-PCB-149 is approximately 0.03 nM. 3- MeSO2-PCB-101 is the predominant PCB metabolite in muscle and blubber in wildlife, such as otter, mink and grey seal. In the environment, they have been linked to chronic and reproductive toxicity in exposed mink. Additionaly, some MeSO{sub 2}-PCBs have been shown to be glucocorticoid receptor (GR) antagonists. Since approximately 60% of all breast tumors are estrogen responsive, exposure to compounds that are able to alter estrogen synthesis through interference with the aromatase enzyme, can lead to changes in estrogen levels and possibly to accelerated or inhibit breast tumor growth. Therefore, it is important to identify exogenous compounds that can alter aromatase activity in addition to those compounds which have direct interaction with the estrogen receptor (ER). Aromatase (CYP19) comprises the ubiquitous flavoprotein, NADPH-cytochrome P450 reductase, and a unique cytochrome P450 that is exclusively expressed in estrogen producing cells. Previous studies have revealed that expression of the aromatase gene is regulated in a species- and tissue specific manner. In healthy breast tissue, the predominantly active aromatase promoter region I.4 is regulated by glucocorticoids and class I cytokines. Therefore, it is important to investigate possible aromatase inhibiting properties of MeSO{sub 2}-PCBs (as anti glucocorticoids?) in relevant human tissues. We used primary human mammary fibroblasts because of their role in breast cancer development. We compared the results in primary fibroblasts with
Dry eye syndrome in aromatase inhibitor users.
Turaka, Kiran; Nottage, Jennifer M; Hammersmith, Kristin M; Nagra, Parveen K; Rapuano, Christopher J
2013-04-01
Aromatase inhibitors are frequently used as an adjuvant therapy in the treatment of breast cancer. We observed that several patients taking aromatase inhibitors presented with severe dry eye symptoms, and we investigated whether there is a relationship between aromatase inhibitors and dry eyes in these patients. Retrospective chart review. Forty-one women. A computerized search of health records was performed to identify patients using anastrazole, letrozole and exemestane seen by the Cornea Service from August 2008 to March 2011. The results were compared with age-matched controls. Ocular surface changes among aromatase inhibitors users. Of the 41 women, 39 were Caucasians. Thirty-nine patients had breast cancer (95%), one patient had ovarian cancer (2.5%) and one had an unknown primary cancer. Mean age was 68 ± 11.3 years (range 47-95). Most common presenting symptoms were blurred vision in 28 (68%) patients, irritation/foreign body sensation in 12 (29%) patients, redness in 9 (22%) patients, tearing in 6 (22%) patients and photosensitivity in 2 (5%) patients. Mean Schirmer's test measurement was 11 ± 5.8 mm (range 0.5-20 mm). Blepharitis was noted in 68 of 82 eyes (73%), decreased or poor tear function in 24 eyes (29%), conjunctival injection in 18 eyes (22%) and superficial punctate keratitis in 12 eyes (29%). Among an age-matched population (45-95 years), dry eye syndrome was found in only 9.5% of patients. Because the prevalence of ocular surface disease signs and symptoms appears to be higher in study group than control patients, aromatase inhibitors might be a contributing factor to the dry eye symptoms. © 2012 The Authors. Clinical and Experimental Ophthalmology © 2012 Royal Australian and New Zealand College of Ophthalmologists.
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
Genetics Home Reference: aromatase deficiency
... to impaired female sexual development, unusual bone growth, insulin resistance, and other signs and symptoms of aromatase deficiency . In women who are pregnant with an affected fetus, excess androgens in the ...
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Aromatase inhibitor treatment limits progression of peritoneal endometriosis in baboons.
Langoi, David; Pavone, Mary Ellen; Gurates, Bilgin; Chai, Daniel; Fazleabas, Asgerally; Bulun, Serdar E
2013-03-01
To determine the effect of inhibiting aromatase activity on endometrial lesion growth and aromatase expression in a baboon model of induced endometriosis. Prospective study. Primate research institute. Sixteen olive baboons. Sixteen olive baboons with induced endometriosis were examined with laparoscopy 10 months after disease inoculation. Animals in group 1 (n = 10) were treated with 1.25 mg/d of the aromatase inhibitor (AI) letrozole, and animals in group 2 (n = 6) were given a placebo for a total of 6 months. Total number of endometriotic lesions, morphology, and volume of lesions, as well as semiquantitative reverse transcription-polymerase chain reaction and quantitative polymerase chain reaction for levels of aromatase cytochrome messenger RNA were measured. Ovarian volumes were evaluated before treatment initiation and every 2 months during the study. Treatment of group 1 animals with an AI significantly decreased lesion volume from baseline measurements, whereas the placebo-treated animals showed an increase in lesion volume. Aromatase messenger RNA levels in lesions in the AI-treated animals were significantly lower compared with the placebo-treated animals. Ovarian volumes were significantly increased at 6 months of AI treatment compared with pretreatment volumes. These findings suggest that suppression of aromatase cytochrome P450 may inhibit the in vivo growth of endometriotic lesions in baboons. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
Imaging of aromatase distribution in rat and rhesus monkey brains with [11C]vorozole
International Nuclear Information System (INIS)
Takahashi, Kayo; Bergstroem, Mats; Fraendberg, Pernilla; Vesstroem, Eva-Lotta; Watanabe, Yasuyoshi; Langstroem, Bengt
2006-01-01
Aromatase is an enzyme that converts androgens to estrogens and may play a role in mood and mental status. The aim of this study was to demonstrate that brain aromatase distribution could be evaluated with a novel positron emission tomography (PET) tracer [ 11 C]vorozole. Vorozole is a nonsteroidal aromatase inhibitor that reversibly binds to the heme domain of aromatase. In vitro experiments in rat brain, using frozen section autoradiography, illustrated specific binding in the medial amygdala (MA), the bed nucleus of stria terminalis (BST) and the preoptic area (POA) of male rat brain. Specific binding in female rat brain was found in the MA and the BST; however, the signals were lower than those of males. The K d of [ 11 C]vorozole binding to aromatase in MA was determined to be 0.60±0.06 nM by Scatchard plot analysis using homogenates. An in vivo PET study in female rhesus monkey brain demonstrated the uptake of [ 11 C]vorozole in the amygdala, where the uptake was blocked by the presence of excess amounts of unlabeled vorozole. Thus, this tracer has a high affinity for brain aromatase and could have a potential for in vivo aromatase imaging. This technique might enable the investigation of human brain aromatase in healthy and diseased persons
Ramsey, Mary; Shoemaker, Christina; Crews, David
2007-12-01
Many egg-laying reptiles have temperature-dependent sex determination (TSD), where the offspring sex is determined by incubation temperature during a temperature-sensitive period (TSP) in the middle third of development. The underlying mechanism transducing a temperature cue into an ovary or testis is unknown, but it is known that steroid hormones play an important role. During the TSP, exogenous application of estrogen can override a temperature cue and produce females, while blocking the activity of aromatase (Cyp19a1), the enzyme that converts testosterone to estradiol, produces males from a female-biased temperature. The production of estrogen is a key step in ovarian differentiation for many vertebrates, including TSD reptiles, and temperature-based differences in aromatase expression during the TSP may be a critical step in ovarian determination. Steroidogenic factor-1 (Sf1) is a key gene in vertebrate sex determination and regulates many steroidogenic enzymes, including aromatase. We find that Sf1 and aromatase are differentially expressed during sex determination in the red-eared slider turtle, Trachemys scripta elegans. Sf1 is expressed at higher levels during testis development while aromatase expression increases during ovary determination. We also assayed Sf1 and aromatase response to sex-reversing treatments via temperature or the modulation of estrogen availability. Sf1 expression was redirected to low-level female-specific patterns with feminizing temperature shift or exogenous estradiol application and redirected to more intense male-specific patterns with male-producing temperature shift or inhibition of aromatase activity. Conversely, aromatase expression was redirected to more intense female-specific patterns with female-producing treatment and redirected toward diffuse low-level male-specific patterns with masculinizing sex reversal. Our data do not lend support to a role for Sf1 in the regulation of aromatase expression during slider turtle sex
Association of aromatase (TTTA)n repeat polymorphisms with central precocious puberty in girls.
Lee, Hae Sang; Kim, Kyung Hee; Hwang, Jin Soon
2014-09-01
Precocious puberty is characterized by early activation of the pituitary-gonadal axis. Oestrogen is the final key factor to start the onset of puberty. The cytochrome P450 19A1 (CYP19A1) gene encodes an aromatase that is responsible for the conversion of androgens to oestrogen, which is a key step in oestrogen biosynthesis. The aim of this study was to identify CYP19A1 gene mutations or polymorphisms in girls with central precocious puberty (CPP). We evaluated the frequency of allelic variants of the CYP19A1 exons and the tetranucleotide tandem repeat (TTTA)n in intron 4 in 203 idiopathic central precocious puberty (CPP) girls and 101 normal healthy women. The genotype analysis of the CYP19A1 (TTTA)n polymorphism revealed six different alleles ranging from seven to 13 repeats. Among the six different repeat alleles detected in this study, the (TTTA)₁₃ repeat allele was only detected in the patient group and carriers of the (TTTA)₁₃ allele were significantly associated with an increased risk of CPP (OR = 1·509, 95% CI = 1·425-1·598, P = 0·033). Carriers of the (TTTA)₁₃ repeat allele were significantly younger at pubertal onset and had higher levels of oestrogen than noncarriers of the (TTTA)₁₃ repeat allele. Although nine polymorphisms were detected in exons of the CYP19A1 gene, no clinical significance was observed. In this study, carriers of a higher repeat (TTTA)₁₃ polymorphism in intron 4 of the CYP19A1 gene had higher levels of oestrogen. Those carrying the (TTTA)₁₃ repeat allele may have a higher risk of developing CPP. © 2014 John Wiley & Sons Ltd.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
In Silico Prediction of Chemicals Binding to Aromatase with Machine Learning Methods.
Du, Hanwen; Cai, Yingchun; Yang, Hongbin; Zhang, Hongxiao; Xue, Yuhan; Liu, Guixia; Tang, Yun; Li, Weihua
2017-05-15
Environmental chemicals may affect endocrine systems through multiple mechanisms, one of which is via effects on aromatase (also known as CYP19A1), an enzyme critical for maintaining the normal balance of estrogens and androgens in the body. Therefore, rapid and efficient identification of aromatase-related endocrine disrupting chemicals (EDCs) is important for toxicology and environment risk assessment. In this study, on the basis of the Tox21 10K compound library, in silico classification models for predicting aromatase binders/nonbinders were constructed by machine learning methods. To improve the prediction ability of the models, a combined classifier (CC) strategy that combines different independent machine learning methods was adopted. Performances of the models were measured by test and external validation sets containing 1336 and 216 chemicals, respectively. The best model was obtained with the MACCS (Molecular Access System) fingerprint and CC method, which exhibited an accuracy of 0.84 for the test set and 0.91 for the external validation set. Additionally, several representative substructures for characterizing aromatase binders, such as ketone, lactone, and nitrogen-containing derivatives, were identified using information gain and substructure frequency analysis. Our study provided a systematic assessment of chemicals binding to aromatase. The built models can be helpful to rapidly identify potential EDCs targeting aromatase.
Inhibitory effect of Sphagnum palustre extract and its bioactive compounds on aromatase activity
Directory of Open Access Journals (Sweden)
Hee Jeong Eom
2016-09-01
Full Text Available Sphagnum palustre (a moss has been traditionally used in Korea for the cure of several diseases such as cardiac pain and stroke. In this research, the inhibitory effect of S. palustre on aromatase (cytochrome P450 19, CYP19 activity was studied. [1β-3H] androstenedione was used as a substrate and incubated with S. palustre extract and recombinant human CYP19 in the presence of NADPH. S. palustre extract inhibited aromatase in a concentration-dependent manner (IC50 value: 36.4 ± 8.1 µg/mL. To elucidate the major compounds responsible for the aromatase inhibitory effects of S. palustre extract, nine compounds were isolated from the extract and tested for their inhibition of aromatase activity. Compounds 1, 6, and 7 displayed aromatase inhibition, while the inhibition by the other compounds was negligible.
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Imaging of aromatase distribution in rat and rhesus monkey brains with [{sup 11}C]vorozole
Energy Technology Data Exchange (ETDEWEB)
Takahashi, Kayo [Division of Pharmacology, Department of Neuroscience, Uppsala University, Uppsala SE-75124 (Sweden); Uppsala Imanet, Uppsala SE-75109 (Sweden)]. E-mail: kayo.takahashi@uppsala.imanet.se; Bergstroem, Mats [Uppsala Imanet, Uppsala SE-75109 (Sweden); Department of Pharmaceutical Biosciences, Uppsala University, Uppsala SE-75124 (Sweden); Fraendberg, Pernilla [Uppsala Imanet, Uppsala SE-75109 (Sweden); Vesstroem, Eva-Lotta [Uppsala Imanet, Uppsala SE-75109 (Sweden); Watanabe, Yasuyoshi [Department of Physiology, Osaka City University Graduate School of Medicine, Osaka 545-8585 (Japan); Langstroem, Bengt [Uppsala Imanet, Uppsala SE-75109 (Sweden)
2006-07-15
Aromatase is an enzyme that converts androgens to estrogens and may play a role in mood and mental status. The aim of this study was to demonstrate that brain aromatase distribution could be evaluated with a novel positron emission tomography (PET) tracer [{sup 11}C]vorozole. Vorozole is a nonsteroidal aromatase inhibitor that reversibly binds to the heme domain of aromatase. In vitro experiments in rat brain, using frozen section autoradiography, illustrated specific binding in the medial amygdala (MA), the bed nucleus of stria terminalis (BST) and the preoptic area (POA) of male rat brain. Specific binding in female rat brain was found in the MA and the BST; however, the signals were lower than those of males. The K {sub d} of [{sup 11}C]vorozole binding to aromatase in MA was determined to be 0.60{+-}0.06 nM by Scatchard plot analysis using homogenates. An in vivo PET study in female rhesus monkey brain demonstrated the uptake of [{sup 11}C]vorozole in the amygdala, where the uptake was blocked by the presence of excess amounts of unlabeled vorozole. Thus, this tracer has a high affinity for brain aromatase and could have a potential for in vivo aromatase imaging. This technique might enable the investigation of human brain aromatase in healthy and diseased persons.
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
Carlini, P; Frassoldati, A; De Marco, S; Casali, A; Ruggeri, E M; Nardi, M; Papaldo, P; Fabi, A; Paoloni, F; Cognetti, F
2001-11-01
There are few clinical data on the sequential use of aromatase inhibitors (AI). This paper focuses on the relevance of clinical benefit CB (CR + PR + SD > or = 6 months) in postmenopausal metastatic breast cancer (MBC) patients treated with the steroidal aromatase inhibitor (SAI) formestane (FOR). who had already received non-steroidal aromatase inhibitor (nSAI): letrozole (LTZ) or anastrozole (ANZ). Twenty postmenopausal women with MBC were analysed in this retrospective two-centre study with the sequence nSAI-FOR. When receiving ANZ, 1 of 11 achieved a complete response and 9 of 11 a stable disease > or = 6 months, and receiving LTZ 1 of 9 achieved a partial response and 4 of 9 a stable disease > or = 6 months. The analysis of the entire population treated with FOR showed an overall CB of 55% (11 of 20) with a median duration of 15 months and median time to progression (TTP) of 6 months. Formestane 250 mg once bi-weekly seems to be an attractive alternative third-line hormonal therapy for the treatment of patients with MBC, previously treated with nSAI.
Lu, Dan-feng; Yang, Li-juan; Wang, Fei; Zhang, Guo-lin
2012-08-29
Inhibition of aromatase, the key enzyme in estrogen biosynthesis, is an important strategy in the treatment of breast cancer. Several dietary flavonoids show aromatase inhibitory activity, but their tissue specificity and mechanism remain unclear. This study found that the dietary flavonoid luteolin potently inhibited estrogen biosynthesis in a dose- and time-dependent manner in KGN cells derived from human ovarian granulosa cells, the major source of estrogens in premenopausal women. Luteolin decreased aromatase mRNA and protein expression in KGN cells. Luteolin also promoted aromatase protein degradation and inhibited estrogen biosynthesis in aromatase-expressing HEK293A cells, but had no effect on recombinant expressed aromatase. Estrogen biosynthesis in KGN cells was inhibited with differing potencies by extracts of onion and bird chili and by four other dietary flavonoids: kaempferol, quercetin, myricetin, and isorhamnetin. The present study suggests that luteolin inhibits estrogen biosynthesis by decreasing aromatase expression and destabilizing aromatase protein, and it warrants further investigation as a potential treatment for estrogen-dependent cancers.
Mechanism-based Categorization of Aromatase Inhibitors: A Potential Discovery and Screening Tool
Cytochrome P450 aromatase is a key steroidogenic enzyme that converts androgens to estrogens in vertebrates. There is much interest in aromatase inhibitors (AIs) because a number of environmental contaminants can act as AIs, thereby disrupting endocrine function in humans and wil...
Are separable aromatase systems involved in hormonal regulation of the male brain
International Nuclear Information System (INIS)
Hutchison, J.B.; Schumacher, M.; Steimer, T.; Gahr, M.
1990-01-01
In vitro study of testosterone (T) metabolism shows that formation of estradiol-17 beta (E2) is regionally specific within the preoptic area (POA) of the male ring dove. The POA is known to be involved in the formation of E2 required for specific components of male sexual behavior. Two sub-areas of high aromatase activity, anterior (aPOA) and posterior preoptic (pPOA) areas, have been identified. Aromatase activity is higher in aPOA than in pPOA. The aromatase activity within the aPOA is also more sensitive to the inductive effects of low circulating T, derived from subcutaneous silastic implants, than the enzyme activity in pPOA. Kinetic analysis of preoptic fractions indicates that a similar high-affinity enzyme occurs in both areas (apparent Km less than 14 nM), but the Vmax of aPOA enzyme activity is higher than pPOA. Cells containing estrogen receptors (ER) are localized in areas of high aromatase activity. There is overlap between immunostained cells in the aPOA and in samples containing inducible aromatase activity measured in vitro. Within the aPOA there is a higher density of ER cells in the nucleus preopticus medialis. The pPOA area also contains ER, notably in the nucleus interstitialis, but at a lower density. We conclude that the hormonal regulation of the male preoptic-anterior hypothalamic region, which is a target for the behavioral action of T, involves at least two inducible aromatase systems with associated estrogen receptor cells
Caglar, Asli Sezgin; Kapucu, Aysegul; Dar, Kadriye Akgun; Ozkaya, Hande Mefkure; Caglar, Erkan; Ince, Haluk; Kadioglu, Pinar
2015-08-01
The aim of this study is to evaluate aromatase expression in prolactin (PRL), thyroid stimulating hormone (TSH), and growth hormone (GH) secreting cells. Nontumoral human pituitary specimens were obtained from autopsy samples. Aromatase co-expression was determined by double immunohistochemical staining and assessed using H scores. H scores for GH-aromatase co-expression (GH-aromatase), TSH-aromatase co-expression (TSH-aromatase), and PRL-aromatase co-expression (PRL-aromatase) were 83.1 ± 13.1, 95.6 ± 16.1, and 83.7 ± 14.5, respectively. TSH producing cells exhibited the highest H score for co-expression of aromatase (p 0.05 for all). There was a negative correlation between the H scores for aromatase and PRL-aromatase, GH-aromatase and TSH-aromatase, respectively (r = -0.592, p 0.05 for all). Age was negatively correlated with PRL-aromatase H score (r = -0.373, p = 0.008). Our study demonstrated significant aromatase co-expression in PRL, GH, and TSH secreting cells of the human anterior pituitary gland. The mutual paracrinal regulation between aromatase and three adenohypophyseal hormones indicates that aromatase may have a regulatory role on the synthesis and secretion of these hormones.
Leptin stimulates aromatase in the growth plate: limiting catch-up growth efficiency.
Masarwi, Majdi; Shamir, Raanan; Phillip, Moshe; Gat-Yablonski, Galia
2018-06-01
Catch-up growth (CUG) in childhood is defined as periods of growth acceleration, after the resolution of growth attenuation causes, bringing the children back to their original growth trajectory. Sometimes, however, CUG is incomplete, leading to permanent growth deficit and short stature. The aim of this study was to investigate the mechanisms that limit nutritional-CUG. Specifically, we focused on the crosstalk between leptin, increased by re-feeding, and sex hormones, which increase with age. In vivo studies were performed in young male Sprague Dawley rats fed ad libitum or subjected to 10/36 days of 40% food restriction followed by 90-120 days of re-feeding. In vitro studies were performed on ATDC5 cells. Analyses of mRNA and protein levels were done using qPCR and Western blot, respectively. CUG was complete in body weight and humerus length in animals that were food-restricted for 10 days but not for those food-restricted for 36 days. In vitro studies showed that leptin significantly increased aromatase gene expression and protein level as well as the expression of estrogen and leptin receptors in a dose- and time-dependent manner. The effect of leptin on aromatase was direct and was mediated through the MAPK/Erk, STAT3 and PI3K pathways. The crosstalk between leptin and aromatase in the growth plate suggests that re-feeding during puberty may lead to increased estrogen level and activity, and consequently, irreversible premature epiphyseal growth plate closure. These results may have important implications for the development of novel treatment strategies for short stature in children. © 2018 Society for Endocrinology.
Big enough for an aromatase inhibitor? How adiposity affects male fertility.
Stephens, Sahar M; Polotsky, Alex J
2013-07-01
Obesity is a pandemic and is associated with multiple medical problems including subfertility. Male obesity has been associated with altered semen parameters and reproductive hormonal levels, including a reduced testosterone:estradiol (T:E₂) ratio. Treatment methods employed for obesity-related male subfertility include gonadotropin administration, weight loss, and aromatase inhibitors. Letrozole is a highly effective nonsteroidal aromatase inhibitor that has been used to treat male subfertility in several case series with promising results. Adequately designed randomized controlled studies are needed to produce evidence-based data on the role of aromatase inhibitors in male subfertility management and evaluate the side-effect profile. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
International Nuclear Information System (INIS)
Biegon, A.; Kim, S.-W.; Logan, J.; Hooker, J.M.; Muench, L.; Fowler, J.S.
2010-01-01
Cigarette smoking and nicotine have complex effects on human physiology and behavior, including some effects similar to those elicited by inhibition of aromatase, the last enzyme in estrogen biosynthesis. We report the first in vivo primate study to determine whether there is a direct effect of nicotine administration on brain aromatase. Brain aromatase availability was examined with positron emission tomography and the selective aromatase inhibitor ( 11 C)vorozole in six baboons before and after exposure to IV nicotine at .015 and .03 mg/kg. Nicotine administration produced significant, dose-dependent reductions in ( 11 C)vorozole binding. The amygdala and preoptic area showed the largest reductions. Plasma levels of nicotine and its major metabolite cotinine were similar to those found in cigarette smokers. Nicotine interacts in vivo with primate brain aromatase in regions involved in mood, aggression, and sexual behavior.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Shaban, N Z; Hegazy, W A; Abdel-Rahman, S M; Awed, O M; Khalil, S A
2016-08-29
Aromatase inhibitors (AIs) provide novel approaches to the adjuvant therapy for postmenopausal women with estrogen-receptor-positive (ER+) breast cancers. In this study, different plant extracts from Olea europaea leaves (OLE), Sonchus oleraceus L. (SOE) and Mangifera indica peels (MPE) were prepared to identify phytoconstituents and measure antioxidant capacities. The effects of these three extracts on aromatase activity in human placental microsomes were evaluated. Additionally, the effects of these extracts on tissue-specific promoter expression of CYP19A1 gene in cell culture model (MCF-7) were assessed using qRT-PCR. Results showed a concentration-dependent decrease in aromatase activity after treatment with OLE and MPE, whereas, SOE showed a biphasic effect. The differential effects of OLE, SOE and MPE on aromatase expression showed that OLE seems to be the most potent suppressor followed by SOE and then MPE. These findings indicate that OLE has effective inhibitory action on aromatase at both the enzymatic and expression levels, in addition to its cytotoxic effect against MCF-7 cells. Also, MPE may be has the potential to be used as a tissue-specific aromatase inhibitor (selective aromatase inhibitor) and it may be promising to develop a new therapeutic agent against ER+ breast cancer.
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
Screening of selected pesticides for inhibition of CYP19 aromatase activity in vitro
DEFF Research Database (Denmark)
Vinggaard, A.M.; Hnida, C.; Breinholt, V.
2000-01-01
than 50 mu M. The positive control 4-hydroxyandrostendione (1 mu M) caused an inhibition of aromatase activity by 74%. The compounds, which did not affect the aromatase activity, were bromopropylate, chlorfenvinphos. chlorobenzilate, chlorpyrifos, diuron, heptachlor, iprodion, linuron, pentachlorphenol...
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Teratogenicity and brain aromatase-induction of monosodium ...
African Journals Online (AJOL)
Teratogenicity and brain aromatase-induction of monosodium glutamate in estrogen-responsive mosaic transgenic zebra fish Danio rerio. Tamer Said Abdelkader, Chang Seo-Na, Kim Tae-Hyun, Song Juha, Kim Dongso, Jae-Hak Park ...
DEFF Research Database (Denmark)
Gravgaard Thomsen, Karina Hedelund; Lyng, Maria Bibi; Elias, Daniel
2015-01-01
predictive of outcome of ER+ breast cancer patients treated with AIs are needed. Global gene expression analysis was performed on ER+ primary breast cancers from patients treated with adjuvant AI monotherapy; half experienced recurrence (median follow-up 6.7 years). Gene expression alterations were validated...... by qRT-PCR, and functional studies evaluating the effect of siRNA-mediated gene knockdown on cell growth were performed. Twenty-six genes, including TFF3, DACH1, RGS5, and GHR, were shown to exhibit altered expression in tumors from patients with recurrence versus non-recurrent (fold change ≥1.5, p ....05), and the gene expression alterations were confirmed using qRT-PCR. Ten of these 26 genes could be linked in a network associated with cellular proliferation, growth, and development. TFF3, which encodes for trefoil factor 3 and is an estrogen-responsive oncogene shown to play a functional role in tamoxifen...
Effects of transferrin on aromatase activity in porcine granulosa cells in vitro.
Directory of Open Access Journals (Sweden)
Małgorzata Duda
2009-01-01
Full Text Available Proliferating cells have an absolute requirement for iron, which is delivered by transferrin with subsequent intracellular transport via the transferrin receptor. Recent studies have reported that transferrin plays a crucial role in the local regulation of ovarian function, apart from its iron-binding characteristic. Therefore, the present study was undertaken to explore the possible role of transferrin in porcine granulosa cells function by examining its influence on aromatase activity, the most important indicator of follicular cell differentiation. In the first series of studies, pig granulosa cells isolated from small, immature follicles were cultured in the presence of transferrin alone (10 microg/ml or 100 microg/ml or with the addition of FSH (100ng/ml. The second series of studies was undertaken to determine transferrin-stimulated granulosa cells ability to aromatize exogenous testosterone (1x10(-7M. One hour after the establishment of cultures an aromatase inhibitor CGS16949A was added to test its influence on estradiol production. After 48 hours, cultures were terminated and cells were processed for immunocytochemical staining of aromatase. Media were frozen for further estradiol level analysis. Positive immunostaining for aromatase was found in all granulosa cell cultures. The intensity of immunostaining was always stronger in cultures supplemented with FSH whereas the addition of transferrin had no effect. Granulosa cells in vitro synthesized the highest amount of estradiol after the addition of FSH and exogenous testosterone as measured radioimmunologically. Concomitant treatment with FSH and transferrin caused an inhibition of FSH-stimulated aromatase activity. The production of estradiol also declined in the presence of FSH, testosterone and transferrin. This study demonstrates that transferrin had a dose-dependent inhibitory effect on FSH-stimulated aromatase activity, which was confirmed by radioimmunoassay. Our results indicate
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Inhibition of human aromatase complex (CYP19) by antiepileptic drugs
DEFF Research Database (Denmark)
Jacobsen, Naja Wessel; Halling-Sørensen, Bent; Birkved, Franziska Maria A Kramer
2008-01-01
of 1.4-49.7 mM. Carbamazepine, gabapentin, primidone, topiramate and vigabatrin showed no inhibition. Additionally, binary drug combinations were tested to investigate if combination therapy could potentiate the aromatase inhibition. Additive inhibition was seen in combination experiments...... with valproate and phenobarbital. When adding carbamazepine to a range of valproate concentrations no additional inhibition was seen. The data for some of the AEDs show that side effects on steroid synthesis in humans due to inhibition of aromatase should be considered....
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
International Nuclear Information System (INIS)
Yoshida, Nobutaka; Osawa, Yoshio
1991-01-01
A simple and efficient method is described for the purification of microsomal aromatase cytochrome P-450 from human placenta. The enzyme was solubilized with Emulgen 913 and sodium cholate and subjected to chromatography on a column of Sepharose 4B couples with a specific monoclonal antibody, followed by hydroxyapatite column chromatography. The specific cytochrome P-450 content of purified aromatase was 13.1 (12-14.8) nmol/mg of protein. Aromatase assays were carried out with reconstituted systems of bovine liver P-450 reductase and dilauroyl-L-α-phosphatidylcholine with [1β- 3 H,4- 14 C]androstenedione as substrate. The total recovery of purified aromatase activity was 32.2%, and P-450 recovery was 17.6%. The very high K m value for 16α-hydroxytestosterone aromatization gives a reasonable indication that estriol is not the directly aromatized product in the fetoplacental unit of human pregnancy. The aromatase P-450 was subjected to SDS-polyacrylamide gel electrophoresis in increasing quantities. Silver stain detection techniques indicated a single band having a molecular mass of 55 kDa with greater than 97% purity. The stability analysis showed a half-life of over 4 years on storage at -80C
DIFERENSIASI KELAMIN TIGA GENOTIPE IKAN NILA YANG DIBERI BAHAN AROMATASE INHIBITOR
Directory of Open Access Journals (Sweden)
Didik Ariyanto
2016-11-01
Full Text Available Penggunaan hormon sintetik 17 a-metiltestosterone untuk sex reversal ikan konsumsi sudah dilarang. Salah satu bahan yang terbukti efektif dalam sex reversal adalah bahan aromatase inhibitor. Bahan ini dapat digunakan dalam proses pembalikan kelamin karena menghambat sekresi enzim aromatase yang bertanggung jawab dalam konversi hormon androgen menjadi estrogen. Tingginya kadar androgen dalam tubuh akan mengarahkan proses diferensiasi kelamin ke arah kelamin jantan. Penelitian ini bertujuan mengetahui pengaruh pemberian bahan aromatase inhibitor terhadap diferensiasi kelamin tiga genotipe ikan nila. Bahan utama yang digunakan adalah larva ikan nila genotipe XX, XY, dan YY yang diberi bahan aromatase inhibitor, khususnya imidazole. Penambahan hormon sintetik 17a-metiltestosterone digunakan sebagai kontrol (+. Pemberian imidazole dilakukan melalui pakan pada larva ikan nila yang berumur 7 hari setelah menetas, selama 28 hari. Selanjutnya benih dipelihara dalam hapa pendederan selama 60 hari di kolam tanah. Pada akhir pendederan dilakukan identifikasi jenis kelamin, bobot individu rata-rata, dan sintasan. Hasil penelitian menunjukkan bahwa imidazole efektif meningkatkan rasio kelamin jantan pada ikan nila genotipe XX dan YY, tetapi tidak pada genotipe XY. Sampai akhir tahap pendederan, semua genotipe dan perlakuan yang berbeda tidak memberikan efek yang berbeda nyata terhadap laju pertumbuhan maupun nilai sintasan, kecuali pada genotipe YY
Napoli, Nicola; Rastelli, Antonella; Ma, Cynthia; Colleluori, Georgia; Vattikuti, Swapna; Armamento-Villareal, Reina
2015-08-01
Polymorphisms in the CYP19A1 (aromatase) gene influence disease-free survival and bone loss in patients taking aromatase inhibitors (AIs) for estrogen receptor-positive (ER+) breast cancers. Because AI use results in severe estrogen deficiency that may lead to changes in body composition, the aim of this study was to determine the effect of the rs700518 polymorphism in the CYP19A1 gene on the changes in body composition among postmenopausal women who were treated with AIs for ER+ breast cancer. This was a 1-year prospective study of changes in body composition in postmenopausal women who were initiated on third-generation AIs for ER+ breast cancer. Body composition was measured by dual-energy absorptiometry at 6 and 12 months, serum estradiol by radioimmunoassay, and genotyping by a TaqMan single-nucleotide polymorphism allelic discrimination assay. Eighty-two women could provide at least one follow-up body composition measurement. Women with the GG genotype for the rs700518 (G/A at Val80) developed a significant increase in truncal fat mass index (P=0.03) and a significant decrease in fat-free mass index (P=0.01) at 12 months relative to patients carrying the A allele (GA/AA). There was no significant difference in the changes in estradiol levels among the genotypes. Patients with the GG genotype for the rs700518 polymorphism in the CYP19A1 gene are at risk for significant loss of fat-free mass and increase in truncal fat with AI therapy. Whether there are associated metabolic abnormalities and whether changes would persist with long-term AI therapy need to be confirmed in a larger study with a longer duration of follow-up.
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Reinbolt, Raquel E; Sonis, Stephen; Timmers, Cynthia D; Fernández-Martínez, Juan Luis; Cernea, Ana; de Andrés-Galiana, Enrique J; Hashemi, Sepehr; Miller, Karin; Pilarski, Robert; Lustberg, Maryam B
2018-01-01
Many breast cancer (BC) patients treated with aromatase inhibitors (AIs) develop aromatase inhibitor-related arthralgia (AIA). Candidate gene studies to identify AIA risk are limited in scope. We evaluated the potential of a novel analytic algorithm (NAA) to predict AIA using germline single nucleotide polymorphisms (SNP) data obtained before treatment initiation. Systematic chart review of 700 AI-treated patients with stage I-III BC identified asymptomatic patients (n = 39) and those with clinically significant AIA resulting in AI termination or therapy switch (n = 123). Germline DNA was obtained and SNP genotyping performed using the Affymetrix UK BioBank Axiom Array to yield 695,277 SNPs. SNP clusters that most closely defined AIA risk were discovered using an NAA that sequentially combined statistical filtering and a machine-learning algorithm. NCBI PhenGenI and Ensemble databases defined gene attribution of the most discriminating SNPs. Phenotype, pathway, and ontologic analyses assessed functional and mechanistic validity. Demographics were similar in cases and controls. A cluster of 70 SNPs, correlating to 57 genes, was identified. This SNP group predicted AIA occurrence with a maximum accuracy of 75.93%. Strong associations with arthralgia, breast cancer, and estrogen phenotypes were seen in 19/57 genes (33%) and were functionally consistent. Using a NAA, we identified a 70 SNP cluster that predicted AIA risk with fair accuracy. Phenotype, functional, and pathway analysis of attributed genes was consistent with clinical phenotypes. This study is the first to link a specific SNP/gene cluster to AIA risk independent of candidate gene bias. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Directory of Open Access Journals (Sweden)
Maia Jr H
2012-02-01
Full Text Available Hugo Maia Jr1,2, Clarice Haddad1,2, Julio Casoy11CEPARH, 2Itaigara Memorial Day Hospital, Salvador, Bahia, BrazilObjective: To investigate whether aromatase expression in the eutopic endometrium correlates with the presence and severity of endometriosis in patients with infertility and/or dysmenorrhea undergoing laparoscopy and hysteroscopy.Patients: The study involved 106 patients of reproductive age with symptoms of dysmenorrhea and infertility. Sixteen endometriosis-free asymptomatic patients were used as a control group.Methods: Concomitant laparoscopy and hysteroscopy was carried out in all cases. An endometrial biopsy was taken to determine aromatase p450 expression by immunohistochemistry. Endometriosis was staged according to the American Society of Reproductive Medicine classification.Results: Endometriosis was diagnosed by laparoscopy in 92/106 symptomatic patients. In this group, aromatase expression was detected in the eutopic endometrium of 66/92 patients with endometriosis (72% and in 13/14 (95% patients in the symptomatic, endometriosis-free group (P = 0.09. Aromatase expression was not detected in any patients from the control group. In the endometriosis group, aromatase expression was detected in the eutopic endometrium of 28/45 patients (62% with American Society of Reproductive Medicine classification stage 1 of the disease, in 11/14 patients (78% with stage II, 14/20 patients (70% with stage III, and in 12/13 patients (92% with stage IV; however, the difference was only statistically significant between stages I and IV (P = 0.04.Conclusion: Aromatase expression in the endometrium was associated with the presence of dysmenorrhea and infertility irrespective of the presence of endometriosis. When endometriosis was present, however, there was a tendency for aromatase expression to be positively correlated with dysmenorrhea severity.Keywords: aromatase, endometrium, endometriosis, Cox-2, dysmenorrhea
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
Ingle, James N; Xie, Fang; Ellis, Matthew J; Goss, Paul E; Shepherd, Lois E; Chapman, Judith-Anne W; Chen, Bingshu E; Kubo, Michiaki; Furukawa, Yoichi; Momozawa, Yukihide; Stearns, Vered; Pritchard, Kathleen I; Barman, Poulami; Carlson, Erin E; Goetz, Matthew P; Weinshilboum, Richard M; Kalari, Krishna R; Wang, Liewei
2016-12-01
Genetic risks in breast cancer remain only partly understood. Here, we report the results of a genome-wide association study of germline DNA from 4,658 women, including 252 women experiencing a breast cancer recurrence, who were entered on the MA.27 adjuvant trial comparing the aromatase inhibitors (AI) anastrozole and exemestane. Single-nucleotide polymorphisms (SNP) of top significance were identified in the gene encoding MIR2052HG, a long noncoding RNA of unknown function. Heterozygous or homozygous individuals for variant alleles exhibited a ∼40% or ∼63% decrease, respectively, in the hazard of breast cancer recurrence relative to homozygous wild-type individuals. Functional genomic studies in lymphoblastoid cell lines and ERα-positive breast cancer cell lines showed that expression from MIR2052HG and the ESR1 gene encoding estrogen receptor-α (ERα) was induced by estrogen and AI in a SNP-dependent manner. Variant SNP genotypes exhibited increased ERα binding to estrogen response elements, relative to wild-type genotypes, a pattern that was reversed by AI treatment. Further, variant SNPs were associated with lower expression of MIR2052HG and ERα. RNAi-mediated silencing of MIR2052HG in breast cancer cell lines decreased ERα expression, cell proliferation, and anchorage-independent colony formation. Mechanistic investigations revealed that MIR2052HG sustained ERα levels both by promoting AKT/FOXO3-mediated ESR1 transcription and by limiting ubiquitin-mediated, proteasome-dependent degradation of ERα. Taken together, our results define MIR2052HS as a functionally polymorphic gene that affects risks of breast cancer recurrence in women treated with AI. More broadly, our results offer a pharmacogenomic basis to understand differences in the response of breast cancer patients to AI therapy. Cancer Res; 76(23); 7012-23. ©2016 AACR. ©2016 American Association for Cancer Research.
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Effect of β-agonist on the dexamethasone-induced expression of aromatase by the human monocyte cells
Directory of Open Access Journals (Sweden)
Masatada Watanabe
2017-02-01
Full Text Available Emerging evidence suggests that sex steroids are important for human skin health. In particular, estrogen improves skin thickness, elasticity and moisture of older women. The major source of circulating estrogen is the ovary; however, local estrogen synthesis and secretion have important roles in, for example, bone metabolism and breast cancer development. We hypothesized that infiltrated peripheral monocytes are one of the sources of estrogen in skin tissues. We also hypothesized that, during atopic dermatitis under stress, a decline in the hypothalamus–pituitary–adrenal axis (HPA and facilitation of the (hypothalamus–sympathetic–adrenomedullary system (SAM attenuates estrogen secretion from monocytes. Based on this hypothesis, we tested aromatase expression in the human peripheral monocyte-derived cell line THP-1 in response to the synthetic glucocorticoid dexamethasone (Dex, the synthetic β-agonist isoproterenol (Iso and the β-antagonist propranolol (Pro. Dex mimics glucocorticoid secreted during excitation of the HPA, and Iso mimics catecholamine secreted during excitation of the SAM. We found that aromatase activity and the CYP19A1 gene transcript were both upregulated in THP-1 cells in the presence of Dex. Addition of Iso induced their downregulation and further addition of Pro rescued aromatase expression. These results may suggest that attenuation of estrogen secretion from peripheral monocytes could be a part of the pathology of stress-caused deterioration of atopic dermatitis. Further examination using an in vitro human skin model including THP-1 cells might be a valuable tool for investigating the therapeutic efficacy and mechanism of estrogen treatment for skin health.
DEFF Research Database (Denmark)
Eriksen, Mette Brandt; Glintborg, Dorte; Nielsen, Michael Friberg Bruun
2014-01-01
Polycystic ovary syndrome (PCOS) is associated with insulin resistance and increased risk of type 2 diabetes. Skeletal muscle is the major site of insulin mediated glucose disposal and the skeletal muscle tissue is capable to synthesize, convert and degrade androgens. Insulin sensitivity is conse......Polycystic ovary syndrome (PCOS) is associated with insulin resistance and increased risk of type 2 diabetes. Skeletal muscle is the major site of insulin mediated glucose disposal and the skeletal muscle tissue is capable to synthesize, convert and degrade androgens. Insulin sensitivity...... is conserved in cultured myotubes (in vitro) from patients with PCOS, but the effect of testosterone on this insulin sensitivity is unknown. We investigated the effect of 7days testosterone treatment (100nmol/l) on glucose transport and gene expression levels of hormone receptors and enzymes involved...... in the synthesis and conversion of testosterone (HSD17B1, HSD17B2, CYP19A1, SRD5A1-2, AR, ER-α, HSD17B6 and AKR1-3) in myotubes from ten patients with PCOS and ten matched controls. Testosterone treatment significantly increased aromatase and androgen receptor gene expression levels in patients and controls...
International Nuclear Information System (INIS)
Benachour, Nora; Moslemi, Safa; Sipahutar, Herbert; Seralini, Gilles-Eric
2007-01-01
Xenobiotics may cause long-term adverse effects in humans, especially at the embryonic level, raising questions about their levels of exposure, combined effects, and crucial endpoints. We are interested in the possible interactions between xenobiotic endocrine disrupters, cellular viability and androgen metabolism. Accordingly, we tested aroclor 1254 (A1254), atrazine (AZ), o,p'-DDT, vinclozolin (VZ), p,p'-DDE, bisphenol A (BPA), chlordecone (CD), nonylphenol (NP), tributylin oxide (TBTO), and diethylstilbestrol (DES) for cellular toxicity against human embryonic 293 cells, and activity against cellular aromatase, but also on placental microsomes and on the purified equine enzyme. Cellular viability was affected in 24 h by all the xenobiotics with a threshold at 50 μM (except for TBTO and DES, 10 μM threshold), and aromatase was inhibited at non-toxic doses. In combination synergism was observed reducing the threshold values of toxicity to 4-10 μM, and aromatase activity by 50% in some cases. In placental microsomes the most active xenobiotics rapidly inhibited microsomal aromatase in a manner independent of NADPH metabolism. Prolonged exposures to low doses in cells generally amplified by 50 times aromatase inhibition. These xenobiotics may act by inhibition of the active site or by allosteric effects on the enzyme. Bioaccumulation is a feature of some xenobiotics, especially chlordecone, DDT and DDE, and low level chronic exposures can also affect cell signaling mechanisms. This new information about the mechanism of action of these xenobiotics will assist in improved molecular design with a view to providing safer compounds for use in the (human) environment
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Barigye, Stephen J; Freitas, Matheus P; Ausina, Priscila; Zancan, Patricia; Sola-Penna, Mauro; Castillo-Garit, Juan A
2018-02-12
We recently generalized the formerly alignment-dependent multivariate image analysis applied to quantitative structure-activity relationships (MIA-QSAR) method through the application of the discrete Fourier transform (DFT), allowing for its application to noncongruent and structurally diverse chemical compound data sets. Here we report the first practical application of this method in the screening of molecular entities of therapeutic interest, with human aromatase inhibitory activity as the case study. We developed an ensemble classification model based on the two-dimensional (2D) DFT MIA-QSAR descriptors, with which we screened the NCI Diversity Set V (1593 compounds) and obtained 34 chemical compounds with possible aromatase inhibitory activity. These compounds were docked into the aromatase active site, and the 10 most promising compounds were selected for in vitro experimental validation. Of these compounds, 7419 (nonsteroidal) and 89 201 (steroidal) demonstrated satisfactory antiproliferative and aromatase inhibitory activities. The obtained results suggest that the 2D-DFT MIA-QSAR method may be useful in ligand-based virtual screening of new molecular entities of therapeutic utility.
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Fish with thermolabile sex determination (TSD) as models to study brain sex differentiation.
Blázquez, Mercedes; Somoza, Gustavo M
2010-05-01
As fish are ectothermic animals, water temperature can affect their basic biological processes such as larval development, growth and reproduction. Similar to reptiles, the incubation temperature during early phases of development is capable to modify sex ratios in a large number of fish species. This phenomenon, known as thermolabile sex determination (TSD) was first reported in Menidia menidia, a species belonging to the family Atherinopsidae. Since then, an increasing number of fish have also been found to exhibit TSD. Traditionally, likewise in reptiles, several TSD patterns have been described in fish, however it has been recently postulated that only one, females at low temperatures and males at high temperatures, may represent the "real" or "true" TSD. Many studies regarding the influence of temperature on the final sex ratios have been focused on the expression and activity of gonadal aromatase, the enzyme involved in the conversion of androgens into estrogens and encoded by the cyp19a1a gene. In this regard, teleost fish, may be due to a whole genome duplication event, produce another aromatase enzyme, commonly named brain aromatase, encoded by the cyp19a1b gene. Contrary to what has been described in other vertebrates, fish exhibit very high levels of aromatase activity in the brain and therefore they synthesize high amounts of neuroestrogens. However, its biological significance is still not understood. In addition, the mechanism whereby temperature can induce the development of a testis or an ovary still remains elusive. In this context the present review is aimed to discuss several theories about the possible role of brain aromatase using fish as models. The relevance of brain aromatase and therefore of neuroestrogens as the possible cue for gonadal differentiation is raised. In addition, the possible role of brain aromatase as the way to keep the high levels of neurogenesis in fish is also considered. Several key examples of how teleosts and aromatase
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Directory of Open Access Journals (Sweden)
Sri Lakshmi Hyndavi Yeruva
2015-01-01
Full Text Available Aromatase inhibitors (AIs are most commonly used for breast cancer patients with hormone receptor positive disease. Although the side effect profile of aromatase inhibitors is well known, including common side effects like arthralgia, bone pain, arthritis, hot flashes, and more serious problems like osteoporosis, we present a case of an uncommon side effect of these medications. We report the case of a postmenopausal woman on adjuvant hormonal therapy with anastrozole after completing definitive therapy for stage IIIB estrogen receptor-positive breast cancer, who was referred to hematology service for evaluation of persistent erythrocytosis. Primary and known secondary causes of polycythemia were ruled out. On further evaluation, we found that her erythrocytosis began after initiation of anastrozole and resolved after it was discontinued. We discuss the pathophysiology of aromatase inhibitor-induced erythrocytosis and reference of similar cases reported in the literature.
Metabolism of 19-methyl-substituted steroids by human placental aromatase
International Nuclear Information System (INIS)
Beusen, D.D.; Carrell, H.L.; Covey, D.F.
1987-01-01
The 19-methyl analogues of androstenedione and its aromatization intermediates (19-hydroxyandrostenedione and 19-oxoandrostenedione) were evaluated as substrates of microsomal aromatase in order to determine the effect of a 19-alkyl substituent on the enzyme's regiospecificity. Neither the androstenedione analog [10-ethylestr-4-ene-3,17-dione (1c) nor the 19-oxoandrostenedione analog [10-acetylestr-4-ene-3,17-dione (3c)] was converted to estrogens or oxygenated metabolites by placental microsomes. In contrast, both analogues of 19-hydroxyandrostenedione [10-[(1S)-1-hydroxyethyl] extr-4-ene-3,17-dione (2c) and 10-[(1R)-1-hydroxyethyl]estr-4-ene-3,17-dione (2e)] were converted to the intermediate analog 3c in a process requiring O 2 and either NADH or NADPH. No change in enzyme regiospecificity was detected. The absolute configuration of 2e was determined by X-ray crystallography. Experiments with 18 O 2 established that 3c generated from 2c retained little 18 O ( 18 O (≅ 70%). All four 19-methyl steroids elicited type I difference spectra from placental microsomes in addition to acting as competitive inhibitors of aromatase. Pretreatment of microsomes with 4-hydroxyandrostenedione (a suicide inactivator of aromatase) abolished the metabolism of 2c and 2e to 3c, as well as the type I difference spectrum elicited by 2c and 2e. The failure of 2c, 2e, and 3c to undergo aromatization was rationalized in the context of a mechanistic proposal for the third oxygenation of aromatase requiring hydrogen abstraction at C 1 of 19,19-dihydroxyandrostenedione, homolytic cleavage of the C 10 -C 19 bond, and oxygen rebound at C 19
Which patients benefit most from adjuvant aromatase inhibitors?
DEFF Research Database (Denmark)
Viale, G; Regan, M M; Dell'Orto, P
2011-01-01
On average, aromatase inhibitors are better than tamoxifen when used as initial or sequential therapy for postmenopausal women with endocrine-responsive early breast cancer. Because there may be contraindications to their use based on side-effects or cost, we investigated subgroups in which aroma...
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
Energy Technology Data Exchange (ETDEWEB)
Ito, Y.; Fisher, C.R.; Simpson, E.R. (Univ. of Texas Southwestern Medical Center, Dallas, TX (United States)); Conte, F.A.; Grumbach, M.M. (Univ. of California, San Francisco, CA (United States))
1993-11-15
The authors identified two mutations in the CYP19 gene responsible for aromatase deficiency in an 18-year-old 46,XX female with ambiguous external genitalia at birth, primary amenorrhea and sexual infantilism, and polycystic ovaries. The coding exons, namely exons II-X, of the CYP19 gene were amplified by PCR from genomic DNA and sequenced directly. Direct sequencing of the amplified DNA from the patient revealed two single-base changes, at bp 1303 (C[yields]T) and bp 1310 (G[yields]A) in exon X, which were newly found missense mutations and resulted in codon changes of R435C and C437Y, respectively. Subcloning followed by sequencing confirmed that the patient is a compound heterozygote. The results of restriction fragment length polymorphism analysis and direct sequencing of the amplified exon X DNA from the patient's mother indicate maternal inheritance of the R435C mutation. Transient expression experiments showed that the R435C mutant protein had [approx]1.1% of the activity of the wild type, whereas C437Y was totally inactive. Cysteine-437 is the conserved cysteine in the heme-binding region believed to serve as the fifth coordinating ligand of the heme iron. To the authors' knowledge, this patient is the first adult to have described the cardinal features of a syndrome of aromatase deficiency. Recognition that such defects exist will lead to a better understanding of the role of this enzyme in human development and disease.
Ye, Lan; Gho, Wai M; Chan, Franky L; Chen, Shiuan; Leung, Lai K
2009-03-01
Licorice is the sweet-tasting rhizomes of a bean plant and is quite commonly used in Western countries for culinary purposes, while it is a medicinal herb in China. Many flavonoids have been isolated from licorice, and their pharmacological properties may be applicable in preventive medicine. Overexposure to estrogen has been implicated in the etiology of breast cancer, and cytochrome P450 (CYP) 19 enzyme, or aromatase, catalyzes the rate-limiting reaction. Phytocompounds that are able to inhibit this enzyme may potentially suppress breast cancer development. In the present study the licorice flavonoid isoliquiritigenin (ILN) was shown to be an aromatase inhibitor in recombinant protein and MCF-7 cells stably transfected with CYP19 (MCF-7aro). ILN displayed a K(i) value of around 3 muM, and it also blocked the MCF-7aro cell growth pertaining to the enzyme activity in vitro. Subsequently, the compound administered in diet was given to ovariectomized athymic mice transplanted with MCF-7aro cells. This mouse model is widely accepted for studying postmenopausal breast cancer. The phytochemical significantly deterred the xenograft growth without affecting the body weight. Subsequently, the flavonoid's effect on CYP19 transcriptional control in vitro was also investigated. At the mRNA level, ILN could also suppress the expression in wild-type MCF-7 cells. Reporter gene assay and real-time PCR verified that the transactivity of CYP19 driven by promoters I.3 and II was suppressed in these cells. Deactivation of C/EBP could be the underlying molecular mechanism. Our study demonstrated that ILN was an inhibitor of aromatase and a potential chemopreventive agent against breast cancer.
Directory of Open Access Journals (Sweden)
Fábio Bagnoli
2010-01-01
Full Text Available OBJECTIVE: This study intends to verify the expression levels and correlation of aromatase, matrix metalloproteinase 2 (MMP-2, matrix metalloproteinase 9 (MMP-9 and CD44 in ductal carcinoma in situ (DCIS and infiltrating ductal carcinoma (IDC when both are found in the same breast. METHODS: One hundred and ten cases were evaluated by tissue microarray (TMA and immunohistochemically screened with anti-aromatase polyclonal antibodies, anti-MMP-2 monoclonal antibodies, anti-MMP-9 policlonal antibodies and anti-CD44 monoclonal antibodies. RESULTS: Aromatase was expressed in IDC and DCIS in 63 (57.3% and 60 (67% of the cases respectively; MMP-2 was similarly expressed in IDC and DCIS in 15 (13.60% cases; MMP-9 was positively expressed in IDC and DCIS in 83 (75.50% and 82 (74.50% cases, respectively; CD44 was positively expressed in IDC and DCIS in 49 (44.50% and 48 (42.60% of the cases, respectively; all of them were highly correlated (pOBJETIVO: O objetivo desse estudo é verificar as expressões e correlações da aromatase, metalloproteinase 2 da matriz (MMP2, metalloproteinase 9 da matriz (MMP-9 e CD44 no carcinoma ductal in situ (CDIS e carcinoma ductal infiltrativo (CDI quando ambos estão presentes simultaneamente na mesma mama. MÉTODOS: Foram avaliados 110 casos pelo método de tissue microarray (TMA e através da utilização de anticorpos policlonais antiaromatase, anticorpos monoclonais anti-MMP-2, anticorpos policlonais anti-MMP-9 e anticorpos monoclonais anti-CD44. RESULTADOS: A aromatase estava expressa de forma positiva no CDI e CDIS em 63 (57,3% e 60 (67% casos, respectivamente. A expressão de MMP-2 estava expressa de forma positiva em 15 (13,6% casos tanto no CDI, quanto no CDIS. A expressão da MMP-9 estava expressa de forma positiva em 83 (75,5% e 82 (74,5% casos de CDI e CDIS, respectivamente. A expressão de CD44 estava expressa de forma positiva em 49 (44,5% e 48 (42,6% casos de CDI e CDIS, respectivamente. Todos eles
International Nuclear Information System (INIS)
Sun, Bin; Hoshino, Juma; Jermihov, Katie; Marler, Laura; Pezzuto, John M.; Mesecar, Andrew D.; Cushman, Mark
2010-01-01
A series of new resveratrol analogues were designed and synthesized and their inhibitory activities against aromatase were evaluated. The crystal structure of human aromatase (PDB 3eqm) was used to rationalize the mechanism of action of the aromatase inhibitor 32 (IC 50 0.59 μM) through docking, molecular mechanics energy minimization, and computer graphics molecular modeling, and the information was utilized to design several very potent inhibitors, including compounds 82 (IC 50 70 nM) and 84 (IC 50 36 nM). The aromatase inhibitory activities of these compounds are much more potent than that for the lead compound resveratrol, which has an IC 50 of 80 μM. In addition to aromatase inhibitory activity, compounds 32 and 44 also displayed potent QR2 inhibitory activity (IC 50 1.7 μM and 0.27 μM, respectively) and the high-resolution X-ray structures of QR2 in complex with these two compounds provide insight into their mechanism of QR2 inhibition. The aromatase and quinone reductase inhibitors resulting from these studies have potential value in the treatment and prevention of cancer.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Directory of Open Access Journals (Sweden)
Prachayasittikul V
2014-08-01
Full Text Available Veda Prachayasittikul,1 Ratchanok Pingaew,2 Chanin Nantasenamat,3 Supaluk Prachayasittikul,3 Somsak Ruchirawat,4,5 Virapong Prachayasittikul1 1Department of Clinical Microbiology and Applied Technology, Faculty of Medical Technology, Mahidol University, Bangkok, Thailand; 2Department of Chemistry, Faculty of Science, Srinakharinwirot University, Bangkok, Thailand; 3Center of Data Mining and Biomedical Informatics, Faculty of Medical Technology, Mahidol University, Bangkok, Thailand; 4Laboratory of Medicinal Chemistry, Chulabhorn Research Institute, 5Chulabhorn Graduate Institute, Bangkok, Thailand Purpose: Estrogens play important roles in the pathogenesis and progression of breast cancer as well as estrogen-related diseases. Aromatase is a key enzyme in the rate-limiting step of estrogen production, in which its inhibition is one strategy for controlling estrogen levels to improve prognosis of estrogen-related cancers and diseases. Herein, a series of metal (Mn, Cu, and Ni complexes of 8-hydroxyquinoline (8HQ and uracil derivatives (4–9 were investigated for their aromatase inhibitory and cytotoxic activities. Methods: The aromatase inhibition assay was performed according to a Gentest™ kit using CYP19 enzyme, wherein ketoconazole and letrozole were used as reference drugs. The cytotoxicity was tested on normal embryonic lung cells (MRC-5 using 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. Results: Only Cu complexes (6 and 9 exhibited aromatase inhibitory effect with IC50 0.30 and 1.7 µM, respectively. Cytotoxicity test against MRC-5 cells showed that Mn and Cu complexes (5 and 6, as well as free ligand 8HQ, exhibited activity with IC50 range 0.74–6.27 µM. Conclusion: Cu complexes (6 and 9 were found to act as a novel class of aromatase inhibitor. Our findings suggest that these 8HQ–Cu–uracil complexes are promising agents that could be potentially developed as a selective anticancer agent for breast cancer
The steroidogenic enzyme aromatase catalyzes the conversion of androgens (androstenedione and testosterone) to estrogens (estrone and estradiol) and therefore plays a central role in reproduction. In contrast to most vertebrates, teleost fish have two distinct forms of aromatase....
International Nuclear Information System (INIS)
Takeda, Shuso; Yamamoto, Ikuo; Watanabe, Kazuhito
2009-01-01
Δ 9 -Tetrahydrocannabinol (Δ 9 -THC), a major constituent of marijuana, has been shown to stimulate the growth of MCF-7 breast cancer cells through cannabinoid receptor-independent signaling [Takeda, S., Yamaori, S., Motoya, E., Matsunaga, T., Kimura, T., Yamamoto, I., Watanabe, K., 2008. Δ 9 -Tetrahydrocannabinol enhances MCF-7 cell proliferation via cannabinoid receptor-independent signaling. Toxicology 245, 141-146]. Although the growth of MCF-7 cells is known to be stimulated by 17β-estradiol (E 2 ), the interaction of Δ 9 -THC and E 2 in MCF-7 cell growth is not fully clarified so far. In the present study, by using E 2 -sensitive MCF-7 cells that have expressed cyclooxygenase-2 (COX-2) and cytochrome P450 19 (aromatase), we studied whether or not COX-2 and aromatase are involved in Δ 9 -THC-mediated MCF-7 cell proliferation. It was shown that Δ 9 -THC-induced MCF-7 cell growth was inhibited by COX-2 inhibitors and was stimulated by arachidonic acid (a COX substrate). However, the growth of MCF-7 cells induced by Δ 9 -THC was not stimulated by PGE 2 , and the expression of aromatase was not affected by COX-2 inhibitors, arachidonic acid, and PGE 2 , suggesting that there is a disconnection between COX-2 (PGE 2 ) and aromatase in Δ 9 -THC-mediated MCF-7 cell proliferation. On the other hand, Δ 9 -THC-induced MCF-7 cell growth was elevated by two kinds of aromatase inhibitors. Taken together with the evidence that Δ 9 -THC-induced MCF-7 cell proliferation was interfered with testosterone (an aromatase substrate) and exogenously provided E 2 , it is suggested that (1) the growth stimulatory effects of Δ 9 -THC are mediated by the product(s) of COX-2 except for PGE 2 , (2) the action of Δ 9 -THC is modulated by E 2 , and (3) COX-2 and aromatase are individually engaged in the proliferation of MCF-7 cells induced by Δ 9 -THC.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Testosterone-induced adult neurosphere growth is mediated by sexually-dimorphic aromatase expression
Directory of Open Access Journals (Sweden)
Mark Ian Ransome
2015-07-01
Full Text Available We derived adult neural stem/progenitor cells (NSPCs from the sub-ventricular zone of male and female mice to examine direct responses to principal sex hormones. In the presence of epidermal growth factor (EGF and fibroblast growth factor-2 (FGF2 NSPCs of both sexes expressed nestin and sox2 and could be maintained as neurospheres without addition of any sex hormones. The reverse was not observed; neither testosterone (T, 17β-oestradiol (E2 nor progesterone (P4 was able to support neurosphere growth in the absence of EGF and FGF2. 10nM T, E2 or P4 induced nestin(+ cell proliferation within 20 minutes and enhanced neurosphere growth over 7 days irrespective of sex, which was abolished by Erk inhibition with 20M U0126. Maintaining neurospheres with each sex hormone did not affect subsequent neuronal differentiation. However, 10nM T, E2 or P4 added during differentiation increased III tubulin(+ neuron production with E2 being more potent compared to T and P4 in both sexes. Androgen receptor (AR inhibition with 20M flutamide but not aromatase inhibition with 10M letrozole reduced basal and T-induced neurosphere growth in females, while only concurrent inhibition of AR and aromatase produced the same effect in males. This sex-specific effect was supported by higher aromatase expression in male neurospheres compared to females measured by Western blot and green fluorescent protein reporter. 10M menadione induced oxidative stress, impaired neurosphere growth and up-regulated aromatase expression in both sexes. However, under oxidative stress letrozole significantly exacerbated impaired neurosphere growth in males only. While both E2 and T could prevent oxidative stress-induced growth reduction in both sexes, the effects of T were dependent on innate aromatase activity. We show for the first time that intrinsic androgen and estrogen signalling may impact the capacity of NSPCs to produce neural progenitors under pathological conditions of
Directory of Open Access Journals (Sweden)
Lei eXing
2015-09-01
Full Text Available Radial glial cells (RGCs are abundant stem-like non-neuronal progenitors that are important for adult neurogenesis and brain repair, yet little is known about their regulation by neurotransmitters. Here we provide evidence for neuronal-glial interactions via a novel role for dopamine to stimulate RGC function. Goldfish were chosen as the model organism due to the abundance of RGCs and regenerative abilities of the adult central nervous system. A close anatomical relationship was observed between tyrosine hydroxylase-positive catecholaminergic cell bodies and axons and dopamine-D1 receptor expressing RGCs along the ventricular surface of telencephalon, a site of active neurogenesis. A primary cell culture model was established and immunofluorescence analysis indicates that in vitro RGCs from female goldfish retain their major characteristics in vivo, including expression of glial fibrillary acidic protein and brain lipid binding protein. The estrogen synthesis enzyme aromatase B is exclusively found in RGCs, but this is lost as cells differentiate to neurons and other glial types in adult teleost brain. Pharmacological experiments using the cultured RGCs established that specific activation of dopamine D1 receptors up-regulates aromatase B mRNA through a cyclic adenosine monophosphate-dependent molecular mechanism. These data indicate that dopamine enhances the steroidogenic function of this neuronal progenitor cell.
Ertas, Merve; Sahin, Zafer; Berk, Barkin; Yurttas, Leyla; Biltekin, Sevde N; Demirayak, Seref
2018-04-01
Drugs used in breast cancer treatments target the suppression of estrogen biosynthesis. During this suppression, the main goal is to inhibit the aromatase enzyme that is responsible for the cyclization and structuring of estrogens either with steroid or non-steroidal-type inhibitors. Non-steroidal derivatives generally have a planar aromatic structure attached to the triazole ring system in their structures, which inhibits hydroxylation reactions during aromatization by coordinating the heme group. Bioisosteric replacement of the triazole ring system and development of aromatic/cyclic structures of the side chain can increase the selectivity for aromatase enzyme inhibition. In this study, pyridine-substituted thiazolylphenol derivatives, which are non-steroidal triazole bioisosteres, were synthesized using the Hantzsch method, and physical analysis and structural determination studies were performed. The IC 50 values of the compounds were determined by a fluorescence-based aromatase inhibition assay. Then, their antiproliferative activities on the MCF7 and HEK 293 cell lines were evaluated with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Furthermore, the crystal structure of human placental aromatase was subjected to a series of docking experiments to identify the possible interactions between the most active structure and the active site. Lastly, an in silico technique was performed to analyze and predict the drug-likeness, molecular and ADME properties of the synthesized molecules. © 2018 Deutsche Pharmazeutische Gesellschaft.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
International Nuclear Information System (INIS)
Lykkesfeldt, Anne E; Henriksen, Katrine L; Rasmussen, Birgitte B; Sasano, Hironobu; Evans, Dean B; Møller, Susanne; Ejlertsen, Bent; Mouridsen, Henning T
2009-01-01
New, third-generation aromatase inhibitors (AIs) have proven comparable or superior to the anti-estrogen tamoxifen for treatment of estrogen receptor (ER) and/or progesterone receptor (PR) positive breast cancer. AIs suppress total body and intratumoral estrogen levels. It is unclear whether in situ carcinoma cell aromatization is the primary source of estrogen production for tumor growth and whether the aromatase expression is predictive of response to endocrine therapy. Due to methodological difficulties in the determination of the aromatase protein, COX-2, an enzyme involved in the synthesis of aromatase, has been suggested as a surrogate marker for aromatase expression. Primary tumor material was retrospectively collected from 88 patients who participated in a randomized clinical trial comparing the AI letrozole to the anti-estrogen tamoxifen for first-line treatment of advanced breast cancer. Semi-quantitative immunohistochemical (IHC) analysis was performed for ER, PR, COX-2 and aromatase using Tissue Microarrays (TMAs). Aromatase was also analyzed using whole sections (WS). Kappa analysis was applied to compare association of protein expression levels. Univariate Wilcoxon analysis and the Cox-analysis were performed to evaluate time to progression (TTP) in relation to marker expression. Aromatase expression was associated with ER, but not with PR or COX-2 expression in carcinoma cells. Measurements of aromatase in WS were not comparable to results from TMAs. Expression of COX-2 and aromatase did not predict response to endocrine therapy. Aromatase in combination with high PR expression may select letrozole treated patients with a longer TTP. TMAs are not suitable for IHC analysis of in situ aromatase expression and we did not find COX-2 expression in carcinoma cells to be a surrogate marker for aromatase. In situ aromatase expression in tumor cells is associated with ER expression and may thus point towards good prognosis. Aromatase expression in cancer
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Effect of dioxin exposure on aromatase expression in ovariectomized rats
International Nuclear Information System (INIS)
Ye Lan; Leung, Lai K.
2008-01-01
Because of their persistence in the environment dioxins are one of the most concerned classes of carcinogens. Displaying both pro- and anti-agonistic properties to some hormone receptors, the pollutants are also known to be endocrine disruptors. Humans can be exposed to this pollutant through contaminated food, air, drinking water, etc. The female hormone estrogen may initiate various physiological functions, and excessive exposure to this hormone is a documented risk factor for carcinogenesis. Cyp19 (aromatase) catalyses the last step of estrogen biosynthesis, while cyp1a1 can hydroxylate and deactivate the hormone. In the present study, we investigated the effect of 2,3,7,8-tetrachlorodibenzo-para-dioxin (TCDD) on aromatase expression in the brain and adipose tissue in ovariectomized Sprague Dawley rats. Female rats were given 2.5 μg/kg TCDD p.o. before and after ovariectomy. Real-time PCR and western blot analysis indicated that pre-ovariectomy administration of TCDD could significantly reduce aromatase expression in the brain but increase the expression in the adipose tissue. In addition, increased plasma estrogen level and uterine weight were observed in these rats. These parameters did not change in rats with post-ovariectomy TCDD treatment. Our results suggested that the timing of exposure to the toxicant could determine the estrogenicity of TCDD. No correlation between cyp1a1 and cyp19 expression was observed
Strobl-Mazzulla, P. H.; Lethimonier, C.; Gueguen, M.M.; Karube, M.; Fernandino, J.I.; Yoshizaki, G.; Patino, R.; Strussmann, C.A.; Kah, O.; Somoza, G.M.
2008-01-01
Although estrogens exert many functions on vertebrate brains, there is little information on the relationship between brain aromatase and estrogen receptors. Here, we report the cloning and characterization of two estrogen receptors, ?? and ??, in pejerrey. Both receptors' mRNAs largely overlap and were predominantly expressed in the brain, pituitary, liver, and gonads. Also brain aromatase and estrogen receptors were up-regulated in the brain of estradiol-treated males. In situ hybridization was performed to study in more detail, the distribution of the two receptors in comparison with brain aromatase mRNA in the brain of adult pejerrey. The estrogen receptors' mRNAs exhibited distinct but partially overlapping patterns of expression in the preoptic area and the mediobasal hypothalamus, as well as in the pituitary gland. Moreover, the estrogen receptor ??, but not ??, were found to be expressed in cells lining the preoptic recess, similarly as observed for brain aromatase. Finally, it was shown that the onset expression of brain aromatase and both estrogen receptors in the head of larvae preceded the morphological differentiation of the gonads. Because pejerrey sex differentiation is strongly influenced by temperature, brain aromatase expression was measured during the temperature-sensitive window and was found to be significantly higher at male-promoting temperature. Taken together these results suggest close neuroanatomical and functional relationships between brain aromatase and estrogen receptors, probably involved in the sexual differentiation of the brain and raising interesting questions on the origin (central or peripheral) of the brain aromatase substrate. ?? 2008 Elsevier Inc.
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Sitzlar, M.A.; Mora, M.A.; Fleming, J.G.W.; Bazer, F.W.; Bickham, J.W.; Matson, C.W.
2009-01-01
Cliff swallows (Petrochelidon pyrrhonota) and cave swallows (P. fulva) were sampled during the breeding season at several locations in the Rio Grande, Texas, to evaluate the potential effects of environmental contaminants on P450 aromatase activity in brain and gonads and DNA damage in blood cells. The tritiated water-release aromatase assay was used to measure aromatase activity and flow cytometry was used to measure DNA damage in nucleated blood cells. There were no significant differences in brain and gonadal aromatase activities or in estimates of DNA damage (HPCV values) among cave swallow colonies from the Lower Rio Grande Valley (LRGV) and Somerville. However, both brain and gonadal aromatase activities were significantly higher (P male cliff swallows from Laredo than in those from Somerville. Also, DNA damage estimates were significantly higher (P males and females combined) from Laredo than in those from Somerville. Contaminants of current high use in the LRGV, such as atrazine, and some of the highly persistent organochlorines, such as toxaphene and DDE, could be potentially associated with modulation of aromatase activity in avian tissues. Previous studies have indicated possible DNA damage in cliff swallows. We did not observe any differences in aromatase activity or DNA damage in cave swallows that could be associated with contaminant exposure. Also, the differences in aromatase activity and DNA damage between male cliff swallows from Laredo and Somerville could not be explained by contaminants measured at each site in previous studies. Our study provides baseline information on brain and gonadal aromatase activity in swallows that could be useful in future studies. ?? 2008 Springer Science+Business Media, LLC.
Aromatase imaging with [N-methyl-C-11]vorozole PET in healthy men and women
International Nuclear Information System (INIS)
Biegon, Anat; Fowler, Joanna S.; Alexoff, David L.; Kim, Sung Won; Logan, Jean; Pareto, Deborah; Schlyer, David; Wang, Gene-Jack
2015-01-01
Aromatase, the last and obligatory enzyme catalyzing estrogen biosynthesis from androgenic precursors, can be labeled in vivo with (11)C-vorozole. Aromatase inhibitors are widely used in breast cancer and other endocrine conditions. The present study aims to provide baseline information defining aromatase distribution in healthy men and women, against which its perturbation in pathological situations can be studied. Methods: (11)C-vorozole (111-296 MBq/subject) was injected I.V in 13 men and 20 women (age range 23 to 67). PET data were acquired over a 90 minute period. Each subject had 4 scans, 2/day separated by 2-6 weeks, including brain and torso or pelvis scans. Young women were scanned at 2 discrete phases of the menstrual cycle (midcycle and late luteal). Men and postmenopausal women were also scanned following pretreatment with a clinical dose of the aromatase inhibitor letrozole.Time activity curves were obtained and standard uptake values (SUV) calculated for major organs including brain, heart, lungs, liver, kidneys, spleen, muscle, bone and male and female reproductive organs (penis, testes, uterus, ovaries). Organ and whole body radiation exposures were calculated using Olinda software. Results: Liver uptake was higher than all other organs, but was not blocked by pretreatment with letrozole. Mean SUVs in men were higher than in women, and brain uptake was blocked by letrozole. Male brain SUVs were also higher than all other organs (ranging from 0.48±0.05 in lungs to 1.5±0.13 in kidneys). Mean ovarian SUVs (3.08±0.7) were comparable to brain levels and higher than all other organs. Furthermore, ovarian SUVs In young women around the time of ovulation (midcycle) were significantly higher than those measured in the late luteal phase, while aging and cigarette smoking reduced (11)C-vorozole uptake. Conclusions: PET with (11)C-vorozole is useful for assessing physiological changes in estrogen synthesis capacity in the human body. Baseline levels in
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Oestrogen-deficient female aromatase knockout (ArKO) mice exhibit depressive-like symptomatology.
Dalla, C; Antoniou, K; Papadopoulou-Daifoti, Z; Balthazart, J; Bakker, J
2004-07-01
We recently found that female aromatase knockout (ArKO) mice that are deficient in oestradiol due to a targeted mutation in the aromatase gene show deficits in sexual behaviour that cannot be corrected by adult treatment with oestrogens. We determined here whether these impairments are associated with changes in general levels of activity, anxiety or 'depressive-like' symptomatology due to chronic oestrogen deficiency. We also compared the neurochemical profile of ArKO and wild-type (WT) females, as oestrogens have been shown to modulate dopaminergic, serotonergic and noradrenergic brain activities. ArKO females did not differ from WT in spontaneous motor activity, exploration or anxiety. These findings are in line with the absence of major neurochemical alterations in hypothalamus, prefrontal cortex or striatum, which are involved in the expression of these behaviours. By contrast, ArKO females displayed decreased active behaviours, such as struggling and swimming, and increased passive behaviours, such as floating, in repeated sessions of the forced swim test, indicating that these females exhibit 'depressive-like' symptoms. Adult treatment with oestradiol did not reverse the behavioural deficits observed in the forced swim test, suggesting that they may be due to the absence of oestradiol during development. Accordingly, an increased serotonergic activity was observed in the hippocampus of ArKO females compared with WT, which was also not reversed by adult oestradiol treatment. The possible organizational role of oestradiol on the hippocampal serotonergic system and the 'depressive-like' profile of ArKO females provide new insights into the pathophysiology of depression and the increased vulnerability of women to depression.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Aromatase is a member of the cytochrome P450 superfamily responsible for a key step in the biosynthesis of estrogens. As estrogens are involved in the control of important reproduction-related processes, including sexual differentiation and maturation, aromatase is a potential ta...
van Dijk, Marc; Ter Laak, Antonius M; Wichard, Jörg D; Capoferri, Luigi; Vermeulen, Nico P E; Geerke, Daan P
2017-01-01
Cytochrome P450 aromatase (CYP19A1) plays a key role in the development of estrogen dependent breast cancer, and aromatase inhibitors have been at the front line of treatment for the past three decades. The development of potent, selective and safer inhibitors is ongoing with in silico screening
Lv, Wei; Liu, Jinzhong; Skaar, Todd C; O'Neill, Elizaveta; Yu, Ge; Flockhart, David A; Cushman, Mark
2016-01-14
A series of triphenylethylene bisphenol analogues of the selective estrogen receptor modulator (SERM) tamoxifen were synthesized and evaluated for their abilities to inhibit aromatase, bind to estrogen receptor α (ER-α) and estrogen receptor β (ER-β), and antagonize the activity of β-estradiol in MCF-7 human breast cancer cells. The long-range goal has been to create dual aromatase inhibitor (AI)/selective estrogen receptor modulators (SERMs). The hypothesis is that in normal tissue the estrogenic SERM activity of a dual AI/SERM could attenuate the undesired effects stemming from global estrogen depletion caused by the AI activity of a dual AI/SERM, while in breast cancer tissue the antiestrogenic SERM activity of a dual AI/SERM could act synergistically with AI activity to enhance the antiproliferative effect. The potent aromatase inhibitory activities and high ER-α and ER-β binding affinities of several of the resulting analogues, together with the facts that they antagonize β-estradiol in a functional assay in MCF-7 human breast cancer cells and they have no E/Z isomers, support their further development in order to obtain dual AI/SERM agents for breast cancer treatment.
Tian, Hua; Wu, Peng; Wang, Wei; Ru, Shaoguo
2015-05-01
Although bioaccumulation of tributyltin (TBT) in fish has been confirmed, information on possible effects of TBT on reproductive system of fish is still relatively scarce, particularly at environmentally relevant levels. To evaluate the adverse effects and intrinsic toxicological properties of TBT in male fish, we studied aromatase gene expression in the brain, sex steroid contents, primary and secondary sexual characteristics, and reproductive behavior in male guppies (Poecilia reticulata) exposed to tributyltin chloride at the nominal concentrations of 5, 50, and 500 ng/L for 28 days in a semi-static exposure system. Radioimmunoassay demonstrated that treatment with 50 ng/L TBT caused an increase in systemic levels of testosterone of male guppies. Gonopodial index, which showed a positive correlation with testosterone levels, was elevated in the 5 ng/L and 50 ng/L TBT treated groups. Real-time PCR revealed that TBT exposure had inhibiting effects on expression of two isoforms of guppy aromatase in the brain, and these changes at the molecular levels were associated with a disturbance of reproductive behavior of the individuals, as measured by decreases in frequencies of posturing, sigmoid display, and chase activities when males were paired with females. This study provides the first evidence that TBT can cause abnormalities of secondary sexual characteristics in teleosts and that suppression of reproductive behavior in teleosts by TBT is due to its endocrine-disrupting action as an aromatase inhibitor targeting the nervous system. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Energy Technology Data Exchange (ETDEWEB)
Biegon, A.; Biegon, A.; Kim, S.W.; Alexoff, D.; Millard, J.; Carter, P.; Hubbard, B.; King, P.; Logan, J.; Muench, L.; Pareto, D.; Schlyer, D.; Shea, C.; Telang, F.; Wang, G.-J.; Xu, Y.; Fowler, J.
2010-10-01
Aromatase catalyzes the last step in estrogen biosynthesis. Brain aromatase is involved in diverse neurophysiological and behavioral functions including sexual behavior, aggression, cognition, and neuroprotection. Using positron emission tomography (PET) with the radiolabeled aromatase inhibitor [N-methyl-{sup 11}C]vorozole, we characterized the tracer distribution and kinetics in the living human brain. Six young, healthy subjects, three men and three women, were administered the radiotracer alone on two separate occasions. Women were scanned in distinct phases of the menstrual cycle. Specificity was confirmed by pretreatment with a pharmacological (2.5 mg) dose of the aromatase inhibitor letrozole. PET data were acquired over a 90-min period and regions of interest placed over selected brain regions. Brain and plasma time activity curves, corrected for metabolites, were used to derive kinetic parameters. Distribution volume (V{sub T}) values in both men and women followed the following rank order: thalamus > amygdala = preoptic area > medulla (inferior olive) > accumbens, pons, occipital and temporal cortex, putamen, cerebellum, and white matter. Pretreatment with letrozole reduced VT in all regions, though the size of the reduction was region-dependent, ranging from {approx}70% blocking in thalamus andpreoptic area to {approx}10% in cerebellum. The high levels of aromatase in thalamus and medulla (inferior olive) appear to be unique to humans. These studies set the stage for the noninvasive assessment of aromatase involvement in various physiological and pathological processes affecting the human brain.
International Nuclear Information System (INIS)
Biegon, A.; Kim, S.W.; Alexoff, D.; Millard, J.; Carter, P.; Hubbard, B.; King, P.; Logan, J.; Muench, L.; Pareto, D.; Schlyer, D.; Shea, C.; Telang, F.; Wang, G.-J.; Xu, Y.; Fowler, J.
2010-01-01
Aromatase catalyzes the last step in estrogen biosynthesis. Brain aromatase is involved in diverse neurophysiological and behavioral functions including sexual behavior, aggression, cognition, and neuroprotection. Using positron emission tomography (PET) with the radiolabeled aromatase inhibitor (N-methyl- 11 C)vorozole, we characterized the tracer distribution and kinetics in the living human brain. Six young, healthy subjects, three men and three women, were administered the radiotracer alone on two separate occasions. Women were scanned in distinct phases of the menstrual cycle. Specificity was confirmed by pretreatment with a pharmacological (2.5 mg) dose of the aromatase inhibitor letrozole. PET data were acquired over a 90-min period and regions of interest placed over selected brain regions. Brain and plasma time activity curves, corrected for metabolites, were used to derive kinetic parameters. Distribution volume (V T ) values in both men and women followed the following rank order: thalamus > amygdala = preoptic area > medulla (inferior olive) > accumbens, pons, occipital and temporal cortex, putamen, cerebellum, and white matter. Pretreatment with letrozole reduced VT in all regions, though the size of the reduction was region-dependent, ranging from ∼70% blocking in thalamus andpreoptic area to ∼10% in cerebellum. The high levels of aromatase in thalamus and medulla (inferior olive) appear to be unique to humans. These studies set the stage for the noninvasive assessment of aromatase involvement in various physiological and pathological processes affecting the human brain.
Biegon, Anat; Kim, Sung Won; Alexoff, David L; Jayne, Millard; Carter, Pauline; Hubbard, Barbara; King, Payton; Logan, Jean; Muench, Lisa; Pareto, Deborah; Schlyer, David; Shea, Colleen; Telang, Frank; Wang, Gene-Jack; Xu, Youwen; Fowler, Joanna S
2010-11-01
Aromatase catalyzes the last step in estrogen biosynthesis. Brain aromatase is involved in diverse neurophysiological and behavioral functions including sexual behavior, aggression, cognition, and neuroprotection. Using positron emission tomography (PET) with the radiolabeled aromatase inhibitor [N-methyl-(11)C]vorozole, we characterized the tracer distribution and kinetics in the living human brain. Six young, healthy subjects, three men and three women, were administered the radiotracer alone on two separate occasions. Women were scanned in distinct phases of the menstrual cycle. Specificity was confirmed by pretreatment with a pharmacological (2.5 mg) dose of the aromatase inhibitor letrozole. PET data were acquired over a 90-min period and regions of interest placed over selected brain regions. Brain and plasma time activity curves, corrected for metabolites, were used to derive kinetic parameters. Distribution volume (V(T)) values in both men and women followed the following rank order: thalamus > amygdala = preoptic area > medulla (inferior olive) > accumbens, pons, occipital and temporal cortex, putamen, cerebellum, and white matter. Pretreatment with letrozole reduced V(T) in all regions, though the size of the reduction was region-dependent, ranging from ∼70% blocking in thalamus andpreoptic area to ∼10% in cerebellum. The high levels of aromatase in thalamus and medulla (inferior olive) appear to be unique to humans. These studies set the stage for the noninvasive assessment of aromatase involvement in various physiological and pathological processes affecting the human brain.
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Lecke, Sheila B; Morsch, Débora M; Spritzer, Poli M
2011-11-01
In polycystic ovary syndrome (PCOS), hypertension has been linked to androgen excess and insulin resistance. Aromatase, an enzyme encoded by the CYP19 gene, affects androgen metabolism and estrogen synthesis, influencing the androgen to estrogen balance. We characterized CYP19 gene expression in subcutaneous adipose tissue of women with PCOS and normal controls and evaluated the association between subcutaneous fat CYP19 mRNA, circulating hormone levels, and blood pressure. This case-control study was carried out with 31 PCOS patients and 27 BMI-matched normotensive non-hirsute women with regular cycles. Participants underwent anthropometric measurements, collection of blood samples, and adipose tissue biopsy (28 PCOS and 19 controls). Hypertension was defined as systolic blood pressure ≥ 130 mmHg and/or diastolic blood pressure ≥ 85 mmHg. PCOS patients were divided into normotensive and hypertensive. Main outcome measures were serum estrogen and androgen levels, estrogen-to-androgen ratio, and CYP19 gene expression in subcutaneous fat. Subcutaneous CYP19 mRNA was higher in hypertensive PCOS than in control and normotensive PCOS women (p = 0.014). Estrogen-to-androgen ratio was lower in hypertensive PCOS than controls (p androgen ratio ≤ 0.06 (median for the three groups) was observed in 91% of hypertensive PCOS women, vs. 37% and 61% in the control and normotensive PCOS groups (p = 0.011). CYP19 gene expression in subcutaneous fat of PCOS patient correlated positively with systolic (p = 0.006) and diastolic blood pressure (p = 0.009). Androgen excess and hyperinsulinemia may play a role in the molecular mechanisms that activate aromatase mRNA transcription in abdominal fat tissue. Copyright © 2011 Elsevier Inc. All rights reserved.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Aromatase imaging with [N-methyl-11C]vorozole PET in healthy men and women.
Biegon, Anat; Alexoff, David L; Kim, Sung Won; Logan, Jean; Pareto, Deborah; Schlyer, David; Wang, Gene-Jack; Fowler, Joanna S
2015-04-01
Aromatase, the last and obligatory enzyme catalyzing estrogen biosynthesis from androgenic precursors, can be labeled in vivo with (11)C-vorozole. Aromatase inhibitors are widely used in breast cancer and other endocrine conditions. The present study aimed to provide baseline information defining aromatase distribution in healthy men and women, against which its perturbation in pathologic situations can be studied. (11)C-vorozole (111-296 MBq/subject) was injected intravenously in 13 men and 20 women (age range, 23-67 y). PET data were acquired over a 90-min period. Each subject had 4 scans, 2 per day separated by 2-6 wk, including brain and torso or pelvis scans. Young women were scanned at 2 discrete phases of the menstrual cycle (midcycle and late luteal). Men and postmenopausal women were also scanned after pretreatment with a clinical dose of the aromatase inhibitor letrozole. Time-activity curves were obtained, and standardized uptake values (SUV) were calculated for major organs including brain, heart, lungs, liver, kidneys, spleen, muscle, bone, and male and female reproductive organs (penis, testes, uterus, ovaries). Organ and whole-body radiation exposures were calculated using OLINDA software. Liver uptake was higher than uptake in any other organ but was not blocked by pretreatment with letrozole. Mean SUVs were higher in men than in women, and brain uptake was blocked by letrozole. Male brain SUVs were also higher than SUVs in any other organ (ranging from 0.48 ± 0.05 in lungs to 1.5 ± 0.13 in kidneys). Mean ovarian SUVs (3.08 ± 0.7) were comparable to brain levels and higher than in any other organ. Furthermore, ovarian SUVs in young women around the time of ovulation (midcycle) were significantly higher than those measured in the late luteal phase, whereas aging and cigarette smoking reduced (11)C-vorozole uptake. PET with (11)C-vorozole is useful for assessing physiologic changes in estrogen synthesis capacity in the human body. Baseline levels
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Sahin, Zafer; Ertas, Merve; Berk, Barkın; Biltekin, Sevde Nur; Yurttas, Leyla; Demirayak, Seref
2018-05-01
Steroidal and non-steroidal aromatase inhibitors target the suppression of estrogen biosynthesis in the treatment of breast cancer. Researchers have increasingly focused on developing non-steroidal derivatives for their potential clinical use avoiding steroidal side-effects. Non-steroidal derivatives generally have planar aromatic structures attached to the azole ring system. One part of this ring system comprises functional groups that inhibit aromatization through the coordination of the haem group of the aromatase enzyme. Replacement of the triazole ring system and development of aromatic/cyclic structures of the side chain can increase selectivity over aromatase enzyme inhibition. In this study, 4-(aryl/heteroaryl)-2-(pyrimidin-2-yl)thiazole derivatives were synthesized and physical analyses and structural determination studies were performed. The IC 50 values were determined by a fluorescence-based aromatase inhibition assay and compound 1 (4-(2-hydroxyphenyl)-2-(pyrimidine-2-yl)thiazole) were found potent inhibitor of enzyme (IC 50 :0.42 nM). Then, their antiproliferative activity over MCF-7 and HEK-293 cell lines was evaluated using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Compounds 1, 7, 8, 13, 15, 18, 21 were active against MCF-7 breast cancer cells. Lastly, a series of docking experiments were undertaken to analyze the crystal structure of human placental aromatase and identify the possible interactions between the most active structure and the active site. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Cantón, Rocío F; Scholten, Deborah E A; Marsh, Göran; de Jong, Paul C; van den Berg, Martin
2008-02-15
Polybrominated diphenyl ethers (PBDEs) are widely used as flame retardants in many different polymers, resins and substrates. Due to their widespread production and use, their high binding affinity to particles, and their lipophilic properties, several PBDE congeners can bioaccumulate in the environment. As a result, PBDEs and their hydroxylated metabolites (OH-PBDEs) have been detected in humans and various wildlife samples, such as birds, seals, and whales. Furthermore, certain OH-PBDEs and their methoxylated derivatives (MeO-PBDEs) are natural products in the marine environment. Recently, our laboratory focused on the possible effects on steroidogenesis of PBDEs and OH-PBDEs, e.g. in the human adrenocortical carcinoma (H295R) cell line indicating that some OH-PBDEs can significantly influence steroidogenic enzymes like CYP19 (aromatase) and CYP17. In the present study, human placental microsomes have been used to study the possible interaction of twenty two OH-PBDEs and MeO-PBDEs with aromatase, the enzyme that mediates the conversion of androgens into estrogens. All OH-PBDE derivates showed significant inhibition of placental aromatase activity with IC(50) values in the low micromolar range, while the MeO-PBDEs did not have any effect on this enzyme activity. Enzyme kinetics studies indicated that two OH-PBDEs, 5-hydroxy-2,2',4,4'-tetrabromodiphenyl ether (5-OH-BDE47) and 6-hydroxy-2,2',4,4'-tetrabromodiphenyl ether (6-OH-BDE47), had a mixed-type inhibition of aromatase activity with apparent K(i)/K(i)' of 7.68/0,02 microM and 5.01/0.04 microM respectively. For comparison, some structurally related compounds, a dihydroxylated polybrominated biphenyl, which is a natural product (2,2'-dihyroxy-3,3',5,5'-tetrabromobiphenyl (2,2'-diOH-BB80)) and its non-bromo derivative were also included in the study. Again inhibition of aromatase activity could be measured, but their potency was significantly less than those observed for the OH-PBDEs. These results show that a
International Nuclear Information System (INIS)
Canton, Rocio F.; Scholten, Deborah E.A.; Marsh, Goeran; Jong, Paul C. de; Berg, Martin van den
2008-01-01
Polybrominated diphenyl ethers (PBDEs) are widely used as flame retardants in many different polymers, resins and substrates. Due to their widespread production and use, their high binding affinity to particles, and their lipophilic properties, several PBDE congeners can bioaccumulate in the environment. As a result, PBDEs and their hydroxylated metabolites (OH-PBDEs) have been detected in humans and various wildlife samples, such as birds, seals, and whales. Furthermore, certain OH-PBDEs and their methoxylated derivatives (MeO-PBDEs) are natural products in the marine environment. Recently, our laboratory focused on the possible effects on steroidogenesis of PBDEs and OH-PBDEs, e.g. in the human adrenocortical carcinoma (H295R) cell line indicating that some OH-PBDEs can significantly influence steroidogenic enzymes like CYP19 (aromatase) and CYP17. In the present study, human placental microsomes have been used to study the possible interaction of twenty two OH-PBDEs and MeO-PBDEs with aromatase, the enzyme that mediates the conversion of androgens into estrogens. All OH-PBDE derivates showed significant inhibition of placental aromatase activity with IC 50 values in the low micromolar range, while the MeO-PBDEs did not have any effect on this enzyme activity. Enzyme kinetics studies indicated that two OH-PBDEs, 5-hydroxy-2,2',4,4'-tetrabromodiphenyl ether (5-OH-BDE47) and 6-hydroxy-2,2',4,4'-tetrabromodiphenyl ether (6-OH-BDE47), had a mixed-type inhibition of aromatase activity with apparent K i /K i ' of 7.68/0,02 μM and 5.01/0.04 μM respectively. For comparison, some structurally related compounds, a dihydroxylated polybrominated biphenyl, which is a natural product (2,2'-dihyroxy-3,3',5,5'-tetrabromobiphenyl (2,2'-diOH-BB80)) and its non-bromo derivative were also included in the study. Again inhibition of aromatase activity could be measured, but their potency was significantly less than those observed for the OH-PBDEs. These results show that a wide
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Pharmacogenetics and aromatase inhibitor induced side effects in breast cancer patients.
Sini, Valentina; Botticelli, Andrea; Lunardi, Gianluigi; Gori, Stefania; Marchetti, Paolo
2017-06-01
This paper reviews genetic variations mainly related to the onset of adverse events during aromatase inhibitors in early breast cancer. Genetic variability could occur at different steps. The analysis included studies that involved breast cancer patients, treated with an aromatase inhibitor, genotyped for CYP19A1 and/or CYP17A1 and/or CYP27B1 and/or TCLA1, and/or RANK/RANKL/OPG and/or ESR1/ESR2, and assessed for toxicity profile. Twenty-two articles were included for the analysis. Three studies evaluated outcomes and adverse events; 19 studies assessed only side effects. Functional variations may be useful in predicting the onset of toxicities. The identification of polymorphisms at increased risk of toxicity may enable patient management. However, more data are needed to be applied in the individualization of treatment in daily practice.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
International Nuclear Information System (INIS)
Bryce, Jane; Bauer, Martina; Hadji, Peyman
2012-01-01
In order to reduce the risk of recurrence, adjuvant treatment with an aromatase inhibitor (AI) is recommended for postmenopausal women following surgery for hormone receptor-positive breast cancer. AIs are associated with improved disease-free survival compared with tamoxifen. The adverse events associated with AIs resemble those of menopause, such as bone density loss and musculoskeletal symptoms. We examine the case of a postmenopausal woman who was prescribed anastrozole, a nonsteroidal AI, as adjuvant therapy following surgery for estrogen and progesterone receptor-positive (ER and PgR+) breast cancer. A 58-year-old postmenopausal woman diagnosed with ER and PgR+ breast cancer was prescribed anastrozole as adjuvant therapy following a right-inferior quadrantectomy. After experiencing joint pain and stiffness, she was prescribed paracetamol and a topical nonsteroidal anti-inflammatory drug. She was also counseled on nonpharmacological interventions. However, she continued to experience symptoms, and reported that she was not taking anastrozole regularly. The case study patient ultimately found relief by switching to letrozole, another aromatase inhibitor. This approach is supported by recent studies examining the benefits of switching strategies between aromatase inhibitors in order to relieve symptoms of arthralgia/myalgia. Both adherence and strategies for managing aromatase inhibitor-associated arthralgia are key to deriving maximal clinical benefit from AI therapy. Switching from one aromatase inhibitor to another may provide a viable option in managing adverse events and enhancing adherence to medication
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Aromatase inhibitors in the treatment of deep endometriosis
Directory of Open Access Journals (Sweden)
Simone Ferrero
2009-09-01
Full Text Available Recent case reports and pilot studies suggested that aromatase inhibitors might be effective in treating pain symptoms related to the presence of endometriosis. We present the case of a 32-year-old woman who suffered dysmenorrhea, dyspareunia, chronic pelvic pain, and dyschezia caused by rectovaginal endometriosis. Pain symptoms recurred after treatment with the oral contraceptive pill; the patient refused surgery. Therefore a double-drug regimen including letrozole (2.5 mg/day and norethisterone acetate (2.5 mg/day was offered to the patient. The scheduled length of treatment was six months. This double-drug regimen determined a quick and significant improvement in all pain symptoms. During treatment, the patient complained mild arthralgia. After the interruption of treatment, pain symptoms quickly recurred and at 6-month follow-up their intensity was similar to baseline values. Operative laparoscopy was performed, the presence of rectovaginal endometriosis was confirmed and all visible endometriotic lesions were excised. Aromatase inhibitors might be offered when pain symptoms caused by endometriosis persist during the administration of other hormonal therapies and the patient refuses surgery. However, women must be informed that these drugs determine only a temporary relief of pain symptoms and might cause adverse effects (such as arthralgia.
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
Synthesis and PET studies of [(11)C-cyano]letrozole (Femara), an aromatase inhibitor drug.
Kil, Kun-Eek; Biegon, Anat; Ding, Yu-Shin; Fischer, Andre; Ferrieri, Richard A; Kim, Sung Won; Pareto, Deborah; Schueller, Michael J; Fowler, Joanna S
2009-02-01
Aromatase, a member of the cytochrome P450 family, converts androgens such as androstenedione and testosterone into estrone and estradiol, respectively. Letrozole (1-[bis-(4-cyanophenyl)methyl]-1H-1,2,4-triazole; Femara) is a high-affinity aromatase inhibitor (K(i)=11.5 nM) that has Food and Drug Administration approval for breast cancer treatment. Here we report the synthesis of carbon-11-labeled letrozole and its assessment as a radiotracer for brain aromatase in the baboon. Letrozole and its precursor (4-[(4-bromophenyl)-1H-1,2,4-triazol-1-ylmethyl]benzonitrile) were prepared in a two-step synthesis from 4-cyanobenzyl bromide and 4-bromobenzyl bromide, respectively. The [(11)C]cyano group was introduced via tetrakis(triphenylphosphine)palladium(0)-catalyzed coupling of [(11)C]cyanide with the bromo precursor. Positron emission tomography (PET) studies in the baboon brain were carried out to assess regional distribution and kinetics, reproducibility of repeated measures and saturability. Log D, the free fraction of letrozole in plasma and the [(11)C-cyano]letrozole fraction in arterial plasma were also measured. [(11)C-cyano]Letrozole was synthesized in 60 min with a radiochemical yield of 79-80%, with a radiochemical purity greater than 98% and a specific activity of 4.16+/-2.21 Ci/mumol at the end of bombardment (n=4). PET studies in the baboon revealed initial rapid and high uptake and initial rapid clearance, followed by slow clearance of carbon-11 from the brain, with no difference between brain regions. Brain kinetics was not affected by coinjection of unlabeled letrozole (0.1 mg/kg). The free fraction of letrozole in plasma was 48.9%, and log D was 1.84. [(11)C-cyano]Letrozole is readily synthesized via a palladium-catalyzed coupling reaction with [(11)C]cyanide. Although it is unsuitable as a PET radiotracer for brain aromatase, as revealed by the absence of regional specificity and saturability in brain regions such as amygdala, which are known to
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
DEFF Research Database (Denmark)
Lykkesfeldt, Anne E; Henriksen, Katrine L; Rasmussen, Birgitte B
2009-01-01
BACKGROUND: New, third-generation aromatase inhibitors (AIs) have proven comparable or superior to the anti-estrogen tamoxifen for treatment of estrogen receptor (ER) and/or progesterone receptor (PR) positive breast cancer. AIs suppress total body and intratumoral estrogen levels. It is unclear...... whether in situ carcinoma cell aromatization is the primary source of estrogen production for tumor growth and whether the aromatase expression is predictive of response to endocrine therapy. Due to methodological difficulties in the determination of the aromatase protein, COX-2, an enzyme involved...... of advanced breast cancer. Semi-quantitative immunohistochemical (IHC) analysis was performed for ER, PR, COX-2 and aromatase using Tissue Microarrays (TMAs). Aromatase was also analyzed using whole sections (WS). Kappa analysis was applied to compare association of protein expression levels. Univariate...
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
International Nuclear Information System (INIS)
Christman, G.M.; Randolph, J.F. Jr.; Peegel, H.; Menon, K.M.
1991-01-01
The objective of this study was to examine the in vitro responsiveness of cultured luteinized human granulosa cells over time to insulin-like growth factor 1 (IGF-1), human follicle-stimulating hormone (FSH), and human chorionic gonadotropin (hCG) for the induction of aromatase activity. Granulosa cells were retrieved from preovulatory follicles in patients undergoing in vitro fertilization. Cells were cultured for a period of 72 hours or 10 days. The ability of hCG, human FSH, and/or IGF-I to induce aromatase activity was assayed by the stereospecific release of tritium from [1B-3H]androstenedione. Short-term cultures (72 hours) demonstrated a marked rise in aromatase activity in response to human FSH and IGF-I, whereas a smaller response to hCG was observed. In contrast, 10-day cultures demonstrated responsiveness predominantly to hCG rather than human FSH for the induction of aromatase activity with no remarkable effect of IGF-I. Luteinized human granulosa cells undergo a transformation from an initial human FSH and IGF-I responsive state to an hCG responsive state in long-term cultures
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
Estrogens and male reproduction: a new concept
Directory of Open Access Journals (Sweden)
S. Carreau
2007-06-01
Full Text Available The mammalian testis serves two main functions: production of spermatozoa and synthesis of steroids; among them estrogens are the end products obtained from the irreversible transformation of androgens by a microsomal enzymatic complex named aromatase. The aromatase is encoded by a single gene (cyp19 in humans which contains 18 exons, 9 of them being translated. In rats, the aromatase activity is mainly located in Sertoli cells of immature rats and then in Leydig cells of adult rats. We have demonstrated that germ cells represent an important source of estrogens: the amount of P450arom transcript is 3-fold higher in pachytene spermatocytes compared to gonocytes or round spermatids; conversely, aromatase activity is more intense in haploid cells. Male germ cells of mice, bank voles, bears, and monkeys express aromatase. In humans, we have shown the presence of a biologically active aromatase and of estrogen receptors (alpha and ß in ejaculated spermatozoa and in immature germ cells in addition to Leydig cells. Moreover, we have demonstrated that the amount of P450arom transcripts is 30% lower in immotile than in motile spermatozoa. Alterations of spermatogenesis in terms of number and motility of spermatozoa have been described in men genetically deficient in aromatase. These last observations, together with our data showing a significant decrease of aromatase in immotile spermatozoa, suggest that aromatase could be involved in the acquisition of sperm motility. Thus, taking into account the widespread localization of aromatase and estrogen receptors in testicular cells, it is obvious that, besides gonadotrophins and androgens, estrogens produced locally should be considered to be physiologically relevant hormones involved in the regulation of spermatogenesis and spermiogenesis.
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
Organizing effects of sex steroids on brain aromatase activity in quail.
Directory of Open Access Journals (Sweden)
Charlotte A Cornil
2011-04-01
Full Text Available Preoptic/hypothalamic aromatase activity (AA is sexually differentiated in birds and mammals but the mechanisms controlling this sex difference remain unclear. We determined here (1 brain sites where AA is sexually differentiated and (2 whether this sex difference results from organizing effects of estrogens during ontogeny or activating effects of testosterone in adulthood. In the first experiment we measured AA in brain regions micropunched in adult male and female Japanese quail utilizing the novel strategy of basing the microdissections on the distribution of aromatase-immunoreactive cells. The largest sex difference was found in the medial bed nucleus of the stria terminalis (mBST followed by the medial preoptic nucleus (POM and the tuberal hypothalamic region. A second experiment tested the effect of embryonic treatments known to sex-reverse male copulatory behavior (i.e., estradiol benzoate [EB] or the aromatase inhibitor, Vorozole on brain AA in gonadectomized adult males and females chronically treated as adults with testosterone. Embryonic EB demasculinized male copulatory behavior, while vorozole blocked demasculinization of behavior in females as previously demonstrated in birds. Interestingly, these treatments did not affect a measure of appetitive sexual behavior. In parallel, embryonic vorozole increased, while EB decreased AA in pooled POM and mBST, but the same effect was observed in both sexes. Together, these data indicate that the early action of estrogens demasculinizes AA. However, this organizational action of estrogens on AA does not explain the behavioral sex difference in copulatory behavior since AA is similar in testosterone-treated males and females that were or were not exposed to embryonic treatments with estrogens.
Saitoh, M; Yanase, T; Morinaga, H; Tanabe, M; Mu, Y M; Nishi, Y; Nomura, M; Okabe, T; Goto, K; Takayanagi, R; Nawata, H
2001-11-23
The superimposition of male sex organs (penis and vas deferens) in a female gastropod, called imposex, is widely attributed to the exposure to tributyltin (TBT) compounds, used world-wide in antifouling paints for ships. It has been hypothesized that the TBT-induced imposex is mediated by an increasing androgen level relative to the estrogen level, namely a decreased conversion of androgens to estrogens (i.e., aromatization). In the present study, we tested this hypothesis by examining the effects of TBT or triphenyltin (TPT) on the aromatase activity in a cultured human granulosa-like tumor cell line, KGN, which was recently established by our group. Treatment with more than 1000 ng/ml TBT compounds was very toxic to the cells and caused immediate cell death within 24 h, while 200 ng/ml was found to cause apoptosis of the cells. Treatment of the KGN cells for more than 48 h with 20 ng/ml TBT or TPT, which is a concentration level reported to cause imposex in marine species, did not affect cell proliferation but significantly suppressed the aromatase activity determined by a [(3)H]H(2)O release assay. Treatment with 20 ng/ml TBT compounds for 7 days also resulted in a reduction of the E2 production from Delta 4-androstenedione stimulated by db-cAMP. The changes in the aromatase activity by TBT compounds were associated with comparable changes in P450arom mRNA assessed by RT-PCR. The luciferase activity of the P450arom promoter II (1 kb) decreased after the addition of 20 ng/ml TBT compounds in transfected KGN cells either in a basic state or in states stimulated by db-cAMP. The Ad4BP-dependent increase in the luciferase activity of P450arom promoter II was also downregulated by such treatments. These results indicate that TBT compounds inhibited the aromatase activity and also decreased the P450arom mRNA level at the transcriptional level in KGN cells. The direct inhibitory effect of TBT compounds on the aromatase activity may therefore partly explain the induction
Synthesis and PET studies of [{sup 11}C-cyano]letrozole (Femara), an aromatase inhibitor drug
Energy Technology Data Exchange (ETDEWEB)
Kil, Kun-Eek [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Department of Chemistry, Stony Brook University, Stony Brook, NY 11794 (United States); Biegon, Anat [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Ding, Yu-Shin [Department of Radiology, Yale University School of Medicine, New Haven, CT 06520-8048 (United States); Fischer, Andre [Johannes-Gutenberg Universitaet Mainz, Institut fuer Organische Chemie, 55128 Mainz (Germany); Ferrieri, Richard A.; Kim, Sung Won; Pareto, Deborah; Schueller, Michael J. [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Fowler, Joanna S. [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Department of Chemistry, Stony Brook University, Stony Brook, NY 11794 (United States)], E-mail: fowler@bnl.gov
2009-02-15
Introduction: Aromatase, a member of the cytochrome P450 family, converts androgens such as androstenedione and testosterone into estrone and estradiol, respectively. Letrozole (1-[bis-(4-cyanophenyl)methyl]-1H-1,2,4-triazole; Femara) is a high-affinity aromatase inhibitor (K{sub i}=11.5 nM) that has Food and Drug Administration approval for breast cancer treatment. Here we report the synthesis of carbon-11-labeled letrozole and its assessment as a radiotracer for brain aromatase in the baboon. Methods: Letrozole and its precursor (4-[(4-bromophenyl)-1H-1,2,4-triazol-1-ylmethyl]benzonitrile) were prepared in a two-step synthesis from 4-cyanobenzyl bromide and 4-bromobenzyl bromide, respectively. The [{sup 11}C]cyano group was introduced via tetrakis(triphenylphosphine)palladium(0)-catalyzed coupling of [{sup 11}C]cyanide with the bromo precursor. Positron emission tomography (PET) studies in the baboon brain were carried out to assess regional distribution and kinetics, reproducibility of repeated measures and saturability. Log D, the free fraction of letrozole in plasma and the [{sup 11}C-cyano]letrozole fraction in arterial plasma were also measured. Results: [{sup 11}C-cyano]Letrozole was synthesized in 60 min with a radiochemical yield of 79-80%, with a radiochemical purity greater than 98% and a specific activity of 4.16{+-}2.21 Ci/{mu}mol at the end of bombardment (n=4). PET studies in the baboon revealed initial rapid and high uptake and initial rapid clearance, followed by slow clearance of carbon-11 from the brain, with no difference between brain regions. Brain kinetics was not affected by coinjection of unlabeled letrozole (0.1 mg/kg). The free fraction of letrozole in plasma was 48.9%, and log D was 1.84. Conclusion: [{sup 11}C-cyano]Letrozole is readily synthesized via a palladium-catalyzed coupling reaction with [{sup 11}C]cyanide. Although it is unsuitable as a PET radiotracer for brain aromatase, as revealed by the absence of regional specificity
Synthesis and PET studies of [11C-cyano]letrozole (Femara®), an aromatase inhibitor drug
Kil, Kun-Eek; Biegon, Anat; Ding, Yu-Shin; Fischer, Andre; Ferrieri, Richard A.; Kim, Sung Won; Pareto, Deborah; Schueller, Michael J.; Fowler, Joanna S.
2011-01-01
Introduction Aromatase, a member of the cytochrome P450 family, converts androgens such as androstenedione and testosterone to estrone and estradiol respectively. Letrozole (1-[bis-(4-cyanophenyl)methyl]-1H-1,2,4-triazole, Femara®) is a high affinity aromatase inhibitor (Ki=11.5 nM) which has FDA approval for breast cancer treatment. Here we report the synthesis of carbon-11 labeled letrozole and its assessment as a radiotracer for brain aromatase in the baboon. Methods Letrozole and its precursor (4-[(4-bromophenyl)-1H-1,2,4-triazol-1-ylmethyl]benzonitrile, 3) were prepared in two-step syntheses from 4-cyanobenzyl bromide and 4-bromobenzyl bromide, respectively. The [11C]cyano group was introduced via the tetrakis(triphenylphosphine)palladium(0) catalyzed coupling of [11C]cyanide with the bromo-precursor (3). PET studies in the baboon brain were carried out to assess regional distribution and kinetics, reproducibility of repeated measures and saturability. The free fraction of letrozole in the plasma, log D, and the [11C-cyano]letrozole fraction in the arterial plasma were also measured. Results [11C-cyano]Letrozole was synthesized in 60 min with a radiochemical yield of 79–80%, with a radiochemical purity greater than 98% and a specific activity of 4.16±2.21 Ci/μmol at the end of bombardment (n=4). PET studies in the baboon revealed initial rapid and high uptake and initial rapid clearance followed by slow clearance of carbon-11 from the brain with no difference between brain regions. The brain kinetics was not affected by co-injection of unlabeled letrozole (0.1 mg/kg). The free fraction of letrozole in plasma was 48.9% and log D was 1.84. Conclusion [11C-cyano]Letrozole is readily synthesized via a palladium catalyzed coupling reaction with [11C]cyanide. Although it is unsuitable as a PET radiotracer for brain aromatase as revealed by the absence of regional specificity and saturability in brain regions, such as amygdala, which are known to contain
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Cornil, C A; Dalla, C; Papadopoulou-Daifoti, Z; Baillien, M; Dejace, C; Ball, G F; Balthazart, J
2005-09-01
In Japanese quail, as in rats, the expression of male sexual behavior over relatively long time periods (days to weeks) is dependent on the local production of estradiol in the preoptic area via the aromatization of testosterone. On a short-term basis (minutes to hours), central actions of dopamine as well as locally produced estrogens modulate behavioral expression. In rats, a view of and sexual interaction with a female increase dopamine release in the preoptic area. In quail, in vitro brain aromatase activity (AA) is rapidly modulated by calcium-dependent phosphorylations that are likely to occur in vivo as a result of changes in neurotransmitter activity. Furthermore, an acute estradiol injection rapidly stimulates copulation in quail, whereas a single injection of the aromatase inhibitor vorozole rapidly inhibits this behavior. We hypothesized that brain aromatase and dopaminergic activities are regulated in quail in association with the expression of male sexual behavior. Visual access as well as sexual interactions with a female produced a significant decrease in brain AA, which was maximal after 5 min. This expression of sexual behavior also resulted in a significant decrease in dopaminergic as well as serotonergic activity after 1 min, which returned to basal levels after 5 min. These results demonstrate for the first time that AA is rapidly modulated in vivo in parallel with changes in dopamine activity. Sexual interactions with the female decreased aromatase and dopamine activities. These data challenge established views about the causal relationships among dopamine, estrogen action, and male sexual behavior.
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
The ovine sexually dimorphic nucleus, aromatase, and sexual partner preferences in sheep.
Roselli, C E; Stormshak, F
2010-02-28
We are using the domestic ram as an experimental model to examine the role of aromatase in the development of sexual partner preferences. This interest has arisen because of the observation that as many as 8% of domestic rams are sexually attracted to other rams (male-oriented) in contrast to the majority of rams that are attracted to estrous ewes (female-oriented). Our findings demonstrate that aromatase expression is enriched in a cluster of neurons in the medial preoptic nucleus called the ovine sexually dimorphic nucleus (oSDN). The size of the oSDN is associated with a ram's sexual partner preference, such that the nucleus is 2-3 times larger in rams that are attracted to females (female-oriented) than in rams that are attracted to other rams (male-oriented). Moreover, the volume of the oSDN in male-oriented rams is similar to the volume in ewes. These volume differences are not influenced by adult concentrations of serum testosterone. Instead, we found that the oSDN is already present in late gestation lamb fetuses (approximately day 135 of gestation) when it is approximately 2-fold greater in males than in females. Exposure of genetic female fetuses to exogenous testosterone during the critical period for sexual differentiation masculinizes oSDN volume and aromatase expression when examined subsequently on day 135. The demonstration that the oSDN is organized prenatally by testosterone exposure suggests that the brain of the male-oriented ram may be under-androgenized during development. Copyright 2009 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Energy Technology Data Exchange (ETDEWEB)
Hinfray, N., E-mail: nathalie.hinfray@ineris.fr [INERIS, Unité d' écotoxicologie in vitro et in vivo , Verneuil-en-Halatte (France); Tebby, C. [INERIS, Unité Modèles pour l' Ecotoxicologie et la Toxicologie, Verneuil-en-Halatte (France); Garoche, C.; Piccini, B. [INERIS, Unité d' écotoxicologie in vitro et in vivo , Verneuil-en-Halatte (France); Bourgine, G. [IRSET, équipe NEED, Université de Rennes 1, Rennes (France); Aït-Aïssa, S. [INERIS, Unité d' écotoxicologie in vitro et in vivo , Verneuil-en-Halatte (France); Kah, O. [IRSET, équipe NEED, Université de Rennes 1, Rennes (France); Pakdel, F. [IRSET, Inserm U1085, équipe TREC, Université de Rennes 1, Rennes (France); Brion, F. [INERIS, Unité d' écotoxicologie in vitro et in vivo , Verneuil-en-Halatte (France)
2016-09-15
Estrogens and progestins are widely used in combination in human medicine and both are present in aquatic environment. Despite the joint exposure of aquatic wildlife to estrogens and progestins, very little information is available on their combined effects. In the present study we investigated the effect of ethinylestradiol (EE2) and Levonorgestrel (LNG), alone and in mixtures, on the expression of the brain specific ER-regulated cyp19a1b gene. For that purpose, recently established zebrafish-derived tools were used: (i) an in vitro transient reporter gene assay in a human glial cell line (U251-MG) co-transfected with zebrafish estrogen receptors (zfERs) and the luciferase gene under the control of the zebrafish cyp19a1b gene promoter and (ii) an in vivo bioassay using a transgenic zebrafish expressing GFP under the control of the zebrafish cyp19a1b gene promoter (cyp19a1b-GFP). Concentration-response relationships for single chemicals were modeled and used to design the mixture experiments following a ray design. The results from mixture experiments were analyzed to predict joint effects according to concentration addition and statistical approaches were used to characterize the potential interactions between the components of the mixtures (synergism/antagonism). We confirmed that some progestins could elicit estrogenic effects in fish brain. In mixtures, EE2 and LNG exerted additive estrogenic effects both in vitro and in vivo, suggesting that some environmental progestin could exert effects that will add to those of environmental (xeno-)estrogens. Moreover, our zebrafish specific assays are valuable tools that could be used in risk assessment for both single chemicals and their mixtures. - Highlights: • Combined effects of EE2 and LNG were assessed on ER-dependent cyp19a1b expression. • EE2 and LNG alone induced brain aromatase in zebrafish specific bioassays. • Experimental ray design allowed complete concentration-response surfaces modeling. • EE2 and
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Stanić, Davor; Dubois, Sydney; Chua, Hui Kheng; Tonge, Bruce; Rinehart, Nicole; Horne, Malcolm K.; Boon, Wah Chin
2014-01-01
Aromatase catalyses the last step of oestrogen synthesis. There is growing evidence that local oestrogens influence many brain regions to modulate brain development and behaviour. We examined, by immunohistochemistry, the expression of aromatase in the adult male and female mouse brain, using mice in which enhanced green fluorescent protein (EGFP) is transcribed following the physiological activation of the Cyp19A1 gene. EGFP-immunoreactive processes were distributed in many brain regions, including the bed nucleus of the stria terminalis, olfactory tubercle, medial amygdaloid nucleus and medial preoptic area, with the densest distributions of EGFP-positive cell bodies in the bed nucleus and medial amygdala. Differences between male and female mice were apparent, with the density of EGFP-positive cell bodies and fibres being lower in some brain regions of female mice, including the bed nucleus and medial amygdala. EGFP-positive cell bodies in the bed nucleus, lateral septum, medial amygdala and hypothalamus co-expressed oestrogen receptor (ER) α and β, or the androgen receptor (AR), although single-labelled EGFP-positive cells were also identified. Additionally, single-labelled ERα−, ERβ- or AR-positive cell bodies often appeared to be surrounded by EGFP-immunoreactive nerve fibres/terminals. The widespread distribution of EGFP-positive cell bodies and fibres suggests that aromatase signalling is common in the mouse brain, and that locally synthesised brain oestrogens could mediate biological effects by activating pre- and post-synaptic oestrogen α and β receptors, and androgen receptors. The higher number of EGFP-positive cells in male mice may indicate that the autocrine and paracrine effects of oestrogens are more prominent in males than females. PMID:24646567
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Cell-Based High-Throughput Screening for Aromatase Inhibitors in the Tox21 10K Library.
Chen, Shiuan; Hsieh, Jui-Hua; Huang, Ruili; Sakamuru, Srilatha; Hsin, Li-Yu; Xia, Menghang; Shockley, Keith R; Auerbach, Scott; Kanaya, Noriko; Lu, Hannah; Svoboda, Daniel; Witt, Kristine L; Merrick, B Alex; Teng, Christina T; Tice, Raymond R
2015-10-01
Multiple mechanisms exist for endocrine disruption; one nonreceptor-mediated mechanism is via effects on aromatase, an enzyme critical for maintaining the normal in vivo balance of androgens and estrogens. We adapted the AroER tri-screen 96-well assay to 1536-well format to identify potential aromatase inhibitors (AIs) in the U.S. Tox21 10K compound library. In this assay, screening with compound alone identifies estrogen receptor alpha (ERα) agonists, screening in the presence of testosterone (T) identifies AIs and/or ERα antagonists, and screening in the presence of 17β-estradiol (E2) identifies ERα antagonists. Screening the Tox-21 library in the presence of T resulted in finding 302 potential AIs. These compounds, along with 31 known AI actives and inactives, were rescreened using all 3 assay formats. Of the 333 compounds tested, 113 (34%; 63 actives, 50 marginal actives) were considered to be potential AIs independent of cytotoxicity and ER antagonism activity. Structure-activity analysis suggested the presence of both conventional (eg, 1, 2, 4, - triazole class) and novel AI structures. Due to their novel structures, 14 of the 63 potential AI actives, including both drugs and fungicides, were selected for confirmation in the biochemical tritiated water-release aromatase assay. Ten compounds were active in the assay; the remaining 4 were only active in high-throughput screen assay, but with low efficacy. To further characterize these 10 novel AIs, we investigated their binding characteristics. The AroER tri-screen, in high-throughput format, accurately and efficiently identified chemicals in a large and diverse chemical library that selectively interact with aromatase. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Interaction of Zinc Chloride with an Aromatase Inhibitor (Letrozole on Anxiety in Adult Male Rats
Directory of Open Access Journals (Sweden)
Sahar Charghan
2016-12-01
Full Text Available Abstract Background: Aromatase is an enzyme converts androstenedione and testosterone to estrone and estradiol, respectively. According to the role of testosterone and zinc in reducing anxiety and the relation between androgenic system function and zinc supplementations, in this research, the effect of zinc chloride injection was analysed in rats which aromatase enzyme was inhibited by aromatase inhibitor (letrozole. Materials and Methods: Adult male Wistar rats (weighing 225±25 g were used. Animals were divided into 12 groups and based on their weight, aromatase inhibitor (letrozole was injected (subcutaneously, and 30 minutes later, ZnCl2 or its solvent (saline was injected intra-peritoneal. Control group was received both solvents (DMSO and saline respectively. Anxiety levels were tested in the elevated plus maze 30 minutes after the last injection, and thereafter, open field was used for measurement of the locomotors activity of animals. Results: The results showed a significant decrease in the percentage of time spent in open arms in letrozole (1.25 mg/kg treated group as compared to that of solvent group. The locomotors activity significantly decreased between letrozole (1.25 mg/kg with the control group. The combined groups received letrozole (2.5 mg/kg and different amounts of zinc chloride (2.5, 5, 10 mg/kg, significantly reduced (p<0.05 the percentage of time spent in the open arm, comparing to the control group. Groups that received the combination of zinc chloride (2.5 mg/kg and different amounts of letrozole (1.25, 5, 10 mg/kg, showed no significant difference in the percentage of entry and time spent in the open arms. Conclusion: Totally, the present study suggests that letrozole alone increased anxiety and decreased locomotors activity and could interfere with anxiolytic effect of ZnCl2 as well.
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Paulo, Thais R S de; Winters-Stone, Kerri M; Viezel, Juliana; Rossi, Fabricio E; Aro, Bruna L; Trindade, Ana Carolina A C; Codogno, Jamile S; Freitas Junior, Ismael F
2018-04-12
The aim of this study was to explore whether postmenopausal breast cancer survivors undergoing aromatase inhibitor therapy differ from healthy postmenopausal women in their response to the same aerobic + resistance training. The participants were separated into two groups: postmenopausal breast cancer survivors undergoing aromatase inhibitor therapy for an average of 20 months (18 women) and healthy postmenopausal women (24 women). We assessed aerobic capacity (predicted maximum oxygen uptake (VO 2 max) and maximum running velocity test (Vmax)) through a walking test, upper and lower body muscle strength using an estimated one-repetition maximum test, and body composition by dual-energy X-ray absorptiometry at baseline and at three, six, and nine months, respectively. The exercise program was performed three times/week over nine months and consisted of 40 min of machine-based strength training (seated cable row, bench press, leg extension, leg press, and leg curl, as well as bridge, abdominal, and standard plank exercises) followed by 30 min of treadmill walking. Analysis of variance (ANOVA) with repeated measures was used to compare the groups over time. Postmenopausal breast cancer survivors undergoing aromatase inhibitor therapy and healthy postmenopausal women presented similar improvements in estimated lower body strength, predicted VO 2max and V max , and body fat mass. For maximal upper body strength, there was a significant group x time interaction after six months of training (p = 0.01). The healthy postmenopausal women presented a significant increase in upper body strength after six months, while postmenopausal breast cancer survivors undergoing aromatase inhibitor therapy demonstrated an improvement only at nine months of training. The breast cancer survivors undergoing aromatase inhibitor therapy presented increased lean mass while healthy postmenopausal women maintained values over time (Breast cancer: 33.7 ± 3.9(Pre) vs. 34.1
Berstein, Lev; Maximov, Sergei; Gershfeld, Eduard; Meshkova, Irina; Gamajunova, Vera; Tsyrlina, Evgenia; Larionov, Alexei; Kovalevskij, Anatolii; Vasilyev, Dmitry
2002-11-15
To investigate the short-term hormonal and clinical effects of the aromatase inhibitor letrozole (Femara) in patients with endometrial cancer. Ten previously untreated, post-menopausal patients (mean age 59 years) with endometrial cancer, predominantly stage I disease, received letrozole 2.5mg per day for 14 days before surgery. Clinical, sonographic, morphologic, cytologic, and hormonal-metabolic parameters (blood estradiol, follicle-stimulating hormone (FSH), luteinizing hormone (LH), glucose, and cholesterol by radioimmunoassay, enzyme immune assay, or enzyme-colorimetric methods; tumor progesterone receptors by ligand-binding assay; and aromatase activity by 3H-water release assay) were evaluated before and after treatment. Treatment was well-tolerated in all patients. In two patients, pain relief in the lower part of the belly and/or decrease in intensity of uterine discharge was reported. In the three cases, substantial decreases in endometrial M-echo (ultrasound) signal were noted; the mean value of this parameter after treatment was 31.1% lower than before treatment. Blood estradiol concentration decreased by an average of 37.8% after letrozole therapy, and tumor progesterone receptor levels and aromatase activity decreased by 34.4 and 17.5%, respectively. Treatment with letrozole did not influence surgery. These data show that short-term treatment with letrozole in the neoadjuvant setting resulted in some positive clinical changes. Longer-term and larger-scale trials of neoadjuvant letrozole in endometrial cancer are warranted.
Potential role of aromatase inhibitors in the treatment of endometriosis
Directory of Open Access Journals (Sweden)
Abu Hashim H
2014-07-01
Full Text Available Hatem Abu HashimDepartment of Obstetrics and Gynecology, Faculty of Medicine, Mansoura University, Mansoura, EgyptAbstract: Endometriosis is an estrogen-dependent chronic inflammatory disease affecting 5%–10% of reproductive-age women, with a prevalence of 5%–50% in infertile women and >33% of women with chronic pelvic pain. Third-generation aromatase inhibitors (AIs are approved adjuvants for the treatment of estrogen receptor-positive breast cancer. Molecular studies have revealed the presence of aromatase P450, the key enzyme in the biosynthesis of ovarian estradiol, inside the endometriotic tissue, indicating local synthesis of estradiol. Thereby, AIs represent an appealing medical option for the management of different aspects of this enigmatic disease, especially pelvic pain and infertility. Accordingly, this review aims to evaluate the potential role of AIs in the treatment of endometriosis-associated symptoms, mainly pain and infertility. Notably, several studies have demonstrated that the combination of AIs with conventional therapy as oral contraceptive pills, progestins, or gonadotropin-releasing hormone analogs can be used to control endometriosis-associated pain and pain recurrence in premenopausal women, particularly those with pain due to rectovaginal endometriosis refractory to other medical or surgical treatment. Some case reports have shown promising results in the treatment of postmenopausal endometriosis as first-line treatment, when surgery is contraindicated, or as second-line treatment in the case of postoperative recurrence. Third-generation AIs, especially letrozole, have challenged clomiphene citrate as an ovulation-induction agent in patients with polycystic ovary syndrome and in cases of unexplained infertility. However, few studies are available regarding the use of AIs to treat endometriosis-associated infertility. Therefore, larger multicenter randomized trials using AIs for the treatment of endometriosis
Neural stem cell sex dimorphism in aromatase (CYP19 expression: a basis for differential neural fate
Directory of Open Access Journals (Sweden)
Jay Waldron
2010-11-01
Full Text Available Jay Waldron1, Althea McCourty1, Laurent Lecanu1,21The Research Institute of the McGill University Health Centre, Montreal, Canada; 2Department of Medicine, McGill University, Quebec, CanadaPurpose: Neural stem cell (NSC transplantation and pharmacologic activation of endogenous neurogenesis are two approaches that trigger a great deal of interest as brain repair strategies. However, the success rate of clinical attempts using stem cells to restore neurologic functions altered either after traumatic brain injury or as a consequence of neurodegenerative disease remains rather disappointing. This suggests that factors affecting the fate of grafted NSCs are largely understudied and remain to be characterized. We recently reported that aging differentially affects the neurogenic properties of male and female NSCs. Although the sex steroids androgens and estrogens participate in the regulation of neurogenesis, to our knowledge, research on how gender-based differences affect the capacity of NSCs to differentiate and condition their neural fate is lacking. In the present study, we explored further the role of cell sex as a determining factor of the neural fate followed by differentiating NSCs and its relationship with a potential differential expression of aromatase (CYP19, the testosterone-metabolizing enzyme.Results: Using NSCs isolated from the subventricular zone of three-month-old male and female Long-Evans rats and maintained as neurospheres, we showed that differentiation triggered by retinoic acid resulted in a neural phenotype that depends on cell sex. Differentiated male NSCs mainly expressed markers of neuronal fate, including ßIII-tubulin, microtubule associated protein 2, growth-associated protein 43, and doublecortin. In contrast, female NSCs essentially expressed the astrocyte marker glial fibrillary acidic protein. Quantification of the expression of aromatase showed a very low level of expression in undifferentiated female NSCs
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Shin, J-I; Lim, H-Y; Kim, H-W; Seung, B-J; Ju, J-H; Sur, J-H
2016-07-01
This study was designed to investigate the role of obesity in canine malignant mammary tumours (CMMTs), by assessing aromatase expression and the regulatory roles of immune mediators such as cyclo-oxygenase-2 (COX2), prostaglandin E2 (PGE2), nuclear factor kappa beta (NF-κB), hypoxia inducible factor-1α (HIF-1α) and adipokines (i.e. leptin) in lean, optimal body weight, overweight and obese animals. Clinicopathological data, including the breed, body weight, body condition score and age and neutering status, were collected, together with histopathological characteristics (i.e. histological types, grading and lymphatic invasion). To determine the expression of each factor, immunohistochemistry was conducted with 60 samples of malignant CMMTs. CMMTs from overweight and obese animals had significantly elevated levels of PGE2, and aromatase expression correlated significantly with PGE2, NF-κB and leptin expression. However, no significant difference was observed in terms of histopathological characteristics. The results suggest that PGE2, a known obesity-related immune mediator, could be upregulated in CMMTs from overweight and obese animals. In addition, PGE2, NF-κB and leptin influenced the expression of aromatase, as observed in women. Copyright © 2016 Elsevier Ltd. All rights reserved.
Balthazart, Jacques; Baillien, Michelle; Ball, Gregory F
2002-05-01
In male quail, like in other vertebrates including rodents, testosterone acting especially through its estrogenic metabolites is necessary for the activation of male sexual behavior. Also, the administration of dopamine agonists and antagonists profoundly influences male sexual behavior. How the steroid-sensitive neural network and dopamine interact physiologically, remains largely unknown. It is often implicitly assumed that testosterone or its metabolite estradiol, stimulates male sexual behavior via the modification of dopaminergic transmission. We have now identified in quail two possible ways in which dopamine could potentially affect sexual behavior by modulating the aromatization of testosterone into an estrogen. One is a long-acting mechanism that presumably involves the modification of dopaminergic transmission followed by the alteration of the genomic expression of aromatase. The other is a more rapid mechanism that does not appear to be dopamine receptor-mediated and may involve a direct interaction of dopamine with aromatase (possibly via substrate competition). We review here the experimental data supporting the existence of these controls of aromatase activity by dopamine and discuss the possible contribution of these controls to the activation of male sexual behavior.
Dalla, C; Antoniou, K; Papadopoulou-Daifoti, Z; Balthazart, J; Bakker, J
2005-09-08
It is well known that estradiol derived from neural aromatization of testosterone plays a crucial role in the development of the male brain and the display of sexual behaviors in adulthood. It was recently found that male aromatase knockout mice (ArKO) deficient in estradiol due to a mutation in the aromatase gene have general deficits in coital behavior and are sexually less motivated. We wondered whether these behavioral deficits of ArKO males could be related to changes in activity, exploration, anxiety and "depressive-like" symptomatology. ArKO and wild type (WT) males were subjected to open field (OF), elevated plus maze (EPM), and forced swim tests (FST), after being exposed or not to chronic mild stress (CMS). CMS was used to evaluate the impact of chronic stressful procedures and to unveil possible differences between genotypes. There was no effect of genotype on OF, EPM and FST behavioral parameters. WT and ArKO mice exposed to CMS or not exhibited the same behavioral profile during these three types of tests. However, all CMS-exposed mice (ArKO and WT) spent less time in the center of the EPM. Additionally, floating duration measured in the FST increased between two tests in both WT and ArKO mice, though that increase was less prominent in mice previously subjected to CMS than in controls. Therefore, both ArKO and WT males displayed the same behavior and had the same response to CMS however CMS exposure slightly modified the behavior displayed by mice of both genotypes in the FST and EPM paradigms. These results show that ArKO males display normal levels of activity, exploration, anxiety and "depressive-like" symptomatology and thus their deficits in sexual behavior are specific in nature and do not result indirectly from other behavioral changes.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
International Nuclear Information System (INIS)
Kim, Sung Won; Biegon, Anat; Katsamanis, Zachary E.; Ehrlich, Carolin W.; Hooker, Jacob M.; Shea, Colleen; Muench, Lisa; Xu Youwen; King, Payton; Carter, Pauline; Alexoff, David L.; Fowler, Joanna S.
2009-01-01
Introduction: We reinvestigated the synthesis of [N-methyl- 11 C]vorozole, a radiotracer for aromatase, and discovered the presence of an N-methyl isomer which was not removed in the original purification method. Herein we report the preparation and positron emission tomography (PET) studies of pure [N-methyl- 11 C]vorozole. Methods: Norvorozole was alkylated with [ 11 C]methyl iodide as previously described and also with unlabeled methyl iodide. A high-performance liquid chromatography (HPLC) method was developed to separate the regioisomers. Nuclear magnetic resonance (NMR) spectroscopy ( 13 C and 2D-nuclear Overhauser effect spectroscopy NMR) was used to identify and assign structures to the N-methylated products. Pure [N-methyl- 11 C]vorozole and the contaminating isomer were compared by PET imaging in the baboon. Results: Methylation of norvorozole resulted in a mixture of isomers (1:1:1 ratio) based on new HPLC analysis using a pentafluorophenylpropyl bonded silica column, in which vorozole coeluted one of its isomers under the original HPLC conditions. Baseline separation of the three labeled isomers was achieved. The N-3 isomer was the contaminant of vorozole, thus correcting the original assignment of isomers. PET studies of pure [N-methyl- 11 C]vorozole with and without the contaminating N-3 isomer revealed that only [N-methyl- 11 C]vorozole binds to aromatase. [N-methyl- 11 C]Vorozole accumulated in all brain regions with highest accumulation in the aromatase-rich amygdala and preoptic area. Accumulation was blocked with vorozole and letrozole consistent with reports of some level of aromatase in many brain regions. Conclusions: The discovery of a contaminating labeled isomer and the development of a method for isolating pure [N-methyl- 11 C]vorozole combine to provide a new scientific tool for PET studies of the biology of aromatase and for drug research and development.
Akther, Shirin; Huang, Zhiqi; Liang, Mingkun; Zhong, Jing; Fakhrul, Azam A K M; Yuhi, Teruko; Lopatina, Olga; Salmina, Alla B; Yokoyama, Shigeru; Higashida, Chiharu; Tsuji, Takahiro; Matsuo, Mie; Higashida, Haruhiro
2015-01-01
Parental behaviors involve complex social recognition and memory processes and interactive behavior with children that can greatly facilitate healthy human family life. Fathers play a substantial role in child care in a small but significant number of mammals, including humans. However, the brain mechanism that controls male parental behavior is much less understood than that controlling female parental behavior. Fathers of non-monogamous laboratory ICR mice are an interesting model for examining the factors that influence paternal responsiveness because sires can exhibit maternal-like parental care (retrieval of pups) when separated from their pups along with their pairmates because of olfactory and auditory signals from the dams. Here we tested whether paternal behavior is related to femininity by the aromatization of testosterone. For this purpose, we measured the immunoreactivity of aromatase [cytochrome P450 family 19 (CYP19)], which synthesizes estrogen from androgen, in nine brain regions of the sire. We observed higher levels of aromatase expression in these areas of the sire brain when they engaged in communicative interactions with dams in separate cages. Interestingly, the number of nuclei with aromatase immunoreactivity in sires left together with maternal mates in the home cage after pup-removing was significantly larger than that in sires housed with a whole family. The capacity of sires to retrieve pups was increased following a period of 5 days spent with the pups as a whole family after parturition, whereas the acquisition of this ability was suppressed in sires treated daily with an aromatase inhibitor. The results demonstrate that the dam significantly stimulates aromatase in the male brain and that the presence of the pups has an inhibitory effect on this increase. These results also suggest that brain aromatization regulates the initiation, development, and maintenance of paternal behavior in the ICR male mice.
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Alli Straubhar
2017-08-01
Full Text Available Introduction: Young women with endometrial intraepithelial hyperplasia or low-grade endometrial carcinoma are potential candidates for conservative fertility sparing therapy utilizing progesterone rather than hysterectomy. High-dose progesterone treatment is associated with 55–80% initial response but high relapse rates. Using aromatase inhibitors in conjunction with high-dose progesterone has largely been unstudied. Case descriptions: Three obese premenopausal women with endometrial cancer failed to respond to oral or intrauterine progesterone as first line therapy. Due to their desire to continue to pursue fertility sparing treatment options, an aromatase inhibitor was added to their treatment regimen. This resulted in resolution of their malignancy in each case. Discussion: In obese premenopausal women, the mechanism of malignant transformation in endometrial carcinoma is considered to be an association with relatively high levels of serum estrogen from peripheral conversion of androgens to estrone in adipose tissue with a deficiency in progesterone exposure due to chronic anovulation. Using aromatase inhibitors seems reasonable as an adjunct to progesterone given the high likelihood that this population has a significant proportion of their estrogen production coming from peripheral conversion in adipose tissue. This case series is unique in that each woman initially failed to respond to progesterone but had resolution when an aromatase inhibitor was added to their treatment regimen. This would suggest that obese women with low grade malignancy or hyperplasia who have no radiographic evidence of deep myometrial invasion, ovarian or retroperitoneal metastases and who wish to retain their fertility may be treated with intrauterine progesterone and an aromatase inhibitor.
Gupta, Ranju; Jindal, Dharam Paul; Jit, Birinder; Narang, Gaurav; Palusczak, Anja; Hartmann, Rolf W
2004-07-01
A novel dimer of 2-(4-pyridylmethyl)-1-indanone (2) was obtained while carrying out aldol condensation of 1-indanone with pyridine-4-carboxaldehyde in potassium hydroxide. The structure of dimer 3 has been established using various spectral techniques and was screened for its ability to inhibit the cytochrome P(450) enzyme aromatase. The dimer showed strong inhibition of human placental aromatase and was found 3 times more potent (RP = 3, IC(50) = 10.2 microM) as compared to aminoglutethimide (RP = 1, IC(50) = 18.5 microM.
Energy Technology Data Exchange (ETDEWEB)
Guo, Jiajia [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); Yuan, Yun [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); School of Life Science and Engineering, Southwest University of Science and Technology, Mianyang (China); Lu, Danfeng; Du, Baowen [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); Xiong, Liang; Shi, Jiangong [State Key Laboratory of Bioactive Substance and Function of Natural Medicines, Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Yang, Lijuan [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); Liu, Wanli [MOE Key Laboratory of Protein Science, School of Life Sciences, Tsinghua University, Beijing 100084 (China); Yuan, Xiaohong [School of Life Science and Engineering, Southwest University of Science and Technology, Mianyang (China); Zhang, Guolin, E-mail: zhanggl@cib.ac.cn [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); Chinese Academy of Sciences Sichuan Translational Medicine Research Hospital, Chengdu (China); Wang, Fei, E-mail: wangfei@cib.ac.cn [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu (China); Chinese Academy of Sciences Sichuan Translational Medicine Research Hospital, Chengdu (China)
2014-08-15
Aromatase is the only enzyme in vertebrates to catalyze the biosynthesis of estrogens. Although inhibitors of aromatase have been developed for the treatment of estrogen-dependent breast cancer, the whole-body inhibition of aromatase causes severe adverse effects. Thus, tissue-selective aromatase inhibitors are important for the treatment of estrogen-dependent cancers. In this study, 63 natural products with diverse structures were examined for their effects on estrogen biosynthesis in human ovarian granulosa-like KGN cells. Two compounds—trans-phytol (SA-20) and (22E)-ergosta-6,9,22-triene-3β,5α,8α-triol (SA-48)—were found to potently inhibit estrogen biosynthesis (IC{sub 50}: 1 μM and 0.5 μM, respectively). Both compounds decreased aromatase mRNA and protein expression levels in KGN cells, but had no effect on the aromatase catalytic activity in aromatase-overexpressing HEK293A cells and recombinant expressed aromatase. The two compounds decreased the expression of aromatase promoter I.3/II. Neither compound affected intracellular cyclic AMP (cAMP) levels, but they inhibited the phosphorylation or protein expression of cAMP response element-binding protein (CREB). The effects of these two compounds on extracellular regulated kinase (ERK), c-Jun N-terminal kinase (JNK), p38 mitogen-activated protein kinases (MAPKs), and AKT/phosphoinositide 3-kinase (PI3K) pathway were examined. Inhibition of p38 MAPK could be the mechanism underpinning the actions of these compounds. Our results suggests that natural products structurally similar to SA-20 and SA-48 may be a new source of tissue-selective aromatase modulators, and that p38 MAPK is important in the basal control of aromatase in ovarian granulosa cells. SA-20 and SA-48 warrant further investigation as new pharmaceutical tools for the prevention and treatment of estrogen-dependent cancers. - Highlights: • Two natural products inhibited estrogen biosynthesis in human ovarian granulosa cells. • They
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Balthazart, J; Foidart, A; Absil, P; Harada, N
1996-01-01
The enzyme aromatase converts testosterone (T) into 17 beta-estradiol and plays a pivotal role in the control of reproduction. In particular, the aromatase activity (AA) located in the preoptic area (POA) of male Japanese quail is a limiting step in the activation by T of copulatory behavior. Aromatase-immunoreactive (ARO-ir) cells of the POA are specifically localized within the cytoarchitectonic boundaries of the medial preoptic nucleus(POM), a sexually dimorphic and steroid-sensitive structure that is a necessary and sufficient site of steroid action in the activation of behavior. Stereotaxic implantation of aromatase inhibitors in but not around the POM strongly decreases the behavioral effects of a systemic treatment with T of castrated males. AA is decreased by castration and increased by aromatizable androgens and by estrogens. These changes have been independently documented at three levels of analysis: the enzymatic activity measured by radioenzymatic assays in vitro, the enzyme concentration evaluated semi-quantitatively by immunocytochemistry and the concentration of its messenger RNA quantified by reverse transcription-polymerase chain reaction (RT-PCR). These studies demonstrate that T acting mostly through its estrogenic metabolites regulates brain aromatase by acting essentially at the transcriptional level. Estrogens produced by central aromatization of T therefore have two independent roles: they activate male copulatory behavior and they regulate the synthesis of aromatase. Double label immunocytochemical studies demonstrate that estrogen receptors(ER) are found in all brain areas containing ARO-ir cells but the extent to which these markers are colocalized varies from one brain region to the other. More than 70% of ARO-ir cells contain detectable ER in the tuberal hypothalamus but less than 20% of the cells display this colocalization in the POA. This absence of ER in ARO-ir cells is also observed in the POA of the rat brain. This suggests that
Directory of Open Access Journals (Sweden)
Laia Navarro-Martín
2011-12-01
Full Text Available Sex ratio shifts in response to temperature are common in fish and reptiles. However, the mechanism linking temperature during early development and sex ratios has remained elusive. We show in the European sea bass (sb, a fish in which temperature effects on sex ratios are maximal before the gonads form, that juvenile males have double the DNA methylation levels of females in the promoter of gonadal aromatase (cyp19a, the enzyme that converts androgens into estrogens. Exposure to high temperature increased the cyp19a promoter methylation levels of females, indicating that induced-masculinization involves DNA methylation-mediated control of aromatase gene expression, with an observed inverse relationship between methylation levels and expression. Although different CpGs within the sb cyp19a promoter exhibited different sensitivity to temperature, we show that the increased methylation of the sb cyp19a promoter, which occurs in the gonads but not in the brain, is not a generalized effect of temperature. Importantly, these effects were also observed in sexually undifferentiated fish and were not altered by estrogen treatment. Thus, methylation of the sb cyp19a promoter is the cause of the lower expression of cyp19a in temperature-masculinized fish. In vitro, induced methylation of the sb cyp19a promoter suppressed the ability of SF-1 and Foxl2 to stimulate transcription. Finally, a CpG differentially methylated by temperature and adjacent to a Sox transcription factor binding site is conserved across species. Thus, DNA methylation of the aromatase promoter may be an essential component of the long-sought-after mechanism connecting environmental temperature and sex ratios in vertebrate species with temperature-dependent sex determination.
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Directory of Open Access Journals (Sweden)
Galih Satrio Putra
2017-08-01
Full Text Available The development of anticancer drugs from ethyl p-methoxycinnamate (EPMC derivatives continues to obtain compounds that have high ability of cancer cells apoptosis and minimal side effects. p-Methoxycinnamoyl hydrazide derivate compounds from EPMC structure modification were docked into the ligand-binding pocket of Check point kinase 1 enzymes (2YWP and the aromatase enzyme (3S7S using software Molegro Virtual Docker (MVD Ver.5.5. We compared the Rerank score of native ligand with derivate compounds of p-Methoxycinnamoyl hydrazide. Rerank scores of compounds 4b and 4c (-99.98 Kcal/mol and -99.80 Kcal/mol were lower than the native ligand A42 in inhibiting the enzyme checkpoint kinase 1. Rerank values of p-Methoxycinnamoyl hydrazide derivate compounds were greater than the native ligand EXM in inhibiting the enzyme aromatase. p-Methoxycinnamoyl hydrazide derivate compounds, especially compounds 4b and 4c, had anticancer mechanism by inhibiting the enzyme pathway checkpoint kinase 1 and had not activity in inhibiting the aromatase enzyme.
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
Gene-gene and gene-environment interactions in prostate, breast and colorectal cancer
DEFF Research Database (Denmark)
Kopp, Tine Iskov
The incidence of cancer in the western world has increased steeply during the last 50 years. For three of the most prevalent cancer types in Denmark, prostate, breast and colorectal cancer (PC, BC and CRC, respectively), only a small fraction (1-15%) of the incidences are caused by highly penetrant...... in alcohol-related BC in postmenopausal women involving a specific polymorphism in PPARG (coding the peroxisome proliferatoractivated receptor (PPARγ)) and its interaction with the aromatase (encoded by CYP19A1) was investigated (Paper V-VI). The Danish prospective “Diet, Cancer and Health” cohort study...... as having strong influence on carcinogenesis. Therefore, very frequent, low effect polymorphisms may have a greater contribution on a population level in combination with environmental factors. Indeed, several dietary and life style factors are now well-established risk factors for different cancer types...
Energy Technology Data Exchange (ETDEWEB)
Kim, Sung Won [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States)], E-mail: swkim@bnl.gov; Biegon, Anat; Katsamanis, Zachary E. [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Ehrlich, Carolin W. [Johannes-Gutenberg Universitaet Mainz, Institut fuer Organische Chemie, Duesbergweg 10-14, Mainz (Germany); Hooker, Jacob M.; Shea, Colleen [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Muench, Lisa [National Institute on Alcoholism and Alcohol Abuse, Bethesda, MD (United States); Xu Youwen; King, Payton; Carter, Pauline; Alexoff, David L. [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Fowler, Joanna S. [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Department of Psychiatry, Mount Sinai School of Medicine, New York, NY (United States); Department of Chemistry, State University of New York at Stony Brook, Stony Brook, NY (United States)
2009-04-15
Introduction: We reinvestigated the synthesis of [N-methyl-{sup 11}C]vorozole, a radiotracer for aromatase, and discovered the presence of an N-methyl isomer which was not removed in the original purification method. Herein we report the preparation and positron emission tomography (PET) studies of pure [N-methyl-{sup 11}C]vorozole. Methods: Norvorozole was alkylated with [{sup 11}C]methyl iodide as previously described and also with unlabeled methyl iodide. A high-performance liquid chromatography (HPLC) method was developed to separate the regioisomers. Nuclear magnetic resonance (NMR) spectroscopy ({sup 13}C and 2D-nuclear Overhauser effect spectroscopy NMR) was used to identify and assign structures to the N-methylated products. Pure [N-methyl-{sup 11}C]vorozole and the contaminating isomer were compared by PET imaging in the baboon. Results: Methylation of norvorozole resulted in a mixture of isomers (1:1:1 ratio) based on new HPLC analysis using a pentafluorophenylpropyl bonded silica column, in which vorozole coeluted one of its isomers under the original HPLC conditions. Baseline separation of the three labeled isomers was achieved. The N-3 isomer was the contaminant of vorozole, thus correcting the original assignment of isomers. PET studies of pure [N-methyl-{sup 11}C]vorozole with and without the contaminating N-3 isomer revealed that only [N-methyl-{sup 11}C]vorozole binds to aromatase. [N-methyl-{sup 11}C]Vorozole accumulated in all brain regions with highest accumulation in the aromatase-rich amygdala and preoptic area. Accumulation was blocked with vorozole and letrozole consistent with reports of some level of aromatase in many brain regions. Conclusions: The discovery of a contaminating labeled isomer and the development of a method for isolating pure [N-methyl-{sup 11}C]vorozole combine to provide a new scientific tool for PET studies of the biology of aromatase and for drug research and development.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Xing, Lei; Esau, Crystal; Trudeau, Vance L.
2016-01-01
Aromatase cytochrome P450arom (cyp19) is the only enzyme that has the ability to convert androgens into estrogens. Estrogens, which are produced locally in the vertebrate brain play many fundamental roles in neuroendocrine functions, reproductive functions, socio-sexual behaviors, and neurogenesis. Radial glial cells (RGCs) are neuronal progenitor cells that are abundant in fish brains and are the exclusive site of aromatase B expression and neuroestrogen synthesis. Using a novel in vitro RGC...
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Maliqueo, Manuel; Benrick, Anna; Marcondes, Rodrigo Rodrigues; Johansson, Julia; Sun, Miao; Stener-Victorin, Elisabet
2017-01-01
What is the central question of this study? The effectiveness of low-frequency electroacupuncture in the treatment of metabolic disorders associated with polycystic ovary syndrome (PCOS), an endocrine-metabolic disorder characterized by an imbalance in sex steroid production, is controversial. What is the main finding and its importance? In a rat model of PCOS induced by the inhibition of P450 aromatase, low-frequency electroacupuncture increased low-density lipoprotein-cholesterol but did not improve the insulin resistance or the adipose tissue dysfunction, suggesting that a balance of sex steroids is needed to restore the metabolic function in this rat model of PCOS. Low-frequency electroacupuncture restores sex steroid synthesis and sympathetic activity in women with polycystic ovary syndrome, which may ameliorate its metabolic disturbances, probably by modulating sympathetic nerve activity or sex steroid synthesis. We investigated whether low-frequency electroacupuncture regulates the metabolic function to the same extent as treatment with estradiol or β-adrenergic blocking in a rat model of polycystic ovary syndrome induced by a P450 aromatase inhibitor (letrozole). Letrozole (200 μg day -1 ) or placebo pellets were implanted in prepubertal Wistar rats. Six weeks thereafter, rats were treated for 5-6 weeks with the following: low-frequency electroacupuncture (5 days per week); a β-adrenergic blocker (propranolol hydrochloride, 0.1 mg kg -1 , 5 days per week); or 17β-estradiol (2.0 μg) every fourth day. Body weight development, body composition, locomotor activity, insulin sensitivity, tissue-specific glucose uptake, lipid profile, adipocyte size, serum concentrations of adiponectin and insulin, and gene expression in inguinal fat were measured. All treatments increased circulating levels of low-density lipoprotein-cholesterol. Estradiol treatment restored locomotor activity and increased insulin sensitivity but did not modify the glucose uptake in
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Advani, Pragati; Brewster, Abenaa M; Baum, George P; Schover, Leslie R
2017-08-01
A randomized pilot trial evaluated the hypothesis that early intervention lessens sexual dysfunction in the first year on aromatase inhibitors. A secondary aim was comparing the efficacy of two vaginal moisturizers. Fifty-seven postmenopausal women with early stage breast cancer starting aromatase inhibitors were randomized to three treatment groups. All received a handout on managing sexual and other side effects. The Usual Care group received no additional therapy. The Active Treatment groups received a 6-month supply of a vaginal moisturizer (hyaluronic acid-based in Active Group-H and prebiotic in Active Group-P) and a vaginal lubricant and dilator, plus access to an educational website and phone coaching. Questionnaires completed at baseline, 6, and 12 months included the Female Sexual Function Index (FSFI), Menopausal Sexual Interest Questionnaire (MSIQ), Female Sexual Distress Scale-Revised (FSDS-R), and a menopausal symptom scale. Forty-nine women (86%) provided follow-up data. Mean age was 59 and 77% were non-Hispanic Caucasian. Sexual function was impaired at baseline, but remained stable over 12 months for all groups. The combined active treatment group had less dyspareunia (P = 0.07) and sexual distress (P = 0.02) at 6 months than the Usual Care group. At 6 months, the Active-H group improved significantly more than the Active-P group on FSFI total score (P = 0.04). Sexual counseling helped women maintain stable sexual function on aromatase inhibitors. Active intervention resulted in better outcomes at 6 months. This promising pilot trial suggests a need for more research on preventive counseling to maintain sexual function during aromatase inhibitor treatment.
Galeazzi, Roberta; Massaccesi, Luca
2012-03-01
CYP450 aromatase catalyzes the terminal and rate-determining step in estrogen synthesis, the aromatization of androgens, and its inhibition is an efficient approach to treating estrogen-dependent breast cancer. Insight into the molecular basis of the interaction at the catalytic site between CYP450 aromatase inhibitors and the enzyme itself is required in order to design new and more active compounds. Hence, a combined molecular docking-molecular dynamics study was carried out to obtain the structure of the lowest energy association complexes of aromatase with some third-generation aromatase inhibitors (AIs) and with other novel synthesized letrozole-derived compounds which showed high in vitro activity. The results obtained clearly demonstrate the role of the pharmacophore groups present in the azaheterocyclic inhibitors (NSAIs)-namely the triazolic ring and highly functionalized aromatic moieties carrying H-bond donor or acceptor groups. In particular, it was pointed out that all of them can contribute to inhibition activity by interacting with residues of the catalytic cleft, but the amino acids involved are different for each compound, even if they belong to the same class. Furthermore, the azaheterocyclic group strongly coordinates with the Fe(II) of heme cysteinate in the most active NSAI complexes, while it prefers to adopt another orientation in less active ones.
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Fadrozole inhibits aromatase (CYP19A), a key enzyme that converts testosterone to estradiol (E2). In fish, E2 concentrations control hepatic synthesis ofthe glycolipoprotein vitellogenin (VTG), an egg yolk precursor protein essential to oocyte development and larval survival. Whe...
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Directory of Open Access Journals (Sweden)
Stanisław Fracki
2005-02-01
Full Text Available Klinefelter's syndrome (47, XXY is the most common chromosome aneuploidy in men and is usually characterized by underdeveloped testes and sterility. The aim of the present study was to detect cellular distribution of androgen receptors (AR and aromatase in testes of patient with KS. The tissue sections were processed for morphological and immunohistochemical staining. Additionally, levels of FSH, LH, PRL, estradiol, and testosterone were measured in the plasma. Morphological analysis revealed a complete absence of spermatogenesis. No germ cells were present in seminiferous tubules. In some tubules, nests of apparently degenerating Sertoli cells were found. In the interstitium, Leydig cell hyperplasia was observed. Using immunohistochemistry, nuclear AR staining was detected in Sertoli cells and peritubular cells, whereas in Leydig cells the staining was exclusively cytoplasmic. The immunostaining of aromatase was detected in the cytoplasm of Sertoli cells and Leydig cells. Increased levels of gonadotropins and decreased level of testosterone concomitantly with the cytoplasmic localization of AR in Leydig cells might contribute to the impaired testicular function in patient with KS.
Barbesino, G; Tomer, Y; Concepcion, E S; Davies, T F; Greenberg, D A
1998-09-01
Hashimoto's thyroiditis (HT) and Graves' disease (GD) are autoimmune thyroid diseases (AITD) in which multiple genetic factors are suspected to play an important role. Until now, only a few minor risk factors for these diseases have been identified. Susceptibility seems to be stronger in women, pointing toward a possible role for genes related to sex steroid action or mechanisms related to genes on the X-chromosome. We have studied a total of 45 multiplex families, each containing at least 2 members affected with either GD (55 patients) or HT (72 patients), and used linkage analysis to target as candidate susceptibility loci genes involved in estrogen activity, such as the estrogen receptor alpha and beta and the aromatase genes. We then screened the entire X-chromosome using a set of polymorphic microsatellite markers spanning the whole chromosome. We found a region of the X-chromosome (Xq21.33-22) giving positive logarithm of odds (LOD) scores and then reanalyzed this area with dense markers in a multipoint analysis. Our results excluded linkage to the estrogen receptor alpha and aromatase genes when either the patients with GD only, those with HT only, or those with any AITD were considered as affected. Linkage to the estrogen receptor beta could not be totally ruled out, partly due to incomplete mapping information for the gene itself at this time. The X-chromosome data revealed consistently positive LOD scores (maximum of 1.88 for marker DXS8020 and GD patients) when either definition of affectedness was considered. Analysis of the family data using a multipoint analysis with eight closely linked markers generated LOD scores suggestive of linkage to GD in a chromosomal area (Xq21.33-22) extending for about 6 cM and encompassing four markers. The maximum LOD score (2.5) occurred at DXS8020. In conclusion, we ruled out a major role for estrogen receptor alpha and the aromatase genes in the genetic predisposition to AITD. Estrogen receptor beta remains a
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
DEFF Research Database (Denmark)
Jacobsen, Naja Wessel; Hansen, Cecilie Hurup; Nellemann, Christine
2015-01-01
shown to inhibit the aromatase enzyme in both types of aromatase assays. The IC50 values ranged from 3 to 600μM. All five SSRIs, were further investigated in the H295R cell line. All compounds altered the steroid secretion from the cells, the lowest observed effect levels were 0.9μM and 3.1μ....... In this study we investigated whether the endocrine effect due to SSRI exposure could be detected in well adopted in vitro steroidogenesis assays, two versions of the aromatase enzyme inhibition assay and the H295R cell assay. The five drugs citalopram, fluoxetine, fluvoxamine, paroxetine and sertraline, were......M for sertraline and fluvoxamine, respectively. In general the H295R cell assay was more sensitive to SSRI exposure than the two aromatase assays, up to 20 times more sensitive. This indicates that the H295R cell line is a better tool for screening endocrine disrupting effects. Our findings show that the endocrine...
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Rhen, T; Metzger, K; Schroeder, A; Woodward, R
2007-01-01
Modes of sex determination are quite variable in vertebrates. The developmental decision to form a testis or an ovary can be influenced by one gene, several genes, environmental variables, or a combination of these factors. Nevertheless, certain morphogenetic aspects of sex determination appear to be conserved in amniotes. Here we clone fragments of nine candidate sex-determining genes from the snapping turtle Chelydra serpentina, a species with temperature-dependent sex determination (TSD). We then analyze expression of these genes during the thermosensitive period of gonad development. In particular, we compare gene expression profiles in gonads from embryos incubated at a male-producing temperature to those from embryos at a female-producing temperature. Expression of Dmrt1 and Sox9 mRNA increased gradually at the male-producing temperature, but was suppressed at the female-producing temperature. This finding suggests that Dmrt1 and Sox9 play a role in testis development. In contrast, expression of aromatase, androgen receptor (Ar), and Foxl2 mRNA was constant at the male-producing temperature, but increased several-fold in embryos at the female-producing temperature. Aromatase, Ar, and Foxl2 may therefore play a role in ovary development. In addition, there was a small temperature effect on ER alpha expression with lower mRNA levels found in embryos at the female-producing temperature. Finally, Dax1, Fgf9, and SF-1 were not differentially expressed during the sex-determining period, suggesting these genes are not involved in sex determination in the snapping turtle. Comparison of gene expression profiles among amniotes indicates that Dmrt1 and Sox9 are part of a core testis-determining pathway and that Ar, aromatase, ER alpha, and Foxl2 are part of a core ovary-determining pathway. 2007 S. Karger AG, Basel
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap
2002-04-15
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.
Directory of Open Access Journals (Sweden)
Hongle Xu
Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.
Evidence for an Elevated Aspartate pKa in the Active Site of Human Aromatase*
Di Nardo, Giovanna; Breitner, Maximilian; Bandino, Andrea; Ghosh, Debashis; Jennings, Gareth K.; Hackett, John C.; Gilardi, Gianfranco
2015-01-01
Aromatase (CYP19A1), the enzyme that converts androgens to estrogens, is of significant mechanistic and therapeutic interest. Crystal structures and computational studies of this enzyme shed light on the critical role of Asp309 in substrate binding and catalysis. These studies predicted an elevated pKa for Asp309 and proposed that protonation of this residue was required for function. In this study, UV-visible absorption, circular dichroism, resonance Raman spectroscopy, and enzyme kinetics were used to study the impact of pH on aromatase structure and androstenedione binding. Spectroscopic studies demonstrate that androstenedione binding is pH-dependent, whereas, in contrast, the D309N mutant retains its ability to bind to androstenedione across the entire pH range studied. Neither pH nor mutation perturbed the secondary structure or heme environment. The origin of the observed pH dependence was further narrowed to the protonation equilibria of Asp309 with a parallel set of spectroscopic studies using exemestane and anastrozole. Because exemestane interacts with Asp309 based on its co-crystal structure with the enzyme, its binding is pH-dependent. Aromatase binding to anastrozole is pH-independent, consistent with the hypothesis that this ligand exploits a distinct set of interactions in the active site. In summary, we assign the apparent pKa of 8.2 observed for androstenedione binding to the side chain of Asp309. To our knowledge, this work represents the first experimental assignment of a pKa value to a residue in a cytochrome P450. This value is in agreement with theoretical calculations (7.7–8.1) despite the reliance of the computational methods on the conformational snapshots provided by crystal structures. PMID:25425647
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
DEFF Research Database (Denmark)
Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H
2012-01-01
OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Quantitative (q)AOP for aromatase inhibition as case study to advance qAOP development practices
Here we describe how “read across” of a quantitative adverse outcome pathway (qAOP) developed with data for one chemical can be used to screen impacts of other chemicals. We developed a qAOP starting with inhibition of CYP19A (aromatase) in fathead minnows (FHM) as th...
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.
Laboratory experiments were conducted with the marine fish cunner (Tautogolabrus adspersus) to evaluate whether four pharmaceuticals used in breast cancer treatment have an impact on reproduction or aromatase activity. Tamoxifen binds to estrogen receptors, while anastrozole, let...
Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.
Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang
2012-02-01
In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István
2016-07-01
A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
DEFF Research Database (Denmark)
Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M
2017-01-01
these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...
Yonezawa, Tomohiro; Higashi, Mayuko; Yoshioka, Kazuki; Mutoh, Ken-ichiro
2011-07-01
The baculum, also called os penis, plays an important role during copulation. However, the hormonal regulation of its development remains to be elucidated. To determine the direct involvement of sex steroids in the development of the baculum of rats, the distributions of androgen receptors (ARs), aromatase, and estrogen receptor alpha (ESR1) were observed immunohistochemically. On Postnatal Day 1, the rudiment of the baculum expressed ARs, aromatase, and ESR1. In the proximal segment of the baculum of neonatal rats, ARs were expressed in the parosteal layer but not in the periosteum or osteoblasts. Aromatase was expressed from the parosteal layer to the endosteum, particularly in the inner osteogenic layer. ESR1 was also abundantly expressed in almost all cells from the parosteal layer to the endosteum. ARs, aromatase, and ESR1 were all abundantly expressed during the neonatal period in the hyaline cartilage of the proximal segment and in fibrocartilage of the distal segment of the baculum. Expression in all the tissues was attenuated in an age-dependent manner and became quite weak at puberty. To determine the effect of estrogen on the growth of the baculum, the aromatase inhibitor 1,4,6-androstatrien-3,17-dione (ATD) was subcutaneously injected daily into pregnant rats from Days 19 to 23 of gestation and into pups on postnatal Days 1, 3, 5, 7, and 9. On Day 10, the length of the baculum in the ATD-treated rats was significantly shorter than that in the controls, although the body weight did not change. These findings suggest that not only androgen but also locally aromatized estrogen is involved in the early growth and development of the baculum.
DEFF Research Database (Denmark)
Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.
2002-01-01
The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...
Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA
2012-06-19
Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-01-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing
2002-07-01
Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.
Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine
2011-01-01
Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.
Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis
Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon
2013-01-01
The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
DEFF Research Database (Denmark)
Huebner, K; Kastury, K; Druck, T
1994-01-01
"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...
Directory of Open Access Journals (Sweden)
Viviana Di Rosa
Full Text Available Fish present daily and seasonal rhythms in spawning and plasmatic levels of steroids that control reproduction. However, the existence of the rhythms of expression of the genes that underlie the endocrine mechanisms responsible for processes such as steroidogenesis and reproduction in fish have still been poorly explored to date. Here we investigated the daily pattern of the expression of key genes involved in sex steroid production that ultimately set the sex ratio in fish. Adult zebrafish were maintained under a 12:12 h light-dark cycle at a constant temperature of 27°C and were sampled every 4 h during a 24-hour cycle. The expression of key genes in the gonads and brains of female and male individuals were analyzed. In gonads, the expression of aromatase (cyp19a1a, ovarian aromatase and the antimüllerian hormone (amh, testis was rhythmic, with almost opposite acrophases: ZT 5:13 h (in the light phase and ZT 15:39 h (at night, respectively. The expression of foxl2 (forkhead box L2 was also rhythmic in the ovary (acrophase located at ZT 5:02 h and the expression of dmrt1 (doublesex and mab-3-related transcription factor 1 was rhythmic in testes (acrophase at ZT 18:36 h. In the brain, cyp19a1b (brain aromatase and cyp11b (11beta-hydroxylase presented daily differences, especially in males, where the expression peaked at night. These results provide the first evidence for marked time-of-the-day-dependent differences in the expression of the genes involved in sex ratio control, which should be considered when investigating processes such as reproduction, sex differentiation and steroidogenesis in fish.
Keebaugh, Alaine C; Thomas, James W
2010-06-01
Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.
Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A
2014-12-13
The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.
Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.
Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A
1993-09-15
Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.
Aromatase inhibitors in stimulated IVF cycles
Directory of Open Access Journals (Sweden)
Tournaye Herman
2011-06-01
Full Text Available Abstract Aromatase inhibitors have been introduced as a new treatment modality that could challenge clomiphene citrate as an ovulation induction regiment in patients with PCOS. Although several randomized trials have been conducted regarding their use as ovulation induction agents, only few trials are available regarding their efficacy in IVF stimulated cycles. Current available evidence support that letrozole may have a promising role in stimulated IVF cycles, either when administered during the follicular phase for ovarian stimulation. Especially for women with poor ovarian response, letrozole appears to have the potential to increase clinical pregnancy rates when combined with gonadotropins, whereas at the same time reduces the total gonadotropin dose required for ovarian stimulation. However, given that in all of the trials letrozole has been administered in GnRH antagonist cycles, it is intriguing to test in the future how it may perform when used in GnRH agonist cycles. Finally administration of letrozole during luteal phase in IVF cycles offers another treatment modality for patients at high risk for OHSS taking into account that it drastically reduces estradiol levels
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G
2014-08-28
The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.
Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang
2014-03-01
The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C
1994-02-01
We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
Directory of Open Access Journals (Sweden)
Maia R
2012-04-01
Full Text Available Hugo Maia Jr1,2, Clarice Haddad1, Julio Casoy1, Rebeca Maia1, Nathanael Pinheiro3, Elsimar M Coutinho11Centro de Pesquisa e Assistência em Reprodução Humana (CEPARH, 2Itaigara Memorial Day Hospital, 3IMAGEPAT, Salvador, Bahia, BrazilObjective: To investigate the effect of a levonorgestrel-releasing intrauterine system (Mirena® on aromatase and cyclooxygenase-2 (Cox-2 expression in the endometrium of patients with adenomyosis who were submitted to endometrial resection at the time of insertion, compared to a group not submitted to endometrial resection and a group of controls with adenomyosis not submitted to any previous hormonal treatment.Patients and methods: Patients with adenomyosis (n = 89 were included in this study. Twenty-two patients had been using Mirena® for 5 years but had not been submitted to endometrial resection prior to insertion of the device. Twenty-four patients were submitted to endometrial resection at the time of Mirena® insertion. The remaining 43 patients with adenomyosis had undergone no previous hormonal treatment and served as a control group. Cox-2 and aromatase expression were determined in the endometrium by immunohistochemistry.Results: Use of Mirena® for 5 years reduced aromatase expression in the endometrium; however, this reduction was significantly greater in the uteri previously submitted to endometrial resection. The reduction in Cox-2 expression was significant only in the uteri submitted to endometrial resection followed by the insertion of Mirena®.Conclusion: Endometrial resection followed by the insertion of Mirena® was associated with greater rates of amenorrhea in patients with adenomyosis, which in turn were associated with a more effective inhibition of aromatase and Cox-2 expression in the endometrium.Keywords: aromatase, Mirena®, adenomyosis, Cox-2, endometrium, levonorgestrel
Grimm, Frauke; Dobler, Nadine; Dahl, Christiane
2010-03-01
Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.
Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas
2013-09-01
GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.
Directory of Open Access Journals (Sweden)
Mohsen Heidary
2017-03-01
Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Directory of Open Access Journals (Sweden)
Mishra Mukti N
2010-07-01
Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)
Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi
2013-03-01
Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).
Karube, M.; Fernandino, J.I.; Strobl-Mazzulla, P.; Strussmann, C.A.; Yoshizaki, G.; Somoza, G.M.; Patino, R.
2007-01-01
Cytochrome P450 aromatase (cyp19) is an enzyme that catalyzes the conversion of androgens to estrogens and may play a role in temperature- dependent sex determination (TSD) of reptiles, amphibians, and fishes. In this study, the ovarian P450 aromatase form (cyp19A1) of pejerrey Odontesthes bonariensis, a teleost with marked TSD, was cloned and its expression profile evaluated during gonadal differentiation at feminizing (17??C, 100% females), mixed-sex producing (24 and 25??C, 73.3 and 26.7% females, respectively), and masculinizing (29??C, 0% females) temperatures. The deduced cyp19A1 amino acid sequence shared high identity (>77.8%) with that from other teleosts but had low identity (<61.8%) with brain forms (cyp19A2), including that of pejerrey itself. The tissue distribution analysis of cyp19A1 mRNA in adult fish revealed high expression in the ovary. Semi-quantitative reverse transcription polymerase chain reaction analysis of the bodies of larvae revealed that cyp19A1 expression increased before the appearance of the first histological signs of ovarian differentiation at the feminizing temperature but remained low at the masculinizing temperature. The expression levels at mixed-sex producing temperatures were bimodal rather than intermediate, showing low and high modal values similar to those at the feminizing and masculinizing temperatures, respectively. The population percentages of high and low expression levels at intermediate temperatures were proportional to the percentage of females and males, respectively, and high levels were first observed at about the time of sex differentiation of females. These results suggest that cyp19A1 is involved in the process of ovarian formation and possibly also in the TSD of pejerrey. ?? 2007 Wiley-Liss, Inc.
Scorpio, A; Zhang, Y
1996-06-01
Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.
Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...
Meijer, Thijs; Essers, Martien L; Kaklamanos, George; Sterk, Saskia S; van Ginkel, Leendert A
2017-04-01
Selective estrogen receptor modulators (SERMs), anti-estrogens and aromatase inhibitors are prohibited in human sports doping. However, they also present a risk of being used illegally in animal husbandry for fattening purposes. A method was developed and validated using UHPLC-MS/MS for the determination and confirmation of SERMs, anti-estrogens and aromatase inhibiters in bovine and porcine urine. This method was used in a survey of more than 200 bovine and porcine urine samples from Dutch farms. In 18 out of 103 porcine urine samples (17%) and two out of 114 bovine samples (2%) formestane, an aromatase inhibitor, was detected. None of the other compounds was detected. From human doping control it is known that formestane can, in some cases, be of natural origin. Analyses of reference samples from untreated bovine and porcine animals demonstrated the presence of formestane in bovine animals, but not yet in porcine animals. Future research will focus on whether the detected formestane in porcine and bovine urine is from endogenous or exogenous origin, using GC-c-IRMS.
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu
2014-01-01
In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial
Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B
2012-08-01
The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
DEFF Research Database (Denmark)
Kümler, Iben; Knoop, Ann S; Jessing, Christina A R
2016-01-01
. However, overall survival was not significantly increased. CONCLUSION: Conventional treatment with an aromatase inhibitor or fulvestrant may be an adequate treatment option for most patients with hormone receptor-positive advanced breast cancer. Mammalian target of rapamycin (mTOR) inhibition and cyclin...
Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.
2003-01-01
The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
Directory of Open Access Journals (Sweden)
Sandro Roselli
Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of
Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter
2017-09-01
Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.
DEFF Research Database (Denmark)
Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven
2017-01-01
The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...
Directory of Open Access Journals (Sweden)
Wang Yu
2011-04-01
Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15
Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang
2011-04-06
In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and
Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua
2017-01-01
Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-06-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.
Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.
A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,
Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B
1995-09-01
Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.
Directory of Open Access Journals (Sweden)
E.A Valizadeh
2011-02-01
Full Text Available During the development of chick embryo, the genotype of the zygote determines the nature of the gonads, which thereafter creates the male or female phenotype. Differentiation of gonads during the period called “critical period for sexual differentiation “is accompanied with beginning of secretion of sexual hormones. Every change in the rate of steroidal hormones concentration during this critical period, affects on the structure of gonads. Therefore, injection of aromatase inhibitors (which blocks the synthesis of estrogen from testostron in 5th day of incubation into the eggs, causes the production of males with female genotype. These sex reversal females have bilateral testes with complete spermatogenesis, having normal physical appearance and behavior. In this study, 14-α-hydroxy 3,6,17, androstan-trion inhibitor (1mg/egg was injected into the eggs. Furthermore, the effect of three anti-estrogens (which blocks the estrogen receptor Tamoxifen, and Clomiphen Citrate and GAR79 were studied. Injection of aromatase inhibitors into the eggs during incubation period caused statistically significant (p
Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.
Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe
2016-11-15
Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide
Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie
2010-01-01
Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558
Directory of Open Access Journals (Sweden)
Shirin eAkther
2015-12-01
Full Text Available Parental behaviors involve complex social recognition and memory processes and interactive behavior with children that can greatly facilitate healthy human family life. Fathers play a substantial role in child care in a small but significant number of mammals, including humans. However, the brain mechanism that controls male parental behavior is much less understood than that controlling female parental behavior. Fathers of non-monogamous laboratory ICR mice are an interesting model for examining the factors that influence paternal responsiveness because sires can exhibit maternal-like parental care (retrieval of pups when separated from their pups along with their pairmates because of olfactory and auditory signals from the dams. Here we tested whether paternal behavior is related to femininity by the aromatization of testosterone. For this purpose, we measured the immunoreactivity of aromatase (cytochrome P450 family 19 (CYP19, which synthesizes estrogen from androgen, in nine brain regions of the sire. We observed higher levels of aromatase expression in these areas of the sire brain when they engaged in communicative interactions with dams in separate cages. The capacity of sires to retrieve pups was increased following a period of five days spent with the pups as a whole family after parturition, whereas the acquisition of this ability was suppressed in sires treated daily with an aromatase inhibitor. These results suggest that brain aromatization regulates the initiation, development, and maintenance of paternal behavior in the ICR mice.
Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael
2009-08-01
Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.
ENGEL, H; KAZEMIER, B; KECK, W
The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or
Energy Technology Data Exchange (ETDEWEB)
Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))
1988-11-01
The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.
Kristiansen, W; Andreassen, K E; Karlsson, R; Aschim, E L; Bremnes, R M; Dahl, O; Fosså, S D; Klepp, O; Langberg, C W; Solberg, A; Tretli, S; Adami, H-O; Wiklund, F; Grotmol, T; Haugen, T B
2012-05-01
Testicular germ cell tumour (TGCT) is the most common cancer in young men, and an imbalance between the estrogen and androgen levels in utero is hypothesized to influence TGCT risk. Thus, polymorphisms in genes involved in the action of sex hormones may contribute to variability in an individual's susceptibility to TGCT. We conducted a Norwegian-Swedish case-parent study. A total of 105 single-nucleotide polymorphisms (SNPs) in 20 sex hormone pathway genes were genotyped using Sequenom MassArray iPLEX Gold, in 831 complete triads and 474 dyads. To increase the statistical power, the analysis was expanded to include 712 case singletons and 3922 Swedish controls, thus including triads, dyads and the case-control samples in a single test for association. Analysis for allelic associations was performed with the UNPHASED program, using a likelihood-based association test for nuclear families with missing data, and odds ratios (ORs) and 95% confidence intervals (CIs) were calculated. False discovery rate (FDR) was used to adjust for multiple testing. Five genetic variants across the ESR2 gene [encoding estrogen receptor beta (ERβ)] were statistically significantly associated with the risk of TGCT. In the case-parent analysis, the markers rs12434245 and rs10137185 were associated with a reduced risk of TGCT (OR = 0.66 and 0.72, respectively; both FDRs <5%), whereas rs2978381 and rs12435857 were associated with an increased risk of TGCT (OR = 1.21 and 1.19, respectively; both FDRs <5%). In the combined case-parent/case-control analysis, rs12435857 and rs10146204 were associated with an increased risk of TGCT (OR = 1.15 and 1.13, respectively; both FDRs <5%), whereas rs10137185 was associated with a reduced risk of TGCT (OR = 0.79, FDR <5%). In addition, we found that three genetic variants in CYP19A1 (encoding aromatase) were statistically significantly associated with the risk of TGCT in the case-parent analysis. The T alleles of the rs2414099, rs8025374 and rs3751592
DEFF Research Database (Denmark)
Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels
particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...
DEFF Research Database (Denmark)
Rosenkilde, M M; Waldhoer, M; Lüttichau, H R
2001-01-01
expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
Musculoskeletal Adverse Events Associated with Adjuvant Aromatase Inhibitors
Directory of Open Access Journals (Sweden)
Qamar J. Khan
2010-01-01
Full Text Available Musculoskeletal symptoms including arthralgia and myalgia occur frequently in aging women, particularly during the transition to menopause, when plasma estrogens precipitously decline. In postmenopausal women (PMW with breast cancer, third-generation aromatase inhibitors (AIs as adjuvant hormonal therapy have proven to be more effective, and to have a more predictable side effect profile, than tamoxifen. However, AIs further reduce plasma estrogens in PMW, exacerbating musculoskeletal symptoms. Clinical trial data have shown significantly higher incidences of arthralgia and myalgia with AIs compared with women on tamoxifen or placebo. Symptoms may be severe enough to significantly affect quality of life; musculoskeletal symptoms are a frequent reason for discontinuing therapy. In many cases, symptoms can be effectively managed with oral analgesics or other strategies. Early recognition and effective management of musculoskeletal symptoms can help maximize treatment compliance, enabling patients to derive optimal benefit from therapy in terms of preventing recurrence.
O’Keeffe, Triona; Hill, Colin; Ross, R. Paul
1999-01-01
Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the
Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O
1998-01-01
All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309
Short Stature in Chronic Kidney Disease Treated with Growth Hormone and an Aromatase Inhibitor
Mendley, Susan R.; Spyropoulos, Fotios; Counts, Debra R.
2015-01-01
We describe an alternative strategy for management of severe growth failure in a 14-year-old child who presented with advanced chronic kidney disease close to puberty. The patient was initially treated with growth hormone for a year until kidney transplantation, followed immediately by a year-long course of an aromatase inhibitor, anastrozole, to prevent epiphyseal fusion and prolong the period of linear growth. Outcome was excellent, with successful transplant and anticipated complete correc...
Directory of Open Access Journals (Sweden)
Nandagopal Murugan
2018-02-01
Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.
Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A
2010-07-01
WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.
Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.
2010-01-01
WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064
Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product
Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham
2015-01-01
Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410
Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J
2018-06-07
Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate
Bassler, B L; Wright, M; Silverman, M R
1994-07-01
Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.
Xu, J; Johnson, R C
1995-06-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes. Expression of aldB is maximally induced during the transition from exponential phase to stationary phase. Its message levels are elevated three- to fourfold by a fis mutation and abolished by an rpoS mutation. In addition, the expression of an aldB-lacZ fusion was decreased about 20-fold in the absence of crp. DNase I footprinting analysis showed that five Fis binding sites and one Crp binding site are located within the aldB promoter region, suggesting that Fis and Crp are acting directly to control aldB transcription. AldB expression is induced by ethanol, but in contrast to that of most of the RpoS-dependent genes, the expression of aldB is not altered by an increase in medium osmolarity.
Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.
2018-01-01
In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717
DEFF Research Database (Denmark)
Alviggi, C; Marci, R; Vallone, R
2017-01-01
OBJECTIVE: To evaluate the hormonal profile in three breast cancer patients who underwent controlled ovarian stimulation in the presence of the aromatase inhibitor letrozole. PATIENTS AND METHODS: In IVF University referral center, a case series of three breast cancer patients who underwent contr...
Allignet, Jeanine; Liassine, Nadia; El Solh, Névine
1998-01-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023
Allignet, J; Liassine, N; el Solh, N
1998-07-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.
Directory of Open Access Journals (Sweden)
Zulvikar Syambani Ulhaq
2018-05-01
Full Text Available Teleost fish are known to express two isoforms of P450 aromatase, a key enzyme for estrogen synthesis. One of the isoforms, brain aromatase (AroB, cyp19a1b, is highly expressed during early development of zebrafish, thereby suggesting its role in brain development. On the other hand, early development of serotonergic neuron, one of the major monoamine neurons, is considered to play an important role in neurogenesis. Therefore, in this study, we investigated the role of AroB in development of serotonergic neuron by testing the effects of (1 estradiol (E2 exposure and (2 morpholino (MO-mediated AroB knockdown. When embryos were exposed to E2, the effects were biphasic. The low dose of E2 (0.005 µM significantly increased serotonin (5-HT positive area at 48 hour post-fertilization (hpf detected by immunohistochemistry and relative mRNA levels of tryptophan hydroxylase isoforms (tph1a, tph1b, and tph2 at 96 hpf measured by semi-quantitative PCR. To test the effects on serotonin transmission, heart rate and thigmotaxis, an indicator of anxiety, were analyzed. The low dose also significantly increased heart rate at 48 hpf and decreased thigmotaxis. The high dose of E2 (1 µM exhibited opposite effects in all parameters. The effects of both low and high doses were reversed by addition of estrogen receptor (ER blocker, ICI 182,780, thereby suggesting that the effects were mediated through ER. When AroB MO was injected to fertilized eggs, 5-HT-positive area was significantly decreased, while the significant decrease in relative tph mRNA levels was found only with tph2 but not with two other isoforms. AroB MO also decreased heart rate and increased thigmotaxis. All the effects were rescued by co-injection with AroB mRNA and by exposure to E2. Taken together, this study demonstrates the role of brain aromatase in development of serotonergic neuron in zebrafish embryos and larvae, implying that brain-formed estrogen is an important factor to
Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A
1997-07-01
Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.
Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M
1999-07-01
The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.
Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki
2014-06-01
Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down
Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas
2006-06-07
Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes encoding for CK2beta-like proteins are present. The X-linked DmCK2beta transcription unit encodes for several CK2beta protein isoforms due to alternative splicing of its primary transcript. We addressed the question whether CK2beta-like proteins are redundant in function. Our in vivo experiments show that variations of the very C-terminal tail of CK2beta isoforms encoded by the X-linked DmCK2beta transcription unit influence their functional properties. In addition, we find that CK2beta-like proteins encoded by the autosomal D. melanogaster genes CK2betates and CK2beta' cannot fully substitute for a loss of CK2beta isoforms encoded by DmCK2beta.
Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C
1995-06-01
cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
The implications of alternative splicing in the ENCODE protein complement
DEFF Research Database (Denmark)
Tress, Michael L.; Martelli, Pier Luigi; Frankish, Adam
2007-01-01
suggested as one explanation for the discrepancy between the number of human genes and functional complexity. Here, we carry out a detailed study of the alternatively spliced gene products annotated in the ENCODE pilot project. We find that alternative splicing in human genes is more frequent than has...
Liu, Ying; Jiang, Yu-xin; Li, Chao-pin
2011-12-01
To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.
International Nuclear Information System (INIS)
Garcia-Casado, Zaida; Cervera-Deval, Jose; Campos, Josefina; Albaladejo, Carlos Vazquez; Llombart-Bosch, Antonio; Guillem, Vicente; Lopez-Guerrero, Jose A; Guerrero-Zotano, Angel; Llombart-Cussac, Antonio; Calatrava, Ana; Fernandez-Serra, Antonio; Ruiz-Simon, Amparo; Gavila, Joaquin; Climent, Miguel A; Almenar, Sergio
2010-01-01
Aromatase (CYP19A1) regulates estrogen biosynthesis. Polymorphisms in CYP19A1 have been related to the pathogenesis of breast cancer (BC). Inhibition of aromatase with letrozole constitutes the best option for treating estrogen-dependent BC in postmenopausal women. We evaluate a series of polymorphisms of CYP19A1 and their effect on response to neoadjuvant letrozole in early BC. We analyzed 95 consecutive postmenopausal women with stage II-III ER/PgR [+] BC treated with neoadjuvant letrozole. Response to treatment was measured by radiology at 4 th month by World Health Organization (WHO) criteria. Three polymorphisms of CYP19A1, one in exon 7 (rs700519) and two in the 3'-UTR region (rs10046 and rs4646) were evaluated on DNA obtained from peripheral blood. Thirty-five women (36.8%) achieved a radiological response to letrozole. The histopathological and immunohistochemical parameters, including hormonal receptor status, were not associated with the response to letrozole. Only the genetic variants (AC/AA) of the rs4646 polymorphism were associated with poor response to letrozole (p = 0.03). Eighteen patients (18.9%) reported a progression of the disease. Those patients carrying the genetic variants (AC/AA) of rs4646 presented a lower progression-free survival than the patients homozygous for the reference variant (p = 0.0686). This effect was especially significant in the group of elderly patients not operated after letrozole induction (p = 0.009). Our study reveals that the rs4646 polymorphism identifies a subgroup of stage II-III ER/PgR [+] BC patients with poor response to neoadjuvant letrozole and poor prognosis. Testing for the rs4646 polymorphism could be a useful tool in order to orientate the treatment in elderly BC patients
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Directory of Open Access Journals (Sweden)
Nicolas Defarge
2016-02-01
Full Text Available Pesticide formulations contain declared active ingredients and co-formulants presented as inert and confidential compounds. We tested the endocrine disruption of co-formulants in six glyphosate-based herbicides (GBH, the most used pesticides worldwide. All co-formulants and formulations were comparably cytotoxic well below the agricultural dilution of 1% (18–2000 times for co-formulants, 8–141 times for formulations, and not the declared active ingredient glyphosate (G alone. The endocrine-disrupting effects of all these compounds were measured on aromatase activity, a key enzyme in the balance of sex hormones, below the toxicity threshold. Aromatase activity was decreased both by the co-formulants alone (polyethoxylated tallow amine—POEA and alkyl polyglucoside—APG and by the formulations, from concentrations 800 times lower than the agricultural dilutions; while G exerted an effect only at 1/3 of the agricultural dilution. It was demonstrated for the first time that endocrine disruption by GBH could not only be due to the declared active ingredient but also to co-formulants. These results could explain numerous in vivo results with GBHs not seen with G alone; moreover, they challenge the relevance of the acceptable daily intake (ADI value for GBHs exposures, currently calculated from toxicity tests of the declared active ingredient alone.
Diehl, David L; LaPara, Timothy M
2010-12-01
The objective of this research was to investigate the ability of anaerobic and aerobic digesters to reduce the quantity of antibiotic resistant bacteria in wastewater solids. Lab-scale digesters were operated at different temperatures (22 °C, 37 °C, 46 °C, and 55 °C) under both anaerobic and aerobic conditions and fed wastewater solids collected from a full-scale treatment facility. Quantitative PCR was used to track five genes encoding tetracycline resistance (tet(A), tet(L), tet(O), tet(W), and tet(X)) and the gene encoding the integrase (intI1) of class 1 integrons. Statistically significant reductions in the quantities of these genes occurred in the anaerobic reactors at 37 °C, 46 °C, and 55 °C, with the removal rates and removal efficiencies increasing as a function of temperature. The aerobic digesters, in contrast, were generally incapable of significantly decreasing gene quantities, although these digesters were operated at much shorter mean hydraulic residence times. This research suggests that high temperature anaerobic digestion of wastewater solids would be a suitable technology for eliminating various antibiotic resistance genes, an emerging pollutant of concern.
Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A
1996-07-15
The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.
Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan
2018-06-01
Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.
Ramallo, Martín R; Morandini, Leonel; Birba, Agustina; Somoza, Gustavo M; Pandolfi, Matías
2017-03-01
The enzyme aromatase, responsible for the conversion of C19 androgens to C18 estrogens, exists as two paralogue copies in teleost fish: Cyp19a1a mostly expressed in the gonads, referred as gonadal aromatase, and Cyp19a1b, mostly expressed in the brain, accordingly known as brain aromatase. The neural localization of Cyp19a1b is greatly contained within the social behavior network and mesolimbic reward system in fish, suggesting a strong role of estrogen synthesis in the regulation of social behavior. In this work we aimed to analyze the variation in cyp19a1b expression in brain and pituitary of males of a highly social cichlid, Cichlasoma dimerus (locally known as chanchita), and its relation with inter-individual variability in agonistic behavior in a communal social environment. We first characterized chanchita's cyp19a1b mRNA and deduced amino acid sequence, which showed a high degree of conservation when compared to other teleost brain aromatase sequences, and its tissue expression patterns. Within the brain, Cyp19a1b was solely detected at putative radial glial cells of the forebrain, close to the brain ventricles. We then studied the relative expression levels of cyp19a1b by Real Time PCR in the brain and pituitary of males of different social status, territorial vs. non-territorial, and its relationship with an index of agonistic behavior. We found that even though, brain aromatase expression did not differ between types of males, pituitary cyp19a1b expression levels positively correlated with the index of agonistic behavior. This suggests a novel role of the pituitary in the regulation of social behavior by local estrogen synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Lu, C.; Fedoroff, N.
2000-01-01
Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.
Sadakierska-Chudy, Anna; Frankowska, Małgorzata; Jastrzębska, Joanna; Wydra, Karolina; Miszkiel, Joanna; Sanak, Marek; Filip, Małgorzata
2017-07-01
Chronic exposure to cocaine, craving, and relapse are attributed to long-lasting changes in gene expression arising through epigenetic and transcriptional mechanisms. Although several brain regions are involved in these processes, the prefrontal cortex seems to play a crucial role not only in motivation and decision-making but also in extinction and seeking behavior. In this study, we applied cocaine self-administration and extinction training procedures in rats with a yoked triad to determine differentially expressed genes in prefrontal cortex. Microarray analysis showed significant upregulation of several genes encoding histone modification enzymes during early extinction training. Subsequent real-time PCR testing of these genes following cocaine self-administration or early (third day) and late (tenth day) extinction revealed elevated levels of their transcripts. Interestingly, we found the enrichment of Brd1 messenger RNA in rats self-administering cocaine that lasted until extinction training during cocaine withdrawal with concomitant increased acetylation of H3K9 and H4K8. However, despite elevated levels of methyl- and demethyltransferase-encoded transcripts, no changes in global di- and tri-methylation of histone H3 at lysine 4, 9, 27, and 79 were observed. Surprisingly, at the end of extinction training (10 days of cocaine withdrawal), most of the analyzed genes in the rats actively and passively administering cocaine returned to the control level. Together, the alterations identified in the rat prefrontal cortex may suggest enhanced chromatin remodeling and transcriptional activity induced by early cocaine abstinence; however, to know whether they are beneficial or not for the extinction of drug-seeking behavior, further in vivo evaluation is required.
D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan
2016-06-01
Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.
Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D
2008-04-01
A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.
Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip
2009-05-01
Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.
Valentijn, Linda J.; Koster, Jan; Versteeg, Rogier
2006-01-01
NM23-H1 and NM23-H2 are neighboring genes on chromosome 17q. They encode nucleoside diphosphate kinases that have additional roles in signal transduction, transcription, and apoptosis. NM23-H1 expression is a strong marker for prognosis and metastatic behavior in many tumor types. A new
Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso
2017-12-18
Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.
Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.
Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C
2001-01-01
Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.
Energy Technology Data Exchange (ETDEWEB)
Yeh, H.; Chow, M.; Abrams, W.R. [Univ. of Pennsylvania, Philadelphia, PA (United States)] [and others
1994-09-15
Microfibrils with a diameter of 10-12 nm, found either in assocation with elastin or independently, are an important component of the extracellular matrix of many tissues. To extend understanding of the proteins composing these microfibrils, the cDNA and gene encoding the human associated microfibril protein (MRAP1) have been cloned and characterized. The coding portion is contained in 9 exons, and the sequence is very homologous to the previously described chick cDNA, but does not appear to share homology or domain motifs with any other known protein. Interestingly, the gene has been localized to chromosome 15q15-q21 by somatic hybrid cell and chromosome in situ analyses. This is the same chromosomal region to which the fibrillin gene, FBN1, known to be defective in the Marfan syndrome, has been mapped. MFAP1 is a candidate gene for heritable diseases affecting microfibrils. 38 refs., 6 figs.
Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.
Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D
2015-04-01
Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.
New insights about the evaluation of human sperm quality: the aromatase example.
Directory of Open Access Journals (Sweden)
A Saad
2010-01-01
Full Text Available Male contribution to the couple's infertility is at first evaluated by the routine examination of semen parameters upon optical microscopy providing valuable information for a rational initial diagnosis and for a clinical management of infertility. But the different forms of infertility defined according to the WHO criteria especially teratozoospermia are not always related to the chromatin structure or to the fertilization capacity. New investigations at the molecular level (transcript and protein could be developed in order to understand the nature of sperm malformation responsible of human infertility and thus to evaluate the sperm quality. The profile analysis of spermatozoal transcripts could be considered as a fingerprint of the past spermatogenic events. The selection of representative transcripts of normal spermatozoa remains complex because a differential expression (increased, decreased or not modified levels of specific transcripts has been revealed between immotile and motile sperm fractions issued from normozoospermic donors. Microarrays tests or real-time quantitative PCR could be helpful for the identification of factors involved in the male infertility. Differences in the expression of specific transcripts have been reported between normal and abnormal semen samples. With the aromatase example, we have noted a negative strong correlation between the amount of transcript and the percentage of abnormal forms especially in presence of head defects. Immunocytochemical procedures using fluorescent probes associated with either confocal microscopy or flow cytometry can be also helpful to proceed with further investigations about the localization of proteins in the compartmentalized spermatozoa or the acrosome reaction. The dual location of aromatase both in the equatorial segment, the mid-piece and the tail could explain the double role of this enzyme in acrosome reaction and motility.
Howe, J G; Shu, M D
1988-08-01
Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang
2008-01-01
This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)
Pereira, S; Lavado, N; Nogueira, L; Lopez, M; Abreu, J; Silva, H
2014-10-01
Orthodontic-induced external apical root resorption (EARR) is a complex phenotype determined by poorly defined mechanical and patient intrinsic factors. The aim of this work was to construct a multifactorial integrative model, including clinical and genetic susceptibility factors, to analyze the risk of developing this common orthodontic complication. This retrospective study included 195 orthodontic patients. Using a multiple-linear regression model, where the dependent variable was the maximum% of root resorption (%EARRmax) for each patient, we assessed the contribution of nine clinical variables and four polymorphisms of genes involved in bone and tooth root remodeling (rs1718119 from P2RX7, rs1143634 from IL1B, rs3102735 from TNFRSF11B, encoding OPG, and rs1805034 from TNFRSF11A, encoding RANK). Clinical and genetic variables explained 30% of%EARRmax variability. The variables with the most significant unique contribution to the model were: gender (P < 0.05), treatment duration (P < 0.001), premolar extractions (P < 0.01), Hyrax appliance (P < 0.001) and GG genotype of rs1718119 from P2RX7 gene (P < 0.01). Age, overjet, tongue thrust, skeletal class II and the other polymorphisms made minor contributions. This study highlights the P2RX7 gene as a possible factor of susceptibility to EARR. A more extensive genetic profile may improve this model. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Identification of a Novel UTY‐Encoded Minor Histocompatibility Antigen
DEFF Research Database (Denmark)
Mortensen, B. K.; Rasmussen, A. H.; Larsen, Malene Erup
2012-01-01
Minor histocompatibility antigens (mHags) encoded by the Y‐chromosome (H‐Y‐mHags) are known to play a pivotal role in allogeneic haematopoietic cell transplantation (HCT) involving female donors and male recipients. We present a new H‐Y‐mHag, YYNAFHWAI (UTY139–147), encoded by the UTY gene...... obtained post‐HCT from male recipients of female donor grafts. In one of these recipients, a CD8+ T cell response was observed against a peptide stretch encoded by the UTY gene. Another bioinformatics tool, HLArestrictor, was used to identify the optimal peptide and HLA‐restriction element. Using peptide....../HLA tetramers, the specificity of the CD8+ T cell response was successfully validated as being HLA‐A*24:02‐restricted and directed against the male UTY139–147 peptide. Functional analysis of these T cells demonstrated male UTY139–147 peptide‐specific cytokine secretion (IFNγ, TNFα and MIP‐1β) and cytotoxic...
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
Methanogenesis and methane genes
International Nuclear Information System (INIS)
Reeve, J.N.; Shref, B.A.
1991-01-01
An overview of the pathways leading to methane biosynthesis is presented. The steps investigated to date by gene cloning and DNA sequencing procedures are identified and discussed. The primary structures of component C of methyl coenzyme M reductase encoded by mcr operons in different methanogens are compared. Experiments to detect the primary structure of the genes encoding F420 reducing hydrogenase (frhABG) and methyl hydrogen reducing hydrogenase (mvhDGA) in methanobacterium thermoautotrophicum strain H are compared with each other and with eubacterial hydrogenase encoding genes. A biotechnological use for hydrogenases from hypermorphillic archaebacteria is suggested. (author)
Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita
2015-10-01
Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Sørensen, Kim I.; Hove-Jensen, Bjarne
1996-01-01
. The rpiB gene resided on a 4.6-kbp HindIII-EcoRV DNA fragment from phage lambda 10H5 (642) of the Kohara gene library and mapped at 92.85 min. Consistent with this map position, the cloned DNA fragment contained two divergent open reading frames of 149 and 296 codons, encoding ribose phosphate isomerase B...
Directory of Open Access Journals (Sweden)
Melissa Dahir, DNP, IF
2014-04-01
Conclusions: The use of a compounded testosterone vaginal cream applied daily for 4 weeks improves reported sexual health quality of life in women with breast cancer taking AIs. Dahir M and Travers‐Gustafson D. Breast cancer, aromatase inhibitor therapy, and sexual functioning: A pilot study of the effects of vaginal testosterone therapy. Sex Med 2014;2:8–15.
Directory of Open Access Journals (Sweden)
Martin Hampel
Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.
de Vries, R P; Poulsen, C H; Madrid, S; Visser, J
1998-01-01
An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.
de Vries, Ronald P.; Poulsen, Charlotte H.; Madrid, Susan; Visser, Jaap
1998-01-01
An extracellular α-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70°C. The α-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and β-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this α-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and α-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose. PMID:9440512
Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H
2006-10-01
We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.
Bulun, S E; Mahendroo, M S; Simpson, E R
1993-06-01
It has been proposed that the biosynthesis of estrogens by the human endometrium may be of physiological significance during the menstrual cycle. Local estrogen production was also suggested to be important in the development of endometrial cancer; however, the presence or absence of aromatase enzyme activity in normal human endometrium is controversial. To address this issue, we used a sensitive technique capable of detecting mRNA transcripts present in only very low copy number. The polymerase chain reaction linked to reverse transcription (RT-PCR) was used to evaluate the presence or absence of aromatase cytochrome P450 (P450arom) transcripts in endometrial tissues (n = 7) and endometrial stromal cells (n = 9) under various culture conditions. RNA was isolated from four proliferative and three secretory tissue samples and from cultured endometrial stromal cells isolated from seven proliferative and two secretory endometria. Five sets of cultures were treated with medroxyprogesterone acetate (MPA), estradiol (E2), and forskolin. Additionally, RNA was isolated from decidualized endometrium obtained from a patient with tubal pregnancy. A single stranded cDNA was synthesized from total RNA using Moloney murine leukemia virus reverse transcriptase and a P450arom-specific oligonucleotide. The single stranded cDNA was used as a template for PCR and was amplified for 20-35 cycles using P450arom-specific primers. RNA from adipose tissue and placenta was amplified to provide positive controls, whereas myometrial RNA was used as a negative control. In two experiments involving two endometrial tissues and three sets of cells in culture, a rat P450arom cRNA was coamplified in each sample as an internal control to demonstrate that the remote possibility of RT-PCR failures in individual test samples cannot account for our negative results. By Southern or slot blot hybridization of the amplified fragments using human and rat P450arom-specific probes, we found no evidence for
Pallotta, Maria Michela; Turano, Mimmo; Ronca, Raffaele; Mezzasalma, Marcello; Petraccioli, Agnese; Odierna, Gaetano; Capriglione, Teresa
2017-06-01
Sexual differentiation (SD) during development results in anatomical, metabolic, and physiological differences that involve not only the gonads, but also a variety of other biological structures, such as the brain, determining differences in morphology, behavior, and response in the breeding season. In many reptiles, whose sex is determined by egg incubation temperature, such as the leopard gecko, Eublepharis macularius, embryos incubated at different temperatures clearly differ in the volume of brain nuclei that modulate behavior. Based on the premise that "the developmental decision of gender does not flow through a single gene", we performed an analysis on E. macularius using three approaches to gain insights into the genes that may be involved in brain SD during the thermosensitive period. Using quantitative RT-PCR, we studied the expression of genes known to be involved in gonadal SD such as WNT4, SOX9, DMRT1, Erα, Erβ, GnRH, P450 aromatase, PRL, and PRL-R. Then, further genes putatively involved in sex dimorphic brain differentiation were sought by differential display (DDRT-PCR) and PCR array. Our findings indicate that embryo exposure to different sex determining temperatures induces differential expression of several genes that are involved not only in gonadal differentiation (PRL-R, Wnt4, Erα, Erβ, p450 aromatase, and DMRT1), but also in neural differentiation (TN-R, Adora2A, and ASCL1) and metabolic pathways (GP1, RPS15, and NADH12). These data suggest that the brains of SDT reptiles might be dimorphic at birth, thus behavioral experiences in postnatal development would act on a structure already committed to male or female. © 2017 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Gorrochategui, Eva; Pérez-Albaladejo, Elisabet [Department of Environmental Chemistry, IDAEA–CSIC, 08034 Barcelona, Catalonia (Spain); Casas, Josefina [Department of Biomedicinal Chemistry, IQAC–CSIC, 08034 Barcelona, Catalonia (Spain); Lacorte, Sílvia, E-mail: slbqam@cid.csic.es [Department of Environmental Chemistry, IDAEA–CSIC, 08034 Barcelona, Catalonia (Spain); Porte, Cinta, E-mail: cinta.porte@cid.csic.es [Department of Environmental Chemistry, IDAEA–CSIC, 08034 Barcelona, Catalonia (Spain)
2014-06-01
The cytotoxicity of eight perfluorinated chemicals (PFCs), namely, perfluorobutanoic acid (PFBA), perfluorohexanoic acid (PFHxA), perfluorooctanoic acid (PFOA), perfluorononanoic acid (PFNA), perfluorododecanoic acid (PFDoA), perfluorobutanesulfonate (PFBS), perfluorohexanesulfonate (PFHxS) and perfluorooctanesulfonate (PFOS) was assessed in the human placental choriocarcinoma cell line JEG-3. Only the long chain PFCs – PFOS, PFDoA, PFNA, PFOA – showed significant cytotoxicity in JEG-3 cells with EC50 values in the range of 107 to 647 μM. The observed cytotoxicity was to some extent related to a higher uptake of the longer chain PFCs by cells (PFDoA > PFOS ≫ PFNA > PFOA > PFHxA). Moreover, this work evidences a high potential of PFOS, PFOA and PFBS to act as aromatase inhibitors in placental cells with IC50s in the range of 57–80 μM, the inhibitory effect of PFBS being particularly important despite the rather low uptake of the compound by cells. Finally, exposure of JEG-3 cells to a mixture of the eight PFCs (0.6 μM each) led to a relative increase (up to 3.4-fold) of several lipid classes, including phosphatidylcholines (PCs), plasmalogen PC and lyso plasmalogen PC, which suggests an interference of PFCs with membrane lipids. Overall, this work highlights the ability of the PFC mixture to alter cellular lipid pattern at concentrations well below those that generate toxicity, and the potential of the short chain PFBS, often considered a safe substitute of PFOS, to significantly inhibit aromatase activity in placental cells. - Highlights: • Eight perfluorinated chemicals of different chain lengths have been selected. • Long chain ones – PFOS, PFDoA, PFNA, PFOA – were cytotoxic in placenta cells. • The uptake of long chain perfluorinated chemicals by cells was comparatively higher. • PFOS, PFOA and the short chain PFBS significantly inhibited aromatase activity. • A mixture of perfluorinated chemicals significantly altered placenta cell
International Nuclear Information System (INIS)
Gorrochategui, Eva; Pérez-Albaladejo, Elisabet; Casas, Josefina; Lacorte, Sílvia; Porte, Cinta
2014-01-01
The cytotoxicity of eight perfluorinated chemicals (PFCs), namely, perfluorobutanoic acid (PFBA), perfluorohexanoic acid (PFHxA), perfluorooctanoic acid (PFOA), perfluorononanoic acid (PFNA), perfluorododecanoic acid (PFDoA), perfluorobutanesulfonate (PFBS), perfluorohexanesulfonate (PFHxS) and perfluorooctanesulfonate (PFOS) was assessed in the human placental choriocarcinoma cell line JEG-3. Only the long chain PFCs – PFOS, PFDoA, PFNA, PFOA – showed significant cytotoxicity in JEG-3 cells with EC50 values in the range of 107 to 647 μM. The observed cytotoxicity was to some extent related to a higher uptake of the longer chain PFCs by cells (PFDoA > PFOS ≫ PFNA > PFOA > PFHxA). Moreover, this work evidences a high potential of PFOS, PFOA and PFBS to act as aromatase inhibitors in placental cells with IC50s in the range of 57–80 μM, the inhibitory effect of PFBS being particularly important despite the rather low uptake of the compound by cells. Finally, exposure of JEG-3 cells to a mixture of the eight PFCs (0.6 μM each) led to a relative increase (up to 3.4-fold) of several lipid classes, including phosphatidylcholines (PCs), plasmalogen PC and lyso plasmalogen PC, which suggests an interference of PFCs with membrane lipids. Overall, this work highlights the ability of the PFC mixture to alter cellular lipid pattern at concentrations well below those that generate toxicity, and the potential of the short chain PFBS, often considered a safe substitute of PFOS, to significantly inhibit aromatase activity in placental cells. - Highlights: • Eight perfluorinated chemicals of different chain lengths have been selected. • Long chain ones – PFOS, PFDoA, PFNA, PFOA – were cytotoxic in placenta cells. • The uptake of long chain perfluorinated chemicals by cells was comparatively higher. • PFOS, PFOA and the short chain PFBS significantly inhibited aromatase activity. • A mixture of perfluorinated chemicals significantly altered placenta cell
Krunic, Aleksandar L; Stone, Kristina L; Simpson, Michael A; McGrath, John A
2013-01-01
Acral peeling skin syndrome (APSS) is a clinically and genetically heterogeneous disorder. We used whole-exome sequencing to identify the molecular basis of APSS in a consanguineous Jordanian-American pedigree. We identified a homozygous nonsense mutation (p.Lys22X) in the CSTA gene, encoding cystatin A, that was confirmed using Sanger sequencing. Cystatin A is a protease inhibitor found in the cornified cell envelope, and loss-of-function mutations have previously been reported in two cases of exfoliative ichthyosis. Our study expands the molecular pathology of APSS and demonstrates the value of next-generation sequencing in the genetic characterization of inherited skin diseases. © 2013 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Knudsen, K; Madsen, AS; Mygind, P
1999-01-01
Two genes encoding 97- to 99-kDa Chlamydia pneumoniae VR1310 outer membrane proteins (Omp4 and Omp5) with mutual similarity were cloned and sequenced. The proteins were shown to be constituents of the C. pneumoniae outer membrane complex, and the deduced amino acid sequences were similar to those...